Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú
Directory of Open Access Journals (Sweden)
Luis A. Gomez-Puerta
2014-05-01
Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.
PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA
BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO
2004-01-01
Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.
Primer registro de la cotorra argentina (Myiopsitta monachus en Chihuahua, México
Directory of Open Access Journals (Sweden)
Ricardo Abel Soto-Cruz
2015-06-01
Full Text Available Reportamos el primer registro de la cotorra argentina (Myiopsitta monachus en las ciudades de Chihuahua y Delicias en Chihuahua, México. Observamos cinco individuos de esta especie de junio a diciembre de 2011 en las instalaciones de la Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua; grupos de 2 a 12 individuos en el área urbana de la ciudad de Chihuahua durante 2012, y cuatro individuos en ciudad Delicias, a 80 km al sureste de la ciudad de Chihuahua, en el 2013. Previamente, en enero de 2011, se reportó, en el portal electrónico de aVerAves, el avistamiento de un individuo en el noroeste del estado. Dada la presencia de nidos activos en las ciudades de Chihuahua y Delicias, la especie podría estar ya establecida en esta parte del país. Recomendamos dar seguimiento a las poblaciones existentes de esta especie a fin de documentar los posibles riesgos a los ecosistemas en la región.
Primer registro de anidación de Carao (Aramus guarauna en el estado de Nayarit, México
Directory of Open Access Journals (Sweden)
David Molina
2017-04-01
Full Text Available De 2012 a 2016 registramos la anidación de carao (Aramus guarauna en un humedal suburbano en el Parque Ecológico de Tepic en Nayarit, México, y puede considerarse que permanece en el sitio. Éste es el primer registro de anidación de esta especie en el estado de Nayarit; además, identificamos la ampliación de su intervalo reproductivo hacia el norte del país. Es muy probable que la residencia del carao en este humedal obedezca a la presencia de una población local de caracol manzana (Pomacea y, al parecer, a la ausencia de depredadores y competidores naturales en el sitio.
El primer registro de Simón Fernández de Moya, escribano público de Cuenca. 1423
Directory of Open Access Journals (Sweden)
Francisco Antonio Chacón Gómez-Monedero
2005-01-01
Full Text Available El estudio y publicación de los registros notariales de la Edad Media proporciona interesante información sobre aspectos sociales de los habitantes de cualquier población. En este trabajo estudiamos el primer registro que confeccionó el escribano Simón Fernández de Moya, investido de la «fieles pública» por el Concejo de Cuenca en sesión municipal de 7 de mayo de 1423. Se presta especial atención a los dos aspectos básicos que interesan al diplomatista: el de los caracteres externos e internos, según la tipología diplomática de los negocios que fedata el «auctor». Ante la imposibilidad material de transcribir el Registro hemos optado por regestar los asientos, acompañados de un índice onomástico.The publication of the present article shows the importance of notarial records in the Middie Ages and how they provide interested Information about social issues of the inhabitants of whichever town. On this review, it is studied the first record elaborated by Simón Fernández de Moya who was invested with «fieles publica» by the Council of Cuenca at municipal session on 7th May 1423. Two aspects can be taken into account by the diplomatist: the external and the infernal characters according to the typificatlon of Diplomatic about business. Because of the material imposibility to transcribe completely the record book, the present essay only summarize all seats as well as an Índex of ñames.
Directory of Open Access Journals (Sweden)
José Arturo García-Domínguez
2015-06-01
Full Text Available Reportamos el primer registro de la gaviota sombría (Larus fuscus en el estado de Veracruz; se trata de una especie cuya distribución geográfica ha estado expandiéndose, de Europa occidental hacia Norteamérica, desde la primera mitad del siglo XX hasta la fecha. Anida de forma regular en por lo menos dos áreas en el suroeste de Groenlandia, en las que la población reproductiva se ha estimado en más de 700 parejas. Su expansión parece estar ocurriendo también hacia el sur, ya que comenzó a reproducirse en las Islas Canarias a partir de 1995. El primer evento reproductivo confirmado en Norteamérica fue en Maine, EUA, en 2007. En México, el primer registro sucedió en 1979; la especie ha sido reportada en seis estados, con un notable incremento durante los últimos años. Nuestro registro ocurrió el 16 de marzo de 2008. La mayoría de los individuos registrados en el este de Norteamérica posiblemente provengan de poblaciones reproductivas ubicadas en Groenlandia o en Islandia, y quizá estén funcionando como puentes geográficos entre Europa noroccidental y Norteamérica. Con base en sus patrones migratorios y de expansión geográfica, y en el aumento de sus colonias reproductivas, L. f. graellsii es la subespecie que puede ocurrir más comúnmente en Norteamérica. Las características morfológicas del individuo registrado en este trabajo son consistentes con dicho taxón. Si consideramos la regularidad y la cantidad de registros en diferentes regiones del continente, es probable que la presencia de la especie se encuentre subestimada en las costas mexicanas del Golfo de México, siendo en realidad una especie regular, aunque poco abundante.
PRIMER REGISTRO DE LYCOPODIUM CLAVATUM (LYCOPODIACEAE PARA URUGUAY
Directory of Open Access Journals (Sweden)
Héctor A. González
2016-01-01
Full Text Available Se registra por primera vez para la flora uruguaya a Lycopodium clavatum (Lycopodiaceae, hallada en los departamentos de Durazno y Maldonado. Este nuevo registro extiende su área de distribución, es- tableciendo las localidades situadas en el centro y este del Uruguay como el límite distribucional austral de Lycopodium s. str. Se presenta una descripción diagnóstica, un mapa de distribución en el país, así como la ilustración de la especie y fotografías del hábitat.
Directory of Open Access Journals (Sweden)
Sergio H. Aguilar-Rodríguez
2015-06-01
Full Text Available Se describe el primer registro de la Perdiz Veracruzana o Chivizcoyo (Dendrortyx barbatus en la Sierra Norte de Oaxaca. Los métodos usados para obtener su registro así como la vegetación del área son descritos. Se menciona el conocimiento local autóctono de ave y su importancia económica, pese a no haber sido anteriormente registrada por ornitólogos. Se discuten evidencias que agregan certeza al registro y se menciona la importancia de éste para la ampliación de su rango de distribución.
PRIMER REGISTRO DE DENNSTAEDTIA DISSECTA (DENNSTAEDTIACEAE PARA LA FLORA ARGENTINA
Directory of Open Access Journals (Sweden)
Agustina Yañez
2012-01-01
Full Text Available Se cita por primera vez para la flora argentina a Dennstaedtia dissecta, hallada en la provincia de Misiones. Este nuevo registro surgió del estudio de ejemplares de los herbarios BA y LP, y luego se corroboró con colecciones realizadas en los Parques Provinciales Cruce Caballero y Urugua-í. Además de las características del rizoma y la lámina, las esporas resultaron una importante fuente de información en la identificación de esta especie. Se describen e ilustran los caracteres diagnósticos, y se incluye una clave para identificar a las especies de Dennstaedtia presentes en Misiones.
En este articulo se reporta por primera vez para el Peru una especies del genero Nielsonia Young, 1977, de material procedente del Departamento de Tumbes. El genero ha sido reportada anteriormente de Ecuador, como unico registro para Sudamerica, y America Central. El unico especimen hembra encontra...
Directory of Open Access Journals (Sweden)
César E. Medina
2016-12-01
Full Text Available El roedor Chilomys instans (Thomasomyini, Cricetidae es una especie común en la comunidad de mamíferos que habita los Andes del Norte en Sudamérica. Aquí presentamos el primer registro de la especie para el Perú, en base a la revisión morfológica de tres ejemplares colectados en el departamento de Cajamarca (Andes del Centro. Se presentan comentarios sobre la taxonomía de C. instans e información sobre su historia natural. La amplia distribución del género Chilomys en los Andes pone de manifiesto la necesidad de realizar la revisión taxonómica de éste género para esclarecer los límites de las especies que la conforman.
Directory of Open Access Journals (Sweden)
Acosta, Juan Carlos
2012-08-01
Full Text Available El objetivo de la presente comunicación es reportar por primera vez un caso de parasitismo en Rhinella arenarum y a la vez mencionar el primer registro del género Ornithodoros en el departamento de Valle Fértil, San Juan, Argentina. Siendo el primer registro de parasitismo de anfibios por Ornithodoros en la Argentina y el segundo para el neotrópico.
Directory of Open Access Journals (Sweden)
Letty Salinas
2013-06-01
Full Text Available El frutero pechinegro, Pipreola lubomirskii, es un cotíngido registrado como raro y de distribución local en los Andes del Norte. Antes del presente registro sólo había sido reportado para la vertiente oriental del Perú y Ecuador, así como los Andes del sur de Colombia. El presente registro amplia su distribución a los bosques montañosos de la vertiente occidental de los Andes peruanos, habiéndose encontrado en los bosques nublados del valle del río Zaña, en el departamento de Cajamarca (6º50’-6º52’ latitud S, 79º10’-79º07’ longitud O.
Directory of Open Access Journals (Sweden)
Lucas Landi
2011-12-01
Full Text Available La presencia de la "avispa taladradora de las latifoliadas", Tremex fuscicornis Fabricius (Hymenoptera: Siricidae, fue detectada en una plantación de álamos de la provincia de Buenos Aires, lo que constituye el primer registro de la especie para la Argentina. Se describen aspectos morfológicos y biológicos de la misma.The presence of the woodwasp Tremex fuscicornis Fabricius (Hymenoptera: Siricidae was detected in a poplar plantation in Buenos Aires. This is the first record of the species in Argentina. Morphological and biological aspects of the woodwasp are described.
Directory of Open Access Journals (Sweden)
Francisco Alonso Solís-Marín
2013-06-01
Full Text Available Se registra por primera vez para el Perú la especie de pepino de mar Heterocucumis godeffroyi(Semper, 1868 (Echinodermata: Holothuroidea. La especie fue recolectada a 19 m de profundidad en Pucusana, de-partamento de Lima. Este registro representa el límite más norteño de distribución de la especie reconocido hasta el momento. Material de referencia se encuentra depositado en la Colección de Zoología Acuática, del Laboratorio de Biología Marina, Departamento de Ciencias Biológicas y Fisiológicas, Universidad Peruana Cayetano Heredia, Lima, Perú.
Obtención de una placa fotosensible como material de registro holográfico
Directory of Open Access Journals (Sweden)
García, C.
2000-08-01
Full Text Available In this article was showed the procedure of obtaining and depositing of photosensitive dry films uses as holographic recording materials. We compare the thickness and the uniformity of plates obtained with two different depositing method, with a manual depositor and an automatic depositor. The influence of the thickness on the behaviour of the material as holographic recording material has been studied.
En este artículo se presenta, en primer lugar, el procedimiento de obtención y depositado de películas fotosensibles secas utilizadas como material de registro holográfico, comparando el espesor y uniformidad de las placas obtenidas con dos métodos de depositado distinto, con un depositador manual y con un depositador automático. En segundo lugar se analiza la influencia del espesor en el comportamiento del material como material de registro holográfico.
Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W
2009-04-01
The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.
Clasificación automática del registro lingüístico en textos del español: un análisis contrastivo
Directory of Open Access Journals (Sweden)
John Roberto Rodríguez
2013-07-01
Full Text Available Las aplicaciones colaborativas como los Sistemas de Recomendación se pueden beneficiar de la clasificación de textos en registros lingüísticos. En primer lugar, el registro lingüístico proporciona información sobre el perfil de los usuarios y sobre el contexto de la recomendación. En segundo lugar, considerar las características de cada tipo de texto puede ayudar a mejorar los métodos actuales de procesamiento de lenguaje natural. En este trabajo contrastamos dos enfoques, uno morfosintáctico y el otro léxico, para categorizar textos por registro en español. Para su evaluación aplicamos 38 algoritmos de aprendizaje automático con los que obtuvimos niveles de precisión superiores al 89%.
Directory of Open Access Journals (Sweden)
Gabrielle Gama Teixeira Lima
2009-01-01
Full Text Available Estudio documental, con planteo cuantitativo, con el propósito de averiguar si los registros de crecimiento y desarrollo del niño, en el contexto de la consulta de enfermería en el sistema de salud pública, están de acuerdo con lo propuesto por el Ministerio de Salud Pública y reflexionar si, en realidad, en los registros, el enfermero planea acciones que pueden impac- tar la salud de la población infantil. La muestra constó de 39 historiales médicos de niños, nacidos en 2006, acompañados durante un año, en la puericultura. Se comprobó que los criterios que estandarizan el acompañamiento del niño durante el primer año de vida, no estaban siendo efectuados, puesto que el acompañamiento estaba desvinculado de lo que preconiza el Ministerio de Salud Pública. De esa manera, se observó que en el espacio que estaría destinado a las consultas de puericultura hechas por los enfermeros, los registros muchas veces no existían, o estaban incompletos, por lo tanto, se percibió la necesidad de introducir e estimular discusiones sobre la importancia de la consulta de enfermería.
Primeros registros de la tribu kingsleyini (Crustácea: decápoda: pseudothlphusidae para Colombia
Directory of Open Access Journals (Sweden)
Rocha de Campos Martha Helena
1997-06-01
Full Text Available This is to report the first record for Colombia of two species of fresh-water crabs of the Kingsleyini Bolt, 1970 tribe. The species Prionothelphusa eliasi Rodríguez, 1980 and Orthothelphusa holthuisi (Rodríguez, 1967 had previously been recorded only for Venezuela.Se establece el primer registro para Colombia de la tribu Kingsleyini Bott, 1970, representado por las especies Prionothelphusa eliasi Rodríguez, 1980 y Orlhothelphusa holthuisi (Rodríguez, 1967. Estas especies solo habían sido registradas para Venezuela.
Directory of Open Access Journals (Sweden)
Gisella Márquez
2011-05-01
Full Text Available El oso de anteojos Tremarctos ornatus es el único representante de la familia Ursidae en Suramérica. La población más grande y de distribución continua del oso andino en el Perú, se localiza en la ladera oriental de la cordillera oriental, incluyendo al departamento de Puno, donde casi todos los registros de esta especie provienen solamente de encuestas. Se describe aquí dos registros indirectos de la presencia del oso en el departamento de Puno, obtenidos en agosto del año 2009. El primer registro corresponde a una feca, con semillas perteneciente a la familia Lauraceae, encontrada en Yanacocha; y el segundo registro corresponde a unas marcas de garras del oso hallado en Challohuma. Este último representa el registro más austral con- firmado para la distribución del oso de anteojos en el Perú. Nuestros registros evidencian una continuidad en la distribución de esta especie en la vertiente oriental de la cordillera andina, desde el sur del Perú hasta el noroeste de Bolivia. Estos registros se hallan también muy próximos al Parque Nacional Bahuaja Sonene (PNBS, uno de los corredores de conservación más importantes en el mundo, y muestran la importancia de establecer estrategias de conservación tanto dentro como fuera de la zona de amortiguamiento del PNBS.
Menocal, Octavio; Kendra, Paul E; Montgomery, Wayne S; Crane, Jonathan H; Carrillo, Daniel
2018-03-08
Ambrosia beetles have emerged as significant pests of avocado ((Persea americana Mill. [Laurales: Lauraceae])) due to their association with pathogenic fungal symbionts, most notably Raffaelea lauricola T.C. Harr., Fraedrich & Aghayeva (Ophiostomatales: Ophiostomataceae), the causal agent of the laurel wilt (LW) disease. We evaluated the interaction of ambrosia beetles with host avocado trees by documenting their flight height and daily flight periodicity in Florida orchards with LW. Flight height was assessed passively in three avocado orchards by using ladder-like arrays of unbaited sticky traps arranged at three levels (low: 0-2 m; middle: 2-4 m; high: 4-6 m). In total, 1,306 individuals of 12 Scolytinae species were intercepted, but six accounted for ~95% of the captures: Xyleborus volvulus (Fabricius) (Coleoptera: Curculionidae), Xyleborinus saxesenii Ratzeburg (Coleoptera: Curculionidae), Euplatypus parallelus (Fabricius) (Coleoptera: Curculionidae), Xyleborus bispinatus Eichhoff (Coleoptera: Curculionidae), Xyleborus affinis Eichhoff (Coleoptera: Curculionidae), and Hypothenemus sp. (Coleoptera: Curculionidae). The primary vector of R. lauricola, Xyleborus glabratus Eichhoff (Coleoptera: Curculionidae), was not detected. Females of X. volvulus showed a preference for flight at low levels and X. bispinatus for the low and middle levels; however, captures of all other species were comparable at all heights. At a fourth orchard, a baiting method was used to document flight periodicity. Females of X. saxesenii and Hypothenemus sp. were observed in flight 2-2.5 h prior to sunset; X. bispinatus, X. volvulus, and X. affinis initiated flight at ~1 h before sunset and Xylosandrus crassiusculus (Motschulsky) (Coleoptera: Curculionidae) at 30 min prior to sunset. Results suggest that ambrosia beetles in South Florida fly near sunset (when light intensity and wind speed decrease) at much greater heights than previously assumed and have species-specific patterns in host
INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN
Directory of Open Access Journals (Sweden)
Orzuza, Gloria Beatriz
2013-01-01
Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.
A coffee berry borer (Coleoptera: Curculionidae: Scolytinae) bibliography
One hundred years ago, one of the most significant biological invasions of an agricultural insect pest in the Americas was initiated. Endemic to Africa, the coffee berry borer (Hypothenemus hampei; Coleoptera: Curculionidae) was accidentally introduced to Brazil in 1913 and years later invaded coffe...
Directory of Open Access Journals (Sweden)
Sandra Patricia da Costa
2010-03-01
Full Text Available Os registros de enfermagem geram subsídios essenciais ao planejamento do cuidado individualizado, sendo a coleta de dados a primeira etapa do Processo de Enfermagem. O objetivo deste estudo foi avaliar os registros realizados pelos enfermeiros quanto ao exame físico do cliente na unidade de tratamento intensivo (UTI e na unidade de internação clínica (UIC. O estudo é transversal-retrospectivo, no qual foram avaliados 69 prontuários de clientes internados em UTI e transferidos para UIC de um hospital público e outro privado. Constatou-se que os registros realizados pelos enfermeiros, mais freqüentes e com melhor qualidade acerca do exame físico, foram os da UTI, enquanto na UIC eram mais frequentes os registros de intercorrências clínicas ocorridas durante o plantão. Evidenciou-se um déficit nos registros acerca do exame físico, o que pode dificultar a assistência individualizada com enfoque nas reais necessidades do cliente, uma vez que muitas alterações podem ser deixadas de serem registradas.Los registros de enfermería son esenciales para la planificación de la atención individualizada, y la recogida de datos el primer paso del proceso de enfermería. El objetivo de este estudio fue evaluar los registros realizados por los enfermeros referentes al examen físico del paciente de la Unidad de Tratamientos Intensivos (UTI y en la Unidad de Internación Clínica (UIC. El estudio es transversal retrospectivo, donde fueron evaluados prontuarios de pacientes internados en UTI y UIC de un hospital público y otro particular. De los 69 prontuarios evaluados, se verificó que los registros más frecuentes y con mejor calidad a respecto del examen físico fueron los de la UTI, mientras en la UIC ocurrían más evaluaciones solamente de intercurrencias sufridas por los pacientes. Se evidenció una caída en los registros a respecto del examen físico, lo que puede dificultar la asistencia individual y vuelta para las reales
Directory of Open Access Journals (Sweden)
Pablo Fuentes Olivares
2016-04-01
Full Text Available Se reporta por primera vez, un individuo en estado larval del cerambícido Acanthinodera cumingii (Hope, 1833 viviendo dentro del tocón de un arbusto exótico. Anteriormente, la larva de ésta especie se había registrado en 28 especies leñosas (14 nativos y 14 exóticos. Este registro aumenta su espectro alimenticio a un total de 29 especies leñosas. Se discute la incidencia de éste arbusto sobre la distribución de la especie.
Directory of Open Access Journals (Sweden)
Cesar Augusto Hernández-Suarez
2016-09-01
Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir
Brian Strom; Smith S.L.; Brownie C.
2013-01-01
Jeffrey pine, Pinus jeffreyi Greville and Balfour, is a dominant yellow pine and important overstory component of forests growing on diverse sites from southwestern Oregon to Baja California to western Nevada. The Jeffrey pine beetle, Dedroctonus jeffreyi Hopkins (Coleoptera: Curculionidae: Scolytinae), is monophagous on Jeffrey...
Acevedo-Cervantes, Alejandro; López-Martínez, Juana; Herrera-Valdivia, Eloisa; Rodríguez-Romero, Jesús
2009-01-01
Se recolectaron 143 ejemplares de tiburón narizón Apristurus nasutus (de Buen, 1959), durante un crucero de prospección en junio de 2007. Las muestras provinieron de tres lances realizados con una red de arrastre entre los 250 y los 460 m de profundidad, en la parte media y alta del Golfo de California. El hallazgo representa el primer registro de la especie en aguas mexicanas y por consiguiente la ampliación de su ámbito de distribución. Los organismos capturados se encontraron agrupados en ...
El principio de confiabilidad en el registro electoral. La experiencia cubana
Directory of Open Access Journals (Sweden)
Raudiel Peña Barrios
2015-01-01
Full Text Available Este artículo pretende dar una panorámica acerca del contenido del principio de confiabilidad en materia registral, específicamente, en sede del registro de electores. Abordaremos las implicaciones que dicho principio tiene para la información que es manejada por los registros electorales, así como las medidas que pueden desarrollarse con el objetivo de lograr niveles cada vez más altos de confiabilidad. En este sentido, expondremos experiencias que se basan fundamentalmente en la utilización de la biometría y en el fortalecimiento del registro civil, como sustento, este último, de un registro electoral eficiente teniendo en cuenta la relación natural que existe entre ambos. Además, ofreceremos un análisis detallado de los puntos de ruptura del registro de electores cubano con el citado principio, con el objetivo de analizar la experiencia de Cuba. Por último, expondremos algunas ideas generales que pudieran contribuir al perfeccionamiento del registro electoral cubano
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
The Peritelini (Coleoptera: Curculionidae, Entiminae of the Vitale collection
Directory of Open Access Journals (Sweden)
Cosimo Baviera
2016-01-01
Full Text Available The collection of Peritelini (Coleoptera Curculionidae Entiminae currently stored in the Vitale collection of Messina University is an element of great importance for studies of taxonomy and biogeography of these rarely collected weevils. All species are commented in relation to the contributions to this taxonomic group, published on several occasions by the authors.
Directory of Open Access Journals (Sweden)
Gorgonio Ruiz-Campos
2010-08-01
Full Text Available New specimens and new records of occurrence for 10 species of chondrichthyan (elasmobranch and chimaeroid fishes previously unknown or little documented for the continental shelf of the Mexican Pacific are reported. This contribution provides the first record of Centroscyllium nigrum, Isurus paucus, and Bathyraja trachura for the Mexican Pacific, as well as new specimens of Hydrolagus colliei, Hexanchus griseus, Echinorhinus cookei, Pseudocarcharias kamoharai, and Raja velezi for the western coast of the Baja California Peninsula, including the intermediate record within the known distribution range for Apristurus kampae, and the southernmost record for Raja inornata.Se reportan nuevos ejemplares y nuevos registros de concurrencia para 10 especies de elasmobranquios previamente desconocidos o con muy poca documentación en aguas del Pacífico mexicano. Esta contribución ofrece el primer registro de Centroscyllium nigrum, Isurus paucus, y Bathyraja trachura en el Pacífico mexicano; así como nuevos ejemplares de Hydrolagus colliei, Hexanchus griseus, Echinorhinus cookei, Pseudocarcharias kamoharai y Raja velezi en la costa occidental de la península de Baja California, con la inclusión del registro intermedio en el ámbito de distribución conocida para Apristurus kampae, y el registro más meridional para Raja inornata.
William Shepherd; Brian Sullivan; Bradley Hoosier; JoAnne Barrett; Tessa Bauman
2010-01-01
We conducted laboratory and field bioassays to characterize the pheromone system of an ash bark beetle, Hylesinus pruinosus Eichhoff (Coleoptera: Curculionidae: Scolytinae). Solitary females in newly initiated galleries in ash logs produced (+)-exo-brevicomin, whereas male beetles paired with females produced (+)-endo-brevicomin, lesser quantities of...
In 2010, the exotic ambrosia beetle, Euwallacea nr. fornicatus Eichhoff (Coleoptera: Curculionidae: Scolytinae) was first discovered in Florida avocado groves. Introduction of its symbiotic Fusarium spp. fungi into galleries in the xylem tissue results in Fusarium-dieback disease. Unlike most ambros...
Directory of Open Access Journals (Sweden)
Georgina Erra
2016-01-01
Full Text Available En esta contribución se da a conocer el primer registro de termiteros fósiles para la región Mesopotámica de Argentina, y su disposición espacial, al tiempo que se discuten sus afinidades taxonómicas e implicancias paleoambientales. Las estructuras fósiles pertenecen a nidificaciones de insectos sociales atribuibles a miembros de la Familia Termitidae, y se ubican en la zona de contacto entre la base de la Fm. Toropí/Yupoí (Pleistoceno tardío y el tope de la Fm. Ituzaingó (Mioceno tardío-Plioceno. Se las identifica en los alrededores del Arroyo Toropí (28°36’ S y 59°02’ W, Departamento Bella Vista, provincia de Corrientes. El estudio de las nidificaciones y su disposición espacial se realizó en cinco campos de termiteros mediante su relevamiento y descripción morfológica. La morfología de las estructuras estudiadas coincide claramente con la de los nidos de termitas, en donde resulta característica una fuerte muralla externa. La caracterización de campo, yacencia, desarrollo, frecuencia, tamaños e interrelaciones de los termiteros fósiles y actuales sugieren una estrecha similitud con montículos del género Cornitermes. La morfología presente muestra también cierta semejanza con Tacuruichnus farinai, descripta para el Piso/Edad Marplatense (Plioceno de la región Pampeana. Por otro lado, el análisis fitolítico indicó que las cantidades y las morfologías fitolíticas son semejantes tanto en los termiteros actuales como en los fósiles. Desde un punto de vista paleoambiental, la abundancia de estos termiteros en el contacto entre las mencionadas unidades indicaría la existencia de suelos bien desarrollados, con abundante vegetación graminosa y condiciones húmedas y cálidas con estacionalidad marcada.
The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), has been the most important pest of cotton (Gossypium spp.) wherever it occurs. Although eradication programs in the U.S. have reduced the range of this pest, the weevil remains an intractable problem in subtropical Tex...
Una mirada semiótica-comunicativa a nuestros registros
Directory of Open Access Journals (Sweden)
Rodríguez, María Itatí
2016-07-01
Full Text Available [es] La celebración de los actos patrios escolares que cuenta con más de un centenar de años de su realización, postula determinados modos de hacer/saber/poder puestos en escena mediante formatos comunicativos densos. En este artículo presentaremos algunos análisis y discusiones al registro durante el trabajo de campo desde herramientas teórico-metodológicas que nos ofrecen la comunicación y la semiótica. Las escenas analizadas corresponden a una investigación doctoral en curso que comprende un estudio empírico sobre efemérides patrias escolares, construcción identitaria y mecanismos de memoria, en el cual se analizan los actos patrios escolares vinculados con la conformación de la identidad nacional, expresiones identitarias locales y en territorios de fronteras, particularmente de la provincia de Misiones, Argentina. De esta manera, en un primer momento narramos nuestras travesías durante la puesta en escena de la efemérides del “25 de Mayo”. Finalmente, pretendemos realizar un aporte a los debates en torno al investigador en campo: ¿Qué lugares ocupan los sentidos y el cuerpo del investigador durante estas travesías? ¿Qué huellas dejamos en nuestros registros?. [en] The celebration of patriotic acts schools with more than one hundred years of its implementation, postulates certain ways of making/knowledge/power staged by dense communication formats. This article presents some analysis and discussion to record during field work from theoretical and methodological tools that we provide communication and semiotics. The scenes analyzed correspond to a doctoral research course comprising an empirical study on school national days, identity construction and mechanisms of memory, in which schoolchildren are analyzed patriotic acts connected with the formation of national identity and local identity and expression border territories, particularly in the province of Misiones, Argentina. Thus, at first we narrate our
Directory of Open Access Journals (Sweden)
Diego Acevedo Aguilar
2013-06-01
Full Text Available A memória natural, ligada ao corpo e ao seu universo sensitivo, parece ter cedido lugar à memória instrumental, dependente da tecnologia e dos seus dispositivos. A cultura dá um giro radical: privilegia-se o registro em detrimento da vivência, a prova em relação à experiência. Ao menos é o que parece nesta passagem da religiosidade quitenha.
Primer registro de artropodofauna cadavérica en sustratos humanos y animales en San Juan, Argentina
Directory of Open Access Journals (Sweden)
Fernando H. ABALLAY
2008-01-01
Full Text Available En el presente trabajo se estudiaron los artrópodos carroñeros que acudieron a cadáveres de vertebrados al aire libre en la provincia de San Juan, Argentina. El objetivo fue inventariar la composición específica de la artropodofauna cadavérica, asociada a diferentes sustratos de vertebrados en descomposición. Se colectaron muestras de artrópodos sobre restos animales y humanos en condiciones de campo y sobre cadáveres de cerdos domésticos colocados al aire libre bajo condiciones controladas. Se registraron, por primera vez para la provincia de San Juan, 40 especies de artropodofauna tanatológica incluidas en cuatro órdenes y 15 familias. Se incorpora, como primera cita para la fauna forense argentina, un necrófago: Megelenophorus americanus Lacordaire (Coleoptera: Tenebrionidae, y tres necrófilas: Polybia ruficeps Schrottky (Hymenoptera: Vespidae, Pheidole bergi Mayr (Hymenoptera, Formicidae, Myrmicinae y Ectatomma brunneum Smith (Hymenoptera, Formicidae, Ponerinae. Se citan 18 especies necrófagas, 18 necrófilas, una omnívora y seis oportunistas sobre siete diferentes sustratos cadavéricos de vertebrados. Se brindan nuevos registros de distribución de 18 especies de insectos. Se confirma la estacionalidad invernal de Callíphora vicina Robineau-Desvoidy (Diptera: Calliphoridae.
Directory of Open Access Journals (Sweden)
Zamorano, M.
2015-06-01
ín (Plioceno y, suprayacentes a esta, otras dos: Formación Esperanza y Formación El Búho (Pleistoceno tardío. El material que se da a conocer en esta comunicación fue exhumado en la Cantera Alcancía (36°58′40′′.06 S; 60°12′23′′.92 O, en niveles correspondientes al Chapadmalalense Superior de la Formación El Polvorín. El material mencionado consiste en osteodermos de la región dorso-lateral de la porción posterior de la coraza dorsal de N. coagmentatus. Se da a conocer el primer registro fehaciente de N. coagmentatus para la región Pampeana, se describe el material hallado, se detalla su procedencia y se presenta el perfil estratigráfico detallado correspondiente.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Ambrosia beetles in the Euwallacea nr. fornicatus complex (Coleoptera: Curculionidae) vector Fusarium spp. fungi pathogenic to susceptible hosts, including avocado. The Florida avocado production area in Miami-Dade County was surveyed for E. nr. fornicatus upon observations of initial damage in 2016...
The boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally...
Directory of Open Access Journals (Sweden)
JOSE RUBIO-GOMEZ
2009-05-01
Full Text Available RESUMEN Se presenta una sinopsis de los escarabajos de la subfamilia Dryophthorinae (Coleoptera: Curculionidae asociados a cultivos de plátano y banano en Colombia. Adicionalmente se ofrecen claves ilustradas para las especies del país. Se registran seis especies asociadas a dichos cultivos: Cosmopolites sordidus (Germar, 1824, Metamasius hemipterus (Linnaeus, 1758, Metamasius hebetatus (Gyllenhal, 1838, Metamasius submaculatus Champion, 1910, Rhyncophorus palmarum (Linnaeus, 1758 y Polytus mellerborgii (Boheman, 1838. Palabras clave: picudos, plátano, banano, Polytus, Colombia. ABSTRACT This synopsis is about beetle’s subfamily Dryophthorinae (Coleoptera: Curculionidae associated to plantain and banana crops. Additionally keys illustrated for the species of the country are offered. Six species associated to these cultures are registered: Cosmopolites sordidus (Germar, 1824, Metamasius hemipterus (Linnaeus, 1758, Metamasius hebetatus (Gyllenhal, 1838, Metamasius submaculatus Champion, 1910, Rhyncophorus palmarum (Linnaeus, 1758 y Polytus mellerborgii (Boheman, 1838. Key words: weevils, plantain, banana, Polytus, Colombia.
El registro civil e identificación en la región y el mundo
Directory of Open Access Journals (Sweden)
Felix Ortega de la Torre
2018-01-01
Full Text Available Realiza un repaso histórico, así como un recorrido por el desarrollo del proceso registral civil en la región latinoamericana. Enfatiza en la importancia que existe en la relación entre el registro de personas y el desarrollo, la democracia, la gobernabilidad; así como para la inclusión, la transparencia, la seguridad, la eficiencia de recursos y la generación de un Estado moderno digital. Puntualmente, analiza los modelos de registro e identificación, el fortalecimiento del registro civil en el siglo veintiuno, las tendencias futuras, el registro universal y sus nuevos desafíos
Directory of Open Access Journals (Sweden)
Gabriel Natalio Castillo
2015-05-01
Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Zornoza Moreno, Matilde
2014-01-01
OBJETIVOS El objetivo general se centró en conocer si el neurodesarrollo y la regulación de los ritmos circadianos de los niños pueden estar influidos por la presencia de diabetes gestacional materna (GDM). Se plantearon como objetivos secundarios: Evaluar si los sensores utilizados en adultos para el registro de temperatura periférica y actividad son útiles en la medición de los estos mismos ritmos circadianos durante el primer año de vida y determinar si existe relación entre la madurac...
Daniel Miller; Jeremy Allison
2011-01-01
In 2006, we tested the responses of the small southern pine engraver, Ips avulsus (Eichhoff) (Coleoptera: Curculionidae), to multiple-funnel traps baited with (+)-, (-)-, and (+/-)- ipsdienol. Three experiments were conducted in Georgia with all traps co-baited with one of the following lure combinations, respectively: experiment 1, ipsenol; experiment 2, lanierone and...
Avaliação dos registros de enfermagem em hemoterapia de um hospital geral
Directory of Open Access Journals (Sweden)
Silvânia Paiva dos Santos
2013-06-01
Full Text Available Objetivo: avaliar os registros de enfermagem em hemoterapia nas unidades de internação de um hospital geral. Métodos: Estudo descritivo e exploratório, realizado no período de julho a outubro de 2009, em um hospital de grande porte no interior de Minas Gerais, Brasil. Foram auditados 606 prontuários de pacientes que se submeteram ao tratamento hemoterápico. Doze quesitos foram analisados nos registros de enfermagem. Resultados: Foram analisadas 7.272 anotações. Dos itens avaliados, 65,5% estavam em conformidade. Dentre as não conformidades auditadas, as que apresentaram maior frequência foram: os "Sinais Vitais Pós-Transfusional" (83,8%, o "Registro de Observação nos 10 minutos iniciais" (73,6%, o "Número da Bolsa" (61,2%, "Horário de Término" e "Sinais Vitais Início" (57,3%. Os procedimentos que obtiveram melhor resultado foram: "Assinatura" (0,7%, "Carimbo" (1,5% e "Cabeçalho" (2,8%. Conclusão: Apesar de necessitar melhorias, a qualidade dos registros foi considerada boa, pois a maioria dos registros sobre hemoterapia estava em conformidade.
