WorldWideScience

Sample records for cuprina wiedemann diptera

  1. A metagenomic assessment of the bacteria associated with Lucilia sericata and Lucilia cuprina (Diptera: Calliphoridae).

    Science.gov (United States)

    Singh, Baneshwar; Crippen, Tawni L; Zheng, Longyu; Fields, Andrew T; Yu, Ziniu; Ma, Qun; Wood, Thomas K; Dowd, Scot E; Flores, Micah; Tomberlin, Jeffery K; Tarone, Aaron M

    2015-01-01

    Lucilia Robineau-Desvoidy (Diptera: Calliphoridae) is a blow fly genus of forensic, medical, veterinary, and agricultural importance. This genus is also famous because of its beneficial uses in maggot debridement therapy (MDT). Although the genus is of considerable economic importance, our knowledge about microbes associated with these flies and how these bacteria are horizontally and trans-generationally transmitted is limited. In this study, we characterized bacteria associated with different life stages of Lucilia sericata (Meigen) and Lucilia cuprina (Wiedemann) and in the salivary gland of L. sericata by using 16S rDNA 454 pyrosequencing. Bacteria associated with the salivary gland of L. sericata were also characterized using light and transmission electron microscopy (TEM). Results from this study suggest that the majority of bacteria associated with these flies belong to phyla Proteobacteria, Firmicutes, and Bacteroidetes, and most bacteria are maintained intragenerationally, with a considerable degree of turnover from generation to generation. In both species, second-generation eggs exhibited the highest bacterial phylum diversity (20 % genetic distance) than other life stages. The Lucilia sister species shared the majority of their classified genera. Of the shared bacterial genera, Providencia, Ignatzschineria, Lactobacillus, Lactococcus, Vagococcus, Morganella, and Myroides were present at relatively high abundances. Lactobacillus, Proteus, Diaphorobacter, and Morganella were the dominant bacterial genera associated with a survey of the salivary gland of L. sericata. TEM analysis showed a sparse distribution of both Gram-positive and Gram-negative bacteria in the salivary gland of L. sericata. There was more evidence for horizontal transmission of bacteria than there was for trans-generational inheritance. Several pathogenic genera were either amplified or reduced by the larval feeding on decomposing liver as a resource. Overall, this study provides

  2. Curva de sobrevivência e estimativa de entropia em Lucilia cuprina (Diptera, Calliphoridae Survivorship curve and estimate of entropy in Lucilia cuprina (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Francely M. Fernandes

    2003-09-01

    Full Text Available Lucilia cuprina (Wiedemann, 1830 is a cosmopolite blowfly species of medical and veterinary importance because it produces myiasis, mainly in ovine. In order to evaluate the demographic characteristics of this species, survivorship curves for 327 adult males and 323 adult females, from generation F1 maintained under experimental conditions, were obtained. Entropy was utilized as the estimator of the survival pattern to quantify the mortality distribution of individuals as a function of age. The entropy values 0.216 (males and 0.303 (females were obtained. These results denote that, considering the survivorship interval until the death of the last individual for each sex, the males present a tendency of mortality in more advanced age intervals, in comparison with the females.

  3. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo

    2012-12-01

    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

  4. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  5. Differentiation between Lucilia cuprina and Hemipyrellia ligurriens (Diptera: Calliphoridae) larvae for use in forensic entomology applications.

    Science.gov (United States)

    Sukontason, Kom; Sribanditmongkol, Pongruk; Ngoen-klan, Ratchadawan; Klong-klaew, Tunwadee; Moophayak, Kittikhun; Sukontason, Kabkaew L

    2010-02-01

    Lucilia cuprina and Hemipyrellia ligurriens are forensically important blow flies in many countries. The immature stage, in particular the third instar, of both species are generally similar in morphological appearance. In this study, the use of three main characteristics, the posterior spiracle, the dorsal spines between the first and second thoracic segments, and the cephalopharyngeal skeleton, allows for identification of both fly species, with the number of papillae on anterior spiracle being a supportive characteristic in some cases. Comparison of these characteristics is illustrated in detail.

  6. Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae preying on Microtheca spp. (Coleoptera: Chrysomelidae larvae

    Directory of Open Access Journals (Sweden)

    VS Sturza

    Full Text Available Microtheca spp. (Coleoptera: Chrysomelidae are insect pests primarily related to Brassicaceae crops. In the State of Rio Grande do Sul (RS, southern Brazil, they are found on forage turnip, Raphanus sativus L. var. oleiferus Metzg., which is commonly grown during fall/winter seasons. This work reports the predation of Microtheca spp. larvae by Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae larvae, on forage turnip crop, in Santa Maria, RS. This register provides new information about Microtheca spp. natural enemies in Brazil, which might be a new option for integrate pest management of these species.

  7. A new record of Fannia pusio (Wiedemann) (Diptera:Fanniidae) from Malaysia.

    Science.gov (United States)

    Omar, B; Kurahashi, H; Jeffery, J; Yasohdha, N; Lau, S Y; John, M C; Marwi, M A; Zuha, R M; Ahmad, M S

    2007-12-01

    Fannia pusio (Wiedemann) (Diptera: Fanniidae) is newly recorded from Malaysia. This record is based on 1male symbol 1female symbol from Sarawak, east Malaysia and 1male symbol 2female symbol from Selangor, peninsular Malaysia. It is included in the pusio group of Fannia wherein are included Fannia femoralis (Stein), Fannia howardi Malloch, Fannia trimaculata (Stein), Fannia leucosticta (Meigen) and Fannia punctiventris Malloch. The male of Fannia pusio is differentiated from other members of the group by the following features: hind femur with a swelling bearing a number of setae that are usually curled at tip; squamae creamy; tergite 1+2 broadly grey dusted at sides.

  8. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  9. Parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae coletados em pupários no substrato rim bovino Parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae collected in pupae in the bovine kidney

    Directory of Open Access Journals (Sweden)

    Jean Patrick Bonani

    2006-04-01

    Full Text Available Objetivou-se com este estudo, identificar as principais espécies de parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae, em Lavras, Minas Gerais, Brasil, cujas larvas foram alimentadas com rim bovino. As coletas foram realizadas durante o período de agosto de 2003 a março de 2004. Um total de 921 parasitóides foram coletados em 942 pupas dessa mosca. A prevalência natural de parasitismo foi de 97%.The study aimed at identifying the main parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae. The larvae were feed on bovine kidney. Samplings were conducted from August 2003 to March 2004, in Lavras, Minas Gerais State, Brazil. A total of 921 parasitoids in 942 pupae fly were collected. The prevalence natural parasitism was 97%.

  10. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae em pupas de fannia pusio (Wiedemann, 1830 (Diptera: fanniidae no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2008-10-01

    Full Text Available Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae em pupas de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae is reported. Pupae of F. pusio were collected in traps using human feces to attract the adults. Ten pupae were obtained, of which two were parasitized by S. nigroaenea, thus demonstrating a parasitism rate of 20.0%.

  11. Eurytoma sp. (Hymenoptera: Pteromalidae como parasitóide de Fannia pusio (Wiedemann (Diptera: Fanniidae no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae as a parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori

    2007-08-01

    Full Text Available This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae as parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  12. Eurytoma sp. (Hymenoptera: Pteromalidae) como parasitóide de Fannia pusio (Wiedemann) (Diptera: Fanniidae) no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae) as a parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    C.H. Marchiori

    2007-01-01

    This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae) as parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  13. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae) em pupas de fannia pusio (Wiedemann, 1830) (Diptera: fanniidae) no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) in pupae of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    Carlos Henrique Marchiori; Vanessa Alves Alvarenga

    2008-01-01

    Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) em pupas de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae), no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Cur...

  14. Parasitóides de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) collected in Caldas Novas, Goiás, Brasil

    OpenAIRE

    Carlos Henrique Marchiori; Otacílio Moreira Silva Filho; Francilene Cardoso Alves Fortes; Rélia Rodrigues Brunes; Rauer Ferreira Borges; Patricia Luzia Pereira Gonçalves; Juliana Fischer Laurindo

    2005-01-01

    Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae)em Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoi...

  15. Dispersão larval radial pós-alimentar em Lucilia cuprina (Diptera, Calliphoridae: profundidade, peso e distância de enterramento para pupação Postfeeding radial larval dispersion in Lucilia cuprina (Diptera, Calliphoridae: depth, weight and distance of burying for pupation

    Directory of Open Access Journals (Sweden)

    Leonardo Gomes

    2004-06-01

    Full Text Available Blowflies utilize discrete and ephemeral sites for breeding and larval nutrition. After the exhaustion of food, the larvae begin dispersing to search for sites to pupate or for additional food source, process referred as postfeeding larval dispersal. Some aspects of this process were investigated in Lucilia cuprina (Wiedemann, 1830, utilizing a circular arena to permit the radial dispersion of larvae from the food source in the center. To determine the localization of each pupa, the arena was split into 72 equal sectors from the center. For each pupa, distance from the center of arena, weight and depth were determined. Statistical tests were performed to verify the relation among weight, depth and distance of burying for pupation. It was verified that the larvae that disperse farthest are those with lowest weights. The majority of individuals reached the depth of burying for pupation between 7 and 18 cm. The study of this process of dispersion can be utilized in the estimation of postmortem interval (PMI for human corpses in medico-criminal investigations.

  16. Parasitóides de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae collected in Caldas Novas, Goiás, Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2005-12-01

    Full Text Available Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidaeem Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae Paraganaspis egeria Díaz, Gallardo & Walsh., 1996 (Hymenoptera: Figitidae e Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae foram de 4,3, 1,5 0,9 e 0,6%, respectivamente. A porcentagem total de parasitismo observada foi de 7,4%. Relata-se a primeira ocorrência de S. nigra em pupas de F. pusio no Brasil.The aim of this study was to report the insect species parasitizing Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, in Caldas Novas, State of Goiás, between August 2003 and May 2004. Flies were attracted to baits consisting of human feces, bovine liver and fish, with the pupae being isolated by the flotation method, in water, and individually placed in gelatin capsules until the emergence of the flies and/or their parasitoids. The parasitism percentages presented by Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae, Paraganaspis egeria Díaz, Gallardo & Walsh, 1996 (Hymenoptera: Figitidae and Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae were 4.3, 1.5, 0.9 and 0.6%, respectively. The total percentage of parasitism was 7.4%. This study reports the first occurrence of S. nigra in pupae of F. pusio in Brazil.

  17. Brachymeria podagrica (Fabricius (Hymenoptera: Chalcididae as a parasitoid of Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae: first report in Brazil

    Directory of Open Access Journals (Sweden)

    Marchiori C.H.

    2002-01-01

    Full Text Available Este trabalho relata a primeira ocorrência do parasitóide Brachymeria podagrica (Fabricius, 1787 parasitando estádios imaturos de Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae no Brasil. Utilizaram-se armadilhas contendo como isca vísceras de galinha. As pupas foram obtidas pelo método de flutuação. Elas foram colocadas individualmente em cápsulas de gelatina e mantidas até a emergência das moscas e/ou dos parasitóides. Foram obtidas 29 pupas de C. albiceps, quatro das quais emergiram parasitóides. A prevalência de parasitismo foi de 13,7%.

  18. First record of Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) in citrus in Brazil.

    Science.gov (United States)

    Lemos, W P; da Silva, R A; Araújo, S C A; Oliveira, E L A; da Silva, W R

    2011-01-01

    Anastrepha serpentina (Wiedemann) is recorded for the first time in citrus (Rutaceae) in Brazil. Specimens were obtained from sweet orange (Citrus sinensis) sampled in the municipalities of Belém and Capitão Poço, and from mandarin orange (Citrus reticulata) from Tomé-Açu, state of Pará, Brazil.

  19. Australian species of Ommatius Wiedemann (Diptera: Asilidae) with an anepimeral bristle.

    Science.gov (United States)

    Daniels, Greg

    2017-02-13

    The presence of an anepimeral bristle in Australian Ommatius Wiedemann species is newly recorded and descriptions of seven new species possessing this character are presented: O. aquilonaris sp. nov., O. burwelli sp. nov., O. imaginis sp. nov., O. limbatus sp. nov., O. melasmus sp. nov., O. musselbrookensis sp. nov. and O. radamnis sp. nov. All species occur in Queensland but O. melasmus sp. nov. also occurs in New South Wales and O. musselbrookensis sp. nov. also occurs in the Northern Territory. A key to separate the species is presented.

  20. A new record for Lispe orientalis Wiedemann, 1824 (Diptera: Muscidae) from peninsular Malaysia.

    Science.gov (United States)

    Chew, W K; Kurahashi, H; Nazni, W A; Heo, C C; Heah, S K; Jeffery, J; Lee, H L

    2012-09-01

    Lispe orientalis Wiedemann, 1824 is recorded for the first time in peninsular Malaysia. Specimens were collected from a mushroom cultivation farm in Genting Highlands, Pahang (3°25'18"N 101°47'48"E). Previously, this species had been recorded from Azerbaijin, India, Russia, Tajikistan, Thailand, Turkey and South Korea. The male of Lispe orientalis can be determined by the following characteristics: body non-metallic, ashy gray, third antennal segment black, R5 cell not narrow apically, hind metatarsus normal, legs entirely black, femora with long bristle-like hairs on av and pv surfaces, hind tibia without av and pv seta and the palpi orangish in colour.

  1. Desenvolvimento Pós-embrionário de Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae em Diferentes Dietas, sob Condições de Laboratório

    Directory of Open Access Journals (Sweden)

    José Mario d'Almeida

    1999-01-01

    Full Text Available Post-embryonic Development of Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae, in Different Diets, under Laboratory Conditions - The performance of various diets (bovine meat, fish- sardine, shrimp, dog faeces, and banana in Ophyra aenescens development was evaluated. The biology was studied in an incubator (BOD at 27±1oC and 80±10% of RH. The developmental time from larvae to adult, the developmental time and viability of larvae and pupae, the weight of pupae as well as the sex ratio of the emerging adults were also determined. Beef and shrimp were the more efficient diets for rearing O. aenescens.

  2. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  3. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  4. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  5. Estudios de infectividad de la especie anopheles albimanus wiedemann, 1820 (Diptera: culicidae

    Directory of Open Access Journals (Sweden)

    Víctor Alberto Olano

    1985-06-01

    Full Text Available Con el propósito de evaluar la infectividad del mosquito Anopheles albimanus Wiedemann, 1820, cepa Cartagena, se realizaron infecciones a partir de pacientes naturalmente infectados con Plasmodium falciparum y Plasmodium vivax y de primates del genero Aotus experimentalmente infectados con ambas especies de Plasmodium. 67 intentos de infección de Anopheles albimanus se realizaron e partir de pacientes con P. falciparum y 36 a partir de pacientes con P. vivax. Se examinaron 654 glándulas salivares en hembras An. albimanus infectadas con P. falciparum de las cuales el 11.9% presentaron esporozoitos, mientras que el 31.2% de 93 glándulas salivares examinadas desarrollaron esporozoitos de P. vivax. Un total de 4 intentos de infección de Anopheles albimanus se realizaron a partir de un Aotus infectado con P. falciparum en los cuales los mosquitos no desarrollaron esporozoitos. A partir de 14 Aotus infectados con P. vivax se realizaron 75 intentos de infección de Anopheles albimanus; solo el 5.2% de un total de 810 glándulas salivares examinadas produjeron esporozoitos. Los resultados obtenidos sugieren que esta cepa Anopheles albimanus tiene una baja infectividad en condiciones experimentales.

  6. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  7. Taxonomic revision and cladistic analysis of the Neotropical genus Acrochaeta Wiedemann, 1830 (Diptera: Stratiomyidae: Sarginae).

    Science.gov (United States)

    Fachin, Diego Aguilar; Amorim, Dalton De Souza

    2015-11-30

    The Neotropical genus Acrochaeta Wiedemann is revised and a cladistics analysis of the genus based on morphological characters is presented. This paper raises the total number of extant Acrochaeta species from 10 to 14 with the description of nine new species, the synonymy of one species, the transfer of five species to other genera and the transfer of one species of Merosargus to Acrochaeta. The new species described (of which eight are from Brazil and one from Bolivia and Peru) are Acrochaeta asapha nov. sp., A. balbii nov. sp., A. dichrostyla nov. sp., A. polychaeta nov. sp., A. pseudofasciata nov. sp., A. pseudopolychaeta nov. sp., A. rhombostyla nov. sp. A. ruschii nov. sp. and A. stigmata nov. sp. The primary types of all Acrochaeta species were studied at least from photos, when possible with the study of dissected male or female terminalia. A. mexicana Lindner is proposed as a junior synonym of A. flaveola Bigot. M. chalconota (Brauer) comb. nov., M. degenerata (Lindner) comb. nov., M. longiventris (Enderlein) comb. nov. and M. picta (Brauer) comb. nov. are herein transferred from Acrochaeta to Merosargus Loew, and Chrysochlorina elegans (Perty) comb. nov. is transferred from Acrochaeta to Chrysochlorina James. A. convexifrons (McFadden) comb. nov. is transferred from Merosargus to Acrochaeta. The limits of the genus and its insertion in the Sarginae are considered, and an updated generic diagnosis is provided. All species of the genus are redescribed and diagnosed, and illustrated with photos of the habitus, thorax, wing, and drawings of the antenna and male and female terminalia. Distribution maps are provided for the species, along with an identification key for adults of all species. Parsimony analyses were carried out under equal and implied weight. Our matrix includes 43 terminal taxa--of which 26 are outgroup species from four different sargine genera--and 59 adult morphological characters. The phylogenetic analysis supports the monophyly of

  8. O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o País e novos registros para o grupo holosericeus (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2011-12-01

    Full Text Available O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o país e novos registros para o grupo holosericeus (Diptera, Asilidae. Neste trabalho é descrita uma nova espécie de Ommatius Wiedemann, 1821 para o estado do Amazonas, pertencente ao grupo ampliatus. Além disso, são fornecidos novos registros, variações taxonômicas, ilustrações e descrição das estruturas das terminálias masculina e feminina para as espécies do grupo holosericeus.

  9. Effect of preservative solutions on preservation of Calliphora augur and Lucilia cuprina larvae (Diptera: Calliphoridae) with implications for post-mortem interval estimates.

    Science.gov (United States)

    Day, Donnah M; Wallman, James F

    2008-07-18

    A major role of forensic entomology is to estimate the post-mortem interval. An entomologist's estimate of post-mortem interval is based on a series of generally valid assumptions, error in any of which can alter the accuracy of an estimate. The initial process of collecting and preserving maggots can itself lead to error, as can the method of killing and preservation. Since circumstances exist where it is not possible to rear maggots, methods of killing and preservation can be vital to preserving the integrity of entomological evidence. In this study, a number of preservation techniques used at crime scenes and in mortuaries were examined, and their effect on feeding third-instar larvae of Calliphora augur and Lucilia cuprina evaluated. The preservatives used were 70, 75, 80, 90 and 100% EtOH, Kahle's solution and 10% formalin. Each treatment was replicated three times. The effect of handling on first- and second-instar, feeding and post-feeding third-instar larvae of C. augur was also examined and compared to unhandled controls. Finally, the effects of preservatives were noted when larvae of C. augur and L. cuprina were placed into preservatives alive. It was found that continued handling is detrimental to specimens because preservative evaporates from both the vial and the specimens. No single preservative type was found to be entirely suitable for both species if DNA retrieval is desired. Specimens placed into most preservatives alive exhibited adverse colour changes, desiccation, sunkeness and agglomeration. It is concluded that the reaction to preservative type might be species specific and that different instars of the same species might also react differently.

  10. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Cecília Kosmann

    2011-12-01

    Full Text Available ABSTRACT. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil. The corpse of a man was found in a Brazilian highland savanna (cerrado in the state of Minas Gerais. Fly larvae were collected at the crime scene and arrived at the laboratory three days afterwards. From the eight pre-pupae, seven adults of Chrysomya albiceps (Wiedemann, 1819 emerged and, from the two larvae, two adults of Hemilucilia segmentaria (Fabricius, 1805 were obtained. As necrophagous insects use corpses as a feeding resource, their development rate can be used as a tool to estimate the postmortem interval. The post-embryonary development stage of the immature collected on the body was estimated as the difference between the total development time and the time required for them to become adults in the lab. The estimated age of the maggots from both species and the minimum postmortem interval were four days. This is the first time that H. segmentaria is used to estimate the postmortem interval in a forensic case.

  11. Scanning electron microscopic studies on antenna of Hemipyrellia ligurriens (Wiedemann, 1830) (Diptera: Calliphoridae)-A blow fly species of forensic importance.

    Science.gov (United States)

    Hore, Garima; Maity, Aniruddha; Naskar, Atanu; Ansar, Waliza; Ghosh, Shyamasree; Saha, Goutam Kumar; Banerjee, Dhriti

    2017-08-01

    Blow flies (Diptera: Calliphoridae) are one of the foremost organisms amongst forensic insects to colonize corpses shortly after death, thus are of immense importance in the domain of forensic entomology. The blow fly Hemipyrellia ligurriens (Wiedemann, 1830) (Diptera: Calliphoridae) is considered as a forensically important fly species globally and is also known for its medical and veterinary importance. In the present study, we report for the first time scanning electron microscopic studies on the morphology of sensilla of antenna of adult male and female of H. ligurriens is with profound importance in better understanding of the insect morphology from forensic entomological perspective, and also could aid in proper identification of the species from other calliphorid flies. The structural peculiarities observed in the (i) antenna of H. ligurriens with three segments- scape, pedicel and flagellum with dorso-laterally placed arista (ii) densely covered microtrichia and most abundant trichoid sensilla identified on the antenna (iii) observation of only one type of sensilla, chaetic sensilla (ChI) on the scape (iv) two types of chaetic sensilla (ChI and ChII) and styloconic sensilla on the pedicel (v) the flagellum with three types of sensilla- trichoid, basiconic and coeloconic sensilla (vi) Basiconic sensilla with multiporous surfaces with characteristic olfactory function. Moderate sexual dimorphism in the width of the flagellum, the females with wider flagella than the males, bear significance to the fact that they bear more multi-porous sensilla than the males, thus suffice their need to detect oviposition sites. Significant difference was observed in the length and width of coeloconic sensilla between the two sexes, the females showed bigger coeloconic sensilla, suggesting their function in oviposition site detection and successful colonization in corpses. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Revision of the genus Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. The pictipennis species-group Revisão do gênero Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. O grupo de espécies pictipennis

    Directory of Open Access Journals (Sweden)

    José Albertino Rafael

    2010-09-01

    Full Text Available All species of Macrostomus Wiedemann allied with Macrostomus pictipennis (Bezzi, are treated in the pictipennis species-group. Three currently recognized species and four new species are included, namely M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. from Brazil (Amazonas and Pará states, M. pacaraima, sp. nov. from Brazil (Roraima, Amazonas and Pará states, M. pictipennis (Bezzi, M. smithi, sp. nov. from Guyana and Brazil (Roraima State and M. utinga, sp. nov. from Brazil (Pará State. All primary types were examined and a key to species is presented.As espécies de Macrostomus Wiedemann afins de Macrostomus pictipennis (Bezzi estão sendo tratadas no grupo M. pictipennis, o qual inclui três espécies já descritas e quarto espécies novas, a saber: M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. do Brasil (Amazonas e Pará, M. pictipennis (Bezzi, M. smithi, sp. nov. da Guiana e Brasil (Roraima, M. utinga, sp. nov. do Brasil (Pará e M. pacaraima, sp. nov. do Brasil (Roraima, Amazonas e Pará. Todos os tipos primários foram examinados e uma chave para espécie é apresentada.

  13. Physiological mechanisms of dehydration tolerance contribute to the invasion potential of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) relative to its less widely distributed congeners.

