WorldWideScience

Sample records for current slc control

  1. Report on the SLC control system

    International Nuclear Information System (INIS)

    Phinney, N.

    1985-05-01

    The SLC control system is based on a VAX 11/780 Host computer with approximately 50 microprocessor clusters which provide distributed intelligence and control of all CAMAC interface modules. This paper will present an overview of the system including current status and a description of the software architecture and communication protocols. 8 refs

  2. The SLC control system - status and development

    International Nuclear Information System (INIS)

    Phinney, N.; Shoaee, H.

    1987-03-01

    The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development

  3. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  4. Klystron control software in the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Thompson, K.; Phinney, N.

    1985-05-01

    Triggering, control, and monitoring of 240 high-power klystrons will be supported by the SLC control system this summer. The control software is distributed among a VAX host computer, a local microprocessor cluster, and a dedicated intelligent CAMAC module. The functions performed by these three components and the algorithms used are discussed

  5. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1991-12-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: Repetition rate; Sensitivity to orbit distortion; Stability/Automation; and Accelerator Development

  6. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1992-01-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

  7. An Integrated Enterprise Accelerator Database for the SLC Control System

    International Nuclear Information System (INIS)

    2002-01-01

    Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations

  8. Timing system control software in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.; Phinney, N.

    1985-04-01

    A new timing system that allows precision (approx.1 to 2 ns) control of the trigger times of klystrons, beam position monitors, and other devices on a pulse-to-pulse basis at up to 360 Hz is in operation in the first third of the SLAC linear accelerator. The control software is divided between a central host VAX and local Intel 8086-based microprocessor clusters. Facilities exist to set up and adjust the timing of devices or groups of devices independently for beam pulses having different destinations and purposes, which are run in an interlaced fashion during normal machine operation. Upgrading of the system is currently underway, using a new version of the Programmable Delay Unit CAMAC module to allow pipelining of timing information for three machine pulses. An overview of the current state of the system is presented in this paper, with an emphasis on software control

  9. Correlation plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.

    1991-05-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs

  10. Correlation Plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.; Clark, S.

    1991-11-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. This generalized interface allows the user to perform a range of operations or machine physics experiments without the need for any specialized analysis software. The user may step one or more independent parameters, such as magnet or feedback setpoints, while measuring or calculating up to 160 other parameters. Measured variables include all analog signals available to the control system, as well as calculated parameters such as beam size, luminosity, or emittance. Various fitting algorithms and display options are provided. A software-callable interface has been provided so that a host of applications can call this package for analysis and display. Such applications regularly phase klystrons, measure emittance and dispersion, minimize beam size, and maintain beam collisions at the interaction point. 4 refs., 5 figs

  11. Correlation Plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sachez-Chopitea, L.; Clark, S.

    1992-01-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. This generalized interface allows the user to perform a range of operations or machine physics experiments without the need for any specialized analysis software. The user may step one or more independent parameters, such as magnet or feedback set points, while measuring or calculating up to 160 other parameters. Measured variables include all analog signals available to the control system, as well as calculated parameters such as beam size, luminosity, or emittance. Various fitting algorithms and display options are provided. A software-callable interface has been provided so that a host of applications can call this package for analysis and display. Such applications regularly phase klystrons, measure emittance and dispersion, minimize beam size, and maintain beam collisions at the interaction point. (author)

  12. Development of operator requested control system applications: Experience with the SLC control system at SLAC

    International Nuclear Information System (INIS)

    Stanek, M.

    1995-01-01

    The SLC Control system at SLAC has evolved into a powerful tool for operation of the accelerator and for troubleshooting the unique problems encountered in extracting maximum performance from the SLC. The evolution has included the development of many custom applications and user interface features generated from accelerator operator and accelerator physicist requests. These applications are written and maintained primarily by the Controls Software Engineering group, and not by the users themselves. The process of developing and supporting user requested control systems applications at SLAC is described, including the effects of organizational structure, formal and informal procedures, and control system architecture

  13. History Data Facility in the SLC control system

    International Nuclear Information System (INIS)

    Johnson, R.G.; White, G.R.

    1991-10-01

    Two major enhancements to the SLC History Data Facility are described separately. First the internal design and procedures used for saving and using long term history data. Second the user interface, facilities and application of the History Data Comparisons sub-system, which is used for analyzing and correlating two or more accelerator device histories

  14. Operating experience with high beam currents and transient beam loading in the SLC damping rings

    International Nuclear Information System (INIS)

    Minty, M.G.; Akre, R.; Krejcik, P.; Siemann, R.H.

    1995-01-01

    During the 1994 SLC run the nominal operating intensity in the damping rings was raised from 3.5 x 10 10 to greater than 4 x 10 10 particles per bunch (ppb). Stricter regulation of rf system parameters was required to maintain stability of the rf system and particle beam. Improvements were made in the feedback loops which control the cavity amplitude and loading angles. Compensation for beam loading was also required to prevent klystron saturation during repetition rate changes. To minimize the effects of transient loading on the rf system, the gain of the direct rf feedback loop and the loading angles were optimized

  15. Beam position monitor readout and control in the SLC linac

    International Nuclear Information System (INIS)

    Bogart, J.; Phinney, N.; Ross, M.; Yaffe, D.

    1985-04-01

    A beam position monitoring system has been implemented in the first third of the SLC linac which provides a complete scan of the trajectory on a single beam pulse. The data is collected from the local micro-computers and viewed with an updating display at a console or passed on to application programs. The system must operate with interlaced beams so the scans are also interlaced, providing each user with the ability to select the beam, the update rate, and the attenuation level in the digitizing hardware. In addition each user calibrates the hardware for his beam. A description of the system architecture will be presented. 6 refs., 4 figs

  16. Error message recording and reporting in the SLC control system

    International Nuclear Information System (INIS)

    Spencer, N.; Bogart, J.; Phinney, N.; Thompson, K.

    1985-01-01

    Error or information messages that are signaled by control software either in the VAX host computer or the local microprocessor clusters are handled by a dedicated VAX process (PARANOIA). Messages are recorded on disk for further analysis and displayed at the appropriate console. Another VAX process (ERRLOG) can be used to sort, list and histogram various categories of messages. The functions performed by these processes and the algorithms used are discussed

  17. Error message recording and reporting in the SLC control system

    International Nuclear Information System (INIS)

    Spencer, N.; Bogart, J.; Phinney, N.; Thompson, K.

    1985-04-01

    Error or information messages that are signaled by control software either in the VAX host computer or the local microprocessor clusters are handled by a dedicated VAX process (PARANOIA). Messages are recorded on disk for further analysis and displayed at the appropriate console. Another VAX process (ERRLOG) can be used to sort, list and histogram various categories of messages. The functions performed by these processes and the algorithms used are discussed

  18. Observations of accelerated high current low emittance beams in the SLC Linac

    International Nuclear Information System (INIS)

    Seeman, J.T.; Ross, M.C.; Sheppard, J.C.; Stiening, R.F.

    1985-05-01

    The Linac of the SLAC Linear Collider (SLC) is required to accelerate several intense single electron and positron bunches to high energy while not enlarging their small transverse emittances. The improvements needed by the SLAC Linac to meet these goals have very stringent design criteria. As partial systems have become available, beam tests have been performed to confirm the designs. The results of those beam tests are discussed. Future plans of the improvement program are described. 13 refs., 9 figs

  19. Simulations of Bunch Precompression at High Currents in the SLC Damping Rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Minty, M.G.; Chao, A.W.

    2011-01-01

    In the Stanford Linear Collider (SLC) each beam, after leaving a damping ring, is compressed in the Ring-to-Linac (RTL) transfer line before entering the linear accelerator. At a bunch population of 4.0 x 10 10 particles, due to the limited energy acceptance of the RTL, approximately 15% of the beam has normally been lost. During the 1996 run, however, to eliminate this loss the bunch was partially precompressed in the damping ring, just before extraction; the beam loss in the RTL was reduced to almost zero. The operation and performance of precompression are presented by Minty et al. (1999). Also given is an analysis which, however, does not include the effects of the longitudinal wakefield on the beam dynamics. In this report we extend that analysis to include these effects.

  20. Use of digital control theory state space formalism for feedback at SLC

    International Nuclear Information System (INIS)

    Himel, T.; Hendrickson, L.; Rouse, F.; Shoaee, H.

    1991-05-01

    The algorithms used in the database-driven SLC fast-feedback system are based on the state space formalism of digital control theory. These are implemented as a set of matrix equations which use a Kalman filter to estimate a vector of states from a vector of measurements, and then apply a gain matrix to determine the actuator settings from the state vector. The matrices used in the calculation are derived offline using Linear Quadratic Gaussian minimization. For a given noise spectrum, this procedure minimizes the rms of the states (e.g., the position or energy of the beam). The offline program also allows simulation of the loop's response to arbitrary inputs, and calculates its frequency response. 3 refs., 3 figs

  1. [Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

    Science.gov (United States)

    Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

    2014-11-01

    Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

  2. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  3. An active feedback system to control synchrotron oscillations in the SLC Damping Rings

    International Nuclear Information System (INIS)

    Corredoura, P.L.; Pellegrin, J.L.; Schwarz, H.D.; Sheppard, J.C.

    1989-03-01

    Initially the SLC Damping Rings accomplished Robinson instability damping by operating the RF accelerating cavities slightly detuned. In order to be able to run the cavities tuned and achieve damping for Robinson instability and synchrotron oscillations at injection an active feedback system has been developed. This paper describes the theoretical basis for the feedback system and the development of the hardware. Extensive measurements of the loop response including stored beam were performed. Overall performance of the system is also reported. 3 refs., 6 figs

  4. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  5. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  6. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  7. Polarization at SLC

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1988-07-01

    The SLAC Linear Collider has been designed to readily accommodate polarized electron beams. Considerable effort has been made to implement a polarized source, a spin rotation system, and a system to monitor the beam polarization. Nearly all major components have been fabricated. At the current time, several source and polarimeter components have been installed. The installation and commissioning of the entire system will take place during available machine shutdown periods as the commissioning of SLC progresses. It is expected that a beam polarization of 45% will be achieved with no loss in luminosity. 13 refs., 15 figs

  8. The SLC polarized electron source

    International Nuclear Information System (INIS)

    Clendenin, J.E.

    1990-10-01

    A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

  9. CMOS current controlled fully balanced current conveyor

    International Nuclear Information System (INIS)

    Wang Chunhua; Zhang Qiujing; Liu Haiguang

    2009-01-01

    This paper presents a current controlled fully balanced second-generation current conveyor circuit (CF-BCCII). The proposed circuit has the traits of fully balanced architecture, and its X-Y terminals are current controllable. Based on the CFBCCII, two biquadratic universal filters are also proposed as its applications. The CFBCCII circuits and the two filters were fabricated with chartered 0.35-μm CMOS technology; with ±1.65 V power supply voltage, the total power consumption of the CFBCCII circuit is 3.6 mW. Comparisons between measured and HSpice simulation results are also given.

  10. The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

    Science.gov (United States)

    Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

    2012-12-01

    Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

  11. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  13. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  14. Physics at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1990-11-01

    The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam

  15. The design of a semi-custom intergrated circuit for the SLAC SLC timing control system

    International Nuclear Information System (INIS)

    Linstadt, E.

    1985-01-01

    A semi-custom (gate array) integrated circuit has been designed for use in the SLAC Linear Collider timing and control system. The design process and SLAC's experiences during the phases of the design cycle are described. Issues concerning the partitioning of the design into semi-custom and standard components are discussed. Functional descriptions of the semi-custom integrated circuit and the timing module in which it is used are given

  16. Design of a semi-custom integrated circuit for the SLAC SLC timing control system

    International Nuclear Information System (INIS)

    Linstadt, E.

    1984-10-01

    A semi-custom (gate array) integrated circuit has been designed for use in the SLAC Linear Collider timing and control system. The design process and SLAC's experiences during the phases of the design cycle are described. Issues concerning the partitioning of the design into semi-custom and standard components are discussed. Functional descriptions of the semi-custom integrated circuit and the timing module in which it is used are given

  17. Orbit monitoring in the SLC

    International Nuclear Information System (INIS)

    Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.

    1991-05-01

    Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs

  18. Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

    Science.gov (United States)

    Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

    2011-07-29

    Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

  19. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1992-01-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine. (author)

  20. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1991-11-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine

  1. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  2. Magnetoelectric control of spin currents

    Energy Technology Data Exchange (ETDEWEB)

    Gómez, J. E.; Vargas, J. M.; Avilés-Félix, L.; Butera, A. [Centro Atómico Bariloche, Instituto de Nanociencia y Nanotecnología (CNEA) and Conicet, 8400 Bariloche, Río Negro (Argentina)

    2016-06-13

    The ability to control the spin current injection has been explored on a hybrid magnetoelectric system consisting of a (011)-cut ferroelectric lead magnesium niobate-lead titanate (PMNT) single crystal, a ferromagnetic FePt alloy, and a metallic Pt. With this PMNT/FePt/Pt structure we have been able to control the magnetic field position or the microwave excitation frequency at which the spin pumping phenomenon between FePt and Pt occurs. We demonstrate that the magnetoelectric heterostructure operating in the L-T (longitudinal magnetized-transverse polarized) mode couples the PMNT crystal to the magnetostrictive FePt/Pt bilayer, displaying a strong magnetoelectric coefficient of ∼140 Oe cm kV{sup −1}. Our results show that this mechanism can be effectively exploited as a tunable spin current intensity emitter and open the possibility to create an oscillating or a bistable switch to effectively manipulate spin currents.

  3. SLC ir conceptual design

    International Nuclear Information System (INIS)

    Keller, L.P.

    1982-01-01

    Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment

  4. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  5. SLC Final Performance and Lessons

    International Nuclear Information System (INIS)

    Phinney, Nan

    2000-01-01

    The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

  6. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  7. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  8. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  9. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  10. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  11. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  12. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  13. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  14. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  15. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  16. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  17. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  18. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  19. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-02-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  20. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-01-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  1. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  2. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  3. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  4. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  5. Stability analysis of direct current control in current source rectifier

    DEFF Research Database (Denmark)

    Lu, Dapeng; Wang, Xiongfei; Blaabjerg, Frede

    2017-01-01

    Current source rectifier with high switching frequency has a great potential for improving the power efficiency and power density in ac-dc power conversion. This paper analyzes the stability of direct current control based on the time delay effect. Small signal model including dynamic behaviors...

  6. Stanford: SLC back in action

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-05-15

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  7. Current challenges in tobacco control.

    Science.gov (United States)

    Slama, K

    2004-10-01

    Tobacco is the world's biggest preventable killer, but the circumstances of its history, the power and influence of its commerce and the nature of addiction make it a very difficult public health issue. Determinants of smoking are both individual and environmental. Genetics and environment influence to varying degrees all of the steps in a smoker's career. Persistence of use, degree of addiction to nicotine and difficulty in stopping are influenced by inherited traits and nicotine susceptibility, whereas the social environment and the individual's cognitions are the key factors in starting smoking and successfully stopping smoking. The tools available to tobacco control include influencing the social and cultural norms concerning tobacco; legislative and regulatory measures to protect the population and to limit tobacco industry marketing tactics, now encapsulated in the Framework Convention on Tobacco Control; and programmes to enhance the chance of not starting and successfully stopping. Strategies for tobacco control must work at both societal and individual levels, and directions are being taken that include genetic, pharmacological, behavioural, socio-cultural and international approaches.

  8. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  9. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  10. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  11. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  12. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  13. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  14. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  15. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  16. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  17. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  18. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  19. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  20. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  1. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  2. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  3. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  4. Variable current speed controller for eddy current motors

    Science.gov (United States)

    Gerth, H.L.; Bailey, J.M.; Casstevens, J.M.; Dixon, J.H.; Griffith, B.O.; Igou, R.E.

    1982-03-12

    A speed control system for eddy current motors is provided in which the current to the motor from a constant frequency power source is varied by comparing the actual motor speed signal with a setpoint speed signal to control the motor speed according to the selected setpoint speed. A three-phase variable voltage autotransformer is provided for controlling the voltage from a three-phase power supply. A corresponding plurality of current control resistors is provided in series with each phase of the autotransformer output connected to inputs of a three-phase motor. Each resistor is connected in parallel with a set of normally closed contacts of plurality of relays which are operated by control logic. A logic circuit compares the selected speed with the actual motor speed obtained from a digital tachometer monitoring the motor spindle speed and operated the relays to add or substract resistance equally in each phase of the motor input to vary the motor current to control the motor at the selected speed.

  5. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  6. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  7. X-ray tube current control

    International Nuclear Information System (INIS)

    Dupuis, W.A.; Resnick, T.A.

    1982-01-01

    A closed loop feedback system for controlling the current output of an x-ray tube. The system has circuitry for improving the transient response and stability of the x-ray tube current over a substantial nonlinear portion of the tube current production characteristic. The system includes a reference generator for applying adjustable step function reference signals representing desired tube currents. The system also includes means for instantaneous sensing of actual tube current. An error detector compares the value of actual and reference tube current and produces an error signal as a function of their difference. The system feedback loop includes amplification circuitry for controlling x-ray tube filament dc voltage to regulate tube current as a function of the error signal value. The system also includes compensation circuitry, between the reference generator and the amplification circuitry, to vary the loop gain of the feedback control system as a function of the reference magnitude

  8. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  9. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  10. Synthesis/literature review for determining structural layer coefficients (SLC) of bases.

    Science.gov (United States)

    2014-12-01

    FDOTs current method of determining a base material structural layer coefficient (SLC) is detailed in the : Materials Manual, Chapter 2.1, Structural Layer Coefficients for Flexible Pavement Base Materials. : Currently, any new base material not a...

  11. Lessons learned from the SLC

    Energy Technology Data Exchange (ETDEWEB)

    Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center

    1998-07-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.

  12. Stanford: SLC back in action

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  13. Lessons learned from the SLC

    International Nuclear Information System (INIS)

    Phinney, N.

    1998-01-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider

  14. Proportional-Integral-Resonant AC Current Controller

    Directory of Open Access Journals (Sweden)

    STOJIC, D.

    2017-02-01

    Full Text Available In this paper an improved stationary-frame AC current controller based on the proportional-integral-resonant control action (PIR is proposed. Namely, the novel two-parameter PIR controller is applied in the stationary-frame AC current control, accompanied by the corresponding parameter-tuning procedure. In this way, the proportional-resonant (PR controller, common in the stationary-frame AC current control, is extended by the integral (I action in order to enable the AC current DC component tracking, and, also, to enable the DC disturbance compensation, caused by the voltage source inverter (VSI nonidealities and by nonlinear loads. The proposed controller parameter-tuning procedure is based on the three-phase back-EMF-type load, which corresponds to a wide range of AC power converter applications, such as AC motor drives, uninterruptible power supplies, and active filters. While the PIR controllers commonly have three parameters, the novel controller has two. Also, the provided parameter-tuning procedure needs only one parameter to be tuned in relation to the load and power converter model parameters, since the second controller parameter is directly derived from the required controller bandwidth value. The dynamic performance of the proposed controller is verified by means of simulation and experimental runs.

  15. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  16. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  17. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  18. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  19. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  20. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  1. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  2. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  3. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  4. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  5. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  6. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  7. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  8. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  9. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  10. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  11. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  12. Bunch length measurements in the SLC damping ring

    International Nuclear Information System (INIS)

    Decker, F.J.; Limberg, T.; Minty, M.; Ross, M.

    1993-05-01

    The synchrotron light of the SLC damping ring was used to measure the bunch length with a streak camera at different times in the damping cycle. There are bunch length oscillations after injection, different equilibrium length during the cycle due to rf manipulations to avoid microwave instability oscillations, and just before extraction there is a longitudinal phase space rotation (bunch muncher) to shorten the bunch length. Measurements under these different conditions are presented and compared with BPM pulse height signals. Calibration and adjustment issues and the connection of the streak camera to the SLC control system are also discussed

  13. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  14. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  15. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  16. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  17. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  18. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  19. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  20. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  1. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  2. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  3. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  4. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  5. SL(C) 5 migration at CERN

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Silva, Ricardo

    2010-01-01

    Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.

  6. Luminosity Optimization Feedback in the SLC

    International Nuclear Information System (INIS)

    1999-01-01

    The luminosity optimization at the SLC has been limited by the precision with which one can measure the micron size beams at the Interaction Point. Ten independent tuning parameters must be adjusted. An automated application has been used to scan each parameter over a significant range and set the minimum beam size as measured with a beam-beam deflection scan. Measurement errors limited the accuracy of this procedure and degraded the resulting luminosity. A new luminosity optimization feedback system has been developed using novel dithering techniques to maximize the luminosity with respect to the 10 parameters, which are adjusted one at a time. Control devices are perturbed around nominal setpoints, while the averaged readout of a digitized luminosity monitor measurement is accumulated for each setting. Results are averaged over many pulses to achieve high precision and then fitted to determine the optimal setting. The dithering itself causes a small loss in luminosity, but the improved optimization is expected to significantly enhance the performance of the SLC. Commissioning results are reported

  7. Current control of light by nonreciprocal magnetoplasmonics

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Yongkang, E-mail: yongkang.gong@southwales.ac.uk; Li, Kang; Carver, Sara; Martinez, Juan Jose; Huang, Jungang; Copner, Nigel [Wireless and Optoelectronics Research and Innovation Centre (WORIC), Faculty of Computing, Engineering and Science, University of South Wales, Cardiff CF37 1DL (United Kingdom); Thueux, Yoann; Avlonitis, Nick [Airbus Group Innovations, Quadrant House, Celtic Springs, Coedkernew, NP10 8FZ Newport (United Kingdom)

    2015-05-11

    The ability to actively control light has long been a major scientific and technological goal. We proposed a scheme that allows for active control of light by utilizing the nonreciprocal magnetoplasmonic effect. As a proof of concept, we applied current signal through an ultrathin metallic film in a magneto-plasmonic multilayer and found that dynamic photonic nonreciprocity appears in magnetic-optical material layer due to the magnetic field being induced from current signal and modulates surface plasmon polaritons trapped in the metal surface and the light reflected. The proposed concept provides a possible way for the active control of light and could find potential applications such as ultrafast optoelectronic signal processing for plasmonic nanocircuit technology and ultrafast/large-aperture free-space electro-optic modulation platform for wireless laser communication technology.

  8. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  9. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  10. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  11. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  12. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  13. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  14. Experience with the SLC permanent magnet multipoles

    International Nuclear Information System (INIS)

    Gross, G.; Spencer, J.

    1994-06-01

    Permanent magnets have been used in the SLC Damping Rings and their injection and extraction lines since 1985. Recent upgrades of the DR vacuum chambers provided an opportunity to check DR magnets prior to higher beam current operation. Several PM sextupoles downstream of the injection kickers in the electron ring had exceeded their thermal stabilization values of 80 degrees C and some showed serious mechanical deformations and radiation >1 R at contact. We discuss our observations, measurements and a few inexpensive modifications that should improve these magnets under such conditions. A new, block matching algorithm allowed us to use magnet blocks that had been considered unusable because of very different remament field strengths and easy axis errors

  15. Disturbance observer based current controller for vector controlled IM drives

    DEFF Research Database (Denmark)

    Teodorescu, Remus; Dal, Mehmet

    2008-01-01

    induction motor (IM) drives. The control design, based on synchronously rotating d-q frame model of the machine, has a simple structure that combines the proportional portion of a conventional PI control and output of the observer. The observer is predicted to estimate the disturbances caused by parameters...... coupling effects and increase robustness against parameters change without requiring any other compensation strategies. The experimental implementation results are provided to demonstrate validity and performance of the proposed control scheme.......In order to increase the accuracy of the current control loop, usually, well known parameter compensation and/or cross decoupling techniques are employed for advanced ac drives. In this paper, instead of using these techniques an observer-based current controller is proposed for vector controlled...

  16. Accelerator physics highlights in the 1997/98 SLC run

    International Nuclear Information System (INIS)

    Assmann, R.W.; Bane, K.L.F.; Barkow, T.

    1998-03-01

    The authors report various accelerator physics studies and improvements from the 1997/98 run at the Stanford Linear Collider (SLC). In particular, the authors discuss damping-ring lattice diagnostics, changes to the linac set up, fast control for linac rf phase stability, new emittance tuning strategies, wakefield reduction, modifications of the final-focus optics, longitudinal bunch shaping, and a novel spot-size control at the interaction point (IP)

  17. Three bunch energy stabilization for the SLC injector

    International Nuclear Information System (INIS)

    Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.

    1986-09-01

    Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes

  18. Tokamak plasma current disruption infrared control system

    International Nuclear Information System (INIS)

    Kugel, H.W.; Ulrickson, M.

    1987-01-01

    This patent describes a device for magnetically confining a plasma driven by a plasma current and contained within a toroidal vacuum chamber, the device having an inner toroidal limiter on an inside wall of the vacuum chamber and an arrangement for the rapid prediction and control in real time of a major plasma disruption. The arrangement is described which includes: scanning means sensitive to infrared radiation emanating from within the vacuum chamber, the infrared radiation indicating the temperature along a vertical profile of the inner toroidal limiter. The scanning means is arranged to observe the infrared radiation and to produce in response thereto an electrical scanning output signal representative of a time scan of temperature along the vertical profile; detection means for analyzing the scanning output signal to detect a first peaked temperature excursion occurring along the profile of the inner toroidal limiter, and to produce a detection output signal in repsonse thereto, the detection output signal indicating a real time prediction of a subsequent major plasma disruption; and plasma current reduction means for reducing the plasma current driving the plasma, in response to the detection output signal and in anticipation of a subsequent major plasma disruption

  19. Nonlinear Deadbeat Current Control of a Switched Reluctance Motor

    OpenAIRE

    Rudolph, Benjamin

    2009-01-01

    High performance current control is critical to the success of the switched reluctance motor (SRM). Yet high motor phase nonlinearities in the SRM place extra burden on the current controller, rendering it the weakest link in SRM control. In contrast to linear motor control techniques that respond to current error, the deadbeat controller calculates the control voltage by the current command, phase current, rotor position and applied phase voltage. The deadbeat controller has demonstrated sup...

  20. Sliding Mode Control of Induction Motor Phase Currents

    DEFF Research Database (Denmark)

    Hansen, R.B.; Hattel, T.; Bork, J

    1995-01-01

    Sliding mode control of induction motor phase currents are investigated through development of two control concepts.......Sliding mode control of induction motor phase currents are investigated through development of two control concepts....

  1. NASA Iced Aerodynamics and Controls Current Research

    Science.gov (United States)

    Addy, Gene

    2009-01-01

    This slide presentation reviews the state of current research in the area of aerodynamics and aircraft control with ice conditions by the Aviation Safety Program, part of the Integrated Resilient Aircraft Controls Project (IRAC). Included in the presentation is a overview of the modeling efforts. The objective of the modeling is to develop experimental and computational methods to model and predict aircraft response during adverse flight conditions, including icing. The Aircraft icing modeling efforts includes the Ice-Contaminated Aerodynamics Modeling, which examines the effects of ice contamination on aircraft aerodynamics, and CFD modeling of ice-contaminated aircraft aerodynamics, and Advanced Ice Accretion Process Modeling which examines the physics of ice accretion, and works on computational modeling of ice accretions. The IRAC testbed, a Generic Transport Model (GTM) and its use in the investigation of the effects of icing on its aerodynamics is also reviewed. This has led to a more thorough understanding and models, both theoretical and empirical of icing physics and ice accretion for airframes, advanced 3D ice accretion prediction codes, CFD methods for iced aerodynamics and better understanding of aircraft iced aerodynamics and its effects on control surface effectiveness.

  2. Impedance calculations for the improved SLC damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Ng, C.K.

    1993-04-01

    A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs

  3. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  4. Bioherbicides: Current knowledge on weed control mechanism.

    Science.gov (United States)

    Radhakrishnan, Ramalingam; Alqarawi, Abdulaziz A; Abd Allah, Elsayed Fathi

    2018-04-17

    Weed control is a challenging event during crop cultivation. Integrated management, including the application of bioherbicides, is an emerging method for weed control in sustainable agriculture. Plant extracts, allelochemicals and some microbes are utilized as bioherbicides to control weed populations. Bioherbicides based on plants and microbes inhibit the germination and growth of weeds; however,few studies conducted in weed physiology. This review ascribes the current knowledge of the physiological changes in weeds that occur during the exposure to bioherbicides. Plant extracts or metabolites are absorbed by weed seeds, which initiates damage to the cell membrane, DNA, mitosis, amylase activity and other biochemical processes and delays or inhibits seed germination. The growth of weeds is also retarded due to low rates of root-cell division, nutrient uptake, photosynthetic pigment synthesis, and plant growth hormone synthesis, while the productions of reactive oxygen species (ROS) and stress-mediated hormones increase, including irregular antioxidant activity. However, lytic enzymes and toxic substances secreted from microbes degrade the weed seed coat and utilize the endosperm for survival, which inhibits seed germination. The microbes grow through the intercellular spaces to reach the root core, and the deposition of toxins in the cells affects cell division and cellular functions. Some of the metabolites of deleterious microbes cause disease, necrosis and chlorosis,which inhibit the germination and growth of weed seeds by suppressing photosynthesis and gibberellin activities and enhancing ROS, abscisic acid and ethylene. This review explains the effects of bioherbicides (derived from plants and microbes) on weed-plant physiology to elucidate their modes of action. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Precise system stabilization at SLC using dither techniques

    International Nuclear Information System (INIS)

    Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

    1993-01-01

    A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

  6. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    ] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

  7. Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

    Science.gov (United States)

    Santos-Sacchi, Joseph; Song, Lei

    2016-06-07

    In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

  8. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  9. The polarized electron gun for the SLC

    International Nuclear Information System (INIS)

    Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.

    1992-03-01

    A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown

  10. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  11. Survey of beam instrumentation used in SLC

    International Nuclear Information System (INIS)

    Ecklund, S.D.

    1991-03-01

    A survey of beam instruments used at SLAC in the SLC machine is presented. The basic utility and operation of each device is briefly described. The various beam instruments used at the Stanford Linear Collider (SLC), can be classified by the function they perform. Beam intensity, position and size are typical of the parameters of beam which are measured. Each type of parameter is important for adjusting or tuning the machine in order to achieve optimum performance. 39 refs

  12. Current control necessary for toroidal plasma equilibrium

    International Nuclear Information System (INIS)

    Nagao, S.

    1987-01-01

    It is shown that a significant amount of dipole current is necessary for the plasma equilibrium of toroidal configurations in general. Through the vector product with the poloidal field, this dipole current force has to balance with the hoop force of plasma pressure itself of the annular shape. The measurement of such a current of dipole type may be interesting for the confirmation of the plasma equilibrium in the toroidal system. Moreover it is certained that there is a new mode of a tokamak operation with such a dipole current component and with smaller vertical field than that based on the classical tokamak theory. (author) [pt

  13. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  14. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  15. Thoracic radiotherapy and breath control: current prospects

    International Nuclear Information System (INIS)

    Reboul, F.; Mineur, L.; Paoli, J.B.; Bodez, V.; Oozeer, R.; Garcia, R.