SEPÚLVEDA-CANO, PAULA A; RUBIO-GÓMEZ, JOSÉ D
2009-01-01
Se presenta una sinopsis de los escarabajos de la subfamilia Dryophthorinae (Coleoptera: Curculionidae) asociados a cultivos de plátano y banano en Colombia. Adicionalmente se ofrecen claves ilustradas para las especies del país. Se registran seis especies asociadas a dichos cultivos: Cosmopolites sordidus (Germar, 1824), Metamasius hemipterus (Linnaeus, 1758), Metamasius hebetatus (Gyllenhal, 1838), Metamasius submaculatus Champion, 1910, Rhyncophorus palmarum (Linnaeus, 1758) y Polytus mell...
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
M. L. Gaylord; K. K. Williams; R. W. Hofstetter; J. D. McMillin; T. E. Degomez; M. R. Wagner
2008-01-01
Determination of temperature requirements for many economically important insects is a cornerstone of pest management. For bark beetles (Coleoptera: Curculionidae, Scolytinae), this information can facilitate timing of management strategies. Our goals were to determine temperature predictors for flight initiation of three species of Ips bark beetles...
Directory of Open Access Journals (Sweden)
Rodrigo Vieira
2011-12-01
Full Text Available O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o país e novos registros para o grupo holosericeus (Diptera, Asilidae. Neste trabalho é descrita uma nova espécie de Ommatius Wiedemann, 1821 para o estado do Amazonas, pertencente ao grupo ampliatus. Além disso, são fornecidos novos registros, variações taxonômicas, ilustrações e descrição das estruturas das terminálias masculina e feminina para as espécies do grupo holosericeus.
Armando T. Wakida-Kusunoki; Luis Enrique Amador del Angel
2008-01-01
Se reporta la presencia de los plecos Pterygoplichthys pardalis y P. disjunctivus en nuevas localidades en el sureste de México. Los organismos fueron colectados en los ríos San Pedro y Palizada en el estado de Campeche en diciembre de 2007. Estos registros representan el primer reporte en México de P. disjunctivus y el primero de P. pardalis en Campeche.The sailfish catfishes Pterygoplichthys pardalis and P. disjunctivus are reported in new localities in Southeastern Mexico. The specimens we...
Cranberry weevil, Anthonomus musculus Say (Coleoptera: Curculionidae), is a key pest of highbush blueberries in the northeast USA. To date, however, no trapping system has been developed to successfully monitor this pest. In 2012-2014, studies were conducted in commercial blueberry farms in New Jers...
CUYA ZEVALLOS, CARLA MADELEINE GRACIELA
2015-01-01
CALIDAD REGISTROS DE EVOLUCIÓN DE ENFERMERÍA CALIDAD EN LOS REGISTROS DE EVOLUCIÓN DE ENFERMERÍA INDICADORES DE CALIDAD DE LOS REGISTROS DE EVOLUCIÓN DE ENFERMERÍA FINALIDAD DE LOS REGISTROS DE EVOLUCIÓN DE ENFERMERÍA RESPONSABILIDAD DE LOS REGISTROS DE EVOLUCIÓN DE ENFERMERÍA CARACTERÍSTICAS DE LOS REGISTROS DE EVOLUCIÓN DE ENFERMERÍA
Sim, Sheina B; Yoneishi, Nicole M; Brill, Eva; Geib, Scott M; Follett, Peter A
2016-02-01
The coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae), is a serious pest of coffee worldwide. It was first detected in Hawai'i in 2010. Two predatory beetles, Cathartus quadricollis (Coleoptera: Silvanidae) and Leptophloeus sp. (Coleoptera: Laemophloeidae), have been observed in H. hampei-infested coffee. Under laboratory conditions, colony-reared C. quadricollis and Leptophloeus sp. prey upon all life stages of H. hampei. However, the H. hampei life cycle occurs almost exclusively within a coffee bean obscured from direct observation. Thus, it is unknown if C. quadricollis and Leptophloeus sp. consume H. hampei as prey in the wild. To demonstrate predation of H. hampei by C. quadricollis and Leptophloeus sp., a molecular assay was developed utilizing species-specific primers targeting short regions of the mitochondrial COI gene to determine species presence. Using these primers, wild C. quadricollis and Leptophloeus sp. were collected and screened for the presence of H. hampei DNA using PCR. Analysis of collections from five coffee farms revealed predation of C. quadricollis and Leptophloeus sp. on H. hampei. Further laboratory testing showed that H. hampei DNA could be detected in predators for as long as 48 h after feeding, indicating the farm-caught predators had preyed on H. hampei within 2 d of sampling. This study demonstrates the utility of molecular markers for the study of the ecology of predators and prey with cryptic behavior, and suggests C. quadricollis and Leptophloeus sp. might be useful biocontrol agents against H. hampei. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.
A VISÃO DA EQUIPE DE ENFERMAGEM SOBRE SEUS REGISTROS
Directory of Open Access Journals (Sweden)
Lorena Mara Nóbrega de Azevêdo
2012-01-01
Full Text Available El objetivo fue conocer la percepción de enfermeros acerca de sus registros y cómo están hechos. Estudio descriptivo, exploratorio, cualitativo, realizado en el Hospital Universitario Onofre Lopes en Natal/RN, Brasil, con 15 profesionales de equipo de enfermería. La recolección de datos ocurrió con entrevistas semiestructuradas sometidas a análisis de contenido temática. Los profesionales perciben sus registros como herramienta indispensable al servicio, cuyas funciones abarcan la comunicación, el apoyo legal y la evaluación del trabajo desarrollado. En su contenido hay información sobre los procedimientos realizados y pequeña descripción de los aspectos emocionales. También se comprobó que las anotaciones de enfermería se consolidan en sólo momento de la documentación, hay distorsión entre este concepto y la evolución de la enfermería. Los profesionales de enfermería comprenden la importancia, las funciones y el contenido de sus registros, todavía, necesitan mejorar su producción.
A checklist of the genus Blosyrus Schoenherr (Coleoptera: Curculionidae: Entiminae of the world
Directory of Open Access Journals (Sweden)
G. Mahendiran
2013-08-01
Full Text Available An annotated checklist of Blosyrus Schoenherr (Coleoptera: Curculionidae: Entiminae comprising 101 species with their updated nomenclature, synonyms and distribution is given. The distribution pattern indicates that the genus is diversified mostly in the Sub-Saharan Africa and Asia regions. Out of 101 species, 92 occur in Sub-Saharan Africa. From India, eight species were recorded. In India, the distribution is mainly in West Bengal, Assam, Maharashtra, Andhra Pradesh, Karnataka and Tamil Nadu.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Alejandro Acevedo-Cervantes; Juana López-Martínez; Eloisa Herrera-Valdivia; Jesús Rodríguez-Romero
2009-01-01
Se recolectaron 143 ejemplares de tiburón narizón Apristurus nasutus (de Buen, 1959), durante un crucero de prospección en junio de 2007. Las muestras provinieron de tres lances realizados con una red de arrastre entre los 250 y los 460 m de profundidad, en la parte media y alta del Golfo de California. El hallazgo representa el primer registro de la especie en aguas mexicanas y por consiguiente la ampliación de su ámbito de distribución. Los organismos capturados se encontraron agrupados en ...
Alicia Nino-Dominguez; Brian T. Sullivan; Jose H. Lopez-Urbina; Jorge E. Macias-Samano
2016-01-01
In southern Mexico and Central America, the southern pine beetle Dendroctonus frontalis Zimmermann (Coleoptera: Curculionidae: Scolytinae) commonly colonizes host trees simultaneously with Dendroctonus mesoamericanus Armend
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
Brian T. Sullivan; Cavell Brownie; JoAnne P. Barrett
2016-01-01
The southern pine beetle Dendroctonus frontalis Zimmermann (Coleoptera: Curculionidae: Scolytinae) is attracted to an aggregation pheromone that includes the multifunctional pheromone component endobrevicomin. The effect of endo-brevicomin on attractive lures varies from strong enhancement to reduction of beetle attraction depending upon release rate, lure component...
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
El registro de franquiciadores en el marco de las competencias de la Comunidad Foral de Navarra
Lara González, Rafael
2000-01-01
Se ha creado un Registro de franquiciadores a nivel del Estado que garantiza la centralización de los datos relativos a las empresas franquiciadoras que operen en más de una Comunidad Autónoma, a los efectos de información y publicidad; y, a este fin, se fijan las directrices técnicas y de coordinación entre los registros similares que puedan establecer las Comunidades Autónomas. En todo caso, la llevanza del Registro de franquiciadores corresponde a las Comunidades Autónomas d...
Paralisia periodica tireotoxica: registro de um caso
Directory of Open Access Journals (Sweden)
Athos Scherer Torres
1979-06-01
Full Text Available É relatado um caso de paralisia periódica tireotóxica. Os autores chamam a atenção para o fato de não haver registro de publicações semelhantes na literatura brasileira nos 10 últimos anos. São abordados diversos aspectos do diagnóstico diferencial com outros tipos de paralisia periódica.
Diptera, Muscidae, Cariocamyia maculosa Snyder: Primeiro Registro para o Nordeste do Brasil
Thayana Monteiro; Freddy Ruben Bravo
2011-01-01
Cariocamyia maculosa Snyder, é um Muscidae com registros para a Colômbia e Brasil (regiões Sul, Sudeste e Centro-Oeste). Em um levantamento de dípteros saprófagos na cidade de Feira de Santana no estado da Bahia com iscas de origem orgânico animal em putrefação, foram coletados 46 espécimes de C. maculosa. Esse é o primeiro registro da espécie para a Bahia e Nordeste do Brasil. Apesar de C. maculosa ter sido encontrada...
Registro Español de Ablación con Catéter. IV Informe Oficial (2004
Directory of Open Access Journals (Sweden)
Miguel Álvarez López
2006-01-01
Conclusiones: Aun con una participación ligeramente inferior a la de años anteriores, el volumen de ablaciones recogidas (> 4.000 y los resultados concordantes con los registros precedentes confirman la validez y la consistencia de nuestro registro.
Directory of Open Access Journals (Sweden)
Sidney Alberto do Nascimento Ferreira
2003-12-01
Full Text Available No Brasil, a ocorrência de Conotrachelus dubiae O'Brien, 1995 (Coleoptera: Curculionidae em camu-camu [Myrciaria dubia (H.B.K. McVaugh, Myrtaceae] tinha sido constatada somente em populações naturais. Relata-se sua ocorrência em um cultivo experimental, onde se avaliou os danos de C. dubiae em frutos de camu-camu, em diferentes graus de amadurecimento, entre 1999 e 2003. Os danos causados pela larva aumentaram com o amadurecimento dos frutos, havendo maior comprometimento da polpa do fruto (30 a 90% do que das sementes (7%. A incidência desse inseto pode implicar em perdas quantitativas significativas na produção de camu-camu.In Brazil, the occurrence of Conotrachelus dubiae O'Brien, 1995 (Coleoptera: Curculionidae in camu-camu [Myrciaria dubia (H.B.K. McVaugh, Myrtaceae] had only been verified in natural populations. This report describes its occurrence in an experimental cultivation, where damage of camu-camu fruits by C. dubiae at different ripening stages was evaluated between 1999 and 2003. The damage caused by the larva increased with the degree of ripening of the fruits, with greater damage of fruit pulp (30 to 90% than to seeds (7%. The incidence of this insect may cause significant quantitative losses in the camu-camu production.
Registro de datos en un servicio de crecimiento y desarrollo infantil del nivel primario
Directory of Open Access Journals (Sweden)
J. Luis Segura
2006-03-01
Full Text Available Objetivos: Determinar el tiempo empleado en el registro de datos en las consultas de los servicios de crecimiento y desarrollo en un centro de salud. Lugar: Centro de Salud Mi Perú, Dirección de Salud Callao, Perú. Materiales y Métodos: Estudio de tiempos, mediante observación directa, durante el proceso de atención a 51 usuarios en la consulta del Servicio de Crecimiento y Desarrollo. Resultados: Durante la atención a los usuarios del servicio de crecimiento y desarrollo, se usó 5 formatos para el registro de datos. Cada vez que un niño fue atendido, se registró 31 variables; una de ellas fue registrada simultáneamente en 5 formatos, 3 variables en 6 formatos y 7 en 2 formatos. La mediana de tiempo requerido para el registro manual de todos los formatos fue 2,09 minutos, equivalentes a 15,3% del tiempo total de atención a cada niño. Conclusión: El registro de datos en los servicios de crecimiento y desarrollo demanda una alta proporción del tiempo disponible para la atención a los usuarios.
AYDOĞAN, Zeynep; GÜROL, Ali; İNCEKARA, Ümit; TAHİDU, Osman Damba
2016-01-01
The overall study objective was to develop baseline information on the heavy elements concentration in edible insect Sitophilus zeamais (Coleoptera: Curculionidae) and to evaluate the contamination levels of this insect. Twelve heavy elements (V, Mn, Fe, Cu, Zn, Br, Sn, Sb, I, La, Ce, Pb) were analysed by energy dispersive X-ray fluorescence (EDXRF). The element concentration showed trend of Cu>Zn>Sn>Sb>Mn>Fe>I=La>Ce>Br>V>P...
The coffee berry borer (Hypothenemus hampei (Ferrari); Coleoptera: Curculionidae: Scolytinae) is the most important insect pest of coffee worldwide, and due to the cryptic life habit of the insect inside coffee berries, effective pest management strategies have been difficult to develop. In this pap...
New records of Mexican Tardigrada Nuevos registros de Tardigrada mexicanos
Directory of Open Access Journals (Sweden)
Łukasz Kaczmarek
2011-12-01
Full Text Available In 9 moss samples collected from Mexico, 6 tardigrade species, including 4 new records for the country, were found. The new records raise the number of known Mexican water bear species to forty-one. We provide a full list of the known Mexican tardigrade species and discuss some biogeographical and taxonomic issues.En 9 muestras de musgo recolectadas en México, se encontraron 6 especies de tardígrados, incluyendo 4 nuevos registros para el país. Los nuevos registros incrementaron a 41 el número de especies de tardígrados mexicanos conocidos. Se proporciona una lista completa de tardígrados mexicanos conocidos y se discuten algunas cuestiones biogeográficas y taxonómicas.
The invasive redbay ambrosia beetle, Xyleborus glabratus Eichhoff (Coleoptera: Curculionidae: Scolytinae) vectors the fungal pathogen (Raffaelea lauricola) that causes laurel wilt, a disease responsible for widespread mortality of trees in the Lauraceae in the southeastern U.S. Early detection of in...
Jose F. Negron; Willis C. Schaupp; Lee Pederson
2011-01-01
There are about 500 species of bark beetles (Coleoptera: Curculionidae: Scolytinae) in the United States (Wood 1982). A number of them are important disturbance agents in forested ecosystems, occasionally creating large tracts of dead trees. One eruptive species is the Douglas-fir beetle, Dendroctonus pseudotsugae Hopkins, which utilizes Douglas-fir, Pseudotsuga...
Características de 107 registros sanitarios españoles y valoración de su utilización (parte a
Directory of Open Access Journals (Sweden)
Iñaki Imaz Iglesia
2005-01-01
Full Text Available Fundamento: La información sobre los registros sanitarios existentes en nuestro país es poco accesible y escasa y algunos son poco conocidos, pudiendo estar infrautilizados en relación con sus múltiples usos potenciales. El objetivo de este trabajo es evaluar las características de los Registros Sanitarios españoles y su utilización, especialmente en Evaluación de Tecnologías Sanitarias. Métodos: Estudio descriptivo transversal de los Registros Sanitarios españoles entre 1997 y 2002. La identificación de los registros se realizó a través de búsqueda bibliográfica y mediante encuesta a Sociedades Científicas y Administración sanitaria central y autonómica. Se ha realizado una búsqueda bibliográfica específica de las publicaciones que utilizan datos de los registros sanitarios incluidos y se han evaluado aplicando los criterios de calidad de la evidencia científica. Resultados: Se han identificado 107 registros sanitarios, preferentemente de cobertura local o regional (71% y dependientes en su mayoría de la Administración autonómica (64,5%. Las áreas con mayor número de registros identificados corresponden a la mortalidad (16,8% y al cáncer (15,9%. Se han recuperado 298 publicaciones que analizan datos producidos por los registros identificados, de las que la mayoría se dedican al estudio de la frecuencia y distribución de los eventos registrados (58,1% y con menor frecuencia a la realización de estudios de evaluación de tecnologías sanitarias (24,4%. Conclusiones: La evaluación crítica de las publicaciones ha permitido identificar algunos elementos relacionados con el diseño y la metodología de análisis que incrementarían la calidad de los estudios de evaluación de tecnologías sanitarias.Los registros sanitarios en España han tenido un desarrollo desigual y reciente. Se han detectado áreas relevantes sin registros y elementos de mejora relacionados con la utilización de los registros sanitarios para
Características de 107 registros sanitarios españoles y valoración de su utilización (parte b
Directory of Open Access Journals (Sweden)
Iñaki Imaz
2005-01-01
Full Text Available Fundamento: La información sobre los registros sanitarios existentes en nuestro país es poco accesible y escasa y algunos son poco conocidos, pudiendo estar infrautilizados en relación con sus múltiples usos potenciales. El objetivo de este trabajo es evaluar las características de los Registros Sanitarios españoles y su utilización, especialmente en Evaluación de Tecnologías Sanitarias. Métodos: Estudio descriptivo transversal de los Registros Sanitarios españoles entre 1997 y 2002. La identificación de los registros se realizó a través de búsqueda bibliográfica y mediante encuesta a Sociedades Científicas y Administración sanitaria central y autonómica. Se ha realizado una búsqueda bibliográfica específica de las publicaciones que utilizan datos de los registros sanitarios incluidos y se han evaluado aplicando los criterios de calidad de la evidencia científica. Resultados: Se han identificado 107 registros sanitarios, preferentemente de cobertura local o regional (71% y dependientes en su mayoría de la Administración autonómica (64,5%. Las áreas con mayor número de registros identificados corresponden a la mortalidad (16,8% y al cáncer (15,9%. Se han recuperado 298 publicaciones que analizan datos producidos por los registros identificados, de las que la mayoría se dedican al estudio de la frecuencia y distribución de los eventos registrados (58,1% y con menor frecuencia a la realización de estudios de evaluación de tecnologías sanitarias (24,4%. Conclusiones: La evaluación crítica de las publicaciones ha permitido identificar algunos elementos relacionados con el diseño y la metodología de análisis que incrementarían la calidad de los estudios de evaluación de tecnologías sanitarias.Los registros sanitarios en España han tenido un desarrollo desigual y reciente. Se han detectado áreas relevantes sin registros y elementos de mejora relacionados con la utilización de los registros sanitarios para
NUEVOS HOSPEDEROS Y REGISTROS DE ÁCAROS FITÓFAGOS PARA COSTA RICA: PERÍODO 2008-2012
Directory of Open Access Journals (Sweden)
Hugo Aguilar
2012-01-01
Full Text Available Se actualizan las e especies de á caros fitó - fagos identificadas para Costa Rica entre 2008 y 2012. Se procesó el material vegetal provisto por productores, técnicos, estudiantes e interesados en general, así como el recolectado por personal del Laboratorio de Acarología de la Universidad de Costa Rica, y s e identificó. Se mencionan 63 nuevas especies e n 29 familias de plantas hos - pedantes, p ara 5 familias de ácaros fitófagos. Tetranychus urticae , familia Tetranychidae, fue la segunda especie en cuanto a número de h os - pederos, encontrándose e n 1 2 nuevas p antas. También s e hallaron o tras especies de la familia, como Eutetranychus banksi , Mononychellus planki , Oligonychus peronis , O. pratensis , O. punicae , O. ununguis , O. yothersi , Paraponychus corderoi , Tetranychus cinnabarinus , T. ludeni , T. mexicanus y 3 especies de este género que no fueron identificadas. S e registran 4 especies de la f amilia Tenuipalpidae: Brevipalpus californi - cus , B. gliricidiae , B. obovatus y B. phoenicis . Dentro de la familia Tarsonemidae, se informa de Phytonemus pallidus , Polyphagotarsonemus latus , con 15 nuevos registros, especie con mayor aporte en asociación con plantas para este nuevo período; s e informa también de Steneotarsone - musananas , asociada conpiña. De la familia Eriophyidae, se indica de Abacarus doctus, descrita recientemente como nueva especie p ara la ciencia y asociada con caña de azúcar en el país y de Calepitrimerus muesebecki , relaciona - da con aguacate; además 2 especies de eriófidos expuestos, no descritas aún. Retracrus johnstoni , familia Phytoptidae, recolectado de Heliconia latispatha , de la familia Heliconiaceae y primer registro de un ácaro de este género asociado con una planta ajena a la familia Arecaceae. Por último, se expone la descripción del reconocimiento de campo para algunas especies escogidas dentro de las 5 familias estudiadas.
Like other ambrosia beetles, Xyleborus volvulus Fabricius (Coleoptera: Curculionidae) lives in a mutualistic symbiotic relationship with fungi that serve as food source. Until recently, X. volvulus was not considered a pest, and none of its symbionts were considered plant pathogens. However, recent ...
Auditoria de prontuário: avaliação dos registros de aspiração traqueal em terapia intensiva
Directory of Open Access Journals (Sweden)
Juliana Faria Campos
2008-06-01
Full Text Available Estudo descritivo, exploratório com abordagem quantitativa, cujo objetivo foi avaliar o registro da aspiração traqueal em Terapia Intensiva realizado pela equipe multiprofissional utilizando-se dos referenciais da auditoria. Para avaliação dos registros foi utilizada análise documental. Foram analisados 21 prontuários. Amostra composta por 37 registros da equipe intensivista. A pesquisa deu-se entre janeiro a maio de 2006, em uma instituição pública do Rio de Janeiro. Dados coletados utilizando-se instrumento do tipo check list. Os registros foram avaliados utilizando-se como parâmetro um barema. Observou-se que 89,6% da equipe de enfermagem e 100% da fisioterapia registram de modo incompleto o procedimento. Foi verificada a falta do registro em 10,4% dos prontuários analisados da equipe de enfermagem e em 100% da medicina. Conclui-se que o registro da aspiração traqueal encontra-se falho, sendo imprescindível que medidas de educação continuada e sensibilização dos profissionais sejam adotadas.
Registros de hóspedes como fonte de pesquisa para a História
Directory of Open Access Journals (Sweden)
Liara Fagundes Echart
2016-03-01
Full Text Available O presente trabalho busca analisar os livros de registros e movimentação de hóspedes do Grande Hotel de Pelotas. O Grande Hotel foi inaugurado em 1928 e permaneceu em funcionamento até o ano de 2002. Atualmente no prédio, doado à Universidade Federal de Pelotas, encontra-se as dependências do Curso Superior de Tecnologia em Hotelaria. A metodologia utilizada consistiu na identificação e análise dos livros de registros e de movimentação de hóspedes do Grande Hotel de Pelotas. Concomitantemente ao processo de pesquisa documental, realizou-se a pesquisa bibliográfica acerca da temática proposta, a fim de realizar o questionamento sobre a relevância do assunto. Ao todo foram localizados 18 exemplares de livros de registros e movimentação de hóspedes, compreendendo o período entre meados de 1959 até 2002, sendo esta última data marcada pelo encerramento das atividades hoteleiras do Grande Hotel de Pelotas. Os livros de registros e movimentação de hóspedes do Grande Hotel mostraram-se uma importante fonte histórica para o estudo da hotelaria em Pelotas.
RUBIO-GOMEZ, JOSE; SEPULVEDA-CANO, PAULA
2009-01-01
RESUMEN
Se presenta una sinopsis de los escarabajos de la subfamilia Dryophthorinae (Coleoptera: Curculionidae) asociados a cultivos de plátano y banano en Colombia. Adicionalmente se ofrecen claves ilustradas para las especies del país. Se registran seis especies asociadas a dichos cultivos: Cosmopolites sordidus (Germar, 1824), Metamasius hemipterus (Linnaeus, 1758), Metamasius hebetatus (Gyllenhal, 1838), Metamasius submaculatus Champion, 1910, Rhyncophorus palmarum...
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Hirsch, Jacqueline
2012-01-01
Worldwide, weevils of the genus Otiorhynchus (Coleoptera: Curculionidae) cause damage with detrimental economic effects to many horticultural crops due to the root feeding of their larvae as well as foliage feeding of their adults. Aside from the black vine weevil Otiorhynchus sulcatus, which is the best-known pest within this genus, numerous other Otiorhynchus species have been increasingly recognized as pests in recent years. Nocturnal adult weevils and soil-inhibiting larvae are in princip...
Primer registro de Empidonax fulvifrons en Nicaragua
Francisco J. Muñoz; Wayne J Arendt; Liliana Chavarria; Pablo Somarriba; Aura L. Cruz
2009-01-01
English title: First documented report of buff-breasted fl ycatcher Empidonax fulvifrons in Nicargua. A buff-breasted flycatcher (Empidonax fulvifrons) was observed on 4 January 2008 in Loma FrÃa, Dipilto Municipality, Department of Nueva Segovia. The bird was sited in a pasture with scattered pines (Pinus oocarpa) adjacent to a pine-oak forest. It formed part of a...
Kelly K. Williams; Joel D. McMillin; Tom E. DeGomez; Karen M. Clancy; Andy Miller
2008-01-01
We examined abundance and flight periodicity of five Ips and six Dendroctonus species (Coleoptera: Curculionidae, Scolytinae) among three different elevation bands in ponderosa pine (Pinus ponderosa Douglas ex. Lawson) forests of northcentral Arizona. Bark beetle populations were monitored at 10 sites in each of three elevation...
El registro electoral en la historia constitucional cubana (1901-1958
Directory of Open Access Journals (Sweden)
Raudiel Peña Barrios
2014-07-01
Full Text Available Este artículo pretende analizar la regulación existente en los textos constitucionales cubanos de 1901, 1940 y en los Estatutos Constitucionales del Gobierno de Fulgencio Batista de 1952, así como en sus leyes complementarias, sobre la inscripción en el registro electoral. En vista de esto, analizaremos los diferentes sistemas empleados para la inscripción de los electores, mientras que veremos cómo se va desarrollando la institución del registro a causa del fortalecimiento de todo el marco legal e institucional que sobre este se va configurando, paulatinamente, durante esta etapa. Además, podremos apreciar cómo en determinado momento de la historia cubana esta institución fue comprometida en su cometido político-social lo que puede ser interpretado como una herramienta de fraude electoral.
Análisis de un registro de adenomas pituitarios
Directory of Open Access Journals (Sweden)
Carolina Albiero
2010-10-01
Full Text Available Dada la complejidad que reviste el enfoque diagnóstico y terapéutico de los tumores pituitarios, el registro y análisis de la experiencia clínica acumulada es de gran ayuda en la toma de decisiones. En este trabajo se informan datos clínico-terapéuticos, extraídos de un registro computarizado, sobre 519 de un total de 670 pacientes con adenomas pituitarios. Trescientos cuarenta y cinco fueron mujeres (66% y 174 varones (34%, de 14 a 80 años de edad. El diagnóstico final fue: acromegalia en 176, enfermedad de Cushing en 153, prolactinoma en 101 y adenoma clínicamente no-funcionante (ANF en 89. La edad media al momento del diagnóstico de acromegalia fue 43.9 ± 13.5 (16-80, para enfermedad de Cushing 35.7 ± 12.9 (14-72, para prolactinomas 30.0 ± 13.4 (15-79 y para ANF 52.1 ± 15.2 (17-79 años. La creación de un registro institucional de tumores de hipófisis es un instrumento de gran utilidad para el análisis de la experiencia adquirida y constituye una herramienta valiosa para mejorar la estrategia terapéutica, optimizar la relación costo/beneficio y mejorar el cuidado del paciente. Contribuye a la docencia médica, tanto en el pre como en el posgrado y da base a la realización de trabajos de investigación clínica, aportando a la difusión y transferencia de conocimientos.
Directory of Open Access Journals (Sweden)
Eduardo I. Faúndez
2015-06-01
Full Text Available Se entrega el primer registro del céstodo Taenia saginata en un indígena de Tierra del Fuego (Patagonia chilena, correspondiente al año 1902. Se discute la importancia del registro y se entregan ilustraciones del ejemplar.
Registro Español de Ablación con Catéter. III Informe Oficial (2003
Directory of Open Access Journals (Sweden)
Enrique Rodríguez Font
2005-04-01
La elevada participación y la consistencia de los resultados con los de años previos ayudan a consolidar este registro como referencia para el resto de la comunidad científica. Los resultados del registro prospectivo ofrecen una información de mejor calidad y más detallada en sus resultados y complicaciones.
N. Mukhamadiev; A. Lynch; C. O' Connor; A. Sagitov; N. Ashikbaev; I. Panyushkina
2014-01-01
On 17 May and 27 June 2011 severe cyclonic storms damaged several hundred hectares of spruce forest (Picea schrenkiana) in the Tian Shan Mountains. Bark beetle populations increased rapidly in dead and damaged trees, particularly Ips hauseri, I. typographus, I. sexdentatus, and Piiyogenesperfossus (all Coleoptera: Curculionidae), and there is concern about the...
Directory of Open Access Journals (Sweden)
Tessone, Augusto
2007-01-01
Full Text Available Las condiciones de hallazgo de los materiales óseos humanos procedentes de bahía Valentín -donde predominan restos en superficie, sin relación anató- mica y con altos grados de perdidas óseas- nos condujo a evaluar en primera instancia la composición e integridad del registro bioarqueológico desde una perspectiva tafonómica. En un trabajo previo se presentaron los resultados alcanzados en el estudio de materiales obtenidos en el marco del proyecto Arqueología de la Margen Suroriental del Archipiélago Fueguino. En esta oportunidad, manteniendo la misma perspectiva de análisis, se incluye la muestra recuperada por el PEOAF entre los años 1984 y 1988. En primer lugar, se establece el número mínimo de individuos, contemplando la representación anatómica, elementos maduros o inmaduros y proximidad espacial. En segundo lugar, con el fin de identificar los procesos postmorten de destrucción y redepositación actuantes, se identificaron y cuantificaron las modificaciones de las superficies óseas del conjunto recuperado: meteorización, pérdida ósea, marcas de roedores, carnívoros y raíces y termoalteración. Finalmente, se discuten las implicaciones de los resultados obtenidos para la caracterización del registro bioarqueológico del área bajo estudio.
Valerio-Mendoza, O; Armendáriz-Toledano, F; Cuéllar-Rodríguez, G; Negrón, José F; Zúñiga, G
2017-09-01
The distribution range of the western pine beetle Dendroctonus brevicomis LeConte (Coleoptera: Curculionidae) is supported only by scattered records in the northern parts of Mexico, suggesting that its populations may be marginal and rare in this region. In this study, we review the geographical distribution of D. brevicomis in northern Mexico and perform a geometric morphometric analysis of seminal rod shape to evaluate its reliability for identifying this species with respect to other members of the Dendroctonus frontalis Zimmermann (Coleoptera: Curculionidae) complex. Our results provide 30 new records, with 26 distributed in the Sierra Madre Occidental and 4 in the Sierra Madre Oriental. These records extend the known distribution range of D. brevicomis to Durango and Tamaulipas states in northern Mexico. Furthermore, we find high geographic variation in size and shape of the seminal rod, with conspicous differences among individuals from different geographical regions, namely west and east of the Great Basin and between mountain systems in Mexico. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America.
M. Muñoz, Liliana; Cañas, Guillermo L.; Urrea, Aura I.; Guarín, Juan H.
2013-01-01
In a farm in the municipality of Andes (Antioquia, Colombia), parcels were planted with Dominico Hartón plantain associated with Caturra-type coffee, where weevil damage (Insecta: Coleoptera: Curculionidae) occurred in 100% of the plantain plants, corms of approximately 2 kg were planted under the same association system. From the sowing until harvest, six types of products were applied every two months on these plantations: chemical of the region (Clorpirifos and Carboxin + Thiram), Carbofur...
Directory of Open Access Journals (Sweden)
A. V. Toledo
Full Text Available Se investigó la ocurrencia natural del hongo entomopatógeno Conidiobolus coronatus (Costantin Batko (Zygomycetes: Entomophthorales en adultos de Delphacodes kuscheli Fennah y D. haywardi Muir (Hemiptera: Delphacidae, criados sobre Hordeum vulgare L. bajo condiciones de invernadero. Los insectos muertos, por una sospechada infección fúngica, fueron recolectados, esterilizados superficialmente, y examinados en el laboratorio. Conidiobolus coronatus fue aislado en cultivos puros, descrito morfológicamente y depositado en colecciones micológicas. Este trabajo presenta el primer registro de C. coronatus contra insectos perjudiciales en la Argentina.The natural occurrence of the entomopathogenic fungus Conidiobolus coronatus (Costantin Batko (Zygomycetes: Entomophthorales in adults of Delphacodes kuscheli Fennah and D. haywardi Muir (Hemiptera: Delphacidae, reared on Hordeum vulgare L. under greenhouse conditions, was investigated. Dead insects, suspected of fungal infection, were collected, surface sterilized, and examined in the laboratory. Conidiobolus coronatus was isolated in pure cultures, described morphologically, and deposited in mycological collections. This paper presents the first record of C. coronatus against harmful insects in Argentina.
Directory of Open Access Journals (Sweden)
Jaime Alberto López
2004-09-01
Full Text Available El conocimiento sobre el qué, el quién, el cuándo, el dónde, el cómo y el porqué de cada proceso, la aplicación de un sistema de control de calidad y la retroalimentación de la evaluación permiten que la información sea analizada y empleada eficientemente en el mejoramiento continuo. Los objetivos del trabajo fueron: mejorar el registro de la información en los procesos microbiológicos, evaluar los resultados obtenidos con las estrategias empleadas, establecer una base de datos para proyectos de investigación y proponer un modelo de evaluación para estudios comparativos. Para esto, se realizó un estudio descriptivo prospectivo, y se utilizaron los datos de los cultivos microbiológicos solicitados a pacientes hospitalizados entre junio de 1997 y junio de 2003. Se diseñó un formato con las variables por analizar. Las fuentes de información fueron las solicitudes de laboratorio, los registros del laboratorio de microbiología y las historias clínicas. Se utilizó el programa EpiInfo 6 para analizar la información de 46.072 cultivos. La primera cifra corresponde al porcentaje en junio de 1997 y la segunda, a la de junio de 2003: persona que solicitó el cultivo (11%-99%, hora de la solicitud (9%-85%, solicitud completamente diligenciada (10%-68%, persona que recolectó la muestra (0%-83%, hora de recolección de la muestra (0%-77% y, finalmente, hoja de trabajo microbiológica completa (78%-96%. El primer paso para el mejoramiento de cualquier proceso consiste en obtener y registrar la información pertinente y, para ello, la evaluación constante y la retroalimentación son fundamentales para el logro de este objetivo.