    Science.gov (United States)

    Weldon, Christopher W; Boardman, Leigh; Marlin, Danica; Terblanche, John S

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is a highly invasive species now with an almost cosmopolitan distribution. Two other damaging, polyphagous and closely-related species, the marula fruit fly, Ceratitis cosyra (Walker), and the Natal fly, Ceratitis rosa Karsch, are not established outside of sub-Saharan Africa. In this study, adult water balance traits and nutritional body composition were measured in all three species at different temperatures and levels of relative humidity to determine whether tolerance of water stress may partially explain their distribution. Adult C. capitata exhibited higher desiccation resistance than C. rosa but not C. cosyra. Desiccation resistance of C. capitata was associated with lower rates of water loss under hot and dry conditions, higher dehydration tolerance, and higher lipid reserves that were catabolised during water stress. In comparison with C. capitata, C. cosyra and C. rosa lost water at significantly higher rates under hot, dry conditions, and did not catabolise lipids or other sources of metabolic water during water stress. These results suggest that adult physiological traits permitting higher tolerance of water stress play a role in the success of C. capitata, particularly relative to C. rosa. The distribution of C. cosyra is likely determined by the interaction of temperature with water stress, as well as the availability of suitable hosts for larval development.

  14. Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) as a natural enemy to Peckia chrysostoma (Wiedemann) (Diptera: Sarcophagidae), in Brazil.

    Science.gov (United States)

    Marchiori, C H; Pereira, L A; Filho, O M

    2003-02-01

    This paper reports the first occurence of the parasite Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) which was collected from Peckia chrysostoma pupae (Diptera: Sarcophagidae) by means of traps containing some fish baits in a wood area close to the Agronomy college (Faculdade of Agronomia) in Itumbiara, Goiás, in the period from March to September, 2001. A total of 362 gregarious specimens of parasitoids from 26 pupae of P. chrysostoma. Aphaereta sp. was collected, with several individuals emerging from the same pupae.

  15. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  16. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  17. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  18. Análise de sobrevivência e estimativa de entropia para Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae Survival analysis and estimation of entropy of Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Maurício O. Moura

    1999-01-01

    Full Text Available The life expectancy of Sarconesia chlorogaster (Wiedemann, 1830 reared in artificial diet and controlled temperatures chamber set at 27±1oC, 70±10% RH and 12 hours of photophase was analysed using entropy (H. Entropy (H was used to quantify the distribuition of deaths between ages and then quantify the impact of mortality on life expectancy. The entropy values obtained for males (H=0,245 and females (H=0,299 were intermediary between the theoretical values of H=0,5 and H=0 suggesting a tendency toward rectangular distribuitions in both sexes. The effect of mortality across ali ages on expectation of life was different at each age. For males the highest values were found between days 10 and 20 and between days 15 and 25 for females. This íindings imply that small changes in female mortality will have a greater impact on female life expectancy than will have on male expectation of life.

  19. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  20. Sobrevivência de pupas de Lucilia eximia (Wiedemann (Diptera, Calliphoridae após submersão em laboratório Survival of Lucilia eximia (Wiedemann (Diptera, Calliphoridae pupae after submersion in laboratory

    Directory of Open Access Journals (Sweden)

    Alex Sandro Barros de Souza

    2009-01-01

    Full Text Available Entre Maio e Junho de 2008 foi observado a sobrevivência das pupas de Lucilia eximia (Diptera, Calliphoridae após submersão em laboratório. Para este experimento foram utilizadas 480 pupas de mesma idade, sendo estas divididas em oito grupos: o controle não foi submerso e os demais grupos foram submersos de um a sete dias. O aumento do período de submersão diminui a sobrevivência, com um dia de submersão a sobrevivência é de 80%, com dois dias 40%, é de 30% a partir do terceiro dia, no quarto dia cai para 23,34% e no quinto dia fica em 10%. Após este período a mortalidade sobe para 100%. Este padrão pode ser explicado pela curva "U-shaped" que ocorre no consumo de O2 durante o período pupal, onde o consumo é maior no início e no final do período pupal. O tempo de submersão também afeta o tempo de desenvolvimento, aumentando o período pupal. Estes dados têm o potencial para serem utilizados em investigações envolvendo Entomologia Forense, para a estimativa do tempo de submersão de um cadáver.Between May and June of 2008, the survival of the pupae of Lucilia eximia (Diptera, Calliphoridae was observed after submersion in laboratory. For this experiment 480 pupae of same age were used, these were divided in eight groups: the group control was not submerged and the other groups were submerged from one to seven days. The increase of the submersion period reduces the survival, with one day of submersion the survival is of 80%, with two days 40%, of 30% with three days, in the fourth day it falls to 23,34% and in the fifth day it is 10%. After this period the mortality rises to 100%. This pattern can be explained by the curve "U-shaped" that happens in the consumption of O2 during the pupal period, where the consumption is larger at the beginning and at the end of the pupal period. The time of submersion also affects the development time, increasing the pupal period. These data are potentially useful in estimating duration of

  1. Biology and Thermal Requirements of Fopius arisanus (Sonan, 1932) (Hymenoptera: Braconidae) Reared on Ceratitis capitata Eggs (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Groth, M Z; Loeck, A E; Nornberg, S D; Bernardi, D; Nava, D E

    2017-05-04

    Fopius arisanus (Sonan) is a solitary parasitoid of eggs and the first instar larvae of Tephritidae. Due to the occurrence of Ceratitis capitata (Wiedemann) in various regions and under several climatic conditions, this study aimed to evaluate the effect of different temperatures on the embryonic development (egg-adult) and determine thermal requirements and the number of annual generations F. arisanus on eggs of C. capitata. In the laboratory, eggs of C. capitata (24 h) were submitted to parasitism of F. arisanus during 6 h. Later, the eggs were placed in plastic containers (50 mL) (50 eggs/container) on a layer of artificial diet and packed in chambers at temperatures 15, 18, 20, 22, 25, 28, 30, and 32 ± 1°C, RH 70 ± 10%, and a photophase of 12 h. The largest number of offspring, emergence rate, and weight of adults of F. arisanus were observed at 25°C. The highest sex ratios (sr > 0.75) were recorded at 15 and 18°C, being statistically higher than the temperatures 20°C (0.65), 22°C (0.64), 25°C (0.65), 28°C (0.49), and 30°C (0.47). At 32°C, there was no embryonic development of F. arisanus. The egg-adult period was inversely proportional to temperature. Based on the development of the biological cycle (egg-adult), the temperature threshold (T t) was 10.3°C and thermal constant (K) of 488.34 degree-days, being the number of generations/year directly proportional to the temperature increase. The data show the ability of F. arisanus to adapt to different thermal conditions, which is important for biological control programs of C. capitata.

  2. Study of some biological aspects of the blowfly Chrysomya albiceps (Wiedemann 1819 (Diptera: Calliphoridae in Jeddah, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Layla A.H. Al-Shareef

    2016-03-01

    Full Text Available We reared Chrysomya albiceps (Wiedemann 1819 unadult stages (first larval instar, second larval instar, third larval instar and pupal stage under four constant temperatures. Results proved that increasing temperature from 20 to 25, 30 and 35 °C reduced total larval stage duration (9–6, 4.83 and 4.75 days, respectively and pupal duration (7, 5.5, 4 and 1.5 days, respectively. C. albiceps larvae at first instar reached adult stage in the longest time at 20 °C (16 days, and in the shortest time at 35 °C (6.25 days. The accumulation degree-day (ADD at 20, 25, 30, 35 °C for first larval instar were 8.86, 13.86, 18.86, 23.86 DD, for second larval instar were 10.5, 12, 17, 22 DD and for third larval instar were 35.88, 42.08, 43.97, 56.43 DD. Heat requirements for larval stage at different temperatures; 20, 25, 30 and 35 °C (49.68, 63.12, 75.01 and 97.47 DD were more than the pupal requirements at the same temperatures (39.78, 58.76, 62.73 and 31.02 DD. Total heat requirements for C. albiceps to develop from the first larval instar to adult eclosion were the lowest at 20 °C (89.46 DD and the highest at 30 °C (129.138 DD. Decreasing of temperature increased larval body length at the same age. The development curves for C. albiceps were established at four constant temperatures using larval length and the time since egg hatching.

  3. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  4. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  5. Diversity and synanthropy of Calliphoridae (Diptera) in the region of Rio Claro, SP, Brazil.

    Science.gov (United States)

    De Souza, C R; Zuben, C J V

    2012-06-01

    Dipteran blowflies (Calliphoridae) are of great medical and hygienic importance as vectors of pathogens and as parasites of living and dead tissue, and their association with carrion allows their use in forensic entomology. The objective of this study was to determine the synanthropic index of adult Calliphoridae (Diptera) collected in Rio Claro, São Paulo. Sampling occurred between September 2009 and August 2010. Traps baited with sardines, beef liver, and minced meat were assessed for five consecutive days per month in three distinct ecological areas representing urban, rural, and forest environments. The most abundant species was Lucilia eximia (Wiedemann), followed by Chrysomya albiceps (Wiedemann) and Chrysomya megacephala (Fabricius). Lucilia eximia was the only species present in all seasons and the only species collected during the winter. The season with the lowest abundance was winter, with 69 (5.5%) specimens, and spring was the season with the greatest number of specimens collected (774-61.8%). The only species found outside inhabited areas (synanthropic) was Lucilia cuprina (Wiedemann), with a synanthropy index (SI) value of +5.7. The SI values for the other species were negative, showing a preference for uninhabited areas. The rural and urban areas were most similar in terms of species composition as were the beef and sardine baits. Among the baits used, liver attracted the greatest abundance of calliphorids, whereas minced meat attracted the greatest diversity.

  6. ENTEROBACTERIA ISOLATED FROM SYNANTHROPIC FLIES (DIPTERA, CALYPTRATAE IN MEDELLÍN, COLOMBIA

    Directory of Open Access Journals (Sweden)

    ISABEL CRISTINA CADAVID-SANCHEZ

    2015-01-01

    Full Text Available Enterobacteria (Enterobacteriaceae causing enteric diseases can be carried and dispersed through insects that act as mechanical vectors, especially flies (Insecta: Diptera. In this study, enterobacteria associated with synanthropic flies were isolated and identified; four different urban areas in the municipality of Medellín were surveyed. Thirteen taxa of calyptrate flies belonging to four families were identified and classified according to the Mechanical Vector Risk Index (MVRI value, which is proposed in this study. Chrysomya megacephala (Fabricius, 1794, Lucilia cuprina (Wiedemann, 1819, Chrysomya albiceps (Wiedemann, 1819, and Musca domestica Linnaeus, 1758 are of high risk; Fannia sp., Atherigona orientalis Schiner, 1868, and Ophyra aenescens (Wiedemann, 1830 of moderate risk; remaining species were classified as low or no risk. Escherichia coli was the most frequent bacterium according to the number of isolations (32%, followed by Klebsiella oxytoca (12%, Pasteurella pneumotropica (11%, and Kluyvera spp. (8%. Raoultella ornithinolitica, Stenotrophomponas maltophilia, and Chryseobacterium menigosepticum were isolated for the first time from flies. Finally, 22 new records of bacteria associated with eight fly species are documented. These results allow us to foresee the existence of a generalist pattern in the interaction between flies and bacteria and indicate that synanthropic flies have a quantifiable potential as vectors of infectious diseases according to the index proposed.

  7. Uma nova espécie de Strebla Wiedemann, 1824 (Diptera, Streblidae, Streblinae sobre Anoura caudifer (E. Geoffroy, 1818 (Chiroptera, Phyllostomidae, Glossophaginae

    Directory of Open Access Journals (Sweden)

    Graciolli Gustavo

    2003-01-01

    Full Text Available A new species of Strebla Wiedemann, S. carvalhoi sp. nov., collected, on Anoura caudifer (E. Geoffroy, 1818 from Southern of Brazil, is described. Drawings of the postvertex, occipital plates, gonopods and tergite VII are provided.

  8. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  9. Organisation and expression of a cluster of yolk protein genes in the Australian sheep blowfly, Lucilia cuprina.

    Science.gov (United States)

    Scott, Maxwell J; Atapattu, Asela; Schiemann, Anja H; Concha, Carolina; Henry, Rebecca; Carey, Brandi-lee; Belikoff, Esther J; Heinrich, Jörg C; Sarkar, Abhimanyu

    2011-01-01

    The Australian sheep blowfly Lucilia cuprina is a major pest for the Australian and New Zealand sheep industries. With the long-term aim of making a strain of L. cuprina suitable for a genetic control program, we previously developed a tetracycline-repressible female lethal genetic system in Drosophila. A key part of this system is a female-specific promoter from a yolk protein (yp) gene controlling expression of the tetracycline-dependent transactivator (tTA). Here we report the sequence of a 14.2 kb genomic clone from L. cuprina that contains a cluster of three complete yp genes and one partial yp gene. The Lcyp genes are specifically expressed in females that have received a protein meal. A bioinformatic analysis of the promoter of one of the yp genes (LcypA) identified several putative binding sites for DSX, a known regulator of yp gene expression in other Diptera. A transgenic strain of L. cuprina was made that contained the LcypA promoter driving the expression of the Escherichia coli lacZ reporter gene. Transgenic females express high levels of β-galactosidase after a protein meal. Thus the LcypA promoter could be used to obtain female-specific expression of tTA in transgenic L. cuprina.

  10. A blow to the fly - Lucilia cuprina draft genome and transcriptome to support advances in biology and biotechnology.

    Science.gov (United States)

    Anstead, Clare A; Batterham, Philip; Korhonen, Pasi K; Young, Neil D; Hall, Ross S; Bowles, Vernon M; Richards, Stephen; Scott, Maxwell J; Gasser, Robin B

    2016-01-01

    The blow fly, Lucilia cuprina (Wiedemann, 1830) is a parasitic insect of major global economic importance. Maggots of this fly parasitize the skin of animal hosts, feed on excretions and tissues, and cause severe disease (flystrike or myiasis). Although there has been considerable research on L. cuprina over the years, little is understood about the molecular biology, biochemistry and genetics of this parasitic fly, as well as its relationship with its hosts and the disease that it causes. This situation might change with the recent report of the draft genome and transcriptome of this blow fly, which has given new and global insights into its biology, interactions with the host animal and aspects of insecticide resistance at the molecular level. This genomic resource will likely enable many fundamental and applied research areas in the future. The present article gives a background on L. cuprina and myiasis, a brief account of past and current treatment, prevention and control approaches, and provides a perspective on the impact that the L. cuprina genome should have on future research of this and related parasitic flies, and the design of new and improved interventions for myiasis.

  11. Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... Wiedemann syndrome References Jones KL, Jones M, Del Campo M, eds. Smith's Recognizable Patterns of Human Malformation . ... Ogilvie, PhD, and the A.D.A.M. Editorial team. Related MedlinePlus Health Topics Growth Disorders Browse ...

  12. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  13. Associação entre larvas de Chrysomya megacephala (Fabricius e Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius e Cochliomyia macellaria (Fabricius (Calliphoridae, Diptera sob condições de laboratório Association between Chrysomya megacephala (Fabricius and Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius and Cochliomyia macellaria (Fabricius larvae (Calliphoridae, Diptera, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Valéria Magalhães Aguiar-Coelho

    1995-01-01

    Full Text Available This paper intends to recognize some aspects of interspecific relationships between Chrysomya megacephala (Fabricius and C. albiceps (Wiedemann and between C. megacephala and Cochliomyia macellaria (Fabricius larvae in laboratory. A diet consisting of decomposing horse flesh was used, and the relation of 1 larva/g diet was established. The development of the two species was done in pure and associated cultures. The association with Chrysomya albiceps influenced the post-embrionary development period and the weight of mature larvae of the C. megacephala, reducing their. Such weight decrease, along with the predation of larvae of C. megacephala larvae, yelded a decrease in survival in all of the stages. Larvae of this species showed an increase in its weight when associated with Cochliomyia macellaria. The native species responded to the association by reducing its body weigth and its viability. This association doesnt influence the duration of post-embrionary development.

  14. New record of Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae in Brazil, a probably mechanical vector of enteric bacteria Novo registro de Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae no Brasil, um provável vetor mecânico de enterobactérias

    Directory of Open Access Journals (Sweden)

    Anderson Sena Barnabe

    2007-03-01

    Full Text Available Pterotaenia fasciata is commonly recorded in rural areas in Argentina, but during a Diptera survey study developed in a reservoir which retains storm water from polluted canals in an urban area of Taboão da Serra municipality, SP, Brazil, we could capture P. fasciata adults. Enteric bacteria Escherichia coli T. Escherich, 1885 and Proteus sp. were isolated from P. fasciata collected in traps inside the reservoir and around it. Fecal coliforms and E. coli were found in the water of the reservoir. These records suggest that a high abundance of this species at urban areas with inadequate sewage canals should reveal these muscoid dipterans as mechanical vectors of enteric bacteria.Pterotaenia fasciata é encontrada freqüentemente em áreas rurais na Argentina, mas durante um estudo de levantamento de Diptera em um reservatório de retenção de enchentes em uma área urbana do município de Taboão da Serra, SP, Brasil, foram capturados adultos de P. fasciata. As enterobactérias Escherichia coli T. Escherich, 1885 e Proteus sp. foram isoladas de P. fasciata coletada em armadilhas no reservatório e em seu entorno. Coliformes fecais e E. coli foram encontrados na água do reservatório. Esses registros sugerem que a alta abundância dessa espécie em áreas urbanas sem saneamento básico poderia indicar esses dípteros muscóides como vetores mecânicos de enterobactérias.

  15. Wiedemann: color y exilio

    Directory of Open Access Journals (Sweden)

    Juan Gustavo Cobo Borda

    1995-01-01

    Full Text Available El exiliado mantiene viva, en la retina de la memoria, los colores de su inicial contacto con el mundo. Al nacer en Munich en 1905 e interesarse por las artes plásticas, las primeras visiones de Guillermo Wiedemann bien pudieran fijarse en los caballos azules de Franz Marc o en las remotas tierras vírgenes de ese adánico primitivismo con que los expresionistas alemanes de la nueva sensibilidad huían hacia la naturaleza, trátese del bosque verde o las cumbres recubiertas de nieve. La choza africana o lo~ archipiélagos del Pacífico donde los tótems de Gauguin todavía arden, con sensualidad ancestral, en la penumbra salvaje.

  16. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  17. Pheromone Analyses of the Anastrepha fraterculus (Diptera: Tephritidae) Cryptic Species Complex

    National Research Council Canada - National Science Library

    Radka Břízová; Adriana L. Mendonça; Lucie Vanícková; Alana L. Mendonça; Carlos Eduardo Da Silva; Aleš Tomčala; Beatriz Aguiar Jordão Paranhos; Vanessa Simões Dias; Iara Sordi Joachim-Bravo; Michal Hoskovec; Blanka Kalinová; Ruth R. Do Nascimento

    2013-01-01

    ABSTRACT The South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) cryptic species complex is presently one of the most studied pest models in terms of speciation and population mating compatibility...

  18. Determinação de idade cronológica de Calliphoridae (Diptera através da deposição pós-emergencial de quitina

    Directory of Open Access Journals (Sweden)

    Emygdio L. A. Monteiro Filho

    1989-01-01

    Full Text Available A method for chronological age determination based on mesothoracic post-phragma post-emergence deposition of chitin is used for Chrysomya putoria and Phaenicia cuprina (Diptera, Calliphoridae. The age of these species were obtained by the maximum period of deposition which were of 11-12 days.

  19. Beckwith-Wiedemann syndrome: dental management.

    LENUS (Irish Health Repository)

    Garvey, M T

    1997-06-01

    Beckwith-Wiedemann syndrome (BWS) comprises multiple congenital anomalies with a risk of childhood tumours. Macroglossia is the most common manifestation. Two cases are presented to illustrate the importance of early referral and the role of preventive dentistry.

  20. Genetics Home Reference: Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... of origin is marked during the formation of egg and sperm cells. Beckwith-Wiedemann syndrome is often associated with ... random events during the formation of reproductive cells (eggs and sperm) or in the earliest stages of development before ...

  1. Scanning electron microscopy of the male genitalia of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Hugo de Souza Lopes

    1990-03-01

    Full Text Available The male genitalia of nine species of Sarcophagidae (Diptera - Goniophyto honsuensis Rohdendorf, 1962, Tricharaea brevicornis (Wiedemann, 1830, Chaetoravinia derelicta (Walker, 1852, Austrohartigia spinigena (Rondani, 1864, Chrysagria duodecimpunctata Townsend, 1935, Boettcheria bisetosa Parker, 1914, Lipoptilocnema lanei Townsend, 1934, L. crispina (Lopes, 1938 and Euboettcheria alvarengai Lopes & Tibana, 1982 - were examined by scanning electron microscope (SEM and the main morphological features are descirbed.

  2. Insecticidal and repellent effects of tea tree (Melaleuca alternifolia) oil against Lucilia cuprina.

    Science.gov (United States)

    Callander, J T; James, P J

    2012-03-23

    Laboratory studies were conducted to assess the effect of tea tree oil (TTO) from Melaleuca alternifolia (terpinen-4-ol chemotype) against different stages of the Australian sheep blowfly Lucilia cuprina. When applied to wool, 3% TTO formulation repelled gravid female L. cuprina and prevented oviposition for six weeks. Formulations containing 1% TTO caused 100% mortality of L. cuprina eggs and 1st instar larvae and 2.5% TTO caused mortality of most second and third instar larvae in agar feeding assays. In experiments where third instar larvae were dipped in TTO formulations for 60s, concentrations of up to 50% TTO gave less than 50% kill. TTO at concentrations of 0.5%, 2% and 5% was strongly repellent to third instar larvae and caused them to evacuate treated areas. Inclusion of TTO in formulations with diazinon, ivermectin and boric acid reduced mortality in comparison with the larvicides used alone, at least partially because of avoidance behaviour stimulated by the TTO. Addition of TTO to wound treatments may aid in wound protection and myiasis resolution by preventing oviposition by L. cuprina adults, insecticidal action against L. cuprina eggs and larvae, stimulating larvae to leave the wound and through antimicrobial and anti-inflammatory properties that aid in wound healing.

  3. Oogênese em Fannia pusio (Wiedemann, 1830 e Fannia heydenni (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg, which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  4. Oogênese em Fannia pusio (Wiedemann, 1830) e Fannia heydenni (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg), which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  5. Beckwith-Wiedemann syndrome and isolated hemihyperplasia

    Directory of Open Access Journals (Sweden)

    Marcus Vinícius de Matos Gomes

    Full Text Available CONTEXT: Beckwith-Wiedemann syndrome is a complex and heterogeneous overgrowth syndrome with genetic and epigenetic alterations, involving genomic imprinting and cancer predisposition. Isolated hemihyperplasia is of unknown cause, and it may represent a partial or incomplete expression of Beckwith-Wiedemann syndrome. OBJECTIVES: A clinical and molecular review and proposal of the use of an experimental protocol to provide a practical approach for the physician. DATA SYNTHESIS: This review demonstrates the genetic and epigenetic mechanisms involved in the Beckwith-Wiedemann syndrome and isolated hemihyperplasia, and the candidate genes. To our knowledge, this is the first Brazilian protocol for research into these disorders. The results have been used at the Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, to elucidate the basis of Beckwith-Wiedemann syndrome and isolated hemihyperplasia, and have been applied at the Hospital Universitário of the Faculdade de Medicina. CONCLUSIONS: Elucidation of the etiological mechanisms and use of a laboratory protocol to detect alterations in these disorders may be useful for guiding the management of such patients and genetic counseling of the families.

  6. CASE REPORT OF BECKWITH-WIEDEMANN SYNDROME

    Directory of Open Access Journals (Sweden)

    Ravikanth

    2014-06-01

    Full Text Available In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys as well as pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele. [7] or some other umbilical deformity, macroglossia. [8] congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Newborn with macrosomia, macroglossia first differential diagnosis are infant of diabetic mother, congenital hypothyroidism etc. IDM can be identified easily with history of maternal diabetes. So congenital hypothyroidism is next common diagnosis and will be treated as hypothyroidism. If TSH, T3 and T4 are not clearly indicative of congenital hypothyroidism next consider the Beckwith Wiedemann syndrome in differential diagnosis of large for gestational age.

  7. Síndrome de Beckwith Wiedemann

    Directory of Open Access Journals (Sweden)

    Dania Faxas Rodríguez

    2015-12-01

    Full Text Available Se presenta el caso de un paciente, atendido en el Servicio de Pediatría del Hospital General Docente “14 de Junio” del municipio de Jobabo, provincia de Las Tunas. El paciente es portador de un síndrome de Beckwith Wiedemann, enfermedad de posible origen genético autosómico dominante, cuyo diagnóstico se fundamenta en criterios clínicos mayores y menores. Se expusieron los resultados del examen clínico y de las investigaciones complementarias. Se realizó una revisión de la literatura médica sobre el tema.