    2002-01-01

    Three-dimensional conformal radiotherapy (3D CRT) is adversely affected by setup error and organ motion. In thoracic 3D CRT, breathing accounts for most of intra-fraction movements, thus impairing treatment quality. Breath control clearly exhibits dosimetric improvement compared to free breathing, leading to various techniques for gated treatments. We review benefits of different breath control methods -i.e. breath-holding or beam gating, with spirometric, isometric or X-ray respiration sensor- and argument the choice of expiration versus inspiration, with consideration to dosimetric concerns. All steps of 3D-CRT can be improved with breath control. Contouring of organs at risk (OAR) and target are easier and more accurate on breath controlled CT-scans. Inter- and intra-fraction target immobilisation allows smaller margins with better coverage. Lung outcome predictors (NTCP, Mean Dose, LV20, LV30) are improved with breath-control. In addition, inspiration breath control facilitates beam arrangement since it widens the distance between OAR and target, and leaves less lung normal tissue within the high dose region. Last, lung density, as of CT scan, is more accurate, improving dosimetry. Our institutions choice is to use spirometry driven, patient controlled high-inspiration breath-hold; this technique gives excellent immobilization results, with high reproducibility, yet it is easy to implement and costs little extra treatment time. Breath control, whatever technique is employed, proves superior to free breathing treatment when using 3D-CRT. Breath control should then be used whenever possible, and is probably mandatory for IMRT. (authors)

  16. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  17. Multi-channel pulser for the SLC thermionic electron source

    International Nuclear Information System (INIS)

    Browne, M.J.; Clendenin, J.E.; Corredoura, P.L.; Jobe, R.K.; Koontz, R.F.; Sodja, J.

    1985-01-01

    A new pulser developed for the SLC thermionic gun has been operational since September 1984. It consists of two planar triode amplifiers with a common output triode driving the gun cathode to produce two independent pulses of up to 9A with a 3 nsec FWHM pulse width. Three long-pulse amplifiers are also connected to the cathode to produce pulses with widths controllable between 100 nsec and 1.6 μsec. Each amplifier has independent timing and amplitude control through a fiber optic link to the high voltage plane of the gun cathode-grid structure. The pulser and its operating characteristics are described. 15 refs., 3 figs

  18. Speed controller for an alternating - current motor

    International Nuclear Information System (INIS)

    Bolie, V.W.

    1984-01-01

    A controller for a multi-phase ac motor that is subject to a large inertial load, e.g. an induction motor driving a heavy spinning rotor of a neutron chopper that must be rotated in phase-locked synchronism with a reference pulse train that is representative of an ac power supply signal Esub(L) having a meandering line frequency, includes a sensor which provides a feedback pulse train representative of the actual speed of the motor which is compared (by counting clock pulses between feedback pulses) with a reference clock signal in a computing unit to provide a motor control signal Esub(c). The motor control signal is a weighted linear sum of a speed error signal, a phase error signal, and a drift error signal, the magnitudes of which are recalculated and updated with each revolution of the motor shaft. The speed error signal is constant for large speed errors but highly sensitive to small speed errors. The stator windings of the motor are driven by variable-frequency power amplifiers which are controlled by the motor control signal Esub(c) via PROMs which store digital representations of sine and cosine waveforms in quadrature. (author)

  19. Discrete-Time LPV Current Control of an Induction Motor

    DEFF Research Database (Denmark)

    Bendtsen, Jan Dimon; Trangbæk, Klaus

    2001-01-01

    In this paper we apply a new method for gain-scheduled output feedback control of nonlinear systems to current control of an induction motor. The method relies on recently developed controller synthesis results for linear parameter-varying (LPV) systems, where the controller synthesis is formulated...... without further complications. The synthesis method is applied to the model, yielding an LPV discrete-time controller. Finally, the efficiency of the control scheme is validated via simulations as well as experimentally on the actual induction motor, both in open-loop current control and when an outer...... speed control loop is closed around the current loop...

  20. Discrete-Time LPV Current Control of an Induction Motor

    DEFF Research Database (Denmark)

    Bendtsen, Jan Dimon; Trangbæk, Klaus

    2003-01-01

    In this paper we apply a new method for gain-scheduled output feedback control of nonlinear systems to current control of an induction motor. The method relies on recently developed controller synthesis results for linear parameter-varying (LPV) systems, where the controller synthesis is formulated...... further complications. The synthesis method is applied to the model, yielding an LPV discrete-time controller. Finally, the efficiency of the control scheme is validated via simulations as well as on the actual induction motor, both in open-loop current control and when an outer speed control loop...... is closed around the current loop....

  1. Malaria vector control: current and future strategies

    NARCIS (Netherlands)

    Takken, W.; Knols, B.G.J.

    2009-01-01

    The recently announced call for malaria eradication represents a new page in the history of this disease. This has been triggered by remarkable reductions in malaria resulting from combined application of effective drugs and vector control. However, this strategy is threatened by development of

  2. Electrolytic tritium enrichment: Current control using current-stabilised Kepco Type JQE modular supplies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1976-07-12

    This note describes the principles, design and operation of a current-stabilised power source for tritium electrolytic enrichment cells. A Kepoo Tpe JE, modular supply is current-stabilised by controlled current feedback. The accompanying control unit incorporates a temperature sensor or the cooling unit of the electrolysis cells, a line monitor to register current shut-off due to temporary power failure, a time-of-day clock, a current control potentiometer and a digital voltmeter providing current reading to an accuracy of 0.01A.

  3. Electrolytic tritium enrichment: Current control using current-stabilised Kepco Type JQE modular supplies

    International Nuclear Information System (INIS)

    1976-01-01

    This note describes the principles, design and operation of a current-stabilised power source for tritium electrolytic enrichment cells. A Kepoo Tpe JE, modular supply is current-stabilised by controlled current feedback. The accompanying control unit incorporates a temperature sensor or the cooling unit of the electrolysis cells, a line monitor to register current shut-off due to temporary power failure, a time-of-day clock, a current control potentiometer and a digital voltmeter providing current reading to an accuracy of 0.01A

  4. Iaverage current mode (ACM) control for switching power converters

    OpenAIRE

    2014-01-01

    Providing a fast current sensor direct feedback path to a modulator for controlling switching of a switched power converter in addition to an integrating feedback path which monitors average current for control of a modulator provides fast dynamic response consistent with system stability and average current mode control. Feedback of output voltage for voltage regulation can be combined with current information in the integrating feedback path to limit bandwidth of the voltage feedback signal.

  5. Designing single phase Current-Programmed-Controlled rectifiers by harmonic currents

    DEFF Research Database (Denmark)

    Andersen, Gert Karmisholt; Blaabjerg, Frede

    2002-01-01

    The grid current harmonics of a Current-Programmed-Controlled (CPC) pfc rectifier strongly depends on the choice of switching frequency and switching inductance. This paper describes a new simple and vert fast method to calculate the grid current of a CPC controlled pfc converter. The method...

  6. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  7. SLAC-Linac-Collider (SLC) Project

    International Nuclear Information System (INIS)

    Wiedemann, H.

    1981-02-01

    The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system

  8. Tuberculosis control in the Americas: current approaches.

    Science.gov (United States)

    Pio, A; Western, K

    1976-01-01

    Tuberculosi remains a serious public health problem in the Americas, and it has not declined as rapidly or as much as experts projected it would in the 1940's. Scientific advances in control of the disease over the last three decades have produced effective chemotherapeutic agents, established the immunizing capacity of BCG vaccine, and demonstrated the superior value of bacteriologic diagnosis in symptomatic individuals over mass community x-ray surveys, which are both inefficient and costly. They have also shown that most cases can be treated on an ambulatory basis, obviating the need for the lengthy hospital stays which have heretofore weighed so heavily on budgets. By standardization of control methods, both for diagnosis and for chemotherapy, these tasks can be taken on by polyvalent staff in the general health services, whose wide coverage places them in a position to reach a much larger segment of the population than that attended by the traditional vertical system. To a greater or lesser degree, all the countries in the Americas are beginning to orient their strategies in this direction, and some of them already have considerable progress to report.

  9. Current control system for superconducting coils of LHD

    International Nuclear Information System (INIS)

    Chikaraishi, H.; Yamada, S.; Inoue, T.

    1996-01-01

    This paper introduce a coil current control system of the LHD. The main part of this system consists of two VME based real time computers and a risc based work station which are connected by optical fiber link. In this computer system, a coil current controller for steady state operation of LHD which based on a state variable control theory is installed. Also advanced current control scheme, which are now developing for dynamic current control in phase II operation of LHD, are introduced. (author)

  10. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  11. Adaptive slope compensation for high bandwidth digital current mode controller

    DEFF Research Database (Denmark)

    Taeed, Fazel; Nymand, Morten

    2015-01-01

    An adaptive slope compensation method for digital current mode control of dc-dc converters is proposed in this paper. The compensation slope is used for stabilizing the inner current loop in peak current mode control. In this method, the compensation slope is adapted with the variations...... in converter duty cycle. The adaptive slope compensation provides optimum controller operation in term of bandwidth over wide range of operating points. In this paper operation principle of the controller is discussed. The proposed controller is implemented in an FPGA to control a 100 W buck converter...

  12. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  13. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  14. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  15. RF phase distribution systems at the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Schwarz, H.D.

    1989-04-01

    Modern large linear accelerators require RF distribution systems with minimal phase drifts and errors. Through the use of existing RF coaxial waveguides, and additional installation of phase reference cables and monitoring equipment, stable RF distribution for the SLC has been achieved. This paper discusses the design and performance of SLAC systems, and some design considerations for future colliders. 6 refs., 4 figs

  16. Kicker for the SLC electron damping ring

    International Nuclear Information System (INIS)

    Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.

    1987-01-01

    The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see

  17. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  18. Current developments in bovine mastitis treatment and control.

    Science.gov (United States)

    Wager, L A; Linquist, W E; Hayes, G L; Britten, A M; Whitehead, R G; Webster, D E; Barnes, F D

    1978-01-01

    Mastitis in its complexity has managed to forestall all efforts of eradication in spite of years of research, antibiotics and practical control measures. This minisymposium will touch on seven topics current to treatment and control of this economically important disease.

  19. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  20. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Current control loop of 3-phase grid-connected inverter

    International Nuclear Information System (INIS)

    Jabbar, A F; Mansor, M

    2013-01-01

    This paper presents a comparative study of current control loop in 3-phase inverter which is used to control the active and reactive output power. Generally, current control loop, power control loop and phase lock-loop are the conventional parameters that can be found in an inverter system controlled by the conventional linear control type, for instance proportional (P), integral (I) and derivative (D). If the grid remains stable throughout the day, PID control can be use. However variation of magnitude, frequency, voltage dips, transient, and other related power quality issues occur in a 3-phase grid often affects the control loop. This paper aims to provide an overall review on the available current control techniques used in grid connected system.

  2. Zener diode controls switching of large direct currents

    Science.gov (United States)

    1965-01-01

    High-current zener diode is connected in series with the positive input terminal of a dc supply to block the flow of direct current until a high-frequency control signal is applied across the zener diode. This circuit controls the switching of large dc signals.

  3. Current Control of Grid Converters Connected with Series AC Capacitor

    DEFF Research Database (Denmark)

    Wang, Xiongfei; Blaabjerg, Frede; Loh, Poh Chiang

    2015-01-01

    The series ac capacitor has recently been used with the transformerless grid-connected converters in the distribution power grids. The capacitive characteristic of the resulting series LC filter restricts the use of conventional synchronous integral or stationary resonant current controllers. Thus...... this paper proposes a fourth-order resonant controller in the stationary frame, which guarantees a zero steady-state current tracking error for the grid converters with series LC filter. This method is then implemented in a three-phase experimental system for verification, where the current harmonics below...... the LC filter resonance frequency are effectively eliminated. Experimental results confirm the validity of the proposed current control scheme....

  4. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  6. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  7. The trajectory control in the SLC linac

    International Nuclear Information System (INIS)

    Hsu, I.C.; Adolphsen, C.E.; Himel, T.M.; Seeman, J.T.

    1991-05-01

    Due to wake field effects, the trajectories of accelerated beams in the Linac should be well maintained to avoid severe beam breakup. In order to maintain a small emittance at the end of the Linac, the tolerance on the trajectory deviations become tighter when the beam intensities increase. The existing two beam trajectory correction method works well when the theoretical model agrees with the real machine lattice. Unknown energy deviations along the linac as well as wake field effects can cause the real lattice to deviate from the model. This makes the trajectory correction difficult. Several automated procedures have been developed to solve these problems. They are: an automated procedure to frequently steer the whole Linac by dividing the Linac into several small regions; an automated procedure to empirically correct the model to fit the real lattice and eight trajectory correcting feedback loops along the linac and steering through the collimator region with restricted corrector strengths and a restricted number of correctors. 6 refs., 2 figs

  8. Beam diagnostics and control for SLC

    International Nuclear Information System (INIS)

    Ross, M.C.

    1987-01-01

    Construction of the SLAC Linear Collider has posed some new problems in beam diagnostic device design. Typical beam sizes are small when compared with conventional storage rings, orbit tolerances are tighter and the pulsed nature of the machine means that signal to noise enhancement by averaging is not always possible. Thus the diagnostics must have high resolution, high absolute accuracy and must deliver data from a single puls. In practice the required performance level depends on the function and dynamics of a given region in the collider. In this paper, the authors review the major beam diagnostic system and then discuss the global data acquisition schemes. Because space is limited each system is described only in a very cursory fashion. More details may be found in the cited papers

  9. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  10. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  11. Simplified current minimization control of vector controlled Interior ...

    Indian Academy of Sciences (India)

    Thakur Sumeet Singh

    2018-04-12

    Apr 12, 2018 ... looked into loss-minimization control of PM motors by use of polynomial .... the chosen motor (''Appendix'') falls outside of its range. Figure 1. ..... command, mmf balance along q-axis should be maintained: (Lq being ...

  12. Discrete-Time LPV Current Control of an Induction Motor

    DEFF Research Database (Denmark)

    Bendtsen, Jan Dimon; Trangbæk, Klaus

    2003-01-01

    In this paper we apply a new method for gain-scheduled output feedback control of nonlinear systems to current control of an induction motor. The method relies on recently developed controller synthesis results for linear parameter-varying (LPV) systems, where the controller synthesis is formulated...... as a set of linear matrix inequalities with full-block multipliers. A standard nonlinear model of the motor is constructed and written on LPV form. We then show that, although originally developed in continuous time, the controller synthesis results can be applied to a discrete-time model as well without...... further complications. The synthesis method is applied to the model, yielding an LPV discrete-time controller. Finally, the efficiency of the control scheme is validated via simulations as well as on the actual induction motor, both in open-loop current control and when an outer speed control loop...

  13. Pharmacotherapy in pregnancy; effect of ABC and SLC transporters on drug transport across the placenta and fetal drug exposure.

    Science.gov (United States)

    Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina

    2012-11-01

    Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.

  14. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  15. Eddy current quality control of soldered current-carrying busbar splices of superconducting magnets

    CERN Document Server

    Kogan, L; Savary, F; Principe, R; Datskov, V; Rozenfel'd, E; Khudjakov, B

    2015-01-01

    The eddy current technique associated with a U-shaped transducer is studied for the quality control of soldered joints between superconducting busbars ('splices'). Two other quality control techniques, based on X-rays and direct measurement of the electrical resistance, are also studied for comparison. A comparative analysis of the advantages and disadvantages of these three methods in relation to the quality control of soldered superconducting busbar cables enclosed in copper shells is used for benchmarking. The results of inspections with the U-shaped eddy current transducer carried out on several sample joints presenting different types of soldering defects show the potential of this type of nondestructive (ND) quality control technique.

  16. SLC Energy Upgrade Program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.

    1985-03-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  17. SLC energy upgrade program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebacqz, J.V.

    1985-01-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  18. The SLC energy upgrade program at SLAC

    International Nuclear Information System (INIS)

    Loew, G.A.; Allen, M.A.; Cassel, R.L.; Dean, N.R.; Konrad, G.T.; Koontz, R.F.; Lebaaqz, J.V.

    1985-01-01

    The SLAC Linear Collider (SLC) must reach a nominal center-of-mass energy of 100 GeV to fulfill its high energy physics goals. This paper describes the energy upgrade program that is being implemented on the SLAC linear accelerator to meet these goals. It includes a discussion of the design requirements and available technical options, the rationale for the adopted solution, and the technical problems involved in the engineering and production of klystrons and modulators

  19. Verification of the SLC wake potentials

    International Nuclear Information System (INIS)

    Bane, K.; Weiland, T.

    1983-01-01

    The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials

  20. Current control of superconducting coils for fusion experimental facility

    International Nuclear Information System (INIS)

    Ise, T.; Etou, D.; Chikaraishi, H.; Takami, S.; Inoue, T.

    2003-01-01

    The LHD (Large Helical Device) has twelve superconducting coils and six dc power supplies, and following specifications are required for its control system; each coil current must be controlled independently, the steady state control error is less than 0.01% of the reference value, the current settling time for 0.1% of control error is less than 1 second, and the control system must be robust against turbulence caused by appearance and disappearance of the plasma, parameter errors and external electro-magnetic noises. In this paper, the design and test results of the coil current control system for the LHD are described. The good response and robustness are in the relation of trade off each other. H-infinity controller is one of schemes to guarantee robustness for stability. However, the independent responses of six coils were impossible by the H-infinity controller only. To resolve this problem, we applied a feed-forward control with the H-infinity control. Moreover, the advanced design method of H-infinity controller using μ-synthesis was applied to guarantee the control performance in the whole operating condition. As a result, good control results were obtained by experiments. (author)

  1. High voltage processing of the SLC polarized electron gun

    International Nuclear Information System (INIS)

    Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

    1993-04-01

    The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

  2. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-01-01

    The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986

  3. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  4. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  5. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  6. A current controlled variable delay superconducting transmission line

    International Nuclear Information System (INIS)

    Anlage, S.M.; Snortland, H.J.; Beasley, M.R.

    1989-01-01

    The authors present a device concept for a current-controlled variable delay for superconducting transmission line. The device makes use of the change in kinetic inductance of a superconducting transmission line under the application of a DC bias current. The relevant materials parameters and several promising superconducting materials have been identified

  7. Current control by a homopolar machine with moving brushes

    International Nuclear Information System (INIS)

    Vogel, H.

    1978-01-01

    The equation for TNS Doublet's E-coil circuit with moving brush homopolar machine is integrated in the flux of the homopolar for a monotonically increasing current function extending beyond the current reversal into the burn period. The results show that the moving brush feature is not useful for controlling the burn

  8. Discrete Current Control Strategy of Permanent Magnet Synchronous Motors

    Directory of Open Access Journals (Sweden)

    Yan Dong

    2013-01-01

    Full Text Available A control strategy of permanent magnet synchronous motors (PMSMs, which is different from the traditional vector control (VC and direct torque control (DTC, is proposed. Firstly, the circular rotating magnetic field is analyzed on the simplified model and discredited into stepping magnetic field. The stepping magnetomotive force will drive the rotor to run as the stepping motor. Secondly, the stator current orientation is used to build the control model instead of rotor flux orientation. Then, the discrete current control strategy is set and adopted in positioning control. Three methods of the strategy are simulated in computer and tested on the experiment platform of PMSM. The control precision is also verified through the experiment.

  9. Current control by ECCD for W7-X

    International Nuclear Information System (INIS)

    Turkin, Yu.; Maassberg, H.; Beidler, C.D.; Geiger, J.; Marushchenko, N.B.

    2005-01-01

    One of the optimization criteria for the stellarator W7-X is the minimization of the bootstrap current. The plasma current changes the magnetic configuration, especially near the plasma edge, where X-points and islands are located. It was shown that the plasma parameter distributions in the divertor region and the particle and energy depositions on the divertor plates depend strongly on the island geometry. An estimation of the tolerable plasma current obtained from the shift of the island structure close to the target plates shows that the plasma current should be controlled within a range of about 10 kA. The bootstrap current even for the standard configuration can easily exceed this value. The W7-X is not equipped with an Ohmic transformer, so the only means for compensating this current is electron cyclotron current drive (ECCD) and/or neutral beam current drive (NBCD). In this report we study the compensation of residual bootstrap current by using ECCD. To model the control of the toroidal current we use a predictive 1D transport code, which is under development. For evaluation of the bootstrap current and neoclassical transport coefficients we use results from an international collaboration on neoclassical transport in stellarators. Power deposition and current drive profiles due to electron cyclotron resonance heating are calculated by a new ray tracing code. The modeling showed that the loop voltage induced by ECCD leads to a redistribution of the current density with the diffusion time of about two seconds. The relaxation time of the total current is much longer than this time - for a typical ECRH-plasma the total toroidal current reaches steady state after several L/R-time that is about hundreds of seconds. In order to keep current in an acceptable range and to avoid long relaxation times we propose Feed-forward or Predictive control using ECCD as actuator, the steps are as follows: - calculate the bootstrap current distribution using measured plasma

  10. Performance of the SLC polarized electron source with high polarization

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Alley, R.K.; Aoyagi, H.

    1993-04-01

    For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed

  11. High Precision Current Control for the LHC Main Power Converters

    CERN Document Server

    Thiesen, H; Hudson, G; King, Q; Montabonnet, V; Nisbet, D; Page, S

    2010-01-01

    Since restarting at the end of 2009, the LHC has reached a new energy record in March 2010 with the two 3.5 TeV beams. To achieve the performance required for the good functioning of the accelerator, the currents in the main circuits (Main Bends and Main Quadrupoles) must be controlled with a higher precision than ever previously requested for a particle accelerator at CERN: a few parts per million (ppm) of nominal current. This paper describes the different challenges that were overcome to achieve the required precision for the current control of the main circuits. Precision tests performed during the hardware commissioning of the LHC illustrate this paper.

  12. The energy stabilization for the SLC scavenger beam

    International Nuclear Information System (INIS)

    Hsu, I.; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.

    1991-01-01

    The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms

  13. The energy stabilization for the SLC scavenger beam

    International Nuclear Information System (INIS)

    Hsu, Ian; Browne, M.; Himel, T.; Humphrey, R.; Jobe, K.; Ross, M.; Pellegrin, J.L.; Seeman, J.

    1990-08-01

    The energy of the SLC scavenger beam which is used to produce positrons must be carefully maintained so that the beam can be transported through the collimators in the dispersive region of the extraction line which leads from the Linac to the positron target. A feedforward control loop has been developed to compensate the energy fluctuations due to the beam intensity fluctuations. The loop detects the beam intensities in the damping rings and then calculates how much energy needs to be compensated due to beam loading effects. The energy is corrected by adjusting the acceleration phases of two sets of klystrons right before the extraction. Because there is feedback loop using the same controls, their interaction needs to be carefully treated. This paper presents an overview of the feedforward algorithms. 3 figs

  14. Evaluation of Current Controllers for Distributed Power Generation Systems

    DEFF Research Database (Denmark)

    Timbus, Adrian; Liserre, Marco; Teodorescu, Remus

    2009-01-01

    This paper discusses the evaluation of different current controllers employed for grid-connected distributed power generation systems having variable input power, such as wind turbines and photovoltaic systems. The focus is mainly set on linear controllers such as proportional-integral, proportio......This paper discusses the evaluation of different current controllers employed for grid-connected distributed power generation systems having variable input power, such as wind turbines and photovoltaic systems. The focus is mainly set on linear controllers such as proportional......-integral, proportional-resonant, and deadbeat (DB) controllers. Additionally, an improved DB controller robust against grid impedance variation is also presented. Since the paper discusses the implementation of these controllers for grid-connected applications, their evaluation is made in three operating conditions....... First, in steady-state conditions, the contribution of controllers to the total harmonic distortion of the grid current is pursued. Further on, the behavior of controllers in the case of transient conditions like input power variations and grid voltage faults is also examined. Experimental results...

  15. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  16. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  17. CATER: An onlne problem tracking facility for SLC

    International Nuclear Information System (INIS)

    Sass, R.C.; Shoaee, H.

    1993-05-01

    An online facility has been developed for SLC to organize and simplify the management of all problems encountered in the operation of the accelerator. CATER (Computer Aided Trouble Entry and Reporting) may be used to make the initial entry of a problem, to enter one or more solutions to a problem, to modify or closeout a problem, to generate a variety of pre-defined reports giving status and statistical summaries, and to allow anyone to browse the database. All phases of CATER can take place on the operator console, workstations, or on any ANSI compatible terminal. The user interface is designed around a menu driven windowed environment with a large amount of context sensitive help information to alleviate the need for consulting user documentation. Currently, the CATER database contains information on more than 30,000 problems entered since it went online in January of 1988. The features of the software and some implementation details will be presented

  18. CATER: An online problem tracking facility for SLC

    International Nuclear Information System (INIS)

    Sass, R.C.; Shoaee, H.

    1993-01-01

    An online facility has been developed for SLC to organize and simplify the management of all problems encountered in the operation of the accelerator. CATER (Computer Aided Trouble Entry and Reporting) may be used to make the initial entry of a problem, to enter one or more solutions to a problem, to modify or closeout a problem, to generate a variety of pre-defined reports giving status and statistical summaries, and to allow anyone to browse the database. All phases of CATER can take place on the operator console, workstations, or on any ANSI compatible terminal. The user interface is designed around a menu driven windowed environment with a large amount of context sensitive help information to alleviate the need for consulting user documentation. Currently, the CATER database contains information on more than 30,000 problems entered since it went online in January of 1988. The features of the software and some implementation details will be presented

  19. New Approaches to Circulating Current Controllers for Modular Multilevel Converters

    Directory of Open Access Journals (Sweden)

    Miguel Moranchel

    2017-01-01

    Full Text Available In the next years, modular multilevel converters (MMCs are going to be a next generation multilevel converters for medium to high voltage conversion applications, such as medium voltage motor drives, medium voltage flexible AC transmission systems (FACTS and high voltage direct current transmission. They provide advantages such as high modularity, availability, low generation of harmonics, etc. However, the circulating current distorts the leg currents and increases the rated current of power devices, which further increases system cost. This paper focuses on analysis and suppression of these currents in a MMC using two algorithms for tracking of harmonics. For this work resonant controllers and repetitive controllers have been selected. Both controllers are analyzed and simulations results are presented. Moreover, the controllers have been tested and validated for a three phase MMC operating as an inverter using a real processing platform based on Zynq by Xilinx and designed to control large multilevel converters and in a real MMC prototype. These results are provided to demonstrate the feasibility of the proposed method.

  20. Active current control in wind power plants during grid faults

    DEFF Research Database (Denmark)

    Martinez, Jorge; Kjær, Phillip C.; Rodriguez, Pedro

    2010-01-01

    Modern wind power plants are required and designed to ride through faults in electrical networks, subject to fault clearing. Wind turbine fault current contribution is required from most countries with a high amount of wind power penetration. In order to comply with such grid code requirements......, wind turbines usually have solutions that enable the turbines to control the generation of reactive power during faults. This paper addresses the importance of using an optimal injection of active current during faults in order to fulfil these grid codes. This is of relevant importance for severe...... faults, causing low voltages at the point of common coupling. As a consequence, a new wind turbine current controller for operation during faults is proposed. It is shown that to achieve the maximum transfer of reactive current at the point of common coupling, a strategy for optimal setting of the active...

  1. Magnetohydrodynamic effects of current profile control in reversed field pinches

    International Nuclear Information System (INIS)

    Sovinec, C.R.; Prager, S.C.

    1999-01-01

    Linear and non-linear MHD computations are used to investigate reversed field pinch configurations with magnetic fluctuations reduced through current profile control. Simulations with reduced ohmic drive and moderate auxiliary current drive, represented generically with an electron force term, applied locally in radius near the plasma edge show magnetic fluctuation energies that are orders of magnitude smaller than those in simulations without profile control. The core of the improved configurations has reduced magnetic shear and closed flux surfaces in some cases, and reversal is sustained through the auxiliary current drive. Modes resonant near the edge may become unstable with auxiliary drive, but their saturation levels can be controlled. The space of auxiliary drive parameters is explored, and the ill effects of deviating far from optimal conditions is demonstrated in non-linear simulations. (author)

  2. Drift chamber vertex detectors for SLC/LEP

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, K G

    1988-03-01

    Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.

  3. Reliability and lifetime predictions of SLC klystrons

    International Nuclear Information System (INIS)

    Allen, M.A.; Callin, R.S.; Fowkes, W.R.; Lee, T.G.; Vlieks, A.E.

    1989-01-01

    The energy upgrade of SLAC, with the first of the new 67 MW SLAC Linear Collider (SLC) klystrons, began over four years ago. Today there are over 200 of these klystrons in operation. As a result, there is a wealth of klystron performance and failure information that enables reasonable predictions to be made on life expectancy and reliability. Data from initial tests, follow-up tests and daily operation monitoring on the accelerator is stored for analysis. Presented here are life expectancy predictions with particular emphasis on cathode life. Also, based on this data, the authors will discuss some of the principal modes of failure. 3 refs., 2 figs., 1 tab

  4. A status report on the SLC program

    International Nuclear Information System (INIS)

    Prescott, C.Y.

    1985-09-01

    The SLC program is an accelerator experiment and a physics experiment. The progress in the accelerator experiment has been rapid, with injector and damping ring components working, conventional construction on schedule, and technical components in production. Accelerator studies will investigate beam-linac and beam-beam interactions, with application to the design of future linear colliders. The physics experiments start in 1987 to study Z 0 properties and to look for new physics effects. Detectors to fully exploit the potential physics are under construction

  5. Reliability and lifetime predictions of SLC klystrons

    International Nuclear Information System (INIS)

    Allen, M.A.; Callin, R.S.; Fowkes, W.R.; Lee, T.G.; Vlieks, A.E.

    1989-03-01

    The energy upgrade of SLAC, with the first of the new 67 MW SLAC Linear Collider (SLC) klystrons, began over four years ago. Today there are over 200 of these klystrons in operation. As a result, there is a wealth klystron performance and failure information that enables reasonable predictions to be made on life expectancy and reliability. Data from initial tests, follow-up tests and daily operation monitoring on the accelerator is stores for analysis. Presented here are life expectancy predictions with particular emphasis on cathode life. Also, based on this data, we will discuss some of the principal modes of failure. 3 refs., 2 figs

  6. Generalized space vector control for current source inverters and rectifiers

    Directory of Open Access Journals (Sweden)

    Roseline J. Anitha

    2016-06-01

    Full Text Available Current source inverters (CSI is one of the widely used converter topology in medium voltage drive applications due to its simplicity, motor friendly waveforms and reliable short circuit protection. The current source inverters are usually fed by controlled current source rectifiers (CSR with a large inductor to provide a constant supply current. A generalized control applicable for both CSI and CSR and their extension namely current source multilevel inverters (CSMLI are dealt in this paper. As space vector pulse width modulation (SVPWM features the advantages of flexible control, faster dynamic response, better DC utilization and easy digital implementation it is considered for this work. This paper generalizes SVPWM that could be applied for CSI, CSR and CSMLI. The intense computation involved in framing a generalized space vector control are discussed in detail. The algorithm includes determination of band, region, subregions and vectors. The algorithm is validated by simulation using MATLAB /SIMULINK for CSR 5, 7, 13 level CSMLI and for CSR fed CSI.