Directory of Open Access Journals (Sweden)
Guillermo Drelichman
2012-08-01
Full Text Available La enfermedad de Gaucher, por su escasa frecuencia, está incluida dentro de las llamadas enfermedades huérfanas. En 1991 se creó el Registro Internacional de Gaucher y en 1992 se incorporaron los primeros pacientes de Latinoamérica. En el año 2008 se creó el Grupo Latinoamericano para la Enfermedad de Gaucher (GLAEG cuyos principales objetivos son fomentar la realización de consensos regionales, difundir el ingreso de pacientes al registro internacional y aumentar el conocimiento sobre la enfermedad para lograr mejorar la atención y la calidad de vida de los pacientes. Hasta abril del 2010 ingresaron 5828 pacientes de todo el mundo, 911 (15.6% son de Latinoamérica. Este es el primer informe global de la enfermedad en la Región: hay un predominio del sexo femenino, la forma clínica más frecuente es el tipo I (95%; al diagnóstico la mayoría son <20 años (68%. Las manifestaciones clínicas más frecuentes al diagnóstico son esplenomegalia (96% y anemia (49%, el 80% presentó hallazgos radiológicos de compromiso óseo. En nuestra Región, la gran mayoría de los pacientes (89% ha recibido alguna vez terapia de reemplazo enzimática con imiglucerasa logrando, con un seguimiento prolongado (hasta10 años, las metas terapéuticas que muestran la gran eficacia de la terapia. Si bien el porcentaje de pacientes con terapia es alto, las suspensiones de tratamiento son frecuentes. Las principales deficiencias en nuestra Región son: la carencia de evaluaciones viscerales volumétricas, de densitometría y de estudios moleculares en algunos pacientes. El principal problema es el subdiagnóstico.
Ferreira, Sidney Alberto do Nascimento; Gentil, Daniel Felipe de Oliveira; Silva, Neliton Marques da
2003-01-01
No Brasil, a ocorrência de Conotrachelus dubiae O'Brien, 1995 (Coleoptera: Curculionidae) em camu-camu [Myrciaria dubia (H.B.K.) McVaugh, Myrtaceae] tinha sido constatada somente em populações naturais. Relata-se sua ocorrência em um cultivo experimental, onde se avaliou os danos de C. dubiae em frutos de camu-camu, em diferentes graus de amadurecimento, entre 1999 e 2003. Os danos causados pela larva aumentaram com o amadurecimento dos frutos, havendo maior comprometimento da polpa do fruto ...
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
REGISTROS DE REPRESENTAÇÃO SEMIÓTICA E SUAS CONTRIBUIÇÕES PARA O ENSINO DE FÍSICA
Directory of Open Access Journals (Sweden)
Cintia Ap. Bento dos Santos
Full Text Available Este artigo apresenta dados de uma pesquisa que tem por objetivo apresentar como ocorrem as mobilizações de conhecimentos matemáticos na resolução de tarefas de Física, considerando os registros de representação semiótica. Para evidenciar o exposto, trazemos uma análise qualitativa centrada na transformabilidade dos registros de representação semiótica e em aspectos didáticos de três tarefas que fizeram parte de um de nossos instrumentos utilizados na pesquisa, bem como uma síntese explicitando o que Duval entende por registros de representação semiótica. Ao final, apresentamos algumas considerações que apontam para as dificuldades que alunos podem ter no momento da resolução de tarefas de Física que, de certa forma, associam-se com a transformabilidade de um registro de representação semiótica.
The redbay ambrosia beetle (RAB), Xyleborus glabratus (Coleoptera: Curculionidae: Scolytinae) vectors the fungal pathogen, Raffaelea lauricola, which causes laurel wilt (LW), a lethal disease of trees in the family Lauraceae, including the most commercially important crop in this family, avocado, Pe...
Directory of Open Access Journals (Sweden)
Santiago PLISCHUK
2011-01-01
Full Text Available Durante estudios prospectivos tendientes a la detección de protistas asociados a ápidos en la región Pampeana, se observó la presencia de esporos ovales bicóncavos y grupos de esporos (cúmulos en los túbulos de Malpighi de abejas de Dufaur, partido de Saavedra, sudoeste de la provincia de Buenos Aires. Los esporos maduros midieron 4,8 ± 0,05 x 2,4 ± 0,03 μm y la carga (intensidad promedió 5,71 ± 1,49 x 106 esporos/abeja. Las detecciones se efectuaron entre julio y octubre de 2006 y la prevalencia en las colmenas positivas osciló entre 1 y 16,7 %. Las características morfológicas de los esporos, el lugar de desarrollo y la especie huésped involucrada sugieren que el microorganismo en cuestión, pertenece al género Nephridiophaga y sería N. apis Ivanić, especie tipo cuyo conocimiento es extremadamente limitado. El hallazgo constituye el primer registro de un nefridiofágido asociado a A. mellifera fuera del continente europeo.
Registro civil y secularización. Comparación entre Ecuador y Francia
Directory of Open Access Journals (Sweden)
Joël Hautebert
2016-12-01
Full Text Available El estudio de la creación del Registro Civil y de sus relaciones con los sacramentos de la Iglesia nos conduce al corazón de varias problemáticas jurídicas y político/religiosas de gran importancia. La comparación entre las historias recientes respectivas de Francia y Ecuador, dos países de tradición católica de distintos continentes, ofrece un interesante ángulo de análisis de estos problemas. Las numerosas observaciones de Mons. Juan Larrea Holguín sobre el tema de las relaciones entre el sacramento de matrimonio (y el bautismo y las obligaciones civiles (registro civil pueden aplicarse en gran parte para Francia. La precisa comprensión de las instituciones necesita siempre aludir a su historia. La génesis del registro civil demuestra cuál era el fin perseguido por los estados laicos, según una lógica de secularización, un tanto beligerante contra la Iglesia. A continuación, se revisa cómo se mantuvieron las reglas del registro civil en los siglos posteriores, tomando en cuenta los nuevos contextos políticos nacionales e internacionales, donde se modificó la postura diplomática de la Iglesia. Finalmente se observa cómo los derroteros entre ambos países se han separado muy recientemente. Este estudio nos muestra lo que se juega de libertad religiosa en los tiempos contemporáneos y abre interrogantes sobre los lazos que la Iglesia debe guardar con las legislaciones civiles.
Directory of Open Access Journals (Sweden)
CAROLINA ACOSTA HOSPITALECHE
2005-09-01
Full Text Available Los cráneos de los Spheniscidae (como los de todas las aves, aunque escasos en el registro paleontológico, muestran importantes caracteres a nivel taxonómico. Hasta el momento se conocían solo seis cráneos en todo el mundo: Paraptenodytes antarctica y una nueva especie de Spheniscidae procedentes de las formaciones Gaiman (Mioceno temprano y Puerto Madryn (Mioceno tardío de Argentina, respectivamente; Spheniscus megaramphus y 3S. urbinai de la formación Pisco (Mioceno tardío de Perú, Marplesornis novaezealandiae del Plioceno de Nueva Zelanda y un resto de Sphenicidae cf Spheniscus procedente de la formación Bahía Inglesa (Mioceno medio-tardío. De esta última unidad provienen cinco restos craneanos recientemente descubiertos en la localidad de Caldera (Región de Atacama, Chile, los cuales fueron descritos y asignados preliminarmente a Palaeospheniscus. Estos materiales constituyen el primer registro de cráneos para la especie y significan un importante aporte al conocimiento de la avifauna fósil de Chile y en particular de la formación Bahía InglesaAlthough the skulls of the Spheniscidae are unusual in the paleontologic record, they show important features useful in the systematics of the group, as well as in the rest of the birds. Until now, fossil occurrences were restricted to six skulls: Paraptenodytes antarctica and one new species from the Gaiman formation (Early Miocene and Puerto Madryn formation (late Miocene of Argentina, respectively; Spheniscus megaramphus and S. urbinai from the Pisco Formation (Late Miocene, Perú; Marplesornis novaezealandiae from New Zealand (Pliocene; and Spheniscidae cf. Spheniscus from the Bahía Inglesa Formation (Middle-Late Miocene, Chile. Five new materials have been exhumed from this last unit. These skulls, which come from the Caldera locality (Region of Atacama, Chile, have been preliminarily assigned to Palaeospheniscus (Aves, Spheniscidae, constituting the first skulls described for
Directory of Open Access Journals (Sweden)
Romina Ghirardi
2011-12-01
Full Text Available Chytridiomycosis, a disease caused by the chytrid fungus Batrachochytrium dendrobatidis (B.d., is recognized as one of the major factors of amphibian decline. Global trade of amphibians has been identified as one of the causes of B.d. spread, involving hundreds of species world wide. In this work we detected the presence of B.d. through histological examination on 5 out of 9 analyzed specimens of bullfrogs (Lithobates catesbeianus from a farm in Santa Fe City (Argentina, deposited since 1993 in the herpetological collection of the Provincial Museum of Natural Sciences "Florentino Ameghino". Our finding represents the oldest record of B.d. for Argentina and the first case of the chytrid fungus infecting the exotic bullfrog in this country. We emphasize the importance of determining and monitoring the distribution and spread of B.d in Argentina, particularly in areas where feral bullfrog populations have already been identified.La quitridiomicosis, enfermedad emergente producida por el hongo Batrachochytrium dendrobatidis (B.d., es reconocida como uno de los factores causantes de la declinación de anfibios. El comercio mundial de anfibios ha sido señalado como una de las fuentes de dispersión de B.d. En este trabajo se detectó la presencia de B.d. en la especie exótica rana toro (Lithobates catesbeianus mediante cortes histológicos en 5 de 9 ejemplares provenientes de un criadero de la ciudad de Santa Fe (Argentina, depositados y conservados desde 1993 en la Colección Herpetológica del Museo Provincial de Ciencias Naturales "Florentino Ameghino". Este registro representa el hallazgo más antiguo de B.d. en Argentina y el primer caso de este hongo en la rana toro exótica en el país; por lo que enfatizamos la importancia de determinar y monitorear la distribución y dispersión de B.d., particularmente en los sitios donde ya se han detectado poblaciones silvestres de rana toro.
B. L. Strom; L. M. Roton
2011-01-01
Insecticide products based on cedar oil are readily available, but evaluations against pine bark beetles (Coleoptera: Curculionidae: Scolytinae) are lacking. In the southeastern U.S., the southern pine beetle, Dendroctonus frontalis Zimm, is the major bark beetle pest for which tree protectants are applied. However, Ips avulsus (Eichhoff) are more consistently...
Registro de altitud del Aedes Aegypti en Colombia
Directory of Open Access Journals (Sweden)
Marco F. Suárez
1981-12-01
Full Text Available En Colombia se había considerado que el mosquito Aedes oegypti no habitaba en alturas superiores a los 1.500 metros sobre el nivel del mar (m/nm. Se disponía de los registros de Oiba [Santander, a 1.400 m/nm y con temperatura media de 20°C y del Líbano (Tolima], a 1.585 m/nm y con temperatura media de 20°C. (1.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Ley de paternidad responsable y Registro Civil
Directory of Open Access Journals (Sweden)
Irene Montarano Lacayo
2007-07-01
Full Text Available Con la promulgación de la Ley de Paternidad Responsable en abril del 2001, los derechos de las madres de hijos extramatrimoniales y de los propios menores han cambiado en lo que a filiación se refiere. El artículo explica ampliamente el procedimiento administrativo que lleva el Registro Civil para la inscripción de nacimientos extramatrimoniales, desde la declaración de paternidad, citatorio, prueba de marcadores genéticos, hasta concluir con la declaración de la paternidad vía administrativa.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
Directory of Open Access Journals (Sweden)
Sávio Silveira Feitosa
2007-08-01
Full Text Available The coleoborers use the wood to complete part of their cycle of life. In search for food they can make galleries and cause damages in the structure of the plant, allowing the entrance of pathogenic individuals that will harm the development of the crop. This research was carried out from January to May 2005 aiming to get information on the species of coleoborers associated to crop wastes in the area of mango crop, in José de Freitas county - Piauí. The insects had been collected in areas of Tommy Atkins, Keitt, Kent and Palmer varieties, in 10 fallen branches, with approximately 50 cm long and 2.5 cm of diameter, that were taken to the plant health laboratory of Centro de Ciências Agrárias in Universidade Federal do Piauí. The coleoborers were removed from the wood, assembled in entomologic pins and sent to the Instituto Biológico in São Paulo SP for species identification. The coleoborers Hypothenemus sp. (Coleoptera: Curculionidae: Scolytinae, Xyleborus sp. (Coleoptera: Curculionidae: Scolytinae and Orthostoma chryseis (Bates, 1970 (Coleoptera: Cerambycidae were found.As coleobrocas usam a madeira para realizar o seu ciclo de vida, fazendo galerias e causando danos na estrutura da planta e em certas situações, permitindo a entrada de patógenos. Este trabalho foi realizado de janeiro a maio de 2005 objetivando identificar e obter informações sobre as espécies de coleobrocas associadas a restos de cultura em área de cultivo de manga, no município de José de Freitas-Piauí. Foram coletados em cada área das variedades Tommy Atkins, Keitt, Kent e Palmer, dez ramos caídos, com aproximadamente 50 cm de comprimento e 2,5 cm de diâmetro, que foram levados ao laboratório de Fitossanidade do Centro de Ciências Agrárias da Universidade Federal do Piauí. As coleobrocas adultas foram retiradas da madeira, montadas em alfinetes entomológicos e enviadas ao Instituto Biológico em São Paulo-SP para identificação das espécies. Foram
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
The coffee berry borer, Hypothenemus hampei(Coleoptera: Curculionidae)(Ferrari), is a serious pest of coffee worldwide and has been recently introduced in Hawai’i, first detected in the state in 2010. Adult silvanid flat bark beetles, Cathartus quadricollis (Coleoptera: Silvanidae) and adult laemoph...
Metodologia de Baixo Custo para Registro de Imagens do Arco Voltaico de Soldagem
Directory of Open Access Journals (Sweden)
Anna Louise Voigt
2017-12-01
Full Text Available Resumo Equipamentos que permitem o registro de imagens são importantes ferramentas no estudo dos processos de soldagem. Contudo, câmeras de alta velocidade que permitem a captura de imagens do arco voltaico e dos fenômenos envolvidos, a exemplo da transferência metálica, são limitadas devido ao seu alto custo. Tendo em visto a utilização de câmeras de baixo custo relativo, o presente estudo tem por objetivo avaliar os efeitos dos parâmetros de exposição no registro do arco voltaico, sendo este, semelhante ao que se observa através da máscara de soldagem. Logo, analisou-se os efeitos da abertura do diafragma, tempo de exposição e sensibilidade ISO. Além destes parâmetros, foram empregados filtros na lente da câmera a fim de melhorar a qualidade das imagens. Por fim, aplicou-se o conhecimento adquirido no registro do processo TIG com alimentação de arame frio, sendo possível a visualização das gotas sendo transferidas bem como da poça de fusão.
Valor de los registros audiovisuales en educación intercultural
Directory of Open Access Journals (Sweden)
Antonio Bautista García-Vera
2012-10-01
Full Text Available Este artículo analiza las posibilidades de los registros audiovisuales como datos en la investigación sobre relaciones interculturales, o aquellas que van dirigidas al conocimiento del otro. Pretende contribuir a la teorización sobre el valor de las narraciones fotográficas y videográficas en la representación y análisis de realidades de la enseñanza que son difíciles de captar y cuantificar. Concretamente, estudiamos si el registro audiovisual es una buena herramienta para recoger y analizar información situada sobre las intenciones e interpretaciones contenidas en las relaciones humanas. Después de presentar algunos dilemas epistemológicos y metodológicos, como la denominada crisis de la representación en ciencias sociales o el conflicto «etic-emic», y de plantear algunas soluciones dadas desde la antropología audiovisual, analizamos la naturaleza de algunas situaciones de educación intercultural recogidas en los dos colegios –etnografías– que soportan el estudio finalizado en 2011 y financiado por el Ministerio de Ciencia e Innovación de España, sobre el uso de narraciones audiovisuales como sustrato de las relaciones entre el alumnado diverso culturalmente de educación infantil y primaria. A modo de ejemplo, describimos cómo hemos llegado a algunas de las categorías o constructos que llevan a entender el universo de significados que dan sentido a la vez que condicionan y configuran las relaciones interculturales de esos centros. Finalmente, describimos las aportaciones de algunas herramientas del software NVivo 9 en el análisis del contenido de registros y narraciones foto-videográficas.
Directory of Open Access Journals (Sweden)
Flávio Miguens
2011-07-01
Resumo. Coleópteros têm sido descritos como pragas e vetores de nematódeos causadores de Anel Vermelho em diversas palmeiras da família Arecaceae. Rhynchophorus palmarum L (Coleoptera: Curculionidae é uma praga que afeta a cocoicultura e outras palmeiras; e, vetor de Bursaphelencus cocophilus (Cobb Baujard (Nematoda, agente etiológico de Anel Vermelho e de outros nematódeos. Atualmente, recomenda-se o emprego de inimigos naturais e parasitas no manejo integrado de pragas; dentre elas, Rhynchophorinae. Armadilhas de coleta massal são recomendadas no manejo integrado de pragas. Nosso estudo relata, na cocoicultura, a eficiência de armadilhas artesanais de baixo custo e a utilização cariomônios (toletes de cana-de-açúcar e cariômonios mais feromônios (toletes de cana-de-açúcar e machos adultos de R. palmarum como atrativos nas armadilhas. Ácaros ectoparasitas foram identificados nestes coleópteros, por microscopia, que podem ser propostos como parte do manejo integrado desta praga. Armadilhas de coleta massal com cariômonios foram eficientes na captura de R. palmarum e outros Curculionidae. No entanto, armadilhas de coleta massal com cariômonios e feromônios aumentaram a atratividade, em relação às primeiras, para este Coleoptera e Cosmopolites sordidus (Germar (Coleoptera: Curculionidae. Eventualmente, exemplares de R. palmarum apresentavam infecção fúngica. Ácaros ectoparasitas infestavam mais de 50% dos exemplares de R. palmarum. A microanatomia destes ácaros e sua interação com R. palmarum foi preliminarmente descrita. Todos os estágios do ciclo de vida destes ácaros foram identificados no compartimento dos élitros. As evidências morfológicas suportam a hipótese de que estes ácaros podem ser empregados no controle biológico de R. palmarum em um programa de manejo integrado.
Xyleborus bispinatus Eichhoff (Coleoptera: Curculionidae) was reported in Florida for the first time in 2013. Previously, it was unrecognized and not distinguished from the morphologically similar Xyleborus ferrugineus (F.). Like other members of the tribe Xyleborini, X. ferrugineus (and possibly X....
Directory of Open Access Journals (Sweden)
Luis Gregorio Estrada
2015-09-01
Full Text Available El estudio de los insectos asociados a la epidemiología de la leishmaniasis, en la Costa Caribe colombiana, se ha concentrado en los departamentos de Sucre y Córdoba, por consiguiente existe un escaso conocimiento de la fauna de flebotomíneos del resto de la región. En la presente nota se presentan cuatro nuevos registros de Lutzomyia spp., para el departamento de Cesar. Los insectos fueron colectados con dos trampas de luz tipo CDC, equipadas con LED de color azul, en el Balneario Hurtado de la ciudad de Valledupar, Cesar. Se recolectaron en total 50 flebotomíneos, los cuales estuvieron representados por las especies Lutzomyia cayennensis cayennensis (38 %, L. evansi (28 %, L. trinidadensis (14 %, L. venezuelensis (10 %, L. micropyga (6 % y L. rangeliana (2 %. Como primeros registros para el departamento sobresalen L. evansi, L. venezuelensis, L. micropyga y L. rangeliana, con lo que se eleva a ocho el número de especies reportadas hasta la fecha en el Cesar. Entre los nuevos registros se destaca el hallazgo de L. evansi, reconocido vector de Leishmania spp. en la Costa Caribe de Colombia.
First nesting record of White-naped Brush-Finch (Atlapetes albinucha
Directory of Open Access Journals (Sweden)
Emma Cisneros Palacios
2015-06-01
Full Text Available Primer registro de animación de Atlapetes albinucha Describo el primer nido localizado de Atlapetes albinucha, y los polluelos que contenía. Este nido lo localicé en un bosque de niebla del Estado de Oaxaca, México.
Christopher J. Fettig; Stephen R. McKelvey; Christopher P. Dabney; Dezene P.W. Huber; Cameron C. Lait; Donald L Fowler; John H. Borden
2012-01-01
The western pine beetle, Dendroctonus brevicomis LeConte (Coleoptera: Curculionidae, Scolytinae), is a major cause of ponderosa pine, Pinus ponderosa Douglas ex Lawson, mortality in much of western North America. We review several years of research that led to the identification of Verbenone Plus, a novel four-component...
Registros nuevos y notables de aves acuáticas en Querétaro y estados adyacentes
Directory of Open Access Journals (Sweden)
Rubén Pineda-López
2013-01-01
Full Text Available Como resultado de muestreos mensuales durante un año en embalses de Querétaro y zonas adyacentes de estados vecinos, así como de visitas a la Sierra de Lobos en Guanajuato, presentamos nuevos registros estatales de aves acuáticas para los estados de Querétaro (Bucephala albeola, Fregata magnificens, Numenius americanus, Hidalgo (Charadrius semipalmatus, Leucophaeus atricilla, Hydroprogne caspia y Guanajuato (Pelecanus occidentalis; además de registros notables de especies poco conocidas en zonas alejadas de las costas mexicanas. Estos registros muestran que los embalses de zonas semiáridas altas de México son más utilizados por especies poco frecuentes que lo que se ha pensado, y elevan a 70 las especies observadas en la zona semiárida de Querétaro, lo que confirma la importancia de los cuerpos de agua artificiales de esta región para la conservación de las aves acuáticas.
Directory of Open Access Journals (Sweden)
Augusto Bolson Murari
2012-03-01
Full Text Available
Este estudo teve por objetivo desenvolver um modelo alternativo de armadilha etanólica de interceptação de insetos voadores, visando à redução dos custos relacionados aos levantamentos de insetos da subfamília Scolytinae (Curculionidae, realizados em ecossistemas florestais. O modelo de armadilha, denominado de PET-SM, foi confeccionado com materiais recicláveis: prato plástico, garrafa de polietileno (PET de dois litros, garrafa PET de 600 mL, e mangueira com álcool 96° GL empregado como atrativo. Em comparação a outros modelos utilizados para monitoramento de Scolytinae, o modelo PET-SM mostrou-se eficiente na captura, apresentando um maior número de espécies coletadas e oferecendo um menor custo de confecção.
doi: 10.4336/2012.pfb.32.69.115
This study aimed to develop an alternative model of trap for interception with ethanol for flying insects, in order to reduce the costs related to surveys of insects of the subfamily Scolytinae (Curculionidae, conducted in forest ecosystems. The model of trap, called PET-SM, was manufactured with recyclable materials: plastic plate, polyethylene (PET bottle of two liters, PET bottle of 600 mL, and a hose with alcohol 96 GL used as attractive. Compared to other models used to monitor Scolytinae, the PET-SM model proved to be effective for capture, presenting a greater number of species and offering a lower cost of manufacture.
doi: 10.4336/2012.pfb.32.69.115
Primer registro de Heliotropium amplexicaule (Heliotropiaceae) en Chile
Ibáñez, Sergio; Luebert, Federico; Gómez, Miguel
2011-01-01
The presence of the commonly known weed Heliotropium amplexicaule (Heliotropiaceae) is reported for Chile first time, from a collection recently made in Santiago. Its potential as weed in Chile is discussed in the context of the experience of other countries where the species has become naturalised.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Directory of Open Access Journals (Sweden)
Ludovic Reveiz
2006-06-01
Full Text Available Debido a los sesgos que afectan a la publicación de ensayos clínicos y sus resultados, los estudios cuyos resultados son positivos son más fáciles de encontrar que los que tienen resultados sin significación estadística y a ello se debe que los primeros estén sobrerrepresentados. Para contrarrestar este tipo de sesgo se ha propuesto ingresar en un registro toda investigación, desde sus comienzos. No obstante, estos registros se encuentran en distintas fases de evolución, especialmente en países en desarrollo, de tal manera que la Red Cochrane Iberoamericana, parte de la Colaboración Cochrane, ha establecido el Registro Latinoamericano de Ensayos Clínicos en Curso (LATINREC, por Latin American Clinical Trial Registry con la idea de facilitar el registro de los datos contenidos en el protocolo de todo ensayo clínico que se esté llevando a cabo en un momento dado y poner esa información a la disposición del público. El LATINREC, que viene a respaldar los objetivos de la Organización Mundial de la Salud (OMS, representa un intento por reducir la duplicación de trabajo y el financiamiento poco equitativo de la investigación sobre enfermedades rezagadas al olvido; por evitar que se efectúen investigaciones sobre asuntos de poca cuantía o que se midan resultados poco útiles; y por fomentar las prácticas éticas y la transparencia. Se han detectado algunos obstáculos mayores que hasta ahora han impedido crear un registro único y común de ensayos clínicos. Con el fin de franquearlos, LATINREC será un registro gratuito que permitirá hacer búsquedas y que se ceñirá a la Plataforma Internacional de Registro de Ensayos Clínicos (ICTRP de la OMS. Además, LATINREC permitirá que los investigadores ingresen en el registro cualquier modificación del protocolo, así como los resultados preliminares. LATINREC ofrecerá grandes ventajas para los consumidores, el gobierno, los profesionales de la salud pública y la industria
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
García Presas, Inmaculada
2008-01-01
La Ley 2/2007, de 15 de marzo, de Sociedades Profesionales considera, entre otras cuestiones, la inscripción de las Sociedades profesionales en el Registro mercantil y en el de las Sociedades profesionales. En este sentido se valora, entre otros contenidos de dicha Ley, su artículo 8, incidiéndose en el grado de exigencia de la inscripción de las Sociedades profesionales en el Registro Civil.
Sistemas de Registro Audiovisual del Patrimonio Urbano (SRAPU)
Conles, Liliana Eva
2006-01-01
El Sistema SRAPU es un método de relevamiento fílmico diseñado para configurar una base de datos interactiva del paisaje urbano. Sobre esta base se persigue la formulación de criterios ordenados en términos de: flexibilidad y eficacia económica, eficiencia en el manejo de datos, democratización de la información. El SRAPU se plantea como un registro audiovisual del patrimonio material e intangible en su singularidad y como conjunto histórico y natural. En su concepción involucra los pro...
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Deepa S. Pureswaran; Richard W. Hofstetter; Brian T. Sullivan
2008-01-01
Subtle differences in pheromone components of sympatric species should be attractive only to the producing species and unattractive or repellent to the nonproducing species, and thereby maintain reproductive isolation and reduce competition between species. Bark beetles Dendroctonus brevicomis and D. frontalis (Coleoptera: Curculionidae) are known to...
Registro multimodal de mamografías: resonancia magnética y rayos-x.
Solves Llorens, Juan Antonio
2014-01-01
Solves Llorens, JA. (2014). Registro multimodal de mamografías: resonancia magnética y rayos-x [Tesis doctoral no publicada]. Universitat Politècnica de València. doi:10.4995/Thesis/10251/38940. Alfresco
AVALIAÇÃO DE ESTUDANTES SOBRE A PRÁTICA DE PRODUZIR REGISTROS DAS ATIVIDADES DE CIÊNCIAS
Directory of Open Access Journals (Sweden)
Helder de Figueiredo e Paula
Full Text Available Nesta pesquisa, apresentamos os resultados da avaliação de um recurso que utilizamos para ensinar ciências: a produção de registros das atividades realizadas pelos estudantes em seus próprios cadernos. Nós investigamos se os estudantes valorizam a produção dos registros, bem como suas justificativas para o interesse ou o desinteresse por essa prática. Nossos dados foram gerados a partir de uma análise das respostas dadas por 196 estudantes a um questionário de avaliação do curso. No processo, nós utilizamos métodos estatísticos combinados com uma análise de enunciações fundamentada na Filosofia da Linguagem de Bakhtin e na Gramática Sistêmico- Funcional de Halliday. Nossos dados mostram que a maioria dos estudantes declara ter feito os registros com frequência e interesse, além de atribuir diversas funções aos mesmos.
Directory of Open Access Journals (Sweden)
Aguilar-Kirigin, Alvaro J.
2011-12-01
Full Text Available Siete ejemplares de la especie Plica plica y tres de Plica umbra fueron colectados en la República de Bolivia y depositados en la Colección Boliviana de Fauna (CBF, La Paz, Bolivia. Todos los registros se realizaron en el Departamento de La Paz, Provincia Abel Iturralde, Capital de Provincia Ixiamas, Sección Primera, Municipio Ixiamas, Cantón Ixiamas, Capital de Cantón Tahua.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Directory of Open Access Journals (Sweden)
Federico Agnolin
2011-01-01
Full Text Available En el presente artículo son reportados ejemplares de diversos taxones de reptiles escamados fósiles procedentes de la base de la Formación Luján (Pleistoceno Superior, en la localidad fosilífera de Merlo, provincia de Buenos Aires, Argentina. Entre los ejemplares registrados se reconoce el primer registro fósil para el género y especie Anops kingii (Amphisbaenidae; asimismo se reporta la presencia de especies indeterminadas de los géneros Homonota (Gekkonidae y Liolaemus (Liolaemidae. La asociación conjunta de estos tres taxones hoy en día no se encuentra representada en el norte de la provincia de Buenos Aires, siendo la región geográficamente más cercana en donde encuentran una superposición en su distribución el Partido de Balcarce, ubicado en el extremo Sureste de la provincia y alejado unos 600 kilómetros al sur de la localidad fosilífera de Merlo. La presencia conjunta de estos tres reptiles se encuentra de acuerdo con la posible existencia de un pulso árido y frío, tal como ha sido propuesto con anterioridad para porción más inferior del Pleistoceno Superior en la provincia de Buenos Aires.
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
REGISTRO DE CÁNCER COLORRECTAL HEREDITARIO: UNA EXPERIENCIA DE “CLEVELAND CLINIC FOUNDATION”
Directory of Open Access Journals (Sweden)
Church J, MBCHB
2017-07-01
RESUMEN: Se describe el enfoque de “Cleveland Clinic” para el cáncer colorrectal hereditario. Esto es multidisciplinario, involucrando varias especialidades y así como servicios de asesoramiento genético y de salud mental dentro del registro.
Acianthera hygrophila(Orchidaceae, nuevo registro para Uruguay
Directory of Open Access Journals (Sweden)
Andrés J. Rossado
2014-07-01
Full Text Available Se reporta por primera vez para la flora de Uruguay la orquídea epífita Acianthera hygrophila (Barb. Rodr. Pridgeon & M.W. Chase. La misma fue hallada en el bosque ribereño del Río Yaguarón en el este del departamento de Cerro Largo próximo al límite con Brasil. Este registro representa el límite sur de distribución de la especie. Se presenta una descripción ampliada, ilustración y mapa de distribución de A. hygrophila, así como una clave para la identificación de las especies de Acianthera presentes en Uruguay
Sistema instrumentado para o registro de comportamentos ingestivos
Pereira, Gustavo Vieira
2003-01-01
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro Tecnológico. Programa de Pós-Graduação em Engenharia Elétrica. Este trabalho descreve um sistema automático para registro de parâmetros que permitam o estudo de atributos do comportamento ingestivo de animais em laboratório. Este sistema é orientado a usuários que não são profissionais da área de engenharia. Portanto, dispensa a necessidade de configurações eletrônicas que são desestimulantes para biólogos, fisiologist...
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Registros cerámicos de época Taifa en madina labla (Niebla, Huelva) : un acercamiento tipológico
Beltrán Pinzón, José Manuel
2010-01-01
El presente estudio constituye un intento de clasificación de la cerámica del periodo taifa del asentamiento de Niebla (Huelva), según los registros obtenidos en la excavación realizada en el sector de murallas de El Desembarcadero, actividad enmarcada dentro del Proyecto de Arqueología Urbana de la Ciudad de Niebla (PAUCN). El conjunto cerámico estudiado revela unas conexiones bastante estrechas con otros registros cerámicos del Suroeste Peninsular.__________________________The present study...
Violência contra crianças e adolescentes no Amazonas: análise dos registros
Directory of Open Access Journals (Sweden)
Angela Costa Maia
2012-06-01
Full Text Available A violência contra crianças e adolescentes é um fenômeno frequente, mas pouco se conhece sobre o contexto em que ocorre e sobre suas consequências. O objetivo deste estudo é caracterizar esta violência no Interior do Estado do Amazonas. Foram analisados 193 registros do Relatório Txain sobre a Violência contra Crianças e Adolescentes. Como resultado, verificou-se que grande parte dos registros oficiais omitem informações. A agressão física é o tipo de violência mais relatado, e a maior parte das vítimas é constituída de adolescentes do sexo feminino de idades entre 12 e 15 anos. Os agressores são predominantemente desconhecidos das vítimas e são do sexo masculino. Em termos de consequências para a saúde, há referência a algumas lesões físicas, mas os dados são bastante omissos em relação à saúde mental. Estes dados sugerem a necessidade de integralização e aprimoramento dos sistemas de registro, informação e atendimento a vítimas fora das grandes cidades.
Christopher J. Fettig; Kurt K. Allen; Robert R. Borys; John Christopherson; Christopher P. Dabney; Thomas J. Eager; Kenneth E. Gibson; Elizabeth G. Hebertson; Daniel F. Long; A. Steven Munson; Patrick J. Shea; Sheri L. Smith; Michael I. Haverty
2006-01-01
High-value trees, such as those located in residential, recreational, or administrative sites, are particularly susceptible to bark beetle (Coleoptera: Curculionidae: Scolytinae) attack as a result of increased amounts of stress associated with drought, soil compaction, mechanical injury, or vandalism. Tree losses in these unique environments generally have a...
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Czech Academy of Sciences Publication Activity Database
Štefková, Kristýna; Okrouhlík, Jan; Doležal, Petr
2017-01-01
Roč. 114, JAN 11 (2017), s. 1-6 E-ISSN 1802-8829 Grant - others:MSM ČR(CZ) LH12098; Lesy ČR(CZ) 08/2009 Institutional support: RVO:60077344 Keywords : Coleoptera * Curculionidae * Scolytinae Subject RIV: ED - Physiology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 1.167, year: 2016 http://www.eje.cz/pdfs/eje/2017/01/01.pdf
Directory of Open Access Journals (Sweden)
OLGA YAMIRA PEÑA GALEANO
2016-01-01
Full Text Available Este trabajo tiene como objetivo presentar resultados de la investigación titulada “El modelo metasociocognitivo. Una alternativa para situar la escritura en contexto” que está fundamentada en la perspectiva sociocultural, el modelo metasociocognitivo y la noción de cognición situada. A nivel metodológico, se aborda el diseño de Investigación Acción, por lo cual se acude a la observación participante, encuestas, entrevistas y registros de clase. En este sentido, se parte del análisis del rastreo de trabajos investigativos, acorde con tres categorías: la escritura en el ciclo uno, los procesos cognitivos y los procesos metacognitivos. Luego se presentan los resultados, organizados en seis hechos, que se derivan del análisis de los procesos de enseñanza y aprendizaje en la producción escrita de los niños en el primer ciclo: estudiantes de grado primero y segundo de básica primaria. Finalmente, se exponen las conclusiones en el ámbito pedagógico, disciplinar e investigativo.