  8. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  9. Developmental studies on the Sigma and Delta-1 glutathione transferases of Lucilia cuprina.

    Science.gov (United States)

    Pal, Ramavati; Sanil, Nitasha; Clark, Alan

    2012-03-01

    The glutathione transferases (GSTs) are a large group of enzymes having both detoxication roles and specialist metabolic functions. The present work represents an initial approach to identifying some of these roles by examining the variation of specific members of the family under differing conditions. The GSTs from Lucilia cuprina have been partially purified, members of two families being isolated, by the use of glutathione immobilised on epichlorhydrin-activated Sepharose 6B. The GSTs were separated by 2D SDS-PAGE and characterised by MALDI-TOF analysis of tryptic peptides. The mass fragments were then matched against the corresponding Drosophila melanogaster and Musca domestica sequences. GSTs were identified as coming from only the Sigma and Delta classes. The multiple Delta zones appear all to be derived from the Lucilia GSTD1 isoform. The distribution of these GST proteins has been studied during different developmental stages of the insect. Delta isoforms were present in all developmental stages of L. cuprina. The Sigma GST was not detectable in the egg, was just detectable in the larval and pupal stages and was the major GST isolated in the adult. Sigma and Delta isoforms were both found in all body segments of the insect. Both isoforms appear to undergo extensive post-translational modification. Activities of the two types of protein with model substrates have been determined.

  10. Macroglossia and Beckwith-Wiedemann syndrome

    Directory of Open Access Journals (Sweden)

    Krasić Dragan

    2011-01-01

    Full Text Available Introduction. In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys and pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele or some other umbilical deformity, macroglossia, congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Case Outline. A 16-month-old male child was admitted for examination because of macroglossia. He underwent examination on several occasions by an endocrinologist due to recurrent hypoglycaemic crisis. The patient was observed by a paediatric neurophysicatrist for disorders of mental development. Hypoglycaemia, muscular hypotonia of the anterior abdominal wall with umbilical hernia and macroglossia were observed by clinical examination. Inratraoral examination revealed macroglossia with microstomia, suckling and swallowing difficulties, hypotonia of the perioral muscles with increased salivation. It was therefore decided to perform surgical reduction of the prominent tongue and develop good condition for nutrition, speech function and the development of orofacial system. Conclusion. The diagnosis of macroglossia is based on subjective clinical criteria such as the morphology and amount of protrusion of the tongue, difficulty in articulating sounds, breathing, and hypersalivation. Some authors have suggested that the tongue size may be analyzed radiographically with a cephalogram. Treatment of macroglossia is controversial because of the absence of objective clinical criteria.

  11. Wiedemann effect of Fe-Ga based magnetostrictive wires

    Institute of Scientific and Technical Information of China (English)

    Li Ji-Heng; Gao Xue-Xu; Zhu Jie; Bao Xiao-Qian; Cheng Liang; Xie Jian-Xin

    2012-01-01

    (Fe83Gal7)gsCr2 wires each with a diameter of 0.7 mm are prepared by hot swaging and warm drawing from the casting rods directly,because the ductility of Fe83Ga17alloy is improved by adding Cr element.The Wiedemann twists and dependences on magnetostrictions of Fes3Ga17 and (Fes3Ga17)98Cr2 wires are investigated.The largest observed Wiedemann twists of 245 s.cm-1 and 182 s.cm-1 are detected in the annealed Fe83Ga17 and (Fe83Ga17)98Cr2 wires,respectively.The magnetostrictions of the annealed Fes3Ga17 and (FesaGa17)98Cr2 wires are 160 ppm and 107 ppm,respectively.The maximum of the Wiedemann twist increases with magnetostriction increasing.However the magnetostriction is just one important factor that affects the Wiedemann effect of alloy wire,and the relationship between magnetostriction and Wiedemann effect is a complex function rather than a simple function.

  12. Effect ofalpha-difluormethylornithine on Anastrepha fraterculus (Diptera, Tephritidae) ovary size.

    Science.gov (United States)

    Cardoso, V V; Moreira, J C F; Oliveira, A K

    2009-02-01

    Ovarian sizes (length and width) were measured in young females of Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) subjected or not to the inhibitor alpha-difluormethylornithine (alpha-DFMO). The most effective concentration of alpha-DMFO used was 50 mM and the ovarian measurements (length and width) of the treated females were smaller than those of females not treated with alpha-DMFO. These data may suggest some relationship between ornithine decarboxylase (ODC) and sexual maturation in A. fraterculus.

  13. Selection of a Bacillus pumilus strain highly active against Ceratitis capitata (Wiedemann) larvae.

    Science.gov (United States)

    Molina, C Alfonso; Caña-Roca, Juan F; Osuna, Antonio; Vilchez, Susana

    2010-03-01

    Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly (medfly), is one of the most important fruit pests worldwide. The medfly is a polyphagous species that causes losses in many crops, which leads to huge economic losses. Entomopathogenic bacteria belonging to the genus Bacillus have been proven to be safe, environmentally friendly, and cost-effective tools to control pest populations. As no control method for C. capitata based on these bacteria has been developed, isolation of novel strains is needed. Here, we report the isolation of 115 bacterial strains and the results of toxicity screening with adults and larvae of C. capitata. As a result of this analysis, we obtained a novel Bacillus pumilus strain, strain 15.1, that is highly toxic to C. capitata larvae. The toxicity of this strain for C. capitata was related to the sporulation process and was observed only when cultures were incubated at low temperatures before they were used in a bioassay. The mortality rate for C. capitata larvae ranged from 68 to 94% depending on the conditions under which the culture was kept before the bioassay. Toxicity was proven to be a special characteristic of the newly isolated strain, since other B. pumilus strains did not have a toxic effect on C. capitata larvae. The results of the present study suggest that B. pumilus 15.1 could be considered a strong candidate for developing strategies for biological control of C. capitata.

  14. Sarcosaprophagous Diptera assemblages in natural habitats in central Spain: spatial and seasonal changes in composition.

    Science.gov (United States)

    Martín-Vega, D; Baz, A

    2013-03-01

    The composition and spatial distribution of sarcosaprophagous Diptera assemblages were studied using carrion-baited traps along a bioclimatic gradient of natural habitats in central Spain throughout the different seasons during 1 year. Calliphoridae and Muscidae were the most abundant families, accounting for, respectively, 41.9% and 35.1% of all Diptera specimens collected. Other abundant families were Heleomyzidae (8.4%), Sarcophagidae (6.9%) and Piophilidae (5.1%). Fly assemblage compositions differed among bioclimatic levels, with Chrysomya albiceps (Wiedemann) (Diptera: Calliphoridae) being the dominant species in mesomediterranean habitats, Muscina levida (Harris) (Diptera: Muscidae) the dominant species in supramediterranean habitats, and Prochyliza nigrimana (Meigen) (Diptera: Piophilidae) the dominant species in oromediterranean habitats. Differences in assemblage composition were also found among seasons. Thermophobic species such as Calliphora vicina Robineau-Desvoidy (Diptera: Calliphoridae) and some species of Heleomyzidae were well represented during autumn, winter and spring in the three bioclimatic levels sampled. By contrast, thermophilic species such as Ch. albiceps and Lucilia sericata (Meigen) (Diptera: Calliphoridae) and most Muscidae and Sarcophagidae species were more abundant during summer and in mesomediterranean habitats located at lower elevations. Knowledge of the preferences of some species for certain habitats may be of ecological and forensic value and may establish a starting point for further research.

  15. Nasal encephalocele in a child with Beckwith-Wiedemann syndrome

    NARCIS (Netherlands)

    Broekman, Marike L. D.; Hoving, Eelco W.; Kho, Kuan H.; Speleman, Lucienne; Sen Han, K.; Hanlo, Patrick W.

    2008-01-01

    Beckwith-Wiedemann syndrome (BWS) is a rare congenital syndrome characterized by gigantism, macroglossia, exophthalmos, postpartum hypoglycemia, and multiple midline defects such as omphalocele. The authors describe, to the best of their knowledge, the first case of a child in whom BWS was diagnosed

  16. Histone deacetylase enzymes as drug targets for the control of the sheep blowfly, Lucilia cuprina

    Directory of Open Access Journals (Sweden)

    Andrew C. Kotze

    2015-12-01

    Full Text Available The Australian sheep blowfly, Lucilia cuprina, is an ecto-parasite that causes significant economic losses in the sheep industry. Emerging resistance to insecticides used to protect sheep from this parasite is driving the search for new drugs that act via different mechanisms. Inhibitors of histone deacetylases (HDACs, enzymes essential for regulating eukaryotic gene transcription, are prospective new insecticides based on their capacity to kill human parasites. The blowfly genome was found here to contain five HDAC genes corresponding to human HDACs 1, 3, 4, 6 and 11. The catalytic domains of blowfly HDACs 1 and 3 have high sequence identity with corresponding human and other Dipteran insect HDACs (Musca domestica and Drosophila melanogaster. On the other hand, HDACs 4, 6 and 11 from the blowfly and the other Dipteran species showed up to 53% difference in catalytic domain amino acids from corresponding human sequences, suggesting the possibility of developing HDAC inhibitors specific for insects as desired for a commercial insecticide. Differences in transcription patterns for different blowfly HDACs through the life cycle, and between the sexes of adult flies, suggest different functions in regulating gene transcription within this organism and possibly different vulnerabilities. Data that supports HDACs as possible new insecticide targets is the finding that trichostatin A and suberoylanilide hydroxamic acid retarded growth of early instar blowfly larvae in vitro, and reduced the pupation rate. Trichostatin A was 8-fold less potent than the commercial insecticide cyromazine in inhibiting larval growth. Our results support further development of inhibitors of blowfly HDACs with selectivity over human and other mammalian HDACs as a new class of prospective insecticides for sheep blowfly.

  17. Conservation and sex-specific splicing of the doublesex gene in the economically important pest species Lucilia cuprina

    Indian Academy of Sciences (India)

    Carolina Concha; Fang Li; Maxwell J. Scott

    2010-09-01

    Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the splicing of dsx RNA to produce functional male and female proteins. In the Australian sheep blowfly (Lucilia cuprina), the tra gene (Lctra) is required for female development and Lctra transcripts are sex-specifically spliced such that only female Lctra mRNA codes for functional protein. In males, a factor encoded by the Y-linked male determining gene is thought to prevent the female-mode of splicing of Lctra RNA. To further our understanding of the sex determination regulatory hierarchy in L. cuprina, we have isolated the dsx gene (Lcdsx) from this species. We found that the Lcdsx transcripts are sex-specifically spliced in a similar manner as their counterparts in D. melanogaster, housefly and tephritids. The LcDSX proteins are well conserved and the male form of DSX contains a motif encoded by a male-specific exon that is within the female-specific intron. This intron/exon arrangement had previously been found only in the housefly dsx gene, suggesting this may be a unique feature of dsx genes of Calyptratae species.

  18. Diptera Brachycera found inside the esophagus of a mummified adult male from the early XIX century, Lisbon, Portugal

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    2008-03-01

    Full Text Available Fly puparia and adult fragments of diptera muscid were found inside the esophagus of a mummified body from the early XIX century, buried inside the crypt of the Sacrament Church (Lisbon, Portugal. The identification of the material revealed a monospecific colonization by Ophyra capensis (Wiedemann (Diptera: Muscidae, a species known to invade corpses in the ammoniacal fermentation wave. This species can be found in corpses kept indoors, not available to the early waves of blowflies (Diptera: Calliphoridae. In the present case, the number of pupae and their developmental stage suggest that the female invaded the mummified corpse through the partially opened mouth and the oviposition took place directly inside the esophagus. This is the first case of O. capensis infesting internal organs of an intact corpse. The use of chemical products for the embalming process probably explains why external colonization did not occur.

  19. The morphology of fecal and regurgitation artifacts deposited by the blow fly Lucilia cuprina fed a diet of human blood.

    Science.gov (United States)

    Durdle, Annalisa; van Oorschot, Roland A H; Mitchell, R John

    2013-07-01

    Fly feces and regurgitation deposits may be mistaken for bloodstain patterns at a crime scene, potentially compromising event reconstruction and/or misdirecting police resources. In some instances, these artifacts contain sufficient human biological material to generate a full DNA profile, sometimes 2 years after deposition. Clearly, it is important that investigators can make the distinction between artifacts and bloodstains. This study examined 6645 artifacts deposited on a smooth, nonporous surface after Lucilia cuprina were fed human blood. Artifacts were also compared with bloodstains on a variety of other surfaces. Both similarities and differences were found between artifacts and bloodstains, highlighting the need for an identification system to assist personnel with little training in bloodstain pattern analysis. The morphology of the artifacts has been described so that these deposits may be more clearly distinguished from bloodstains, targeted by crime scene personnel as potential sources of human DNA, and/or identified as potential evidence contaminants. Flowcharts have been devised to facilitate the analysis.

  20. Morphometry and distribution of sensilla on the antennae of Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Bisotto-de-Oliveira, R; Redaelli, L R; Sant'ana, J

    2011-01-01

    Antennal sensilla of Anastrepha fraterculus (Wied.) were examined using scanning electron microscopy. In the flagellum, there are trichoid, basiconic, clavate type I and II, and styloconic sensilla and microtrichia. Only microtrichiae and chaetica sensilla were observed in the scape and pedicel. The number of sensilla in the flagellum was similar between sexes. At the apex there was a higher density of trichoid and an absence of clavate sensilla, while basiconic sensilla were more abundant in the proximal region.

  1. Ultrastructure of immature stages of the black dump fly: Ophyra aenescens (Wiedemann, 1830) (Diptera: Muscidae: Azeliinae).

    Science.gov (United States)

    Cortinhas, Lucas Barbosa; Mendonça, Paloma Martins; Barbosa, Rodrigo Rocha; Queiroz, Margareth Maria de Carvalho

    2016-06-01

    Ophyra aenescens (black dump fly) originally belonged to the New World, however, now it is spread worldwide. This fly is a mechanical vector of some pathogenic microorganisms and eggs of the human botfly (Dermatobia hominis). The adults are associated with decaying matter and the immature stages colonize animal and human corpses. It is considered an important muscid species for forensic entomology. The aim of this study was to describe the morphology of the eggs, the three larval instars and the puparia of O. aenescens using scanning electron microscopy (SEM). The spiracular opening of the first instar has an interruption in the middle of its length. Comparing to the other instar, the ventral tubercles are only developed in the first instar. The anterior spiracles have a variation in the numbers of spiracular ramification. The puparia morphology is similar to the third instar larvae, however the cephalic region is retracted and on the third thoracic segment, a respiratory structure is present. In conclusion, the SEM technique used and the results obtained are helpful to describe and differentiate the immature stages of O. aenescens and consequently support forensic and medical entomology.

  2. Induced Cannibalism in Experimental Populations of the Forensic Indicator Chrysomya putoria Wiedemann (Diptera: Calliphoridae).

    Science.gov (United States)

    Botteon, V W; Fernandes, F S; Godoy, W A C

    2016-04-01

    We analyzed the behavior of third-instars of Chrysomya putoria as potential cannibals in experimental populations. Cannibalism rates were evaluated in three settings observed for 3, 6, 9, and 24 h, placing injured and uninjured larvae of C. putoria together. Our data heavily support that C. putoria larvae behave as cannibals when induced by a wound in another larva, and also after starving for 24 h. The probability of cannibalism increased as a function of time, both in no-choice and in choice experiments evidencing that time is a determining factor for cannibalism induction in C. putoria. However, the treatment combining injured with uninjured larvae showed the highest probability of cannibalism. These results suggest that C. putoria larvae may cannibalize under scarcity of food over long time or the presence of injured larvae. This study is useful to understand the behavior of C. putoria feeding on ephemeral substrates such as carrion or corpses and brings relevant and significant contribution to population ecology of blowflies and also forensic entomology.

  3. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  4. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in southern Syria

    National Research Council Canada - National Science Library

    Mohammed Mansour; Fater Mohamad

    2016-01-01

      Population fluctuations of the Mediterranean fruit fly (medfly), [Ceratitis capitata], were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria...

  5. Morphology of immature stages of Hemipyrellia ligurriens (Wiedemann) (Diptera: Calliphoridae) for use in forensic entomology applications.

    Science.gov (United States)

    Sukontason, Kabkaew L; Sribanditmongkol, Pongruk; Chaiwong, Tarinee; Vogtsberger, Roy C; Piangjai, Somsak; Sukontason, Kom

    2008-09-01

    In forensic investigations, all immature stages of flies (egg, larvae, and puparium) can serve as entomological evidence at death scenes. These insects are primarily used to estimate the post mortem interval (PMI), but can also be involved in the analysis of toxic substances, determining manner of death, and in indicating relocation of a corpse in homicide cases. In this study, we present the morphology of the egg, larvae, and puparium of Hemipyrellia ligurriens, a blow fly species of forensic importance in Thailand. Examination was conducted using scanning electron microscopy (SEM). The egg stage was found to display a relatively wide plastron region (or median hatch line area) that spans almost the entire length of the egg. The median hatch line is oriented in an upright position. External chorionic sculpture of the egg is present in a hexagonal pattern whose reticular boundaries are slightly elevated. In the larval stages, the most prominent morphological changes were detected upon comparison of the first to the second instar; whereas, the differences between second and third instar larvae were less obvious outside of the increase in number of posterior spiracular slits. Most of the major differences involve body size and structure of the anterior and posterior spiracles. Each anterior spiracle in both the second and third instars projects five to seven papillae apically. Each posterior spiracular disc of a third instar exhibits a complete peritreme, three spiracular slits, and a prominent button that is ventromedially located. The puparium is coarctate and features a clustered bubble membrane comprised of approximately 57 mammillate structures positioned dorsolaterally on each side of the first abdominal segment in young puparia. This feature is replaced by short, tubular respiratory horns in aged puparia. This study provides more detailed exposure of important morphological features that can be used for accurate identification of immature stages of H. ligurriens. Information presented can aid in forensic investigations involving this fly species.

  6. The Preimaginal Stages of Cryptotylus unicolor (Wiedemann and Tabanus nebulosus ornativentris Kroeber (Tabanidae-Diptera-Insecta

    Directory of Open Access Journals (Sweden)

    Coscarón S

    1998-01-01

    Full Text Available A larva with peculiar very long pubescence on the integument, the pupa of Cryptotylus unicolor, and the larva and pupa of Tabanus nebulosus ornativentris are described and illustrated

  7. Ocorrência e Sazonalidade de Muscóides (Diptera, Calliphoridae de Importância Sanitária no Município de Itaboraí, RJ, Brasil

    Directory of Open Access Journals (Sweden)

    José Batista-da-Silva

    2010-04-01

    Abstract. This work was carried out to contribute to the knowledge of Calliphoridae flies (Diptera in Itaboraí, RJ, Brazil and quantify the predominant species of health importance. The flies were captured in eight different points in the city over a one year period, always using fish as bait, separated by species and kept properly in an entomological box in the Laboratório de Transmissores de Leishmaniose (Setor de Entomologia Médica e Forense - IOC / FIOCRUZ, RJ. A total of 1792 Calliphoridae flies were captured, belonging to seven (7 species: Chloroprocta idioidea (Robineau-Desvoidy (0.11%, Chrysomya megacephala (Fabricius (87.94%, Chrysomya albiceps (Wiedemann (6.70%, Chrysomya putoria (Wiedemann (1.23%, Cochliomyia macellaria (Fabricius (0.56%, Hemilucilia segmentaria (Fabricius (0.33%, Lucilia eximia (Wiedemann (3.13%.

  8. Prenatal diagnosis of Beckwith-Wiedemann syndrome by two- and three-dimensional ultrasonography

    Directory of Open Access Journals (Sweden)

    Edward Araujo Junior

    2013-12-01

    Full Text Available Beckwith-Wiedemann syndrome is a genetic syndrome characterized by macroglossia, omphalocele, fetal gigantism and neonatal hypoglycemia. The authors report a case of Beckwith-Wiedemann syndrome diagnosed in a 32-year-old primigravida in whom two-dimensional ultrasonography revealed the presence of abdominal wall cyst, macroglossia and polycystic kidneys. Three-dimensional ultrasonography in rendering mode was of great importance to confirm the previous two-dimensional ultrasonography findings.

  9. The impact of industrial anthropization on mosquito (Diptera, Culicidae) communities in mangrove areas of Guanabara Bay (Rio de Janeiro, Brazil).

    Science.gov (United States)

    de Souza, A S; Couri, M S; Florindo, L

    2012-02-01

    The effects of industrial anthropization on species composition and community diversity of Culicidae (Diptera) were studied in a mangrove area impacted by industrial activities as compared to a preserved area, both around Guanabara Bay in the state of Rio de Janeiro, Brazil. Diversity, equitability, and species richness in Culicidae community differed between the studied areas. Indicator species analysis and correspondence analysis were carried out and indicated that the Sabethini, especially Wyeomyia (Phoniomyia) theobaldi Lane, Wyeomyia (Phoniomyia) fuscipes (Edwards), and a non-identified species of Wyeomyia sp. were associated to the preserved area, whereas Aedes taeniorhynchus Wiedemann and Aedes scapularis (Rondani) to the impacted area.

  10. Monozygotic male twins concordant for Beckwith-Wiedemann syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Clemens, M.; McPherson, E.; Sherer, C. [West Penn Hospital, Pittsburgh, PA (United States)]|[Ludwig Institute for Cancer Reseach, LaJolla, CA (United States)] [and others

    1994-09-01

    The Beckwith-Wiedemann syndrome (BWS) is a multiple congenital anomaly syndrome characterized by macrosomia, macro glossia, visceromegaly, characteristic facies, and in some cases omphalocele, hypoglycemia, hemihypertrophy, and risk of embryonal tumors. Most cases occur sporadically in chromosomally normal individuals, but a few BWS patients have anomalies of 11p and others have evidence of microduplications or paternal isodisomy in this region. In some families with autosomal dominant transmission, BWS maps to 11p15.5, but the mechanism of transmission is not fully understood. BWS has been reported in 11 sets of MZ twins, including 10 female pairs (9 discordant and 1 partially concordant) and one male pair concordant for both BWS & dup 15q11.2-q13. We report a pair of premature male MZ twins with macroglossia, postnatal overgrowth, characteristic BWS facies, and mild developmental delay. One twin had hypoglycemia, but neither had omphalocele or hemihypertrophy and serial abdominal ultrasounds have been normal. DNA fingerprinting confirmed monozygosity. Chromosome studies showed a marker 11p14.2 in one twin only, and molecular genetic studies of the 11p15.5 region showed no evidence of duplication or isodisomy in either twin.

  11. Comparative morphology of the spermathecae of some species of Chrysomya Robineau-Desvoidy and Cochliomyia Townsend (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Érica Sevilha Harterreiten-Souza

    2012-03-01

    Full Text Available Comparative morphology of the spermathecae of some species of Chrysomya Robineau-Desvoidy and Cochliomyia Townsend (Diptera, Calliphoridae. Little is known about the morphology of the chitinized structures of the spermathecae of the Calliphoridae. In this work, the spermathecae of Chrysomya albiceps Wiedemann, 1819, C. megacephala Fabricius, 1794, Cochliomyia macellaria Fabricius, 1775 and C. hominivorax Coquerel, 1858 are described and illustrated. The occurrence in one species of four spermathecae, an atypical form for blow flies, was recorded for the first time. The analysis of these structures will allow a better understanding of this group as well as provide taxonomic characters for future phylogenetic studies.Morfologia comparada das espermatecas de espécies de Chrysomya Robineau-Desvoidy e Cochliomyia Townsend (Diptera, Calliphoridae. Pouco se conhece sobre a morfologia das estruturas quitinizadas das espermatecas de Calliphoridae. Nesse trabalho as espermatecas de Chrysomya albiceps Wiedemann, 1819, C. megacephala Fabricius, 1794, Cochliomyia macellaria Fabricius, 1775 e C. hominivorax Coquerel, 1858 são descritas e ilustradas. Foi registrada pela primeira vez a ocorrência em uma espécie com quatro espermatecas, uma forma atípica em califorídeos. A análise dessas estruturas possibilitará uma melhor compreensão do grupo e fornecerá caracteres taxonômicos para futuros estudos filogenéticos.