  7. Application of online modeling to the operation of SLC

    International Nuclear Information System (INIS)

    Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.

    1987-01-01

    Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desire optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beam matching and optimization of injection and extraction efficiencies and beam transmissions. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction

  8. Application of online modeling to the operation of SLC

    International Nuclear Information System (INIS)

    Woodley, M.D.; Sanchez-Chopitea, L.; Shoaee, H.

    1987-02-01

    Online computer models of first order beam optics have been developed for the commissioning, control and operation of the entire SLC including Damping Rings, Linac, Positron Return Line and Collider Arcs. A generalized online environment utilizing these models provides the capability for interactive selection of a desired optics configuration and for the study of its properties. Automated procedures have been developed which calculate and load beamline component set-points and which can scale magnet strengths to achieve desired beam properties for any Linac energy profile. Graphic displays facilitate comparison of design, desired and actual optical characteristics of the beamlines. Measured beam properties, such as beam emittance and dispersion, can be incorporated interactively into the models and used for beamline matching and optimization of injection and extraction efficiencies and beam transmission. The online optics modeling facility also serves as the foundation for many model-driven applications such as autosteering, calculation of beam launch parameters, emittance measurement and dispersion correction

  9. On Ion Cyclotron Current Drive for sawtooth control

    International Nuclear Information System (INIS)

    Eriksson, L.-G.; Johnson, T.; Hellsten, T.; Mayoral, M.-L.; McDonald, D.; Santala, M.; Vries, P. de; Coda, S.; Sauter, O.; Mueck, A.; Buttery, R.J.; Mantsinen, M.J.; Noterdaeme, J.-M.; Westerhof, E.

    2006-01-01

    Experiments using Ion Cyclotron Current Drive (ICCD) to control sawteeth are presented. In particular, discharges demonstrating shortening of fast ion induced long sawteeth reported in [L.-G. Eriksson et al., Physical Review Letters 92, 235004 (2004)] by ICCD have been analysed in detail. Numerical simulations of the ICCD driven currents are shown to be consistent with the experimental observations. They support the hypothesis that an increase of the magnetic shear, due to the driven current, at the surface where the safety factor is unity was the critical factor for the shortening of the sawteeth. In view of the potential utility of ICCD, the mechanisms for the current drive have been further investigated experimentally. This includes the influence of the averaged energy of the resonating ions carrying the current and the spectrum of the launched waves. The results of these experiments are discussed in the light of theoretical considerations. (author)

  10. Current control for magnetized plasma in direct-current plasma-immersion ion implantation

    International Nuclear Information System (INIS)

    Tang Deli; Chu, Paul K.

    2003-01-01

    A method to control the ion current in direct-current plasma-immersion ion implantation (PIII) is reported for low-pressure magnetized inductively coupled plasma. The ion current can be conveniently adjusted by applying bias voltage to the conducting grid that separates plasma formation and implantation (ion acceleration) zones without the need to alter the rf input power, gas flux, or other operating conditions. The ion current that diminishes with an increase in grid bias in magnetized plasmas can be varied from 48 to 1 mA by increasing the grid voltage from 0 to 70 V at -50 kV sample bias and 0.5 mTorr hydrogen pressure. High implantation voltage and monoenergetic immersion implantation can now be achieved by controlling the ion current without varying the macroscopic plasma parameters. The experimental results and interpretation of the effects are presented in this letter. This technique is very attractive for PIII of planar samples that require on-the-fly adjustment of the implantation current at high implantation voltage but low substrate temperature. In some applications such as hydrogen PIII-ion cut, it may obviate the need for complicated sample cooling devices that must work at high voltage

  11. Dynamics and stabilization of peak current-mode controlled buck converter with constant current load

    International Nuclear Information System (INIS)

    Leng Min-Rui; Zhou Guo-Hua; Zhang Kai-Tun; Li Zhen-Hua

    2015-01-01

    The discrete iterative map model of peak current-mode controlled buck converter with constant current load (CCL), containing the output voltage feedback and ramp compensation, is established in this paper. Based on this model the complex dynamics of this converter is investigated by analyzing bifurcation diagrams and the Lyapunov exponent spectrum. The effects of ramp compensation and output voltage feedback on the stability of the converter are investigated. Experimental results verify the simulation and theoretical analysis. The stability boundary and chaos boundary are obtained under the theoretical conditions of period-doubling bifurcation and border collision. It is found that there are four operation regions in the peak current-mode controlled buck converter with CCL due to period-doubling bifurcation and border-collision bifurcation. Research results indicate that ramp compensation can extend the stable operation range and transfer the operating mode, and output voltage feedback can eventually eliminate the coexisting fast-slow scale instability. (paper)

  12. SLC2A9 and ZNF518B polymorphisms correlate with gout-related metabolic indices in Chinese Tibetan populations.

    Science.gov (United States)

    Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C

    2015-08-19

    Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.

  13. Power electronic converters PWM strategies and current control techniques

    CERN Document Server

    Monmasson, Eric

    2013-01-01

    A voltage converter changes the voltage of an electrical power source and is usually combined with other components to create a power supply. This title is devoted to the control of static converters, which deals with pulse-width modulation (PWM) techniques, and also discusses methods for current control. Various application cases are treated. The book is ideal for professionals in power engineering, power electronics, and electric drives industries, as well as practicing engineers, university professors, postdoctoral fellows, and graduate students.

  14. Control of bootstrap current in the pedestal region of tokamaks

    Energy Technology Data Exchange (ETDEWEB)

    Shaing, K. C. [Institute for Space and Plasma Sciences, National Cheng Kung University, Tainan City 70101, Taiwan (China); Department of Engineering Physics, University of Wisconsin, Madison, Wisconsin 53796 (United States); Lai, A. L. [Institute for Space and Plasma Sciences, National Cheng Kung University, Tainan City 70101, Taiwan (China)

    2013-12-15

    The high confinement mode (H-mode) plasmas in the pedestal region of tokamaks are characterized by steep gradient of the radial electric field, and sonic poloidal U{sub p,m} flow that consists of poloidal components of the E×B flow and the plasma flow velocity that is parallel to the magnetic field B. Here, E is the electric field. The bootstrap current that is important for the equilibrium, and stability of the pedestal of H-mode plasmas is shown to have an expression different from that in the conventional theory. In the limit where ‖U{sub p,m}‖≫ 1, the bootstrap current is driven by the electron temperature gradient and inductive electric field fundamentally different from that in the conventional theory. The bootstrap current in the pedestal region can be controlled through manipulating U{sub p,m} and the gradient of the radial electric. This, in turn, can control plasma stability such as edge-localized modes. Quantitative evaluations of various coefficients are shown to illustrate that the bootstrap current remains finite when ‖U{sub p,m}‖ approaches infinite and to provide indications how to control the bootstrap current. Approximate analytic expressions for viscous coefficients that join results in the banana and plateau-Pfirsch-Schluter regimes are presented to facilitate bootstrap and neoclassical transport simulations in the pedestal region.

  15. Real-time control for long ohmic alternate current discharges

    International Nuclear Information System (INIS)

    Carvalho, Ivo S.; Duarte, Paulo; Fernandes, Horácio; Valcárcel, Daniel F.; Carvalho, Pedro J.; Silva, Carlos; Duarte, André S.; Neto, André; Sousa, Jorge; Batista, António J.N.; Hekkert, Tiago; Carvalho, Bernardo B.; Gomes, Rui B.

    2014-01-01

    Highlights: • 40 Alternate plasma current (AC) semi-cycles without loss of ionization, more than 1 s of operation. • AC discharges automatic control: feedback loops, time-windows control strategy, goal oriented time-windows and exception handling. • Energy deposition and Carbon radiation evolution during the AC discharges. - Abstract: The ISTTOK tokamak has a long tradition on alternate plasma current (AC) discharges, but the old control system was limiting and lacked full system integration. In order to improve the AC discharges performance the ISTTOK fast control system was updated. This control system developed on site based on the Advanced Telecommunications Computing Architecture (ATCA) standard now integrates the information gathered by all the tokamak real-time diagnostics to produce an accurate observation of the plasma parameters. The real-time actuators were also integrated, allowing a Multiple Input Multiple Output (MIMO) control environment with several synchronization strategies available. The control system software was developed in C++ on top of a Linux system with the Multi-threaded Application Real-Time executor (MARTe) Framework to synchronize the real-time code execution under a 100μs control cycle. In addition, to simplify the discharge programming, a visual Human–Machine Interface (HMI) was also developed using the BaseLib2 libraries included in the MARTe Framework. This paper presents the ISTTOK control system and the optimizations that extended the AC current discharges duration to more than 1 s, corresponding to 40 semi-cycles without apparent degradation of the plasma parameters. This upgrade allows ISTTOK to be used as a low-cost material testing facility with long time exposures to nuclear fusion relevant plasmas, comparable (in duration) with medium size tokamaks

  16. Real-time control for long ohmic alternate current discharges

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Ivo S., E-mail: ivoc@ipfn.ist.utl.pt; Duarte, Paulo; Fernandes, Horácio; Valcárcel, Daniel F.; Carvalho, Pedro J.; Silva, Carlos; Duarte, André S.; Neto, André; Sousa, Jorge; Batista, António J.N.; Hekkert, Tiago; Carvalho, Bernardo B.; Gomes, Rui B.

    2014-05-15

    Highlights: • 40 Alternate plasma current (AC) semi-cycles without loss of ionization, more than 1 s of operation. • AC discharges automatic control: feedback loops, time-windows control strategy, goal oriented time-windows and exception handling. • Energy deposition and Carbon radiation evolution during the AC discharges. - Abstract: The ISTTOK tokamak has a long tradition on alternate plasma current (AC) discharges, but the old control system was limiting and lacked full system integration. In order to improve the AC discharges performance the ISTTOK fast control system was updated. This control system developed on site based on the Advanced Telecommunications Computing Architecture (ATCA) standard now integrates the information gathered by all the tokamak real-time diagnostics to produce an accurate observation of the plasma parameters. The real-time actuators were also integrated, allowing a Multiple Input Multiple Output (MIMO) control environment with several synchronization strategies available. The control system software was developed in C++ on top of a Linux system with the Multi-threaded Application Real-Time executor (MARTe) Framework to synchronize the real-time code execution under a 100μs control cycle. In addition, to simplify the discharge programming, a visual Human–Machine Interface (HMI) was also developed using the BaseLib2 libraries included in the MARTe Framework. This paper presents the ISTTOK control system and the optimizations that extended the AC current discharges duration to more than 1 s, corresponding to 40 semi-cycles without apparent degradation of the plasma parameters. This upgrade allows ISTTOK to be used as a low-cost material testing facility with long time exposures to nuclear fusion relevant plasmas, comparable (in duration) with medium size tokamaks.

  17. Concepts Concerning 'Disease\\' Causation, Control, and the current ...

    African Journals Online (AJOL)

    There is an ethical necessity that doctors understand the complex social, political, environmental and economic dynamics involved in infectious disease outbreaks. This article discusses some important concepts concerning 'disease' causation and control with specific reference to the current cholera outbreak in Zimbabwe ...

  18. High performance current controller for particle accelerator magnets supply

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Bidoggia, Benoit; Munk-Nielsen, Stig

    2013-01-01

    The electromagnets in modern particle accelerators require high performance power supply whose output is required to track the current reference with a very high accuracy (down to 50 ppm). This demands very high bandwidth controller design. A converter based on buck converter topology is used...

  19. Determination of electroweak parameters at the SLC

    International Nuclear Information System (INIS)

    Torrence, E.

    1996-09-01

    We present an improved measurement of the left-right cross section asymmetry (A LR ) for Z 0 boson production by e + e - collisions. The measurement was performed at a center-of-mass energy of 91.28 GeV with the SLD detector at the SLAC Linear Collider (SLC) during the 1994-95 running period. The luminosity-weighted average polarization of the SLC electron beam during this run was measured to be (77.23 ± 0.52)%. Using a sample of 93,644 hadronic Z 0 decays, we measure the pole asymmetry A LR 0 to be 0.1512 ± 0.0042(stat.) ± 0.0011(syst.) which is equivalent to an effective weak mixing angle of sin 2 θ W eff = 0.23100 ± 0.00054(stat.) ± 0.00014(syst.). We also present a preliminary direct measurement of the Z 0 -lepton coupling asymmetries A e , A μ , and A τ extracted from the differential cross section observed in leptonic Z 0 decays. We combine these results with our previous A LR measurement to obtain a combined determination of the weak mixing angle sin 2 θ W eff = 0.23061 ± 0.00047

  20. Machine protection schemes for the SLC

    International Nuclear Information System (INIS)

    Ross, M.C.

    1991-01-01

    The beamline components of a linear collider must be protected from high power beams in a way that is both reliable and has a minimum impact on integrated luminosity. When an upstream accelerator component fault occurs, the machine protection system suppresses the appropriate beam pulses and restores them when the fault clears or is compensated for. If an unacceptable localized beam loss is detected, without an accompanying component fault that is a likely cause of the loss, the system must provide identical, lower rate (lower average power), beam pulses to be used for diagnosis. This must not be done at the expense of any upstream beam stabilization system since fault diagnosis and recovery may take some time. Since the SLC beam pulse sequence is a regenerative one, i.e. correct function on a given pulse requires that several preceding pulses have been successfully completed, beam pulse repetition rate limiting is not trivial. Smooth, rapid, recovery from this type of fault is very important and can have a significant impact on luminosity. This paper provides an overview of the beam suppression and repetition rate limiting schemes used at the SLC

  1. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  2. Controlling chaos in the current-driven ion acoustic instability

    International Nuclear Information System (INIS)

    Fukuyama, T.; Taniguchi, K.; Kawai, Y.

    2002-01-01

    Control of intermittent chaos caused by the current-driven ion acoustic instability is attempted and the controlling mechanism is investigated. When a small negative dc voltage is applied to the chaotic system as a perturbation, the system changes from a chaotic state to a periodic state while maintaining the instability, indicating that the chaotic state caused by the ion acoustic instability is well controlled by applying a small negative dc voltage. A hysteresis structure is observed on the V-I curve of the mesh grid to which the negative dc voltage to control is applied. Furthermore, when a negative dc voltage is applied to the state which shows a laminar structure existing under same experimental conditions, the system becomes chaotic via a bifurcation. Driven-chaos is excited when a negative dc voltage is applied to the laminar state. Applying a small negative dc voltage leads to controlling intermittent chaos while exciting driven-chaos

  3. Current control of PMSM based on maximum torque control reference frame

    Science.gov (United States)

    Ohnuma, Takumi

    2017-07-01

    This study presents a new method of current controls of PMSMs (Permanent Magnet Synchronous Motors) based on a maximum torque control reference frame, which is suitable for high-performance controls of the PMSMs. As the issues of environment and energy increase seriously, PMSMs, one of the AC motors, are becoming popular because of their high-efficiency and high-torque density in various applications, such as electric vehicles, trains, industrial machines, and home appliances. To use the PMSMs efficiently, a proper current control of the PMSMs is necessary. In general, a rotational coordinate system synchronizing with the rotor is used for the current control of PMSMs. In the rotating reference frame, the current control is easier because the currents on the rotating reference frame can be expressed as a direct current in the controller. On the other hand, the torque characteristics of PMSMs are non-linear and complex; the PMSMs are efficient and high-density though. Therefore, a complicated control system is required to involve the relation between the torque and the current, even though the rotating reference frame is adopted. The maximum torque control reference frame provides a simpler way to control efficiently the currents taking the torque characteristics of the PMSMs into consideration.

  4. Control of optically induced currents in semiconductor crystals

    Energy Technology Data Exchange (ETDEWEB)

    Kohli, Kapil Kumar

    2010-06-01

    The generation and control of optically induced currents has the potential to become an important building block for optical computers. Here, shift and rectification currents are investigated that emerge from a divergence of the optical susceptibility. It is known that these currents react to the shape of the impinging laser pulse, and especially to the shape of the pulse envelope. The main goal is the systematic manipulation of the pulse envelope with an optical pulse shaper that is integrated into a standard THz emission setup. The initial approach, the chirping of the laser pulse only has a weak influence on the envelope and the currents. Instead, a second approach is suggested that uses the combined envelope of a phase-stable pulse-pair as a parameter. In a laser pulse, the position of the maxima of the electrical field and the pulse envelope are shifted relative to each other. This shift is known as the Carrier-Envelope Phase (CEP). It is a new degree of freedom that is usually only accessible in specially stabilized systems. It is shown, that in a phase-stable pulse-pair, at least the relative CEP is usable as a new degree of freedom. It has a great influence on the shape of the pulse envelope and thus on the current density. It is shown that this approach enables the coherent control of the current density. The experiments are corroborated by a theoretical model of the system. The potential of this approach is demonstrated in an application. A framework is presented that uses an iterative genetic algorithm to create arbitrarily shaped THz traces. The algorithm controls the optical pulse shaper, and varies the phase of the impinging laser pulses until the desired target trace is found. (orig.)

  5. HOM frequency control of SRF cavity in high current ERLs

    Science.gov (United States)

    Xu, Chen; Ben-Zvi, Ilan

    2018-03-01

    The acceleration of high-current beam in Superconducting Radio Frequency (SRF) cavities is a challenging but essential for a variety of advanced accelerators. SRF cavities should be carefully designed to minimize the High Order Modes (HOM) power generated in the cavities by the beam current. The reduction of HOM power we demonstrate in a particular case can be quite large. This paper presents a method to systematically control the HOM resonance frequencies in the initial design phase to minimize the HOM power generation. This method is expected to be beneficial for the design of high SRF cavities addressing a variety of Energy Recovery Linac (ERL) applications.

  6. Solid state high power amplifier for driving the SLC injector klystron

    International Nuclear Information System (INIS)

    Judkins, J.G.; Clendenin, J.E.; Schwarz, H.D.

    1985-03-01

    The SLC injector klystron rf drive is now provided by a recently developed solid-state amplifier. The high gain of the amplifier permits the use of a fast low-power electronic phase shifter. Thus the SLC computer control system can be used to shift the phase of the high-power rf rapidly during the fill time of the injector accelerator section. These rapid phase shifts are used to introduce a phase-energy relationship in the accelerated electron pulse in conjunction with the operation of the injector bunch compressor. The amplifier, the method of controlling the rf phase, and the operational characteristics of the system are described. 5 refs., 4 figs

  7. Control of the current density profile with lower hybrid current drive on PBX-M

    International Nuclear Information System (INIS)

    Bell, R.E.; Bernabei, S.; Chu, T.K.; Gettelfinger, G.; Greenough, N.; Hatcher, R.; Ignat, D.; Jardin, S.; Kaita, R.; Kaye, S.; Kozub, T.; Kugel, H.; LeBlanc, B.; Okabayashi, M.; Paul, S.; Sauthoff, N.; Sesnic, S.; Sun, Y.; Takahashi, H.; Tighe, W.; Valeo, E.; von Goeler, S.; Jones, S.; Kesner, J.; Luckhardt, S.; Paoletti, F.; Levinton, F.; Timini, F.

    1993-07-01

    Lower hybrid current drive (LHCD) is being explored as a means to control the current density profile on PBX-M with the goal of raising the central safety factor q(O) to values of 1.5-2 to facilitate access to a full-volume second stable regime. Initial experiments have been conducted with up to 400 kW of 4.6 GHz LH power in circular and indented plasmas with modest parameters. A tangential-viewing two-dimensional hard x-ray imaging diagnostic has been used to observe the bremsstrahlung emission from the suprathermal electrons generated during LHCD. Hollow hard x-ray images have indicated off-axis localization of the driven current. A serious obstacle to the control of the current density profile with LHCD is the concomitant generation of MHD activity, which can seriously degrade the confinement of suprathermal electrons. By combining neutral beam injection with LHCD, an MHD-free condition has been obtained where q(O) is raised above 1

  8. Bunch lengthening in the SLC [Stanford Linear Collider] damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1990-02-01

    A high level of current dependent bunch lengthening has been observed on the North damping ring of the Stanford Linear Collider (SLC). At currents of 3 x 10 10 this behavior does not appear to degrade the machine's performance significantly. However, at the higher currents that are envisioned for the future one fears that its performance could be greatly degraded due to the phenomenon of bunch lengthening. This was the motivation for the work described in this paper. In this paper we calculate the longitudinal impedance of the damping ring vacuum chamber. More specifically, in this paper we find the response function of the ring to a short Gaussian bunch, which we call the Green function wake. In addition, we try to estimate the relative importance of the different vacuum chamber objects, in order to see how we might reduce the ring impedance. This paper also describes bunch length measurements performed on the North damping ring. We use the Green function wake, discussed above, to compute the bunch lengthening. Then we compare these results with those obtained from the measurements. In addition, we calculate the current dependence of the tune distribution

  9. Myoelectric hand prosthesis force control through servo motor current feedback.

    Science.gov (United States)

    Sono, Tálita Saemi Payossim; Menegaldo, Luciano Luporini

    2009-10-01

    This paper presents the prehension force closed-loop control design of a mechanical finger commanded by electromyographic signal (EMG) from a patient's arm. The control scheme was implemented and tested in a mechanical finger prototype with three degrees of freedom and one actuator, driven by arm muscles EMG of normal volunteers. Real-time indirect estimation of prehension force was assessed by measuring the DC servo motor actuator current. A model of the plant comprising finger, motor, and grasped object was proposed. Model parameters were identified experimentally and a classical feedback phase-lead compensator was designed. The controlled mechanical finger was able to provide a more accurate prehension force modulation of a compliant object when compared to open-loop control.

  10. Frequency-Controlled Current-Fed Resonant Converter with No Input Ripple Current

    Directory of Open Access Journals (Sweden)

    Bor-Ren Lin

    2018-02-01

    Full Text Available This paper studies a frequency-controlled current-fed resonant circuit. The adopted direct current (DC-to-DC converter contains two boost circuits and a resonant circuit on the primary side. First, two boost circuits are connected in parallel to achieve voltage step-up and reduce input ripple current by using interleaved pulse-width modulation. Therefore, the size and current rating of boost inductors are decreased in the proposed converter. Second, the boost voltage is connected to the resonant circuit to realize the mechanism of the zero-voltage switching of all active switches and zero-current switching of all diodes. Two boost circuits and a resonant circuit use the same power devices in order to lessen the switch counts. The voltage doubler topology is adopted on the secondary side (high-voltage side. Therefore, the voltage rating of diodes on the high-voltage side is clamped at output voltage. The feasibility of the studied circuit is confirmed by the experimental tests with a 1 kW prototype circuit.

  11. Electric Machine with Boosted Inductance to Stabilize Current Control

    Science.gov (United States)

    Abel, Steve

    2013-01-01

    High-powered motors typically have very low resistance and inductance (R and L) in their windings. This makes the pulse-width modulated (PWM) control of the current very difficult, especially when the bus voltage (V) is high. These R and L values are dictated by the motor size, torque (Kt), and back-emf (Kb) constants. These constants are in turn set by the voltage and the actuation torque-speed requirements. This problem is often addressed by placing inductive chokes within the controller. This approach is undesirable in that space is taken and heat is added to the controller. By keeping the same motor frame, reducing the wire size, and placing a correspondingly larger number of turns in each slot, the resistance, inductance, torque constant, and back-emf constant are all increased. The increased inductance aids the current control but ruins the Kt and Kb selections. If, however, a fraction of the turns is moved from their "correct slot" to an "incorrect slot," the increased R and L values are retained, but the Kt and Kb values are restored to the desired values. This approach assumes that increased resistance is acceptable to a degree. In effect, the heat allocated to the added inductance has been moved from the controller to the motor body, which in some cases is preferred.

  12. Stator Current Harmonic Control with Resonant Controller for Doubly Fed Induction Generator

    DEFF Research Database (Denmark)

    Liu, Changjin; Blaabjerg, Frede; Chen, Wenjie

    2012-01-01

    rotor current control loop for harmonic suppression. The overall control scheme is implemented in dq frame. Based on a mathematical model of the DFIG control system, the effects on system stability using the resonant controller, an analysis of the steady-state error, and the dynamic performance......, are discussed in this paper. Taking these effects into account, the parameters of the resonant controller can be designed and effectively damp the influence from the grid voltage harmonics. As a result, the impacts of the negative sequence fifth- and positive sequence seventh-order voltage harmonics...... harmonics, especially low-order harmonics. This paper proposes a stator current harmonic suppression method using a sixth-order resonant controller to eliminate negative sequence fifth- and positive sequence seventh-order current harmonics. A stator current harmonic control loop is added to the conventional...

  13. Operational experience with optical matching in the SLC Final Focus System

    International Nuclear Information System (INIS)

    Bambade, P.; Burchat, P.; Burke, D.

    1989-01-01

    In the SLC Final Focus System, all components of transverse phase-space and the couplings between them must be controlled to minimize the beam size at the interaction point. After summarizing the experimental algorithm and the on-line tuning programs, we present a consistent set of measurements and describe our present understanding of the various contributions to this beam size. 17 refs., 9 figs

  14. De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

    Science.gov (United States)

    Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

    2017-11-02

    Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  15. Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

    Science.gov (United States)

    Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

    2015-01-01

    Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

  16. Production and decay of Z bosons at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Feldman, G.J.

    1989-12-01

    My lectures at Cargese covered the very first physics results from the SLAC Linear Collider (SLC). At the time of this writing (December 1989), it seems most sensible to present a review of the results that were presented at the school in an updated form. The organization of this report will be to give a brief introduction to linear colliders and the SLC, then to describe the MARK II detector, and finally to review the current status of the three major physics topics discussed at Cargese: the Z line shape, from which we deduce the Z mass and width, and the number of neutrino species, the partonic structure of hadronic decays and a measurement of α s , and searches for new quarks and leptons. 39 refs., 27 figs., 3 tabs

  17. The calculated longitudinal impedance of the SLC [Stanford Linear Collider] damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1988-05-01

    A high level of current dependent bunch lengthening has been observed in the north damping ring of the Stanford Linear Collider (SLC), indicating that the ring's impedance is very inductive. This level of bunch lengthening will limit the performance of the SLC. In order to study the problem of bunch lengthening in the damping ring and the possibility of reducing their inductance we compute, in this report, the longitudinal impedance of the damping ring vacuum chamber. More specifically we find the response function of the ring to a short gaussian bunch. This function will later be used as a driving term in the longitudinal equation of motion. We also identify the important inductive elements of the vacuum chamber and estimate their contribution to the total ring inductance. This information will be useful in assessing the effect of vacuum chamber modifications. 7 refs. , 8 figs., 1 tab

  18. Cancer pain and current theory for pain control.

    Science.gov (United States)

    Kahan, Brian

    2014-05-01

    This article discusses current trends in managing cancer pain, with specific regard to opioid transmission, descending pathway inhabitation, and ways to facilitate the endogenous antinociceptive chemicals in the human body. Various techniques for opioid and nonopioid control of potential pain situations of patients with cancer are discussed. The benefits of using pharmacogenetics to assess the appropriate medications are addressed. Finally, specific treatment of abdominal cancer pain using radiofrequency lesioning is discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Controlling the emission current from a plasma cathode

    International Nuclear Information System (INIS)

    Bagaev, S.P.; Gushenets, V.I.; Schanin, P.M.

    1993-01-01

    The processes determining the time and amplitude characteristics of the grid-controlled electron emission from the plasma of an arc discharge have been analyzed. It has been shown that by applying to the grid confining the plasma emission boundary of a modulated voltage it is possible to form current pulse of up to 1 kA with nanosecond risetimes and falltimes and a pulse repetitive rate of 100 kHz

  20. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  1. Shear optimization experiments with current profile control on JET

    International Nuclear Information System (INIS)

    1997-01-01

    A record performance on JET has been obtained with shear optimization scenarios. A neutron yield of 5.6x10 16 s -1 in deuterium discharges, and a global energy confinement improvement above the ITER-89 L-mode scaling with H ≤ 2.5 in L-mode and H ≤ 3 in H-mode have been achieved. The tailoring of plasma current, density and heating power waveforms and current profile control with lower hybrid current drive and ICRF phasing have been essential. Internal energy, particle and momentum transport barriers develop spontaneously upon heating above a threshold power of about 15 MW with neutral beams and ICRH into a low-density target plasma, with a wide central region of slightly negative or flat magnetic shear with q > 1 everywhere. An additional H-mode transition can also raise the pressure in the region between internal and edge transport barriers. The ion heat conductivity falls to the neoclassical level in the improved core confinement region. Pressure profile control through power deposition feedback control makes it possible to work close to the marginal stability boundary for pressure-driven MHD modes. First experiments in deuterium/tritium plasmas, with up to 75% tritium target concentration, have established internal transport barriers already with heating powers at the lowest threshold of pure deuterium plasmas, resulting in a fusion power output of P fusion = 2 MW. (author)

  2. Current standards for infection control: audit assures compliance.

    Science.gov (United States)

    Flanagan, Pauline

    Having robust policies and procedures in place for infection control is fundamentally important. However, each organization has to go a step beyond this; evidence has to be provided that these policies and procedures are followed. As of 1 April 2009, with the introduction of the Care Quality Commission and The Health and Social Care Act 2008 Code of Practice for the NHS on the Prevention and Control of Healthcare-Associated Infections and Related Guidance, the assurance of robust infection control measures within any UK provider of health care became an even higher priority. Also, the commissioning of any service by the NHS must provide evidence that the provider has in place robust procedures for infection control. This article demonstrates how the clinical audit team at the Douglas Macmillan Hospice in North Staffordshire, UK, have used audit to assure high rates of compliance with the current national standards for infection control. Prior to the audit, hospice staff had assumed that the rates of compliance for infection control approached 100%. This article shows that a good quality audit tool can be used to identify areas of shortfall in infection control and the effectiveness of putting in place an action plan followed by re-audit.

  3. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  4. Recent luminosity improvements at the SLC

    International Nuclear Information System (INIS)

    Raimondi, P.; Usher, T.; Akre, R.