Directory of Open Access Journals (Sweden)
Luciano Palmieri
2013-09-01
Full Text Available Paracrias strii Schauff, 1985 and P. ceratophaga Palmieri & Hansson sp. nov. are first record in Brazil and both are associated with Ceratopus Schoenherr larvae (Coleoptera, Curculionidae reared from syconia of two species of fig-trees. Both Paracrias species are diagnosed and illustrated. Males of P. ceratophaga sp. nov. are described. The association of Paracrias with weevil larvae is briefly discussed.
Directory of Open Access Journals (Sweden)
2015-08-01
Full Text Available Esta pesquisa teve como objetivo avaliar a flutuação populacional de Rhynchophorus palmarum L. (Coleoptera: Curculionidae em plantios de Elaeis guineensis Jacq, em ecossistemas de savana e floresta no estado de Roraima. A pesquisa foi desenvolvida durante o perÃodo de janeiro de 2011 a fevereiro de 2012 nos campos experimentais da Embrapa Roraima: Monte Cristo e Caroebe, numa área de 2 hectares com a cultura da Palma de Óleo, em cada campo. Foram distribuÃdas armadilhas iscadas com roletes de cana-de-açúcar e feromônio de agregação para captura dos insetos no entorno dos plantios. Ocorreu flutuação de R. palmarum com picos populacionais nos meses de julho e agosto no ecossistema de savana e de abril a setembro no ambiente de floresta. A população de R. palmarum foi menor em meses de baixa precipitação pluviométrica nos dois ambientes avaliados com a Palma de Óleo em Roraima Population Fluctuation of Rhynchophorus palmarum L. (Coleoptera: Curculionidae in Plantations of Oil Palm in Roraima Abstract. This research aimed to evaluate the population fluctuation Rhynchophorus palmarum L. (Coleoptera: Curculionidae in Elaeis guineensis Jacq plantations in forest and savanna ecosystems in the state of Roraima. The research was conducted during the period from January 2011 to February 2012 in the experimental field of Embrapa Roraima: Monte Cristo and Caroebe in an area of 2 hectares with culture Oil Palm in each field. Traps baited with rollers cane sugar and aggregation pheromone for capturing insects in the vicinity of the plantations were distributed. Fluctuation occurred R. palmarum with population peaks in the months of July and August in the savanna ecosystem and from April to September in the forest environment. The population of R. palmarum was lower in months of low rainfall in the two environments assessed with a palm-oil-in Roraima.
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Christopher J. Fettig; Kurt K. Allen; Robert R. Borys; John Christopherson; Christopher P. Dabney; Thomas J. Eager; Kenneth E. Gibson; Elizabeth G. Hebertson; Daniel F. Long; A. Steven Munson; Patrick J. Shea; Sheri L. Smith; Michael I. Haverty
2006-01-01
High-value trees, such as those located in residential, recreational, or administrative sites, are particularly susceptible to bark beetle (Coleoptera: Curculionidae: Scolytinae) attack as a result of increased amounts of stress associated with drought, soil compaction, mechanical injury, or vandalism. Tree losses in these unique environments generally have a...
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Directory of Open Access Journals (Sweden)
Traian MANOLE
2013-12-01
Full Text Available Controlled growth in the laboratory of some species of insect’s are justified both scientifically and practically. Due to the economic importance that the corn crop pest Tanymecus dilaticollis Gyll. (Coleoptera: Curculionidae had in Romania like the main pest of maize crops we tried to obtain successive generations under environment controlled of the insect mentioned. In this paper we aim to improve the efficiency of the multiplication of the species with respect to two aspects: attending larval and multiplication high efficiency. The coefficient value of 20, 90 obtained by us indicate a considerable increase in performance compared to previous attempts multiplication thus increasing your chances of recovery of this method of mass multiplication.
Caracterización de la fibrosis quística en el primer año de vida
Directory of Open Access Journals (Sweden)
Gladys Fuentes Fernández
Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.
Directory of Open Access Journals (Sweden)
Paulino Artur Ferreira de Sousa
2012-01-01
Full Text Available Revisión integrativa que analizó en las publicaciones las contribuciones de los registros electrónicos de salud para la seguridad de los pacientes en unidades de cuidados intensivos. La investigación se realizó en las bases de datos CINAHL, MEDLINE y SciELO, utilizando las palabras clave: registros médicos electrónicos, sistemas de información, informática de enfermería, informática médica, unidades de cuidados intensivos, seguridad del paciente y gestión de la seguridad. Se incluyeron 64 artículos y se analizaron en dos categorías empíricas: "Los sistemas de información y tecnología de la información: el registro electrónico para la continuidad de los cuidados de enfermería", "sistemas de apoyo: las contribuciones a la seguridad del paciente" y "los indicadores de calidad de la atención y seguridad de los pacientes de los registros electrónica". Los estudios señalaron como contribuciones a la continuidad de la atención, la toma de decisiones basadas en los sistemas de soporte de decisiones y la creación de indicadores de calidad y seguridad de los pacientes de los registros electrónicos.
la escritura oficial del registro civil: cuando la ciudadanía pasa por la inscripción*
Directory of Open Access Journals (Sweden)
Claudine Dardy
2002-01-01
Full Text Available Los estados modernos registran oficialmente las identidades de los individuos. Este registro es una obligación, un cierto tipo de control; pero al mismo tiempo brinda un espacio social con todos los derechos que le corresponden, es decir, provee de identidades sociales. Aunque esta inscripción y burocratización de la vida cotidiana es un control, paradójicamente abre espacios de libertad. Así, aunque el modelo identitario del Registro Civil otorga privilegios a ciertas marcas (nombre, apellido, nacionalidad, sexo, impone la permanencia de las mismas. Un estado democrático dirige y codifica las posibles salidas de este modelo.
Directory of Open Access Journals (Sweden)
Guillermo L Guzmán
2011-11-01
Full Text Available Se cita por primera vez para el margen continental de Chile una especie de camarón Stenopodidae, asociado a una esponja hexactinelida. Los especímenes fueron recolectados en dos sitios de Chile central (31°12'S, 71°52'W y 36°00'S, 73°38'W; 922 a 1000 m de profundidad. Las esponjas estaban adheridas al sustrato con probable origen en emanaciones de metano. Spongicoloides sp. aff. a S. gala-pagensis, es el primer registro de la familia en aguas del margen continental del Pacífico suroriental. Los ejemplares coinciden con los rangos de la variación morfológica de S. galapagensis, no obstante difieren en el número de branquias descrito.This is the first record of a species of Stenopodid shrimp along the Chilean margin, associated with a hexactinellid sponge. The specimens were collected at two sites in central Chile (31°12'S, 71°52'W and 36°00'S, 73°38'W; 922 to 1000 m depth. The sponges were attached to the substrate with probable origins in methane seepage. Spongicoloides sp. aff. to S. galapagensis constitutes the first record of the family for the eastern south Pacific continental margin. The specimens coincide with the ranges of morphological variation of S. galapagensis, although they differ in the number of brachia described.
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Salsench Cabré, Juan; Samsó Manzanedo, Jorge; Nogueras Bayona, Joaquim
1993-01-01
Se hace una revisión bibliográfica del registro de trayectorias condíleas en la construcción de prótesis totales. Se presenta un nuevo método sencillo y eficaz, para su registro en la fase de planchas base y rodetes.
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Miastenia gravis familiar: registro de dois irmãos
Directory of Open Access Journals (Sweden)
Marcos R. G. de Freitas
1985-03-01
Full Text Available A forma familiar da miastenia gravis é condição relativamente rara, ocorrendo em cerca de 3,4% dos pacientes miastênicos. Os autores registram os casos de dois irmãos não-gêmeos, apresentando miastenia gravis com acometimento predominantemente ocular desde o nascimento. Um terceiro irmão faleceu na infância, provavelmente com a mesma afecção. Os pais eram consanguíneos. Estudo da incidência da forma familiar da miastenia e de seus aspectos clínicos, genéticos e terapêuticos complementa os registros.
Siete nuevos registros de Arctiini (Lepidoptera: Erebidae: Arctiinae para Perú
Directory of Open Access Journals (Sweden)
Juan Grados
2013-12-01
Full Text Available Se presenta siete nuevos registros de Arctiini (Erebidae: Lepidoptera para Perú. Algunas de las especies son raras en colecciones. Cada nuevo reporte pertenece a géneros diferentes, proporcionando para cada género las especies que ocurren en el Perú, basado en colecciones y las fuentes bibliográficas de las descripciones originales. Se da a conocer un nuevo sinónimo para Agyrtiola niepeltiGaede, 1926.
N. Erbilgin; S.R. Mori; J.H. Sun; J.D. Stein; D.R. Owen; L.D. Merrill; R. Campos Bolande; os; K.F. Raffa; T. Mendez Montiel; D.L. Wood; N.E. Gillette
2007-01-01
Bark beetles (Coleoptera: Curculionidae, Scolytinae) have specialized feeding habits, and commonly colonize only one or a few closely related host genera in their geographical ranges. The red turpentine beetle, Dendroctonus valens LeConte, has a broad geographic distribution in North America and exploits volatile cues from a wide variety of pines...
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Primeros registros de la cotorra argentina (Myiopsitta monachus en el estado de Hidalgo, México
Directory of Open Access Journals (Sweden)
Iriana Zuria
2017-04-01
Full Text Available La cotorra argentina (Myiopsitta monachus es una especie de ave exótica e invasora en México. En esta nota presentamos los primeros registros de esta especie en el estado de Hidalgo. Observamos individuos adultos y nidos activos desde 2011 en dos ciudades de la entidad: Huejutla y Pachuca. Los nidos en Huejutla los ubicamos tanto en una galera metálica como en una antena de telefonía, mientras que en Pachuca un nido estaba en una yuca dentro de un campo de golf. La presencia de nidos activos indica que la especie está en proceso de establecerse en la entidad. La distribución de la cotorra argentina se ha incrementado de manera significativa en México ya que actualmente se tienen registros en 23 entidades del país.
Frank, Steven D; Anderson, Amanda L; Ranger, Christopher M
2017-12-08
Exotic ambrosia beetles, particularly Xylosandrus crassiusculus (Motschulsky) (Coleoptera: Curculionidae: Scolytinae) and Xylosandrus germanus (Blandford) (Coleoptera: Curculionidae: Scolytinae), are among the most damaging pests of ornamental trees in nurseries. Growers have had few tactics besides insecticide applications to reduce ambrosia beetle attacks but recent research has shown that attacks may be reduced by maintaining media moisture below a 50% threshold thereby reducing flood stress. We compared the efficacy of managing media moisture and insecticide applications for reducing ambrosia beetle attacks on three ornamental tree species in North Carolina. During trials in spring 2013 and 2015, flooded Cornus florida and Cornus kousa were heavily attacked despite sprays with permethrin, but nonflooded C. kousa or C. florida were not attacked. In spring 2015 trials, both nonflooded and flooded Styrax japonicus were heavily attacked regardless of permethrin applications. Although ethanol emissions were not measured, the apparently healthy nonflooded S. japonicus trees may have been exposed to an unknown physiological stress, such as low temperature injury, the previous winter, which predisposed them to beetle attack. However, ethanol levels within host tissues were not measured as part of the current study. X. crassiusculus (75%), Xyloborinus saxesenii Ratzburg (13%), and X. germanus (9%) were the most abundant species collected in ethanol baited traps deployed in 2015, while X. crassiusculus (63%) and X. germanus (36%) were the predominant species reared from attacked trees. Results indicate that managing media moisture levels at or below 50%, and maximizing tree health overall, may provide significant protection against Xylosandrus spp. attacks in flood intolerant tree species. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
Registro Nacional de Internación por Insuficiencia Cardíaca
Directory of Open Access Journals (Sweden)
Raúl Borracci
2009-01-01
Full Text Available IntroducciónLa insuficiencia cardíaca representa una de las principales causas de internación con una tasa elevada de complicaciones y cuyo enfoque no parece que haya mejorado en los últimos años.ObjetivosConocer el perfil epidemiológico y clínico, analizar las medidas terapéuticas y la evolución durante la internación y a los 3 meses de pacientes admitidos por insuficiencia cardíaca descompensada.Material y métodosRegistro prospectivo, multicéntrico de pacientes internados por insuficiencia cardíaca descompensada en 31 centros de todo el país que aceptaron la invitación a participar del registro. Se analizaron variables vinculadas con la presentación y la evolución hospitalaria y a los 90 días.ResultadosSe incluyeron 736 pacientes, mediana de edad 74 años (64-82, 41% mujeres, 75% hipertensos, 27% diabéticos, 20% infarto previo, 30% fibrilación auricular crónica, 17% insuficiencia renal crónica, 18% EPOC. Sólo el 29% era de etiología isquémico-necrótica. El 47% había tenido internación en el último año por insuficiencia cardíaca. Las causas de descompensación más frecuentes fueron infecciones, suspensión del tratamiento y transgresión alimentaria.Las formas graves de presentación (shock cardiogénico, edema agudo de pulmón, anasarca representaron el 30%. El 60% de los pacientes se internaron en área crítica. La mediana de permanencia fue de 7 (5-11 días. La mortalidad hospitalaria fue del 8%. A los 90 días, la reinternación fue del 24,5% y la mortalidad posalta fue del 12,8%.ConclusionesEl presente registro confirma que se trata de una población de edad avanzada con una incidencia alta de comorbilidades. Muchas descompensaciones ocurren por factores prevenibles. La tasa de complicaciones es elevada y no se redujo en la última década.REV ARGENT CARDIOL 2009;77:33-39.
Directory of Open Access Journals (Sweden)
Hugo O. Toledo Alvarado
2015-01-01
Full Text Available Se analizaron 1,289 registros de hembras de primer parto con diversas proporciones de genes Bos indicus y Bos taurus (Charolais, Suizo, Simmental, Holstein Friesian y Salers. Tanto animales puros y cruzados de un hato comercial, ubicado en el municipio de Hueytamalco, Puebla, nacidas entre 1966 a 2006, con el objetivo de estimar la combinación óptima de genes Cebú y la retención de heterosis (RVH sobre las características de peso al destete ajustado a 270 días (PD y edad a primer parto (EPP. A partir de modelos de regresión múltiple se identificó la proporción de Cebú con el mejor comportamiento para las dos características de acuerdo al coeficiente de determinación (R 2 y al estadístico de Mallow (CP. La mejor respuesta para PD se encontró en el rango de 42 a 70 % de genes Bos indicus ; mientras que las menores EPP se establecieron entre 27 al 40 % de proporción Cebú. La retención de heterosis que mostró mayor potencial para PD fue de 76 a 78 % y para EPP de 79 a 92 %. Estos resultados manifiestan la importancia de los efectos no aditivos en ambas características, así como la necesidad de realizar cruzamientos dirigidos.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
UNA ESPECIE NUEVA DE MYRCIA (MYRTACEAE Y NUEVOS REGISTROS DE LA FAMILIA PARA COLOMBIA
Directory of Open Access Journals (Sweden)
CARLOS PARRA-O.
2013-12-01
Full Text Available Se describe e ilustra una especie nueva de Myrcia (Myrtaceae para los Andes de Colombia. Se discuten las afinidades taxonómicas del nuevo taxón dentro de las Myrtaceae colombianas. Adicionalmente, se presentan cinco nuevos registros de Myrtaceae para la flora nativa colombiana.
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
Directory of Open Access Journals (Sweden)
Ervino Bleicher
2010-06-01
Full Text Available The objective of this research was to determine, in field conditions, the minimal of phosphine effective dose for the cashew root borer control. Three experiments were set up at three different periods: August, October and November, 1994, to control the cashew root borer, Marshallius bondari Rosado-Neto (Coleoptera: Curculionidae, in Piaui State, Brazil. One, two, three and six phosphine tablets of three gram each, per plant were tested. In the August essay, phosphine was inefficient to control the borer. In the October essay, control was achieved using as little as 2 tablets per plant and in November with one tablet per plant to control the adult borers in the soil. Higher efficiency was achieved when treatment was applied far away from the last rain, in other words, as soil dries out.Objetivou-se determinar, em condições de campo, a dose mínima de fosfina para o controle da broca da raiz do cajueiro. Foram instalados 3 experimentos em épocas distintas, sendo o primeiro em agosto, o segundo em outubro e o terceiro em novembro de 1994 para o controle de Marshallius bondari Rosado-Neto (Coleoptera: Curculionidae em cajueiro, Anacardium occidentale L. no município de Pio IX, Estado do Piauí. Foram testadas 1; 2; 3 e 6 pastilhas de fosfina na forma de fosfeto de alumínio, de 3 gramas cada, por planta. No ensaio conduzido em agosto nenhum tratamento foi eficiente para o controle de brocas adultas no solo. No ensaio instalado em outubro, a fosfina foi eficiente a partir de duas pastilhas por planta e no ensaio de novembro a partir de uma pastilha por planta para o controle de adultos no solo. A eficiência foi tanto maior quanto maior foi o tempo decorrido após a última chuva, estando, portanto, o solo mais seco.
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Directory of Open Access Journals (Sweden)
Mercedes Cáffaro Rovira
2017-01-01
Full Text Available La enfermedad de Huntington (EH es una enfermedad hereditaria de baja prevalencia, por lo que se incluye en los registros de enfermedades raras. El registro poblacional de enfermedades raras de las Islas Baleares se inició en el año 2010. Previamente no existían datos de prevalencia y mortalidad de la EH en las Islas Baleares. El objetivo de este estudio fue determinar la prevalencia y la mortalidad de la enfermedad de Huntington en las Islas Baleares durante el periodo 2010-2013. Métodos: Se utilizaron como fuentes de información el registro poblacional de enfermedades raras de las Islas Baleares, del que se obtuvieron los casos diagnosticados, el Registro de mortalidad de las Islas Baleares, del que se obtuvieron los casos fallecidos, el registro del Servicio de Salud de las Islas Baleares del que se obtuvieron el número de tarjetas sanitarias y del Instituto Nacional de Estadística se obtuvieron los datos de población. Se calcularon las tasas de prevalencia y de mortalidad. Resultados: El registro poblacional de enfermedades raras de las Islas Baleares durante el periodo 2010-2013 registró 27 casos de EH. El 63% fueron mujeres. La tasa de prevalencia fue de 2,6 por 105 y la tasa de mortalidad de 1,1 por 105. La isla de Menorca fue la más afectada con una prevalencia de 5,9 por 105 y una mortalidad de 2,1 por 105. Conclusiones: La prevalencia y mortalidad de la EH en las Islas Baleares son bajas en comparación con zonas del entorno.
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Directory of Open Access Journals (Sweden)
Juan R. Ordoñana
2018-01-01
Full Text Available Los diseños genéticamente informativos, y en particular los estudios de gemelos, constituyen la metodología más utilizada para analizar la contribución relativa de los factores genéticos y ambientales a la variabilidad interindividual. Básicamente, consisten en comparar el grado de similitud, con respecto a una característica o rasgo determinado, entre gemelos monocigóticos y dicigóticos. Además de la clásica estimación de heredabilidad, este tipo de registros permite una amplia variedad de análisis únicos por las características de la muestra. El Registro de Gemelos de Murcia es un registro de base poblacional centrado en el análisis de conductas relacionadas con la salud. Las prevalencias de problemas de salud observadas son comparables a las de otras muestras de referencia de ámbito regional y estatal, lo que avala su representatividad. En conjunto, sus características facilitan el desarrollo de diversas modalidades de investigación, además de diseños genéticamente informativos y la colaboración con distintas iniciativas y consorcios.
Directory of Open Access Journals (Sweden)
Sergio A Carrasco
2012-03-01
Full Text Available Early life stages of cephalopods were sampled with zooplankton nets in southern Chile (41°-43°S during the CIMAR 11 Fiordos cruise, November 2005. A total of 52 individuals were collected, comprising three families (Octopodidae, Sepiolidae, Onychoteuthidae and four species (Robsonella fontaniana, Enteroctopus megalocyathus, Semirossia patagonica, an undetermined Onychoteuthidae species. Paralarvae of Octopodidae have been previously recorded in northern and southern Chile; however, for Sepiolidae and Onychoteuthidae, this is the first record of early life stages in Chilean waters.Estadios tempranos de cefalópodos fueron obtenidos con redes de zooplancton en el sur de Chile (41°-43°S durante el crucero CIMAR 11 Fiordos en noviembre de 2005. Un total de cincuenta y dos individuos fueron recolectados, comprendiendo tres familias (Octopodidae, Sepiolidae and Onychoteuthidae y cuatro especies (Robsonella fontaniana, Enteroctopus megalocyathus, Semirossia patagonica, y una especie indeterminada de Onychoteuthidae. Si bien existen descripciones previas de paralarvas de Octopodidae para el norte y sur de Chile, este trabajo provee el primer registro de estadios tempranos de vida de Sepiolidae y Onychoteuthidae para aguas chilenas.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Registros adicionales del carrao (Aramus guarauna en el estado de Jalisco, México
Directory of Open Access Journals (Sweden)
Carlos Palomera-García
2015-06-01
Full Text Available Se reportan registros adicionales del carrao (Aramus guarauna para el interior del Estado de Jalisco, México. Esta información, en conjunto con la previa conocida, apoya la idea que dice que la distribución de la especie podría está relacionada con la del caracol (Pomacea flagellata, Gastropoda: Ampullaridae que le sirve de alimento.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
Directory of Open Access Journals (Sweden)
Juan P. R. Bouvet
2008-06-01
Full Text Available Se menciona por primera vez para Argentina la especie Ctenarytaina spatulata Taylor, asociada a plantaciones de eucalipto. Este nuevo registro se obtuvo en la Provincia de Entre Ríos, Argentina.Ctenarytaina spatulata Taylor, a species associated with eucalypt plantations, is recorded for the first time from Entre Ríos, Argentina.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Soria Iglesias, Francisco Javier; Jiménez, A.; Villagrán Pinteño, Miguel; Ocete Rubio, María Elvira
2005-01-01
En un encinar del SW de España se ha realizado el seguimiento de una población del gorgojo Curculio elephas Gyll. (Coleóptera, Curculionidae) durante 2001 y 2002. La finalidad del trabajo fue valorar y relacionar la incidencia de la infestación del insecto con el proceso de maduración y caída natural de frutos de la encina. Durante ...
Racionalidade e métodos: estudo BREATHE - I registro brasileiro de insuficiência cardíaca
Directory of Open Access Journals (Sweden)
2013-05-01
Full Text Available FUNDAMENTO: Diversos registros locais buscam de forma isolada retratar características clínicas de pacientes internados com Insuficiência Cardíaca (IC em hospitais e comunidades brasileiras. De forma geral, a análise desses dados sugere que existam diferenças importantes na etiologia, nos fatores de descompensação, no tratamento e no prognóstico de pacientes com IC nas diferentes regiões brasileiras. OBJETIVOS: Avaliar as características demográficas, clínicas, prognósticas de 1.200 pacientes admitidos com diagnóstico clínico de insuficiência cardíaca descompensada em um grupo de 60 hospitais representativos das diferentes regiões brasileiras. MÉTODOS: Estudo observacional transversal (registro com seguimento longitudinal de doze meses (visitas de admissão, alta hospitalar, três meses, seis meses e doze meses após inclusão, em que pacientes admitidos em hospitais da rede pública e privada com quadro clínico primariamente de IC definida serão estudados. RESULTADOS: Os resultados serão apresentados logo após o término da coleta, avaliação da qualidade e análise estatística dos dados. CONCLUSÕES: A análise dos resultados deste registro multicêntrico permitirá um planejamento mais adequado do aporte de recursos financeiros, pessoais e tecnológicos para a área da saúde, bem como o planejamento de medidas preventivas mais eficazes na IC descompensada.
Directory of Open Access Journals (Sweden)
César Aguilar
2013-04-01
Full Text Available En el presente trabajo la larva de Telmatobius rimac es descrita y ocho nuevos registros de anfibios y reptiles para el departamento de Lima son dados a conocer. Los nuevos registros de anfibios para Lima son Gastrotheca peruana y Pleurodema marmorata. Los nuevos registros de reptiles son las lagartijas Phyllodactylus gerrhopygus y Ameiva edracantha, y las serpientes Leptotyphlops tricolor, Philodryas tachymenoides, Sibynomorphus vagus y Tantilla capistrata. Con este estudio la herpetofauna presente en el departamento de Lima queda compuesta de 7 anfibios y 33 reptiles. Se proporciona una clave de identificación para los anfibios y una lista actualizada de la herpetofauna del departamento de Lima.
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Directory of Open Access Journals (Sweden)
Alejandro García-Becerra
2012-06-01
Full Text Available El ratón de los volcanes (Neotomodon alstoni se registra por primera vez en el estado de Hidalgo, México. Los ejemplares se recolectaron en diciembre de 2010, en el municipio de Almoloya, aproximadamente a 32.8 km al norte de la localidad documentada más cercana al estado de Tlaxcala, por lo que este nuevo registro se convierte en el más norteño para la distribución conocida del ratón de los volcanes.The volcano mouse (Neotomodon alstoni is firstly recorded in the State of Hidalgo. Specimens were collected in December 2010, at the municipality of Almoloya, approximately 32.8 km to the north from the nearest locality in the state of Tlaxcala. Therefore, this is the northernmost record for the range of the Mexican volcano mouse.
Situação do registro de medicamentos fitoterápicos no Brasil
Directory of Open Access Journals (Sweden)
Ana C. B. Carvalho
Full Text Available Fitoterápico é uma classe de medicamento largamente utilizada no país e constitui um mercado em potencial expansão. Este artigo busca traçar um panorama sobre os medicamentos fitoterápicos registrados no país e as espécies vegetais que lhe deram origem, enfocando o papel regulador da Anvisa. Realizou-se uma pesquisa nas seguintes bases de dados: Visalegis e site da Anvisa para verificar os medicamentos fitoterápicos registrados na Anvisa, obtendo-se os seguintes dados: há 432 fitoterápicos simples registrados e 80 compostos, as espécies vegetais com maior número de derivados registrados são o Ginkgo (Ginkgo biloba e a Castanha da Índia (Aesculus hippocastanum, com 33 e 29 registros, respectivamente. O artigo traz ainda uma tabela com as espécies vegetais que possuem derivados registrados como fitoterápicos simples, sua classificação terapêutica, lista as espécies registradas em associação, as principais formas farmacêuticas registradas e os percentuais de registro e empresas por região do país, fornecendo assim um panorama da atuação da Anvisano setor de fitoterápicos.
Directory of Open Access Journals (Sweden)
Raúl Valencia-Herverth
2010-04-01
Full Text Available Se presentan 6 registros nuevos de aves para el estado de Hidalgo que se obtuvieron durante el trabajo de campo realizado de agosto 2006 a octubre 2007 y de registros no publicados de especímenes de la Colección Ornitológica del Instituto Tecnológico de Huejutla.Six new state records of birds for Hidalgo based on field work carried out from August 2006 to October 2007 are presented, and from unpublished records of specimens in the Ornithological Collection of the Instituto Tecnológico de Huejutla.
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Directory of Open Access Journals (Sweden)
Alfredo E Zurita
2011-06-01
Full Text Available Los Glyptodontidae del Neógeno tardío (Pisos/Edades Chapadmalalense-Marplatense; ca. 3.9-1.8 Ma constituyen un grupo escasamente conocido, en tanto la mayoría de los registros están limitados a restos aislados de la coraza dorsal y/o caudal. Las únicas excepciones están representadas por Paraglyptodon chapalmalensis (Ameghino in Rovereto, un fósil guía para el Chapadmalalense superior, y el Plohophorini Plohophorus figuratus Ameghino. Por otro lado, los "Hoplophorinae" Hoplophorini son gliptodontes que tienen sus primeros registros durante los Pisos Huayqueriense (Mioceno tardío y "Araucanense" (Mioceno tardío-Plioceno, pero están prácticamente ausentes durante los Pisos Chapadmalalense-Marplatense (Plioceno-Pleistoceno temprano. Posteriormente, los Hoplophorini (Neosclerocalyptus Paula Couto son, junto con Glyptodon Owen, los Glyptodontidae de registro más frecuente en el Pleistoceno de América del Sur. En esta contribución damos a conocer el primer registro de un Hoplophorini de antigüedad Chapadmalalense, asignado al género Eosclerocalyptus C. Ameghino (Eosclerocalyptus cf. E. lineatus. Este nuevo material, representado por una coraza dorsal, fue exhumado de la sección superior de la Fm. Chapadmalal, Mar del Plata, provincia de Buenos Aires. Desde una perspectiva morfológica, esta coraza presenta un tamaño intermedio entre E. tapinocephalus Cabrera, E. proximus (Moreno & Mercerat y Neosclerocalyptus Paula Couto. Junto con cf. Paraglyptodon chapalmalensis y Plohophorus figuratus Ameghino, estos registros representan los Glyptodontidae Pliocenos más completos que se conocen; a su vez, completa parcialmente la distribución estratigráfica de los Glyptodontidae Hoplophorini.The late Neogene (Chapadmalalan-Marplatan Stages; ca. 3.9-1.8 Ma Glyptodontidae from southern South America are poorly known since most of the record are limited to remains of the dorsal and/or caudal armour. In this sense, the exceptions are represented
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Directory of Open Access Journals (Sweden)
Gabriel Barragán
2009-01-01
Full Text Available Antecedentes. El registro del paro cardíaco es una actividad que se debe acompañar en la reanimación cerebro cardio pulmonar. En Colombia no existe un formato de registro oficial de paro cardiorrespiratorio, lo que dificulta la investigación en reanimación y la conducción de los procesos de responsabilidad médica que se deriven de esta atención. Objetivo. Analizar la calidad del registro de paro cardíaco en casos de responsabilidad médico legal iniciada a médicos generales que tuvieron asesoría científica del Fondo para Auxilio de Demandas de la Sociedad Colombiana de Anestesiología y Reanimación (SCARE-FEPASDE, 1999-2007. Material y métodos. Se realizó una investigación tipo serie de casos, en donde se incluyeron los casos de paro cardiorrespiratorio que tuvieron demanda médico legal y que fueron atendidos por médicos generales, entre 1999 y 2007, y que requirieron asesoría jurídica por SCARE-FEPASDE. La información se registró en tablas de Excel®, según las recomendaciones Utstein. La calificación de calidad se hizo por tres médicos expertos en responsabilidad médica de manera independiente. Se utilizó un formato de calificación sobre la proporción de registros realizados sobre 25 ítem posibles. La calidad se consideró alta (mayor de 95% ítem, media (70-94% ítem y baja (menor de 70%. En los casos de desacuerdo se realizó consenso. Resultados. Se incluyeron en total 83 casos. La calidad del registro del paro fue media en 49 casos (59%, baja en 32 casos (39% y alta en dos casos. Conclusión. El registro de paro cardiorrespiratorio en casos de responsabilidad médica es de mediana calidad, por lo que no se alcanza a cumplir con los estándares internacionales y las guías al estilo Utstein.
Directory of Open Access Journals (Sweden)
María del Canto de Hoyos-Alonso
2016-01-01
Conclusiones: Casi la mitad de los pacientes con anticolinesterásicos o memantina no tienen registrado diagnóstico de demencia en su HCE-AP. El registro mejora al aumentar el tiempo de seguimiento. Se requieren mejoras de la HCE-AP, coordinación asistencial adecuada y actitud activa para aumentar la calidad del registro de demencia.
Primer registro de la familia Morchellaceae (Ascomycota: Pezizales para Colombia
Directory of Open Access Journals (Sweden)
César Augusto Pinzón Osorio
2017-04-01
Full Text Available Se registra por primera vez al género Morchella Dill. ex Pers. (Ascomycota, Pezizales, único representante de la familia Morchellaceae para la micobiota Colombiana. El ascocarpo fue recolectado en un bosque muy húmedo premontano, en la vereda Santa Helena, municipio de Gachalá, departamento de Cundinamarca. El espécimen es descrito e ilustrado con fotografías y se aporta información sobre su distribución, ecología y sustrato de crecimiento. La identidad taxonómica del ejemplar es discutida de acuerdo al concepto morfológico tradicional establecido en la literatura micológica. Con este reporte, en Colombia el orden Pezizales queda constituido por 17 especies contenidas en 12 géneros y 7 familias.
Primer registro de Vespula vulgaris (Hymenoptera: Vespidae) en la Argentina
Maité MASCIOCCHI; Jacqueline R. BEGGS; James M. CARPENTER; Juan C. CORLEY
2010-01-01
Vespula vulgaris (Linnaeus) es un véspido social nativo de la región Holártica. En este trabajo reportamos la primera detección de esta especie en Argentina. Obreras de esta avispa fueron capturadas cerca de la ciudad de San Carlos de Bariloche (Argentina) en Febrero de 2010, mientras se tomaban muestras de otra avispa invasora, Vespula germanica (Fabricius) o chaqueta amarilla, de morfología externa y hábitos similares a la anteriormente mencionada. Además, detallamos algunos caracteres de i...
Primer registro de Vespula vulgaris (Hymenoptera: Vespidae en la Argentina
Directory of Open Access Journals (Sweden)
Maité MASCIOCCHI
2010-01-01
Full Text Available Vespula vulgaris (Linnaeus es un véspido social nativo de la región Holártica. En este trabajo reportamos la primera detección de esta especie en Argentina. Obreras de esta avispa fueron capturadas cerca de la ciudad de San Carlos de Bariloche (Argentina en Febrero de 2010, mientras se tomaban muestras de otra avispa invasora, Vespula germanica (Fabricius o chaqueta amarilla, de morfología externa y hábitos similares a la anteriormente mencionada. Además, detallamos algunos caracteres de identificación y características biológicas.