  12. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes

    DEFF Research Database (Denmark)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia

    2016-01-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60...

  13. Finding column depedencies in sparse matrices over $ F_ 2 $ by block Wiedemann

    NARCIS (Netherlands)

    Penninga, O.

    1998-01-01

    Large systems of linear equations over $mathbb{F_2$ with sparse coefficient matrices have to be solved as a part of integer factorization with sieve-based methods such as in the Number Field Sieve algorithm. In this report, we first discuss the Wiedemann algorithm to solve these systems and investig

  14. Beckwith-Wiedemann syndrome and bilateral adrenal pheochromocytoma: sonography and MRI findings

    Energy Technology Data Exchange (ETDEWEB)

    Baldisserotto, Matteo; Peletti, Adriana Barcellos; Araujo, Manoel Angelo de; Pertence, Ana Paula Cardoso; Dora, Marcelo Dourado; Maciel, Elines Oliva; Gaiger, Ana Maria [Hospital da Crianca Conceicao, Departamento de Radiologia, Porto Alegre, RS (Brazil)

    2005-11-01

    Beckwith-Wiedemann syndrome is characterized by a group of clinical abnormalities, the most frequent of which are omphalocele, macroglossia, gigantism, neonatal hypoglycemia and umbilical hernia. The association of this syndrome with malignant tumors is well documented. We report a child with this syndrome associated with bilateral adrenal pheochromocytoma. (orig.)

  15. SNP arrays in Beckwith-Wiedemann syndrome: an improved diagnostic strategy.

    Science.gov (United States)

    Keren, Boris; Chantot-Bastaraud, Sandra; Brioude, Frédéric; Mach, Corinne; Fonteneau, Eric; Azzi, Salah; Depienne, Christel; Brice, Alexis; Netchine, Irène; Le Bouc, Yves; Siffroi, Jean-Pierre; Rossignol, Sylvie

    2013-10-01

    Beckwith-Wiedemann syndrome is an overgrowth disorder with an increased risk of childhood tumors that results from a dysregulation of imprinted gene expression in the 11p15 region. Since epigenetic defects are the most frequent anomalies, first-line diagnostic methods involve methylation analysis. When paternal isodisomy is suspected, it should be confirmed by a second technique capable of distinguishing true 11p15 paternal disomy (patUPD) from paternal 11p15 duplication or 11p15 trisomy. We sought to evaluate the interest of using SNP arrays in the Beckwith-Wiedemann syndrome diagnostic strategy. We analyzed the SNP profiles of 25 Beckwith Wiedemann patients with previously determined methylation indexes. Among them, 3 had 11p15 trisomies, 13 had patUPD, 8 had an inconclusive methylation index and 1 had a normal result. All known trisomies and known patUPDs were detected. Moreover we found 7 low-rate mosaicisms 11p15 patUPDs among the 8 patients with an inconclusive methylation index. We were able to precisely characterize the sizes and mosaicism rates of the anomalies. We demonstrate that SNP arrays are of real diagnostic interest in Beckwith-Wiedemann syndrome: 1) they help to distinguish patUPDs from trisomies more precisely than karyotyping and FISH, 2) they help determine the size and mosaicism rate of patUPDs, 3) they provide complementary information in inconclusive cases, helping to distinguish low-rate patUPD mosaicism from other BWS-related molecular defects.

  16. Wiedemann-Steiner Syndrome With 2 Novel KMT2A Mutations.

    Science.gov (United States)

    Min Ko, Jung; Cho, Jae So; Yoo, Yongjin; Seo, Jieun; Choi, Murim; Chae, Jong-Hee; Lee, Hye-Ran; Cho, Tae-Joon

    2017-02-01

    Wiedemann-Steiner syndrome is a rare genetic disorder characterized by short stature, hairy elbows, facial dysmorphism, and developmental delay. It can also be accompanied by musculoskeletal anomalies such as muscular hypotonia and small hands and feet. Mutations in the KMT2A gene have only recently been identified as the cause of Wiedemann-Steiner syndrome; therefore, only 16 patients from 15 families have been described, and new phenotypic features continue to be added. In this report, we describe 2 newly identified patients with Wiedemann-Steiner syndrome who presented with variable severity. One girl exhibited developmental dysplasia of the hip and fibromatosis colli accompanied by other clinical features, including facial dysmorphism, hypertrichosis, patent ductus arteriosus, growth retardation, and borderline intellectual disability. The other patient, a boy, showed severe developmental retardation with automatic self-mutilation, facial dysmorphism, and hypertrichosis at a later age. Exome sequencing analysis of these patients and their parents revealed a de novo nonsense mutation, p.Gln1978*, of KMT2A in the former, and a missense mutation, p.Gly1168Asp, in the latter, which molecularly confirmed the diagnosis of Wiedemann-Steiner syndrome.

  17. Partial KCNQ1OT1 hypomethylation: A disguised familial Beckwith–Wiedemann syndrome as a sporadic adrenocortical tumor

    Directory of Open Access Journals (Sweden)

    Dorra H'mida Ben-Brahim

    2015-03-01

    Full Text Available Beckwith–Wiedemann syndrome has a wide spectrum of complications such as embryonal tumors, namely adrenocortical tumor. Tumor predisposition is one of the most challenging manifestations of this syndrome. A 45-day old female with a family history of adrenocortical tumor presented with adrenocortical tumor. The case raised suspicion of a hereditary Beckwith–Wiedemann syndrome, therefore molecular analysis was undertaken. The results revealed partial KCNQ1OT1 hypomethylation in the infant's blood DNA which was associated with a complete loss of methylation in the infant's adrenocortical tumor tissue. It is unique for familial Beckwith–Wiedemann syndrome caused by KCNQ1OT1 partial hypomethylation to manifest solely through adrenocortical tumor. Incomplete penetrance and specific tissue mosaicism could provide explanations to this novel hereditary Beckwith–Wiedemann syndrome presentation.

  18. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 3.0

    Science.gov (United States)

    The Mediterranean fruit fly (Medfly), Ceratitis capitata (Wiedemann), causes direct damage to fruits and vegetables through oviposition and larval feeding. Rigorous quarantine procedures are currently enforced to prevent domestic and transnational spread of Medfly. Accessible and reliable informatio...

  19. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  20. Two sibs with Wiedemann-Rautenstrauch syndrome: possibilities of prenatal diagnosis by ultrasound.

    Science.gov (United States)

    Castiñeyra, G; Panal, M; Lopez Presas, H; Goldschmidt, E; Sánchez, J M

    1992-01-01

    A girl with Wiedemann-Rautenstrauch syndrome was born to a non-consanguineous couple. During the pregnancy, growth retardation particularly in the biparietal and abdominal diameters but not the femoral length was detected through serial ultrasound scans. When the woman became pregnant again, in spite of having been assessed as having a 25% risk of recurrence, the prenatal findings seen in her previous pregnancy led us to suggest sequential echography and a similar pattern of growth retardation was shown. After termination, the male fetus was found to be affected by Wiedemann-Rautenstrauch syndrome. This case shows that ultrasound examination can be a useful tool in the prenatal diagnosis of this rare, autosomal recessive syndrome. Images PMID:1619643

  1. Prenatal sonographic findings of Beckwith-Wiedemann syndrome: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Won Sang; Lee, Jee Young; Lee, Yeon Hee [Dankook University Hospital, Chonan (Korea, Republic of)

    2000-03-15

    The Backwith-Wiedemann syndrome (BWS) is and unusual complex with variable clinical features. Major findings included defects in the abdominal wall, macroglossia and macrosomia. These features should be amenable to prenatal ultrasound detection. Serious complications are possible in the neonatal period, which may result from the hypoglycemia or the airway obstruction due to macroglossia. Accurate prenatal diagnosis allows optimum prenatal care and prevention of serious complications. We report a case of prenatally diagnosed BWS with omphalocele, macroglossia, nephromegaly and hepatic cyst.

  2. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  3. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  4. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): a comparative study

    OpenAIRE

    Rosemary Cardoso Ribeiro; Eliane Maria Vieira Milward-de-Azevedo

    1997-01-01

    Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no sub...

  5. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: a comparative study

    Directory of Open Access Journals (Sweden)

    Rosemary Cardoso Ribeiro

    1997-12-01

    Full Text Available Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no substrato à base de carne eqüina e 76,01mg, no substrato à base de sardinha, a diferença foi, portanto, significativa. A taxa de sobrevivência larval registrada foi superior a 80%, enquanto a taxa de sobrevivência pupal foi próxima a 100%. A razão sexual foi próxima a 0,5. A dieta à base de carne eqüina mostrou-se mais adequada ao desenvolvimento de C. albiceps, pois as larvas mantidas neste substrato apresentaram-se mais pesadas, o que potencializa a capacidade reprodutiva do adulto.The objective of the present study was to observe the postembryonic development of Chrysomya albiceps reared on sardines or horse meat and to compare the results. Fresh substratos were maintened m an oven ai 30°C for 2 hours. Fifty newly emerged larvas were inoculated into 100g diel per reptication. Four replications per treatment were used. The experiment was conducted under laboratory conditions. The mean weight of postfeeding larvas was 91.19mg for especimens reared on horse meat and 76.01mg for especimens reared on sardines, with a marked difference between diets. Larval viability was more than 80% for the two diets, while pupal viability was dose to 100%. The sex ratio was about 0.5. The horse meat diet proved to be more adequate for the development of C. albiceps since the larvas weighed more, with consequent potentiations of adult reproductive abilily.

  6. Morfologia e duração dos ínstares larvais de Chrysomya putoria (Wiedemann (Diptera, Calliphoridae, em laboratório Morphology and duration of larval instars of Chrysomya putoria (Wiedemann (Diptera, Calliphoridae, in laboratory

    Directory of Open Access Journals (Sweden)

    Marcio Sacramento de Oliveira

    2007-01-01

    Full Text Available Este trabalho visou descrever a morfologia e o tempo de desenvolvimento das larvas de Chrysomya putoria, um importante díptero para saúde pública e medicina legal. As amostras foram coletadas a cada duas horas e, a partir da 56ª hora, as coletas foram realizadas com intervalos de 12 horas até o abandono das larvas maduras do meio de criação. As larvas de C. putoria apresentaram um tempo total de desenvolvimento de 92 horas quando mantidas a 27 ºC com comprimento médio de 13,42 mm e características morfológicas peculiares que as diferenciam das outras espécies exóticas e autóctones do Brasil. O esqueleto cefalofaringeano das larvas de terceiro ínstar é robusto e esclerotizado; o gancho labial é completamente pigmentado e curvo, a parte posterior é mais larga que a anterior, mostrando-se levemente pontiagudo. Estas larvas não possuem esclerito oral acessório e o corno dorsal e o ventral apresentam áreas menos pigmentadas. Nota-se uma região não pigmentada em continuação aos cornos, destacando-se no tamanho na região do corno ventral com uma incisão média bem demarcada. Apresentam de 10 a 11 ramificações no espiráculo anterior, peritrema incompleto e presença do botão espiracular, a partir do segundo ínstar.The objective of this work was to describe the morphology and the developmental time of Chrysomya putoria larvae, a fly of public health and forensic importance. The samples were collected at 2 hr intervals, during the first 56 hr and at 12 hr intervals thereafter, until all mature larvae had abandoned the diet. The total developmental time for Chrysomya putoria larvae at 27 ºC was 92 hr, with a mean length of 13.42 mm. The larvae presented unique morphological characteristics which differentiated them from other exotic and autochthonous species found in Brazil. The cephalopharyngeal skeleton of the third instar larvae is robust and sclerotized; the mouth hook is completely pigmented and curved; the posterior end is wider than the anterior, being slightly pointed. The accessory oral sclerit is absent and the dorsal and ventral horns have areas with less pigmentation. It is possible to visualize an area with no pigmentation adjacent to the horns, outstanding in size near the ventral corn with a well delimited medial incision. The anterior spiracles presented 10 to 11 ramifications, open peritrema and the presence of a spiracular bud from the second instar on.

  7. Study of the combined radial post-feeding dispersion of the blowflies Chrysomya megacephala (Fabricius and C. albiceps (Wiedemann (Diptera, Calliphoridae Estudo da dispersão radial combinada de Chrysomya megacephala (Fabricius e C. albiceps (Wiedemann (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Leonardo Gomes

    2005-09-01

    Full Text Available Blowflies use discrete and ephemeral substrates to feed their larvae. After they run out of food, the larvae begin to disperse in order to find adequate places for pupation or additional food sources, a process named post-feeding larval dispersion. Some important aspects of this process were studied in a circular arena allowing the combined radial post-feeding dispersion from the center of the arena of C. albiceps and C. megacephala larvae. To determine the location of each pupa, the arena was divided in 72 identical sections starting from the center. The distance from the center, the depth and weight of each pupa were evaluated. Statistical tests were done to verify the relation between weight, depth and distance for pupation. From the total an average of 976 larvae released (488 for each species were collected considering both experiments 456 C. megacephala pupae and 488 of C. albiceps. This demonstrates that C. albiceps probably preyed on 32 C. megacephala larvae during post-feeding dispersion. The study of this dispersion process can be used to estimate the postmortem interval (PMI of human cadavers in legal medicine.As moscas- varejeiras utilizam-se de substratos discretos e efêmeros para alimentar suas larvas. Após deixarem o substrato alimentar, as larvas começam a dispersar em busca de locais adequados para pupação e fontes adicionais de alimento, um processo denominado dispersão larval pós-alimentar. Alguns aspectos importantes desse processo foram estudados em uma arena permitindo a dispersão radial combinada de larvas de C. megacephala e C. albiceps. Para determinar a localização de cada pupa, a arena foi dividida em 72 setores iguais começando do centro. A distância a partir do centro, a profundidade e o peso de cada pupa foram determinados. Testes estatísticos foram feitos para verificar a relação entre peso, profundidade e distância para pupação. De um total em média de 976 larvas soltas (488 de cada espécie foram coletadas considerando ambos os experimentos 456 larvas de C. megacephala e 488 larvas de C. albiceps. Isso demonstrou que as larvas de C. albiceps provavelmente predaram 32 larvas de C. megacephala. O estudo desse processo de dispersão pode auxiliar na estimativa do intervalo pós- morte (IPM em estudos de medicina legal.

  8. Evaluation of lufenuron as a chemosterilant against fruit flies of the genus Anastrepha (Diptera: Tephritidae).

    Science.gov (United States)

    Moya, Pilar; Flores, Salvador; Ayala, Ildefonso; Sanchis, Juan; Montoya, Pablo; Primo, Jaime

    2010-06-01

    Chemosterilisation with lufenuron bait stations is a recently developed technique that is being implemented for Ceratitis capitata Wiedemann control. The aim of this work was to evaluate the chemosterilising effect of lufenuron against four economically important Latin American fruit flies species: Anastrepha ludens (Loew.), A. obliqua Macquart, A. serpentina Wiedemann and A. striata Schiner (Diptera: Tephritidae) in order to design a similar strategy for their control. Sexually mature adults were treated by ingestion with concentrations ranging from 0.1 to 30.0 mg g(-1) of lufenuron in the diet. In addition, conspecific crosses with only one of the sexes being treated (30.0 mg g(-1)) were performed in order to appraise the contribution of each sex to the sterilising effect. In all cases, fecundity was not affected by the treatments, as opposed to fertility where all Anastrepha species studied were significantly affected, although to different extents. The conspecific crosses showed that treated males of A. ludens, A. obliqua and A. serpentina were not able to transmit the sterility to their respective untreated females. Only in the case of A. striata did crossing treated males with untreated females significantly reduced egg hatch. Although further investigations are required, the present results demonstrate that the use of lufenuron for controlling A. striata could be potentially viable.

  9. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  10. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver, which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  11. Estudo morfologico e histoquimico das glandulas sexuais acessorias de chrysomya putoria durante a ovogenese (wiedemann) (diptera : calliphoridae)

    OpenAIRE

    1995-01-01

    Resumo: Chrysomya putoria é uma mosca varejeira normalmente associada a locais com precárias condições de higiene. Na natureza ela cria-se em carcaças e no esterco que acumula-se sob as gaiolas de galinhas poedeiras. Esta mosca está no Brasil a cerca de duas décadas mas na Áftica, seu local de origem, ela é descrita como díptero causador facultativo de miíase. As glândulas sexuais acessórias de temeas tem um importante papel em diferentes etapas da fertilização do ovo e sua ausência experimen...

  12. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  13. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver), which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  14. Bionomy of two flies of sanitary and forensic importance: Peckia (Sarcodexia lambens (Wiedemann and Oxysarcodexia amorosa (Schiner (Diptera, Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Alexandre da Silva Xavier

    2015-09-01

    Full Text Available ABSTRACTThis study aims to elucidate the bionomy of Peckia(Sarcodexia lambens and Oxysarcodexia amorosa to provide data for medical, veterinary and forensic entomology analyses. We analyzed larval stage duration (L1–L3, weight of the mature larvae (L3, pupal stage duration, L1–adult duration, adult emergence and viability of larvae and adults of both species. Larval viability of P. (S. lambens was 82% and the mean duration of the larval stage was 3.51 ± 0.99 days. The mature larvae had a mean weight of 33.67 ± 7.13 mg. The mean duration of the pupal stage was 8.26 ± 0.93 days and the mean duration of the L1–adult was 11.53 ± 1.22 days. Mean lifespan for females and males was 39.33 ± 1.52 and 57.33 ± 4.72 days, respectively. Larval viability of O. amorosa was 76% and mean duration of larval stage was 3.51 ± 0.64 days. Mature larvae had a mean weight of 28.28 ± 3.38 mg. Mean duration of the pupal stage was 10.14 ± 0.63 days and mean duration of the L1–adult was 13.60 ± 0.69 days. Mean lifespan for females and males was 83.66 ± 15.94 and 84.00 ± 19.97 days, respectively. Oxysarcodexia amorosa showed a L1–adult stage longer than P. (S. lambens; however both species showed low viability. O. amorosa laid more larvae than P. (S. lambens, this fact may occur because O. amorosa had longer life duration.

  15. Permethrin resistance in Aedes albopictus (Diptera: Culicidae) and associated fitness costs.

    Science.gov (United States)

    Chan, Hiang Hao; Zairi, Jaal

    2013-03-01

    Insecticide resistance has become a serious issue in vector management programs. Information on insecticidal resistance and its associated mechanisms is important for successful insecticide resistance management. The selection of a colony of permethrin-resistant Aedes albopictus (Skuse) (Diptera: Culicidae), originating from Penang Island, Malaysia, yielded high larval-specific resistance to permethrin and cross-resistance to deltamethrin. Synergism assays showed that the major mechanism underlying this resistance involves cytochrome P450 monooxygenase. The resistance is autosomal, polygenically inherited and incompletely dominant (D = 0.26). Resistant larvae were reared under different conditions to assess the fitness costs. Under high larval density, larval development time of the resistant SGI strain was significantly longer than the susceptible VCRU strain. In both high- and low-density conditions SGI showed a lower rate of emergence and survival compared with the VCRU strain. Resistant larvae were more susceptible to predation by Toxorhynchites splendens (Wiedemann) (Diptera: Culicidae) larvae. The body size of SGI females reared under high-density conditions was larger compared with females of the susceptible strain. SGI females survived longer when starved than did VCRU females. The energy reserve upon eclosion was positively correlated with the size of the adults.

  16. Syndromes and Disorders Associated with Omphalocele (I: Beckwith–Wiedemann Syndrome

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2007-06-01

    Full Text Available Beckwith–Wiedemann syndrome (BWS, OMIM 130650 is characterized by macrosomia, macroglossia, visceromegaly, hemihypertrophy, abdominal wall defects, ear creases/pits, neonatal hypoglycemia, polyhydramnios, placentomegaly, placental mesenchymal dysplasia, cardiac defects, nevus flammeus, hemangiomata, and an increased frequency of embryonal tumors. This article provides an overview of BWS including the genetics, genetic diagnosis, genotype/epigenotype–phenotype correlations, association with assisted reproductive technology, and prenatal diagnosis. Omphalocele is an important sonographic marker for BWS. Prenatal detection of omphalocele, fetal overgrowth, polyhydramnios, increased abdominal circumference, placentomegaly and/or placental mesenchymal dysplasia should alert one to the possibility of BWS and prompt a genetic investigation and counseling for BWS.

  17. Survival of Wild Adults of Ceratitis capitata (Wiedemann under Natural Winter Conditions in North East Spain

    Directory of Open Access Journals (Sweden)

    E. Peñarrubia-María

    2012-01-01

    Full Text Available The overwintering of the Mediterranean fruit fly (medfly, Ceratitis capitata (Wiedemann at the northern limits of its geographic distribution is not yet well known. With the aim of estimating the survival rate of medfly adults in northeast Spain under natural winter conditions, a two-winter-season trial was carried out. A control was carried out in a climatic chamber at 25°C. The results showed that medfly adults were unable to survive the entire winter season in the Girona area. Climatic conditions, including the daily minimum temperature, daily maximum temperature and the high rainfall, appeared to be involved in adult mortality in winter.

  18. Nonlinear heat transport in mesoscopic conductors: Rectification, Peltier effect, and Wiedemann-Franz law

    Science.gov (United States)

    López, Rosa; Sánchez, David

    2013-07-01

    We investigate nonlinear heat properties in mesoscopic conductors using a scattering theory of transport. Our approach is based on a leading-order expansion in both the electrical and thermal driving forces. Beyond linear response, the transport coefficients are functions of the nonequilibrium screening potential that builds up in the system due to interactions. Within a mean-field approximation, we self-consistently calculate the heat rectification properties of a quantum dot attached to two terminals. We discuss nonlinear contributions to the Peltier effect and find departures from the Wiedemann-Franz law in the nonlinear regime of transport.

  19. Calliphoridae (Diptera from wild, suburban, and urban sites at three Southeast Patagonian localities: Calliphoridae (Diptera de ambientes no habitados, suburbanos y urbanos en tres localidades del sudeste patagónico

    Directory of Open Access Journals (Sweden)

    Juan C. Mariluis

    2008-06-01

    Full Text Available Species composition, relative abundance, sex ratio and habitat preference of blowflies (Diptera: Calliphoridae from Caleta Olivia, Puerto Deseado, and Puerto San Julián (Santa Cruz Province, Argentina were studied during late spring and summer in 2004-2005. Results showed a higher prevalence of the exotic species, Calliphora vicina (Robineau-Desvoidy and Phaenicia sericata (Meigen at urban sites over the natives, Compsomyops fulvicrura (Robineau-Desvoidy and Sarconesia chlorogaster (Wiedemann, which shows a strong preference for those sampling sites either not inhabited or less influenced by human activities. Sex ratio was female biased for all species, except for Sarconesia chlorogaster, which exhibited a male prevalence over females.Durante fines de la primavera-verano de 2004-2005, se analizó la composición, abundancia relativa y proporción de sexos de especies de Calliphoridae (Diptera en las localidades de Caleta Olivia, Puerto Deseado y Puerto San Julián (Provincia de Santa Cruz, Argentina. Tres sitios de muestreo afectados diferencialmente por la intervención humana fueron seleccionados en cada localidad. En las áreas urbanas, las especies exóticas Calliphora vicina (Robineau-Desvoidy y Phaenicia sericata (Meigen fueron dominantes. Por el contrario, las nativas Compsomyiops fulvicrura (Robineau-Desvoidy y Sarconesia chlorogaster (Wiedemann predominaron tanto en áreas inhabitadas como en aquellas con bajo impacto humano. En los cebos utilizados para las capturas, se observó mayor proporción de hembras en todas las especies, excepto Sarconesia chlorogaster que mostró mayor proporción de machos.