    1998-07-01

    The luminosity of the SLAC Linear Collider (SLC) has been increased by more than a factor of three during the 1997--98 run. Improved alignment and emittance tuning techniques throughout the accelerator resulted in minimal emittance growth from the damping rings to the final focus. In particular, a revised strategy for wakefield cancellation using precision beam size measurements at the entrance of the final focus proved effective for optimizing emittance. The final focus lattice was modified to provide stronger demagnification near the interaction point and to remove residual higher-order aberrations. Beam sizes as small as 1.5 by 0.65 microns were achieved at full beam intensity of 4 10 10 particles per pulse. With these parameters, the mutual focusing of the beams in collision becomes significant, resulting in a further increase in the luminosity. Recorded SLD event rates confirmed the theoretical calculations of the disruption enhancement which was typically 50 to 100%

  5. SLC status and SLAC future plans

    International Nuclear Information System (INIS)

    Richter, B.

    1990-01-01

    In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high-energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of higher-energy linear colliders. SLAC has a major colliding-beam storage-ring program as well, including present rings and design studies on future high luminosity projects, but time constraints preclude a discussion of them. (author) 8 figs., 3 tabs

  6. Dynamics and stabilization of peak current-mode controlled buck converter with constant current load

    Science.gov (United States)

    Leng, Min-Rui; Zhou, Guo-Hua; Zhang, Kai-Tun; Li, Zhen-Hua

    2015-10-01

    The discrete iterative map model of peak current-mode controlled buck converter with constant current load (CCL), containing the output voltage feedback and ramp compensation, is established in this paper. Based on this model the complex dynamics of this converter is investigated by analyzing bifurcation diagrams and the Lyapunov exponent spectrum. The effects of ramp compensation and output voltage feedback on the stability of the converter are investigated. Experimental results verify the simulation and theoretical analysis. The stability boundary and chaos boundary are obtained under the theoretical conditions of period-doubling bifurcation and border collision. It is found that there are four operation regions in the peak current-mode controlled buck converter with CCL due to period-doubling bifurcation and border-collision bifurcation. Research results indicate that ramp compensation can extend the stable operation range and transfer the operating mode, and output voltage feedback can eventually eliminate the coexisting fast-slow scale instability. Project supported by the National Natural Science Foundation of China (Grant No. 61371033), the Fok Ying-Tung Education Foundation for Young Teachers in the Higher Education Institutions of China (Grant No. 142027), the Sichuan Provincial Youth Science and Technology Fund, China (Grant Nos. 2014JQ0015 and 2013JQ0033), and the Fundamental Research Funds for the Central Universities, China (Grant No. SWJTU11CX029).

  7. Prevention and control of schistosomiasis: a current perspective

    Directory of Open Access Journals (Sweden)

    Inobaya MT

    2014-10-01

    Full Text Available Marianette T Inobaya,1 Remigio M Olveda,1 Thao NP Chau,3 David U Olveda,2 Allen GP Ross21Department of Health, Research Institute for Tropical Medicine, Muntinlupa City, Philippines; 2Griffith Health Institute, School of Medical Sciences, Gold Coast Campus, Griffith University, Southport, Australia; 3Discipline of Public Health, Flinders University, Adelaide, AustraliaAbstract: Schistosomiasis is a neglected tropical disease that ranks second only to malaria in terms of human suffering in the tropics and subtropics. Five species are known to infect man and there are currently over 240 million people infected worldwide. The cornerstone of control to date has been mass drug administration with 40 mg/kg of praziquantel but there are problems with this approach. Human and bovine vaccines are in various stages of development. Integrated control, targeting the life cycle, is the only approach that will lead to sustainability and future elimination.Keywords: schistosomiais, morbidity, treatment and control, mass drug administration

  8. Improved control strategy for PI-R current of DFIG considering voltage and current harmonics compensation

    Science.gov (United States)

    Song, S. Y.; Liu, Q. H.; Zhao, Y. N.; Liu, S. Y.

    2016-08-01

    With the rapid development of wind power generation, the related research of wind power control and integration issues has attracted much attention, and the focus of the research are shifting away from the ideal power grid environment to the actual power grid environment. As the main stream wind turbine generator, a doubly-fed induction generator (DFIG) is connected to the power grid directly by its stator, so it is particularly sensitive to the power grid. This paper studies the improvement of DFIG control technology in the power grid harmonic environment. Based on the DFIG dynamic model considering the power grid harmonic environment, this paper introduces the shortcomings of the common control strategy of DFIG, and puts forward the enhanced method. The decoupling control of the system is realized by compensating the coupling between the rotor harmonic voltage and harmonic current, improving the control performance. In addition, the simulation experiments on PSCAD/EMTDC are carried out to verify the correctness and effectiveness of the improved scheme.

  9. Current Approaches for Control Room I and C Modernization

    International Nuclear Information System (INIS)

    Lopez, Alberto; Jimenez, Alfonso

    2002-01-01

    In general, instrumentation and control (I and C) systems for nuclear power plants were made using analogic systems and relays, since this was the only technology available by the time these systems were designed. This fact impacts on the operational and maintenance capabilities required to these systems. For this reason, nuclear power plants are facing nowadays two challenges: on one hand, the obsolescence of these systems contributes to the increase in the operation and maintenance costs - due to the difficulties for getting spare parts and support from the system vendors -. On the other hand, there has been an increase in the utilities competitiveness due to the electric power market liberalization. All this, of course, along with the commitment to maintain the current safety levels and meet the new requirements and standards that may arise in the near future. The application of current technologies, especially digital technology, solves the obsolescence problems and allows for a more functional and updated human-machine interface. Nevertheless, the cost associated to these modifications makes it necessary to develop strategies to determine which systems need to be modified and how to implement modifications effectively, so that these systems can work jointly with others using different technologies. Other issues inherent to digital technology must be considered, such as verification and validation of the software and of the human-machine interface, which are required for its licensing. This presentation describes the current approaches for I and C modernization, the main reasons, technologies and implementation plans, focusing on the control room and on the impact on operations. The main issues to be considered for developing a specific modernization plan are analysed. The goals and status of the 'Feasibility Study of the Control Room I and C Modernization' are described. This study is currently being developed by Endesa, Iberdrola and Tecnatom, and is included

  10. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  11. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  12. Precision electronic speed controller for an alternating-current motor

    Science.gov (United States)

    Bolie, V.W.

    A high precision controller for an alternating-current multi-phase electrical motor that is subject to a large inertial load. The controller was developed for controlling, in a neutron chopper system, a heavy spinning rotor that must be rotated in phase-locked synchronism with a reference pulse train that is representative of an ac power supply signal having a meandering line frequency. The controller includes a shaft revolution sensor which provides a feedback pulse train representative of the actual speed of the motor. An internal digital timing signal generator provides a reference signal which is compared with the feedback signal in a computing unit to provide a motor control signal. The motor control signal is a weighted linear sum of a speed error voltage, a phase error voltage, and a drift error voltage, each of which is computed anew with each revolution of the motor shaft. The speed error signal is generated by a novel vernier-logic circuit which is drift-free and highly sensitive to small speed changes. The phase error is also computed by digital logic, with adjustable sensitivity around a 0 mid-scale value. The drift error signal, generated by long-term counting of the phase error, is used to compensate for any slow changes in the average friction drag on the motor. An auxillary drift-byte status sensor prevents any disruptive overflow or underflow of the drift-error counter. An adjustable clocked-delay unit is inserted between the controller and the source of the reference pulse train to permit phase alignment of the rotor to any desired offset angle. The stator windings of the motor are driven by two amplifiers which are provided with input signals having the proper quadrature relationship by an exciter unit consisting of a voltage controlled oscillator, a binary counter, a pair of read-only memories, and a pair of digital-to-analog converters.

  13. Current vector control challenges in the fight against malaria.

    Science.gov (United States)

    Benelli, Giovanni; Beier, John C

    2017-10-01

    The effective and eco-friendly control of Anopheles vectors plays a key role in any malaria management program. Integrated Vector Management (IVM) suggests making use of the full range of vector control tools available. The strategies for IVM require novel technologies to control outdoor transmission of malaria. Despite the wide number of promising control tools tested against mosquitoes, current strategies for malaria vector control used in most African countries are not sufficient to achieve successful malaria control. The majority of National Malaria Control Programs in Africa still rely on indoor residual spraying (IRS) and long-lasting insecticidal nets (LLINs). These methods reduce malaria incidence but generally have little impact on malaria prevalence. In addition to outdoor transmission, growing levels of insecticide resistance in targeted vectors threaten the efficacy of LLINs and IRS. Larvicidal treatments can be useful, but are not recommended for rural areas. The research needed to improve the quality and delivery of mosquito vector control should focus on (i) optimization of processes and methods for vector control delivery; (ii) monitoring of vector populations and biting activity with reliable techniques; (iii) the development of effective and eco-friendly tools to reduce the burden or locally eliminate malaria and other mosquito-borne diseases; (iv) the careful evaluation of field suitability and efficacy of new mosquito control tools to prove their epidemiological impact; (v) the continuous monitoring of environmental changes which potentially affect malaria vector populations; (vi) the cooperation among different disciplines, with main emphasis on parasitology, tropical medicine, ecology, entomology, and ecotoxicology. A better understanding of behavioral ecology of malaria vectors is required. Key ecological obstacles that limit the effectiveness of vector control include the variation in mosquito behavior, development of insecticide resistance

  14. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  15. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  16. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  17. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  18. Automatic control system for measuring currents produced by ionization chambers

    International Nuclear Information System (INIS)

    Brancaccio, Franco

    2002-01-01

    Ionization Chambers in current mode operation are usually used in Nuclear Metrology. Activity measurements are quickly performed by Ionization Chambers, with very good precision. For this purpose measurements of very low ionization currents, carried out by high quality instrumentation, are required. Usually, electrometers perform the current integration method under command of signals from an automation system, in order to reduce the measurement uncertainties. Among the measurement systems at the Laboratorio de Metrologia Nuclear (LMN) of IPEN, there are two ionization chamber systems. In the present work, an automation system developed for current integration measurements is described. This automation system is composed by software (graphic interface and control) and an electronic module connected to a microcomputer, by means of a commercial data acquisition card. Several test measurements were performed in order to determine the intrinsic uncertainty, linearity and stability of the system. Using calibrated radioactive solutions, the IG12/A20 chamber calibration factors for 18 F and 153 Sm were obtained, making possible to determine activities of these radionuclides. (author)

  19. A simplified controller and detailed dynamics of constant off-time peak current control

    Science.gov (United States)

    Van den Bossche, Alex; Dimitrova, Ekaterina; Valchev, Vencislav; Feradov, Firgan

    2017-09-01

    A fast and reliable current control is often the base of power electronic converters. The traditional constant frequency peak control is unstable above 50 % duty ratio. In contrast, the constant off-time peak current control (COTCC) is unconditionally stable and fast, so it is worth analyzing it. Another feature of the COTCC is that one can combine a current control together with a current protection. The time dynamics show a zero-transient response, even when the inductor changes in a wide range. It can also be modeled as a special transfer function for all frequencies. The article shows also that it can be implemented in a simple analog circuit using a wide temperature range IC, such as the LM2903, which is compatible with PV conversion and automotive temperature range. Experiments are done using a 3 kW step-up converter. A drawback is still that the principle does not easily fit in usual digital controllers up to now.

  20. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  1. Two coupled Josephson junctions: dc voltage controlled by biharmonic current

    International Nuclear Information System (INIS)

    Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J

    2012-01-01

    We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)

  2. Diagnostic development for current density profile control at KSTAR

    Energy Technology Data Exchange (ETDEWEB)

    Ko, J., E-mail: jinseok@nfri.re.kr [National Fusion Research Institute, Daejeon 34133 (Korea, Republic of); University of Science and Technology, Daejeon 34113 (Korea, Republic of); Chung, J. [National Fusion Research Institute, Daejeon 34133 (Korea, Republic of); Messmer, M.C.C. [Department of Applied Physics, Eindhoven University of Technology, Eindhoven (Netherlands)

    2016-11-01

    Highlights: • The motional Stark effect (MSE) diagnostic installed at KSTAR. • Engineering challenges and solutions on the design and fabrication of the front optics housing and filter modules. • Characterization of the bandpass filters and the responses to polarized light. - Abstract: The current density profile diagnostics are critical for the control of the steady-state burning plasma operations. A multi-channel motional Stark effect (MSE) diagnostic system has been implemented for the measurements of the internal magnetic field structures that constrain the magnetic equilibrium reconstruction to accurately produce the tokamak safety factor and current density profiles for the Korea Superconducting Tokamak Advanced Research (KSTAR). This work presents the design and fabrication of the front optics and the filter modules and the calibration activities for the MSE diagnostic at KSTAR.

  3. A Harmonic Current Suppression Control Strategy for Droop-Controlled Inverter Connected to the Distorted Grid

    DEFF Research Database (Denmark)

    Wei, Feng; Sun, Kai; Guan, Yajuan

    2015-01-01

    currents. Therefore, the reason of generation of distorted grid-feeding current of GF-VCI under the distorted grid voltage is investigated firstly in this paper. Then, a harmonic grid-feeding current suppression control strategy for GF-VCI is proposed. Two different filters are compared and analysed before...... voltage component at the point of common coupling. As a result, the difference of harmonic voltage between PCC and GF-VCI is reduced and the THDi of grid feeding-currents is decreased. Finally, the proposed control strategy is verified through simulations and experimental results....

  4. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  5. Hierarchical Controlled Grid-Connected Microgrid based on a Novel Autonomous Current Sharing Controller

    DEFF Research Database (Denmark)

    Guan, Yajuan; Quintero, Juan Carlos Vasquez; Guerrero, Josep M.

    2015-01-01

    In this paper, a hierarchical control system based on a novel autonomous current sharing controller for grid-connected microgrids (MGs) is presented. A three-level hierarchical control system is implemented to guarantee the power sharing performance among voltage controlled parallel inverters......, while providing the required active and reactive power to the utility grid. A communication link is used to transmit the control signal from the tertiary and secondary control levels to the primary control. Simulation results from a MG based on two grid-connected parallel inverters are shown in order...

  6. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  7. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. A Novel Sliding Mode Control Technique for Indirect Current Controlled Active Power Filter

    Directory of Open Access Journals (Sweden)

    Juntao Fei

    2012-01-01

    Full Text Available A novel sliding mode control (SMC method for indirect current controlled three-phase parallel active power filter is presented in this paper. There are two designed closed loops in the system: one is the DC voltage controlling loop and the other is the reference current tracking loop. The first loop with a PI regulator is used to control the DC voltage approximating to the given voltage of capacitor, and the output of PI regulator through a low-pass filter is applied as the input of the power supply reference currents. The second loop implements the tracking of the reference currents using integral sliding mode controller, which can improve the harmonic treating performance. Compared with the direct current control technique, it is convenient to be implemented with digital signal processing system because of simpler system structure and better harmonic treating property. Simulation results verify that the generated reference currents have the same amplitude with the load currents, demonstrating the superior harmonic compensating effects with the proposed shunt active power filter compared with the hysteresis method.

  9. High performance predictive current control of a three phase VSI: An ...

    Indian Academy of Sciences (India)

    ... current control of a three phase VSI: An experimental assessment ... Voltage source inverter; two level inverter; predictive current control; weighting factor ... Conventionally, for reference current tracking control in a two level VSI, the objective ...

  10. Architecture and control of a high current ion implanter system

    International Nuclear Information System (INIS)

    Bayer, E.H.; Paul, L.F.; Kranik, J.R.

    1979-01-01

    The design of an ion implant system for use in production requires that special attention be given to areas of design which normally are not emphasized on research or development type ion implanters. Manually operated, local controls are replaced by remote controls, automatic sequencing, and digital displays. For ease of maintenance and replication the individual components are designed as simply as possible and are contained in modules of separate identities, joined only by the beam line and electrical interconnections. A production environment also imposes requirements for the control of contamination and maintainability of clean room integrity. For that reason the major portion of the hardware is separated from the clean operator area and is housed in a maintenance core area. The controls of a production system should also be such that relatively unskilled technicians are able to operate the system with optimum repeatability and minimum operator intervention. An extensive interlock system is required. Most important, for use in production the ion implant system has to have a relatively high rate of throughput. Since the rate of throughput at a given dose is a function of beam current, pumpdown time and wafer handling capacity, design of components affecting these parameters has been optimized. Details of the system are given. (U.K.)

  11. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  12. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  13. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  14. Robust quasi NID current and flux control of an induction motor for position control

    NARCIS (Netherlands)

    van Duijnhoven, M.; Blachuta, M.J.

    1999-01-01

    In the paper, a new control design method called Dynamic Contraction method is applied to the flux and quadrature current robust control of an induction motor operated using the field orientation principle. The resulting input-output decoupled and linearized drive is then used for time-optimal

  15. Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Fei Liu

    Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

  16. Heavy quark production at SLC and LEP

    International Nuclear Information System (INIS)

    Hearty, C.

    1990-06-01

    Experiments at SLC and LEP have made preliminary measurements of the relative partial widths of the c and b quarks. Using D* tagging, DELPHI has found R c bar c triple-bond/Γ c bar c/Γ hadr. = 0.162 ± 0.032 ± 0.031, in good agreement with the Standard Model value of 0.171. ALEPH has used semileptonic decays of charm to obtain 0.148 ± 0.044 -0.038 +0.045 . Three experiments have used semileptonic Β decays to measurement R b bar b: R b bar b = 0.23 ± 0.10 (Mark II), 0.218 ± 0.010 ± 0.021 (L3), and 0.220 ± 0.016 ± 0.024 (ALEPH). All agree well with the expected value of 0.217. The uncertainty in branching ratios of c and b hadrons is the largest systematic error in all of the results. Future LEP measurements of the branching ratios may reduce the errors. R b bar b will also be measured with different, and possibly lower, systematic errors by Mark II using impact parameter tagging

  17. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  18. A Control Method of Current Type Matrix Converter for Plasma Control Coil Power Supply

    International Nuclear Information System (INIS)

    Shimada, K.; Matsukawa, M.; Kurihara, K.; Jun-ichi Itoh

    2006-01-01

    In exploration to a tokamak fusion reactor, the control of plasma instabilities of high β plasma such as neoclassical tearing mode (NTM), resistive wall mode (RWM) etc., is the key issue for steady-state sustainment. One of the proposed methods to avoid suppressing RWM is that AC current having a phase to work for reduction the RWM growth is generated in a coil (sector coil) equipped spirally on the plasma vacuum vessel. To stabilize RWM, precise and fast real-time feedback control of magnetic field with proper amplitude and frequency is necessary. This implies that an appropriate power supply dedicated for such an application is expected to be developed. A matrix converter as one of power supply candidates for this purpose could provide a solution The matrix converter, categorized in an AC/AC direct converter composed of nine bi-directional current switches, has a great feature that a large energy storage element is unnecessary in comparison with a standard existing AC/AC indirect converter, which is composed of an AC/DC converter and a DC/AC inverter. It is also advantageous in cost and size of its applications. Fortunately, a voltage type matrix converter has come to be available at the market recently, while a current type matrix converter, which is advantageous for fast control of the large-inductance coil current, has been unavailable. On the background above mentioned, we proposed a new current type matrix converter and its control method applicable to a power supply with fast response for suppressing plasma instabilities. Since this converter is required with high accuracy control, the gate control method is adopted to three-phase switching method using middle phase to reduce voltage and current waveforms distortion. The control system is composed of VME-bus board with DSP (Digital Signal Processor) and FPGA (Field Programmable Gate Array) for high speed calculation and control. This paper describes the control method of a current type matrix converter

  19. Current trends in small vocabulary speech recognition for equipment control

    Science.gov (United States)

    Doukas, Nikolaos; Bardis, Nikolaos G.

    2017-09-01

    Speech recognition systems allow human - machine communication to acquire an intuitive nature that approaches the simplicity of inter - human communication. Small vocabulary speech recognition is a subset of the overall speech recognition problem, where only a small number of words need to be recognized. Speaker independent small vocabulary recognition can find significant applications in field equipment used by military personnel. Such equipment may typically be controlled by a small number of commands that need to be given quickly and accurately, under conditions where delicate manual operations are difficult to achieve. This type of application could hence significantly benefit by the use of robust voice operated control components, as they would facilitate the interaction with their users and render it much more reliable in times of crisis. This paper presents current challenges involved in attaining efficient and robust small vocabulary speech recognition. These challenges concern feature selection, classification techniques, speaker diversity and noise effects. A state machine approach is presented that facilitates the voice guidance of different equipment in a variety of situations.

  20. Seizing Control: From Current Treatments to Optogenetic Interventions in Epilepsy.

    Science.gov (United States)

    Bui, Anh D; Alexander, Allyson; Soltesz, Ivan

    2015-12-23

    The unpredictability and severity of seizures contribute to the debilitating nature of epilepsy. These factors also render the condition particularly challenging to treat, as an ideal treatment would need to detect and halt the pathological bursts of hyperactivity without disrupting normal brain activity. Optogenetic techniques offer promising tools to study and perhaps eventually treat this episodic disorder by controlling specific brain circuits in epileptic animals with great temporal precision. Here, we briefly review the current treatment options for patients with epilepsy. We then describe the many ways optogenetics has allowed us to untangle the microcircuits involved in seizure activity, and how it has, in some cases, changed our perception of previous theories of seizure generation. Control of seizures with light is no longer a dream, and has been achieved in numerous different animal models of epilepsy. Beyond its application as a seizure suppressor, we highlight another facet of optogenetics in epilepsy, namely the ability to create "on-demand" seizures, as a tool to systematically probe the dynamics of networks during seizure initiation and propagation. Finally, we look into the future to discuss the possibilities and challenges of translating optogenetic techniques to clinical use. © The Author(s) 2015.

  1. Control systems for ITER diagnostics, heating and current drive

    Energy Technology Data Exchange (ETDEWEB)

    Simrock, Stefan, E-mail: stefan.simrock@iter.org

    2016-11-15

    The ITER Diagnostic, Heating and Current Drive systems might appear, on the face of it, to have very different control requirements. There are approximately 45 diagnostic systems, including magnetic sensors for plasma position and shape determination, imaging systems in the IR and visible, Thompson scattering for electron temperature and density, neutron detectors and collective scattering for alpha particle density and energy distribution. The H&CD systems encompass Electron Cyclotron Heating, using 24 1MW, 170 GHz gyrotrons and 5 steerable launchers to deliver 20 MW to the plasma, Ion Cyclotron Heating, using 8 3MW, 40–55 MHz sources and two multi-element launchers to deliver 20 MW to the plasma, and 2 Negative Ion Neutral Beam Injectors, each of which can deliver up to 16.5 MW of 1 MeV beams to the plasma. Although there are substantial differences in the needs for protection, when handling multi-MW heating systems, and in data throughput for many diagnostics, the formal processes needed to translate system requirements into Instrumentation and Control are identical. Due to the distributed procurement of ITER sub-systems and the need to integrate as painlessly as possible to CODAC, the formal processes, together with a substantial degree of standardization, are even more than usually essential. Starting from the technical, safety and protection, integration and operation requirements, a loop of functional analysis and signal listing is used to generate the controller configuration and the conceptual architecture. These elements in their turn lead to the physical and software design. The paper will describe the formal processes of control system design and the methods used by the ITER project to achieve the standardization of systems engineering practices. These have been applied to several use-cases covering all operation relevant phases such as plasma operation, maintenance, testing and conditioning. There are a number of running contracts that are developing

  2. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  3. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  4. Sialin (SLC17A5) functions as a nitrate transporter in the plasma membrane

    Science.gov (United States)

    Qin, Lizheng; Liu, Xibao; Sun, Qifei; Fan, Zhipeng; Xia, Dengsheng; Ding, Gang; Ong, Hwei Ling; Adams, David; Gahl, William A.; Zheng, Changyu; Qi, Senrong; Jin, Luyuan; Zhang, Chunmei; Gu, Liankun; He, Junqi; Deng, Dajun; Ambudkar, Indu S.; Wang, Songlin

    2012-01-01

    In vivo recycling of nitrate (NO3−) and nitrite (NO2−) is an important alternative pathway for the generation of nitric oxide (NO) and maintenance of systemic nitrate–nitrite–NO balance. More than 25% of the circulating NO3− is actively removed and secreted by salivary glands. Oral commensal bacteria convert salivary NO3− to NO2−, which enters circulation and leads to NO generation. The transporters for NO3− in salivary glands have not yet been identified. Here we report that sialin (SLC17A5), mutations in which cause Salla disease and infantile sialic acid storage disorder (ISSD), functions as an electrogenic 2NO3−/H+ cotransporter in the plasma membrane of salivary gland acinar cells. We have identified an extracellular pH-dependent anion current that is carried by NO3− or sialic acid (SA), but not by Br−, and is accompanied by intracellular acidification. Both responses were reduced by knockdown of sialin expression and increased by the plasma membrane-targeted sialin mutant (L22A-L23A). Fibroblasts from patients with ISSD displayed reduced SA- and NO3−-induced currents compared with healthy controls. Furthermore, expression of disease-associated sialin mutants in fibroblasts and salivary gland cells suppressed the H+-dependent NO3− conductance. Importantly, adenovirus-dependent expression of the sialinH183R mutant in vivo in pig salivary glands decreased NO3− secretion in saliva after intake of a NO3−-rich diet. Taken together, these data demonstrate that sialin mediates nitrate influx into salivary gland and other cell types. We suggest that the 2NO3−/H+ transport function of sialin in salivary glands can contribute significantly to clearance of serum nitrate, as well as nitrate recycling and physiological nitrite-NO homeostasis. PMID:22778404

  5. Linear quadratic Gaussian controller design for plasma current, position and shape control system in ITER

    International Nuclear Information System (INIS)

    Belyakov, V.; Kavin, A.; Rumyantsev, E.; Kharitonov, V.; Misenov, B.; Ovsyannikov, A.; Ovsyannikov, D.; Veremei, E.; Zhabko, A.; Mitrishkin, Y.

    1999-01-01

    This paper is focused on the linear quadratic Gaussian (LQG) controller synthesis methodology for the ITER plasma current, position and shape control system as well as power derivative management system. It has been shown that some poloidal field (PF) coils have less influence on reference plasma-wall gaps control during plasma disturbances and hence they have been used to reduce total control power derivative by means of the additional non-linear feedback. The design has been done on the basis of linear models. Simulation was provided for non-linear model and results are presented and discussed. (orig.)

  6. Balanced Current Control Strategy for Current Source Rectifier Stage of Indirect Matrix Converter under Unbalanced Grid Voltage Conditions

    Directory of Open Access Journals (Sweden)

    Yeongsu Bak

    2016-12-01

    Full Text Available This paper proposes a balanced current control strategy for the current source rectifier (CSR stage of an indirect matrix converter (IMC under unbalanced grid voltage conditions. If the three-phase grid connected to the voltage source inverter (VSI of the IMC has unbalanced voltage conditions, it affects the currents of the CSR stage and VSI stage, and the currents are distorted. Above all, the distorted currents of the CSR stage cause instability in the overall system, which can affect the life span of the system. Therefore, in this paper, a control strategy for balanced currents in the CSR stage is proposed. To achieve balanced currents in the CSR stage, the VSI stage should receive DC power without ripple components from the CSR stage. This is implemented by controlling the currents in the VSI stage. Therefore, the proposed control strategy decouples the positive and negative phase-sequence components existing in the unbalanced voltages and currents of the VSI stage. Using the proposed control strategy under unbalanced grid voltage conditions, the stability and life span of the overall system can be improved. The effectiveness of the proposed control strategy is verified by simulation and experimental results.

  7. Secondary vertex detection at the SLC

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The vertex topology of a high energy e + e - interaction contains a wealth of information. These interactions copiously produce the tau lepton and hadrons containing the c and b quarks; all these particles decay within a millimeter or so of the primary interaction point, giving these interactions a rich secondary vertex structure. With suitable detectors, one can hope to reconstruct these vertices and so tag events with tau's, c's and b's; measure lifetimes and mixing angles; and perhaps directly measure the flavor of c and b jets. The spatial resolution and track-pair resolution required of such detectors demand detector development, but several techniques, including solid state microstrip and CCD detectors, pressurized drift chambers, and holographic bubbble chambers look promising. Vertex detection in the colliding beam environment has already yielded a measurement of the tau lifetime. The SLC, with its micron-sized beam and one-centimeter sized beam pipe is uniquely suited for these studies. Compared to conventional storage rings, it offers a well-defined and minute primary interaction point, the possibility of locating a detector within a centimeter of the interaction (an order of magnitude improvement over LEP), negligibly thin beam pipes, and a repetition rate low enough to permit novel detectors and readout schemes. This report discusses the physics accessible with vertex detectors, depicts the physics environment at 100 GeV - particle multiplicities, momenta, angular correlations, and topologies of charm decays, sketches the elements of a vertex detector, and, through some model studies evaluates the spatial resolution and track-pair resolution requirements, and summarizes the detector technologies which seem most promising for vertex detection

  8. Cerebellar transcranial direct current stimulation improves adaptive postural control.

    Science.gov (United States)

    Poortvliet, Peter; Hsieh, Billie; Cresswell, Andrew; Au, Jacky; Meinzer, Marcus

    2018-01-01

    Rehabilitation interventions contribute to recovery of impaired postural control, but it remains a priority to optimize their effectiveness. A promising strategy may involve transcranial direct current stimulation (tDCS) of brain areas involved in fine-tuning of motor adaptation. This study explored the effects of cerebellar tDCS (ctDCS) on postural recovery from disturbance by Achilles tendon vibration. Twenty-eight healthy volunteers participated in this sham-ctDCS controlled study. Standing blindfolded on a force platform, four trials were completed: 60 s quiet standing followed by 20 min active (anodal-tDCS, 1 mA, 20 min, N = 14) or sham-ctDCS (40 s, N = 14) tDCS; three quiet standing trials with 15 s of Achilles tendon vibration and 25 s of postural recovery. Postural steadiness was quantified as displacement, standard deviation and path derived from the center of pressure (COP). Baseline demographics and quiet standing postural steadiness, and backwards displacement during vibration were comparable between groups. However, active-tDCS significantly improved postural steadiness during vibration and reduced forward displacement and variability in COP derivatives during recovery. We demonstrate that ctDCS results in short-term improvement of postural adaptation in healthy individuals. Future studies need to investigate if multisession ctDCS combined with training or rehabilitation interventions can induce prolonged improvement of postural balance. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

  9. Serotonin transporter gene (SLC6A4) polymorphism and susceptibility to a home-visiting maternal-infant attachment intervention delivered by community health workers in South Africa: Reanalysis of a randomized controlled trial.

    Science.gov (United States)

    Morgan, Barak; Kumsta, Robert; Fearon, Pasco; Moser, Dirk; Skeen, Sarah; Cooper, Peter; Murray, Lynne; Moran, Greg; Tomlinson, Mark

    2017-02-01

    raises questions about how policy-makers deal with the challenge of balancing equity (equal treatment for all) and efficacy (treating only those whose genes render them likely to benefit) when implementing psychosocial interventions. Current Controlled Trials ISRCTN25664149.