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Protótipo de um software para registro de enfermagem em unidade de terapia intensiva neonatal
Directory of Open Access Journals (Sweden)
Luciana de Medeiros Lima
2015-01-01
Full Text Available Introducción: el creciente volumen de informaciones originadas de los registros de enfermería exige estrategias de tratamiento del conocimiento producido, de forma que se eviten las desventajas del histórico de papel. Objetivo: se plantea en este estudio desarro - llar un software aplicado a la sistematización de la asistencia de enfermería que les brinde a los enfermeros el registro informatizado, eficiente y rápido. Metodología: se trata de un estudio metodológico con producción tecnológica, dividido en tres fases: construcción de las afirmativas de diagnósticos e intervenciones de enfermería, validación de las afirmativas y desarrollo del software. El sistema se desarrolló sobre la plataforma Java, con utilización de framework JSF, incorporado a la especificación J2EE, para desarrollar aplicaciones web de forma ágil. Resultados: el banco de datos se compone de 143 afirmativas de diagnósticos de enfermería y 130 referentes a las intervenciones de enfermería. El software desarrollado presenta 17 pantallas que incluyen datos de identificación, examen físico completo del recién nacido, organizado de acuerdo con las necesidades humanas básicas, listado de diagnósticos e intervenciones de enfermería sugeridas por el programa y hoja final para impresión. Consideraciones finales: el software proporciona la ejecución del proceso de enfermería con un registro completo, uniforme y rápido, y se constituye una importante fuente de datos para investigación.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Directory of Open Access Journals (Sweden)
Rafael Dal-Ré
2015-05-01
Full Text Available El sesgo de publicación es una grave deficiencia del actual sistema de comunicación de los resultados de estudios de investigación en seres humanos. Los investigadores clínicos saben que, desde el punto de vista ético, deben inscribir los ensayos clínicos antes de su inicio en un registro público. Se entiende que este hecho ayudará a reducir el sesgo de publicación. Sin embargo, la mayor parte de los estudios en seres humanos son de tipo observacional y no de tipo experimental. Se estima que se han registrado menos del 2% de los 2 millones de estudios observacionales concluidos o en curso. La revisión de 2013 de la Declaración de Helsinki exige el registro de todo estudio de investigación en seres humanos, sus muestras o datos identificables. Se propone que los agentes financiadores, como el Fondo de Investigaciones Sanitarias, requieran el registro de los estudios observacionales para proveer la financiación. Las empresas deberían hacer lo propio. Así mismo, se propone que los comités de ética de la investigación, que cumpliendo la regulación española utilizan desde 1990 la Declaración como marco de referencia para evaluar los aspectos éticos de los ensayos clínicos con medicamentos, hagan lo mismo con los estudios observacionales del ámbito sanitario; deberían, por tanto, exigir el registro del estudio antes de otorgar su aprobación definitiva. Esto permitiría educar a los investigadores de estudios observacionales en el cumplimiento de un requisito ético de reciente introducción en el código ético de mayor relevancia en la realización de investigaciones en seres humanos.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Paula Posadas
2003-07-01
Full Text Available El análisis de los patrones de distribución y la información filogenética de 71 especies de Curculionidae, distribuidas en las subregiones Subantártica y Chilena Central, aplicando los métodos biogeográficos de los árboles reconciliados y análisis de parsimonia de Brooks (BPA, resulta en un único cladograma general de áreas: ((Chile Central (Maule, Bosque Valdiviano (Islas Malvinas (Páramo Magallánico, Bosque Magallánico. La aplicación del análisis de dispersión-vicarianza (DIVA muestra que el evento vicariante más frecuente es el que separa las Islas Malvinas de las otras dos provincias subantárticas meridionales. Por otra parte, de acuerdo con los resultados del DIVA, se evidencia que las relaciones entre el Maule, Bosque Valdiviano y Chile Central no se deberían a eventos de vicarianza sino a eventos de dispersión, ya que el 61% del total de los eventos de dispersión implica a estas tres áreas. Aún más, los eventos de dispersión más frecuentes implican al Maule, ya sea en relación con Chile Central o con el Bosque Valdiviano, por lo que se deduce que la aparente complejidad de las relaciones biogeográficas del Maule podría estar relacionada con dichos eventos de dispersión.The application of the historical biogeographic techniques of reconciled trees and Brooks parsimony analysis (BPA to the distributional and phylogenetic information of 71 species of Curculionidae ranged in the Subantarctic and Central Chilean subregions results in a single general area cladogram: ((Central Chile (Maule, Valdivian Forest (Malvinas Islands (Magellanic Moorland, Magellanic Forest. The application of dispersal-vicariance analysis (DIVA to the same data set shows as the most frequent vicariant event the split of Islas Malvinas from the two southern Subantarctic provinces. In addition, DIVA results evidenced that the relationship among Maule, Valdivian Forest, and Central Chile did not arise from vicariance events (common history
DEFF Research Database (Denmark)
Fountain, Michelle T.; Baroffio, Catherine; Borg-Karlson, Anna-Karin
2017-01-01
Strawberry blossom weevil (SBW), Anthonomus rubi Herbst (Coleoptera: Curculionidae) and European tarnished plant bug (ETB), Lygus rugulipennis Poppius (Hetereoptera: Miridae), cause significant damage to strawberry and raspberry crops. Using the SBW aggregation pheromone and ETB sex pheromone we...... if deployed at ground level and although a cross vane was not important for catches of ETB it was needed for significant captures of SBW. The potential for mass trapping SBW and ETB simultaneously in soft fruit crops is discussed including potential improvements to make this more effective and economic...
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
José Ismael Campos-Rodríguez; Berenice Pérez-Valera; Leonor E. Evaristo-Aguilar; Cynthia Elizalde-Arellano; Juan Carlos López-Vidal; Raúl Hernández-Arciga
2010-01-01
Five new reptile records for the Mexican state of Guanajuato are reported: Lampropeltis triangulum dixoni, Leptodeira annulata cusiliris, Oxybelis aeneus, Tropidodipsas sartorii, and Scincella silvicola caudaequinae. These records are within western versant of the Sierra Gorda at Sierra Gorda de Guanajuato. Evidence is given that supports the idea that the area supports a herpetofaunal assemblage of tropical affinities.Se presentan 5 nuevos registros de reptiles para el estado de Guanajuato; ...
Normativa sobre el registro contable de los derechos de emisión
M. G. López Gordo; J. F. López Gordo
2007-01-01
Normativa sobre el registro contable de los derechos de admisión. La entrada en vigor del Protocolo de Kioto ha dado lugar a la puesta en marcha de los denominados mecanismos de flexibilidad, entre los que se encuentra el mercado de derechos de emisión de gases de efecto invernadero. En el ámbito de la Unión Europea, el mercado comienza su andadura el 1 de enero de 2005, afectando a unas 12.000 instalaciones emisoras de CO2. Las especiales características del mercado de emisiones req...
El Registro Civil costarricense a 125 años de su nacimiento
Directory of Open Access Journals (Sweden)
Luis Antonio Bolaños Bolaños
2013-01-01
Full Text Available Destaca la importancia de las funciones que cumple el Registro Civil en la sociedad costarricense realizando un breve repaso de sus orígenes y organización, centrando su atención en la credibilidad que los costarricenses tienen en los actos registrales que ejecuta, su aporte al desarrollo de la democracia costarricense al ofrecer un padrón electoral actualizado diariamente y la constante búsqueda en la mejora de los servicios que presta mediante la incorporación de nuevas tecnologías.
Algunos aportes para una taxonomía de los registros artificiales de información
Nicolás Golovchenko Villagrán
2013-01-01
Se sugleren algunos criteríos para una clasificacíón delos distintos tipos de registro empleados para la información, partiendo del discernimiento entre la naturaleza de la información, por un lado, y las características físicas y propiedades básicas de /os soporfes que lacontienen, por otro.
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Da Imagem à Cena: o palhaço fotógrafo e o registro do circo-teatro
Directory of Open Access Journals (Sweden)
Alda Fátima de Souza
2014-01-01
Full Text Available Este artigo trata do registro, a princípio registro fotográfico e depois escrito, realizado pelo palhaço Cadilac e evidencia a forma de atuação nos pequenos circos mambembes e o início de uma troupe circense, no período entre 1950 e 1970. A pesquisa, concluída em fevereiro de 2012, teve como resultado final a dissertação na área de Artes Cênicas intitulada A memória do circo mambembe: o palhaço Cadilac e a reinvenção de uma tradição. Para a realização deste artigo, utilizou-se o levantamento da pesquisa, em que foram feitos cruzamentos de dados entre as entrevistas, documentos de arquivos públicos, fotos, escritos do próprio palhaço, além de diversas publicações sobre o assunto em questão.
O INVENTÁRIO E O REGISTRO DO PATRIMÔNIO IMATERIAL:NOVOS INSTRUMENTOS DE PRESERVAÇÃO
Directory of Open Access Journals (Sweden)
Beatriz Freire
2012-09-01
Full Text Available O Registro de Bens de Natureza Imaterial, criado em agosto de 2000 pelo Instituto do Patrimônio Histórico e Artístico Nacional –IPHAN –tornou possível o reconhecimento de bens culturais processuais e a definição de estratégias específicas de preservação e divulgação dos mesmos. Sua aplicação pressupõe a documentação dos bens culturais a serem registrados. Para procedê-la, o IPHAN desenvolveu uma metodologia específica, o Inventário Nacional de Referências Culturais/INRC. A aplicação do INRC e as primeiras experiências de Registro serão comentadas à luz da ampliação do conceito de patrimônio que hoje orienta a política nacional de preservação.PALAVRAS-CHAVE: Registro de Bens de Natureza Imaterial; patrimônio; atual política nacional de preservação; bens culturais; IPHAN.ABSTRACT:The Register of ImmaterialNature Possessions, createdin August 2000, by Institute of National Historical and Artistic Heritage (IPHAN, became possible the recognition of processcultural possessions as well as the definition of specific strategies for their preservation and publication. His application supposes the cultural possessions document that will be registered. To proceed with her, IPHAN developed a specific methodology denominated National Inventory of Cultural References (INRC. This application and first experiences will be analyzed based on an enlargement of heritage’s concept which, nowadays, positions the national politics about preservation.KEY-WORKS: Register of Immaterial Nature Possessions; heritage; national politics about preservation;IPHAN; cultural possessions.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Manrique Guzmán, Jorge A.; Manrique Chávez, Jorge E.; Chávez Reátegui, Beatriz; Manrique Chávez, Carolina B.
2014-01-01
Objetivo: Evaluar la calidad de registro o llenado de historias clínicas de pacientes nuevos atendidos en unaClínica Dental Docente durante el período de enero a julio de 2012 empleando la auditoría odontológica comoherramienta sistematizada. Material y métodos: Se tomaron como muestra 140 historias clínicas de pacientesnuevos de las cuales se evaluó la frecuencia y porcentaje de registro de los diferentes aspectos que componenla historia clínica. Resultados: Se encontró que el 78% de las his...
Directory of Open Access Journals (Sweden)
Maria Helena de Rezende Brito Portela
1989-12-01
Full Text Available Decorrente de falta de dados que informem de modo fidedigno aos planejadores da área de Saúde, objetivou-se estimar a taxa mínima de sub-registro de nascimentos vivos na cidade de Piripiri, Piauí, no período de 1 de julho de 1983 a 30 de junho de 1984. O método utilizado para medir o sub-registro foi a comparação dos dados oficiais (Cartório de Registro Civil com os não oficiais (Fundação Serviço Especial de Saúde Pública - FSESP e Igreja Católica, cujo resultado mostrou uma taxa mínima de sub-registro muito alta (68,4% quando comparada com taxas de outras localidades brasileiras. Estudou-se a associação entre registro civil e variáveis interveníentes como local do parto, sexo da criança, estado civil e zona de residência da mãe. Concluiu-se ser o sub-registro um problema de Saúde Pública cujos fatores fundamentais como a educação, a conscientização da população e a gratuidade do registro, dentre outros, poderão contribuir para sua diminuição, com a conseqüente melhoria do planejamento das ações na área da Saúde Pública, de benéfica repercussão na vida da população.The minimum rate of underregistration of live births in the city of Piripiri, Piauí, between Jury 1,1983 and June 30,1984, is calculated. The lack of trustworthy data on underregistration of births is of the utmost importance in the area of Public Health, principally to those responsible for planning the Health Services. The method used to measure underregistration was the comparison of official data (Civil Registry Office with unofficial data (Foundation SESP and the Catholic Church, the results of which show a very high minimum rate of underregistration - 68.4% - as compared with the rates of other places in Brazil. The association between the civil register and such variables as place of births, sex of child, civil status and residential zone of mother was also studies. It is concluded that underregistration is a public health problem
Directory of Open Access Journals (Sweden)
Ludovic Reveiz
2011-12-01
Full Text Available Los registros de ensayos clínicos (EC constituyen una de las mayores fuentes de información de investigaciones en intervenciones en salud que se han o se están llevando a cabo en el mundo. La Organización Mundial de la Salud estableció un conjunto mínimo de datos que se deben registrar (20 ítems, consensuado a nivel internacional con las partes interesadas, y estableció una red de registros primarios y de registros asociados. Existen actualmente dos registros primarios en las Américas (Brasil y Cuba avalados por la OMS, además del registro ClinicalTrial.Gov (de los Estados Unidos de Norteamérica que aportan datos a la plataforma internacional de registros de EC de la OMS (ICTRP. Adicionalmente, hay avances importantes en la región relacionados con las regulaciones, el desarrollo e implementación de registros nacionales y la adhesión de comités de ética y editores a la iniciativa.Clinical trial registries are one of the main sources of information concerning health research interventions that have been or are being carried out throughout the world. The World Health Organization (WHO established a minimum data set to be recorded (20 items, which was agreed upon internationally with the stakeholders, and established a network of primary and associated records. In addition to the register ClinicalTrial.Gov (of the United States of America, there are currently two primary registries in the Americas (from Brazil and Cuba that meet WHO requirements and provide data to WHO’s International Clinical Trials Registry Platform (ICTRP. Furthermore, there are important advances in the region related to the regulations, development and implementation of national registries and to the support of the ethics committees and editors to this initiative.
Registro Fossílifero das Raias (Chondrichtes-Batomorphi em Bacias Sedimentares Brasileiras.
Directory of Open Access Journals (Sweden)
Paloma Tâmega da Silva Abreu Moreira
2007-07-01
Full Text Available A classe dos Chondrichthyes é representadapelos Elasmobranchii (tubarões e raias e Holocephali(quimeras. A presença de fósseis de raias em baciassedimentares brasileiras é conhecida desde o séculoXIX, sendo representadas atualmente por seisfamílias. São estruturas de difícil preservação, sendo,portanto raras no registro fossilífero. A grande maioriados registros é de espinhos e dentes, mas ocorrênciasextraordinárias de exemplares quase completos deraias e tubarão foram encontradas na Chapada doAraripe, nordeste do Brasil. A primeira espécie foidescrita da bacia de Pernambuco e posteriormentemais três espécies foram assinaladas nas baciasde Sergipe, Pernambuco e Araripe. O restante domaterial é conhecido apenas em nível de gêneroou família. Com base na literatura, foi realizadoum inventário destas ocorrências, pertencentes aoacervo de várias instituições de pesquisa, permitindorecuperar e atualizar as informações, sistematizandoas ocorrências e o material depositado nas diversascoleções. No Museu de Ciências da Terra/DNPM,Rio de Janeiro foram encontrados 69 dentes isolados,provenientes das bacias de Pernambuco, Sergipe ePirabas e um exemplar quase completo da bacia doAraripe. Constam sete placas dentárias, 118 dentese quatro espinhos caudais provenientes das baciasde São Luís, Pirabas, Acre, Pernambuco, Sergipee Pelotas. Dentre os gêneros estudados, os maisrepresentativos são: Myliobatis sp. com 60 dentes eRhombodus binkhorsti com 52 dentes.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Tafosfera: el registro de las relaciones biogeológicas
Directory of Open Access Journals (Sweden)
Nieto-Díaz, M.
2006-12-01
érmino Tafosfera, enfatizando el hecho del enterramiento causante de que materiales originados directa o indirectamente por los organismos pasen a la Litosfera, escapando de la Biosfera. La Tafosfera pretende ser un concepto paleontológico y sedimentológico que plantee un escenario coherente para la comprensión de los procesos tafonómicos que han ocurrido a lo largo de la historia de la Tierra. La Tafosfera se encuentra limitada, por una parte, por su interfase con la Biosfera y, por otra, por las capas de la corteza terrestre que no han sufrido alteraciones biológicas directas. El concepto de Tafosfera suministra un escenario general mucho más coherente y preciso para el conocimiento de la evolución de la Vida y su interacción con la Litosfera que denominaciones procedentes de ámbitos diferentes, tales como «registro fósil» o «corteza terrestre». La Tafosfera incluye la totalidad del Registro fósil, junto con el Registro geológico formado como respuesta a las condiciones bióticas existentes en la superficie terrestre. La entidad del concepto permite distinguir dos génesis diferentes en la formación de la corteza terrestre: una abiótica, en la que los materiales son mayoritariamente basaltos originados en el Manto litosférico y otra biótica, en cuya composición intervienen materiales que, en algún momento de su historia, han residido en la Biosfera.
Directory of Open Access Journals (Sweden)
Augusto SIRI
2014-01-01
Full Text Available Se presenta el primer reporte de Parochlus Enderlein del sistema serrano de Ventania, el cual constituye el primer registro de este género de la provincia de Buenos Aires. Se describe e ilustra la hembra de Parochlus caroli - nae Rodriguez et al. y se enmiendan las descripciones originales del macho y de la larva. Se remarcan caracteres del cuerno torácico de la pupa para distinguir P. carolinae de otras especies del género Parochlus.
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Comportamento da síndrome coronariana aguda: resultados de um registro brasileiro
Directory of Open Access Journals (Sweden)
Leopoldo Soares Piegas
2013-06-01
Full Text Available FUNDAMENTO: O Brasil carece de registros multicêntricos publicados de síndrome coronariana aguda. OBJETIVO: O Registro Brasileiro de Síndrome Coronariana Aguda é um estudo multicêntrico nacional com objetivo de apresentar dados representativos das características clínicas, e manejo e evolução hospitalares dessa síndrome. MÉTODOS: Participaram 23 hospitais de 14 cidades. Foram elegíveis pacientes que se apresentaram com suspeita de síndrome coronariana aguda nas primeiras 24 horas, com quadro clínico sugestivo, associado a alterações eletrocardiográficas compatíveis e/ou marcadores de necrose. O seguimento foi realizado até o óbito ou a alta hospitalar. RESULTADOS: Entre os anos de 2003 e 2008, foram incluídos 2.693 pacientes com diagnóstico de síndrome coronariana aguda, sendo 864 (32,1% mulheres. O diagnóstico final foi de angina instável para 1.141 (42,4% pacientes, com mortalidade de 3,06% deles; de infarto agudo do miocárdio sem supradesnível de ST para 529 (19,6% pacientes, com mortalidade de 6,8% deles; e de infarto agudo do miocárdio com supradesnível de ST para 950 (35,3% pacientes, com mortalidade de 8,1% deles; tiveram diagnóstico não confirmado 73 (2,7% pacientes, com mortalidade de 1,36% deles. A mortalidade global foi de 5,53%. O modelo de regressão logística múltipla identificou o gênero feminino (OR=1,45, o diabetes melito (OR=1,59, o índice de massa corporal (OR=1,27 e a intervenção coronariana percutânea (OR=0,70 como fatores de risco de óbito, para demografia e intervenções. Um modelo para óbito por complicações maiores identificou choque cardiogênico/Edema Agudo de Pulmão (OR=4,57, reinfarto (OR=3,48, acidente vascular cerebral (OR=21,56, sangramento grave (OR=3,33, parada cardiorrespiratória (OR=40,27 e classe funcional de Killip (OR=3,37. CONCLUSÃO: Os dados do Registro Brasileiro de Síndrome Coronariana Aguda não diferem de outros coletados fora do país. Seus achados poder
Directory of Open Access Journals (Sweden)
Susana L. Paradell
2011-06-01
Full Text Available Se cita por primera vez para la Argentina la especie Syncharina lineiceps (Spinola y se da a conocer como nuevo registro para los cultivos de arándanos. Para cada especie del género Syncharina Young, se proporciona información actualizada referida a la distribución geográfica y las plantas huéspedes. Se propone una clave para identificar las especies del género.We report for the first time in Argentina the presence of Syncharina lineiceps (Spinola and it is cited as new record for blueberries crops. For each species of the genus Syncharina Young we provide updated information referred to geographic distribution and plants hosts. A key to identify the species of the genus is presented.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Proyecto normativo de ordenamiento legal relacionado con los registros contables y su documentación
Dell’Elce, Quintino Pierino
2008-01-01
Se aborda un proyecto normativo de carácter legal elaborado para nuestro país referido al ordenamiento de los registros contables y su documentación respaldatoria tendiente a reemplazar y actualizar el régimen dispositivo actualmente vigente incluyendo una breve y debida fundamentación que justifica esa circunstancia. Fil: Dell’Elce, Quintino Pierino. Universidad de Buenos Aires. Facultad de Ciencias Económicas. Buenos Aires. Argentina
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Directory of Open Access Journals (Sweden)
Natalia G. Armando
2017-01-01
Full Text Available Este trabajo tiene como objetivo la identificación morfológica y molecular de cinco especies de Trichoderma asociadas con los nidos de hormigas cortadoras de hojas del género Acromyrmex presentes en Argentina. Las especies identificadas fueron: T. lentiforme, T. inhamatum, T. virens, T. koningiopsis y T. aff. neotropicale resultando éste el primer registro de T. lentiforme y T. inhamatum asociados a hormigas cortadoras de hojas Acromyrmex, en particular Acromyrmex lobicornis y Acromyrmex lundii para el primero y de A. lobicornis para el segundo. Además T. lentiforme representa el primer registro para la Argentina. En este trabajo se amplían medidas del conidióforo y conidios y se aportan datos adicionales sobre la distribución de las especies de Trichoderma en el país. Se ilustran con fotografías los conidióforos, células conidiógenas, conidios y el fenotipo de la colonia para cada especie.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Tatiane Lobak
2016-01-01
A broca-do-café, Hypothenemus hampei (Ferrari, 1867) (Coleoptera: Curculionidae), é praga limitante à produtividade e a qualidade dos grãos. Com a proibição do uso do endossulfam, para seu controle, em 2013, novas alternativas devem ser pesquisadas, visto que atualmente tem se seis princípios ativos registrados no Brasil, incluindo a azadiractina. Assim, o objetivo deste trabalho foi avaliar a bioatividade da azadiractina e de inseticidas sintéticos sobre a broca-do-café, em condições de labo...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Racionalidade e métodos: registro da prática clínica em pacientes de alto risco cardiovascular
Directory of Open Access Journals (Sweden)
Luiz Alberto Piva e Mattos
2011-07-01
Full Text Available FUNDAMENTO: Até o momento, nenhum registro brasileiro foi desenhado para documentar a prática clínica em relação ao atendimento de pacientes de alto risco cardiovascular em uma representativa e ampla amostra de centros investigadores, incluindo hospitais públicos e privados em âmbito nacional. Sendo assim, este estudo permitirá identificar os hiatos na incorporação de intervenções com benefício comprovado em nosso meio. OBJETIVO: Elaborar um registro dedicado à aferição da prática clínica brasileira no que se refere ao atendimento do paciente cardiovascular classificado como de alto risco. MÉTODOS: Estudo observacional do tipo registro, prospectivo, visando documentar a prática clínica atual aplicada a nível ambulatorial para pacientes de alto risco cardiovascular, classificados quando da presença de uma das variáveis: evidência de doença arterial coronariana, doença cerebrovascular, vascular periférica, em diabéticos ou não diabéticos; ou na presença de pelo menos três dos seguintes fatores de risco cardiovascular: hipertensão arterial sistêmica, tabagismo ativo, dislipidemia, idade superior a 70 anos, nefropatia crônica, história familiar de doença arterial coronariana e ou doença carotídea assintomática. Os pacientes serão coletados em 43 centros de todas as regiões brasileiras, incluindo hospitais públicos e privados, assim como em unidades básicas de atendimento a saúde, e revisados clinicamente até um ano após a inclusão. RESULTADOS: Os resultados serão apresentados um ano após o início da coleta (setembro de 2011, e consolidados, após a reunião da população e dos objetivos almejados posteriormente. CONCLUSÃO: A análise deste registro multicêntrico permitirá projetar uma perspectiva horizontal do tratamento dos pacientes acometidos da doença cardiovascular no Brasil.
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Directory of Open Access Journals (Sweden)
Sebastian A. PELIZZA
2010-01-01
Full Text Available Los acridios (tucuras y langostas continúan ocasionando pérdidas económicas en la agricultura a nivel mundial. En Argentina, la importancia de estos insectos ha sido reconocida desde mediados del siglo XIX, dependiendo de la región considerada y en relación al progresivo desarrollo agropecuario en el país. Los hongos son los microorganismos parásitos de insectos más frecuentemente encontrados en la naturaleza y la mayoría de las investigaciones con hongos entomopatógenos se ha centrado en su desarrollo como bioplaguicidas. En el presente trabajo se dan a conocer cinco registros nuevos de Beauveria bassiana (Bals.-Criv. Vuill., y dos de Entomophaga grylli (Fresen. A. Batko que se encontraron afectando distintas especies de acridios; se amplía así la distribución geográfica y el espectro hospedador para estas especies fúngicas. Cabe destacar que con el aporte de estos siete registros nuevos, el número total de hongos entomopatógenos de acridios citados para la República Argentina se eleva de 22 a 29.
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
Directory of Open Access Journals (Sweden)
Ernesto R. Krauczuk
2013-07-01
Full Text Available Se presentan nuevos registros de plantas micoheterótrofas aclorofiladas para la provincia de Corrientes, Argentina. Sobre la base de especímenes de herbario recolectados en el territorio de la provincia de Corrientes, Argentina, se documenta por primera vez la presencia de tres especies de plantas micoheterótrofas sin clorofila. Las especies son ilustradas mediante fotografías y se brinda información ecológica sobre los sitios donde las plantas fueron halladas.
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Dickens, J C
1984-12-01
Electroantennogram (EAG) techniques were utilized to measure the antennal olfactory responsiveness of adult boll weevils,Anthonomus grandis Boh. (Coleoptera: Curculionidae), to 38 odorants, including both insect and host plant (Gossypium hirsutum L.) volatiles. EAGs of both sexes were indicative of at least two receptor populations: one receptor population primarily responsive to pheromone components and related compounds, the other receptor population primarily responsive to plant odors. Similar responses to male aggregation pheromone components (i.e., compounds I, II, and III + IV) were obtained from both sexes, but females were slightly more sensitive to I. Both sexes were highly responsive to components of the "green leaf volatile complex," especially the six-carbon saturated and monounsaturated primary alcohols. Heptanal was the most active aldehyde tested. More acceptors responded to oxygenated monoterpenes than to monoterpene hydrocarbons. β-Bisabolol, the major volatile of cotton, was the most active sesquiterpene. In general, males, which are responsible for host selection and pheromone production, were more sensitive to plant odors than were females. In fact, males were as sensitive to β-bisabolol and heptanal as to aggregation pheromone components. Electrophysiological data are discussed with regard to the role of insect and host plant volatiles in host selection and aggregation behavior of the boll weevil.
Development and Life History of Sitophilus zeamais (Coleoptera: Curculionidae on Cereal Crops
Directory of Open Access Journals (Sweden)
James Adebayo Ojo
2016-01-01
Full Text Available The maize weevil, Sitophilus zeamais Motschulsky (Coleoptera: Curculionidae, is one of the most destructive pests of stored cereals. Knowledge of the life history and biology is important to the development of an integrated pest management program. Investigation was carried out on developmental biology of S. zeamais on four main cereal crops, maize, rice, sorghum, and millet, under laboratory conditions. Egg incubation, oviposition periods, and larval instar development were not different significantly among the food hosts. Number of eggs laid varied significantly among the cereal grains; mean fecundity was highest on maize (67.2±3.16 and lowest on millet (53.8±0.17. Number of immature (larva and pupa and adult stages varied significantly among the cereal grains. There exist four larval instars with a varied mean head capsule width, with a mean total instar larval developmental period of 23.1, 22.2, 22.2, and 21.6 d on maize, rice, sorghum, and millet, respectively. There was linear relationship and significant correlation between the stages of larval development and head capsule width. The mean developmental period from egg to adult varied, being highest on maize (34.7 d and lowest on sorghum (33.5 d.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Franco, Maria Teresa Gomes; Akemi, Elizabeth Nishio; D´inocento, Maria [UNIFESP
2012-01-01
OBJETIVO: Analisar os registros de enfermagem (RE) realizados por enfermeiros em prontuários de pacientes da Clínica Médica (CM) de um hospital público. MÉTODOS: A amostra do estudo foi composta de 240 (100%) prontuários de pacientes que tiveram alta ou óbito, de fevereiro a abril de 2008. Os critérios de classificação para o preenchimento, basearam-se nos estabelecidos pela instituição pesquisada. RESULTADOS: Os registros foram preenchidos de forma completa na maioria dos itens: histórico de...
Canchari Zambrano, Nelly Ninfa
2015-01-01
En el estudio de investigación efectuado sobre; los factores determinantes de la calidad de los registros de enfermería en el servicio de Medicina del Hospital Nacional Ramiro Prialé Prialé, EsSalud, Huancayo, 2015, se tuvo como objetivo; Establecer los factores determinantes de la calidad de los registros de enfermería en el servicio de Medicina del Hospital Nacional Ramiro Prialé Prialé, EsSalud, Huancayo, este estudio se efectuó a un total de 20 enfermeras que laboran en este servicio a qu...
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
ESPAMACS: el nuevo Registro Español de Asistencia Mecánica Circulatoria
Directory of Open Access Journals (Sweden)
Paloma Martínez Cabeza
2016-10-01
Full Text Available ESPAMACS es el nuevo Registro Español de Asistencia Mecánica Circulatoria, que ha sido creado en el seno del Grupo de Trabajo de Asistencia Mecánica Circulatoria y Trasplante Cardiaco de la Sociedad Española de Cirugía Torácica-Cardiovascular (GRUTAT-SECTCV con el objetivo de registrar todas las asistencias, tanto de corto como de largo plazo, que se implanten en España. Técnicamente, es una base de datos «on-line» que permite a los usuarios introducir datos a tiempo real desde cualquier puesto con acceso a Internet. Está operativa desde octubre del 2014, sustituyendo a la anterior base de datos en formato Microsoft Excel en la que se recogieron los dispositivos implantados entre 2007 y 2012. En el presente artículo se justifica la necesidad de este registro en el actual escenario de tratamiento de la insuficiencia cardiaca, caracterizado por la progresión de la asistencia mecánica circulatoria y la limitada disponibilidad del trasplante cardiaco. Asimismo, se describen las características y el funcionamiento de ESPAMACS: propiedad, modo de acceso, planificación y desarrollo, financiación, objetivos, aspectos éticos, requisitos para participar, selección de pacientes, dispositivos incluidos, diseño, variables registradas, sistema de extracción de datos para su análisis estadístico y posterior elaboración de estudios científicos y control de calidad.
Primer registro del género Mellinus (Hymenoptera: Sphecidae en Colombia
Directory of Open Access Journals (Sweden)
Fernández C. Fernando
1999-06-01
Full Text Available Uno de los taxones menos conocidos de Sphecidae (Hymenoptera: Apoidea es Mellinus Fabricius, género que en el pasado llegó a tener categoría de subfamilia (Bohart & Menke 1976, pero que ahora comprende una tribu, Mellinini, dentro de la subfamilia Nyssoninae (Menke & Fernández 1996. Al parecer, las hembras de este género capturan moscas del estiércol cerca a excrementos de mamíferos en el campo, y hacen sus nidos en el suelo (Evans 1989.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Directory of Open Access Journals (Sweden)
Alberdi, M. T.
2008-06-01
Full Text Available A new record of Hippidion saldiasi with new radiocarbon data referred to early Holocene (8,850 ± 80 year C-14 B.P of Patagonia is reported. Both its peculiar geographic location in a scarcely prospected zone and its radiocarbon age, provide new elements to discuss the previous hypotheses about the extinction of the horses and its relations with the human beings that inhabited the different environments of South America.Presentamos un nuevo registro de Hippidion saldiasi con datación radiocarbónica directa correspondiente al Holoceno temprano de Patagonia (8.850 ± 80 años C-14 AP. Su particular ubicación temporal y geográfica en una zona poco estudiada hasta ahora y su registro reciente, aportan nuevos elementos para discutir las hipótesis previas sobre la extinción de los caballos y su relación con los grupos humanos que colonizaron los diferentes ambientes de América del Sur.
Directory of Open Access Journals (Sweden)
Cynthia Helena Soares Bouças Teixeira
2017-11-01
Full Text Available Este trabalho tem como objetivo fornecer um detalhamento sobre o processo de busca do conhecimento, partindo de uma ferramenta básica que é a informação. No contexto que envolve Pesquisa & Desenvolvimento, o conhecimento pode ser estruturado para o desenvolvimento de novas tecnologias, produtos ou processos, em que o registro do conhecimento pode ocorrer através das patentes. Dado que é preciso conhecer a legislação do país de depósito,trataremos mais especificamente do sistema de registro de patentes brasileiro denominado Instituto Nacional da Propriedade Intelectual – INPI. As reflexões apresentadas são provenientes de uma experiência profissional.
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Directory of Open Access Journals (Sweden)
Paola Michelle Pascua-Cantarero
2016-01-01
Full Text Available Recibido 21 de mayo de 2014 • Corregido 15 de setiembre de 2015 • Aceptado 3 de noviembre de 2015El presente artículo da a conocer detalles sobresalientes obtenidos al realizar una investigación que tuvo entre sus objetivos determinar los factores relacionados con deserción de estudiantes, quienes ingresaron en los años 2007, 2008, 2009, durante el primer y segundo año del Bachillerato y Licenciatura en Enseñanza de la Matemática (carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica. La citada investigación respondió a un estudio mixto, con una fase cuantitativa de carácter descriptivo y una parte cualitativa con un diseño fenomenológico; su fundamentación teórica se basó en investigaciones sobre deserción universitaria en distintas regiones y la teoría de personas expertas como Tinto y Spady con respecto a las causas de esta problemática. Para el análisis de la información se empleó una base de datos proporcionada por el Departamento de Registro de la UNA y una entrevista telefónica semi-estructurada aplicada a estudiantes que desertaron de la carrera en forma definitiva. La población en la fase cuantitativa estuvo constituida por la totalidad de participantes que ingresaron en los años 2007, 2008 y 2009 y que desertaron en el primer y segundo año de la carrera. El grupo en estudio para la etapa cualitativa estuvo compuesto por quince informantes pertenecientes a las diferentes cohortes 2007, 2008 y 2009 y quienes desertaron en el primer y segundo año de la carrera. Los resultados mostraron que el fenómeno de deserción en el primer año tuvo factores similares a la que se produjo en el segundo año de la carrera de Enseñanza de la Matemática. Las conclusiones indican que entre los diversos factores relacionados con la deserción en el primer y segundo año de las cohortes 2007, 2008 y 2009 sobresalieron las expectativas no satisfechas y la falta de integración académica y
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Familial myasthenia gravis: report of four cases Miastenia grave familial: registro de quatro casos
Directory of Open Access Journals (Sweden)
José Lamartine de Assis
1976-09-01
Full Text Available Two pairs of siblings with myasthenia gravis, belonging to two different families, are reported. This is the only record of familial myasthenia during the past twenty years, in a total of 145 patients seen at the Neurological Clinic of the São Paulo Medical School. In spite of the fact that myasthenia gravis does not show hereditary characteristics, the peculiar features of the four cases justify the present report. The two pairs of siblings were born from non myasthenic nor consanguineous parents. The disease started at birth showing bilateral partial eyelid ptosis in all patients. The course of the illness has been favorable. There was no thymoma.Os autores registram dois pares de gêmeos com miastenia grave, pertencentes a duas famílias diferentes. Este é o único registro de miastenia familial durante os últimos 20 anos, num total de 145 pacientes examinados na Clínica Neurológica da FMUSP. Apesar do fato de a miastenia grave não ter características hereditárias, os aspectos peculiares dos quatro pacientes justificam o presente registro. Os dois pares de gêmeos nasceram de pais não miastênicos e sem consanguinidade. A doença iniciou-se no nascimento, evoluindo com ptose bilateral parcial da pálpebra superior precocemente em todos os pacientes. O curso da moléstia tem sido favorável. Não havia timoma.