  20. A microdeletion at 12q24.31 can mimic beckwith-wiedemann syndrome neonatally.

    Science.gov (United States)

    Baple, E; Palmer, R; Hennekam, R C M

    2010-02-01

    We report on a patient who was initially suspected to have Beckwith-Wiedemann syndrome because of recurrent neonatal hypoglycaemias, macroglossia and overgrowth, but in whom no 11p15 abnormality could be found. Follow-up showed continued overgrowth and disturbed glucose homeostasis, a marked developmental delay, and severe behavioural problems especially caused by anxieties. Array comparative genomic hybridization analysis showed a de novo 12q24.31 interstitial deletion, which was confirmed by fluorescence in situ hybridization. The deleted region contains amongst others: HNF1 homeobox A (HNF1A) which is important for the regulation of gene expression in the liver and involved in maturity-onset diabetes of the young type 3 and insulin resistance; acyl-CoA dehydrogenase short chain (ACADS) which encodes an enzyme important in mitochondrial fatty acid beta-oxidation and can cause short-chain acyl-CoA dehydrogenese (SCAD) deficiency, and purinergic receptor P2X7 (P2RX7) which encodes a ligand-gated ion channel, and of which polymorphisms are found with increased frequency in patients with psychiatric disorders, especially anxieties. We conclude the present patient has a hitherto undescribed contiguous gene syndrome, which can initially resemble Beckwith-Wiedemann syndrome.

  1. Postmortem Attraction of Sarcosaprophagous Diptera to Tramadol-Treated Rats and Morphometric Aspects of the Developed Larvae.

    Science.gov (United States)

    AbouZied, E M

    2016-06-01

    The presence of some specific drugs in animal tissues may affect the time of minimal postmortem intervals estimated during forensic entomological investigations. To test the effects of a specific drug on decomposition, a field study was conducted at Fayoum University campus, Egypt, from March to May 2013, using tramadol, a synthetic analgesic opioid used to treat moderate to severe pain in humans. Albino rats were used as the animal model during this study. The duration of the fresh stage of tramadol treated rat (Ttr) carcasses was significantly shorter (2.4 ± 0.27 days) compared to tramadol free rat (Tfr) carcasses (6.4 ± 0.49 days). The dry carcass stage of Ttr lasted longer (10.3 ± 0.99 days) as compared to (7.4 ± 0.18 days) the Tfr carcass. The decomposition process of the (Ttr) carcass was not significantly faster (24.9 ± 1.58 days) as compared to (Tfr) carcasses (29.5 ± 1.69). Lucilia cuprina (Wiedemann), Chrysomya albiceps (Wiedemann), and Musca domestica L. were less attracted to Ttr carcass-baited traps than traps with Tfr carcasses. However, females of Sarcophaga spp. showed a greater attraction to Ttr carcasses. Females of another sarcophagid fly, Wohlfahrtia spp. exhibited similar attraction tendencies to both types of trap baits. Larvae of S. argyrostoma (Robineau-Desvoidy) collected from Ttr carcasses developed to a significantly longer total body length (10.4 ± 0.04 mm) as compared to the average length of the larvae collected from Tfr carcasses (8.9 ± 0.34 mm). During days 9-13 after rat death, the relative lengths of larvae from Ttr carcasses were not significantly different from Tfr carcasses. Larvae fed on Ttr carcasses pupated 2 days later than the control larvae.

  2. Osseous abnormalities and CT findings in stueve-wiedemann-syndrome (SWS); Ossaere Manifestationen und CT-Befunde bei der seltenen Skelettdysplasie Stueve-Wiedemann (SWS)

    Energy Technology Data Exchange (ETDEWEB)

    Langer, R. [UAE University, Dept. of Radiology, Al Ain (United Arab Emirates); Al-Gazali, L. [UAE University, Dept. of Paediatrics (United Arab Emirates); Haas, D. [FMHS - UAE Univ. and Tawam Hospital - Dept. of Radiology (United Arab Emirates); Raupp, P.; Varady, E. [Dept. of Paediatrics Al Ain (United Arab Emirates)

    2004-02-01

    Purpose: analysis of typical conventional radiological and CT findings in our group of patients with the rare skeletal dysplasia Stueve-Wiedemann-Syndrome (SWS) and comparison with published data. Materials and methods: in 16 newborns with clinically dysmorphic features, dwarfism, and bowed limbs, radiographs of the chest and skeleton were obtained for classification of the underlying skeletal dysplasia. For the first time, computed tomography was performed for further investigation of midface hypoplasia. The early diagnosis of SWS could be made by correlation of the radiological and clinical findings. For evaluation of progression, follow-up radiological examinations of the skeleton were performed in four children surviving infancy. Results: clinically, the newborns with SWS showed dwarfisms, midface hypoplasia, bowed extremities with contractures and had severe problems with respiration, feeding, and swallowing as well as episodes of hyperthermia. Skeletal radiographs revealed bowing of the long tubular bones, most pronounced at the lower extremities. Additional findings were internal triangular cortical diaphyseal thickening at the concave side of the bowing, wide metaphyses with abnormal trabecular pattern and radiolucencies. Four patients survived infancy. Clinically, they suffered from recurrent aspiration pneumonia and recurrent episodes of hyperthermia as well as form cutaneous and mucosal infections. The follow-up radiographs showed progressive bowing of the long tubular bones as well as progressive metaphyseal decalcification. Conclusions: skeletal abnormalities in SWS are so characteristic that an early post partum diagnosis can be made. However, a close cooperation between radiologists, clinicians, and geneticists is required for correlation of clinical and radiological findings. The few cases that survive infancy have progressing orthopaedic problems. (orig.) [German] Ziel: Die typischen radiologischen und CT-Befunde beim kongenitalen Stueve-Wiedemann

  3. Histological features of the pancreas in a patient with congenital hyperinsulinism due to Beckwith-Wiedemann syndrome

    DEFF Research Database (Denmark)

    Christensen, Lene; Christesen, Henrik Boye Thybo; Brusgaard, Klaus

    Introduction: Beckwith-Wiedemann syndrome (BWS) is a genetic disorder with typical features such as macroglossia, abdominal wall defects, macrosomia, visceromegaly and embryonal tumors. Hypoglycemia is reported in about half of all newborns with BWS, usually resolving spontaneously within the first...

  4. No evidence for pathogenic variants or maternal effect of ZFP57 as the cause of Beckwith-Wiedemann Syndrome

    DEFF Research Database (Denmark)

    Boonen, Susanne E; Hahnemann, Johanne M D; Mackay, Deborah

    2012-01-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome, which, in 50-60% of sporadic cases, is caused by hypomethylation of KCNQ1OT1 differentially methylated region (DMR) at chromosome 11p15.5. The underlying defect of this hypomethylation is largely unknown. Recently, recessive mutations...

  5. Ovarian thecal metaplasia of the adrenal gland in association with Beckwith-Wiedemann syndrome

    Institute of Scientific and Technical Information of China (English)

    Eslam; Y; Wassal; Mouhammed; Amir; Habra; Rafael; Vicens; Priya; Rao; Khaled; M; Elsayes

    2014-01-01

    Beckwith-Wiedemann syndrome(BWS) is an overgrowth syndrome associated with increased risk to develop malignancies including adrenocortical carcinoma. Ovarian thecal metaplasia of the adrenal gland is a rare tumorlike mesenchymal lesion in BWS patients that lacks detailed radiological description. We report a 17-yearold female patient with BWS, associated with bilateral Wilms tumor, hepatic hemangiomatosis, pancreatic neuroendocrine tumor, and a phyllodes tumor of the right breast. Surveillance abdominal ultrasound identified a right adrenal mass that was further characterized by computed tomography and magnetic resonance imaging. Radiologically, this mass displayed features that overlap with adrenocortical carcinoma and pheochromocytoma but after pathological examination this proved to be an ovarian thecal metaplasia of the adrenal gland. Adrenal masses in BWS should raise the suspicion for adrenocortical carcinoma though other adrenal tumors including ovarian thecal metaplasia can be seen in these patients.

  6. A perplexing encounter (The poem “Ziemia” by Adam Wiedemann

    Directory of Open Access Journals (Sweden)

    Marcin Jaworski

    2012-01-01

    Full Text Available The poem is interpreted as an ironic self-thematic commentary. The poet’s attitude is critical towards different interpretations: conventional, i.e. based on ambiguity, colloquial or stereotypical and academic, inspired by increasingly new theories. The substantial element in the poem is the relation between the subject (persona and the protagonist that corresponds to and translates into a communicative situation between the author and the reader. The result is complex, intertwined styles and techniques combined with one another. Wiedemann engages in a play with different ways of writing, ironically challenges or undermines poetical strategies to underline the conventionality of literature and communication in general. By doing this, he disturbs the reader by challenging the reader’s reading habits and thus making an impression that the reader is sent away from the poem to a single and unique experience in reality.

  7. H19DMR methylation analysis in patients with Beckwith-Wiedemann syndrome and isolated hemihyperplasia

    Directory of Open Access Journals (Sweden)

    Marcus Vinícius de Matos Gomes

    2005-01-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a congenital overgrowth disorder of complex and heterogeneous etiology involving alterations in genomic imprinting. The cause of isolated hemihyperplasia (IHH is unknown but might be due to partial or incomplete expression of BWS because both these conditions share predisposition for the same types of neoplasias. We investigated the methylation pattern of the putative imprinting control region H19DMR using peripheral blood from 12 patients, six with clinical features of BWS and six with IHH. All the patients had normal karyotypes and paternal uniparental disomy (UPD was excluded in 10 informative cases. The normal H19DMR methylation pattern was found in eight informative patients, indicating that H19DMR methylation was not related to their condition. We suggest that the absence of neoplasias in the BWS and IHH patients studied might be related to the absence of UPD and to the presence of normal H19DMR methylation.

  8. Understanding electrical-thermal transport characteristics of organic semiconductors: Violation of Wiedemann-Franz law

    Science.gov (United States)

    Lu, Nianduan; Li, Ling; Gao, Nan; Liu, Ming

    2016-11-01

    Organic semiconductors exhibit plenty of attractive properties for use as thermoelectric elements. A comprehensive understanding for the electrical-thermal transport characteristics is crucial to design and fabricate the thermoelectric device. We proposed a theoretical model to investigate the electrical conductivity and the electronic thermal conductivity of organic semiconductors based on the hopping transport mechanism. The electrical-thermal transport characteristics of organic semiconductors have been analyzed in detail and compared with the experimental results and Monte Carlo simulation. The Wiedemann-Franz law, connecting the electronic thermal conductivity to the electrical conductivity of organic semiconductors, is generally found to be strongly violated under the effect of temperature, carrier concentration, energetic disorder and electric field.

  9. The Wiedemann-Franz law in a normal metal-superconductor junction

    Institute of Scientific and Technical Information of China (English)

    R Ghanbari; G Rashedi

    2011-01-01

    In this paper the influence of superconducting correlations on the thermal and charge conductances in a normal metal-superconductor (NS) junction in the clean limit is studied theoretically.First we solve the quasiclassical Eilenberger equations,and using the obtained density of states we can acquire the thermal and electrical conductances for the NS junction.Then we compare the conductance in a normal region of an NS junction with that in a single layer of normal metal (N).Moreover,we study the Wiedemann-Franz (WF) law for these two cases (N and NS).From our calculations we conclude that the behaviour of the NS junction does not conform to the WF law for all temperatures.The effect of the thickness of normal metal on the thermal conductivity is also theoretically investigated in the paper.

  10. Observations on the predatory potential of Lutzia fuscana on Aedes aegypti larvae: implications for biological control (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Soujita Pramanik

    2016-12-01

    Full Text Available Among the natural predators, larval stages of the mosquito Lutzia fuscana (Wiedemann, 1820 (Diptera: Culicidae bear potential as a biological control agent of mosquitoes. An estimation of the predatory potential of the larva of L. fuscana against the larva of the dengue vector Aedes aegypti (Linnaeus, 1762 (Diptera: Culicidae was made to highlight its use in vector management. Laboratory experiments revealed that the larva of L. fuscana consumes 19 to 24 A. aegypti larvae per day, during its tenure as IV instar larva. The consumption of A. aegypti larvae was proportionate to the body length (BL and body weight (BW of the predatory larva L. fuscana as depicted through the logistic regressions: y = 1 / (1 + exp(-(-2.09 + 0.35*BL and y = 1 / (1 + exp(-(0.4+ 0.06*BW. While the prey consumption remained comparable among the days, the net weight gained by the L. fuscana larva showed a decreasing trend with the age. On the basis of the results, it is apparent that the larva of the mosquito L. fuscana can be used in the regulation of the mosquito A. aegypti through augmentative release, particularly, in the smaller mosquito larval habitats.

  11. Survey of the Genetic Diversity of Forensically Important Chrysomya (Diptera: Calliphoridae) from Egypt.

    Science.gov (United States)

    Salem, Abeer M; Adham, Fatma K; Picard, Christine J

    2015-05-01

    Minimum postmortem interval estimations of a corpse using blow fly larvae in medicolegal investigations require correct identification and the application of appropriate developmental data of the identified fly species. Species identification of forensically relevant blow flies could be very difficult and time consuming when specimens are damaged or in the event of morphologically indistinguishable immature stages, which are most common at crime scenes. In response to this, an alternative, accurate determination of species may depend on sequencing and molecular techniques for identification. Chrysomyinae specimens (n = 158) belonging to three forensically important species [Chrysomya albiceps (Wiedemann), Chrysomya megacephala (F.), and Chrysomya marginalis (Wiedemann)] (Diptera: Calliphoridae) were collected from four locations in Egypt (Giza, Dayrout, Minya, and North Sinai) and sequenced across the mitochondrial cytochrome oxidase subunit I (COI) gene. Phylogenetic analyses using neighbor-joining, maximum likelihood and maximum parsimony methods resulted in the same topological structure and confirmed DNA based identification of all specimens. Interspecific divergence between pairs of species was 5.3% (C. marginalis-C. megacephala), 7% (C. albiceps-C. megacephala), and 8% (C. albiceps-C. marginalis). These divergences are sufficient to confirm the utility of cytochrome oxidase subunit I gene in the molecular identification of these flies in Egypt. Importantly, the maximum intraspecific divergence among individuals within a species was <1% and the least nucleotide divergence between species used for phylogenetic analysis was 3.6%. This study highlights the need for thorough and diverse sampling to capture all of the possible genetic diversity if DNA barcoding is to be used for molecular identification.

  12. [Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856] / Paul Kaegbein

    Index Scriptorium Estoniae

    Kaegbein, Paul

    2008-01-01

    Arvustus: Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856. - Buch und Bildung im Baltikum. Münster : LIT, 2005. lk. 495-525. Kubermangugümnaasiumi vanemõpetaja Ferdinand Wiedemann kirjutas 1856. aastal kooli ajaloo, mis mingitel põhjustel jäi avaldamata. Tema tööd on kasutanud 1881. aastal Gotthard von Hansen

  13. [Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856] / Paul Kaegbein

    Index Scriptorium Estoniae

    Kaegbein, Paul

    2008-01-01

    Arvustus: Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856. - Buch und Bildung im Baltikum. Münster : LIT, 2005. lk. 495-525. Kubermangugümnaasiumi vanemõpetaja Ferdinand Wiedemann kirjutas 1856. aastal kooli ajaloo, mis mingitel põhjustel jäi avaldamata. Tema tööd on kasutanud 1881. aastal Gotthard von Hansen

  14. Congenital immunodeficiency in an individual with Wiedemann-Steiner syndrome due to a novel missense mutation in KMT2A.

    Science.gov (United States)

    Stellacci, Emilia; Onesimo, Roberta; Bruselles, Alessandro; Pizzi, Simone; Battaglia, Domenica; Leoni, Chiara; Zampino, Giuseppe; Tartaglia, Marco

    2016-09-01

    Wiedemann-Steiner Syndrome (WSS) is an autosomal dominant disorder characterized by hypertrichosis, short stature, intellectual disability, developmental delay, and facial dysmorphism. Since the original reports by Wiedemann and co-workers, and Steiner and Marques, only a few cases have been described. Recently, the clinical variability of the disorder has more precisely been characterized by Jones and co-workers, who also identified heterozygous KMT2A mutations as the molecular defect underlying this condition. Here, we report on a boy with a complex phenotype overlapping WSS but exhibiting epilepsy, feeding difficulties, microcephaly, and congenital immunodeficiency with low levels of immunoglobulins as additional features. Whole exome sequencing allowed identifying a previously unreported de novo KMT2A missense mutation affecting the DNA binding domain of the methyltransferase. This finding expands the clinical phenotype associated with KMT2A mutations to include immunodeficiency and epilepsy as clinically relevant features for this disorder. © 2016 Wiley Periodicals, Inc.

  15. Sjögren, Wiedemann ja liivi keele sõnaraamat. Panus 19. sajandi teadusajalukku / Eberhard Winkler

    Index Scriptorium Estoniae

    Winkler, Eberhard, 1955-

    2009-01-01

    Uuritakse, milline võis olla kummagi teadlase osa esimese liivi keele sõnaraamatu koostamisel: Sjögren, Andreas Johan. Gesammelte Schriften. Band II. Theil I., Joh. Andreas Sjögren's Livische Grammatik nebst Sprachproben ; Band II. Theil II., Joh. Andreas Sjögren's livisch-deutsches und deutsch-livisches Wörterbuch / bearbeitet von Ferdinand Joh. Wiedemann. St. Petersburg, 1861

  16. Quarantine treatment against mediterranean fruit fly (Ceratitis capitata Wiedemann) in mangoes haden variety (Mangifera indica) with gamma irradiation (Co 60)

    OpenAIRE

    Peña C., María E.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Guillen E., Rafael; Servicio Nacional de Sanidad Agraria - SENASA.; Arias A., Gladys C.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Tephritidae fruit flies are among the most damaging pests of fruit crops worldwide Ceratitis capitata Wiedemann, for instance, can infest more than 250 fruit and vegetable crop species, and constitutes the main phytosanitary restrict for export purposes. The investigation was carried out in a SENASA’s Production Center of Sterile Fruit Flies and PIMU’s laboratory; it was supervised by an OIEA’s irradiation expert. This research comprised two stages: 1) Determine the minimum irradiation dose t...

  17. Sjögren, Wiedemann ja liivi keele sõnaraamat. Panus 19. sajandi teadusajalukku / Eberhard Winkler

    Index Scriptorium Estoniae

    Winkler, Eberhard, 1955-

    2009-01-01

    Uuritakse, milline võis olla kummagi teadlase osa esimese liivi keele sõnaraamatu koostamisel: Sjögren, Andreas Johan. Gesammelte Schriften. Band II. Theil I., Joh. Andreas Sjögren's Livische Grammatik nebst Sprachproben ; Band II. Theil II., Joh. Andreas Sjögren's livisch-deutsches und deutsch-livisches Wörterbuch / bearbeitet von Ferdinand Joh. Wiedemann. St. Petersburg, 1861

  18. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  19. Review of magnetostrictive transducers (MsT) utilizing reversed Wiedemann effect

    Science.gov (United States)

    Vinogradov, Sergey; Cobb, Adam; Light, Glenn

    2017-02-01

    Magnetostrictive transduction has been widely utilized in NDE applications, specifically for generation and reception of guided waves for long-range inspection of components such as pipes, vessels, and small tubes. Transverse-motion guided wave modes (e.g., torsional vibrations in pipes) are the most typical choice for long-range inspection applications because the wave motion is in the plane of the structure. Magnetostrictive-based sensors have been available for several years for these wave modes based on the Wiedemann effect. For these sensors, a permanent magnetic bias is applied that is perpendicular to the direction of the propagated guided wave. This bias field strains the material that the guided wave is generated in preferentially in the desired particle motion direction. A time-varying magnetic field oriented parallel to the direction of guided wave propagation is also induced in the material. This time-varying field is induced using an electric coil located near the material surface. The interaction of these two fields produces the guided waves; an inverse effect is used for the receive process. An alternative configuration of a sensor for generating and receiving these traverse-motion guided waves is to swap the biasing and time-varying magnetic fields directions. Since transverse-motion guided wave sensors are typically much longer in the particle motion direction than in the bias field direction, the net effect of this alternative design is that the magnetic biasing length is shorter and different coil designs can be used. Because of this, the alternative design, known as a magnetostrictive transducer (MsT), exhibits a number of unique features compared to the Wiedemann sensor described above, such as: 1) the ability to use smaller rare earth permanent magnets and achieve uniform and self-sustained bias field strengths, 2) the choice of more efficient electric coil arrangements to induce a stronger time-varying magnetic field for a given coil

  20. Germline mutation in NLRP2 (NALP2 in a familial imprinting disorder (Beckwith-Wiedemann Syndrome.

    Directory of Open Access Journals (Sweden)

    Esther Meyer

    2009-03-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a fetal overgrowth and human imprinting disorder resulting from the deregulation of a number of genes, including IGF2 and CDKN1C, in the imprinted gene cluster on chromosome 11p15.5. Most cases are sporadic and result from epimutations at either of the two 11p15.5 imprinting centres (IC1 and IC2. However, rare familial cases may be associated with germline 11p15.5 deletions causing abnormal imprinting in cis. We report a family with BWS and an IC2 epimutation in which affected siblings had inherited different parental 11p15.5 alleles excluding an in cis mechanism. Using a positional-candidate gene approach, we found that the mother was homozygous for a frameshift mutation in exon 6 of NLRP2. While germline mutations in NLRP7 have previously been associated with familial hydatidiform mole, this is the first description of NLRP2 mutation in human disease and the first report of a trans mechanism for disordered imprinting in BWS. These observations are consistent with the hypothesis that NLRP2 has a previously unrecognised role in establishing or maintaining genomic imprinting in humans.

  1. Silver-Russell Syndrome and Beckwith-Wiedemann Syndrome: Opposite Phenotypes with Heterogeneous Molecular Etiology

    Science.gov (United States)

    Õunap, Katrin

    2016-01-01

    Silver-Russell syndrome (SRS) and Beckwith-Wiedemann syndrome (BWS) are 2 clinically opposite growth-affecting disorders belonging to the group of congenital imprinting disorders. The expression of both syndromes usually depends on the parental origin of the chromosome in which the imprinted genes reside. SRS is characterized by severe intrauterine and postnatal growth retardation with various additional clinical features such as hemihypertrophy, relative macrocephaly, fifth finger clinodactyly, and triangular facies. BWS is an overgrowth syndrome with many additional clinical features such as macroglossia, organomegaly, and an increased risk of childhood tumors. Both SRS and BWS are clinically and genetically heterogeneous, and for clinical diagnosis, different diagnostic scoring systems have been developed. Six diagnostic scoring systems for SRS and 4 for BWS have been previously published. However, neither syndrome has common consensus diagnostic criteria yet. Most cases of SRS and BWS are associated with opposite epigenetic or genetic abnormalities in the 11p15 chromosomal region leading to opposite imbalances in the expression of imprinted genes. SRS is also caused by maternal uniparental disomy 7, which is usually identified in 5-10% of the cases, and is therefore the first imprinting disorder that affects 2 different chromosomes. In this review, we describe in detail the clinical diagnostic criteria and scoring systems as well as molecular causes in both SRS and BWS. PMID:27587987

  2. Taste and speech following surgical tongue reduction in children with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Maas, Saskia M; Kadouch, Daniel J; Masselink, Anne-Claire C M; Van Der Horst, Chantal M A M

    2016-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder in which macroglossia is one of the main signs. We investigated the long-term outcome of tongue surgery reduction (TRS) on taste and speech in patients with BWS who were more than 5 years of age and had undergone surgical anterior wedge resection of the tongue. A questionnaire was used to assess medical history and to determine some aspects of speech, taste, psychological well-being, and degree of satisfaction with regard to TRS and tongue mobility. Speech sound error pattern and degree of intelligibility were measured by a speech therapist, and taste was assessed using a validated test. The degree of both intelligibility and satisfaction with the surgery was high. There were some speech errors; especially the interdental 's', addental 't', and addental 'd' were more noticed. We conclude that anterior wedge resection is an effective technique to treat macroglossia in children with BWS, and that it has no long-term consequences for intelligibility and taste perception and only limited consequences for speech.

  3. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  4. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition.

    Science.gov (United States)

    Follett, Peter A

    2009-06-01

    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  5. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  6. Effect of age on cuticular hydrocarbon profiles in adult Chrysomya putoria (Diptera: Calliphoridae).