  10. Serotonin transporter gene (SLC6A4 polymorphism and susceptibility to a home-visiting maternal-infant attachment intervention delivered by community health workers in South Africa: Reanalysis of a randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Barak Morgan

    2017-02-01

    raises questions about how policy-makers deal with the challenge of balancing equity (equal treatment for all and efficacy (treating only those whose genes render them likely to benefit when implementing psychosocial interventions.Current Controlled Trials ISRCTN25664149.

  11. Current profile control experiments in EXTRAP T2R

    Science.gov (United States)

    Brunsell, P.; Cecconello, M.; Drake, J.; Franz, P.; Malmberg, J. A.; Marrelli, L.; Martin, P.; Spizzo, G.

    2002-11-01

    EXTRAP T2R is a high aspect ratio (R=1.24 m, a = 0.183 m) reversed-field pinch device, characterised by a double, thin shell system. The simultaneous presence of many m=1, |n| > 11 tearing modes is responsible for a magnetic field turbulence, which is believed to produce the rather high energy and particle transport that is observed in this type of magnetic configuration. In this paper first results from current profile control experiments (PPCD) in a thin shell device are shown. When an edge poloidal electric field is transiently applied, an increase of the electron temperature and of the electron density is seen, which is consistent with an increase of the thermal content of the plasma. At the same time, the soft x-ray emission, measured with a newly installed miniaturised camera, shows a peaking of the profile in the core. Furthermore, the amplitudes of the m=1 tearing modes are reduced and and the rotation velocities increase during PPCD, which is also consistent with a reduction of magnetic turbulence and a heating of the plasma

  12. Essay: Bob Siemann-SLC Days at SLAC

    International Nuclear Information System (INIS)

    Raubenheimer, Tor O.

    2008-01-01

    Bob Siemann was a great experimentalist and an excellent teacher.We will greatly miss him. Bob came to SLAC in early 1991 to work on the Stanford Linear Collider (SLC). The SLC was a challenging accelerator which began operating in the late 1980's but still had numerous obstacles to be overcome years into operation. One of the compounding difficulties was making reproducible measurements, since the stability of the collider was poor and the diagnostics were insufficient. Bob dove into this challenge and helped design experiments and diagnostics that provided further clarity. I first got to know Bob while I was still a graduate student, trying to finish my thesis and performing some experimental studies on the SLC, which, at the time, was proving to be very difficult. Most of my expertise had been in beam theory and simulation. Dealing with the real issues of the accelerator was challenging. Bob helped me understand the difference between systematic and statistical errors, and separate operational issues from the fundamental physics. His way of teaching was not to provide an explanation but to ask enough questions so that I could find the answer on my own - this was the best way to learn. I later asked Bob to be a reader on my thesis. As in all things, he took this role extremely seriously. He read through the draft and marked every page to the point where I was regretting my decision. However, his questions again helped me understand my own work better and greatly improved my thesis. Bob was also the de facto leader of an effort focused on the damping rings and the bunch compressors. He was great to work with. He made people think for themselves and refused to simply provide answers. He also worked hard himself, expressing real interest and curiosity. After the studies of the SLC damping rings identified a sawtooth instability due to the vacuum chamber impedance as a source of many downstream fluctuations, Bob took charge of upgrading the rings. As part of this

  13. Operation and performance of bunch pre-compression for increased transmission at the SLC

    International Nuclear Information System (INIS)

    Minty, M.G.; Akre, R.; Decker, F.J.; Turner, J.

    1997-11-01

    As the beam currents at the SLC are increased, transverse aperture restrictions in the ring-to-linac transport line (RTL) become increasingly important. The RTL contains a bunch compressor which introduces a large energy variation across the bunch and hence a larger transverse beam size. Since 1994 the compressor amplitude has been operating at higher than design voltage. While advantageous for shaping the bunch distribution, this increased the bunch energy spread and therefore resulted in more beam loss. Moreover, due to current-dependent bunch lengthening in the damping ring, the higher the beam current, the more the current loss. To avoid such losses, the bunch length may be precompressed in the damping ring. Until recently, bunch precompression with high beam currents was not stable. In this paper the authors identify the reasons for the difficulties, describe the changes made to accommodate bunch precompression, and discuss performance aspects after implementation. The estimated increase in current at the interaction point is 15%

  14. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    Science.gov (United States)

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  15. A Self-Oscillating Control Scheme for a Boost Converter Providing a Controlled Output Current

    DEFF Research Database (Denmark)

    Knott, Arnold; Pfaffinger, Gerhard R.; Andersen, Michael A. E.

    2011-01-01

    Most switched mode power supplies provide a regulated voltage at their output. However, there are applications requiring a controlled current. Among others are battery chargers, test equipment for converters driven by solar cells, and LED drivers. This paper describes a dc–dc power converter real...

  16. Mitigation of Grid Current Distortion for LCL-Filtered Voltage Source Inverter with Inverter Current Feedback Control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2018-01-01

    LCL filters feature low inductance; thus, the injected grid current from an LCL-filtered Voltage Source Inverter (VSI) can be easily distorted by grid voltage harmonics. This problem is especially tough for the control system with Inverter-side Current Feedback (ICF), since the grid current...... harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...

  17. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  18. Steam generator degradation: Current mitigation strategies for controlling corrosion

    International Nuclear Information System (INIS)

    Millett, P.

    1997-01-01

    Steam Generator degradation has caused substantial losses of power generation, resulted in large repair and maintenance costs, and contributed to significant personnel radiation exposures in Pressurized Water Reactors (PWRs) operating throughout the world. EPRI has just published the revised Steam Generator Reference Book, which reviews all of the major forms of SG degradation. This paper discusses the types of SG degradation that have been experienced with emphasis on the mitigation strategies that have been developed and implemented in the field. SG degradation is presented from a world wide perspective as all countries operating PWRs have been effected to one degree or another. The paper is written from a US. perspective where the utility industry is currently undergoing tremendous change as a result of deregulation of the electricity marketplace. Competitive pressures are causing utilities to strive to reduce Operations and Maintenance (O ampersand M) and capital costs. SG corrosion is a major contributor to the O ampersand M costs of PWR plants, and therefore US utilities are evaluating and implementing the most cost effective solutions to their corrosion problems. Mitigation strategies developed over the past few years reflect a trend towards plant specific solutions to SG corrosion problems. Since SG degradation is in most cases an economic problem and not a safety problem, utilities can focus their mitigation strategies on their unique financial situation. Accordingly, the focus of R ampersand D has shifted from the development of more expensive, prescriptive solutions (e.g. reduced impurity limits) to corrosion problems to providing the utilities with a number of cost effective mitigation options (e.g. molar ratio control, boric acid treatment)

  19. Cross Voltage Control with Inner Hysteresis Current Control for Multi-output Boost Converter

    DEFF Research Database (Denmark)

    Nami, Alireza; Zare, Firuz; Blaabjerg, Frede

    2009-01-01

    Multi-output boost (MOB) converter is a novel DC-DC converter unlike the regular boost converter, has the ability to share its total output voltage and to have different series output voltage from a given duty cycle for low and high power applications. In this paper, discrete voltage control...... with inner hysteresis current control loop has been proposed to keep the simplicity of the control law for the double-output MOB converter, which can be implemented by a combination of analogue and logical ICs or simple microcontroller to constrain the output voltages of MOB converter at their reference...... voltages against variation in load or input voltage. The salient features of the proposed control strategy are simplicity of implementation and ease to extend to multiple outputs in the MOB converter. Simulation and experimental results are presented to show the validity of control strategy....

  20. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  1. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  2. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  3. A Short-Current Control Method for Constant Frequency Current-Fed Wireless Power Transfer Systems

    Directory of Open Access Journals (Sweden)

    Yanling Li

    2017-04-01

    Full Text Available Frequency drift is a serious problem in Current-Fed Wireless Power Transfer (WPT systems. When the operating frequency is drifting from the inherent Zero Voltage Switching (ZVS frequency of resonant network, large short currents will appear and damage the switches. In this paper, an inductance-dampening method is proposed to inhibit short currents and achieve constant-frequency operation. By adding a small auxiliary series inductance in the primary resonant network, short currents are greatly attenuated to a safe level. The operation principle and steady-state analysis of the system are provided. An overlapping time self-regulating circuit is designed to guarantee ZVS running. The range of auxiliary inductances is discussed and its critical value is calculated exactly. The design methodology is described and a design example is presented. Finally, a prototype is built and the experimental results verify the proposed method.

  4. Improving the phase stability of the SLAC rf driveline network for SLC operation

    International Nuclear Information System (INIS)

    Weaver, J.N.; Hogg, H.A.

    1983-01-01

    Successful operation of the Stanford Linear Collider (SLC) will require greater phase stability from the two-mile long rf drive network than previous linac operation did. This paper discusses four proposed modifications of the present system that should help achieve the general objective to reduce all long term temperature and atmospheric pressure induced phase variations to less than 20 0 at 2856 MHz, so that the phase/amplitude detector subsystems, which will control the network output phases relative to a beam reference, will operate within their most accurate ranges

  5. Generation and acceleration of high intensity beams in the SLC injector

    International Nuclear Information System (INIS)

    Ross, M.C.; Browne, M.J.; Clendenin, J.E.; Jobe, R.K.; Seeman, J.T.; Sheppard, J.C.; Stiening, R.F.

    1985-04-01

    A new gun pulser and substantially increased focusing have been added to the first 100 m of the SLAC linac in order to provide a pair of intense electron bunches to the SLC damping ring. Each bunch from this injector must have 5 x 10 10 electrons, an invariant emittance γepsilon less than or equal to 1.8 x 10 -3 m-rad and the pair must have an energy spread of less than 2%. Wakefield instabilities present in earlier versions of this injector have been controlled by reducing the transverse beam dimension by a factor of 3

  6. Automatic analysis of signals during Eddy currents controls

    International Nuclear Information System (INIS)

    Chiron, D.

    1983-06-01

    A method and the corresponding instrument have been developed for automatic analysis of Eddy currents testing signals. This apparatus enables at the same time the analysis, every 2 milliseconds, of two signals at two different frequencies. It can be used either on line with an Eddy Current testing instrument or with a magnetic tape recorder [fr

  7. Measurements of longitudinal phase space in the SLC linac

    International Nuclear Information System (INIS)

    Bane, K.; Adolphsen, C.; Lavine, T.L.; Ross, M.; Seeman, J.; Thompson, K.

    1990-05-01

    In the Stanford Linear Collider the beam leaves a damping ring and then enters the Ring-to-Linac (RTL) transfer line. In the RTL it is compressed in length by a factor of 10 by means of an rf section, with which a longitudinally correlated energy variation is induced in the beam, and a following beam line which has non-zero momentum compaction. The compressed beam then enters the linac proper. In this paper we describe three measurements of longitudinal properties of the beam in the SLC linac. We present measurements of single bunch beam loading, of the energy spectrum at the end of the linac, and of the linac bunch length. Since the results of all three measurements depend on the beam's longitudinal charge distribution in the linac they, in turn, also depend on the bunch lengthening that occurs in the damping rings, as well as on the behavior of the compressor. The results of the first two measurements, in addition, depend critically on the strength of the longitudinal wakefields in the linac. The results of these three measurements are compared with simulations. For these calculations, at any given current, the potential well distortion in the damping ring is first computed. The compression process is then simulated to obtain the longitudinal charge distribution in the linac. For the first two measurements this distribution is then convolved with the calculated longitudinal wake function of the SLAC linac in order to obtain the induced voltage. Finally, the induced voltage is combined with the effect of the linac rf wave to give the final energy spectrum. 8 refs., 5 figs

  8. A Comparative Study of Voltage, Peak Current and Dual Current Mode Control Methods for Noninverting Buck-Boost Converter

    Directory of Open Access Journals (Sweden)

    M. Č. Bošković

    2016-06-01

    Full Text Available This paper presents a comparison of voltage mode control (VMC and two current mode control (CMC methods of noninverting buck-boost converter. The converter control-to-output transfer function, line-to-output transfer function and the output impedance are obtained for all methods by averaging converter equations over one switching period and applying small-signal linearization. The obtained results are required for the design procedure of feedback compensator to keep a system stable and robust. A comparative study of VMC, peak current mode control (PCMC and dual-current mode control (DCMC is performed. Performance evaluation of the closed-loop system with obtained compensator between these methods is performed via numerical simulations.

  9. A Modified Droop Control Method for Parallel-Connected Current Source Inverters

    DEFF Research Database (Denmark)

    Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2016-01-01

    In this paper, a novel control method was proposed for current source inverters under the grid-connected working mode. The control scheme is based on a modified droop control method, with an additional current reference signal that will be generated instead of the voltage reference. Hence......, there is only a current control loop with droop control in the whole control scheme without voltage control loop. So it is very suitable for grid-connected current source inverter which will simplify the design of the control scheme and combine the advantage of droop control. The parallel configuration...... is widely used to acquire high power demand, but the circulating current problem is a key issue that should be considered. In this paper, a simulation based on parallel current source inverters using the proposed control scheme is provided. Simulation results showed that a good circulating current...

  10. Fragmented Canopies Control the Regimes of Gravity Current Development

    Science.gov (United States)

    Barcelona, Aina; Serra, Teresa; Colomer, Jordi

    2018-03-01

    Coastal ecosystems (marine littoral regions, wetlands, and deltas) are regions of high biological productivity. However, they are also one of the world's most threatened ecosystems. Wetlands are characterized by aquatic vegetation adapted to high salinity levels and climatic variations. Wetland canopies buffer these hydrodynamic and atmospheric variations and help retain sediment by reducing current velocity during sea storms or runoff after periods of rain. This work focuses on the effect of the presence of a gap (i.e., nonvegetated zone) parallel to the direction of the main current has on the sedimentation and hydrodynamics of a gravity current. The study aims to (1) address the behavior of a gravity current in a vegetated region compared to one without vegetation (i.e., the gap), (2) determine the effect gap size has on how a gravity current evolves, and 3) determine the effect gap sizes have on the sedimentary rates from a gravity current. Laboratory experiments were carried out in a flume using four different sediment concentrations, four different canopy densities (884, 354, 177, and 0 plants·m-2) and three different gap widths (H/2, H, and 1.5H, where H is the height of the water). This work shows that a gravity current's evolution and its sedimentary rates depend on the fractional volume occupied by the vegetation. While current dynamics in experiments with wider gaps are similar to the nonvegetated case, for smaller gaps the dynamics are closer to the fully vegetated case. Nonetheless, the gravity current exhibits the same behavior in both the vegetated region and the gap.

  11. Dead Zone Oscillator Control for Communication-Free Synchronization of Paralleled, Three-Phase, Current-Controlled Inverters

    Science.gov (United States)

    2016-05-11

    Current-Controlled Inverters by Midshipman 1/C Spencer C. Shabshab, USN UNITED STATES NAVAL ACADEMY...Three-Phase, Current-Controlled Inverters by Midshipman 1/C Spencer C. Shabshab United States Naval Academy Annapolis, Maryland...for Communication-Free Synchronization of Paralleled, 5a. CONTRACT NUMBER Three-Phase, Current-Controlled Inverters 5b. GRANT NUMBER 5c

  12. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  13. Optimized design of resonant controller for stator current harmonic compensation in DFIG wind turbine systems

    DEFF Research Database (Denmark)

    Liu, Changjin; Chen, Wenjie; Blaabjerg, Frede

    2012-01-01

    This paper presents an analytical method to optimize the parameters of resonant controller which is used in a Doubly-Fed Induction Generator (DFIG). In the DFIG control system, the fundamental current loop is controlled by PI-controllers, and the stator harmonic current loop is controlled...

  14. Review of lattice measurement techniques at the SLC

    International Nuclear Information System (INIS)

    Barklow, T.; Emma, P.; Krejcik, P.; Walker, N.

    1991-11-01

    A technique is described for reconstructing the first order transport matrix (R) for a given beam line. Emphasis is placed on the rigorous error analysis of the data, and the use of powerful statistical techniques to estimate unknown systematic errors. The application of the technique to the measurement and subsequent correction of the SLC Arcs is briefly described. 5 refs., 4 figs

  15. Micromagnetic analysis of geometrically controlled current-driven magnetization switching

    Directory of Open Access Journals (Sweden)

    O. Alejos

    2017-05-01

    Full Text Available The magnetization dynamics induced by current pulses in a pair of two “S-shaped” ferromagnetic elements, each one consisting on two oppositely tilted tapered spikes at the ends of a straight section, is theoretically studied by means of micromagnetic simulations. Our results indicate that the magnetization reversal is triggered by thermal activation, which assists the current-induced domain nucleation and the propagation of domain walls. The detailed analysis of the magnetization dynamics reveals that the magnetization switching is only achieved when a single domain wall is nucleated in the correct corner of the element. In agreement with recent experimental studies, the switching is purely dictated by the shape, being independent of the current polarity. The statistical study points out that successful switching is only achieved within a narrow range of the current pulse amplitudes.

  16. ICRF current drive by using antenna phase control

    International Nuclear Information System (INIS)

    Kishimoto, Y.; Itoh, K.

    1987-01-01

    A global analysis of current drive in tokamaks by using waves in the ion cyclotron range of frequencies (ICRF), considering the entire antenna-plasma system, is presented. A phase shifted antenna array is used to inject toroidal momentum into the electrons. Within the context of quasi-linear theory, a Fokker-Planck calculation is combined with an ICRF wave propagation-absorption analysis which includes kinetic effects and realistic boundary conditions. The radial profile of the current induced by the mode converted ion Bernstein wave and by the magnetosonic fast wave is obtained, together with the global current drive efficiency (total induced current/total emitted power from the antennas) in the high density and temperature plasma regime. The phase dependence of the global efficiency is investigated by changing the launching conditions such as the total antenna number and the antenna spacing. In medium size tokamaks, the electron power absorption and the associated driven current are found to be affected considerably by the plasma cavity resonance. It is also found that the global efficiency is sensitive to the antenna spacing. When the antenna spacing is increased, the global efficiency is reduced by counter current generation. (author)

  17. Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

    Science.gov (United States)

    Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

    2017-09-01

    Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

  18. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  19. Off-axis current drive and real-time control of current profile in JT-60U

    International Nuclear Information System (INIS)

    Suzuki, T.; Ide, S.; Oikawa, T.; Fujita, T.; Ishikawa, M.; Seki, M.; Matsunaga, G.; Hatae, T.; Naito, O.; Hamamatsu, K.; Sueoka, M.; Hosoyama, H.; Nakazato, M.

    2008-01-01

    Aiming at optimization of current profile in high-β plasmas for higher confinement and stability, a real-time control system of the minimum of the safety factor (q min ) using the off-axis current drive has been developed. The off-axis current drive can raise the safety factor in the centre and help to avoid instability that limits the performance of the plasma. The system controls the injection power of lower-hybrid waves, and hence its off-axis driven current in order to control q min . The real-time control of q min is demonstrated in a high-β plasma, where q min follows the temporally changing reference q min,ref from 1.3 to 1.7. Applying the control to another high-β discharge (β N = 1.7, β p = 1.5) with m/n = 2/1 neo-classical tearing mode (NTM), q min was raised above 2 and the NTM was suppressed. The stored energy increased by 16% with the NTM suppressed, since the resonant rational surface was eliminated. For the future use for current profile control, current density profile for off-axis neutral beam current drive (NBCD) is for the first time measured, using the motional Stark effect diagnostic. Spatially localized NBCD profile was clearly observed at the normalized minor radius ρ of about 0.6-0.8. The location was also confirmed by multi-chordal neutron emission profile measurement. The total amount of the measured beam driven current was consistent with the theoretical calculation using the ACCOME code. The CD location in the calculation was inward shifted than the measurement

  20. Management and employee control in current industrial work

    DEFF Research Database (Denmark)

    Holt, Helle; Hvid, Helge

    2014-01-01

    This article examines how employee control is affected by the ongoing erosion of boundaries in work organization and established boundaries in the relationship between employees and management. One assumption is that the erosion of boundaries offers potential for increased employee control, meaning...... increased autonomy or self-determination at work (employee control how and when to do what). This assumption is supported by theories on the psychosocial working environment. Another assumption is that the erosion of boundaries threatens the frontiers from where employees can defend their interests......, and consequently reduces employees’ control of their work (what and how much to do). This assumption is supported by “labor process theory.” This article studies control and the erosion of boundaries in two case factories in the food industry. Two perspectives are applied: the psychosocial working environment...

  1. Management and employee control in current industrial work

    DEFF Research Database (Denmark)

    Holt, Helle; Hvid, Helge

    2014-01-01

    , and consequently reduces employees’ control of their work (what and how much to do). This assumption is supported by “labor process theory.” This article studies control and the erosion of boundaries in two case factories in the food industry. Two perspectives are applied: the psychosocial working environment......This article examines how employee control is affected by the ongoing erosion of boundaries in work organization and established boundaries in the relationship between employees and management. One assumption is that the erosion of boundaries offers potential for increased employee control, meaning...... increased autonomy or self-determination at work (employee control how and when to do what). This assumption is supported by theories on the psychosocial working environment. Another assumption is that the erosion of boundaries threatens the frontiers from where employees can defend their interests...

  2. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  3. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  4. Pulse current gas metal arc welding characteristics, control and applications

    CERN Document Server

    Ghosh, Prakriti Kumar

    2017-01-01

    This monograph is a first-of-its-kind compilation on high deposition pulse current GMAW process. The nine chapters of this monograph may serve as a comprehensive knowledge tool to use advanced welding engineering in prospective applications. The contents of this book will prove useful to the shop floor welding engineer in handling this otherwise critical welding process with confidence. It will also serve to inspire researchers to think critically on more versatile applications of the unique nature of pulse current in GMAW process to develop cutting edge welding technology.

  5. Current status of fertility control methods in India

    Indian Academy of Sciences (India)

    Use of the condom increased to 3.1% from 2.4%. ... Current efforts in India to develop a male contraceptive are mainly directed towards ... the existing range of contraceptive methods available in the National Family Planning Programme. ... long acting, relatively easily removed and fertility returns rapidly after their removal.

  6. Current drive and profile control in low aspect ratio tokamaks

    International Nuclear Information System (INIS)

    Chan, V.S.; Chiu, S.C.; Lin-Liu, Y.R.; Miller, R.L.; Turnbull, A.D.

    1995-07-01

    The key to the theoretically predicted high performance of a low aspect ratio tokamak (LAT) is its ability to operate at very large plasma current*I p . The plasma current at low aspect ratios follows the approximate formula: I p ∼ (5a 2 B t /Rqψ) [(1 + κ 2 )/2] [A/(A - 1)] where A quadruple-bond R/a which was derived from equilibrium studies. For constant qψ and B t , I p can increase by an order of magnitude over the case of tokamaks with A approx-gt 2.5. The large current results in a significantly enhanced β t (quadruple-bond β N I p /aB t ) possibly of order unity. It also compensates for the reduction in A to maintain the same confinement performance assuming the confinement time τ follows the generic form ∼ HI p P -1 / 2 R 3 / 2 κ 1 / 2 . The initiation and maintenance of such a large current is therefore a key issue for LATs

  7. DSP based adaptive hysteresis-band current controlled active filter ...

    African Journals Online (AJOL)

    The use of non-linear loads critically affects the quality of supply by drawing harmonic currents and reactive power from the electrical distribution system. Active power filters are the most viable solution for solving such power quality problems in compliance with the harmonic standards. This article presents a digital signal ...

  8. A differential-delay control for ramped magnet current

    Energy Technology Data Exchange (ETDEWEB)

    Murray, J. [State Univ. of New York, Stony Brook, NY (United States). Dept. of Electrical Engineering; Olsen, R. [Brookhaven National Lab., Upton, NY (United States)

    1992-11-01

    A differential-delay control system has been designed and implemented for the main dipole magnet power supply of the booster ring at the National Synchrotron Light Source at Brookhaven National Lab. The control algorithm was implemented on a floating-point digital signal processor; in tests, the use of digital signal-processing techniques gave a factor of ten improvement in the tracking response time, together with a modest improvement in tracking accuracy.

  9. A differential-delay control for ramped magnet current

    Energy Technology Data Exchange (ETDEWEB)

    Murray, J. (State Univ. of New York, Stony Brook, NY (United States). Dept. of Electrical Engineering); Olsen, R. (Brookhaven National Lab., Upton, NY (United States))

    1992-01-01

    A differential-delay control system has been designed and implemented for the main dipole magnet power supply of the booster ring at the National Synchrotron Light Source at Brookhaven National Lab. The control algorithm was implemented on a floating-point digital signal processor; in tests, the use of digital signal-processing techniques gave a factor of ten improvement in the tracking response time, together with a modest improvement in tracking accuracy.

  10. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  11. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

    Directory of Open Access Journals (Sweden)

    Maider Ibarrola-Villava

    Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

  13. Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

    Science.gov (United States)

    Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

    2016-08-01

    The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

  14. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  15. Controlled parity switch of persistent currents in quantum ladders

    Science.gov (United States)

    Filippone, Michele; Bardyn, Charles-Edouard; Giamarchi, Thierry

    2018-05-01

    We investigate the behavior of persistent currents for a fixed number of noninteracting fermions in a periodic quantum ladder threaded by Aharonov-Bohm and transverse magnetic fluxes Φ and χ . We show that the coupling between ladder legs provides a way to effectively change the ground-state fermion-number parity, by varying χ . Specifically, we demonstrate that varying χ by 2 π (one flux quantum) leads to an apparent fermion-number parity switch. We find that persistent currents exhibit a robust 4 π periodicity as a function of χ , despite the fact that χ →χ +2 π leads to modifications of order 1 /N of the energy spectrum, where N is the number of sites in each ladder leg. We show that these parity-switch and 4 π periodicity effects are robust with respect to temperature and disorder, and outline potential physical realizations using cold atomic gases and photonic lattices, for bosonic analogs of the effects.

  16. Design and Implementation of Digital Current Mode Controller for DC-DC Converters

    DEFF Research Database (Denmark)

    Taeed, Fazel

    to be regulated by a closed-loop controller. The Peak Current Mode Control (PCMC) is one of the most promising control methods for dc-dc converters. It has been known for high bandwidth (speed), and inherent current protection. Increasing the controller bandwidth decreases the output filter size and cost. Analog...

  17. The TS 600: automatic control system for eddy currents

    International Nuclear Information System (INIS)

    Poulet, J.P.

    1986-10-01

    In the scope of fabrication and in service inspection of the PWR steam generator tubing bendle, FRAMATOME developed an automatic Eddy Current testing system: TS600. Based on a mini-computer, TS600 allows to digitize, to store and to process data in various ways, so it is possible to perform several kinds of inspection: conventional inservice inspection, roll area profilometry...... TS600 can also be used to develop new methods of examination [fr

  18. Field-controlled spin current in frustrated spin chains

    Directory of Open Access Journals (Sweden)

    A.K. Kolezhuk

    2009-01-01

    Full Text Available We study states with spontaneous spin current, emerging in frustrated antiferromagnetic spin-S chains subject to a strong external magnetic field. As a numerical tool, we use a non-Abelian symmetry realization of the density matrix renormalization group. The field dependence of the order parameter and the critical exponents are presented for zigzag chains with S=1/2, 1, 3/2, and 2.

  19. Electric field control photo-induced Hall currents in semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

    2008-10-15

    We generate spin-polarized carrier populations in GaAs and low temperature-grown GaAs (LT-GaAs) by circularly polarized optical beams and pull them by external electric fields to create spin-polarized currents. In the presence of the optically generated spin currents, anomalous Hall currents with an enhancement with increasing doping are observed and found to be almost steady in moderate electric fields up to {approx}120 mV {mu}m{sup -1}, indicating that photo-induced spin orientation of electrons is preserved in these systems. However, a field {approx}300 mV {mu}m{sup -1} completely destroys the electron spin polarization due to an increase of the D'yakonov-Perel' spin precession frequency of the hot electrons. This suggests that high field carrier transport conditions might not be suitable for spin-based technology with GaAs and LT-GaAs. It is also demonstrated that the presence of the excess arsenic sites in LT-GaAs might not affect the spin relaxation by Bir-Aronov-Pikus mechanism owing to a large number of electrons in n-doped materials.

  20. Improved adaptive input voltage control of a solar array interfacing current mode controlled boost power stage

    International Nuclear Information System (INIS)

    Sitbon, Moshe; Schacham, Shmuel; Suntio, Teuvo; Kuperman, Alon

    2015-01-01

    Highlights: • Photovoltaic generator dynamic resistance online estimation method is proposed. • Control method allowing to achieve nominal performance at all time is presented. • The method is suitable for any type of photovoltaic system. - Abstract: Nonlinear characteristics of photovoltaic generators were recently shown to significantly influence the dynamics of interfacing power stages. Moreover, since the dynamic resistance of photovoltaic generators is both operating point and environmental variables dependent, the combined dynamics exhibits these dependencies as well, burdening control challenge. Typically, linear time invariant input voltage loop controllers (e.g. Proportional-Integrative-Derivative) are utilized in photovoltaic applications, designed according to nominal operating conditions. Nevertheless, since actual dynamics is seldom nominal, closed loop performance of such systems varies as well. In this paper, adaptive control method is proposed, allowing to estimate photovoltaic generator resistance online and utilize it to modify the controller parameters such that closed loop performance remains nominal throughout the whole operation range. Unlike previously proposed method, utilizing double-grid-frequency component for estimation purposes and suffering from various drawbacks such as operation point dependence and applicability to single-phase grid connected systems only, the proposed method is based on harmonic current injection and is independent on operating point and system topology

  1. Design studies on high current and grid control electron gun

    International Nuclear Information System (INIS)

    Wang Jinnan; Lu Kun; Chi Yunlong; Zhou Zusheng

    2011-01-01

    Electron gun, the source of electrons, is a kind of ultrahigh vacuum device and plays an important role in different kind of accelerators. With the irradiation accelerator demands, describes the design studies on beam optics optimization. The simulation result shows that the beam current is above 5 A with cathode voltage of 80 kV and beam emittance, gun electric field and beam waist radius meet the accelerator needs. The electron gun manufactured and installed in the test stand, the conditioning and test will be done in the near future. (authors)

  2. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Ring Current He Ion Control by Bounce Resonant ULF Waves

    Science.gov (United States)

    Kim, Hyomin; Gerrard, Andrew J.; Lanzerotti, Louis J.; Soto-Chavez, Rualdo; Cohen, Ross J.; Manweiler, Jerry W.