Nuevos registros de aves en el bosque mesófilo de montaña del noreste de Hidalgo, México
Directory of Open Access Journals (Sweden)
Miguel Angel Martínez-Morales
2015-06-01
Full Text Available Se reportan nuevos registros y ampliaciones en el área de distribución de Harpagus bidentatus, Glaucidium sanchezi, Attila spadiceus, Cyanolyca nana, Oreoscoptes montanus y Peucedramus taeniatus. Estas seis especies de aves fueron registradas en el bosque mesófilo de montaña del estado de Hidalgo, México. Dos de estas especies (G. sanchezi y C. nana son especies de distribución restringida, lo que eleva a tres el número de especies de distribución restringida en la zona. Esto enfatiza la importancia de esta región en la conservación de la diversidad de aves. Se discuten las implicaciones de estos nuevos registros en la obtención de inventarios completos de la avifauna de la región y en la conservación de su diversidad de aves.
Directory of Open Access Journals (Sweden)
Víctor JIMÉNEZ JÁIMEZ
2009-08-01
Full Text Available RESUMEN: El interés de los investigadores peninsulares sobre la formación del registro arqueológico decreció considerablemente una vez que, en los años ochenta del pasado siglo, la influencia de la obra de L. Binford fue remitiendo y la Nueva Arqueología entró en decadencia. No obstante, la reflexión sobre los procesos de formación del registro arqueológico ha continuado hasta la actualidad, y de hecho ha ido progresivamente cobrando mayor importancia. Las últimas tendencias en este campo han insistido en la aplicación de lo que llamaremos el ciclo formativo del registro arqueológico, un esquema conceptual que viene siendo profusamente empleado en muchos estudios sobre formación del registro arqueológico, especialmente entre los seguidores de la Arqueología Conductual de M. Schiffer. En efecto, sus últimas propuestas no usan las nociones de deposicional y posdeposicional, sino que asumen, con ligeras variaciones de unos autores a otros, un esquema biográfico que sitúa los procesos de formación del registro en una de estas tres fases: 1 ocupación/uso; 2 abandono; 3 posabandono. Dentro de este esquema, la denuncia a lo que se denomina Premisa Pompeya es una clave esencial. Desgraciadamente, y pese a su utilidad, este marco conceptual sigue siendo ignorado por los arqueólogos de la Península Ibérica. En el presente artículo definiremos el concepto, expondremos algunas de sus implicaciones, señalaremos el escaso eco que ha tenido en el ámbito académico peninsular y, finalmente, indicaremos las críticas que ha recibido desde las Arqueologías Posprocesuales. Como conclusión, afirmaremos su utilidad en la práctica arqueológica, aunque convenientemente matizada por los apuntes realizados por autores como Hodder o Moore. Como ejemplo de las posibilidades interpretativas que abre un esquema como el referido, en la última parte del texto se hará una breve exposición de la que actualmente es una de las nociones más de
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Registro de ensayos con vacunas del Programa Mundial de Vacunas e Inmunización de la OMS
Directory of Open Access Journals (Sweden)
Robertson S. E.
1998-01-01
Full Text Available En 1995, el Programa Mundial de Vacunas e Inmunización de la OMS estableció un registro para ensayos con vacunas. En septiembre de 1996, este registro contenía 50 ensayos de vacunación patrocinados por la OMS, de los cuales 25 (50% eran estudios ya terminados. Las vacunas que se habían estudiado con mayor frecuencia fueron las de sarampión (9 ensayos, poliovirus (8 ensayos, cólera (8 ensayos, Escherichia coli enterotoxígena (4 ensayos y neumococo (4 ensayos. Casi 80% de estos ensayos se llevaron a cabo en países en desarrollo, principalmente en el África. En los 25 ensayos ya terminados, los resultados investigados fueron la respuesta inmunitaria (24 ensayos, las reacciones adversas (13 ensayos, la morbilidad (4 ensayos y la mortalidad (1 ensayo. La OMS contribuyó a estos ensayos con el aporte indirecto de fondos, ayuda con el diseño metodológico, visitas a las localidades, el análisis de los datos, la adquisición de vacunas y la investigación de su potencia.
Registros administrativos de policía para la consolidación de cifras de criminalidad en Colombia
Directory of Open Access Journals (Sweden)
Julián Ricardo Buitrago Cubides
2015-08-01
Full Text Available La Policía Nacional de Colombia desarrolla la operación estadística "Conductas y servicios de policía", para tener insumos que permitan la formulación de políticas públicas en seguridad y seguimiento permanente del impacto del servicio de policía; esta operación usa como herramienta tecnológica el Sistema de Información Estadístico, Delincuencial, Contravencional y Operativo - SIEDCO. La metodología para la recolección, registro, consolidación y difusión de los registros administrativos, con propósitos estadísticos, permite obtener las cifras de criminalidad de acuerdo con los tipos penales del Código Penal colombiano, delitos de mayor impacto y actividad operativa, con la posibilidad de ubicarlos por jurisdicción política o policial. De otra parte, las herramientas tecnológicas de software actuales, para extracción de información, ofrecen diferentes maneras de analizar y estudiar los datos en un menor período de tiempo en cada una de las unidades policiales.
Primeros registros de 4 especies de felinos en el sur de Puebla, México
Farías, Verónica; Téllez, Oswaldo; Botello, Francisco; Hernández, Omar; Berruecos, Jessica; Olivares, Saúl J.; Hernández, Julio C.
2015-01-01
Se presentan los primeros registros de margay (Leopardus wiedii), gato montés (Lynx rufus), puma (Puma concolor) y jaguarundi (Puma yagouaroundi) en el sur del estado de Puebla. El trabajo de campo fue parte de una monitorización participativa que incluyó a las autoridades civiles del ejido. Se colocaron 11 estaciones de cámaras-trampa digitales que funcionaron del 18 de diciembre de 2012 al 18 de febrero de 2014. Con un esfuerzo de muestreo de 2,669 días-trampa y dentro del conjunto de regis...
Responsabilidad civil derivada de la inclusión indebida en un registro de morosos
Lagunas Reyes, Lucia
2014-01-01
El presente trabajo se aborda con motivo de la reciente Sentencia del Tribunal Supremo (Sala de lo Civil) núm. 176/2013, de 6 marzo. Avanzando en la línea marcada por sentencias precedentes, el Tribunal Supremo declara que “la inclusión de datos personales en un registro de morosos por una deuda dudosa vulnera el derecho al honor”. La citada sentencia del Tribunal Supremo asume como propia la doctrina del Tribunal Supremo ya consolidada, según la cual la inclusión incorrecta de datos en u...
Nuevos registros de hongos marinos en el litoral sur de Guantánamo, Cuba
Samón Legrá, E.; Enríquez Lavandera, D.
2010-01-01
Por primera vez se realizó la identificación de hongos marinos filamentosos aislados en cuatro playas del litoral sur de la provincia de Guantánamo, Cuba. Para el aislamiento de los hongos se empleó el método indirecto de incubación de sustratos vegetales en cámara húmeda. Se describieron 25 especies de hongos marinos: 18 ascomicetes, seis hongos mitospóricos y un basidiomiceto. De las especies descritas, seis constituyen nuevos registros para el país. Con estos resultados, el número total de...
Directory of Open Access Journals (Sweden)
Juan P. Matzumura Kasano
2014-07-01
Full Text Available El eje de la auditoria médica es una historia clínica adecuadamente confeccionada. La historia clínica es la constancia escrita de todos los exámenes médicos, estudios realizados y tratamientos aplicados durante el transcurso de la enfermedad. Objetivo: Evaluar la calidad de registro de las historias clínicas de Consultorios Externos del Servicio de Medicina Interna en la Clínica Centenario Peruano Japonesa. Diseño: Descriptivo de corte transversal. Lugar: Consultorios externos del Servicio de Medicina Interna de la Clínica Centenario Peruano Japonesa. Material: Historias clínicas de pacientes atendidos en la consulta externa del Servicio de Medicina Interna. Métodos: Se evaluó 323 historias clínicas mediante un muestreo aleatorio simple, las cuales fueron sometidas a una ficha de auditoría que comprendía 10 ítems, cada uno calificado con 10 puntos, para un total de 100 puntos: fecha y hora de atención, pulcritud y legibilidad, anamnesis adecuada, signos vitales, examen físico, diagnóstico, plan de trabajo, exámenes auxiliares, tratamiento completo y firma y sello del médico. Las historias que obtenían un puntaje total mayor o igual de 80 fueron calificadas como ‘aceptables’; las restantes como ‘falta mejorar’. Principales medidas de resultados: Historias auditadas aceptables o falta mejorar. Resultados: El 63,8% (206 de las historias tenía una calidad de registro ‘aceptable’, mientras que en 36,2% (117 de historias, la calidad de registro ‘falta mejorar’. Los ítems diagnóstico y tratamiento completo fueron los que presentaron un registro deficiente con mayor frecuencia, tanto en aquellas historias que cumplían un registro aceptable (64,6% y 62,6% llenadas de modo completo, respectivamente como en aquellas con registro falta mejorar (20,5% y 23,1%, respectivamente. La firma y sello del médico tratante fue el ítem que en ambas categorías era el mejor registrado (99,5% y 93,2%, respectivamente
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Directory of Open Access Journals (Sweden)
Pedro Pimenta de Mello Spineti
2016-01-01
Full Text Available Resumo O relacionamento probabilístico de registros vem sendo cada vez mais empregado na identificação de desfechos em estudos de coorte. O objetivo deste trabalho foi avaliar a acurácia deste método na identificação de óbitos em uma coorte de 450 pacientes admitidos em um hospital universitário por insuficiência cardíaca descompensada, em um período de seis anos. O estado vital dos membros da coorte foi determinado a partir dos registros no prontuário eletrônico dos pacientes (padrão-ouro. O software OpenRecLink foi utilizado para relacionar os registros da coorte com aqueles da base do Sistema de Informações de Mortalidade, visando à identificação de óbitos. Apenas 53,6% pacientes apresentavam estado vital conhecido ao final do seguimento e destes 59,3% haviam falecido. O método apresentou sensibilidade de 97,9%, especificidade de 100%, valor preditivo positivo de 100%, valor preditivo negativo de 97% e acurácia de 98,8%. Esses resultados sugerem que o relacionamento probabilístico de registros é uma valiosa ferramenta na identificação de óbitos para estudos de coorte.
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Directory of Open Access Journals (Sweden)
Sergio Antonio Vanin
2008-01-01
Full Text Available A new species of Pacholenus Schoenherr from southeastern Brazil (Coleoptera, Curculionidae, Molytinae, and new occurrences of species of the genus. Pacholenus monteiroi sp. nov. (type-locality Brazil, Rio de Janeiro state, Carapebus, Parque Nacional da Restinga de Jurubatiba is described and illustrated. The weevil develops as a stem gall-former in Calyptranthes brasiliensis Spreng (Myrtaceae. The new species is easily distinguished from the other five known of the genus by the presence of a prominent supra-ocular ridge. An updated key for identification for all species of Pacholenus is provided. Three species of Pacholenus are presently recorded for the states of Rio de Janeiro and São Paulo; P. pelliceus and P. monteiroi occur in both states, while P. penicillus is only known from Rio de Janeiro; P. hispidus occurs in São Paulo, being the most widespread species of the genus, ranging from Minas Gerais south to Santa Catarina.Nova espécie de Pacholenus Schoenherr do sudeste do Brasil (Coleoptera, Curculionidae, Molytinae, e novas ocorrências de espécies do gênero. Pacholenus monteiroi sp. nov. (localidade-tipo Brasil, Estado do Rio de Janeiro, Carapebus, Parque Nacional da Restinga de Jurubatiba é descrita e ilustrada. Esse gorgulho se desenvolve em galhas caulinares de Calyptranthes brasiliensis Spreng (Myrtaceae. A nova espécie é facilmente distinta das outras cinco conhecidas do gênero devido à presença de uma crista supra-ocular proeminente. Uma chave atualizada para identificação das espécies de Pacholenus é fornecida. Três espécies de Pacholenus ocorrem nos estado do Rio de Janeiro e São Paulo; P. pelliceus e P. monteiroi ocorrem em ambos os estados, enquanto que P. penicillus apenas no Rio de Janeiro; P. hispidus ocorre em São Paulo, sendo a espécie do gênero com a distribuição mais ampla, sendo encontrada desde Minas Gerais até Santa Catarina.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Directory of Open Access Journals (Sweden)
Daniela de Cassia Bená
2013-12-01
Full Text Available Description of the immature stages of the weevil Anthonomus vis Clark (Coleoptera, Curculionidae, inquiline into the gall of Leandra aurea (Melastomataceae. The third instar larva and the pupa of Anthonomus vis Clark, 1992 are described and illustrated, based upon specimens collected in the Serra de São José, Tiradentes, in Minas Gerais, southeastern Brazil. The species was previously known from the type series collected in the states of Amapá and Pará. Comparisons with the larva and pupa of A. grandis Boheman, 1843 and A. monostigma Champion, 1903 are included. The larvae of A. vis live as inquilines in the galls induced by a species of momphid moths (Lepidoptera, Momphidae in the stems of Leandra aurea (Cham. Cogn. (Melastomataceae.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Registro Español de Ablación con Catéter. V Informe Oficial (2005
Directory of Open Access Journals (Sweden)
Miguel Álvarez López
2007-01-01
Conclusiones: Con un número de procedimientos de ablación superior a 6.000 y con la participación más numerosa de centros de todo el Estado, el Registro Español de Ablación con Catéter aumenta su representatividad y su valor como referencia. El número de procedimientos de ablación de fibrilación auricular se incrementa progresivamente en nuestro país.
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Directory of Open Access Journals (Sweden)
Jordie D. Fraser
2017-06-01
Full Text Available Winter mortality is a major factor regulating population size of the mountain pine beetle, Dendroctonus ponderosae Hopkins (Coleoptera: Curculionidae. Glycerol is the major cryoprotectant in this freeze intolerant insect. We report findings from a gene expression study on an overwintering mountain pine beetle population over the course of 35 weeks. mRNA transcript levels suggest glycerol production in the mountain pine beetle occurs through glycogenolytic, gluconeogenic and potentially glyceroneogenic pathways, but not from metabolism of lipids. A two-week lag period between fall glycogen phosphorylase transcript and phosphoenolpyruvate carboxykinase transcript up-regulation suggests that gluconeogenesis serves as a secondary glycerol-production process, subsequent to exhaustion of the primary glycogenolytic source. These results provide a first look at the details of seasonal gene expression related to the production of glycerol in the mountain pine beetle.
Realidad de la cirugía cardíaca en la República Argentina. Registro CONAREC XVI
Directory of Open Access Journals (Sweden)
Diego M. Lowenstein Haber
2010-01-01
Full Text Available RESUMENIntroducciónLos dos grandes registros multicéntricos de cirugía cardíaca realizados en la Argentina,CONAREC y ESMUCICA, datan de más de 10 años. Considerando los avances médicosy quirúrgicos de la última década, surgió la necesidad de realizar un nuevo registronacional, prospectivo y multicéntrico para conocer las características, la evolución, lascomplicaciones y los predictores de mortalidad de los pacientes sometidos a cirugía cardíaca.ObjetivosConocer el perfil epidemiológico, la modalidad quirúrgica y la evolución posoperatoria de lospacientes sometidos a cirugía cardíaca en la Argentina.Material y métodosRegistro prospectivo, consecutivo y multicéntrico realizado en 49 centros cardioquirúrgicosde la República Argentina por residentes de cardiología. Se analizaron las características yla evolución de 2.553 pacientes sometidos a cirugía cardíaca entre septiembre de 2007 yoctubre de 2008: 1.465 (57,4% a cirugía coronaria, 359 (14,1% a reemplazo valvular aórtico,169 (6,6% a cirugía valvular mitral, 312 (12,2% a cirugía combinada coronariovalvular y248 (9,7% a otros procedimientos.ResultadosHubo predominio de hombres (74,9%; la edad promedio fue de 63 ± 11 años. La prevalenciade diabetes fue del 24,9%, la de hipertensión del 76,3% y la de insuficiencia cardíaca del17%. La disfunción ventricular moderada a grave prequirúrgica fue del 23,8% y el 19,8% delas cirugías fueron no programadas.En las cirugías coronarias, el 41,9% de ellas se realizaron sin circulación extracorpórea y seempleó puente mamario en el 89%.El 81,7% de las cirugías mitrales se indicaron por insuficiencia y el 62,6% de las aórticas,por estenosis. En estas cirugías se emplearon válvulas mecánicas en el 58% de los casos.La mediana de internación fue de 6 días. Se presentaron complicaciones mayores en el31,7% (del 25% en coronarios al 49,36% en combinados y la mortalidad global fue del 7,7%(del 4,3% en coronarios al 13
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Murdoch, Gregory; Clift, Alan D; Mansfield, Sarah
2017-10-01
The accumulated damage from elephant weevil larvae, Orthorhinus cylindrirostris (F.) (Coleoptera: Curculionidae), reduces blueberry yield and shortens the productive lifespan of blueberry plants by several years. Selective breeding to develop pest-resistant blueberry cultivars is a possible control option, but the relationship between O. cylindrirostris populations, plant damage, and blueberry yield has not been described. A field survey of 17 blueberry cultivars was conducted on a commercial farm to measure O. cylindrirostris populations (emergence holes and adult numbers) and yield from plants of different ages (2-12 yr). Blueberry plants accumulated damage over time, that is, older plants tended to have more O. cylindrirostris emergence holes than younger plants. All cultivars received some level of O. cylindrirostris attack but this did not always lead to yield losses. Newer cultivars that have been in production since 2000 were less susceptible to O. cylindrirostris than older cultivars. Removal of highly susceptible cultivars from commercial blueberry farms may reduce O. cylindrirostris populations. There is potential for selective breeding to increase plant resistance to O. cylindrirostris if the specific resistance mechanisms can be identified in blueberry. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Slavimira A. Draganova
2010-01-01
Full Text Available Bark beetles (Coleoptera: Curculionidae: Scolytinae belong to one of the most damaging groups of forest insects and the activity of their natural enemies –pathogens, parasitoids,parasites or predators suppressing their population density,is of great importance. Biodiversity of entomopathogenic fungi on bark beetles in Bulgaria has been investigated sporadically. The aim of this preliminary study was to find, identify and study morphological characteristics of fungal entomopathogens naturally-occurring in populations of three curculionid species – Ips sexdentatus Boern, Ips typographus (L. and Dryocoetes autographus (Ratz.. Dead pest adults were found under the bark of Pinus sylvestris and Picea abies trees collectedfrom forests in the Maleshevska and Vitosha Mountains. Fungal pathogens were isolated into pure cultures on SDAY (Sabouraud dextrose agar with yeast extract and were identified based on morphological characteristics both on the host and in a culture.Morphological characteristics of the isolates were studied by phenotypic methods. The fungal isolates obtained from dead adults of Ips sexdentatus, Ips typographus and D. autographus were found to belong to the species Beauveria bassiana (Bals. – Criv. Vuillemin,Beauveria brongniartii (Saccardo Petch and Isaria farinosa (Holmsk. Fries (anamorph Ascomycota, Sordariomycetes: Hypocreales, Cordycipitaceae. Morphological traits of the isolates are described.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
Hematoma epidural espinal espontâneo durante a gravidez: registro de um caso
Directory of Open Access Journals (Sweden)
Ivan Hack
1984-03-01
Full Text Available Registro de caso de paciente no oitavo mês de gestação que desenvolveu hematoma epidural espinal espontâneo dorsolombar. A gravidez, determinando aumento da pressão intra-abdominal e, como consequência, aumento da pressão venosa no plexo epidural, poderia ter sido o fator desencadeante no hematoma- A paciente foi submetida a cirurgia precocemente, porém não apresentou recuperação do déficit sensitivo-motor. São discutidos aspectos clínicos, do tratamento cirúrgico, da evolução e da etiologia dos hematomas epidurals espinais espontâneos.
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
ALTERAÇÃO DO REGISTRO CIVIL DE TRANSEXUAIS: Uma análise empírica do posicionamento do TJ/RS
Directory of Open Access Journals (Sweden)
Maicon Varella Flores
2017-05-01
Full Text Available A presente pesquisa propõe investigar o posicionamento do Tribunal de Justiça do Estado do Rio Grande do Sul quanto à alteração do prenome e do gênero no registro civil de sujeitos transexuais. Para isso, utilizando-se do seguinte descritor “alteração de registro civil transexual”, realizou-se um mapeamento, através da abordagem quantitativa, das decisões julgadas e publicadas entre os anos de 1985 a 2016, que versam acerca da temática analisada. Para as problematizações das categorias identitárias (DIAS, 2015 de gêneros e das sexualidades, orienta-se a partir das teorizações propostas pelos estudos culturais, em especial, de Foucault (1999, 2010, 2014 e de Butler (2003, 2012, 2015. Também, realizou-se uma etapa bibliográfica sobre a (reconstrução das categorizações das identidades de gêneros e das sexualidades, interpretando-as a partir da perspectiva teórica que as estabelece inseridas nas relações de poder (Foucault, 2014 e as propõe performáticas e flexíveis, atribuindo-as potencial de fluidez (Brum & Dias, 2015. Para além de denotar a importância do reconhecimento jurídico da alteração tanto do prenome, quanto do gênero no registro civil aos transexuais, defende-se que esses corpos sejam reconhecíveiscomo humanos e, assim, sujeitos de dignidade humana, contribuindo, a partir disso, para o reconhecimento de uma construção identitária transexual efetivamente inteligíveis e reconhecíveis.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Baughman, William B; Nelson, Peter N; Grieshop, Matthew J
2015-06-01
We assessed the efficacy of cultivation as a potential management strategy for codling moth, Cydia pomonella L. (Lepidoptera: Tortricidae), and plum curculio, Conotrachelus nenuphar Herbst (Coleoptera: Curculionidae) in apple orchards. Cocooned codling moth pupae and thinning apples infested with plum curculio larvae were cultivated over in the field. Emergence, percent burial, damage to buried fruit, and depth of burial was recorded. In the laboratory, both insects were buried at variable depths in sand and potting soil and emergence was measured. A greater proportion of plum curculio larvae buried in infested fruit under laboratory conditions survived to adulthood compared with unburied infested fruit, down to 15 cm. No codling moth adults emerged from under 1 cm or more of sand. Buried codling moth larvae experienced drastically reduced survival to adulthood compared with unburied larvae. These results indicate that strip cultivation may negatively impact codling moth diapausing larvae and pupae on the ground, but not likely to negatively impact plum curculio in infested dropped apples. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
GABRIEL GENZANO
2006-06-01
Full Text Available Blackfordia virginica is a well-known invasive medusa inhabiting estuarine areas. It was recently detected in northern Argentina, constituting the first record of invasive hydromedusa for the Argentine Sea. In this work more than 1,500 plankton samples in the southwestern Atlantic Ocean (34-55º S from 1983 to 2000 were analyzed. More than 5,000 specimens per sample of B. virginica were found in Río de la Plata estuary for the first time in February 2000. This river is one of the large waterways of South America with an intense nautical traffic and several exotic species has been recorded here, mainly due to trans-oceanic shipping traffic. It is important to point out that we found medusae of both sexes (therefore this species could be introduced in either the medusa or the polyp stages or both, different size classes (including very small juveniles and maturation stages, and in such high numbers that would suggest local reproduction. For this reason the recent finding of this hydromedusa could represent the starting point of an successful introductionBlackfordia virginica es una medusa invasora reconocida por habitar áreas estuariales. Recientemente fue descubierta en el norte de Argentina, constituyendo el primer registro de una hidromedusa invasora para el mar argentino. En este trabajo se analizaron más de 1.500 muestras de plancton en el Océano Atlántico sudoccidental (34-55º S desde 1983 hasta el año 2000. Más de 5.000 especímenes por muestra fueron encontrados por primera vez en el estuario del Río de la Plata durante febrero del año 2000. Este río es una de las mayores vías de agua de América del Sur, posee un intenso tráfico náutico y varias especies exóticas se han registrado allí, principalmente debido al tráfico marítimo transoceánico. Es importante señalar que se encontraron medusas de ambos sexos (por lo tanto esta especie podría haber sido introducida en su estadio medusa, pólipo o ambos, con diferentes
Directory of Open Access Journals (Sweden)
Manuel Murillo
2011-12-01
Full Text Available En el presenta trabajo exploramos algunos interrogantes en torno a lo que llamamos la hipótesis de los tres registros -simbólico, imaginario, real- en la enseñanza de J. Lacan. El objetivo que nos propusimos fue identificar los momentos privilegiados en la enseñanza de Lacan para el abordaje en la temática y describir su hipótesis de los tres registros. De acuerdo a nuestra hipótesis los tres registros constituyen en la enseñanza de Lacan una tesis inédita en el campo del psicoanálisis que implica a la vez un retorno a Freud y una interrogación a Freud. Para este estudio nos hemos servido principalmente de la conferencia que Lacan dictó en 1953 sobre los tres registros, y del seminario 22 de 1974-1975, también dedicado, en gran medida, a los tres registros. Concluimos que los registros son los nombres del padre, a la par que las dimensiones del ser hablante y los fundamentos del discurso y práctica psicoanalíticos.In this paper we explore some questions about what we call the three registers hypothesis -symbolic, imaginary, real- in J. Lacan work. The objective we set was to identify the pivotal moments in the work of Lacan to approach the subject and describe his three records hypothesis. According to our hypothesis, three records are in the work of Lacan an original thesis in the psychoanalysis field, which involves both a return to Freud and an interrogation to Freud. For this study we used mainly the conference that Lacan gave in 1953 on three records, and the seminar 22, 1974-1975, also dedicated largely to the three records. We conclude that the records are the father's names, and at the same time, the speaking being dimensions and psychoanalytic discourse and practice fundaments.
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Directory of Open Access Journals (Sweden)
Edwin Alexander Cerquera
2015-09-01
Full Text Available Las matrices de microelectrodos son dispositivos que permiten la detección de potenciales de acción o espigas en poblaciones de células excitables, ofreciendo varias aplicaciones en el campo de las neurociencias y la biología. Este trabajo muestra un protocolo para el registro de espigas en una población de células ganglionares retinales empleando una matriz de microelectrodos. La retina de una rata albina fue extraída y preparada para ser estimulada in vitro con luz led blanca, con el fin de registrar sus espigas evocadas ante estos estímulos. Cada microelectrodo puede registrar espigas de más de una célula ganglionar, razón por la cual se determinó a qué célula pertenece cada espiga aplicando un procedimiento conocido como “clasificación de espigas”. El trabajo permitió obtener el registro de un periodo de estimulación y otro de no estimulación, con el fin de representar los potenciales de acción evocados con luz y los espontáneos. Los registros fueron almacenados para visualizar las espigas de las células ganglionares y poder aplicar la herramienta de clasificación de espigas. De este modo, se almacenan los instantes de tiempo en los cuales cada célula ganglionar registrada generó potenciales de acción. Este trabajo conllevó al establecimiento de un protocolo de experimentación básico enfocado al uso de matrices MEA en el laboratorio de adquisición de potenciales extracelulares de la Universidad Antonio Nariño Sede Bogotá, no sólo para caracterizar los potenciales de acción de células ganglionares retinales, sino también para otro tipo de células que puedan ser estudiadas empleando matrices de microelectrodos.
El registro biológico humano de la costa meridional de Santa Cruz
Directory of Open Access Journals (Sweden)
Suby, Jorge A.
2009-01-01
Full Text Available La costa patagónica constituye un sector de riesgo para el registro arqueológico, asociado a factores naturales y antrópicos. Al mismo tiempo, la conservación de las colecciones bioarqueológicas, destacándose la pérdida de restos óseos e información asociada por escasez de recursos, desconocimiento o falta de atención especializada, representa escenarios de riesgo para el registro. Una de las áreas para las cuales no se dispone hasta el momento de información bioarqueológica es la región que comprende la costa meridional de la provincia de Santa Cruz. Considerando esta ausencia de información, el objetivo de este trabajo es presentar y discutir los primeros resultados sobre restos óseos humanos hallados en la región costera próxima a la desembocadura del Río Santa Cruz (Santa Cruz, Argentina. Los estudios incluyen el análisis de las situaciones de hallazgo y riesgo de los restos recuperados en acciones de rescate, el reconocimiento y puesta en valor de materiales depositados en el Museo Regional "Carlos Borgialli" (Puerto Santa Cruz, Santa Cruz, Argentina y estudios paleopatológicos. Al mismo tiempo se informan y analizan resultados cronológicos e isotópicos. Los resultados brindan evidencias claras de la ocupación de la región costera al menos durante los últimos 2000 años, consumo de recursos predominantemente terrestres y un estilo de vida que favorece el desarrollo de lesiones articulares, con escasos indicios de estrés sistémico que coinciden con los resultados reportados para la región continental del estrecho de Magallanes.
Barquete, Viviane; Bugoni, Leandro; Silva-Filho, Rodolfo P.; Adornes, Andrea C.
2006-01-01
En este estudio se presenta una revisión de hallazgos previos y nuevos registros del Pingüino Rey (Aptenodytes patagonicus) y del Pingüino Penacho Amarillo (Eudyptes chrysocome) en la costa de Brasil. En total se registraron seis individuos de Pingüino Rey y diez de Pingüino de Penacho Amarillo. Tanto juveniles como adultos de las dos especies fueron encontrados en las playas, especialmente en Rio Grande do Sul, sur de Brasil. Los registros de Pingüino Rey están restringidos al verano, mientr...
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Olhar do cronista, registro da memória
Directory of Open Access Journals (Sweden)
Angela Maria Dutra da Silva Senra
2016-09-01
Full Text Available Propomos apresentar a pesquisa “Rastros da memória literária em crônicas dos jornais marianenses dos séculos XIX e XX” (PERPÉTUA, 2015, que tem como fonte um acervo de periódicos da cidade de Mariana (MG, hoje sob a guarda do Centro de Pesquisas Linguagem, Memória e Tradução do ICHS-UFOP. Dada a evidente relação desse acervo com a memória sociocultural da cidade, nossa pesquisa, em andamento, volta-se objetivamente para identificar e selecionar crônicas literárias publicadas nos periódicos, com a subsequente análise em sua correlação com a memória da região, sob as bases de um significativo material teórico sobre esse gênero. Assim, com vistas a adentrar no passado memorial da cidade de Mariana, apresentaremos o resultado parcial da nossa investigação, que tem proporcionado o conhecimento acerca da crônica; e do registro memorial dessa cidade em razão de sua importância no cenário histórico, social e cultural de Minas Gerais.
Armstrong, J S
2010-04-01
Boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), trapping and pheromone quantitative analysis of extended-life pheromone lures manufactured with 0, 10, 20, and 30 mg of eugenol was conducted in the Rio Grande Valley of Texas under spring and summer conditions. Boll weevils responded positively to eugenol on one of 12 trapping weeks when densities were high, but when densities were low (30 degrees C, accumulative grandlure loss per week may be too high, leaving too little residual grandlure to effectively attract boll weevils at the end of 3 wk of trapping. Eugenol plays no role in reserving or encouraging the release of grandlure, or in increasing boll weevil captures when boll weevil densities are low.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Directory of Open Access Journals (Sweden)
Ana Lorena Flores Salazar
2018-01-01
Full Text Available El artículo se centra en las demandas de las personas trans por el reconocimiento de su identidad y los retos que conllevan para los registros civiles, como instituciones operadoras de los cambios propuestos. En particular, se analizan las demandas de rectificación de nombre y sexo, según la identidad de género, ambas características del estado civil de las personas y elementos definitorios de la identidad. De igual manera, se analizan las propuestas de procedimientos administrativos, que tendrían como institución responsable a los registros civiles, en contraposición a la judicialización de los procesos de rectificación, según la propia voluntad y la libre determinación de la persona, siendo la cuestión de fondo el reconocimiento del componente de género del derecho a la identidad
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Directory of Open Access Journals (Sweden)
Luz Helena Alba
2016-11-01
Full Text Available
Objetivos: Comparar los registros de atención a pacientes con cáncer en Colombia en el periodo 2009−2013 a través del Registro Individual de Prestación de Servicios de Salud (RIPS, con los registros consignados en la página de la Agencia Internacional Contra el Cáncer: Globocan.
Métodos: Se realizó una búsqueda de información de 27 tipos de cáncer en los RIPS y, a partir de esos datos, se estimaron las tasas de incidencia ajustadas por edad siguiendo la metodología de ajuste directo. Posteriormente, los resultados se compararon con Globocan.
Resultados: Según los RIPS, en el período comprendido entre 2009−2013, se reportaron 110.879 casos incidentes de cáncer; 68.312 en mujeres y 42.509 en hombres. Para la mayoría de los tipos de cáncer se observan tasas de incidencia menores en los registros RIPS respecto a aquellas estimadas por Globocan. De menor a mayor figuran: el cáncer de labio y cavidad oral (0.15:1; próstata (0,33:1; mama (0,74:1; cuello uterino (0,64:1; estómago (0,22:1, colorrectal (0,44:1 y tiroides (0.86:1.
Conclusión: Las diferencias podrían atribuirse a una subestimación presentada en los RIPS; una sobreestimación, en Globocan; o una combinación de las dos. Dada la trayectoria y los mecanismos de verificación de los registros de: Pasto, Cali, Manizales y Bucaramanga, base de la información de Globocan, es probable que los datos de incidencia de los RIPS no se encuentren todavía suficientemente depurados.
ANALYSIS OF INDIVIDUAL RECORDS OF PROVISION OF HEALTH SERVICES (RIPS IN CANCER IN COLOMBIA
ABSTRACT
Objectives: To compare the data for cancer patients care in Colombia during the period 2009- 2013 through the Individual Registration of Health Care Provision (RIPS with records from the International Agency for Research in Cancer (IARC website
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Directory of Open Access Journals (Sweden)
João M. D. Miranda
2007-12-01
Full Text Available The first record of Histiotus laephotis Thomas, 1916 from Brazil is reported here. An adult male was caught with a mist net in a barn located within an Araucaria pine forest in the municipality of Passos Maia, State of Santa Catarina, Southern Brazil (26º46'48"S and 52º03'34"W. This record extends the distribution of this species in South America. Morphological and taxonomic notes of this species are described as well.O primeiro registro de Histiotus laephotis Thomas, 1916 o Brasil é aqui reportado. Um macho adulto foi coletado com rede de neblina (em abrigo artificial nos domínios da Floresta com Araucária, no Município de Passos Maia, Estado de Santa Catarina, Sul do Brasil (26º46'48"S e 52º03'34"W. Este registro amplia a distribuição da própria espécie na América do Sul. Aspectos morfológicos e taxonômicos desta espécie são também descritos.