    Science.gov (United States)

    Braga, Marina Vianna; Pinto, Zeneida Teixeira; Queiroz, Margareth Maria de Carvalho; Blomquist, Gary James

    2016-02-01

    A species-specific complex mixture of highly stable cuticular hydrocarbons (CHCs) covers the external surface of all insects. Components can be readily analyzed by gas chromatography coupled to mass spectrometry (GC-MS) to obtain a cuticular hydrocarbon profile, which may be used as an additional tool for the taxonomic differentiation of insect species and also for the determination of the age and sex of adult and immature forms. We used GC-MS to identify and quantify the CHCs of female and male Chrysomya putoria (Wiedemann, 1818) (Diptera: Calliphoridae) from one to five days old. CHCs ranged from C21 to C35 for females and from C21 to C37 in males. Major compounds were the same for both sexes and were 2-MeC28, C29:1, n-C29, 15-,13-MeC29, 2-MeC30, C31:1, n-C31 and 15-,13-MeC31. The relative abundance of each component, however, varied with age. Cluster Analysis using Bray-Curtis measure for abundance showed that cuticular hydrocarbon profiles are a strong and useful tool for the determination of age in adult C. putoria.

  7. Aedes aegypti survival in the presence of Toxorhynchites violaceus (Diptera: Culicidae fourth instar larvae

    Directory of Open Access Journals (Sweden)

    Daniel S Albeny

    2011-08-01

    Full Text Available The mosquito Aedes aegypti (Linnaeus, 1762 is the main vector of dengue and yellow fever viruses. Different methods have been used to control A. aegypti, including chemical and biological tools. However, chemical control can lead to a subsequent increase in the mosquitoes' insecticide resistance, and biological control represents an important method as an alternative to insecticide usage. Larvae from the Toxorhynchites genus (Diptera: Culicidae are predators of other mosquitoes and represent a potential natural biocontrol agent of A. aegypti larvae. In the present work, A. aegypti larval survival was studied in the presence of the neotropical Toxorhynchites violaceus (Wiedemann, 1821 fourth instar larvae. Toxorhynchites violaceus consumption of A. aegypti increased during the 192 hours of the experiment and was more marked in the intervals between 96 and 120 hours and between 168 and 192 hours, when the A. aegypti survival reached 0%. During the fourth instar, T. violaceus increased its predation on A. aegypti larvae, possibly in order to increase its nutrient storage prior to pupation. Otherwise, low prey consumption can lead to a nutritional deficit for the larvae, delaying the adult's sexual development and reducing its egg production. Here we show that A. aegypti survival can be reduced by the T. violaceus fourth larvae predation under laboratory conditions

  8. Determination of Calliphoridae (Diptera) fauna and seasonal distribution on carrion in Ankara province.

    Science.gov (United States)

    Sabanoğlu, Burcu; Sert, Osman

    2010-07-01

    This study was conducted from March 2006 to 2007. The aim of the study was to determine the forensically significant Calliphoridae (Diptera) species and their seasonal distribution in Ankara province at Beytepe Campus. Pig carcasses were killed by a veterinary using pentobarbital sodium with intervals from 2 to 3 weeks to a month. Samples were collected from the carcass everyday in the morning, in the afternoon, and at sunset. Temperature and parameters of weather, such as cloudy, sunny, rainy, and snowy, were recorded at each visit. Phaenicia sericata (Meigen), Chrysomya albiceps (Wiedemann), Calliphora vomitoria (Linnaeus), and Calliphora vicina (Robineau-Desvoidy) species, which belong to Calliphoridae family, were collected. It was shown that the seasonal distribution of the collected species was different from each other. The species were determined on carcass between the following times; P. sericata, from April to November; C. albiceps, from May to November; Ca. vomitoria, from February to June and from September to December; and Ca. vicina, from February to May and in June and September. Calliphoridae fauna and its annual seasonal distribution in Turkey on 12 pig carcasses were reported for the first time in this study.

  9. Hyperinsulinemic hypoglycemia in Beckwith-Wiedemann syndrome due to defects in the function of pancreatic beta-cell adenosine triphosphate-sensitive potassium channels

    DEFF Research Database (Denmark)

    Hussain, K; Cosgrove, K E; Shepherd, R M

    2005-01-01

    Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients the hypo......Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients...

  10. Glosectomía parcial en paciente portador del síndrome de Beckwith-Wiedemann: relato del caso

    Directory of Open Access Journals (Sweden)

    Victor Diniz Borborema dos Santos

    2015-10-01

    Full Text Available El síndrome de Beckwith-Wiedemann es una alteración congénita con diversas manifestaciones clínicas, de entre las cuales las más prevalentes son la macroglosia (97%, el gigantismo (88% y los defectos de la pared abdominal (80%. Ortodónticamente, la mayoría de los pacientes presentan mordida abierta anterior y relación de clase III de Angle. La macroglosia puede causar problemas estéticos y anomalías funcionales relacionadas con el habla, la masticación, fonación, deglución y respiración, con potencial de obstrucción de las vías respiratorias superiores y disminución de la estabilidad del tratamiento ortoquirúrgico. Con el fin de evitar episodios como este, es necesaria la realización de una glosectomía parcial en algunos pacientes. El presente trabajo realiza consideraciones con relación al diagnóstico y tratamiento de la macroglosia y relata el caso clínico de un paciente portador del síndrome de Beckwith-Wiedemann que fue intervenido por medio de glosectomía parcial, utilizando la técnica preconizada por Obwergeser et al. (1964 y que en un postoperatorio de 3 años presentó resultados cosméticos y funcionales satisfactorios.

  11. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  12. Effects of superparasitism on immature and adult stages of Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae) reared on Ceratitis capitata Wiedemann (Diptera: Tephritidae).

    Science.gov (United States)

    Devescovi, F; Bachmann, G E; Nussenbaum, A L; Viscarret, M M; Cladera, J L; Segura, D F

    2017-04-06

    The optimal use of available host by parasitoid insects should be favoured by natural selection. For solitary parasitoids, superparasitism (i.e. the egg-laying of several eggs/host) may represent a detrimental phenomenon both in a biological and an applied sense, but under certain circumstances it may be adaptive. Here, we studied the effects of increasing levels of superparasitism (LSPs, number of parasitoid larvae/host) on fitness-related parameters of the immature and adult stages of Diachasmimorpha longicaudata, a solitary endoparasitoid parasitizing Ceratitis capitata. We investigated the moment when supernumerary parasitoid larvae are eliminated and the effects produced by this process, together with its repercussion on female fecundity, parasitism rate, sex ratio, adult survival, flight ability and body size. Complete elimination of competitors occurred soon after larval hatching, before reaching the second larval stage. Elimination process took longer at higher LSPs, although a normal developmental (egg-adult) time was achieved. For LSPs 1, 2, 3 and 5 the effects on parasitoid emergence were mild, but LSP 10 led to the death of all developing parasitoids. Aside from this, to develop in superparasitized hosts did not significantly affect any of the evaluated parameters, and only a female-biased sex ratio was observed at higher LSPs. However, the effects of superparasitism on the adults may have a different outcome under more variable conditions in the field, once they are released for biological control purposes.

  13. UV-B radiation-related effects on conidial inactivation and virulence against Ceratitis capitata (Wiedemann) (Diptera; Tephritidae) of phylloplane and soil Metarhizium sp. strains.

    Science.gov (United States)

    Fernández-Bravo, María; Flores-León, Alejandro; Calero-López, Salvador; Gutiérrez-Sánchez, Fernando; Valverde-García, Pablo; Quesada-Moraga, Enrique

    2017-09-01

    Recent studies have demonstrated the presence of Metarhizium species on the epigeal areas of weeds and woody plants in various Mediterranean ecosystems, and the question arises whether isolates from the phylloplane, which experiences greater exposure to environmental UV-B radiation than soil isolates do, could have better UV-B radiation tolerance. The in vitro response of 18 Metarhizium strains isolated from phylloplane and soil of several Mediterranean ecosystems to UV-B radiation and the in vitro and in vivo effects of UV-B radiation on the viability and virulence of a selected M. brunneum strain against C. capitata were determined. The conidial germination, culturability and colony growth of these strains exposed to 1200mWm(-2) for 2, 4 or 6h were evaluated. Germination rates below 30% and poor conidia recovery rates were observed for all strains. However, no relationship between the Metarhizium species or isolation habitat and the effect of UV-B radiation was found. Strain EAMa 01/58-Su, which showed a high tolerance to UV-B inactivation in terms of relative germination, was subsequently selected to investigate the UV-B related effects on virulence toward C. capitata adults. In a series of bioassays, the virulence and viability was determined using pure dry conidia, which were irradiated with 1200mWm(-2) for 6h prior or after adult flies were inoculated, which resulted in a significant 84.7-86.4% decrease in conidial viability but only a slightly significant reduction of virulence, with 100.0% and 91.4% adult mortality rates and 4.6 and 5.9days average survival time for the no UV-B and UV-B treatments, respectively. A second series of experiments was performed to determine whether the UV-B effects on strain EAMa 01/58-Su were dose- or exposure time-dependent. Adult flies were inoculated with five doses (1.0×10(4)-1.0×10(8)conidiaml(-1)) and then irradiated at 1200mWm(-2) for 6h, and similar LC50 values, 3.8×10(7) and 4.3×10(7)conidiaml(-1), were determined for the UV-B and no UV-B treatments, respectively. However, the LT50 values for flies inoculated with 1.0×10(8)conidiaml(-1) and with1.0×10(7)conidiaml(-1) were 15.1% and 30.8% longer for UV-B treatments than no UV-B treatments, respectively. Next, adult flies were treated with 1.0×10(8)conidiaml(-1) and then exposed to 1200mWm(-2) for 0, 6, 12, 24, 36 and 48h, and the relationships among exposure time and conidia viability and fly mortality losses were determined. The exposure time for adult flies at 1200mWm(-2) to achieve a 50% reduction in fly mortality was 47.2h, which was longer than that of 5.6h required for a 50% reduction in conidia viability. Our results show that the UV-B radiation significantly affected the virulence of EAMa 01/58-Su strain against C. capitata adults, with this effect being dependent on the exposure time but not related to fungal dosage. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann),Version 2.0

    Science.gov (United States)

    MEDHOST,Version 2.0 is the second revision of:"MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly,Ceratitis capitata(Wiedemann),Version 1.0," which was released in 1998 as a Windows-based executable database and listed all plant species reported as hosts of Medit...

  15. Glosectomía parcial en paciente portador del síndrome de Beckwith-Wiedemann: relato del caso

    OpenAIRE

    Victor Diniz Borborema dos Santos; Gleysson Mathias de Assis; José Sandro Pereira da Silva; Adriano Rocha Germano

    2015-01-01

    El síndrome de Beckwith-Wiedemann es una alteración congénita con diversas manifestaciones clínicas, de entre las cuales las más prevalentes son la macroglosia (97%), el gigantismo (88%) y los defectos de la pared abdominal (80%). Ortodónticamente, la mayoría de los pacientes presentan mordida abierta anterior y relación de clase III de Angle. La macroglosia puede causar problemas estéticos y anomalías funcionales relacionadas con el habla, la masticación, fonación, deglución y respiración, c...

  16. Persistent congenital hyperinsulinism in two patients with Beckwith-Wiedemann syndrome due to mosaic uniparental disomy 11p.

    Science.gov (United States)

    Zarate, Yuri A; Shur, Natasha; Robin, Andrew; Garnica, Adolfo D; Quintos, Jose Bernardo; Schaefer, G Bradley

    2014-09-01

    Congenital hyperinsulinism (CHI) is a rare metabolic disease characterized by inappropriate insulin secretion in the presence of hypoglycemia. We describe the clinical presentation and management of congenital hyperinsulinism and persistent hypoglycemia in two infants. Both patients had an initial clinical diagnosis of Beckwith-Wiedemann syndrome (BWS) but normal methylation analysis for LIT1 and H19 status. Both patients were eventually found to have mosaic uniparental disomy 11p diagnosed by single nucleotide polymorphism (SNP) array in DNA isolated from lymphoblasts and fibroblasts, respectively. We report that patients with mosaic BWS are at increased risk for both transient and refractory hypoglycemia that may need aggressive management with diazoxide, octreotide, high glucose infusion rates, and a frequent feeding regime. Our patient experience supports the case for pursuing further testing in patients with features of BWS with normal methylation studies, karyotype, and SNP arrays on blood. The next logical step is SNP array on skin biopsy to rule out mosaicism.

  17. Fibroadenoma in Beckwith-Wiedemann syndrome with paternal uniparental disomy of chromosome 11p15.5.

    Science.gov (United States)

    Takama, Yuichi; Kubota, Akio; Nakayama, Masahiro; Higashimoto, Ken; Jozaki, Kosuke; Soejima, Hidenobu

    2014-12-01

    Herein is described a case of breast fibroadenomas in a 16-year-old girl with Beckwith-Wiedemann syndrome (BWS) and uniparental disomy (UPD) of chromosome 11p15.5. She was clinically diagnosed with BWS and direct closure was performed for an omphalocele at birth. Subtotal and 90% pancreatectomy were performed for nesidioblastosis at the ages 2 months and 8 years, respectively. Bilateral multiple breast fibroadenomas were noted at the age of 16 and 17 years. In this case, paternal UPD of chromosome 11p15.5 was identified on microsatellite marker analysis. The relevant imprinted chromosomal region in BWS is 11p15.5, and UPD of chromosome 11p15 is a risk factor for BWS-associated tumorigenicity. Chromosome 11p15.5 consists of imprinting domains of IGF2, the expression of which is associated with the tumorigenesis of various breast cancers. This case suggests that fibroadenomas occurred in association with BWS.

  18. Defining species boundaries in the Merodon avidus complex (Diptera, Syrphidae using integrative taxonomy, with the description of a new species

    Directory of Open Access Journals (Sweden)

    Jelena Ačanski

    2016-10-01

    Full Text Available Several recent studies have detected and described complexes of cryptic and sibling species in the genus Merodon (Diptera, Syrphidae. One representative of these complexes is the Merodon avidus complex that contains four sibling species, which have proven difficult to distinguish using traditional morphological characters. In the present study, we use two geometric morphometric approaches, as well as molecular characters of the 5’-end of the mtDNA COI gene, to delimit sibling taxa. Analyses based on these data were used to strengthen species boundaries within the complex, and to validate the status of a previously-recognized cryptic taxon from Lesvos Island (Greece, here described as Merodon megavidus Vujić & Radenković sp. nov. Geometric morphometric results of both wing and surstylus shape confirm the present classification for three sibling species-M. avidus (Rossi, 1790, M. moenium Wiedemann in Meigen, 1822 and M. ibericus Vujić, 2015-and, importantly, clearly discriminate the newly-described taxon Merodon megavidus sp. nov. In addition to our geometric morphometric results, supporting characters were obtained from molecular analyses of mtDNA COI sequences, which clearly differentiated M. megavidus sp. nov. from the other members of the M. avidus complex. Molecular analyses revealed that the earliest divergence of M. ibericus occurred around 800 ky BP, while the most recent separation happened between M. avidus and M. moenium around 87 ky BP.

  19. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  20. Thermal death kinetics of Mediterranean, Malaysian, melon, and oriental fruit fly (Diptera: Tephritidae) eggs and third instars.

    Science.gov (United States)

    Armstrong, John W; Tang, Juming; Wang, Shaojin

    2009-04-01

    The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50 degrees C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian, Mediterranean (Hawaii and Israel strains), melon, Mexican, and oriental fruit fly eggs or third instars and wild Mediterranean fruit fly (Hawaii strain) eggs or third instars showed that oriental fruit fly was the most thermotolerant among the third instars, and the difference in heat tolerance between third instars and eggs was negligible at 50 degrees C.

  1. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  2. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  3. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Ammonium Acetate Enhances the Attractiveness of a Variety of Protein-Based Baits to Female Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Smith, Trevor R; Fox, Abbie J; Vargas, Roger I

    2015-04-01

    Ammonia and its derivatives are used by female fruit flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally based control strategies such as food-based lures and insecticidal baits targeting pestiferous fruit fly species. In field cage studies conducted in Hawaii, we examined the behavioral response of laboratory-reared male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann), to seven commercially available protein baits and to beer waste, a relatively inexpensive and readily available substance. Each material was tested alone or in combination with either ammonium acetate or ammonium carbonate. For the majority of baits evaluated, the presence of ammonium acetate, but not ammonium carbonate, elicited a significantly greater level of response of female C. capitata compared with the protein baits alone. The addition of ammonium acetate to selected baits increased bait attractiveness to a level comparable with that elicited by the most widely used spinosad-based protein bait, GF-120. Our findings indicate that the addition of ammonium acetate to commercially available proteinaceous baits and to beer waste can greatly improve their attractiveness to C. capitata, potentially increasing the bait's effectiveness for fruit fly monitoring and suppression. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  6. Developmental rates of immatures of three Chrysomya species (Diptera: Calliphoridae) under the effect of methylphenidate hydrochloride, phenobarbital, and methylphenidate hydrochloride associated with phenobarbital.

    Science.gov (United States)

    Rezende, Fábio; Alonso, Marcela A; Souza, Carina M; Thyssen, Patrícia J; Linhares, Arício X

    2014-05-01

    Entomotoxicology is focused on obtaining data on necrophagous entomofauna, for criminal investigations purposes. This study aimed to evaluate the effect of different concentrations of methylphenidate hydrochloride, phenobarbital, and their association on the developmental rate, larval and pupal survivorship, and the interval of emergence of adults of Chrysomya albiceps (Wiedemann), Chrysomya megacephala (Fabricius), and Chrysomya putoria (Wiedemann) (Diptera: Calliphoridae). Considering the therapeutic dose (TD) of methylphenidate hydrochloride (0.29 mg/Kg), the concentrations tested were 10× TD, 50× TD, and 100× TD. For phenobarbital, the concentrations used were 1× TD (=150 mg/Kg), 3.3× TD, and 6.7× TD. For the association of the drugs, the combinations used were 10× TD-methylphenidate hydrochloride plus 1× TD-phenobarbital, 50× TD-methylphenidate hydrochloride plus 3.3× TD-phenobarbital, and 100× TD-methylphenidate hydrochloride plus 6.7× TD-phenobarbital. The control group, without addition of drug, was maintained under the same conditions of temperature (25 ± 1 °C), humidity (70 ± 10%), and photoperiod (12 h). Specimens of each group were weighed every 12 h until pupariation. The developmental rate of the three Chrysomya species immatures was monitored. For C. albiceps the developmental time was delayed in 24 h for methylphenidate hydrochloride group and in 12 h for the phenobarbital and the drugs association groups. The effect was observed only at specific ages for C. megacephala, without altering the developmental time. For C. putoria, the developmental time was delayed in 12 h for methylphenidate hydrochloride group and in 24 h for the phenobarbital and the drugs association groups. The emergence interval was similar among all experimental groups, but larval and pupal viabilities were affected in different ways.

  7. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano

    2016-12-01

    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Host status of grapefruit and Valencia oranges for Anastrepha serpentina and Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena M Tarshis

    2011-04-01

    Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) is sporadically captured in the Rio Grande Valley of Texas. Although its preferred hosts are in the Sapotaceae family, several varieties of Citrus, including grapefruit and oranges are listed as alternate hosts. Although Mexican fruit fly, Anastrepha ludens (Loew), is known to be a major pest of Citrus, doubt exists as to the status of Citrus as a breeding host for A. serpentina. To evaluate the host status of commercial Citrus for A. serpentina we compared oviposition and development with that of A. ludens under laboratory conditions with 'Rio Red' grapefruit (Citrus paradisi MacFayden) and 'Valencia' oranges [Citrus sinensis (L.) Osbeck] in different stages of maturity. Both fly species oviposited in early season fruit in which the eggs and larvae died in the fruit albedo. Survival of either species to the adult stage occurred in later season grapefruit. In oranges, no A. serpentina larvae survived compared with 150 A. ludens surviving to adults. Survival on both Citrus species was much lower for A. serpentina, only approximately 5% of eggs eclosed into larvae in grapefruit compared with approximatley 50% for A. ludens. In oranges approximately 16% of A. serpentina eggs eclosed compared with approximately 76% for A. ludens. In grapefruit, only one fourth as many A. serpentina larvae survived to the adult stage compared with A. ludens. Additional experiments were performed in a greenhouse on small, caged trees of la coma (Sideroxylon celastrinum H.B.K.), a Texas species of Sapotaceae. The A. serpentina females readily oviposited into these berries and normal adults emerged. The present low incidence of the adults, coupled with the high mortality during development of the larvae, suggests that Texas citrus is unlikely to support a breeding population of A. serpentina.

  9. Estudo taxonômico de Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Ronaldo Toma

    2002-01-01

    Full Text Available Taxonomic study of Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae. The genus Leschenaultia Robineau-Desvoidy, 1830 is redescribed. Two genera are considered as its junior synonyms: Echinomasicera Townsend, 1915 syn. nov. and Parachaetopsis Blanchard, 1959 syn. nov. Thirty two especies are treated, as follows: 18 described as new, Leschenaultia aldrichi, sp. nov. (Brazil, Santa Catarina, L. arnaudi sp. nov. (Haiti, La Salle, L. bergenstammi sp. nov. (Peru, San Martin, L. bessi sp. nov. (Brazil, Santa Catarina, L. bigoti sp. nov. (Peru, Huanuco, L. blanchardi sp. nov. (Equador, Cuenca, L. braueri sp. nov. (Brazil, Mato Grosso, L. brooksi sp. nov. (Brazil, Rio de Janeiro, L. coquilletti sp. nov. (Brazil, Santa Catarina; L. cortesi sp. nov. (Venezuela, Maracay, L. currani sp. nov. (Brazil, São Paulo, L. loewi sp. nov. (Mexico, Vera Cruz, L. macquarti sp. nov. (U. S. A., Arizona, L. reinhardi sp. nov. (Canada, Quebec, L. sabroskyi sp. nov. from (U. S. A., California, L. schineri sp. nov. (U. S. A., California, L. thompsoni sp. nov. (Mexico, Mexico City, L. townsendi sp. nov. (Mexico, Puebla, and 14 known species, for these, diagnoses are given: L. adusta (Loew, 1872; L. americana (Brauer & Bergenstamm, 1893; L. bicolor (Macquart, 1846 = L. fusca (Townsend, 1916 syn. nov.; = Parachaetopsis proseni Blanchard, 1959 syn. nov.; L. ciliata (Macquart, 1848; L. exul (Townsend, 1892; L. fulvipes (Bigot, 1887; L. grossa Brooks, 1947; L. halisidotae Brooks, 1947; L. hospita Reinhard, 1952; L. hystrix (Townsend, 1915 comb. nov., L. jurinioides (Townsend, 1895; L. leucophrys (Wiedemann, 1830 = Leschenaultia latifrons (Walker, 1852 syn. nov. = Parachaeta nigricalyptrata (Macquart, 1855 syn. nov.; L. montagna (Townsend, 1912; L. nuda Thompson, 1963. One species was not examined, Leschenaultia nigrisquamis (Townsend, 1892, and two were not recognized, L. trichopsis (Bigot, 1887 and L. hirta Robineau-Desvoidy, 1830. Keys for Nearctic and Neotropical species

  10. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  11. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract. © 2014 Entomological Society of America.

  12. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  13. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  14. Hypopituitarism in a patient with Beckwith-Wiedemann syndrome due to hypomethylation of KvDMR1.