    2017-12-01

    Ring current energy He ion (˜65 keV to ˜520 keV) differential flux data from the Radiation Belt Storm Probe Ion Composition Experiment (RBSPICE) instrument aboard the Van Allan Probes spacecraft show considerable variability during quiet solar wind and geomagnetic time periods. Such variability is apparent from orbit to orbit (˜9 h) of the spacecraft and is observed to be ˜50-100% of the nominal flux. Using data from the Electric and Magnetic Field Instrument Suite and Integrated Science (EMFISIS) instrument, also aboard the Van Allen Probes spacecraft, we identify that a dominant source of this variability is from ULF waveforms with periods of tens of seconds. These periods correspond to the bounce resonant timescales of the ring current He ions being measured by RBSPICE. A statistical survey using the particle and field data for one full spacecraft precession period (approximately 2 years) shows that the wave and He ion flux variations are generally anticorrelated, suggesting the bounce resonant pitch angle scattering process as a major component in the scattering of He ions.

  4. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  5. Current status of patient-controlled analgesia in cancer patients.

    Science.gov (United States)

    Ripamonti, C; Bruera, E

    1997-03-01

    Patient-controlled analgesia (PCA) is a relatively new technique in which patients are able to self-administer small doses of opioid analgesics when needed. Many different devices are available for opioid infusion, including a syringe pump, disposable plastic cylinder, and battery-operated computer-driven pump. These devices allow patients to choose an intermittent (demand) bolus, continuous infusion, or both modes of administration. Parameters, such as route, drug concentration dose, frequency, and maximum daily or hourly dose, are programmed by the physician. The patient decides whether or not to take a dose. Devices can be used to deliver the drug into a running intravenous infusion, the epidural space, or subcutaneously. Controlled trials indicate that PCA is probably superior to regular opioid administration in postoperative pain. Reported advantages include greater patient satisfaction, decreased sedation and anxiety, and reduced nursing time and hospitalization. Preliminary experience suggests that PCA is also useful and safe for cancer pain, but further research is greatly needed.

  6. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  7. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  8. Harmonic current control for LCL-filtered VSCs connected to ultra-weak grids

    DEFF Research Database (Denmark)

    Wang, Xiongfei; Yang, Dongsheng; Blaabjerg, Frede

    2017-01-01

    This paper addresses the harmonic current control for LCL-filtered Voltage-Source Converters (VSCs) connected to ultra-weak (high-impedance) grids. It is shown that the harmonic current controllers tend to be unstable as the Short-Circuit Ratio (SCR) of the system reduces. An active stabilizing...... control scheme is thus proposed by feeding back the filter capacitor voltage and the converter-side current. The method not only stabilizes the harmonic current control with a wide range of SCR values, but also mitigates harmonic distortions in the grid-side current of the VSC. The stabilizing mechanism...

  9. Infectious bronchitis virus variants ? History, current situation and control measures

    OpenAIRE

    2011-01-01

    Abstract Infectious bronchitis virus (IBV) is ubiquitous in most parts of the world where poultry are reared and is able to spread very rapidly in non-protected birds. It is shed via both the respiratory tract and the faeces and can persist in the birds and the intestinal tract for several weeks or months. Outdoors, survival of IBV for 56 days in litter has been reported. Although strict biosecurity and working with a one-age system are essential control measures, normally vaccinat...

  10. Plug-and-Play Design of Current Controllers for Grid-feeding Converters in DC Microgrids

    DEFF Research Database (Denmark)

    Han, Renke; Tucci, Michele; Soloperto, Raffaele

    2017-01-01

    In this paper, we address the problem of synthesizing decentralized current controllers for grid-feeding converters of current-controlled distributed generation units (CDGUs) in dc microgrids (MGs). Notably, a plug-and-play (PnP) design procedure is proposed to achieve grid-feeding current tracking...

  11. Electronically Tunable Current Controlled Current Conveyor Transconductance Amplifier-Based Mixed-Mode Biquadratic Filter with Resistorless and Grounded Capacitors

    Directory of Open Access Journals (Sweden)

    Hua-Pin Chen

    2017-03-01

    Full Text Available A new electronically tunable mixed-mode biquadratic filter with three current controlled current conveyor transconductance amplifiers (CCCCTAs and two grounded capacitors is proposed. With current input, the filter can realise lowpass (LP, bandpass (BP, highpass (HP, bandstop (BS and allpass (AP responses in current mode and LP, BP and HP responses in transimpedance mode. With voltage input, the filter can realise LP, BP, HP, BS and AP responses in voltage and transadmittance modes. Other attractive features of the mixed-mode biquadratic filter are (1 the use of two grounded capacitors, which is ideal for integrated circuit implementation; (2 orthogonal control of the quality factor (Q and resonance angular frequency (ωo for easy electronic tenability; (3 low input impedance and high output impedance for current signals; (4 high input impedance for voltage signal; (5 avoidance of need for component-matching conditions; (6 resistorless and electronically tunable structure; (7 low active and passive sensitivities; and (8 independent control of the voltage transfer gains without affecting the parameters ωo and Q.

  12. Comparison of Unmodulated Current Control Characteristics of Permanent Magnet Synchronous Motor

    Directory of Open Access Journals (Sweden)

    Anwar Muqorobin

    2014-12-01

    Full Text Available This paper discusses comparison of unmodulated current controls in PMSM, more specifically, on-off, sliding mode, predictive and hybrid controls. The purpose of this study is to select the most appropriate control technique to be adopted. The comparison method is preceded by modeling the motor and entering the values of the motor parameters. PI control is used for speed control and zero d-axis current is employed. Furthermore, performing simulation for each type ofthe selected current controls and analyzing their responses in terms of dq and abc currents, q-axis current response with step reference, as well as THD. Simulation results show that the on-off control gives the best overall performance based on its abc-axis current ripple and THD at large load torque. The hybrid control shows the best response occurring only at the fastest transient time of q-axis current but its response exhibits bad qualities compared with other controls. The predictive control yields the best responses offering the smallest d-axis ripple current and THD at small load torque condition. The sliding mode control, however, does not exhibit any prominent performance compared to the others. Results presented in this paper further indicate that for the PMSM used in the simulation the most appropriate control is the predictive control.

  13. Coherent control of single electrons: a review of current progress

    Science.gov (United States)

    Bäuerle, Christopher; Glattli, D. Christian; Meunier, Tristan; Portier, Fabien; Roche, Patrice; Roulleau, Preden; Takada, Shintaro; Waintal, Xavier

    2018-05-01

    In this report we review the present state of the art of the control of propagating quantum states at the single-electron level and its potential application to quantum information processing. We give an overview of the different approaches that have been developed over the last few years in order to gain full control over a propagating single-electron in a solid-state system. After a brief introduction of the basic concepts, we present experiments on flying qubit circuits for ensemble of electrons measured in the low frequency (DC) limit. We then present the basic ingredients necessary to realise such experiments at the single-electron level. This includes a review of the various single-electron sources that have been developed over the last years and which are compatible with integrated single-electron circuits. This is followed by a review of recent key experiments on electron quantum optics with single electrons. Finally we will present recent developments in the new physics that has emerged using ultrashort voltage pulses. We conclude our review with an outlook and future challenges in the field.

  14. Mitigation of Grid-Current Distortion for LCL-Filtered Voltage-Source Inverter with Inverter-Current Feedback Control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2018-01-01

    harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...

  15. Digital peak current mode control with adaptive slope compensation for DC-DC converters

    DEFF Research Database (Denmark)

    Andersen, Karsten Holm; Nymand, Morten

    2017-01-01

    performance and stability of current mode control. The presented method adapt to DC-DC converter operating conditions by estimating the rising and falling inductor current slopes, to apply a current slope compensation value to obtain a constant quality factor. The experimental results verifies the theoretical......This paper presents an adaptive slope compensation method for peak current mode control of digital controlled DC-DC converters, which controls the quality factor of the complex conjugated poles at half the switching frequency. Using quality factor control enables optimization of the dynamic...

  16. Energy spread in SLC linac with Landau damping

    International Nuclear Information System (INIS)

    Seeman, J.

    1984-01-01

    The possibility of using Landau damping to reduce the growth of the beam size due to transverse wake fields has been known for some time. Recently K. Bane has calculated the effects of Landau damping for the SLC. The energy spread is then slowly removed so that at the end of the linac it has returned to the SLC specification of less than +0.5%. The purpose of the energy spread is to reduce the resonant driving of the tail of the bunch by the head. In this note the expected energy spreads within the beam are tabulated at various positions along the linac for use by those people designing momentum dependent equipment and for those interested in Landau damping

  17. Spin motion of electrons in the SLC linac

    International Nuclear Information System (INIS)

    Panofsky, W.K.H.

    1990-01-01

    It is generally expected that the depolarizing effects of the linear accelerator RF fields will be small. Recently Bill Atwood raised the question whether this conclusion is still correct in view of the fact that the particles in the SLC spend a larger fraction of their time at phase angles ''off crest'' due to BNS damping; since radial fields are in quadrature with the accelerating field this might imply that depolarizing effects are larger. On the other hand, because of the smaller emittance of the SLC relative to the earlier linac radial excursions would be smaller. The anticipation is therefore that the depolarizing effect will again be negligible but it might be worthwhile to update the early calculations of SLAC TN-63-97 revised in this paper

  18. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  19. Configuring the SLC linac for injection into PEP

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1989-01-01

    From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs

  20. Beam based alignment of the SLC final focus sextupoles

    International Nuclear Information System (INIS)

    Emma, P.; Irwin, J.; Phinney, N.; Raimondi, P.; Toge, N.; Walker, N.J.; Ziemann, V.

    1993-05-01

    The strong demagnification inherent in final focus systems requires local cancellation of the resulting chromaticty. Strong sextupole pair separated by a -I transform are positioned π/2 in the betatron phase away from the Interaction Point (IP) in order to cancel chromatic aberrations primarily due to the final quadrupoles. Sextupole alignment is critical in order to provide orthogonal tuning of the chromaticty and, in the case of the SLC, to limit the third and higher order optical aberrations generated from misaligned and 'nested' horizontal and vertical sextupole pairs. Reported here is a novel technique for aligning the beam centroid to the sextupole centers, which uses measurements of the criticality dependent parameter - the beam size at the IP. Results for the SLC final focus sextupoles are presented, where a resolution of <50 μm is achieved

  1. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  2. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  3. Heating, current drive and MHD control using ECH in TCV

    International Nuclear Information System (INIS)

    Goodman, T.

    2001-01-01

    The 6 beam 2nd harmonic X-mode (X2), 3MW, ECH/ECCD system of the TCV tokamak allows a fine tailoring of the deposition profiles in the plasma. The sensitivity of the sawtooth period to the deposition location is used to increase the equilibria reconstruction and ray-tracing accuracy. Off-axis ECH, followed by on-axis counter-ECCD produces improved central confinement regimes in which τ Ee exceeds RLW scaling by a factor of 3.5. The PRETOR transport code (incorporating an RLW local transport model but constrained by the experimental density profiles) predicts an extreme sensitivity of τ Ee to the deposition location of the counter-ECCD. This is confirmed by experiments. Sawtooth simulations using PRETOR, including the effects of current drive with inputs from the TORAY ray-tracing code, are in good agreement with experimental results. These results are an initial benchmark for the package of analysis codes, LIUQE/TORAY/PRETOR used during ECH/ECCD experiments on TCV. (author)

  4. Beam dynamics in the SLC final focus system

    International Nuclear Information System (INIS)

    Bambade, P.S.

    1987-06-01

    The SLC luminosity is reached by colliding beams focused to about 2 μm transverse sizes. The Final Focus System (FFS) must enable, beyond its basic optical design, the detection and correction of errors accumulated in the system. In this paper, after summarizing the design, we review the sensitivity to such errors and the ability to correct them. The overall tuning strategy involves three phases: single beam spot minimization, steering the beams in collision and luminosity optimization with beam-beam effects

  5. Resistive flux saving and current profile control during lower hybrid waves assisted current rise in TORE SUPRA

    International Nuclear Information System (INIS)

    van Houtte, D.; Hoang, G.T.; Joffrin, E.; Lecoustey, P.; Moreau, D.; Parlange, F.; Tonon, G.; Vallet, J.C.

    1992-01-01

    Resistive flux saving at densities n e = (1 - 2) x 10 19 m -3 has been studied. High flux saving efficiency (0.7 x 10 13 Wb/J/m -1 ) can be achieved for a low rf power (P LH = 0.5 MW) due to the beneficial effect of the electric field on the suprathermal electrons. However for power higher than 1 MW, the efficiency is 0.25 x 10 13 Wb/J/m -1 . This flux saving efficiency is comparable to the one obtained during the flat top phase. The application of the LH power during a low density current ramp-up tends to peak the electron temperature and current density profiles. The rf power level, the parallel wavenumber and the current ramp rate allow to control the trajectories of the plasma discharges during the current rise inside the MHD stable domain

  6. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  7. Status of the SLC: Developments in Linear Collider physics

    International Nuclear Information System (INIS)

    Krejcik, P.

    1994-11-01

    This paper reviews the performance of the SLAC Linear Collider, both from the perspective of a machine delivering high luminosity polarized beams for physics, and as a test for future linear colliders. The development of the SLC taken place over a number of years and the steady improvements have been documented in previous review papers. As a review paper, the list references also serves as a bibliography, pointing to the work of the many people contributing to the upgrades and commissioning of the various SLC systems. The major upgrades for this present run have been an improved final focus optics, new low impedance vacuum chambers for the damping rings and improved polarization from the electron source. The performance of the SLC is driven to some extent by its unique 3-beam operation in which the linac accelerates both the electron and positron bunches for collision, as well as the electron bunch to produce the positrons. The special attention required to maintain stable operation in the face of the interactions caused by beam loading from the bunches will (fortunately exclamation point) not be an issue in future linear colliders. They will deal instead with the problems associated with handling long bunch trains

  8. Speed Control Analysis of Brushless DC Motor Based on Maximum Amplitude DC Current Feedback

    Directory of Open Access Journals (Sweden)

    Hassan M.A.A.

    2014-07-01

    Full Text Available This paper describes an approach to develop accurate and simple current controlled modulation technique for brushless DC (BLDC motor drive. The approach is applied to control phase current based on generation of quasi-square wave current by using only one current controller for the three phases. Unlike the vector control method which is complicated to be implemented, this simple current modulation technique presents advantages such as phase currents are kept in balance and the current is controlled through only one dc signal which represent maximum amplitude value of trapezoidal current (Imax. This technique is performed with Proportional Integral (PI control algorithm and triangular carrier comparison method to generate Pulse Width Modulation (PWM signal. In addition, the PI speed controller is incorporated with the current controller to perform desirable speed operation of non-overshoot response. The performance and functionality of the BLDC motor driver are verified via simulation by using MATLAB/SIMULINK. The simulation results show the developed control system performs desirable speed operation of non-overshoot and good current waveforms.

  9. Turbine Engine Clearance Control Systems: Current Practices and Future Directions

    Science.gov (United States)

    Lattime, Scott B.; Steinetz, Bruce M.

    2002-01-01

    Improved blade tip sealing in the high pressure compressor (HPC) and high pressure turbine (HPT) can provide dramatic reductions in specific fuel consumption (SFC), time-on-wing, compressor stall margin, and engine efficiency as well as increased payload and mission range capabilities. Maintenance costs to overhaul large commercial gas turbine engines can easily exceed $1M. Engine removal from service is primarily due to spent exhaust gas temperature (EGT) margin caused mainly by the deterioration of HPT components. Increased blade tip clearance is a major factor in hot section component degradation. As engine designs continue to push the performance envelope with fewer parts and the market drives manufacturers to increase service life, the need for advanced sealing continues to grow. A review of aero gas turbine engine HPT performance degradation and the mechanisms that promote these losses are discussed. Benefits to the HPT due to improved clearance management are identified. Past and present sealing technologies are presented along with specifications for next generation engine clearance control systems.

  10. Load Torque Compensator for Model Predictive Direct Current Control in High Power PMSM Drive Systems

    DEFF Research Database (Denmark)

    Preindl, Matthias; Schaltz, Erik

    2010-01-01

    In drive systems the most used control structure is the cascade control with an inner torque, i.e. current and an outer speed control loop. The fairly small converter switching frequency in high power applications, e.g. wind turbines lead to modest speed control performance. An improvement bring...... the use of a current controller which takes into account the discrete states of the inverter, e.g. DTC or a more modern approach: Model Predictive Direct Current Control (MPDCC). Moreover overshoots and oscillations in the speed are not desired in many applications, since they lead to mechanical stress...

  11. A Coordinate Control Strategy for Circulating Current Suppression in Multiparalleled Three-Phase Inverters

    DEFF Research Database (Denmark)

    Zhang, Xueguang; Wang, Tianyi; Wang, Xiongfei

    2017-01-01

    This paper addresses the zero-sequence circulating current control in the multiparalleled three-phase voltage-source inverters. The model of the zero-sequence circulating current in the N-paralleled (N ≥ 3) inverters is derived. It is shown that the circulating current is not only susceptible...... to the mismatches of circuit parameters, but it is also influenced by the interactions of circulating current controllers used by other paralleled inverters. To eliminate these adverse effects on the circulating current control loop, a coordinate control strategy for the N-paralleled inverter is proposed based...... on the zero-vector feedforward method with the space-vector pulse width modulation. Moreover, a virtual inverter method is introduced to facilitate the implementation of the proposed controller, which decouples the interactions of circulating current controllers in the paralleled inverters. Finally...

  12. Current knowledge on groundwater microbial pathogens and their control

    Science.gov (United States)

    Macler, Bruce A.; Merkle, Jon C.

    Those who drink groundwater that has not been disinfected are at increased risk of infection and disease from pathogenic microorganisms. Recent studies have shown that up to half of all US drinking-water wells tested had evidence of fecal contamination. A significant fraction of all waterborne disease outbreaks is associated with groundwater. An estimated 750,000 to 5.9million illnesses per year result from contaminated groundwaters in the US. Mortality from these illnesses may be 1400-9400 deaths per year. Control of these pathogens starts with source-water protection activities to prevent fecal contamination of aquifers and wells. These include assessment of wellhead vulnerability to fecal contamination and correction of identified deficiencies. Correction may include control of sources or rehabilitation of the well itself. Disinfection can serve as a useful barrier and is recommended as a prudent public-health policy for all groundwater systems. Ceux qui boivent une eau souterraine non désinfectée présentent un risque accru d'infection et de maladie par des germes pathogènes. De récentes études ont montré que près de la moitié de tous les puits américains testés, captés pour l'eau potable, sont soumis à une contamination fécale. Une fraction significative de l'ensemble des premières manifestations de maladies liées à l'eau est associée aux eaux souterraines. On estime qu'entre 750 000 et 5,9millions de personnes sont malades chaque année aux États-Unis à cause d'eaux souterraines polluées. La mortalité parmi ces malades doit ètre de l'ordre de 1400 à 9400 décès par an. La protection contre ces germes pathogènes commence avec des mesures prises au niveau du captage pour empècher la pollution des aquifères et des puits. Celles-ci comprennent une évaluation de la vulnérabilité des tètes de puits à la pollution fécale et une correction des insuffisances mises en évidence. Cette correction peut comprendre une maîtrise des sources

  13. A current controlled matrix converter for wind energy conversion systems based on permanent magnet synchronous generator

    OpenAIRE

    Naggar H. Saad; Ahmed A. El-Sattar; Mohamed I. Marei

    2016-01-01

    The main challenges of wind energy conversion systems (WECS) are to maximize the energy capture from the wind and injecting reactive power during the fault. This paper presents a current controlled matrix converter to interface Permanent Magnet Synchronous Generators (PMSG) based WECS with the grid. To achieve fast dynamic response with reduced current ripples, a hysteresis current control is utilized. The proposed control system decouples the active and reactive components of the PMSG curren...

  14. An improved current control scheme for grid-connected DG unit based distribution system harmonic compensation

    DEFF Research Database (Denmark)

    He, Jinwei; Wei Li, Yun; Wang, Xiongfei

    2013-01-01

    In order to utilize DG unit interfacing converters to actively compensate distribution system harmonics, this paper proposes an enhanced current control approach. It seamlessly integrates system harmonic mitigation capabilities with the primary DG power generation function. As the proposed current...... controller has two well decoupled control branches to independently control fundamental and harmonic DG currents, phase-locked loops (PLL) and system harmonic component extractions can be avoided during system harmonic compensation. Moreover, a closed-loop power control scheme is also employed to derive...... the fundamental current reference. The proposed power control scheme effectively eliminates the impacts of steady-state fundamental current tracking errors in the DG units. Thus, an accurate power control is realized even when the harmonic compensation functions are activated. Experimental results from a single...

  15. Operator interface for the PEP-II low level RF control system

    International Nuclear Information System (INIS)

    Allison, S.; Claus, R.

    1997-05-01

    This paper focuses on the operational aspects of the low level RF control system being built for the PEP-II storage rings at SLAC. Subsystems requiring major operational considerations include displays for monitor and control from UNIX workstations, slow feedback loops and control sequences residing on microprocessors, and various client applications in the existing SLAC Linear Collider (SLC) control system. Since commissioning of PEP-II RF is currently in-progress, only those parts of the control system used during this phase are discussed in detail. Based on past experience with the SLC control system, it is expected that effort expended during commissioning on a solid user interface will result in smoother transition to full reliable 24-hour-a-day operation

  16. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  17. New Gain Controllable Resistor-less Current-mode First Order Allpass Filter and its Application

    Directory of Open Access Journals (Sweden)

    W. Jaikla

    2012-04-01

    Full Text Available New first order allpass filter (APF in current mode, constructed from 2 CCCCTAs and grounded capacitor, is presented. The current gain and phase shift can be electronically /orthogonally controlled. Low input and high output impedances are achieved which make the circuit to be easily cascaded to the current-mode circuit without additional current buffers. The operation of the proposed filter has been verified through simulation results which confirm the theoretical analysis. The application example as current-mode quadrature oscillator with non-interactive current control for both of oscillation condition and oscillation frequency is included to show the usability of the proposed filter.

  18. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  19. Control system user interface for accelerator commissioning and operation

    International Nuclear Information System (INIS)

    Dobrott, D.; Keeley, D.; Kolte, G.; Mikic, Z.; Lee, M.; Corbett, J.; Howry, S.; King, A.

    1991-01-01

    An Interactive Accelerator Interface Module (AIM) has been developed in a workstation environment for the purposes of assisting in the commissioning and operation of any storage ring/collider system. The function of AIM is to integrate modeling and simulation codes into accelerator and beamline control systems for the purpose of rapid on-line data analysis and error-correction, resulting in significant time-saving. A system dependent module provides for the translation of specific control system data files to appropriate input format for application programs within AIM. Interactive screen graphics, including system function diagrams, menus, beamline element status and update information are standard in AIM. AIM is currently connected to the Stanford Linear Collider (SLC) control system, but is easily transportable to other facilities. This paper describes the development of AIM and its applications on SLC

  20. Disturbance estimator based predictive current control of grid-connected inverters

    OpenAIRE

    Al-Khafaji, Ahmed Samawi Ghthwan

    2013-01-01

    ABSTRACT: The work presented in my thesis considers one of the modern discrete-time control approaches based on digital signal processing methods, that have been developed to improve the performance control of grid-connected three-phase inverters. Disturbance estimator based predictive current control of grid-connected inverters is proposed. For inverter modeling with respect to the design of current controllers, we choose the d-q synchronous reference frame to make it easier to understand an...

  1. Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women.

    Directory of Open Access Journals (Sweden)

    Agné Kulyté

    Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in

  2. Mechanical design and development of a high power target system for the SLC Positron Source

    International Nuclear Information System (INIS)

    Reuter, E.; Mansour, D.; Porter, T.; Sax, W.; Szumillo, A.

    1991-12-01

    In order to bring the SLC Positron Source luminosity up to design specifications, the previous (stationary) positron target had to be replaced with a version which could reliably dissipate the higher power levels and cyclic pulsed thermal stresses of the high intensity 33GeV electron beam. In addition to this basic requirement, the new target system had to meet SLAC's specifications for Ultra High Vacuum, be remotely controllable, ''radiation hard,'' and designed in such a way that it could be removed and replaced quickly and easily with minimum personnel exposure to radiation. It was also desirable to integrate the target and collection components into a compact, easily manufacturable, and easily maintainable module. This paper briefly summarize the mechanical design and development of the new modular target system, its associated controls and software, alignment, and the quick removal system. Operational experience gained with the new system over the first running cycle is also summarized

  3. AMS: Area Message Service for SLC

    International Nuclear Information System (INIS)

    Crane, M.; Mackenzie, R.; Millsom, D.; Zelazny, M.

    1993-04-01

    The Area Message Service (AMS) is a TCP/IP based messaging service currently in use at SLAC. A number of projects under development here at SLAC require and application level interface to the 4.3BSD UNIX socket level communications functions using TCP/IP over ethernet. AMS provides connection management, solicited message transfer, unsolicited message transfer, and asynchronous notification of pending messages. AMS is written completely in ANSI 'C' and is currently portable over three hardware/operating system/network manager platforms, VAX/VMS/Multinet, PC/MS-DOS/Pathworks, VME 68K/pSOS/pNA. The basic architecture is a client-server connection where either end of the interface may be the server. This allows for connections and data flow to be initiated from either end of the interface. Included in the paper are details concerning the connection management, the handling of the multi-platform code, and the implementation process

  4. Progressive irreversible hearing loss is caused by stria vascularis degeneration in an Slc26a4-insufficient mouse model of large vestibular aqueduct syndrome.

    Science.gov (United States)

    Ito, T; Nishio, A; Wangemann, P; Griffith, A J

    2015-12-03

    Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.

  5. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  6. A Decentralized Current-Sharing Controller Endows Fast Transient Response to Parallel DC-DC Converters

    DEFF Research Database (Denmark)

    Wang, Haojie; Han, Minxiao; Han, Renke

    2018-01-01

    This paper proposes a decentralized current-sharing control strategy to endow fast transient response to paralleled DC-DC converters systems, such as DC microgrids or distributed power systems. The proposed controller consist of two main control loops: an external voltage droop control for current......-sharing proposes and an internal current loop. The external droop control loop is designed as a voltage loop with embedded virtual impedance, which avoids the use of a slow voltage loop and a separate extra virtual impedance loop that may limit the system bandwidth. The internal current loop, thanks...... and the proposed embedded-virtual-impedance based I-V droop. In order to compare the dynamic response performances between two droop controllers, their state-space models have been developed and analyzed in this paper. The results show that the dynamic response of the I-V droop control is faster than...

  7. Decoupled Double Synchronous Reference Frame Current Controller for Unbalanced Grid Voltage Conditions

    DEFF Research Database (Denmark)

    Reyes, M.; Rodriguez, Pedro; Vazquez, S.

    2012-01-01

    -sequence current components is becoming necessary for achieving new capabilities like the reactive power injection during a grid fault. This paper deals with a fundamental issue in this topic, i.e., the performance of the current controller. Classical dq controllers, which are extensively used in industrial...

  8. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  9. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  10. Ion effects in the SLC electron damping ring under exceptionally poor vacuum conditions

    International Nuclear Information System (INIS)

    Zimmermann, F.; Krejcik, P.; Minty, M.; Pritzkau, D.; Raubenheimer, T.; Ross, M.; Woodley, M.

    1997-10-01

    In 1996, due to a catastrophic kicker chamber failure in the SLC electron damping ring, the ring vacuum system was contamianted for several months. During this time, the vertical emittance of the beam extracted from the ring was increased by a large factor (4--20). The emittance slowly decreased as the vacuum pressure gradually improved. At the same time, an intermittent vertical instability was observed. Both the emittance blow-up and the instability behavior depended strongly on beam current, ring pressure, number of bunches in the ring (1 or 2), duty cycle, store time and betatron tunes. In this report, the authors describe the observations, and compare them with predictions from classical ion-trapping and ion-instability theories

  11. Design of Nonlinear Robust Rotor Current Controller for DFIG Based on Terminal Sliding Mode Control and Extended State Observer

    Directory of Open Access Journals (Sweden)

    Guowei Cai

    2014-01-01

    Full Text Available As to strong nonlinearity of doubly fed induction generators (DFIG and uncertainty of its model, a novel rotor current controller with nonlinearity and robustness is proposed to enhance fault ride-though (FRT capacities of grid-connected DFIG. Firstly, the model error, external disturbances, and the uncertain factors were estimated by constructing extended state observer (ESO so as to achieve linearization model, which is compensated dynamically from nonlinear model. And then rotor current controller of DFIG is designed by using terminal sliding mode variable structure control theory (TSMC. The controller has superior dynamic performance and strong robustness. The simulation results show that the proposed control approach is effective.

  12. All-electric-controlled spin current switching in single-molecule magnet-tunnel junctions

    Science.gov (United States)

    Zhang, Zheng-Zhong; Shen, Rui; Sheng, Li; Wang, Rui-Qiang; Wang, Bai-Gen; Xing, Ding-Yu

    2011-04-01

    A single-molecule magnet (SMM) coupled to two normal metallic electrodes can both switch spin-up and spin-down electronic currents within two different windows of SMM gate voltage. Such spin current switching in the SMM tunnel junction arises from spin-selected single electron resonant tunneling via the lowest unoccupied molecular orbit of the SMM. Since it is not magnetically controlled but all-electrically controlled, the proposed spin current switching effect may have potential applications in future spintronics.

  13. AMS: Area Message Service for SLC

    International Nuclear Information System (INIS)

    Crane, M.; Mackenzie, R.; Millsom, D.; Zelazny, M.

    1993-01-01

    The Area Message Service (AMS) is a TCP/IP based messaging service currently in use at SLAC. A number of projects under development here at SLAC require an application level interface to the 4.3BSD UNIX socket level communications functions using TCP/IP over ethernet. AMS provides connection management, solicited message transfer, unsolicited message transfer, and asynchronous notification of pending messages. AMS is written completely in ANSI open-quote C close-quote and is currently portable over three hardware/operating system/network manager platforms, VAX/VMS/Multinet, PC/MS-DOS/Pathworks, VME 68K/pSOS/pNA. The basic architecture is a client-server connection where either end of the interface may be the server. This allows for connections and data flow to be initiated from either end of the interface. Included in the paper are details concerning the connection management, the handling of the multi-platform code, and the implementation process

  14. Current Mode Control for LLC Series Resonant DC-to-DC Converters

    Directory of Open Access Journals (Sweden)

    Jinhaeng Jang

    2015-06-01

    Full Text Available Conventional voltage mode control only offers limited performance for LLC series resonant DC-to-DC converters experiencing wide variations in operational conditions. When the existing voltage mode control is employed, the closed-loop performance of the converter is directly affected by unavoidable changes in power stage dynamics. Thus, a specific control design optimized at one particular operating point could become unacceptable when the operational condition is varied. This paper presents a new current mode control scheme which could consistently provide good closed-loop performance for LLC resonant converters for the entire operational range. The proposed control scheme employs an additional feedback from the current of the resonant tank network to overcome the limitation of the existing voltage mode control. The superiority of the proposed current mode control over the conventional voltage mode control is verified using an experimental 150 W LLC series resonant DC-to-DC converter.