Odor-baited trap trees: a novel management tool for plum curculio (Coleoptera: Curculionidae).
Leskey, Tracy C; Piñero, Jaime C; Prokopy, Ronald J
2008-08-01
The plum curculio, Conotrachelus nenuphar (Herbst) (Coleoptera: Curculionidae), one of the most important pests of apple (Malus spp.) in eastern and central North America, historically has been managed in New England apple orchards by three full block insecticide applications. Efforts to reduce insecticide inputs against plum curculio include perimeter row sprays, particularly after petal fall, to control immigrating adults. The odor-baited trap tree approach represents a new reduced input strategy for managing plum curculio based on the application of insecticides to a few perimeter-row trap trees rather than the entire perimeter row or full orchard block. Here, we compared the efficacy of a trap tree approach with perimeter row treatments to manage populations after petal fall in commercial apple orchards in 2005 and 2006. Injury was significantly greater in trap trees compared with unbaited perimeter row treated trees in both years of the study. In 2005, heavy rains prevented growers from applying insecticide applications at regular intervals resulting in high injury in nearly all blocks regardless of type of management strategy. In 2006, both the trap-tree and perimeter-row treatments prevented penetration by immigrating populations and resulted in economically acceptable levels of injury. The trap tree management strategy resulted in a reduction of approximately 70% total trees being treated with insecticide compared with perimeter row sprays and 93% compared with standard full block sprays.
Energy Technology Data Exchange (ETDEWEB)
Singh, Sudhanshu S. [Materials Science and Engineering, Arizona State University, Tempe, AZ 85287-6106 (United States); Current address: Department of Materials Science and Engineering, Indian Institute of Technology Kanpur, Uttar Pradesh 208016 (India); Jansen, Michael A.; Franz, Nico M. [School of Life Sciences, Arizona State University, Tempe, AZ 85287-4501 (United States); Chawla, Nikhilesh, E-mail: nchawla@asu.edu [Materials Science and Engineering, Arizona State University, Tempe, AZ 85287-6106 (United States)
2016-08-15
The rostrum is an extension of the cuticle of the head of weevils (Coleoptera: Curculionidae) and is often used to bore holes for oviposition (the process of laying eggs) into host plant tissue where larval development occurs. In members of the genus Curculio Linnaeus, 1758, the rostrum is long, slender, and strongly curved, but is nevertheless used to excavate straight bore-holes in the fruit of various host plants, through significant deformation of this structure. In this study, scanning electron microscopy (SEM) was used to examine the rostrum of Curculio longinasus Chittenden, 1927, leading to a microstructural model that describes its deformation behavior. Specifically, we used the continuous stiffness measurement (CSM) technique in nanoindentation to measure the Young's modulus and hardness of rostrum. The values of Young's modulus and hardness for the endocuticle were measured to be 8.91 ± 0.93 GPa and 558 ± 60 MPa, respectively. These results are critical for generating accurate finite element models of the head's mechanical behavior while it undergoes deformation. - Highlights: •SEM was used to examine the rostrum of Curculio longinasus Chittenden, 1927. •Nanoindentation to measure the Young's modulus and hardness of rostrum. •Results are critical for finite element models of the head's mechanical behavior.
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
Directory of Open Access Journals (Sweden)
Aline Cabral de Oliveira
2008-10-01
Full Text Available O potencial miogênico evocado vestibular (VEMP é um teste clínico que avalia a função vestibular através de um reflexo vestíbulo-cervical inibitório captado nos músculos do corpo em resposta à estimulação acústica de alta intensidade. OBJETIVO: Verificar e analisar os diversos métodos de registro dos potenciais miogênicos evocados vestibulares no homem e em cobaias. MATERIAL E MÉTODO: Realizou-se busca eletrônica nas bases de dados MEDLINE, LILACS, SCIELO e COCHRANE. RESULTADOS: Foram verificadas divergências quanto às formas de registro dos potenciais miogênicos evocados vestibulares, relacionadas com os seguintes fatores: posição do paciente no momento do registro, tipo de estímulo sonoro utilizado (clicks ou tone bursts, parâmetros para a promediação dos estímulos (intensidade, freqüência, tempo de apresentação, filtros, ganho de amplificação das respostas e janelas para captação dos estímulos, tipo de fone utilizado e forma de apresentação dos estímulos (monoaural ou binaural, ipsi ou contralateral. CONCLUSÃO: Não existe consenso na literatura quanto ao melhor método de registro dos potenciais evocados miogênicos vestibulares, havendo necessidade de pesquisas mais específicas para comparação entre estes registros e a definição de um modelo padrão para a utilização na prática clínica.The vestibular evoked myogenic potential (VEMP is a clinical test that assess the vestibular function by means of an inhibitory vestibulo-neck reflex, recorded in body muscles in response to high intensity acoustic stimuli. AIM: To check and analyze the different methods used to record VEMPs in humans and in guinea pigs. MATERIALS AND METHODS: We researched the following databases: MEDLINE, LILACS, SCIELO and COCHRANE. RESULTS: we noticed discrepancies in relation to the ways used to record the vestibular evoked myogenic potentials in relation to the following factors: patient position at the time of recording
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Primer registro de la cotorra argentina (Myiopsitta monachus en Coahuila, México
Directory of Open Access Journals (Sweden)
Guillermo Romero-Figueroa
2017-04-01
Full Text Available Reportamos por primera vez individuos de la cotorra argentina (Myiopsitta monachus en una colonia reproductiva en la ciudad de Torreón, Coahuila, México. observadas por primera vez en febrero de 2013. Tras las observaciones de junio de 2016, se registró un aumento importante de la población, fue evidente que su distribución se extendió a nuevas áreas dentro del campus Laguna de la Universidad Autónoma Agraria Antonio Narro. La colonia estaba establecida sobre plantas de yuca (Yucca elata, con al menos ocho entradas visibles activas, a una altura de 4 m sobre el nivel del suelo. En 2013 observamos 12 individuos en el sitio; de los cuales nueve fueron adultos y tres jóvenes, mientras que en las observaciones del 2016 detectamos 25 cotorras. A pesar de que hay una estrategia nacional para prevenir, controlar y erradicar especies exóticas invasoras en México, en la ciudad de Torreón no existe ninguna acción que controle esta especie. El área urbana donde se encuentra establecida la población de cotorras posee características y condiciones apropiadas en estructura y composición de la vegetación, según la literatura, para que continúe el crecimiento de la población.
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
Ortego, Jaime; Olave, Anabel; Mier Durante, Milagros Pilar
2014-01-01
Se informa del hallazgo del áfido Drepanosiphum oregonense Granovsky (Hemiptera: Aphididae) sobre árboles de Acer pseudoplatanus y A. campestre (Sapindaceae) en Argentina lo que constituye el primer registro de la especie y del género Drepanosiphum Koch en Argentina y el segundo en Sudamérica. The finding in Argentina of the aphid Drepanosiphum oregonense on "maple tree" Acer pseudoplatanus ...
Nuevos registros para la flora de Honduras y el Parque Nacional Montaña de Celaque.
Directory of Open Access Journals (Sweden)
Hermes Vega
2016-09-01
Full Text Available Se registran 11 novedades para la flora de Honduras a partir de ejemplares recolectados en el Parque Nacional Montaña Celaque. Los nuevos registros son: Tillandsia mateoensis (Bromeliaceae, Diastema affine (Gesneriaceae, Scutellaria costaricana (Lamiaceae, Miconia contrerasii (Melastomataceae, Acianthera violacea, Dendrophylax porrectus, Epidendrum santaclarense, Lepanthes enca-barcenae, L. fratercula, L. isabelae y Sarcoglottis schaffneri (Orchidaceae. Por otra parte, Potosia guatemalensis es sinonimizado bajo S. schaffneri. Se incluyen fotos de todas las especies, hábitats y un mapa de distribución con sus localidades en Honduras.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Cucho Martínez, Liliana Luz
2016-01-01
El presente estudio titulado “calidad de las notas de enfermería en los registros clínicos del servicio de hospitalización y emergencia del hospital emergencias pediátrica, Lima 2016” tuvo como objetivo general, comparar la calidad de las notas de enfermería en los registros clínicos entre los servicio de hospitalización y emergencia del hospital emergencias pediátricas. El tipo de investigación fue cuantitativo, retrospectivo, de diseño no experimental, de corte transversal...
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Parra, Leonardo; Mutis, Ana; Ceballos, Ricardo; Lizama, Marcelo; Pardo, Fernando; Perich, Fernando; Quiroz, Andrés
2009-06-01
The objective of this study was to evaluate the role of host volatiles in the relationship between a blueberry plant Vaccinium corymbosum L. and the raspberry weevil Aegorhinus superciliosus (Guérin) (Coleoptera: Curculionidae), the principal pest of blueberry in the south of Chile. Volatiles from the aerial part of different phenological stages of the host were collected on Porapak Q and analyzed by coupled gas chromatography-mass spectrometry (GC-MS). Several chemical groups were identified including green leaf volatiles, aromatic compounds, and terpenes. The olfactometric responses of A. superciliosus toward different odor sources were studied in a four-arm olfactometer. Blueberry shoots at the phenological stages of fruit set, and blue-pink fruit color elicited the greatest behavioral responses from weevils. Five compounds (2-nonanone, eucalyptol, R- and S-limonene, and 4-ethyl benzaldehyde) elicited an attractant behavioral response from A. superciliosus. The results suggest the host location behavior of A. superciliosus could be mediated by volatiles derived from V. corymbosum. This work has identified a number of compounds with which it is possible to develop a lure for the principal pest of blueberry in southern Chile.
Haro Sosa, Giovanny Lenin
2017-01-01
La investigación tiene por objetivo analizar la calidad de servicio al cliente que se oferta en las agencias de Registro Civil de las ciudades de Riobamba, Ambato, Guaranda y Latacunga usando el modelo SERVQUAL. Registro Civil ha implementado grandes cambios en los últimos años referente a infraestructura, innovación tecnológica y talento humano, sin embargo, de ello no existe un modelo de aseguramiento de la calidad del servicio, por lo cual se hace necesario visitar a cada un...
Directory of Open Access Journals (Sweden)
Augusto S. Casmuz
Full Text Available Sternechus subsignatus Boheman, 1836 (Curculionidae: Sternechini es una de las plagas de la soja más importantes en el noroeste argentino (NOA. Se trata de un insecto de gran potencial de daño, dado que tanto la larva como el adulto causan perjuicio al cultivo de soja. El manejo de S. subsignatus es difícil principalmente por sus características comportamentales y las particularidades de su biología. En busca de una alternativa de control, se estudió el uso de productos químicos insecticidas para el tratamiento de semillas de soja como método de protección del cultivo en las primeras etapas de su desarrollo. Se evaluaron tres principios activos en diferentes dosis: tiametoxan, acetamiprid e imidacloprid, más un testigo, durante tres campañas: 2002/2003, 2006/2007 y 2007/2008. El parámetro evaluado fue el porcentaje de plantas dañadas. Las evaluaciones se hicieron en diferentes tiempos, a partir de la fecha de siembra del ensayo. El activo que ofreció mayor control fue tiametoxan 35% FS, en todos los ensayos evaluados, brindando una protección adecuada hasta las tres semanas posteriores a la siembra del cultivo.Sternechus subsignatus Boheman, 1836 (Curculionidae: Sternechini is one of the most important soybean pests in Northwestern Argentina (NOA. It has potential for considerable damage, since both larvae and adults are harmful to the crop. S. subsignatus management is difficult primarily due to its behaviour and peculiarities of its biology. In the search for an alternative to control the pest, we studied the use of chemical insecticides for soybean seed treatment as a method for protecting the crop in its early development stages. Three products at different doses, thiamethoxan, acetamiprid and imidacloprid, and a control were evaluated during three crop seasons: 2002/2003, 2006/2007 and 2007/2008. The evaluated parameter was the percentage of damaged plants. Assessments were made at different times, from trial sowing date
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
Os ensaios clínicos e o registro de anticorpos monoclonais e biomedicamentos oncológicos no Brasil
Directory of Open Access Journals (Sweden)
Cecilia Ferreira da Silva
Full Text Available RESUMO Objetivo Analisar o percurso dos ensaios clínicos com anticorpos monoclonais e biomedicamentos oncológicos realizados em instituições brasileiras de 2003 a 2012. Método Neste estudo retrospectivo e descritivo, realizou-se um levantamento junto aos repositórios ClinicalTrials.gov e ReBEC. Foram incluídos ensaios de fase II ou III com participação do Brasil e registro em pelo menos um dos repositórios. Após a seleção dos ensaios, foi investigada a trajetória dos anticorpos monoclonais e biomedicamentos desde a pesquisa até o registro sanitário junto a Agência Nacional de Vigilância Sanitária (Anvisa, Food and Drug Administration (FDA e European Medicines Agency (EMA. Resultado Nove ensaios foram selecionados, todos randomizados controlados. Oito eram de fase III e um de fase II. Dois ensaios utilizaram cegamento duplo e sete eram abertos. Todos apresentaram recrutamento para ambos os sexos, com idade mínima de 18 anos. A média de recrutamento foi de 985,2 pacientes. Sete ensaios estavam finalizados e dois haviam sido encerrados prematuramente. Todos os ensaios foram financiados por indústrias farmacêuticas não brasileiras e enfocaram câncer renal, colorretal, gástrico, de pulmão (não pequenas células, linfoma não-Hodgkin e melanoma, envolvendo a utilização de cetuximabe, figitumumabe, ipilimumabe, rituximabe, bevacizumabe e interferon alfa-2a. A FDA foi a primeira agência a registrar os medicamentos, seguida pela EMA, a não ser no caso do interferon alfa-2a, recusado pela EMA. Não foi possível avaliar o ano de aprovação no Brasil pela Anvisa. Conclusão A participação do Brasil nos ensaios clínicos com anticorpos monoclonais e biomedicamentos oncológicos é insuficiente. A limitação do conteúdo disponível sobre os estudos, histórico de registro e outros elementos relevantes é uma fragilidade importante das fontes consultadas.
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Desbalance energético proteico en lactantes durante el primer año de vida*
Directory of Open Access Journals (Sweden)
Virginia Díaz-Argüelles Ramírez-Corría
2004-06-01
Full Text Available La alimentación de los lactantes durante el primer año de vida tiene gran influencia en el crecimiento y desarrollo posterior, sobre todo en el lactante de muy bajo peso al nacer. El objetivo de este trabajo fue caracterizar el consumo de energía y macronutrientes en un grupo de recién nacidos, con peso inferior a 1 800 g y compararlo con un grupo control de término, para conocer si existía un consumo adecuado durante el primer año de vida. Para ello, se realizó un estudio de cohorte en 25 recién nacidos con peso al nacer menor de 1800 g y 34 semanas de edad gestacional, en el Hospital Ginecoobstétrico "Ramón González Coro", en Ciudad de La Habana, desde enero del 2000 hasta enero del 2001 y en 25 recién nacidos de buen peso a término como grupo control. Se realizó encuesta dietética de registro de 3 días, y a los 4, 6, 9 y 12 meses de edad para evaluar el consumo de macronutrientes. Los datos se procesaron por el Programa para la evaluación del consumo de alimentos (CERES. El consumo de energía fue adecuado, pero con un desequilibrio manifiesto de los macronutrientes en uno y otro grupos, a expensas del consumo de proteínas que fue excesivo (5 g/kg/día durante todo el primer año de vida y una baja densidad energética de la dieta. Se hace necesaria una revisión de la ablactación en los lactantes, del tipo de leche utilizado durante los primeros meses de la lactancia y los hábitos alimentarios de la población, con el objetivo de mejorar su calidad durante los primeros años de la vida.The feeding of infants during the first year of life has a great influence on the further growth and development, mainly on the infant with very low birth weight. The objective of this paper was to characterize the intake of energy and macronutrients in a group of newborn infants with a weight under 1 800 g and to compare it with a term control group to know if there was an adequate consumption during the first year of life. To this end, a
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Primeiro registro de Guyalna cuta em pinhão-manso no estado de Mato Grosso do Sul
Directory of Open Access Journals (Sweden)
Harley Nonato de Oliveira
2012-01-01
Full Text Available Trata-se do primeiro registro de ocorrência de Guyalna cuta (Walker (Hemiptera: Cicadidae em pinhão-manso, Jatropha curcas L. (Euphorbiaceae no Estado de Mato Grosso do Sul. Adultos desse inseto foram observados na parte aérea da planta, durante novembro e dezembro de 2008 e de 2009. Em Mato Grosso do Sul, existem plantios comerciais e experimentais do pinhão-manso, tornando-se necessários estudos relacionados a este inseto, a fim de prevenir eventuais danos à cultura.
Levantamiento del proceso de registros contables por causación de las cuentas por cobrar a clientes
Mayele-Rodríguez, Luz
2013-01-01
De igual forma el Proyecto de Mejora de Procesos a elaborar, desarrollar e implementar en el Área Administrativa y Financiera del Centro de Pinturas Automotriz “LMS”, es realizar el levantamiento del Proceso de Registros Contables por Causación de las cuentas por cobrar a clientes. Lo anterior se puede desarrollar a partir de un poder de negociación con proveedores que incluye entre otros los siguientes factores : El plazo alcanzado en la negociación de compras de insumos, materias primas, co...
Jaramillo, Juliana; Chabi-Olaye, Adenirin; Borgemeister, Christian
2010-08-01
The coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae: Scolytinae), is the most important constrain for coffee production throughout the world. Knowledge on the emergence pattern of H. hampei females to infest new berries is crucial to effectively plan control measures. In this laboratory study, we assessed the development of immature stages and the emergence pattern of H. hampei females from the berries by exposing them to temperatures that are typical for high-altitude plantations (> or = 1,700 m above sea level [masl] ) or when coffee is grown under shade trees (20-22 degrees C), and optimum altitude plantations (1,200-1,600 masl) or nonshaded coffee (25-30 degrees C). Fecundity and emergence pattern of H. hampei females from coffee berries varied with temperature. Temperature played a crucial role determining the rate of H. hampei development and therefore the emergence of the females to start a new infestation cycle. The emergence and colonization phases of new colonizing females in coffee plantations with mean temperatures of 20, 25, or 30 degrees C would take place at different moments in the development of the coffee berries, and in some cases more than once. The implications of our findings for an improved, site-specific timing of control interventions against H. hampei are discussed.
El registro más antiguo de Panochthus (Xenarthra, Glyptodontidae
Directory of Open Access Journals (Sweden)
Zamorano, M.
2014-06-01
Full Text Available Panochthus is one of the largest sized and most frequently recorded genera of Pleistocene South American Glyptodontidae. A recent taxonomic revision shows that the genus includes six species: P. intermedius>/i> and P. subintermedius (early Pleistocene-middle Pleistocene, P. tuberculatus and P. frenzelianus (middle Pleistocene-late Pleistocene, whereas P. greslebini and P. jaguaribensis only can be referred to the Pleistocene sensu lato. In this contribution the oldest record of the genus Panochthus (MMP 5171 is presented and described. The remains came from the late Pliocene (Playa Los lobos Aloformation, Chapadmalal Formation; Chapadmalalan; Paraglyptodon chapalmalensis Biozone of the Mar del Plata, Buenos Aires province, Argentina. The material is represented by a considerable fragment of dorsal carapace and some associated osteoderms, which are assignable to an indeterminate species of Panochthus. One of the most significant characters in the exposed surface of the osteoderms is the presence of a clear “reticular” pattern, a character only observed in Panochthus. From a biostratigraphic viewpoint, it is remarkable the absence of records of Panochthus in the Marplatan Age/Stage (late Pliocene-early Pleistocene.Panochthus es uno de los géneros de gliptodóntidos de mayores dimensiones y más ampliamente registrado en el Pleistoceno del sur de América del Sur. Una reciente revisión demostró que alberga seis especies distribuidas cronológicamente de la siguiente manera: P. Intermedius y P. Subintermedius (Pleistoceno temprano-Pleistoceno medio, Ensenadense; P. Tuberculatus y P. Frenzelianus tienen sus biocrones limitados al Pleistoceno medio-Pleistoceno tardío (Bonaerense-Lujanense, mientras que P. Greslebini y P. Jaguaribensis solo pueden referirse al Pleistoceno sensu lato. En la presente contribución se da a conocer el registro más antiguo de Panochthus, representado por el material MMP 5171, procedente del Plioceno tard
Acero P. Arturo; Garzón F. Jaime; Köster Friedemann
1984-01-01
301 species of previously reported reef fishes from the north coast of Colombia are listed. In this paper we report 22 species for the first time, and 9 species that were already reported are described. With these new reports 323 species distributed in 63 families are now known from this area. Se presenta una lista de las 301 especies de peces de arrecifes de la costa Norte de Colombia que han sido registradas anteriorrnente en la literatura. Se aportan 22 nuevos registros y se describen 9 es...
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Dickens, J C; Mori, K
1989-02-01
Electrophysiological recordings from antennal olfactory receptors and field behavioral experiments showed both male and female boll weevils,Anthonomus grandis Boh. (Coleoptera: Curculionidae), to respond specifically to (+)-grandisol, an enantiomer of compound I of the boll weevil aggregation pheromone. Single-cell recordings revealed antennal olfactory neurons in both male and female weevils keyed to (+)-grandisol. Electroantennograms in response to serial dilutions of the grandisol enaniiomers showed a threshold 100 to 1000 times lower for (+)-grandisol relative to its antipode. In field behavioral experiments, both sexes were significantly more attracted to (+)-grandisol in combination with the three other pheromone components than the combination with (-)-grandisol. When (-)-grandisol was placed with the (+)-enantiomer at equal dosages, a slight although statistically insignificant inhibition occurred. Subsequent field tests showed that the low level of attraction exhibited by (-)-grandisol in combination with the other three pheromone components could be attributed to the other three components alone. These results are in contrast with an earlier study, which found (-)-grandisol to be as attractive as the (+)-enantiomer.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Directory of Open Access Journals (Sweden)
M. Rebeca Granja-Fernández
2011-12-01
Full Text Available Se presentan nuevos registros de ofiuroideos para localidades de Zihuatanejo, Guerrero y de Puerto Escondido, Oaxaca en el Pacífico mexicano. Mediante recolectas realizadas en diversos sustratos se obtuvieron 12 especies, de las cuales Ophiocoma alexandri Lyman, 1860 y Ophiothela mirabilis (Verrill, 1867 fueron las más ampliamente distribuidas. Este número de especies, el más alto registrado respecto a trabajos previos, se atribuye a la mayor amplitud espacial del esfuerzo de muestreo y a la mayor diversidad de sustratos explorados. Se dan a conocer nuevos sustratos habitados por O. mirabilis y Ophioderma panamensis Lütken, 1859. Se presenta el primer registro de asociación de un organismo juvenil de O. alexandri con un hidrozoo del orden Leptothecata en el Pacífico oriental. A pesar del incremento en el número de especies reconocidas para las localidades, se sugiere llevar a cabo una prospección más amplia del Pacífico tropical mexicano y un mayor esfuerzo de muestreo en diversos sustratos con el fin de incrementar el conocimiento de la biodiversidad de ofiuros en la zona.New records of ophiuroids from localities at Zihuatanejo, Guerrero and Puerto Escondido, Oaxaca in the Mexican Pacific are presented. Based on specimens collected on diverse substrata, 12 species were identified; Ophiocoma alexandri Lyman, 1860 and Ophiothela mirabilis (Verrill, 1867 being the most widely distributed. The larger number of recorded species compared to previous studies may result from a spatially broader sampling and a more thorough survey involving a larger variety of substrata. New substrata for O. mirabilis and Ophioderma panamensis Lütken, 1859 are reported. We document, for first time, the relationship between a juvenile of O. alexandri and a hydrozoan of the order Leptothecata in the Eastern Pacific. Although this paper documents a significant increase in the number of recorded species in the study area, we highlight the need for a large scale
Directory of Open Access Journals (Sweden)
Andréa Roveré Franz
2011-03-01
Full Text Available Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae. Stored grains are subject to losses in quality nutritional value and in sanitation from the time they are stored to the time they are consumed. Botanical insecticides may offer an alternative solution for pest control. The objective was to test the insecticidal properties of the essential oils of Cymbopogon citratus (leaf, Zingiber officinale (root and Mentha sp. (leaf. The efficacy of these oils was tested to control the rice weevil, S. oryzae, using hydrodistillation. Chemical analysis of the essential oils was carried out by gas chromatography. Major components of C. citratus were geranial (48% and neral (31%, of Z. officinale were α-zingibereno (13%, geranial (16%, neral (10% and α-farneseno (5% and of Mentha sp. was menthol (92%. Bioassays were carried out by fumigation and topical application. In topical application assays, the essential oil of C. citratus had greater toxicity (LC50 0.027 µL mL-1 and shorter exposure time than the oils of the other two plants. After 24 h and 48 h, 70% and 100% mortality of S. oryzae occurred, respectively. In fumigation assays, essential oil of Z. officinale had a lower LC50 (1.18 µL cm-2 and 70% mortality after 24 h exposure. Therefore, we recommend the use of essential oils of C. citratus and Z. officinale to control the rice weevil S. oryzae.
Reddy, Gadi V P; Raman, A
2011-04-01
Trap designs for banana root borer, Cosmopolites sordidus (Germar) (Coleoptera: Curculionidae), have been done essentially on the understanding that C. sordidus rely primarily on chemical cues. Our present results indicate that these borers also rely on visual cues. Previous studies have demonstrated that among the eight differently colored traps tested in the field, brown traps were the most effective compared with the performances of yellow, red, gray, blue, black, white, and green traps; mahogany-brown was more effective than other shades of brown.In the current study, efficiency of ground traps with different colors was evaluated in the laboratory for the capture of C. sordidius. Response of C. sordidus to pheromone-baited ground traps of several different colors (used either individually or as 1:1 mixtures of two different colors) were compared with the standardized mahogany-brown traps. Traps with mahogany-brown mixed with different colors had no significant effect. In contrast, a laboratory color-choice tests indicated C. sordidus preferred black traps over other color traps, with no specific preferences for different shades of black. Here again, traps with black mixed with other colors (1:1) had no influence on the catches. Therefore, any other color that mixes with mahogany-brown or black does not cause color-specific dilution of attractiveness. By exploiting these results, it may be possible to produce efficacious trapping systems that could be used in a behavioral approach to banana root borer control.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Registro electrónico de pacientes “DELFOS” en Cardiología y Cirugía Cardiovascular pediátrica
Directory of Open Access Journals (Sweden)
Luis E. Marcano Sanz
2015-03-01
Full Text Available Introducción: El interés por los registros electrónicos de pacientes ha crecido significativamente en los últimos años. En Cuba no existe un sistema de registro electrónico de pacientes en cardiología y cirugía cardiovascular pediátrica.Objetivo: Diseñar y aplicar una herramienta informática que permita gestionar toda la información de los pacientes atendidos en la Red Cardiopediátrica Nacional, para apoyar la toma de decisiones gerenciales, clínicas, docentes e investigativas.Método: Se utilizó el software FileMaker pro 11, se programó de forma cooperativa con los usuarios un sistema de módulos independientes conectados en tiempo real que abarca desde la admisión hasta el seguimiento y la rehabilitación. La entrada de datos es validada, los cálculos se ejecutan automáticamente y se muestran en gráficos. Se implementó un servidor para compartir el sistema en todos los departamentos del hospital y en la web, con sus correspondientes permisos de acceso y autentificación.Resultados: Se logra un nivel alto de empleo, disminuyó el tiempo de obtener informes y otras salidas con mayor confiabilidad, organización y satisfacción de los usuarios finales en relación con las historias clínicas impresas. La información puede ser exportada en PDF o EXCEL. Se facilitan los accesos a enlaces de internet. La versión final quedó registrada en el Centro Nacional de Derecho de Autor con el número 2411 de 2012.Conclusiones: El “DELFOS” es una herramienta informática multiusuario de fácil utilización, que posibilita de modo seguro, rápido, estable y eficiente, el registro, procesamiento y recuperación en tiempo real de los datos de los pacientes y su empleo en la práctica clínica.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Ana Castañeda-Guarderas; Guillermo Beltrán-Ale; Renzo Casma-Bustamante; Paulo Ruiz-Grosso; Germán Málaga
2011-01-01
Estudio que describe las características de los registros de pacientes con accidente cerebro vascular (ACV), como diagnóstico causante de hospitalización en el Hospital Nacional Cayetano Heredia entre los años 2000 - 2009. Se obtuvieron 2225 registros de pacientes mayores de 18 años, con ACV. De acuerdo con la CIE-10, 1071 tenían el diagnóstico de ACV isquémico, 554 ACV hemorrágico, 183 hemorragia subaracnoidea, 49 isquémico hemorrágico, 10 crisis isquémica transitorias y en 358 no fue posibl...
Safe-record : segurança e privacidade para registros eletrônicos em saúde na nuvem
Souza, Stefano Mozart Pontes Canedo de
2016-01-01
O mercado de computação em nuvem tornou disponível a equipes hospitalares e acadêmicas um volume virtualmente ilimitado de recursos computacionais, os quais têm sido utilizados em atividades de pesquisa e desenvolvimento. Apesar das evidentes vantagens da computação em nuvem, o armazenamento e o processamento de Registros Eletrônicos em Saúde (RES) nesses ambientes levantam preocupações genuínas com a privacidade e a segurança dos pacientes que, voluntária ou involuntariamente, têm seus dados...
Directory of Open Access Journals (Sweden)
Osvaldo Eric Ramírez-Bravo
2012-09-01
Full Text Available The state of Puebla has little information about mammal presence and distribution. In a study to determine jaguar presence using camera traps and interviews, we obtained 16 new records of tepezcuincle (Cuniculus paca in different vegetation types such as tropical rainforest and cloud forest, as well as in coffee plantations. The records prove that the species is widely spread along the Sierra Norte of Puebla, but the distribution of populations in the Sierra Negra is uncertain.El estado de Puebla tiene poca información sobre presencia y distribución de mamíferos. En un estudio para determinar la presencia del jaguar, mediante cámaras y encuestas, logramos obtener 16 nuevos registros de tepezcuincle (Cuniculus paca en diferentes tipos de vegetación como selvas medianas y bosque mesófilo de montaña,además de cafetales. Estos registros prueban que la especie se distribuye ampliamente a lo largo de la sierra Norte de Puebla; sin embargo, se desconoce la distribución de las poblaciones en la sierra Negra.
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
Análisis de un registro de adenomas pituitarios Analysis of a pituitary adenoma registry
Directory of Open Access Journals (Sweden)
Carolina Albiero
2010-10-01
Full Text Available Dada la complejidad que reviste el enfoque diagnóstico y terapéutico de los tumores pituitarios, el registro y análisis de la experiencia clínica acumulada es de gran ayuda en la toma de decisiones. En este trabajo se informan datos clínico-terapéuticos, extraídos de un registro computarizado, sobre 519 de un total de 670 pacientes con adenomas pituitarios. Trescientos cuarenta y cinco fueron mujeres (66% y 174 varones (34%, de 14 a 80 años de edad. El diagnóstico final fue: acromegalia en 176, enfermedad de Cushing en 153, prolactinoma en 101 y adenoma clínicamente no-funcionante (ANF en 89. La edad media al momento del diagnóstico de acromegalia fue 43.9 ± 13.5 (16-80, para enfermedad de Cushing 35.7 ± 12.9 (14-72, para prolactinomas 30.0 ± 13.4 (15-79 y para ANF 52.1 ± 15.2 (17-79 años. La creación de un registro institucional de tumores de hipófisis es un instrumento de gran utilidad para el análisis de la experiencia adquirida y constituye una herramienta valiosa para mejorar la estrategia terapéutica, optimizar la relación costo/beneficio y mejorar el cuidado del paciente. Contribuye a la docencia médica, tanto en el pre como en el posgrado y da base a la realización de trabajos de investigación clínica, aportando a la difusión y transferencia de conocimientos.Collection and analysis of data obtained during the clinical treatment of pituitary tumours are of great utility in the decision making process, when facing clinical situations. We report here data on 519 from 670 patients with pituitary adenomas obtained from a computerized registry. Three hundred and forty five were females (66% and 174 males (34%, aged 14-80. Final diagnosis was acromegaly in 176, Cushing's disease in 153, prolactinoma in 101 and clinically non-functioning adenoma in 89. Mean age at diagnosis was 43.9 ± 13.5 (16-80 for acromegalics, 35.7 ± 12.9 (14-72 for Cushing's, 30.0 ± 13.4 (15-79 for prolactinoma and 52.1 ± 15.2 (17-79, for non
EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA
Directory of Open Access Journals (Sweden)
Mauren Salazar-Carranza
2013-01-01
Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
Directory of Open Access Journals (Sweden)
José Ismael Campos-Rodríguez
2010-04-01
Full Text Available Five new reptile records for the Mexican state of Guanajuato are reported: Lampropeltis triangulum dixoni, Leptodeira annulata cusiliris, Oxybelis aeneus, Tropidodipsas sartorii, and Scincella silvicola caudaequinae. These records are within western versant of the Sierra Gorda at Sierra Gorda de Guanajuato. Evidence is given that supports the idea that the area supports a herpetofaunal assemblage of tropical affinities.Se presentan 5 nuevos registros de reptiles para el estado de Guanajuato; Lampropeltis triangulum dixoni, Leptodeira annulata cusiliris, Oxybelis aeneus, Tropidodipsas sartorii y Scincella silvicola caudaequinae. Todos localizados en la vertiente oeste de la sierra Madre Oriental, en la sierra Gorda de Guanajuato. Se proporciona evidencia de un ensamble herpetofaunístico de afinidad tropical a subtropical presente en la región.