    Science.gov (United States)

    Baiocchi, Michela; Yousuf, Fatimah Sireen; Hussain, Khalid

    2014-04-01

    Beckwith-Wiedemann syndrome (BWS) is caused by dysregulation of imprinted genes on chromosome 11.p15.5. The syndrome includes overgrowth, macroglossia, organomegaly, abdominal wall defects, hypoglycemia, and long-term malignancy risk. No patient who has BWS has been reported with hypopituitarism. We describe a patient who presented at birth with macrosomia, macroglossia, respiratory distress, jaundice, and hypoglycemia, and who was followed for 4.5 years. Genetic test for BWS was performed, which detected loss of maternal methylation on region KvDMR1 (11p15.5). The hypoglycemia was attributable to hyperinsulinism and was treated with diazoxide and chlorothiazide. She responded well, but the hypoglycemia returned after reducing the diazoxide. It was possible to stop the diazoxide after 2.5 years. On routine follow-up she was noted to be developing short stature. Baseline pituitary and growth hormone (GH) stimulation tests detected GH deficiency and secondary hypothyroidism. A brain MRI showed a small anterior pituitary gland. Thereafter, thyroxine and replacement therapy with GH were started, which resulted in a remarkable improvement in growth velocity. This is the first patient to be reported as having hypopituitarism and BWS. It is unclear if the BWS and the hypopituitarism are somehow connected; however, further investigations are necessary. Hypopituitarism explains the protracted hypoglycemia and the short stature. In our patient, GH therapy seems to be safe, but strict follow-up is required given the increased cancer risk related to BWS.

  15. Clinical and molecular analyses of Beckwith-Wiedemann syndrome: Comparison between spontaneous conception and assisted reproduction techniques.

    Science.gov (United States)

    Tenorio, Jair; Romanelli, Valeria; Martin-Trujillo, Alex; Fernández, García-Moya; Segovia, Mabel; Perandones, Claudia; Pérez Jurado, Luis A; Esteller, Manel; Fraga, Mario; Arias, Pedro; Gordo, Gema; Dapía, Irene; Mena, Rocío; Palomares, María; Pérez de Nanclares, Guiomar; Nevado, Julián; García-Miñaur, Sixto; Santos-Simarro, Fernando; Martinez-Glez, Víctor; Vallespín, Elena; Monk, David; Lapunzina, Pablo

    2016-10-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by an excessive prenatal and postnatal growth, macrosomia, macroglossia, and hemihyperplasia. The molecular basis of this syndrome is complex and heterogeneous, involving genes located at 11p15.5. BWS is correlated with assisted reproductive techniques. BWS in individuals born following assisted reproductive techniques has been found to occur four to nine times higher compared to children with to BWS born after spontaneous conception. Here, we report a series of 187 patients with to BWS born either after assisted reproductive techniques or conceived naturally. Eighty-eight percent of BWS patients born via assisted reproductive techniques had hypomethylation of KCNQ1OT1:TSS-DMR in comparison with 49% for patients with BWS conceived naturally. None of the patients with BWS born via assisted reproductive techniques had hypermethylation of H19/IGF2:IG-DMR, neither CDKN1 C mutations nor patUPD11. We did not find differences in the frequency of multi-locus imprinting disturbances between groups. Patients with BWS born via assisted reproductive techniques had an increased frequency of advanced bone age, congenital heart disease, and decreased frequency of earlobe anomalies but these differences may be explained by the different molecular background compared to those with BWS and spontaneous fertilization. We conclude there is a correlation of the molecular etiology of BWS with the type of conception. © 2016 Wiley Periodicals, Inc.

  16. Excess functional copy of allele at chromosomal region 11p15 may cause Wiedemann-Beckwith (EMG) syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, T.; Saitoh, S.; Jinno, Y.; Niikawa, N.; Matsumoto, T. [Nagasaki Univ. School of Medicine (Japan); Narahara, K. [Okayama Univ. School of Medicine, Okayama (Japan); Fukushima, Y. [Saitama Children`s Hospital, Iwatsuki (Japan)

    1994-02-15

    Wiedemann-Beckwith syndrome (WBS) is a genetic disorder with overgrowth and predisposition to Wilms` tumor. The putative locus of the gene responsible for this syndrome is assigned to chromosome region 11p15.5, and genomic imprinting in this region has been proposed: the paternally derived gene(s) at 11p15.5 is selectively expressed, while the maternally transmitted gene(s) is inactive. The authors examined 18 patients for the parental origin of their 11p15 regions. DNA polymorphism analyses using 6 loci on chromosome 11 showed that 2 patients with duplications of 11p15 regions from their respective fathers and one from the mother, indicating the transmission of an excessive paternal gene at 11p15 to each patient. The result, together with the previous findings in karyotypically normal or abnormal patients and in overgrowth mouse experiments, are consistent with imprinting hypothesis that overexpression of paternally derived gene(s) at 11p15.5, probably the human insulin-like growth factor II (IFG-II) gene, may cause the phenotype. Total constitutional uniparental paternal disomy (UPD) or segmental UPD for the 6 loci examined of chromosome 11 was not observed in our 12 sporadic patients. In order to explain completely the inheritance of this syndrome in patients with various chromosomal constitutions, the authors propose an alternative imprinting mechanism involving the other locus that may be paternally imprinted and may suppress the expression of this gene. 28 refs., 3 figs., 1 tab.

  17. Genome-wide paternal uniparental disomy as a cause of Beckwith-Wiedemann syndrome associated with recurrent virilizing adrenocortical tumors.

    Science.gov (United States)

    Bertoin, F; Letouzé, E; Grignani, P; Patey, M; Rossignol, S; Libé, R; Pasqual, C; Lardière-Deguelte, S; Hoeffel-Fornes, C; Gaillard, D; Previderè, C; Delemer, B; Lalli, E

    2015-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by fetal macrosomia, macroglossia, and abdominal wall defects. BWS patients are at risk to develop Wilms tumor, neuroblastoma, hepatoblastoma, and adrenal tumors. A young woman with BWS features, but with inconclusive genetic evidence for the disease, came to clinical observation for signs of virilization at the age of 16 years. An adrenocortical tumor was diagnosed and surgically resected. The tumor underwent 2 local relapses that were also surgically treated. The patient was also operated to remove a breast fibroadenoma. SNP arrays were used to analyze chromosome abnormalities in normal and tumor samples from the patient and her parents. The patient presented genome-wide mosaic paternal uniparental disomy (patUPD) both in the adrenocortical and the breast tumors, with different degrees of loss of heterozygosity (LOH). The more recent relapses of the adrenocortical tumor showed a loss of part of chromosome 17p that was absent in the first tumor. Analysis of a skin biopsy sample also showed mosaic patUPD with partial LOH, while no LOH was detected in leukocyte DNA. This case shows that virilizing adrenocortical tumors may be a clinical feature of patients with BWS. The SNP array technology is useful to diagnose genome-wide patUPD mosaicism in BWS patients with an inconclusive molecular diagnosis and underlines the tumorigenic potential of the absence of the maternal genome combined with an excess of the paternal genome.

  18. MACROGLOSSIA AS A CAUSE OF ATYPICAL SWALLOWING: COMPARISON OF EVALUATION AND LOGOPEDIC TREATMENT BETWEEN BECKWITH-WIEDEMANN AND DOWN PATIENTS

    Directory of Open Access Journals (Sweden)

    C. Anichini

    2013-12-01

    Full Text Available Atypical swallowing is the persistence of childlike deglutition at the end of dental eruption. One of the main causes is macroglossia, that is the abnormal enlargement of the tongue. The treatment is logopedic and/or surgical. Children with macroglossia have an increased incidence of respiratory diseases and infections, as well as malocclusions, articulatory defects and aesthetic damage. In this study we focused on two genetic syndromes with macroglossia: Beckwith-Wiedemann Syndrome (BWS and Down Syndrome (DS: 7 patients were evaluated for logopedic treatment: 3 are affected by BWS, 2 are affected by DS. In addition, 2 patients with isolated atypical swallowing were included in the study to emphasize problems connected with atypical swallowing. All the patients underwent a global examination and a personalized logopedic therapy scheme was planned. With the exception of one of them who was lost to follow up and who did not continue with the exercises the speech therapist had recommended, all the children showed good response and compliance with remarkable improvements, thus proving the importance of an early, constant and intensive logopedic treatment.

  19. Imprinted anomalies in fetal and childhood growth disorders: the model of Russell-Silver and Beckwith-Wiedemann syndromes.

    Science.gov (United States)

    Netchine, Irène; Rossignol, Sylvie; Azzi, Salah; Brioude, Fréderic; Le Bouc, Yves

    2012-01-01

    Fetal growth is a complex process. Its restriction is associated with morbidity and long term metabolic consequences. Imprinted genes have a critical role in mammalian fetal growth. The human chromosome 11p15 encompasses two imprinted domains regulated by their own differentially methylated region (DMR), also called Imprinted Control Region (ICR1 at the H19/IGF-2 domain, paternally methylated), and ICR2 at the KCNQ1/CDKN1C domain (maternally methylated). Loss of imprinting at these two domains is implicated in two growth disorders clinically opposite. A loss of DNA methylation (LOM) at ICR1 is identified in over 50% of patients with Russell-Silver syndrome (RSS), characterized by intrauterine and postnatal growth retardation, spared cranial growth, frequent body asymmetry and severe feeding difficulties. Inversely, a gain of methylation at ICR1 is found in 10% of patients with Beckwith-Wiedemann syndrome (BWS), an overgrowth syndrome with an enhanced childhood tumor risk. We have identified over 150 RSS patients with 11p15 LOM allowing long-term follow-up studies and proposal of clinical guidelines. We also found that ∼10% of RSS patients and ∼25% of BWS patients have multilocus LOM at imprinted regions other than ICR1 or ICR2 11p15, respectively. Recent studies have identified cis-acting regulatory elements and trans-acting factors involved in the regulation of 11p15 imprinting, establishing new potential mechanisms of RSS and BWS.

  20. Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib in a patient with multilocus imprinting disturbance: a female-dominant phenomenon?

    Science.gov (United States)

    Sano, Shinichiro; Matsubara, Keiko; Nagasaki, Keisuke; Kikuchi, Toru; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fukami, Maki; Kagami, Masayo; Ogata, Tsutomu

    2016-08-01

    Although recent studies have often revealed the presence of multilocus imprinting disturbance (MLID) at differentially methylated regions (DMRs) in patients with imprinting disorders (IDs), most patients exhibit clinical features of the original ID only. Here we report a Japanese female patient with Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib. Molecular studies revealed marked methylation defects (MDs) at the Kv-DMR and the GNAS-DMRs and variable MDs at four additional DMRs, in the absence of a mutation in ZFP57, NLRP2, NLRP7, KHDC3L and NLRP5. It is likely that the MDs at the Kv-DMR and the GNAS-DMRs were sufficient to cause clinically recognizable IDs, whereas the remaining MDs were insufficient to result in clinical consequences or took place at DMRs with no disease-causing imprinted gene(s). The development of MLID and the two IDs of this patient may be due to a mutation in a hitherto unknown gene for MLID, or to a reduced amount of DNA methyltransferase-1 (DNMT1) available for the methylation maintenance of DMRs because of the consumption of DNMT1 by the maintenance of X-inactivation. In support of the latter possibility, such co-existence of two IDs has primarily been identified in female patients, and MLID has predominantly been identified as loss of methylations.

  1. Cyt1Aa protein from Bacillus thuringiensis (Berliner) serovar israelensis is active against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann).

    Science.gov (United States)

    Vidal-Quist, J Cristian; Castañera, Pedro; González-Cabrera, Joel

    2010-09-01

    Ceratitis capitata (Wiedemann) is one of the world's most destructive fruit pests. The aim of this study was to ascertain insecticidal activity of Bacillus thuringiensis (Berliner) delta-endotoxins to C. capitata. Among 42 selected Bacillus strains, only B. thuringiensis serovar israelensis (Bti) solubilised protoxins showed biological activity against C. capitata neonate larvae, whereas Bti spore and crystal mixture was inactive. Insecticidal activity of Bti protoxins was significantly enhanced by incubation with Culex pipiens L. gut extracts. Overdigestion of Bti protoxins with Sesamia nonagrioides (Lefebvre) gut extracts suppressed biological activity against C. capitata, and this correlated with degradation of Cyt toxins. Cyt1Aa solubilised protoxin showed the highest toxicity, LC(50) after 7 days of 4.93 microg cm(-2), while proteolytical processing of Cyt1Aa protoxins by larval gut extracts did not enhance insecticidal activity. The present study provides evidence for the first time of the insecticidal activity of a B. thuringiensis strain against C. capitata and identifies a single delta-endotoxin with potential for controlling this pest. (c) 2010 Society of Chemical Industry.

  2. Morphology and identification of first instars of the European and Mediterranean blowflies of forensic importance

    DEFF Research Database (Denmark)

    Szpila, K.; Hall, M. J. R.; Pape, T.

    2013-01-01

    First instars of Lucilia ampullacea Villeneuve, Lucilia caesar Linnaeus, Lucilia cuprina Weidemann, Lucilia richardsi Collin, Lucilia sericata Meigen and Lucilia silvarum Meigen (Diptera: Calliphoridae) are thoroughly documented with scanning electron microscopy images, light microscopy photographs...

  3. De edelherthorzel Cephenemyia auribarbis gekweekt (Diptera: Oestridae)

    NARCIS (Netherlands)

    Aartsen, van B.; Zeegers, Th.

    1999-01-01

    The rearing of the botfly Cephenemyia auribarbis (Diptera: Oestridae) After several failures we finally succeeded in rearing botflies Cephenemyia from third-instar larvae. From a red deer shot at 13 March 1998 about one hundred larvae of Cephenemyia auribarbis (Meigen, 1824) were collected. Ten

  4. Tabanid flies (Insecta: Diptera from Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Kailash Chandra

    2015-08-01

    Full Text Available The paper presents an account on the Tabanidae (Diptera from Chhattisgarh, which includes 16 species representing five genera under three subfamilies: Pangoniinae, Chrysopsinae and Tabaninae. Among these species, Haematopota latifascia Ricardo is new addition to the fauna of Chhattisgarh. The distributional area of the collection localities, key characters are also provided. 

  5. A receiver operating characteristic analysis approach for the assessment of the separation of female Mediterranean fruit fly (Diptera: Tephritidae) oviposition distributions.

    Science.gov (United States)

    Alonzo, Todd A; Nakas, Christos T; Papadopoulos, Nikos T; Papachristos, Dimitrios P

    2009-10-01

    Average fecundity rates and survival are the main components of fitness estimates in studies comparing performance of insect populations. Reproduction is inherently age related in most insect species, and age-specific offspring production is very important in determining fitness components. However, comparison of age-specific reproduction rates are not straight forward and most studies limit analyses to comparisons of average fecundity rates and survival as the main components of the performance of insect populations. We develop a receiver operating characteristic (ROC) curve approach to compare lifetime oviposition distributions. We use empirical data of a study of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) populations, where each fly's lifetime oviposition distribution was recorded for samples studied in natural and artificial oviposition substrates. Currently, there exists no routinely used methodology for the comparison of oviposition distributions and assessment of their separation. ROC analysis is regularly used in two-sample problems in medical biostatistics when the main task is depiction and quantification of the separation of the empirical distributions from which the data arise. Adaptation of such an analysis to our data has shown that age-specific egg-laying distributions can differ, whereas average fecundity rates do not. Therefore, ROC analysis provides a method of gaining insight in the biological process of egg-laying patterns in relatively long-lived insects with many practical and theoretical implications in entomological experimentation.

  6. Enhanced power factor and reduced Lorenz number in the Wiedemann-Franz law due to pudding mold type band structures

    Science.gov (United States)

    Usui, Hidetomo; Kuroki, Kazuhiko

    2017-04-01

    We study the relationship between the shape of the electronic band structure and the thermoelectric properties. In order to study the band shape dependence of the thermoelectric properties generally, we first adopt models with band structures having the dispersion E ( k ) ˜ | k | n with n = 2, 4, and 6. We consider one-, two-, and three-dimensional systems and calculate the thermoelectric properties using the Boltzmann equation approach within the constant quasi-particle lifetime approximation. n = 2 corresponds to the usual parabolic band structure, while the band shape for n = 4 and 6 has a flat portion at the band edge, so that the density of states diverges at the bottom of the band. We call this kind of band structure the "pudding mold type band". n ≥ 4 belong to the pudding mold type band, but since the density of states diverges even for n = 2 in the one dimensional system, this is also categorized as the pudding mold type. Due to the large density of states and the rapid change of the group velocity around the band edge, the spectral conductivity of the pudding mold type band structures becomes larger than that of the usual parabolic band structures. It is found that the pudding mold type band has a coexistence of a large Seebeck coefficient and a large electric conductivity and a small Lorenz number in the Wiedemann-Franz law due to the specific band shape. We also find that the low dimensionality of the band structure can contribute to large electronic conductivity and hence a small Lorenz number. We conclude that the pudding mold type band, especially in low dimensional systems, can enhance not only the power factor but also the dimensionless figure of merit due to stronger reduction of the Lorenz number.

  7. Genome-wide paternal uniparental disomy mosaicism in a woman with Beckwith-Wiedemann syndrome and ovarian steroid cell tumour.

    Science.gov (United States)

    Gogiel, Magdalena; Begemann, Matthias; Spengler, Sabrina; Soellner, Lukas; Göretzlehner, Ulf; Eggermann, Thomas; Strobl-Wildemann, Gertrud

    2013-07-01

    Uniparental disomy (UPD) of single chromosomes is a well-known molecular aberration in a group of congenital diseases commonly known as imprinting disorders (IDs). Whereas maternal and/or paternal UPD of chromosomes 6, 7, 11, 14 and 15 are associated with specific IDs (Transient neonatal diabetes mellitus, Silver-Russell syndrome, Beckwith-Wiedemann syndrome (BWS), upd(14)-syndromes, Prader-Willi syndrome, Angelman Syndrome), the other autosomes are not. UPD of the whole genome is not consistent with life, in case of non-mosaic genome-wide paternal UPD (patUPD) it leads to hydatidiform mole. In contrast, mosaic genome-wide patUPD might be compatible with life. Here we present a 19-year-old woman with BWS features and initially diagnosed to be carrier of a mosaic patUPD of chromosome 11p15. However, the patient presented further clinical findings not typically associated with BWS, including nesidioblastosis, fibroadenoma, hamartoma of the liver, hypoglycaemia and ovarian steroid cell tumour. Additional molecular investigations revealed a mosaic genome-wide patUPD. So far, only nine cases with mosaic genome-wide patUPD and similar clinical findings have been reported, but these patients were nearly almost diagnosed in early childhood. Summarising the data from the literature and those from our patient, it can be concluded that the mosaic genome-wide patUPD (also known as androgenic/biparental mosaicism) might explain unusual BWS phenotypes. Thus, these findings emphasise the need for multilocus testing in IDs to efficiently detect cases with disturbances affecting more than one chromosome.

  8. Beckwith-Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques.

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-04-01

    Beckwith-Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10-20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder.

  9. Single cell analysis demonstrating somatic mosaicism involving 11p in a patient with paternal isodisomy and Beckwith-Wiedemann Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Bischoff, F.Z.; McCaskill, C.; Subramanian, S. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Beckwith-Wiedemann Syndrome (BWS) is characterized by numerous growth abnormalities including exomphalos, macroglossia, gigantism, and hemihypertrophy or hemihyperplasia. The {open_quotes}BWS gene{close_quotes} appears to be maternally repressed and is suspected to function as a growth factor or regulator of somatic growth, since activation of this gene through a variety of mechanisms appears to result in somatic overgrowth and tumor development. Mosaic paternal isodisomy of 11p has been observed previously by others in patients with BWS by Southern blot analysis of genomic DNA. The interpretation of these results was primarily based on the intensities of the hybridization signals for the different alleles. In our study, we demonstrate somatic mosaicism directly through PCR and single cell analysis. Peripheral blood was obtained from a patient with BWS and initial genomic DNA analysis by PCR was suggestive of somatic mosaicism for paternal isodisomy of 11p. Through micromanipulation, single cells were isolated and subjected to primer extention preamplification. Locus-specific microsatellite marker analyses by PCR were performed to determine the chromosome 11 origins in the preamplified individual cells. Two populations of cells were detected, a population of cells with normal biparental inheritance and a population of cells with paternal isodisomy of 11p and biparental disomy of 11q. Using the powerful approach of single cell analysis, the detected somatic mosaicism provides evidence for a mitotic recombinational event that has resulted in loss of the maternal 11p region and gain of a second copy of paternal 11p in some cells. The direct demonstration of mosaicism may explain the variable phenotypes and hemihypertrophy often observed in BWS.

  10. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes: a challenge for molecular analysis and genetic counseling.

    Science.gov (United States)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia; Lombardi, Maria P; Bliek, Jet; Maher, Eamonn R; Larizza, Lidia; Prawitt, Dirk; Netchine, Irène; Gonzales, Marie; Grønskov, Karen; Tümer, Zeynep; Monk, David; Mannens, Marcel; Chrzanowska, Krystyna; Walasek, Malgorzata K; Begemann, Matthias; Soellner, Lukas; Eggermann, Katja; Tenorio, Jair; Nevado, Julián; Moore, Gudrun E; Mackay, Deborah Jg; Temple, Karen; Gillessen-Kaesbach, Gabriele; Ogata, Tsutomu; Weksberg, Rosanna; Algar, Elizabeth; Lapunzina, Pablo

    2016-06-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60% of the cases. In addition, 10% of the SRS patients carry a maternal uniparental disomy of chromosome 7 11p15.5. There is an increasing demand for prenatal testing of these disorders owing to family history, indicative prenatal ultrasound findings or aberrations involving chromosomes 7 and 11. The complex molecular findings underlying these disorders are a challenge not only for laboratories offering these tests but also for geneticists counseling affected families. The scope of counseling must consider the range of detectable disturbances and their origin, the lack of precise quantitative knowledge concerning the inheritance and recurrence risks for the epigenetic abnormalities, which are hallmarks of these developmental disorders. In this paper, experts in the field of BWS and SRS, including members of the European network of congenital IDs (EUCID.net; www.imprinting-disorders.eu), put together their experience and work in the field of 11p15.5-associated IDs with a focus on prenatal testing. Altogether, prenatal tests of 160 fetuses (122 referred for BWS, 38 for SRS testing) from 5 centers were analyzed and reviewed. We summarize the current knowledge on BWS and SRS with respect to diagnostic testing, the consequences for prenatal genetic testing and counseling and our cumulative experience in dealing with these disorders.

  11. Beckwith–Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-01-01

    Beckwith–Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10–20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder. PMID:21248736

  12. Multiple genetic loci within 11p15 defined by Beckwith-Wiedemann syndrome rearrangement breakpoints and subchromosomal transferable fragments.

    Science.gov (United States)

    Hoovers, J M; Kalikin, L M; Johnson, L A; Alders, M; Redeker, B; Law, D J; Bliek, J; Steenman, M; Benedict, M; Wiegant, J

    1995-01-01

    Beckwith-Wiedemann syndrome (BWS) involves fetal overgrowth and predisposition to a wide variety of embryonal tumors of childhood. We have previously found that BWS is genetically linked to 11p15 and that this same band shows loss of heterozygosity in the types of tumors to which children with BWS are susceptible. However, 11p15 contains > 20 megabases, and therefore, the BWS and tumor suppressor genes could be distinct. To determine the precise physical relationship between these loci, we isolated yeast artificial chromosomes, and cosmid libraries from them, within the region of loss of heterozygosity in embryonal tumors. Five germ-line balanced chromosomal rearrangement breakpoint sites from BWS patients, as well as a balanced chromosomal translocation breakpoint from a rhabdoid tumor, were isolated within a 295- to 320-kb cluster defined by a complete cosmid contig crossing these breakpoints. This breakpoint cluster terminated approximately 100 kb centromeric to the imprinted gene IGF2 and 100 kb telomeric to p57KIP2, an inhibitor of cyclin-dependent kinases, and was located within subchromosomal transferable fragments that suppressed the growth of embryonal tumor cells in genetic complementation experiments. We have identified 11 transcribed sequences in this BWS/tumor suppressor coincident region, one of which corresponded to p57KIP2. However, three additional BWS breakpoints were > 4 megabases centromeric to the other five breakpoints and were excluded from the tumor suppressor region defined by subchromosomal transferable fragments. Thus, multiple genetic loci define BWS and tumor suppression on 11p15. Images Fig. 1 Fig. 3 PMID:8618920

  13. Nieuwe en zeldzame vliegen voor de Nederlandse fauna (Diptera)

    NARCIS (Netherlands)

    Aartsen, van B.