  15. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  16. Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

    Directory of Open Access Journals (Sweden)

    Xin Wen

    Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

  17. Distributed Secondary Control for DC Microgrid Applications with Enhanced Current Sharing Accuracy

    DEFF Research Database (Denmark)

    Lu, Xiaonan; Guerrero, Josep M.; Sun, Kai

    2013-01-01

    With the consideration of line resistances in a dc microgrid, the current sharing accuracy is lowered down, since the dc output voltage cannot be exactly the same for different interfacing converters. Meanwhile, the dc bus voltage deviation is involved by using droop control. In this paper...... control diagram is accomplished and the requirement of distributed configuration in a microgrid is satisfied. The experimental validation based on a 2×2.2 kW prototype was implemented to demonstrate the proposed approach......., a distributed secondary control method is proposed. Droop control is employed as the primary control method for load current sharing. Meanwhile, the dc output voltage and current in each module is transferred to the others by the low bandwidth communication (LBC) network. Average voltage and current controllers...

  18. Rectifier Current Control for an LLC Resonant Converter Based on a Simplified Linearized Model

    OpenAIRE

    Zhijian Fang; Junhua Wang; Shanxu Duan; Liangle Xiao; Guozheng Hu; Qisheng Liu

    2018-01-01

    In this paper, a rectifier current control for an LLC resonant converter is proposed, based on a simplified, two-order, linearized model that adds a rectifier current feedback inner loop to improve dynamic performance. Compared to the traditional large-signal model with seven resonant states, this paper utilizes a rectifier current state to represent the characteristics of the resonant states, simplifying the LLC resonant model from seven orders to two orders. Then, the rectifier current feed...

  19. Realization of Electronically Controllable Current-mode Square-rooting Circuit Based on MO-CFTA

    OpenAIRE

    P. Silapan; C. Chanapromma; T. Worachak

    2011-01-01

    This article proposes a current-mode square-rooting circuit using current follower transconductance amplifier (CTFA). The amplitude of the output current can be electronically controlled via input bias current with wide input dynamic range. The proposed circuit consists of only single CFTA. Without any matching conditions and external passive elements, the circuit is then appropriate for an IC architecture. The magnitude of the output signal is temperature-insensitive. Th...

  20. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  1. A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider

    International Nuclear Information System (INIS)

    Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.

    1989-04-01

    A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs

  2. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  3. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  4. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  5. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.

    1987-03-01

    The polarimeters needed to monitor and measure electron beam polarization at the Stanford Linear Collider are discussed. Two types of polarimeters, are to be used. The first is based on the spin dependent elastic scattering of photons from high energy electrons. The second utilizes the spin dependence of elastic electron-electron scattering. The plans of the SLC polarization group to measure and monitor electron beam polarization are discussed. A brief discussion of the physics and the demands it imposes on beam polarization measurements is presented. The Compton polarimeter and the essential characteristics of two Moeller polarimeters are presented

  6. Review of weak mixing angle results at SLC and LEP

    International Nuclear Information System (INIS)

    Woods, M.

    1995-10-01

    In this paper, the authors review recent precise measurements of the weak mixing angle by the SLD experiment at SLC and by the ALEPH, DELPHI, L3, and OPAL experiments at LEP. If they assume that the Minimal Standard Model provides a complete description of the quark and lepton couplings to the Z boson, they find sin 2 θ W eff = 0.23143 ± 0.00028. If this assumption is relaxed to apply to lepton couplings only, they find sin 2 θ W eff = 0.23106 ± 0.00035. They compare these results with other precision electroweak tests

  7. Chromatic correction in the SLC bunch length compressors

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.

    1991-06-01

    The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs

  8. Timing jitter measurements at the SLC electron source

    International Nuclear Information System (INIS)

    Sodja, J.; Browne, M.J.; Clendenin, J.E.

    1989-03-01

    The SLC thermionic gun and electron source produce a beam of up to 15 /times/ 10 10 /sub e//minus/ in a single S-band bunch. A 170 keV, 2 ns FWHM pulse out of the gun is compressed by means of two subharmonic buncher cavities followed by an S-band buncher and a standard SLAC accelerating section. Ceramic gaps in the beam pipe at the output of the gun allow a measure of the beam intensity and timing. A measurement at these gaps of the timing jitter, with a resolution of <10 ps, is described. 3 refs., 5 figs

  9. Recent improvements in the SLC positron system performance

    International Nuclear Information System (INIS)

    Krejcik, P.; Corbett, J.; Ecklund, S.; Emma, P.; Fieguth, T.; Helm, R.; Kulikov, A.; Limberg, T.; Moshammer, H.; Ross, M.; Siemann, R.; Spence, W.; Woodley, M.

    1992-03-01

    The positron system is very specific to the SLC in that the positrons are accelerated in the same linac as the electrons that produce them and the electrons with which they collide. Some of the difficulties in tuning this system to peak performance are thus unlikely to be encountered in future linear colliders, but many of the lessons learned in beam matching are useful for future machines. The design and commissioning of this system has been previously reported so we only briefly describe the major subsystems before detailing the tuning and diagnostics involved in optimizing the performance of the overall system

  10. The completed design of the SLC Final Focus System

    International Nuclear Information System (INIS)

    Murray, J.J.; Brown, K.L.; Fieguth, T.

    1987-02-01

    The design of the SLC Final Focus System has evolved from its initial conceptual design into its final form. This final design is described including a review of the critical decisions influencing the adoption of particular features. The creation of a feasible design has required that these decisions be tempered by practical considerations such as site constraints, correction of optical errors caused by imperfections, and accommodations requested by engineers and particle detector physicists. As this is the first such system to be built, it is hoped that the experience gained will be useful for the design of future systems

  11. Some experiences from the commissioning program of the SLC arcs

    International Nuclear Information System (INIS)

    Fischer, G.E.; Brown, K.L.; Bulos, F.; Fieguth, T.; Hutton, A.; Murray, J.J.; Toge, N.; Weng, W.T.; Wiedemann, H.

    1987-01-01

    The SLC Arc System is designed to transport beams of electrons and positrons from the end of the SLAC Linac to the beginning of the Final Focus System where they are made to collide head on. To minimize phase space dilution caused by quantum processes in the synchrotron radiation energy loss mechanism, the bending radii are large (279 m) and very high gradient (n = 32824) AG cells are arranged in trains of low dispersion, terrain following achromats. First experiences in operating a system of over 900 magnets, each with beam position monitors and corrector magnet movers, spanning 9000 feet, are described

  12. Adaptive Hysteresis Band Current Control for Transformerless Single-Phase PV Inverters

    DEFF Research Database (Denmark)

    Vázquez, Gerardo; Rodriguez, Pedro; Ordoñez, Rafael

    2009-01-01

    Current control based on hysteresis algorithms are widely used in different applications, such as motion control, active filtering or active/reactive power delivery control in distributed generation systems. The hysteresis current control provides to the system a fast and robust dynamic response......, and requires a simple implementation in standard digital signal platforms. On the other hand, the main drawback of classical hysteresis current control lies in the fact that the switching frequency is variable, as the hysteresis band is fixed. In this paper a variable band hysteresis control algorithm...... different single-phase PV inverter topologies, by means of simulations performed with PSIM. In addition, the behavior of the thermal losses when using each control structure in such converters has been studied as well....

  13. Real-time control of the current density and pressure profiles in Jet

    International Nuclear Information System (INIS)

    Mazon, D.; Moreau, D.; Litaudon, X.; Joffrin, E.; Laborde, L.; Zabeo, L.; Crisanti, F.; Riva, M.; Felton, R.; Murari, A.; Tala, T.

    2003-01-01

    In order to ultimately control internal transport barriers during advanced operation scenarios, new algorithms using a truncated singular value decomposition of a linearized model operator have been implemented in the JET real-time controller, with the potentiality of retaining the distributed nature of plasma parameter profiles. First experiments using the simplest, lumped-parameter, version of this technique have been dedicated to the feedback control of the current density profile in a negative shear plasma using three heating and current drive actuators, namely neutral beam injection (NBI), ion cyclotron resonant frequency heating (ICRH) and lower hybrid current drive (LHCD). Successful control of the safety factor profile has been achieved on the time scale of the current redistribution time, first during an extended preheat phase with only LHCD as actuator and, then, in quasi steady-state conditions during the main heating phase of a discharge, using the three heating and current drive actuators

  14. Feedback control of current drive by using hybrid wave in tokamaks

    International Nuclear Information System (INIS)

    Wijnands, T.J.; CEA Centre d'Etudes de Cadarache, 13 - Saint-Paul-lez-Durance

    1997-03-01

    This work is focussed on an important and recent development in present day Controlled Nuclear Fusion Research and Tokamaks. The aim is to optimise the energy confinement for a certain magnetic configuration by adapting the radial distribution of the current. Of particular interest are feedback control scenarios with stationary modifications of the current profile using current, driven by Lower Hybrid waves. A new feedback control system has been developed for Tore Supra and has made a large number of new operation scenarios possible. In one of the experiments described here, there is no energy exchange between the poloidal field system and the plasma, the current is controlled by the power of the Lower Hybrid waves while the launched wave spectrum is used to optimise the current profile shape and the energy confinement. (author)

  15. Enhancing the Frequency Adaptability of Periodic Current Controllers for Grid-Connected Power Converters

    DEFF Research Database (Denmark)

    Yang, Yongheng; Zhou, Keliang; Blaabjerg, Frede

    2015-01-01

    It is mandatory for grid-connected power converters to synchronize the feed-in currents with the grid. Moreover, the power converters should produce feed-in currents with low total harmonic distortions according to the demands, by employing advanced current controllers, e.g., Proportional Resonant...... deviations. Experiments on a single-phase grid-connected inverter system are presented, which have verified the proposals and also the effectiveness of the frequency adaptive current controllers....... (PR) and Repetitive Controllers (RC). The synchronization is actually to detect the instantaneous grid information (e.g., frequency and phase of the grid voltage) for the current control, which is commonly performed by a Phase-Locked-Loop (PLL) system. As a consequence, harmonics and deviations...

  16. Simple DCM or CRM analog peak current controller for HV capacitor charge-discharge applications

    DEFF Research Database (Denmark)

    Trintis, Ionut; Dimopoulos, Emmanouil; Munk-Nielsen, Stig

    2013-01-01

    This paper presents a simple analog current controller suitable for buck and boost converter topologies. The controller operates in DCM or CRM, depending on the setup. The experimental results are presented to validate the proposed controller functionality for a high voltage capacitor charge...

  17. Real time control of EC heating & current drive systems on TCV

    NARCIS (Netherlands)

    Paley, J.I.; Felici, F.; Curchod, L.; Coda, S.; Goodman, T.P.

    2009-01-01

    The ability to control, in real time, the electron cyclotron heating & current drive systems for the control of MHD instabilities is particularly important for large tokamaks operating at high performance. Several algorithms have been developed and tested on TCV to explore possible control

  18. A unified grid current control for grid-interactive DG inverters in microgrids

    DEFF Research Database (Denmark)

    Wang, Xiongfei; Loh, Poh Chiang; Blaabjerg, Frede

    2015-01-01

    This paper proposes a unified grid current control for grid-interactive distributed generation inverters. In the approach, the grid-side current, instead of inverter-side current, is controlled as an inner loop, while the filter capacitor voltage is indirectly regulated through a virtual admittan...... locus analyses in the discrete z-domain are performed for elaborating the controller design. Simulations and experimental results demonstrate the performances of the proposed approach.......This paper proposes a unified grid current control for grid-interactive distributed generation inverters. In the approach, the grid-side current, instead of inverter-side current, is controlled as an inner loop, while the filter capacitor voltage is indirectly regulated through a virtual admittance...... in the outer loop. It, therefore, provides several superior features over traditional control schemes: 1) high-quality grid current in the grid-connected mode, 2) inherent derivative-less virtual output impedance control, and 3) the unified active damping for both grid-connected and islanded operations. Root...

  19. Modeling and control of the output current of a Reformed Methanol Fuel Cell system

    DEFF Research Database (Denmark)

    Justesen, Kristian Kjær; Andreasen, Søren Juhl; Pasupathi, Sivakumar

    2015-01-01

    In this work, a dynamic Matlab SIMULINK model of the relationship between the fuel cell current set point of a Reformed Methanol Fuel Cell system and the output current of the system is developed. The model contains an estimated fuel cell model, based on a polarization curve and assumed first order...... dynamics, as well as a battery model based on an equivalent circuit model and a balance of plant power consumption model. The models are tuned with experimental data and verified using a verification data set. The model is used to develop an output current controller which can control the charge current...... of the battery. The controller is a PI controller with feedforward and anti-windup. The performance of the controller is tested and verified on the physical system....

  20. Design of laser diode driver with constant current and temperature control system

    Science.gov (United States)

    Wang, Ming-cai; Yang, Kai-yong; Wang, Zhi-guo; Fan, Zhen-fang

    2017-10-01

    A laser Diode (LD) driver with constant current and temperature control system is designed according to the LD working characteristics. We deeply researched the protection circuit and temperature control circuit based on thermos-electric cooler(TEC) cooling circuit and PID algorithm. The driver could realize constant current output and achieve stable temperature control of LD. Real-time feedback control method was adopted in the temperature control system to make LD work on its best temperature point. The output power variety and output wavelength shift of LD caused by current and temperature instability were decreased. Furthermore, the driving current and working temperature is adjustable according to specific requirements. The experiment result showed that the developed LD driver meets the characteristics of LD.

  1. Complex state variable- and disturbance observer-based current controllers for AC drives

    DEFF Research Database (Denmark)

    Dal, Mehmet; Teodorescu, Remus; Blaabjerg, Frede

    2013-01-01

    In vector-controlled AC drives, the design of current controller is usually based on a machine model defined in synchronous frame coordinate, where the drive performance may be degraded by both the variation of the machine parameters and the cross-coupling between the d- and q-axes components...... of the stator current. In order to improve the current control performance an alternative current control strategy was proposed previously aiming to avoid the undesired cross-coupling and non-linearities between the state variables. These effects are assumed as disturbances arisen in the closed-loop path...... of the parameter and the cross-coupling effect. Moreover, it provides a better performance, smooth and low noisy operation with respect to the complex variable controller....

  2. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  3. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  4. Performance assessment of a dynamic current allocator for the JET eXtreme Shape Controller

    International Nuclear Information System (INIS)

    Varano, G.; Ambrosino, G.; Tommasi, G.De; Galeani, S.; Pironti, A.; Zaccarian, L.

    2011-01-01

    This paper reports on a recently proposed dynamic allocation technique that can be effectively adopted to handle the current saturations of the Poloidal Field coils with the eXtreme Shape Controller. The proposed approach allows to automatically relax the plasma shape regulation when the reference shape requires current levels out of the available ranges, finding in real-time an optimal trade-off between shape control precision and currents saturation avoidance. In this paper the results attained during preliminary analysis are presented, showing the advantage arising from the use of the dynamic allocator, versus the bare use of the eXtreme Shape Controller.

  5. Control Strategies for Islanded Microgrid using Enhanced Hierarchical Control Structure with Multiple Current-Loop Damping Schemes

    DEFF Research Database (Denmark)

    Han, Yang; Shen, Pan; Zhao, Xin

    2017-01-01

    In this paper, the modeling, controller design, and stability analysis of the islanded microgrid (MG) using enhanced hierarchical control structure with multiple current loop damping schemes is proposed. The islanded MG is consisted of the parallel-connected voltage source inverters using LCL...... output filters, and the proposed control structure includes: the primary control with additional phase-shift loop, the secondary control for voltage amplitude and frequency restoration, the virtual impedance loops which contains virtual positive- and negative-sequence impedance loops at fundamental...... frequency, and virtual variable harmonic impedance loop at harmonic frequencies, and the inner voltage and current loop controllers. A small-signal model for the primary and secondary controls with additional phase-shift loop is presented, which shows an over-damped feature from eigenvalue analysis...

  6. Control of tokamak plasma current and equilibrium with hybrid poloidal field coils

    International Nuclear Information System (INIS)

    Shimada, Ryuichi

    1982-01-01

    A control method with hybrid poloidal field system is considered, which comprehensively implements the control of plasma equilibrium and plasma current, those have been treated independently in Tokamak divices. Tokamak equilibrium requires the condition that the magnetic flux function value on plasma surface must be constant. From this, the current to be supplied to each coil is determined. Therefore, each coil current is the resultant of the component related to plasma current excitation and the component required for holding equilibrium. Here, it is intended to show a method by which the current to be supplied to each coil can easily be calculated by the introduction of hybrid control matrix. The text first considers the equilibrium of axi-symmetrical plasma and the equilibrium magnetic field outside plasma, next describes the determination of current using the above hybrid control matrix, and indicates an example of controlling Tokamak plasma current and equilibrium by the hybrid poloidal field coils. It also shows that the excitation of plasma current and the maintenance of plasma equilibrium can basically be available with a single power supply by the appropriate selection of the number of turns of each coil. These considerations determine the basic system configuration as well as decrease the installed capacity of power source for the poloidal field of a Tokamak fusion reactor. Finally, the actual configuration of the power source for hybrid poloidal field coils is shown for the above system. (Wakatsuki, Y.)

  7. A novel harmonic current sharing control strategy for parallel-connected inverters

    DEFF Research Database (Denmark)

    Guan, Yajuan; Guerrero, Josep M.; Savaghebi, Mehdi

    2017-01-01

    A novel control strategy which enables proportional linear and nonlinear loads sharing among paralleled inverters and voltage harmonic suppression is proposed in this paper. The proposed method is based on the autonomous currents sharing controller (ACSC) instead of conventional power droop control...... to provide fast transient response, decoupling control and large stability margin. The current components at different sequences and orders are decomposed by a multi-second-order generalized integrator-based frequency locked loop (MSOGI-FLL). A harmonic-orthogonal-virtual-resistances controller (HOVR......) is used to proportionally share current components at different sequences and orders independently among the paralleled inverters. Proportional resonance controllers tuned at selected frequencies are used to suppress voltage harmonics. Simulations based on two 2.2 kW paralleled three-phase inverters...

  8. Constant voltage and constant current control implementation for electric vehicles (evs) wireless charger

    Science.gov (United States)

    Tampubolon, Marojahan; Pamungkas, Laskar; Hsieh, Yao Ching; Chiu, Huang Jen

    2018-04-01

    This paper presents the implementation of Constant Voltage (CV) and Constant Current (CC) control for a wireless charger system. A battery charging system needs these control modes to ensure the safety of the battery and the effectiveness of the charging system. Here, the wireless charger system does not employ any post-regulator stage to control the output voltage and output current of the charger. But, it uses a variable frequency control incorporated with a conventional PI control. As a result, the size and the weight of the system are reduced. This paper discusses the brief review of the SS-WPT, control strategy and implementation of the CV and CC control. Experimental hardware with 2kW output power has been performed and tested. The results show that the proposed CV and CC control method works well with the system.

  9. Enhancing current density profile control in tokamak experiments using iterative learning control

    NARCIS (Netherlands)

    Felici, F.A.A.; Oomen, T.A.E.

    2015-01-01

    Tokamaks are toroidal devices to create and confine high-temperature plasmas, and are presently at the forefront of nuclear fusion research. Many parameters in a tokamak are feedback controlled, but some quantities that are either difficult to measure or difficult to control are still controlled by

  10. SLC status and NLC design and R and D

    International Nuclear Information System (INIS)

    Raubenheimer, T.O.

    1996-09-01

    In this paper, the authors will first review the status of the Stanford Linear Collider (SLC). In particular, they discuss the luminosity and performance issues and the accelerator studies that relate to future linear colliders. Next, they describe the present state of the Next Linear Collider (NLC) design and the ongoing R and D effort which is, in addition to the work at the SLC, supporting the design. This includes extensive ground motion measurements to verify the required stability, measurements of the dipole wakefields to verify the performance of the Damped-Detuned accelerator Structures (DDS), and tests of the rf structure BPMs that are needed to align the structure to the beam trajectory. It also includes the development and fabrication of the X-band structures, klystrons, and rf pulse compressors that are needed to accelerate the beams with gradients in excess of 50 MV/m. It should be noted that much of the material reported here is described in greater detail in other papers submitted to this conference and thus the appropriate references are included throughout. In addition, because of space limitations, they only briefly describe the design of the NLC and, instead, concentrate on the R and D that is supporting the design

  11. Subsidence of the pit slab at SLC experimental hall

    International Nuclear Information System (INIS)

    Inaba, J.; Himeno, Yoichi; Katsura, Yutaka

    1992-01-01

    Detectors installed at particle accelerator facilities are quite heavy, weighing thousands of tons. On the other hand, ground subsidence caused by the installation of a detector adversely affects the beam line alignment of the collider. It becomes, therefore, very important to figure out the expected amount of ground settlement by means of adequate evaluation methods in advance. At Stanford Linear Accelerator Center (SLAC), a 1700 mT (metric tons) Mark II detector was replaced with a 4000 mT SLD detector in Stanford Linear Collider (SLC). The exchange started in December 1990 and lasted until March 1991, and the amount of ground settlement was measured by SLAC during that period. We performed simulation studies to evaluate the subsidence of the pit slab using several analysis methods. Parameters used for the analyses were decided based on the information of the SLC structure and the ground conditions at the SLAC area. The objective of this study is to verify the applicability of several simulation methods by comparing the analytical results with the actual subsidence data obtained by SLAC

  12. A Hierarchical Control Scheme for Reactive Power and Harmonic Current Sharing in Islanded Microgrids

    DEFF Research Database (Denmark)

    Lorzadeh, Iman; Firoozabadi, Mehdi Savaghebi; Askarian Abyaneh, Hossein

    2015-01-01

    In this paper, a hierarchical control scheme consisting of primary and secondary levels is proposed for achieving accurate reactive power and harmonic currents sharing among interface inverters of distributed generators (DGs) in islanded microgrids. Firstly, fundamental and main harmonic componen...

  13. H∞ Robust Current Control for DFIG Based Wind Turbine subject to Grid Voltage Distortions

    DEFF Research Database (Denmark)

    Wang, Yun; Wu, Qiuwei; Gong, Wenming

    2016-01-01

    This paper proposes an H∞ robust current controller for doubly fed induction generator (DFIG) based wind turbines (WTs) subject to grid voltage distortions. The controller is to mitigate the impact of the grid voltage distortions on rotor currents with DFIG parameter perturbation. The grid voltage...... distortions considered include asymmetric voltage dips and grid background harmonics. An uncertain DFIG model is developed with uncertain factors originating from distorted stator voltage, and changed generator parameters due to the flux saturation effect, the skin effect, etc. Weighting functions...... are designed to efficiently track the unbalanced current components and the 5th and 7th background harmonics. The robust stability (RS) and robust performance (RP) of the proposed controller are verified by the structured singular value µ. The performance of the H∞ robust current controller was demonstrated...

  14. Lower hybrid wave accessibility as a means for current profile control

    International Nuclear Information System (INIS)

    Briffod, G.; Gormezano, C.; Parlange, F.; Van Houtte, D.

    1986-01-01

    Powerful ICRH experiments on JET and Neutral Beam Injection of various species on TFTR have recently confirmed the insensitivity of the temperature and safety factor profile shapes to the heating profile and the important role played by the sawtooth activity on the overall performances. In order to overcome these limitations, we propose in this paper, in a Tokamak operating at constant plasma current: to control the resistive part of the current by driving an H.F. current by Lower Hybrid Wave. To act on the current profile, with the constraint that q(o) > 1 by controlling the wave penetration. Constant plasma current Tokamak discharges in which a part of the current is driven by L.H.W. have been extensively studied on PETULA and this mode of operation has proven to be very efficient in stabilizing the sawtooth and M.H.D. activity

  15. Double-Frame Current Control with a Multivariable PI Controller and Power Compensation for Weak Unbalanced Networks

    CERN Document Server

    Siemaszko, Daniel

    2015-06-15

    The handling of weak networks with asymmetric loads and disturbances im- plies the accurate handling of the second-harmonic component that appears in an unbalanced network. This paper proposes a classic vector control approach using a PI-based controller with superior decoupling capabilities for operation in weak networks with unbalanced phase voltages. A synchronization method for weak unbalanced networks is detailed, with dedicated dimensioning rules. The use of a double-frame controller allows a current symmetry or controlled imbalance to be forced for compensation of power oscillations by controlling the negative current sequence. This paper also serves as a useful reminder of the proper way to cancel the inherent coupling effect due to the transformation to the synchronous rotating reference frame, and of basic considerations of the relationship between switching frequency and control bandwidth.

  16. Design of Controller for Reducing In-Rush Current of Single-Phase Induction Motor

    Energy Technology Data Exchange (ETDEWEB)

    Park, Su Kang; Baek, Hyung Lae; Lee, Sang Il [Chosun University, Kwangju (Korea)

    2001-05-01

    During an AC motor's start-up accelerating period, a large amount of current is required to reach to the rating speed. This is called in-rush current. This peak in-rush current can be more than about several times the operating or steady-state current in the full load rating of the motor. In-rush current is present in both and electronic ballasts. The main area of concern is the tripping of circuit breaker and fuses which can affect electrical system components From this, we can see that the electrical power controllers will be rather concerned, since they have to supply the actual current necessary to start the motor. This paper presents a new method to reducing in-rush current and energy saving of the single-phase induction motor used in air-conditioner. It can be obtained that proposed system is low cost and small size as compared with other controller. Experiments are focused on a capacitor starting single-phase induction motor. The optimal power saving and in-rush current limiting by phase angle control are verified by experimental results. Also, auxiliary winding was controlled by electronic starting switch. (author). 10 refs., 13 figs., 2 tabs.

  17. Indirect thermal control for improved reliability of Modular Multilevel Converter by utilizing circulating current

    DEFF Research Database (Denmark)

    Dowlatabadi, Mohammadkazem Bakhshizadeh; Ma, Ke; Loh, Poh Chiang

    2015-01-01

    semiconductor devices are comprehensively investigated. Also a novel control strategy by utilizing the circulating current is proposed to enhance the reliability performance of MMC in order to limit the amplitude of thermal cycles. It is concluded that the circulating current may change the losses and thermal...

  18. 37 CFR 1.419 - Display of currently valid control number under the Paperwork Reduction Act.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Display of currently valid... UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES International Processing Provisions General Information § 1.419 Display of currently valid control...

  19. Instantaneous Project Controls: Current Status, State of the Art, Benefits, and Strategies

    Science.gov (United States)

    Abbaszadegan, Amin

    2016-01-01

    Despite advancements in construction and construction-related technology, capital project performance deviations, typically overruns, remain endemic within the capital projects industry. Currently, management is generally unaware of the current status of their projects, and thus monitoring and control of projects are not achieved effectively. In…

  20. A DC Microgrid Coordinated Control Strategy Based on Integrator Current-Sharing

    DEFF Research Database (Denmark)

    Gao, Liyuan; Liu, Yao; Ren, Huisong

    2017-01-01

    The DC microgrid has become a new trend for microgrid study with the advantages of high reliability, simple control and low losses. With regard to the drawbacks of the traditional droop control strategies, an improved DC droop control strategy based on integrator current-sharing is introduced....... In the strategy, the principle of eliminating deviation through an integrator is used, constructing the current-sharing term in order to make the power-sharing between different distributed generation (DG) units uniform and reasonable, which can reduce the circulating current between DG units. Furthermore......, at the system coordinated control level, a hierarchical/droop control strategy based on the DC bus voltage is proposed. In the strategy, the operation modes of the AC main network and micro-sources are determined through detecting the DC voltage variation, which can ensure the power balance of the DC microgrid...

  1. Study on model current predictive control method of PV grid- connected inverters systems with voltage sag

    Science.gov (United States)

    Jin, N.; Yang, F.; Shang, S. Y.; Tao, T.; Liu, J. S.

    2016-08-01

    According to the limitations of the LVRT technology of traditional photovoltaic inverter existed, this paper proposes a low voltage ride through (LVRT) control method based on model current predictive control (MCPC). This method can effectively improve the photovoltaic inverter output characteristics and response speed. The MCPC method of photovoltaic grid-connected inverter designed, the sum of the absolute value of the predictive current and the given current error is adopted as the cost function with the model predictive control method. According to the MCPC, the optimal space voltage vector is selected. Photovoltaic inverter has achieved automatically switches of priority active or reactive power control of two control modes according to the different operating states, which effectively improve the inverter capability of LVRT. The simulation and experimental results proves that the proposed method is correct and effective.

  2. A fault-tolerant strategy based on SMC for current-controlled converters

    Science.gov (United States)

    Azer, Peter M.; Marei, Mostafa I.; Sattar, Ahmed A.

    2018-05-01

    The sliding mode control (SMC) is used to control variable structure systems such as power electronics converters. This paper presents a fault-tolerant strategy based on the SMC for current-controlled AC-DC converters. The proposed SMC is based on three sliding surfaces for the three legs of the AC-DC converter. Two sliding surfaces are assigned to control the phase currents since the input three-phase currents are balanced. Hence, the third sliding surface is considered as an extra degree of freedom which is utilised to control the neutral voltage. This action is utilised to enhance the performance of the converter during open-switch faults. The proposed fault-tolerant strategy is based on allocating the sliding surface of the faulty leg to control the neutral voltage. Consequently, the current waveform is improved. The behaviour of the current-controlled converter during different types of open-switch faults is analysed. Double switch faults include three cases: two upper switch fault; upper and lower switch fault at different legs; and two switches of the same leg. The dynamic performance of the proposed system is evaluated during healthy and open-switch fault operations. Simulation results exhibit the various merits of the proposed SMC-based fault-tolerant strategy.

  3. Current controller considering harmonics compensation for grid connected converter in DPGS applications

    DEFF Research Database (Denmark)

    Barote, L.; Marinescu, C.; Teodorescu, Remus

    2012-01-01

    This paper deals with the design and implementation of PR current control method in the αβ stationary reference frame for the grid side converter in Distributed Power Generation Systems (DPGS) applications. The goals of this paper are to implement a control technique for the grid side inverter...... including a LC filter, a compensation technique for low-order harmonics and to examine the grid current harmonic content with and without harmonic compensation. A comparative study in terms of current harmonic distortion between two different values of PR proportional gain running in steady state condition...

  4. Enhanced Decoupled Double Synchronous Reference Frame Current Controller for Unbalanced Grid-Voltage Conditions

    DEFF Research Database (Denmark)

    Reyes, M.; Rodriguez, Pedro; Vazquez, S.

    2012-01-01

    . In these codes, the injection of positive- and negative-sequence current components becomes necessary for fulfilling, among others, the low-voltage ride-through requirements during balanced and unbalanced grid faults. However, the performance of classical dq current controllers, applied to power converters......, under unbalanced grid-voltage conditions is highly deficient, due to the unavoidable appearance of current oscillations. This paper analyzes the performance of the double synchronous reference frame controller and improves its structure by adding a decoupling network for estimating and compensating...