Park, Yong-Lak; Gururajan, Srikanth; Thistle, Harold; Chandran, Rakesh; Reardon, Richard
2018-01-01
Rhinoncomimus latipes (Coleoptera: Curculionidae) is a major biological control agent against the invasive plant Persicaria perfoliata. Release of R. latipes is challenging with the current visit-and-hand release approach because P. perfoliata shows a high degree of patchiness in the landscape, possesses recurved barbs on its stems, and often spreads into hard-to-access areas. This 3-year study developed and evaluated unmanned aerial systems (UAS) for precise aerial release of R. latipes to control P. perfoliata. We have developed two UAS (i.e. quad-rotor and tri-rotor) and an aerial release system to disseminate R. latipes. These include pods containing R. latipes and a dispenser to accommodate eight pods. Results of field tests to evaluate the systems showed no significant (P > 0.05) effects on survivorship and feeding ability of R. latipes after aerial release. Our study demonstrates the potential of UAS for precision aerial release of biological control agents to control invasive plants. The aerial deployment systems we have developed, including both pods and a dispenser, are low cost, logistically practical, and effective with no negative effects on aerially released R. latipes. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Energy Technology Data Exchange (ETDEWEB)
Campos-Aranda, D.F. [Universidad Nacional Autonoma de Mexico, Mexico, D.F. (Mexico)
1999-03-01
Firstly, the estimates of standard deviation and arithmetic mean as basic statistical parameters are emphasised, which point out the variability and magnitude of annual streamflow records in the hydrological studies of planning water-resource developments inside a region. Then the equations for quantitative evaluations of statistical convenience of extending a short stream flow record are described in detail. The previous makes use of additional and common data in one or two closer hydrometric stations, with this the short observed record has a certain correlation (dependence or association). Later two numerical applications to real problems are given, the first one for the two dimensional model, which uses a closed hydrometric station in order to extend the short record, and the second application for the three dimensional model which makes use of two auxiliary hydrometric stations. Lastly, three general observations about the paper are cited. [Spanish] Inicialmente se destaca la importancia de las estimaciones de la medida y la desviacion estandar como parametros estadisticos basicos, los cuales caracterizan la magnitud y la variabilidad de los volumenes escurridos anuales en los estudios hidrologicos de planeacion del aprovechamiento de los recursos hidraulicos de una region. Enseguida, se describen con detalle las ecuaciones que permiten evaluar cuantitativamente si es conveniente o no, desde un punto de vista estadistico, ampliar el registro corto de escurrimientos, con base en datos comunes, adicionales y disponibles; esto en una o dos estaciones hidrometricas cercanas, con las cuales, el registro reducido guarda cierta correlacion (dependencia o asociacion). Lo anterior, significa evaluar si con base en el registro ampliado, las estimaciones de la medida y la variancia mejoran estadisticamente. Posteriormente, se realizan dos aplicaciones numericas a casos reales; una, para el modelo bidimensional que utiliza una estacion hidrometrica cercana para ampliar el
Alzate, Adriana; Muñoz, Carlos G.; Zapata, Fernando A.; Giraldo, Alan
2012-01-01
Se hacen cuatro nuevos registros de especies en isla Gorgona, Pacífico colombiano: dos gobios (Gobulus crescentalis y Chriolepis cuneata) y un pez pipa (Cosmocampus arctus), colectados con anestésico en pequeñas colonias de coral aisladas; y un pez globo (Canthigaster janthinoptera) observado y fotografiado. Este estudio extiende el ámbito de distribución de tres de estas especies en el Pacífico Oriental Tropical.
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Directory of Open Access Journals (Sweden)
Mitja Skubic
2004-12-01
Full Text Available L'edizione, in una veste tecnicamente impeccabile, ha come scopo principale quello di presentare i1 registro di una importante confraternita udinese del tardo Medioevo, quella dei pellicciai. In questo ambiente climatico tale mestiere deve esse re stato importante; e vedrei una prova nel fatto che viene menzionato, a parte gli beçars - macelatores (es. 42, l'unico, negli Esercizi di versione dal volgare friulano in latino nel sec. XIV in una scuola notarile cividalese dove si legge: L'ager gait, qual è d'estat, fas spargna lis pliçis, chosa ricrisint agl piliças. Ager calidus, qualis est in estate, facit parsimonucare renones, re cuius tedet pelixarios, (es. 40. Il curatore della pubbli cazione del Registro, Federico Vicario, vanta già una decina di pubblicazi.oni di testi analoghi e con l'attuale ha aggiunto un ulteriore testo prezioso per la nostra cono scenza del friulano antico. Il Registro è l'elenco dei censuari, però, oltre ad essere un documento della vita e dei rapporti sociali del Tre- e Quattrocento, offre un quadro linguistico del friulano in un'epoca in cui la letteratura vera e propria in friulano offre poco.
Sequential Sampling Plan of Anthonomus grandis (Coleoptera: Curculionidae) in Cotton Plants.
Grigolli, J F J; Souza, L A; Mota, T A; Fernandes, M G; Busoli, A C
2017-04-01
The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is one of the most important pests of cotton production worldwide. The objective of this work was to develop a sequential sampling plan for the boll weevil. The studies were conducted in Maracaju, MS, Brazil, in two seasons with cotton cultivar FM 993. A 10,000-m2 area of cotton was subdivided into 100 of 10- by 10-m plots, and five plants per plot were evaluated weekly, recording the number of squares with feeding + oviposition punctures of A. grandis in each plant. A sequential sampling plan by the maximum likelihood ratio test was developed, using a 10% threshold level of squares attacked. A 5% security level was adopted for the elaboration of the sequential sampling plan. The type I and type II error used was 0.05, recommended for studies with insects. The adjustment of the frequency distributions used were divided into two phases, so that the model that best fit to the data was the negative binomial distribution up to 85 DAE (Phase I), and from there the best fit was Poisson distribution (Phase II). The equations that define the decision-making for Phase I are S0 = -5.1743 + 0.5730N and S1 = 5.1743 + 0.5730N, and for the Phase II are S0 = -4.2479 + 0.5771N and S1 = 4.2479 + 0.5771N. The sequential sampling plan developed indicated the maximum number of sample units expected for decision-making is ∼39 and 31 samples for Phases I and II, respectively. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
Registro de un ejemplar de Trachemys scripta elegans (Wied 1839) en la provincia de Jujuy, Argentina
Quiroga, María Fernanda; González Baffa Trasci, Noelia; Akmentins, Mauricio
2015-01-01
La tortuga de orejas rojas (Trachemys scripta elegans) es originaria del centro este de los Estados Unidos y noreste de México (Ernst, 1990), pero debido al comercio internacional de animales silvestres se ha convertido en un invasor biológico a nivel global. En Argentina, Trachemys scripta elegans ha sido reportada para dos localidades en la provincia de Buenos Aires y en ambos casos se trató del registro de individuos aislados, por lo que se desconoce si la tortuga de orejas rojas ha lograd...
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Directory of Open Access Journals (Sweden)
JUAN PABLO HERRERA SAAVEDRA
2014-01-01
Full Text Available Este documento presenta una aplicación de discriminación de segundo grado a las tarifas de pro - piedad industrial, en particular al sistema multi-clase, esto a propósito de la adhesión de Colombia al Protocolo de Madrid en 2011. La metodología consistió en la construcción de un modelo para establecer una estructura tarifaria óptima de registro de marcas con dos objetivos: (i cumplir con las obligaciones dispuestas en el TLT e incentivar la utilización del sistema multi-clase, y (ii identificar un mecanismo que minimizara los efectos negativos, que en materia de recaudo podría enfrentar la autoridad de propiedad industrial, con la entrada en vigencia de dicho acuerdo. Dentro de los prin - cipales hallazgos del estudio se identificó la no existencia inequívoca inversa entre tarifa marcaria y número de solicitudes, lo que da espacio a considerar múltiples factores que pueden incidir en la de - manda del servicio de registros marcarios distintos a su precio. Igualmente, se estableció que este sis - tema de tarifas diferenciadas amortiguó el descenso de los ingresos de la autoridad administradora de propiedad industrial en Colombia dadas las características de la demanda del servicio observado.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Registros de representación semiótica del concepto de función exponencial. Parte I
Directory of Open Access Journals (Sweden)
María G. Castro Rodríguez
2017-01-01
Full Text Available El concepto de función es un objeto matemático fundamental en el proceso de abstracción, en particular, en la función exponencial, la cual es preponderante para el aprendizaje de varios procesos físicos y sociales. Esta función, es parte de los programas de matemáticas desde elinicio de la instrucción escolar hasta el nivel superior, donde la extensión de los mismos, ha limitadosu tiempo de estudio.Aunado a este problema, el sistema tradicional de enseñanza sólo incluye algunos cambios de representación, que de acuerdo con La teoría de registros de representación semiótica (Duval, 1993 no son suficientes para que el estudiante adquiera un entendimiento significativo de esta función. En este artículo se muestra el efecto de la instrucción recibida mediante el coeficiente ganancia normalizada de Hake (1998 a través de una secuencia didáctica. Esta secuencia se fundamenta en los diversos cambios de registros de representación semiótica del concepto de función. Se muestran los efectos de entendimiento de dos grupos, el experimental y el de control. Los resultados indican que el grupo experimental obtuvo una mayor ganancia, y accedió a niveles de entendimiento de Hitt (1998 más altos en comparación con el grupo de control. Además, se obtuvo una correlación de 0.5 entre estos dos índices.
Reproductive Plasticity of an Invasive Insect Pest, Rice Water Weevil (Coleoptera: Curculionidae).
Huang, Yunshang; Ao, Yan; Jiang, Mingxing
2017-12-05
Reproductive plasticity is a key determinant of species invasiveness. However, there are a limited number of studies addressing this issue in exotic insects. The rice water weevil Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), which is native to North America, is one of the most invasive insect pests in east Asia. In this study, we investigated the reproductive status of first-generation females (progeny of overwintered weevils) from five geographic regions in southern and northern China in the field, and reproductive status and ovipositional features of females provided with suitable host plants in the laboratory after collection. Under field conditions, a proportion of females oviposited, while the rest remained in diapause from all three southern regions investigated, but reproductive development did not take place in females from the two northern regions, where the weevil produces only one generation per year. However, when fed host plants in the laboratory, females from all regions laid eggs. They typically had a very short ovipositional period (3-6 d on average on rice at a temperature of 27°C), laid a low number of eggs, and did not die soon after oviposition; this was different from common reproductive females. We concluded that first-generation L. oryzophilus females, which largely enter diapause after emergence, are highly plastic in their reproductive performance and are ready to reproduce under favorable conditions. Our results indicate the significance of their reproductive plasticity for geographic spread and population development. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Santana,Ariel; Olave,Carlos; Butorovic,Nicolás
2010-01-01
A fines de 2007 se instaló una estación automática de tiempo (AWS) en la planta Posesión (ENAP), al oriente de la región, en plena estepa magallánica. Se analiza la información recolectada durante el 2008 y se la compara con registros similares obtenidos en Punta Arenas. Se describen los montos y distribución de la radiación solar en diferentes rangos, al igual que el resto de variables atmosféricas. Se muestra que la temperatura del aire, la humedad relativa y el viento, dependen directament...
Comparisons of boll weevil (Coleoptera: Curculionidae) pheromone traps with and without kill strips.
Suh, C P C; Armstrong, J S; Spurgeon, D W; Duke, S
2009-02-01
Boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), eradication programs typically equip pheromone traps with an insecticide-impregnated kill strip. These strips are intended to kill captured insects, thereby simplifying trap servicing and reducing the loss of weevils from predation and escape. However, the effectiveness of kill strips has not been extensively evaluated. We examined the influences of kill strips on weevil captures, trap servicing, and the incidences of weevil predation and trap obstruction (e.g., by spider webs). Evaluations were conducted weekly during three different production periods (pre- to early-, late-, and postseason) of cotton, Gossypium hirsutum L., to represent different environmental conditions and weevil population levels. Within each period, mean weekly captures of weevils in traps with and without kill strips were statistically similar. On average, traps with kill strips took 9 s longer to service than traps without kill strips, but statistical differences were only detected during the late-season period. Overall, the mean weekly proportion of traps with evidence of weevil predation or trap obstruction was significantly lower for traps with kill strips (0.25) than for traps without kill strips (0.37). However, this reduction in the frequency of weevil predation or trap obstruction was too small to produce a corresponding increase in the numbers of weevils captured. In light of these findings, the use of kill strips is likely unnecessary in eradication programs, but may be a consideration in situations when the numbers of deployed traps are reduced and chronic problems with weevil predation or trap obstruction exist.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Aplicaciones de los registros de resonancia magnética nuclear (nmrl) en la evaluación de yacimientos
Landi Torres, Richard Paúl
2008-01-01
La extraordinaria tecnología de adquisición de registros o perfilaje de resonancia magnética nuclear (RMN) ha estado en continua evolución durante los últimos 10 años. Las compañías petroleras utilizan las mediciones de RMN en una variedad de aplicaciones cada vez más numerosa; por ejemplo, para caracterizar los fluidos de las formaciones durante la evolución de los yacimientos y determinar la producibilidad de la formación. Hoy en día, las mediciones obtenidas con estas herramien...
Marco, registro y concepción. Notas sobre las relaciones entre tres conceptos claves en didáctica
Balacheff, Nicolas
2005-01-01
Las palabras «marco», «registro» y «medio» designan conceptos de amplia utilización por los investigadores en didáctica de las matemáticas, con el fin de modelizar situaciones o de analizar las actividades de los alumnos. Sin embargo, y a pesar de una literatura importante, su uso plantea problemas recurrentes para distinguirlas y relacionarlas (o vincularlas). Proponemos una solución a tales problemas, analizando las relaciones que mantienen entre ellos estos tres conceptos clave de la didác...
Abades-Porcel, Mercedes; Sirvent-Angulo, Montserrat
2016-01-01
Objetivo. Analizar las reflexiones del estudiantado de enfermería recogidas en el registro de su experiencia práctica en salud mental y geriátrica en la Escuela Universitaria de Enfermería del Hospital de la Santa Creu i Sant Pau (HSCSP EUI). Metodología: Se realizó un estudio descriptivo, transversal, basado en los informes recibidos de estudiantes de tercer año de la EUE en el curso 2012 y 2014. Los datos recogidos fueron las variables sociodemográficas (sexo, edad, nacionalidad) y las resp...
La descripción del productor y los registros de autoridades en los contextos archivísticos
Directory of Open Access Journals (Sweden)
Dunia LLanes Padrón
2016-07-01
Full Text Available La representación de la información en el ámbito de los archivos enfrenta nuevos desafíos marcados por las transiciones paradigmáticas de la Archivística. Las reflexiones suscitadas por la teoría del pos-custodial mudaron las formas teóricas y prácticas de realizar el proceso de descripción, ahora dirigido a representar de forma normalizada diferentes entidades archivísticas: documentos, productores, funciones, instituciones de custodia entre otras. Este artículo tiene como objetivo estudiar la representación normalizada de los productores archivísticos y la creación de registros de autoridades. El estudio que se presenta es de naturaleza exploratorio – descriptivo; se realiza un análisis teórico sobre la descripción de la entidad productor así como las sub-entidades institución, persona y familia. Se investigan, además, algunas nociones generales sobre registro de autoridad, puntos de acceso y control de autoridades. Finalmente, se presentan las normas internacionales, nacionales y regionales publicadas para la creación de registros de autoridades archivísticas. La representación de los productores y su integración en los sistemas de información es una tarea fundamental en los nuevos contextos de la archivística posmoderna, orientada a la gestión, el acceso y la veracidad de la información. The information representation in the archives framework faces new challenges characterized by the paradigmatic transitions in the Archivistics. The thinking raised by the post-custodial theory changed the theoretical and practical ways of the description process, now directed to represent in a standardized way different archival entities: documents, producers, functions, custodial institutions among others. The aim of this article is to study the standardized representation of archivistics producers and the creation of the authority registries. The present study is mostly exploratory-descriptive; it offers a theoretical
Directory of Open Access Journals (Sweden)
Ivo Rohling Ghizoni-Junior
2009-06-01
Full Text Available http://dx.doi.org/10.5007/2175-7925.2009v22n3p129 A composição e a distribuição dos répteis em Santa Catarina são pouco conhecidas, particularmente em suas áreas abertas naturais do planalto (estepe ombrófila e do litoral (faixa litorânea de restingas com dunas. Visando contribuir com o conhecimento dos répteis nestas áreas, são apresentados registros de dezesseis espécies anteriormente desconhecidas ou com poucos registros para Santa Catarina: Acanthochelys spixii, Anops kingii, Cnemidophorus lacertoides, C. vacariensis, Leptotyphlops munoai, Mastigodryas b. bifossatus, Tantilla aff. melanocephala, Atractus reticulatus, Gomesophis brasiliensis, Lygophis flavifrenatus, Oxyrhopus r. rhombifer, Phalotris reticulatus, Philodryas agassizii, Xenodon dorbignyi, Micrurus altirostris e Bothrops pubescens. São discutidos brevemente aspectos sobre a distribuição e a conservação destas espécies.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
Primer registro de Hippodamia variegata (Goeze 1777) (Coleoptera: Coccinellidae) en el Perú.
Bustamante-Navarrete, Abdhiel; Marquina-Montesinos, Edgar Luis; Elme-Tumpay, Araseli
2017-01-01
First report of Hippodamia variegata (Goeze 1777) (Coleoptera: Coccinellidae) in Peru. The first record of Hippodamia variegata (Goeze 1777) (Coleoptera: Coccinellidae) in Peru is reported, which also constitutes the highest record of the species. This introduced species is already established in the rest of the continent, but its presence in Peru is confirmed in this contribution. A distribution map and a key to distinguish the two species of this genus present in Peru are presented.
Primer registro de Florometra magellanica (Bell, 1882 (Echinodermata: Crinoidea para el Perú
Directory of Open Access Journals (Sweden)
Elba Prieto Rios
2011-08-01
Full Text Available Se registra por primera vez para el Perú al Crinoideo (Echinodermata Florometra magellanica (Bell, 1882. La especie fue recolectada en el talud continental (360 – 814 m frente al departamento de Piura al norte del Perú (3°38,67’S, 81° 2,73’W. El material de referencia se encuentra depositado en la Colección Científica del Instituto del mar del Perú (IMARPE, Lima, Perú y en la Colección Nacional de Equinodermos de la Universidad Nacional Autónoma de México, Ciudad de México.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Registro Español de Hemodinámica y Cardiología Intervencionista. XIII Informe Oficial (1990–2003
Directory of Open Access Journals (Sweden)
Ramón López Palop
2005-04-01
En el intervencionismo no coronario destaca un aumento del número de valvuloplastias mitrales (21,6%, un incremento de los cierres percutáneos de comunicación interauricular en pacientes adultos (86% y un ligero aumento de los procedimientos intervencionistas en pacientes en edad pediátrica (13,3%. Finalmente, destacamos el alto grado de participación de centros en el registro, lo que hace que los datos aquí presentados sean representativos de la actividad hemodinámica en nuestro país.
Directory of Open Access Journals (Sweden)
José Antonio Escamilla-Cejudo
Full Text Available RESUMEN En varios países centroamericanos se observa que el número de muertes por enfermedad renal crónica asociada a causas no tradicionales (ERCnt entre trabajadores del campo continúa creciendo y existe un subregistro. Se presenta el resultado de un proceso de consenso coordinado por la Organización Panamericana de la Salud/Organización Mundial de la Salud (OPS/OMS, el Centro para el Control de Enfermedades de los Estados Unidos (CDC y la Sociedad Latinoamericana de Nefrología e Hipertensión Arterial (SLANH. Este consenso busca aumentar la probabilidad de detectar y registrar las muertes por estas causas. Se reconoció el impacto negativo que tiene la falta de un instrumento estandarizado y la baja capacitación que se tiene en la profesión médica para un registro adecuado de la o las causas de muerte. Como resultado del consenso, se propone el uso de un código de la Lista para Propósitos Especiales (de manera temporaria dentro de la Clasificación Internacional de Enfermedades (CIE-10, continuar con la promoción del uso del instrumento internacional estandarizado de la OMS para el registro de causas y eventos antecedentes relacionados con la muerte, aumentar el entrenamiento de los médicos responsables por el llenado del certificado de defunción, la realización de acciones para aumentar la completitud y calidad de la información de mortalidad, un algoritmo de decisión para facilitar la selección de la ERCnt como causa específica de muerte, presentando el papel que debieran tener los diferentes mecanismos regionales y subregionales en la región de las Américas para mejorar la situación del registro de mortalidad por ERC y ERCnt.
Signals and systems primer with Matlab
Poularikas, Alexander D
2006-01-01
Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,
Directory of Open Access Journals (Sweden)
Mercedes Villalobos
2011-05-01
Full Text Available Desde la entrada en vigencia de la Constitución del año 2000, se persigue el alcance de la autonomía e independencia tecnológica para contribuir al desarrollo económico, social y político del país. Así, se ordenó el uso obligatorio del software libre en la Administración Pública con el fin de promover la prestación oportuna y eficiente de los servicios públicos a medida que la tecnología se vaya incluyendo como un instrumento de dicha labor. Ejemplo de ello es el Ministerio del Poder Popular para Relaciones Interiores y Justicia, que a través del Servicio Autónomo de Registros y Notarías y, la emisión de los decretos y leyes que rigen la correspondiente competencia como el caso del Decreto Presidencial N 3.390 (Presidencia de la República, 2004, se ha implementado la modernización a través de la automatización de los procesos registrales y notariales con el empleo de los medios electrónicos, en donde tiene cabida el software libre. Al respecto ha surgido el interés de trabajar con el objeto de establecer la efectiva aplicación legal de la función pública desarrollada por los Registros y Notarías con la implementación de tal migración informática. Para ello se adoptó una investigación de tipo documental con diseño bibliográfico y el método de observación documental a partir de la Ley del Registro Público y del Notariado (Asamblea Nacional, 2006 y la Ley Orgánica de Registro Civil (Asamblea Nacional, 2009, que regulan la materia registral y notarial en Venezuela, permitiendo obtener resultados a través de una hermenéutica jurídica aplicable en el método de análisis dogmático jurídico; concluyéndose en el conocimiento de los efectos legales que determinaron la esencialidad de las acciones concretas para usar este tipo de software, acordes con los preceptos aplicables a la función pública especificada.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
DEFF Research Database (Denmark)
Hansen, A C; Grunwald, T; Lund, Anders Henrik
2001-01-01
could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...
Directory of Open Access Journals (Sweden)
Ruy Laurenti
1971-12-01
Full Text Available No distrito de São Paulo foi verificado que 9,5% das crianças falecidas com menos de um ano de idade não têm registro de nascimento. Em proporção apreciável dêsses casos (82,5%, os óbitos ocorreram em hospitais. Êsses dados são analisados em face da Lei dos Registros Públicos - decreto 4857 de 9 de novembro de 1939, com as alterações introduzidas pelo decreto 5318 de 29 de novembro de 1940 e, a partir daí, foram feitas algumas proposições aos administradores de hospitais. Levando-se em conta o sub registro observado, devem ser corrigidos os coeficientes e índices vitais que utilizam o número de nascidos vivos como base de referência, para o distrito de São Paulo.It was verified in the District of São Paulo, Brazil that 9.5% of all infant deaths (children less than one year old did not have birth certificates; 82.5% of them were deaths ocurred in hospitals. This data was analised considering the Law of Public Register, decree no. 4857 of November, 9, 1939 with the modifications presented in the decree no. 5318 of November, 29, 1940. From this, some propositions were made to Hospital Administrators. Considering the observed "under-register", the District of São Paulo vital rates and ratios, that utilize the number of live births in their computation, must be corrected.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Directory of Open Access Journals (Sweden)
Luiz Alberto Piva e Mattos
2011-07-01
Full Text Available FUNDAMENTO: Até o momento, nenhum registro brasileiro foi desenhado para documentar a prática clínica em relação ao atendimento de pacientes de alto risco cardiovascular em uma representativa e ampla amostra de centros investigadores, incluindo hospitais públicos e privados em âmbito nacional. Sendo assim, este estudo permitirá identificar os hiatos na incorporação de intervenções com benefício comprovado em nosso meio. OBJETIVO: Elaborar um registro dedicado à aferição da prática clínica brasileira no que se refere ao atendimento do paciente cardiovascular classificado como de alto risco. MÉTODOS: Estudo observacional do tipo registro, prospectivo, visando documentar a prática clínica atual aplicada a nível ambulatorial para pacientes de alto risco cardiovascular, classificados quando da presença de uma das variáveis: evidência de doença arterial coronariana, doença cerebrovascular, vascular periférica, em diabéticos ou não diabéticos; ou na presença de pelo menos três dos seguintes fatores de risco cardiovascular: hipertensão arterial sistêmica, tabagismo ativo, dislipidemia, idade superior a 70 anos, nefropatia crônica, história familiar de doença arterial coronariana e ou doença carotídea assintomática. Os pacientes serão coletados em 43 centros de todas as regiões brasileiras, incluindo hospitais públicos e privados, assim como em unidades básicas de atendimento a saúde, e revisados clinicamente até um ano após a inclusão. RESULTADOS: Os resultados serão apresentados um ano após o início da coleta (setembro de 2011, e consolidados, após a reunião da população e dos objetivos almejados posteriormente. CONCLUSÃO: A análise deste registro multicêntrico permitirá projetar uma perspectiva horizontal do tratamento dos pacientes acometidos da doença cardiovascular no Brasil.FUNDAMENTO: Hasta hoy, ningún registro brasileño fue proyectado para documentar la práctica clínica con relaci
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Bazı Biyolojik Preparatların Sitophilus granarius (Coleoptera: Curculionidae Erginlerine Etkileri
Directory of Open Access Journals (Sweden)
Tuğba AYYILDIZ
2017-09-01
Full Text Available Bu çalışmada, Entomopatojen funguslardan Biocatch, Nibortem (Verticillium lecani, BMAUM-M3-003 (Metharizum anisopliae ile okaliptus ve zencefil bitkilerinden elde edilen uçucu yağların ve bir bitkisel ekstrakt preparatı olan Nibedicine EC (Azadiractin’in buğdaylarda oldukça önemli zarara neden olan Sitophilus granarius (Coleoptera: Curculionidae erginlerine karşı laboratuar koşullarında etkinlikleri denenmiştir. 10x10x8 cm boyutlarında ağızları tül ile yapıştırılmış olan plastik kaplarda ve 25±1 °C sıcaklık, %60±5 nem oranlarında ve 16:8 saat ışıklandırma süresine ayarlı iklim odasında yetiştirilen S. granarius erginleri üzerine Biocatch, Nibortem (Verticillium lecanii entomopatojen funguslardan 1x109 cfu/mL, BMAUM-M3-003 (Metharizum anisopliae 1x108 cfu/mL dozunda, Nibedicine EC (Azadirachtin 3000 ppm dozunda, uçucu yağlar ise %1 (1 l/100 l dozunda uygulanmıştır. Çalışma sonucunda elde edilen verilere göre BMAUM-M3-003 kodlu entomopatojen fungus (M. anisopliae, S. granarius’u zamana bağlı olarak en fazla etkileyen etmen olmuştur. Yapılan değerlendirmeler sonucunda kullanılan preparatların 21 gün sonunda etkileri incelendiğinde, zencefilin %89.47, diğerlerinin ise %100 ölüm oranına sahip olduğu saptanmıştır.
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Directory of Open Access Journals (Sweden)
Ivo Rohling Ghizoni-Jr
2009-08-01
Full Text Available http://dx.doi.org/10.5007/2175-7925.2009v22n2p195 Apresentamos o primeiro registro da pomba-do-orvalho Patagioenas maculosa (Aves: Columbidae para Santa Catarina, região sul do Brasil. Um indivíduo foi observado em 10 de setembro de 2006 em uma área aberta (pastagens para gado e vegetação arbustiva no município de Anita Garibaldi (centro-sul do estado. Sugerimos que este encontro pontual é resultado de uma recente expansão da distribuição desta espécie devido a modificações na paisagem nesta região.
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Blood Donation and Transfusion: A Primer for Health Educators.
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Small Commercial Building Re-tuning: A Primer
Energy Technology Data Exchange (ETDEWEB)
Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas
2013-09-30
To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.
Eremophila alpestris (Alaudidae): A new bird species and family for the Yucatan Peninsula, Mexico
Barbara MacKinnon; Jaques Laesser; James Rotenberg; Luís I. Tellez
2015-01-01
Eremophila alpestris (Alaudidae): una especie y familia nuevas para la Península de Yucatán, México Se reporta el primer registro de Eremophila alpestris el 23 de noviembre del 2002, en Progreso, costa norte de la Península de Yucatán, México. La población migratoria más cercana esta en la costa de Texas y posiblemente este individuo cruzo el Golfo de México.
Dos registros recientes del quetzal (Pharomachrus mocinno en las Montañas del Este de Chiapas
Directory of Open Access Journals (Sweden)
Manuel Gustavo Palacio Peralta
2009-07-01
Full Text Available El quetzal es un símbolo de la conservación de los bosques de niebla siempreverdes de Mesoamérica. Aquí, presentamos la descripción de dos registros obtenidos en las Montañas del Este de Chiapas, durante la estación reproductiva (abril y no-reproductiva (agosto de 2008. En la zona en donde se registraron estos quetzales ocurre una intensa pérdida forestal, por lo que sus hábitats reproductivo y no-reproductivo podrían estar en peligro de desaparecer en esta región.
El registro imaginario y la estrategia seductora: análisis de las campañas de Victoria’s Secret
Martín Enríquez, Andrea
2015-01-01
Mi trabajo se basa en un análisis del registro imaginario y la estrategia seductora. Para ello realizo un marco teórico en el que abro de la publicidad y el deseo en marcos generales, para después centrarme en el imaginario. La estrategia seductora se analiza desde el punto de vista teórico en el marco y desde el punto de vista práctico a través del análisis de las campañas de la marca Victoria’s Secret. Grado en Publicidad y Relaciones Públicas
Ceballos Vázquez, Margarita; Montes de Oca Martínez, Nivian
2016-01-01
Este artículo realiza una revisión del proceso del Registro Sanitario de los productos bioplaguicidas microbianos. Brinda una panorámica de las legislaciones, documentos, etapas, autoridades que participan y los requisitos técnicos que se exigen en 16 países de América Latina. Se exponen las similitudes, diferencias y los desafíos por los que están obligados a transitar los centros de investigación, fabricantes y productores de alimentos que aplican estos productos. A través del KlamiC®, prod...
Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae
Directory of Open Access Journals (Sweden)
Warren B. Chatwin
2014-10-01
Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema
Johnston, Nessa
2012-01-01
Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...
Directory of Open Access Journals (Sweden)
Mariela Cotignola
2017-12-01
Full Text Available El presente trabajo aborda el estudio de las trayectorias universitarias de los estudiantes de las carreras de Sociología desde los registros administrativos donde se almacenan los datos de la historia académica de los/as alumnos/as. Entendemos a las trayectorias estudiantiles en términos de los recorridos particulares y diversos a través de los cuales los alumnos transitan su experiencia universitaria. El concepto permite focalizar el complejo entramado de aspectos o esferas de la vida cotidiana de los sujetos que participan en la delimitación de un recorrido o itinerario posible, posibilitando así el análisis de procesos complejos, recuperando la dinámica propia de la vida social de los sujetos y considerando las temporalidades sociales externas que las enmarcan (Toscano y otros; 2015. En este trabajo, nos enfocaremos en el tramo inicial de la trayectoria de los estudiantes, ya que consideramos que es la etapa o momento donde los estudiantes construyen el lazo académico con la institución en un sentido amplio. Las facultades de la UNLP cuentan con dos registros disponibles que contienen información sobre los alumnos de las unidades académicas: el Sistema de Preinscripción a carreras de la UNLP (SIPU y el Sistema de Información Universitaria Guaraní (SIU-GUARANÍ. Ambos registros representan temporalidades diferentes. Específicamente en este trabajo se caracterizan las trayectorias de las cohortes de ingreso 2014 –2017 en términos sociodemográficos, de procedencia, el clima educativo de los hogares de pertenencia, las trayectorias educativas previas y la actividad académica desarrollada en los primeros tramos de las carreras. Ahondar en las trayectorias nos permitirá identificar recorridos habituales, los obstáculos que enfrentan los/as estudiantes y pensar en las posibles intervenciones institucionales y pedagógicas al respecto. El trabajo tiene características descriptivas con la intención de abrir interrogantes
Directory of Open Access Journals (Sweden)
Elisiane Gomes Bonfim
2010-03-01
Full Text Available Trata-se de estudo qualitativo que utilizou pesquisa documental na coleta dos dados. Aborda a violência doméstica contra a mulher, considerando a atenção pré-natal pública. Objetiva-se identificar e analisar condutas e estratégias utilizadas por profissionais de saúde durante o pré-natal, na suspeita de casos e na violência declarada, e discutir a problemática dos atendimentos às gestantes em situação de violência, na perspectiva dos registros. Foram pesquisados 784 prontuários de gestantes cadastradas em 2006, em 12 Serviços de Atenção Básica de Porto Alegre. Identificara-se 20 registros de violência contra a mulher, 10 anteriores ao pré-natal, 7 durante o pré-natal e 3 no pós-natal. Constatou-se que a violência aparece descontextualizada, e a conduta centrou-se nas consequências sobre a saúde física e psicológica da mulher e dos filhos. A violência não é registrada como agravo à saúde da mulher, gerando omissões no atendimento, sub-registro e invisibilização; consequentemente, inviabiliza-se a elaboração de estratégias de enfrentamento.Se trata de estudio cualitativo que utilizó la pesquisa documental para la recolección de los datos. Aborda la violencia doméstica contra la mujer tomando en consideración la atención prenatal pública. El objetivo fue identificar y analizar las conductas y estrategias utilizadas por los profesionales de la salud durante el prenatal, en la sospecha de casos de violencia y en la violencia declarada, y discutir la problemática de los atendimientos a las mujeres embarazadas en situación de violencia, bajo la luz de los registros. Se analizaron 784 registros de mujeres embarazadas registrados en 2006 en 12 Centros de Servicios de Atención Básica de Porto Alegre. Se identificaron 20 registros de violencia contra la mujer, 10 anteriores al periodo prenatal, 07 durante el periodo prenatal y 03 durante el periodo posnatal. Fue constatado que la violencia aparece
Primers As Socializing Agents in American and Finnish Schools.
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Directory of Open Access Journals (Sweden)
Rodrigo Leandro Braga de Castro Coitinho
2006-01-01
Full Text Available Oils of andiroba (Carapa guianensis Aubl., copaiba (Copaifera sp., Eucaliptus globulus Labill. and Eucaliptus citriodora Hook., neem (Azadirachta indica A. Juss, eugenol, souari nut (Caryocar brasiliense Camb., rosemary (Lippia gracillis HBK., and cedar (Cedrela fissilis Vell. were evaluated in adults of Sitophilus zeamais Mots. (Coleoptera: Curculionidae. In the non-choice test, 20 g of corn grains per plot were treated with 50¿L of each oil and homogenized for two minutes. The plot was infested with eight 0 to 15 days-old S. zeamais adults. The E. globulus, eugenol, rosemary, and neem oils caused 100% mortality in S. zeamais adults. Except for copaiba, all oils caused mortality above 87% and the reduction in emergence of 100%. In the free-choice tests, arenas consisting of two plastic containers symmetrically interconnected to a central box by two plastic tubes were used. Twenty grams of non-treated corn (control were placed in one of the boxes and the same amount of grain treated with 50¿L of each oil comprised the other treatment. Sixteen non-sexed S. zeamais adults (0-15 days old were released in the central box. The rosemary, E. citriodora, eugenol and copaiba oils were the most repellent for S. zeamais adults, with repellence percentage varying from 97.3 to 87.7. Rosemary, andiroba, neem, and cedar reduced S. zeamais emergence in 100%, while the reduction caused by the other oils ranged from 72.7 to 97.9%.
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
D. S. Lucas
2004-10-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.