  5. Method for controlling low-energy high current density electron beams

    International Nuclear Information System (INIS)

    Lee, J.N.; Oswald, R.B. Jr.

    1977-01-01

    A method and an apparatus for controlling the angle of incidence of low-energy, high current density electron beams are disclosed. The apparatus includes a current generating diode arrangement with a mesh anode for producing a drifting electron beam. An auxiliary grounded screen electrode is placed between the anode and a target for controlling the average angle of incidence of electrons in the drifting electron beam. According to the method of the present invention, movement of the auxiliary screen electrode relative to the target and the anode permits reliable and reproducible adjustment of the average angle of incidence of the electrons in low energy, high current density relativistic electron beams

  6. Active and reactive power control of a current-source PWM-rectifier using space vectors

    Energy Technology Data Exchange (ETDEWEB)

    Salo, M.; Tuusa, H. [Tampere University of Technology (Finland). Department of Electrical Engineering, Power Electronics

    1997-12-31

    In this paper the current-source PWM-rectifier with active and reactive power control is presented. The control system is realized using space vector methods. Also, compensation of the reactive power drawn by the line filter is discussed. Some simulation results are shown. (orig.) 8 refs.

  7. Towards Current Profile Control in ITER: Potential Approaches and Research Needs

    Science.gov (United States)

    Schuster, E.; Barton, J. E.; Wehner, W. P.

    2014-10-01

    Many challenging plasma control problems still need to be addressed in order for the ITER Plasma Control System (PCS) to be able to successfully achieve the ITER project goals. For instance, setting up a suitable toroidal current density profile is key for one possible advanced scenario characterized by noninductive sustainment of the plasma current and steady-state operation. The nonlinearity and high dimensionality exhibited by the plasma demand a model-based current-profile control synthesis procedure that can accommodate this complexity through embedding the known physics within the design. The development of a model capturing the dynamics of the plasma relevant for control design enables not only the design of feedback controllers for regulation or tracking but also the design of optimal feedforward controllers for a systematic model-based approach to scenario planning, the design of state estimators for a reliable real-time reconstruction of the plasma internal profiles based on limited and noisy diagnostics, and the development of a fast predictive simulation code for closed-loop performance evaluation before implementation. Progress towards control-oriented modeling of the current profile evolution and associated control design has been reported following both data-driven and first-principles-driven approaches. An overview of these two approaches will be provided, as well as a discussion on research needs associated with each one of the model applications described above. Supported by the US Department of Energy under DE-SC0001334 and DE-SC0010661.

  8. Start Up Current Control of Buck-Boost Convertor-Fed Serial DC Motor

    Directory of Open Access Journals (Sweden)

    Yusuf SÖNMEZ

    2009-02-01

    Full Text Available Generally, DC motors are given preference for industrial applications such as electric locomotives, cranes, goods lifts. Because of they have high starting moment; they initially start with high current. This high start-up current must be decreased since it may damage windings of the motor and increases power consumption. It could be controlled by an appropriate driver system and controller. The nature of fuzzy logic control has adaptive characteristics that can achieve robust response to a system with uncertainty, parameter variation, and load disturbance. In this paper, fuzzy logic based control of start-up current of a Buck-Boost Converter fed serial DC motor is examined through computer simulation. In order to see the advantages of fuzzy logic control, classical PI control has applied to the same motor, under same circumstances and has been compared. C++ Builder software has been used for the simulation. According to the simulation results, plainly, fuzzy logic control has stronger responses than classical PI control and uses lower current at starting moment.

  9. Mitigation of grid-current distortion for LCL-filtered grid-connected voltage-source inverter with inverter-side current control

    DEFF Research Database (Denmark)

    Xin, Zhen; Mattavelli, Paolo; Yao, WenLi

    2017-01-01

    Due to the low inductance of an LCL-filter, the grid current generated by an LCL-filtered Voltage Source Inverter (VSI) is sensitive to low-order grid-voltage harmonics. This issue is especially tough for the control system with Inverter Current Feedback (ICF), because the grid-current harmonics...... can freely flow into the filter capacitor without control. To cope with this issue, this paper develops an approach for the ICF control system to suppress the grid-current harmonics without adding extra sensors. The proposed method applies harmonic controllers and feedforward scheme simultaneously...

  10. Particle-in-cell simulations of electron beam control using an inductive current divider

    Energy Technology Data Exchange (ETDEWEB)

    Swanekamp, S. B.; Angus, J. R.; Cooperstein, G.; Ottinger, P. F.; Richardson, A. S.; Schumer, J. W.; Weber, B. V. [Plasma Physics Division, Naval Research Laboratory, Washington, District of Columbia 20375 (United States)

    2015-11-15

    Kinetic, time-dependent, electromagnetic, particle-in-cell simulations of the inductive current divider are presented. The inductive current divider is a passive method for controlling the trajectory of an intense, hollow electron beam using a vacuum structure that inductively splits the beam's return current. The current divider concept was proposed and studied theoretically in a previous publication [Swanekamp et al., Phys. Plasmas 22, 023107 (2015)]. A central post carries a portion of the return current (I{sub 1}), while the outer conductor carries the remainder (I{sub 2}) with the injected beam current given by I{sub b} = I{sub 1} + I{sub 2}. The simulations are in agreement with the theory which predicts that the total force on the beam trajectory is proportional to (I{sub 2}−I{sub 1}) and the force on the beam envelope is proportional to I{sub b}. Independent control over both the current density and the beam angle at the target is possible by choosing the appropriate current-divider geometry. The root-mean-square (RMS) beam emittance (ε{sub RMS}) varies as the beam propagates through the current divider to the target. For applications where control of the beam trajectory is desired and the current density at the target is similar to the current density at the entrance foil, there is a modest 20% increase in ε{sub RMS} at the target. For other applications where the beam is pinched to a current density ∼5 times larger at the target, ε{sub RMS} is 2–3 times larger at the target.

  11. Current error vector based prediction control of the section winding permanent magnet linear synchronous motor

    Energy Technology Data Exchange (ETDEWEB)

    Hong Junjie, E-mail: hongjjie@mail.sysu.edu.cn [School of Engineering, Sun Yat-Sen University, Guangzhou 510006 (China); Li Liyi, E-mail: liliyi@hit.edu.cn [Dept. Electrical Engineering, Harbin Institute of Technology, Harbin 150000 (China); Zong Zhijian; Liu Zhongtu [School of Engineering, Sun Yat-Sen University, Guangzhou 510006 (China)

    2011-10-15

    Highlights: {yields} The structure of the permanent magnet linear synchronous motor (SW-PMLSM) is new. {yields} A new current control method CEVPC is employed in this motor. {yields} The sectional power supply method is different to the others and effective. {yields} The performance gets worse with voltage and current limitations. - Abstract: To include features such as greater thrust density, higher efficiency without reducing the thrust stability, this paper proposes a section winding permanent magnet linear synchronous motor (SW-PMLSM), whose iron core is continuous, whereas winding is divided. The discrete system model of the motor is derived. With the definition of the current error vector and selection of the value function, the theory of the current error vector based prediction control (CEVPC) for the motor currents is explained clearly. According to the winding section feature, the motion region of the mover is divided into five zones, in which the implementation of the current predictive control method is proposed. Finally, the experimental platform is constructed and experiments are carried out. The results show: the current control effect has good dynamic response, and the thrust on the mover remains constant basically.

  12. Thoracic radiotherapy and breath control: current prospects; Radiotherapie thoracique et controle de la respiration: perspectives actuelles

    Energy Technology Data Exchange (ETDEWEB)

    Reboul, F.; Mineur, L.; Paoli, J.B.; Bodez, V.; Oozeer, R.; Garcia, R. [Institut Sainte-Catherine, 84 - Avignon (France)

    2002-11-01

    Three-dimensional conformal radiotherapy (3D CRT) is adversely affected by setup error and organ motion. In thoracic 3D CRT, breathing accounts for most of intra-fraction movements, thus impairing treatment quality. Breath control clearly exhibits dosimetric improvement compared to free breathing, leading to various techniques for gated treatments. We review benefits of different breath control methods -i.e. breath-holding or beam gating, with spirometric, isometric or X-ray respiration sensor- and argument the choice of expiration versus inspiration, with consideration to dosimetric concerns. All steps of 3D-CRT can be improved with breath control. Contouring of organs at risk (OAR) and target are easier and more accurate on breath controlled CT-scans. Inter- and intra-fraction target immobilisation allows smaller margins with better coverage. Lung outcome predictors (NTCP, Mean Dose, LV20, LV30) are improved with breath-control. In addition, inspiration breath control facilitates beam arrangement since it widens the distance between OAR and target, and leaves less lung normal tissue within the high dose region. Last, lung density, as of CT scan, is more accurate, improving dosimetry. Our institutions choice is to use spirometry driven, patient controlled high-inspiration breath-hold; this technique gives excellent immobilization results, with high reproducibility, yet it is easy to implement and costs little extra treatment time. Breath control, whatever technique is employed, proves superior to free breathing treatment when using 3D-CRT. Breath control should then be used whenever possible, and is probably mandatory for IMRT. (authors)

  13. A current controlled matrix converter for wind energy conversion systems based on permanent magnet synchronous generator

    Directory of Open Access Journals (Sweden)

    Naggar H. Saad

    2016-05-01

    Full Text Available The main challenges of wind energy conversion systems (WECS are to maximize the energy capture from the wind and injecting reactive power during the fault. This paper presents a current controlled matrix converter to interface Permanent Magnet Synchronous Generators (PMSG based WECS with the grid. To achieve fast dynamic response with reduced current ripples, a hysteresis current control is utilized. The proposed control system decouples the active and reactive components of the PMSG current to extract the maximum power from the wind at a given wind velocity and to inject reactive power to the grid. Reactive power injection during the fault satisfying the grid-codes requirement. The proposed WECS has been modeled and simulated using PSCAD/EMTDC software package.

  14. Large-current-controllable carbon nanotube field-effect transistor in electrolyte solution

    Science.gov (United States)

    Myodo, Miho; Inaba, Masafumi; Ohara, Kazuyoshi; Kato, Ryogo; Kobayashi, Mikinori; Hirano, Yu; Suzuki, Kazuma; Kawarada, Hiroshi

    2015-05-01

    Large-current-controllable carbon nanotube field-effect transistors (CNT-FETs) were fabricated with mm-long CNT sheets. The sheets, synthesized by remote-plasma-enhanced CVD, contained both single- and double-walled CNTs. Titanium was deposited on the sheet as source and drain electrodes, and an electrolyte solution was used as a gate electrode (solution gate) to apply a gate voltage to the CNTs through electric double layers formed around the CNTs. The drain current came to be well modulated as electrolyte solution penetrated into the sheets, and one of the solution gate CNT-FETs was able to control a large current of over 2.5 A. In addition, we determined the transconductance parameter per tube and compared it with values for other CNT-FETs. The potential of CNT sheets for applications requiring the control of large current is exhibited in this study.

  15. Rotor Current Control of DFIG for Improving Fault Ride - Through Using a Novel Sliding Mode Control Approach

    Science.gov (United States)

    Cai, Guowei; Liu, Cheng; Yang, Deyou

    2013-11-01

    The doubly fed induction generators (DFIG) have been recognized as the dominant technology used in wind power generation systems with the rapid development of wind power. However, continuous operation of DFIG may cause a serious wind turbine generators tripping accident, due to destructive over-current in the rotor winding which is caused by the power system fault or inefficient fault ride-through (FRT) strategy. A new rotor current control scheme in the rotor-side converter (RSC) ispresented to enhance FRT capacities of grid-connected DFIG. Due to the strongly nonlinear nature of DFIG and insensitive to DFIG parameter's variations, a novel sliding mode controller was designed. The controller combines extended state observer (ESO) with sliding model variable structure control theory. The simulation is carried out to verify the effectiveness of the proposed control approach under various types of grid disturbances. It is shown that the proposed controller provides enhanced transient features than the classic proportional-integral control. The proposed control method can effectively reduce over-current in the RSC, and the transient pulse value of electromagnetic torque is too large under power grid fault.

  16. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  17. Plug-and-play control and consensus algorithms for current sharing in DC microgrids

    DEFF Research Database (Denmark)

    Tucci, Michele; Meng, Lexuan; Guerrero, Josep M.

    2017-01-01

    In this paper, we propose a secondary consensus-based control layer for current sharing and voltage balancing in DC microGrids (mGs). Differently from existing approaches based on droop control, we assume decentralized Plug-and-Play (PnP) regulators at the primary level, as they provide voltage...... functions (Tucci et al., 2016a). Besides showing stability, current sharing, and voltage balancing in the asymptotic régime, we describe how to design secondary controllers in a PnP fashion when Distributed Generation Units (DGUs) are added or removed. Theoretical results are complemented by simulations...

  18. Design of PR current control with selective harmonic compensators using Matlab

    Directory of Open Access Journals (Sweden)

    Daniel Zammit

    2017-12-01

    Full Text Available This paper presents a procedure to design a Proportional Resonant (PR current controller with additional PR selective harmonic compensators for Grid Connected Photovoltaic (PV Inverters. The design of the PR current control and the harmonic compensators will be carried out using Matlab. Testing was carried out on a 3 kW Grid-Connected PV Inverter which was designed and constructed for this research. Both simulation and experimental results will be presented. Keywords: Inverters, Proportional-resonant controllers, Harmonic compensation, Photovoltaic, Matlab, SISO design tool

  19. Load Torque Compensator for Model Predictive Direct Current Control in High Power PMSM Drive Systems

    DEFF Research Database (Denmark)

    Preindl, Matthias; Schaltz, Erik

    2011-01-01

    The widely used cascade speed and torque controllers have a limited control performance in most high power applications due to the low switching frequency of power electronic converters and the convenience to avoid speed overshoots and oscillations for lifetime considerations. Model Predictive...... Direct Current Control (MPDCC) leads to an increase of torque control performance taking into account the discrete nature of inverters but temporary offsets and poor responses to load torque variations are still issues in speed control. A load torque estimator is proposed in this paper in order...

  20. A novel current mode controller for a static compensator utilizing Goertzel algorithm to mitigate voltage sags

    International Nuclear Information System (INIS)

    Najafi, E.; Yatim, A.H.M.

    2011-01-01

    Research highlights: → We proposed a new current control method for STATCOM. → The current control method maintains a fixed switching frequency. → It also produces fewer harmonics compared to conventional hysteresis method. → A new voltage dip (sag) detection method was used in STATCOM. → The control method can mitigate voltage sag in each phase separately. -- Abstract: Static compensator (STATCOM) has been widely proposed for power quality and network stability improvement. It is easily connected in parallel to the electric network and has many advantages for electrical grids. It can improve network stability; power factor, power transfer rating and can avoid some disturbances such as sags and swells. Most of STATCOM controllers are based on voltage controllers that are based on balanced d-q transform. However, they are not thorough solutions for network disturbances since in most cases single-phase disturbances occur in electrical networks that cannot be avoided by the conventional controllers. Voltage mode controllers are also not capable of responding fast enough to the changes expected of a network system. This paper proposes a new current mode controller to overcome the mentioned problem. The approach uses a fixed frequency current controller to maintain voltage levels in voltage sags (dips). This approach is also simple and can be easily implemented by digitally. It has superior performance over conventional methods in terms of harmonic reduction in STATCOM output current. Another important factor for STATCOM effectiveness in sag mitigation is its sag detection method. This paper also introduces a new sag detection method based on Goertzel algorithm which is both effective and simple for practical applications. The simulation results presented illustrate the superiority of the proposed controller and sag detection algorithm to be utilized in the STATCOM.

  1. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  2. Beam-based alignment technique for the SLC [Stanford Linear Collider] linac

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.

    1989-03-01

    Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs

  3. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  4. Study on the Electronic Magnetic Field Oriented Control Based on D-axis Current

    Directory of Open Access Journals (Sweden)

    Hongyu Feng

    2014-07-01

    Full Text Available In order to improve the magnetic field orientation accuracy and system performance, the electronic field oriented control has been a hot research field of the induction motor speed control. Although the vector control of AC machines has many excellent properties, the researchers have been attempting to simplify the calculating steps and the structure of the control system to improve the accuracy of filed-oriented and the performance of AC machine drives. Based on the analysis of the conventional induction motor magnetic field oriented control, this paper puts forward a novel method of stator magnetic field orientation control. By analytical methods, the given current of d-axis can be calculated directly, and the stator flux can be controlled precisely. This method has a fast flux and torque response, and the control performance is unaffected by the rotor parameters.

  5. Isochronous 180 degree turns for the SLC positron system

    International Nuclear Information System (INIS)

    Helm, R.H.; Clendenin, J.E.; Ecklund, S.D.; Kulikov, A.V.; Pitthan, R.

    1991-05-01

    The design of the compact, achromatic, second order isochronous 180 degrees turn for the SLC positron transport system will be described. Design criteria require an energy range of 200±20 MeV, energy acceptance of ±5%, transverse admittance of 25π mm-mr, and minimal lengthening of the 3 to 4 mm (rms) positron bunch. The devices had to fit within a maximum height or width of about 10 ft. Optics specifications and theoretical performance are presented and compared to experimental results based on streak camera measurements of bunch length immediately after the first isochronous turn (200 MeV) and positron beam energy spread after S-band acceleration to 1.15 GeV. 5 refs., 7 figs

  6. SLC status and SLAC [Stanford Linear Accelerator Center] future plans

    International Nuclear Information System (INIS)

    Richter, B.

    1989-08-01

    In this presentation, I shall discuss the linear collider program at the Stanford Linear Accelerator Center as it is now, and as we hope to see it evolve over the next few years. Of greatest interest to the high energy accelerator physics community gathered here is the development of the linear collider concept, and so I shall concentrate most of this paper on a discussion of the present status and future evolution of the SLC. I will also briefly discuss the research and development program that we are carrying out aimed at the realization of the next generation of high-energy linear colliders. SLAC had a major colliding-beam storage-ring program as well, including present rings and design studies on future high-luminosity projects, but time constraints preclude a discussion of them. 8 figs., 3 tabs

  7. Wakefield effects in the SLC beam delivery system

    International Nuclear Information System (INIS)

    Napoly, O.

    1996-06-01

    Wakefield effects occurring in the SLC after the LI28 emittance measurement station could be responsible for part of all of the observed discrepancy between the expected vertical spot sizes at the IP and the measured ones. The strongest wakefields are generated by the parts of the beam chamber which are the closest to the beam, like collimators. In this note we review the effect of the following wakefield sources: geometric wakefields from final focus fixed and movable collimators, geometric and resistive wakefields from linac collimators jaws, resistive wakefields from the beam pipe at the sextupole and final transformer locations. We mostly concentrate on the transverse dipole and quadrupole wakefield effects, although the longitudinal wakefields are briefly studied at the end. We limit ourselves to the vertical beam dynamics and to the lowest (mainly linear) order of the wakefield expansion with respect to the beam offset, which excludes the near wall effect on the beam. (author)

  8. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  9. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  10. Global tuning knobs for the SLC final focus

    International Nuclear Information System (INIS)

    Walker, N.J.; Irwin, J.; Woodley, M.

    1993-04-01

    The beam phase space at the exit of a given transport line generally depends on the incoming beam conditions, and thus in order to adjust the beam parameters at the exit of the line requires a prior knowledge of the initial beam parameters. The same is generally true for final focus systems. A tuning algorithm for β matching the SLC final focus is reported here in which no prior knowledge of the exact incoming phase space is required. Only a single beam size diagnostic located at either the interaction point (IP) or an image of the IP is required, together with a knowledge of the linear lattice from the quadrupoles to the tuning point. The algorithm is presented within the Lie Algebra framework. Although the algorithm is presented here is specific to linear collider final focus systems, the technique is generally applicable to any beamline

  11. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  12. Harmonic Mitigation Using a Polarized Ramp-time Current-Controlled Inverter

    Directory of Open Access Journals (Sweden)

    Lawrence J. Borle

    2010-12-01

    Full Text Available This paper describes the implementation of a shunt active power filter for a three-phase four-wire system to compensate for power quality problems generated by mixed non-linear loads, which are a combination of harmonic, reactive and unbalanced components. The filter is a three-phase current-controlled voltage source inverter (CC-VSI with a filter inductor at the AC output and a DC-bus capacitor. The CC-VSI is operated to directly control the grid current to be sinusoidal and in phase with the grid voltage without sensing the load currents. The switching is controlled using polarized ramp-time current control, which is based on the concept of zero average current error (ZACE with a fixed switching frequency. The laboratory experiment results indicate that the filter is able to mitigate predominantly the harmonics, as well as the reactive power, so that the grid currents are sinusoidal, in phase with the grid voltages and symmetrical although the grid voltage contains harmonics.

  13. SOME CONSIDERATIONS OVER THE INTERNAL CONTROL IN THE CONTEXT OF CURRENT ACCOUNTANCY REGULATIONS

    Directory of Open Access Journals (Sweden)

    Lenghel Dorin Radu

    2012-12-01

    Full Text Available Through the hereby study we set ourselves on an analysis over the internal control and the ways of implementation of it. The final purpose of our research is represented by the characteristics of the internal control system in the context of current accountancy regulations. The accomplishment of such goal has forced us to research the current literature in the area and also the legal regulations over internal control. Of course, the accomplishment of such a research was possible only after a pertinent analysis over the opinions expressed in specialty literature regarding this area. Our research wants to be with a theoretical and applicative character. It is based on analysing the internal control system, the methodology of internal control and the steps of internal control. We express our belief that the implementation of the internal control in a very exact manner comes as an aid to the company management and lead to the accomplishment of managerial objectives and policies. In what it regards the result of our research there can be drawn the following conclusions: from the legal regulations (OMFP nr. 3055/2009, there is no clear conclusion over the procedures and policies of implementation of internal control applicable to an economical entity; also there are not presented in a detailed way the types (forms of internal control, being presented in the legal regulations only a classification of them after the time in which they are exercised (before, during or after the finishing of the operations; also in the legal regulations there is developed a certain way of internal control, represented by the financial and accounting internal control, as if the other forms of internal control do not exist; in what regards the components of internal control, these are presented in another way, but similar to already known models of internal control (Coso and Coco; also in the legal regulations there are presented the general objectives of internal control

  14. A real-time current driving control system for the TJ-II coils

    International Nuclear Information System (INIS)

    Pena, Angel de la; Pacios, Luis; Carrasco, Ricardo; Lapayese, Fernando

    2009-01-01

    Since the start of plasma operation in the TJ-II stellarator, the required values of DC currents that are fed to its different coil sets have been controlled to high precision along the complete discharge flat-top. As a result each current configuration produced a highly stable magnetic-field configuration. Recently, the configurational flexibility of the TJ-II has been broadened by the commissioning of a new mode of operation that allows magnetic configurations to be varied dynamically during the discharge flat-top. In order to achieve this, new hardware and software features have been added to the TJ-II Control System. These new features may also provide new strategies for feedback control in accordance with parameters measured in one or more diagnostics. In this new set-up, coil current profiles are generated and controlled to millisecond timescales by a system based on VMEbus and OS9 real-time operating system. A new communication middleware architecture called XML-based Messages Distribution Service (X-MDS) has been designed to exchange XML-based data with calling clients. Furthermore, with this software, a fully functional Java application for supervision and for current profiles settings has been developed. This paper provides a detailed description of the complete TJ-II real-time current-profile control system and results obtained during its operation.

  15. A real-time current driving control system for the TJ-II coils

    Energy Technology Data Exchange (ETDEWEB)

    Pena, Angel de la [Association EURATOM - CIEMAT, Avda. Complutense 22, 28040 Madrid (Spain)], E-mail: a.delapena@ciemat.es; Pacios, Luis; Carrasco, Ricardo; Lapayese, Fernando [Association EURATOM - CIEMAT, Avda. Complutense 22, 28040 Madrid (Spain)

    2009-06-15

    Since the start of plasma operation in the TJ-II stellarator, the required values of DC currents that are fed to its different coil sets have been controlled to high precision along the complete discharge flat-top. As a result each current configuration produced a highly stable magnetic-field configuration. Recently, the configurational flexibility of the TJ-II has been broadened by the commissioning of a new mode of operation that allows magnetic configurations to be varied dynamically during the discharge flat-top. In order to achieve this, new hardware and software features have been added to the TJ-II Control System. These new features may also provide new strategies for feedback control in accordance with parameters measured in one or more diagnostics. In this new set-up, coil current profiles are generated and controlled to millisecond timescales by a system based on VMEbus and OS9 real-time operating system. A new communication middleware architecture called XML-based Messages Distribution Service (X-MDS) has been designed to exchange XML-based data with calling clients. Furthermore, with this software, a fully functional Java application for supervision and for current profiles settings has been developed. This paper provides a detailed description of the complete TJ-II real-time current-profile control system and results obtained during its operation.

  16. SLAC modulator operation and reliability in the SLC Era

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Ashton, J.R.

    1992-06-01

    A discussion of the operation and reliability of the 244 modulators in the SLAC linac with an emphasis on the past three years of operation. The linac modulators were designed and built in the 60's, upgraded for the SLAC Linear Collider (SLC) in the mid 80s, and despite their age are still reliable accelerator components. The 60s modulator operated at 65 MW peak and 83 kW average power. The upgrade resulted in 150 MW peak output at an average power of 87 kW, a modest increase since the repetition rate was dropped from 360 to 120 Hz. In the present accelerator configuration, the Linac operates as a source of electrons and positrons to a single pass coillider. The classic collider is a storage ring filled with oppositely charged, counter-rotating particles which are allowed to collide until an accelerator fault occurs and the stored beams are aborted. A reasonable storage ring can store and collide particles for as long as eight hours with a 10 or 20 minute filling time. A single pass collider, + on the other hand, can only produce e - and e + collisions at whatever rate the source operates. To be effective the SLC must operate at 120 Hz with a very high degree of reliability and on a continuous basis. Fortunately, the linac has a modest excess of modulator/klystron systems which allows some measure of redundancy and hence some freedom from the constraint that all 244 modulator/klystrons operate simultaneously. Nonetheless, high importance is placed on modulator MTBF and MTRR or, in the parlance of reliability experts and accelerator physicists, availability. This is especially true of the modulators associated with the fundamental requirements of a collider such as injection, compression and positron production

  17. Two-group Current-equivalent Parameters for Control Rod Cells. Autocode Programme CRCC

    Energy Technology Data Exchange (ETDEWEB)

    Norinder, O; Nyman, K

    1962-06-15

    In two-group neutron diffusion calculations there is mostly necessary to describe the influence of control rods by equivalent homogeneous two-group parameters in regions about the control rods. The problem is solved for a control rod in a medium characterized by two-group parameters. The property of fast and thermal neutr. on current equivalence is selected to obtain equivalent two-group parameters for a homogeneous cell with the same radius as the control rod cell. For the parameters determined one obtains the same fast and thermal neutron current into the rod cell and the equivalent cell independent of the fast and thermal flux amplitudes on the cell boundaries. The equivalent parameters are obtained as a solution of a system of transcendental equations. A Ferranti Mercury Autocode performing the solution is described. Calculated equivalent parameters for control rods in a heavy water lattice are given for some representative cases.

  18. High-frequency, three-phase current controller implementation in an FPGA

    Energy Technology Data Exchange (ETDEWEB)

    Hartmann, M.; Round, S. D.; Kolar, J. W.

    2008-07-01

    Three phase rectifiers with switching frequencies of 500 kHz or more require high speed current controllers. At such high switching frequencies analog controllers as well as high speed digital signal processing (DSP) systems have limited performance. In this paper, two high speed current controller implementations using two different field-programmable gate arrays (FPGA) - one for switching frequencies up to 1 MHz and one for switching frequencies beyond 1 MHz - are presented to overcome this performance limitation. Starting with the digital system design all the blocks of the signal chain, containing analog-to-digital (A/D) interface, digital controller implementation using HW-multipliers and implementation of a novel high speed, high resolution pulse width modulation (PWM) are discussed and compared. Final measurements verify the performance of the controllers. (author)

  19. Controlling hollow relativistic electron beam orbits with an inductive current divider

    Energy Technology Data Exchange (ETDEWEB)

    Swanekamp, S. B.; Richardson, A. S.; Angus, J. R.; Cooperstein, G.; Hinshelwood, D. D.; Ottinger, P. F.; Rittersdorf, I. M.; Schumer, J. W.; Weber, B. V.; Zier, J. C. [Plasma Physics Division, Naval Research Laboratory, Washington, DC 20375 (United States)

    2015-02-15

    A passive method for controlling the trajectory of an intense, hollow electron beam is proposed using a vacuum structure that inductively splits the beam's return current. A central post carries a portion of the return current (I{sub 1}), while the outer conductor carries the remainder (I{sub 2}). An envelope equation appropriate for a hollow electron beam is derived and applied to the current divider. The force on the beam trajectory is shown to be proportional to (I{sub 2}-I{sub 1}), while the average force on the envelope (the beam width) is proportional to the beam current I{sub b} = (I{sub 2} + I{sub 1}). The values of I{sub 1} and I{sub 2} depend on the inductances in the return-current path geometries. Proper choice of the return-current geometries determines these inductances and offers control over the beam trajectory. Solutions using realistic beam parameters show that, for appropriate choices of the return-current-path geometry, the inductive current divider can produce a beam that is both pinched and straightened so that it approaches a target at near-normal incidence with a beam diameter that is on the order of a few mm.

  20. Intensity and frequency stabilization of a laser diode by simultaneously controlling its temperature and current

    Science.gov (United States)

    Mu, Weiwei; Hu, Zhaohui; Wang, Jing; Zhou, Binquan

    2017-10-01

    Nuclear magnetic resonance gyroscope (NMRG) detects the angular velocity of the vehicle utilizing the interaction between the laser beam and the alkali metal atoms along with the noble gas atoms in the alkali vapor cell. In order to reach high precision inertial measurement target, semiconductor laser in NMRG should have good intensity and frequency stability. Generally, laser intensity and frequency are stabilized separately. In this paper, a new method to stabilize laser intensity and frequency simultaneously with double-loop feedback control is presented. Laser intensity is stabilized to the setpoint value by feedback control of laser diode's temperature. Laser frequency is stabilized to the Doppler absorption peak by feedback control of laser diode's current. The feedback control of current is a quick loop, hence the laser frequency stabilize quickly. The feedback control of temperature is a slow loop, hence the laser intensity stabilize slowly. With the feedback control of current and temperature, the laser intensity and frequency are stabilized finally. Additionally, the dependence of laser intensity and frequency on laser diode's current and temperature are analyzed, which contributes to choose suitable operating range for the laser diode. The advantage of our method is that the alkali vapor cell used for stabilizing laser frequency is the same one as the cell used for NMRG to operate, which helps to miniaturize the size of NMRG prototype. In an 8-hour continuous measurement, the long-term stability of laser intensity and frequency increased by two orders of magnitude and one order of magnitude respectively.