    1997-01-01

    New and rare flies for the Dutch fauna (Diptera) In this paper an overview is given of captures of rare and interesting Diptera, belonging to different families, mainly from the years 19941996. In total 46 species are presented, of which 13 are new to the Dutch fauna (marked with an *), viz.: Spania

  14. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.

    2002-01-01

    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  15. Revision of the Neotropical Xanthandrus Verral (Diptera, Syrphidae

    Directory of Open Access Journals (Sweden)

    Borges Zuleica M.

    2003-01-01

    Full Text Available The Neotropical genus Xanthandrus Verral, 1901 is revised. Six species are redescribed: X. bucephalus (Wiedemann, 1830, X. cubanus Fluke, 1936, X. mellinoides (Macquart, 1846, X. mexicanus Curran, 1930, X. nitidulus Fluke, 1937, and X. plaumanni Fluke, 1937. Three species are included based on original descriptions: X. flavomaculatus Shannon, 1927, X. palliatus (Fluke, 1945, and X. simplex (Loew, 1861. New synonyms proposed: Argentinomyia longicornis (Walker, 1837 = Xanthandrus biguttatus Hull, 1945 syn. nov., and Xanthandrus bucephalus (Wiedemann, 1830 = Melanostoma quadrinotata Bigot, 1884 syn. nov. Description of terminalia, a key for Neotropical species, and illustrations are also presented.

  16. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-06-01

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  18. Beckwith-Wiedemann综合征九例及随访%Nine Cases of Beckwith-Wiedemann Syndrome and Their Follow-up

    Institute of Scientific and Technical Information of China (English)

    宋家其; 佘亚雄

    1993-01-01

    收治Beckwith-Wiedemann综合征9例,其中7例为新生儿,男7例,女2例.脐膨出为其最突出的畸形.分析其诊断特点及合并畸形,治疗方法首先解决危及生命的病症:低血糖和脐膨出.强调术前认真检查,术后定期随访,以防合并恶性肿瘤.%Nine cases (male 7,female 2) of Beckwith-Wiedemann syndrome included 7 neonates and 2 of five years old.The most common deformity was omphalocele (9 cases).Besides there were PDA (1),prominent malrotation (1),umbilical hernia(2),and Wilms'tumor(1) etc.The treatment of this syndrome is mainly controlling hypoglycemia and repairing omphalocele.Because there is a tendency of malignant change in Beckwith-Wiedemann syndrome,therefore a long-term followed-up should be emphasized.

  19. Studies on male genitalia of sarcophagidae (Diptera based on scanning electron microscope observations Estudos sobre a genitália masculina de Sarcophagidae (Diptera baseados em observações de microscópio de varredura

    Directory of Open Access Journals (Sweden)

    Antônio Cesar Rios Leite

    1989-06-01

    Full Text Available Male genitalia of Oxyvinia exicisa (Lopes, Oxysarcodexia thomax (Walker, O. fluminensis Lopes, Sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann and Liopygia ruficornis (Fabricius were studied based on scanning electron microscope photography. Some important details were evidentiated with this method.As genitálias dos machos de Oxyvinia excisa (Lopes, Oxysarcodexia tornax (Walker, O. fluminensis Lopes, sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann e Liopygia ruficornis (Fabricius foram estudadas com base em fotografias de microscópio de varredura. Alguns detalhes importantes foram evidenciados por este método.

  20. Metalimnobia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo

    2016-06-30

    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  1. Numerous transitions of sex chromosomes in Diptera.

    Science.gov (United States)

    Vicoso, Beatriz; Bachtrog, Doris

    2015-04-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  2. Numerous transitions of sex chromosomes in Diptera.

    Directory of Open Access Journals (Sweden)

    Beatriz Vicoso

    2015-04-01

    Full Text Available Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot, but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes. Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  3. Anastrepha ludens and Anastrepha serpentina (Diptera: Tephritidae) do not infest Psidium guajava (Myrtaceae), but Anastrepha obliqua occasionally shares this resource with Anastrepha striata in nature.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martin

    2011-08-01

    This study examined whether economically important fruit fly species Anastrepha ludens (Loew), Anastrepha serpentina (Wiedemann), and Anastrepha obliqua (Macquart) (Diptera: Tephritidae) may opportunistically exploit guavas, Psidium guajava L. (Myrtaceae), growing near preferred natural hosts. We collected 3,459 kg of guavas and 895 kg of other known host species [sour orange, Citrus aurantium L.; grapefruit, Citrus paradisi Macfadyen; mango, Mangifera indica L.; white sapote, Casimiroa edulis La Llave and Lex.; sapote, Pouteria sapota (Jacq.); sapodilla, Manilkara zapota L.; and wild plum, Spondias purpurea L. and Spondias mombin L.] along an altitudinal gradient over a 4-yr period (2006-2009). Plants were growing in sympatry in 23 localities where the guavas are usually infested in the state of Veracruz, M6xico. The guava samples yielded 20,341 Anastrepha spp. pupae in total (overall mean, 5.88 pupae per kg of fruit). Confirming previous reports, Anastrepha fraterculus (Wiedemann) and Anastrepha striata (Schiner) were found heavily infesting guavas in Veracruz. Importantly, although we did not find evidence that A. ludens and A. serpentina are able to attack this valuable commodity, we document for the first time in the agriculturally important state of Veracruz that P. guajava is an alternative natural host plant of A. obliqua. We recovered two fruit in the mango-growing locality of la Vibora, Tlalixcoyan, that harbored larvae of A. striata and A. obliqua. This finding has important practical implications for management of A. obliqua. Over the entire altitudinal gradient, when individual fruit infestation was examined, a dynamic pattern of species dominance was unveiled with guavas growing below 800 m above sea level mainly attacked by A. striata and a progressive replacement with increasing altitude by A. fraterculus. Interestingly, most individual fruit examined (97%) harbored a single species of fruit fly, a finding that may be taken as evidence of

  4. The effects of constant and alternating temperatures on the reproductive potential, life span, and life expectancy of Anastrepha fraterculus (Wiedemann (Dipteria: Tephritidae

    Directory of Open Access Journals (Sweden)

    V. V. CARDOSO

    Full Text Available Ovarian development, oviposition, larval eclosion, ornithine decarboxylase (ODC activity, ovarian, testis and ejaculatory apodeme measurements (length, width, and area, and the number of spermatozoa of Anastrepha fraterculus (Wiedemann were analyzed at alternating (20º/6ºC and 20º/13°C and constant (6°C; 25°C temperatures. Life span and life expectancy were also analyzed for both genders. All the results suggest that temperature, especially alternating temperatures, increase not only male and female reproductive potential but also their life span and life expectancy. These changes can be a powerful strategy triggered by A. fraterculus as a means to survive the stressful temperature conditions found in winter in the apple production region in Brazil, enabling this species to increase its population density and cause apple damage when spring begins.

  5. The effects of constant and alternating temperatures on the reproductive potential, life span, and life expectancy of Anastrepha fraterculus (Wiedemann (Dipteria: Tephritidae

    Directory of Open Access Journals (Sweden)

    CARDOSO V. V.

    2002-01-01

    Full Text Available Ovarian development, oviposition, larval eclosion, ornithine decarboxylase (ODC activity, ovarian, testis and ejaculatory apodeme measurements (length, width, and area, and the number of spermatozoa of Anastrepha fraterculus (Wiedemann were analyzed at alternating (20masculine/6masculineC and 20masculine/13degreesC and constant (6degreesC; 25degreesC temperatures. Life span and life expectancy were also analyzed for both genders. All the results suggest that temperature, especially alternating temperatures, increase not only male and female reproductive potential but also their life span and life expectancy. These changes can be a powerful strategy triggered by A. fraterculus as a means to survive the stressful temperature conditions found in winter in the apple production region in Brazil, enabling this species to increase its population density and cause apple damage when spring begins.

  6. Temporal patterns of abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) and mitochondrial DNA analysis of Ae. albopictus in the Central African Republic

    National Research Council Canada - National Science Library

    Kamgang, Basile; Ngoagouni, Carine; Manirakiza, Alexandre; Nakouné, Emmanuel; Paupy, Christophe; Kazanji, Mirdad

    2013-01-01

    The invasive Asian tiger mosquito Aedes albopictus (Diptera: Culicidae) was first reported in central Africa in 2000, in Cameroon, with the indigenous mosquito species Ae. aegypti (Diptera: Culicidae...

  7. New addition to the mosquito fauna of United States, Anopheles grabhamii (Diptera: Culicidae).

    Science.gov (United States)

    Darsie, Richard F; Vlach, Joshua J; Fussell, Edsel M

    2002-05-01

    An anopheline mosquito new to the United States was collected in Monroe County, FL, USA. It is Anopheles (Anopheles) grabhamii Theobald, a species common throughout the Greater Antilles area and often found in association with Anopheles albimanus Wiedemann.

  8. Variação na infestação de mosca-das-frutas (Diptera: Tephritidae e parasitismo em diferentes fases de frutificação em mirtaceas nativas no Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Diogo Ricardo Pereira Rêgo

    2013-07-01

    Abstract. The fruit fly Anastrepha fraterculus (Wiedemann (Diptera: Tephritidae is an important pest of fruit production in Rio Grande do Sul. A. fraterculus presents native and exotic hosts, according to fruiting time. The objective of this study was compare infestation rate, the intensity of infestation of fruit fly and parasitism in four native Myrtaceae. The fruits were stored under ambient conditions until flies or parasitoids emergence. These evaluation were made in fruits collected from the canopy and soil, and between stages of ripening of the canopy. The largest infestation rate of fruit fly occurred in guava (89.5% and the lowest in feijoa (67%. The intensity of infestation per fruit was highest in guava (17.33 and lowest in red strawberry guava (1.62. The highest rate of puparia per gram of fruit was obtained in the feijoa (0.50 and the lowest in guava (0.22. The highest parasitism rate was in feijoa (21.40% and the lowest in yellow strawberry guava (2.81%. A greater occurrence of this pest in guava and feijoa revealing highest attractiveness in these hosts. Feijoa is a repository for native parasitodes species.

  9. Revision of the family Nothybidae (Diptera: Schizophora).

    Science.gov (United States)

    Lonsdale, O; Marshall, S A

    2016-04-05

    The family Nothybidae (Diptera: Schizophora) is revised. The family consists of 11 species in the single genus Nothybus Rondani, which occurs in Papua New Guinea, Nepal and much of the Oriental Region. Three species are described as new: N. absens spec. nov. (China), N. cataractus spec. nov. (Laos, Thailand) and N. procerus spec. nov. (India). Nothybus longithorax Rondani, 1875 is treated as a junior synonym of N. longicollis (Walker, 1856). Nothybus decorus Meijere, 1924 syn. nov. is included as a junior synonym of N. lineifer Enderlein, 1922.

  10. Rhipidia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2016-07-07

    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  11. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  12. Recombination rate predicts inversion size in Diptera.

    Science.gov (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A

    1999-09-01

    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  13. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    Science.gov (United States)

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  14. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    Science.gov (United States)

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  15. Effect of constant temperatures on the biology, life table, and thermal requirements of Aganaspis pelleranoi (Hymenoptera: Figitidae), a parasitoid of Anastrepha fraterculus (Diptera: Tephritidae).

    Science.gov (United States)

    Gonçalves, R S; Nava, D E; Andreazza, F; Lisbôa, H; Nunes, A M; Grützmacher, A D; Valgas, R A; Maia, A H N; Pazianotto, R A A

    2014-04-01

    Aganaspis pelleranoi (Brèthes, 1924) (Hymenoptera: Figitidae) is a koinobiont endoparasitoid of larvae of species of the genus Anastrepha and of Ceratitis capitata. It is a candidate for use as a biological control agent, as under field conditions, it may reach a parasitism rate of 62%. The objective of this study was to determine the effect of different constant temperatures on biological parameters of A. pelleranoi when parasitizing the larva of Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae), as well as to determine its thermal requirements. The study was conducted in environmental chambers at 18, 20, 22, 25, 28, and 30 ± 1°C; 70 ± 10% relative humidity; and a 12-h photophase. Females maintained at 18 and 20°C produced more progeny than females at other temperatures tested. The longevity of males and females was inversely proportional to temperature, ranging from 49.1 to 3.73 d for females and from 32.1 to 3.8 d for males at temperatures of 18-30°C, respectively. The duration of the biological cycle (egg-to-adult) was influenced by temperature, and ranged from 69.1 d at 18°C to 30 d at 25°C. No preimaginal development of A. pelleranoi occurred at 28 and 30°C. The relationship between temperature and the demographic parameters of A. pelleranoi showed a linear effect over the temperature range of 18-25°C. The lower temperature threshold and thermal constant were 11.69°C and 391.70 degree days, respectively.

  16. Response of female Ceratitis capitata (Diptera: Tephritidae) to a spinosad bait and polymer matrix mixture with extended residual effect in Hawaii.

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Gomez, Luis E; Mau, Ronald F L; Vargas, Roger I

    2011-12-01

    The effectiveness of foliar applications of protein baits against pestiferous fruit flies (Tephritidae) can be adversely affected by a rapid loss of attractive volatile compounds and by rainfall due to the high water solubility of the baits. In a large coffee, Coffea arabica L., plantation in Hawaii with high and low populations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the relative attractiveness of GF-120 NF Naturalyte Fruit Fly Bait as either a 40% (vol:vol) spray solution (= GF-120 NF) or as a formulated proprietary amorphous polymer matrix (= GF-120 APM) was compared. The GF-120 APM formulations contained either, 25, 50, or 75% of GF-120 NF (wt:wt). All baits were tested in association with visually attractive yellow bait stations as a way of standardizing the evaluations. With both high and low C. capitata populations, significantly more females were attracted to the fresh sprayed GF-120 NF than to any of the three fresh GF-120 APM formulations. The attractiveness of GF-120 sprayed decreased significantly after 1 wk, whereas 1-wk-old GF-120 APM formulations were as attractive as similar fresh formulations. GF-120 APM 75% aged for 3 wk outperformed similarly-aged sprayed GF-120 NF with comparatively high C. capitata populations. With low populations, both GF-120 APM 75% and GF-120 APM 50% aged for 2 wk outperformed the similarly aged sprayed GF-120 NF. Combined findings indicate that APM mixed with either 50 or 75% GF-120 applied to bait stations can be attractive to female C. capitata for up to 3 wk longer than the standard sprayed GF-120 NF.

  17. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    Science.gov (United States)

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Medical Entomology Studies - III. A Revision of the Subgenus Culex in the Oriental Region (Diptera: Culicidae) (Contributions of the American Entomological Institute. Volume 12, Number 2)

    Science.gov (United States)

    1976-01-01

    Subgroup with quinquefasciatus which is widespread throughout tropical parts of the world, (2) TrifiZatus Subgroup with vegans and hutchinsoni, both...region; torrentium Martini 1925 from the western Palearctic; vegans Wiedemann 1828 from the eastern Pale- arctic; pervigiluns Bergroth 1889, pacificus...discovered when the fauna is thoroughly examined. 2. C ULEX (C ULEX) VAGANS WIEDEMANN (Figs. 4, 5, 14) Culex vegans Wiedemann 1828: 545 (d, 0

  19. Microscopia eletrônica de varredura de duas espécies de Fannia Robineau-Desvoidy (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Ariel David Freitas Al Gazi

    2004-06-01

    Full Text Available As espécies Fannia pusio Wiedeman, 1830 e Fannia trimaculata Stein, 1898 pertencem ao grupo canicularis e ao subgrupo pusio. Estas espécies são morfologicamente muito similares e geralmente são diferenciadas por uma fileira de cerdas no fêmur do terceiro par de pernas do macho. A análise com microscopia eletrônica de varredura mostrou na estrutura denominada "cellas", menor número de orifícios na superfície dorsal do ovo e, na superfície ventral, foi detectado menor rugosidade, ambos em F. trimaculata. Na larva, o estigma ou espiráculo protorácico é proeminente, onde F. trimaculata apresentou duas expansões tegumentares pequenas e sete longas de igual comprimento. Os machos de F. trimaculata apresentam uma fileira de cerdas localizadas mais externamente na faceta e, outra fileira de cerdas menores, a qual é ausente em machos de F. pusio, porém presente nas fêmeas de ambas as espécies.Scanning electron microscopy in two species of Fannia Robineau-Desvoidy, (Diptera, Fanniidae. The species Fannia pusio Wiedemann, 1830 and F. trimaculata Stein, 1898 belong to the canicularis group and pusio subgroup. These species are morphologically very similar and usually distinguished from each other by a line of bristles on the males hind femur. The scanning electron microscopy analysis showed a smaller number of orifices on the dorsal surface of the egg in the structure called "cellas" and, on the ventral surface, less rugosity was noted, both in F. trimaculata. On the larvae, the stigma or protothoracic spiracle was outstanding, where F. trimaculata possess two short tegumental extensions and seven long ones, while F. pusio has nine extensions, all long, of equal length. Males of F. trimaculata present alongside a line of longer bristles located more externally on the facet, another line of shorter bristles, which is absent in males of F. pusio, but present in females of both species.

  20. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  1. Congenital hyperinsulinism in an infant with paternal uniparental disomy on chromosome 11p15: few clinical features suggestive of Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Adachi, Hiroyuki; Takahashi, Ikuko; Higashimoto, Ken; Tsuchida, Satoko; Noguchi, Atsuko; Tamura, Hiroaki; Arai, Hirokazu; Ito, Tomoo; Masue, Michiya; Nishibori, Hironori; Takahashi, Tsutomu; Soejima, Hidenobu

    2013-01-01

    Beckwith-Wiedemann syndrome (BWS) is the most common congenital overgrowth syndrome involving tumor predisposition. BWS is caused by various epigenetic or genetic alterations that disrupt the imprinted genes on chromosome 11p15.5 and the clinical findings of BWS are highly variable. Hyperinsulinemic hypoglycemia is reported in about half of all babies with BWS. We identified an infant with diazoxide-unresponsive congenital hyperinsulinism (HI) without any apparent clinical features suggestive of BWS, but diagnosed BWS by molecular testing. The patient developed severe hyperinsulinemic hypoglycemia within a few hours after birth, with macrosomia and mild hydronephrosis. We excluded mutations in the K(ATP) channel genes on chromosome 11p15.1, but found a rare homozygous single nucleotide polymorphism (SNP) of ABCC8. Parental SNP pattern suggested paternal uniparetal disomy in this region. By microsatellite marker analysis on chromosome 11p15, we could diagnose BWS due to the mosaic of paternal uniparental disomy. Our case suggests that some HI of unknown genetic etiology could involve undiagnosed BWS with no apparent clinical features, which might be diagnosed only by molecular testing.

  2. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver–Russell and Beckwith–Wiedemann syndrome

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah JG; Eggermann, Thomas

    2016-01-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver–Russell and Beckwith–Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature. PMID:27165005

  3. Mutations of the Imprinted CDKN1C Gene as a Cause of the Overgrowth Beckwith-Wiedemann Syndrome: Clinical Spectrum and Functional Characterization.

    Science.gov (United States)

    Brioude, Frederic; Netchine, Irène; Praz, Francoise; Le Jule, Marilyne; Calmel, Claire; Lacombe, Didier; Edery, Patrick; Catala, Martin; Odent, Sylvie; Isidor, Bertrand; Lyonnet, Stanislas; Sigaudy, Sabine; Leheup, Bruno; Audebert-Bellanger, Séverine; Burglen, Lydie; Giuliano, Fabienne; Alessandri, Jean-Luc; Cormier-Daire, Valérie; Laffargue, Fanny; Blesson, Sophie; Coupier, Isabelle; Lespinasse, James; Blanchet, Patricia; Boute, Odile; Baumann, Clarisse; Polak, Michel; Doray, Berenice; Verloes, Alain; Viot, Géraldine; Le Bouc, Yves; Rossignol, Sylvie

    2015-09-01

    Beckwith-Wiedemann syndrome (BWS) is an imprinting disorder associating macroglossia, abdominal wall defects, visceromegaly, and a high risk of childhood tumor. Molecular anomalies are mostly epigenetic; however, mutations of CDKN1C are implicated in 8% of cases, including both sporadic and familial forms. We aimed to describe the phenotype of BWS patients with CDKN1C mutations and develop a functional test for CDKN1C mutations. For each propositus, we sequenced the three exons and intron-exon boundaries of CDKN1C in patients presenting a BWS phenotype, including abdominal wall defects, without 11p15 methylation defects. We developed a functional test based on flow cytometry. We identified 37 mutations in 38 pedigrees (50 patients and seven fetuses). Analysis of parental samples when available showed that all mutations tested but one was inherited from the mother. The four missense mutations led to a less severe phenotype (lower frequency of exomphalos) than the other 33 mutations. The following four tumors occurred: one neuroblastoma, one ganglioneuroblastoma, one melanoma, and one acute lymphoid leukemia. Cases of BWS caused by CDKN1C mutations are not rare. CDKN1C sequencing should be performed for BWS patients presenting with abdominal wall defects or cleft palate without 11p15 methylation defects or body asymmetry, or in familial cases of BWS.

  4. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver-Russell and Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah Jg; Eggermann, Thomas

    2016-10-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver-Russell and Beckwith-Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature.

  5. Composition and anti-insect activity of essential oils from Tagetes L. species (Asteraceae, Helenieae) on Ceratitis capitata Wiedemann and Triatoma infestans Klug.

    Science.gov (United States)

    López, Sandra B; López, María L; Aragón, Liliana M; Tereschuk, María L; Slanis, Alberto C; Feresin, Gabriela E; Zygadlo, Julio A; Tapia, Alejandro A

    2011-05-25

    Essential oils from four species of the genus Tagetes L. (Asteraceae, Helenieae) collected in Tucumán province, Argentina, were evaluated for their chemical composition, toxicity, and olfactory activity on Mediterranean fruit fly Ceratitis capitata Wiedemann adults and for repellent properties on Triatoma infestans (Klug) (Chagas disease vector). Yields of essential oils range from 0.2 to 0.8% (v/w). The same main constituents among Tagetes minuta L., Tagestes rupestris Cabrera, and Tagetes terniflora Kunth, (cis-trans)-ocimenes, (cis-trans)-tagetones, and (cis-trans)-ocimenones showed important differences in their relative compositions. Tagetes filifolia Lag. was characterized by the recognized phenylpropanoids methylchavicol and trans-anethole as the main components. LD(50) was ≤20 μg/insect in topical bioassays. T. rupestris was the most toxic to C. capitata females, whereas the other oils presented similar toxicities against males and females. Tagetes rupestris oil attracted both sexes of C. capitata at 5 μg, whereas T. minuta showed opposite activities between males (attractant) and females (repellent). Oils from T. minuta and T. filifolia were the most repellent to T. infestans. The results suggest that compositions of essential oils influence their insecticidal and olfactory properties. The essential oils from Tagetes species show an important potential as infochemical agents on insects' behaviors. This study highlights the chemical variability of essential oils as a source of variation of anti-insect properties.

  6. Mild Beckwith-Wiedemann and severe long-QT syndrome due to deletion of the imprinting center 2 on chromosome 11p.

    Science.gov (United States)

    Gurrieri, Fiorella; Zollino, Marcella; Oliva, Antonio; Pascali, Vincenzo; Orteschi, Daniela; Pietrobono, Roberta; Camporeale, Antonella; Coll Vidal, Monica; Partemi, Sara; Brugada, Ramon; Bellocci, Fulvio; Neri, Giovanni

    2013-09-01

    We report on a young woman admitted to our Cardiology Unit because of an episode of cardiac arrest related to a long-QT syndrome (LQTS). This manifestation was part of a broader phenotype, which was recognized as a mild form of Beckwith-Wiedemann syndrome (BWS). Molecular analysis confirmed the diagnosis of BWS owing to a maternally inherited deletion of the centromeric imprinting center, or ICR2, an extremely rare genetic mechanism in BWS. The deletion interval (198 kb) also included exons 11-16 of the KCNQ1 gene, known to be responsible for LQTS at locus LQT1. No concomitant mutations were found in any other of the known LQT genes. The proposita's mother carries the same deletion in her paternal chromosome and shows manifestations of the Silver-Russell syndrome (SRS). This report describes the smallest BWS-causing ICR2 deletion and provides the first evidence that a paternal deletion of ICR2 leads to a SRS-like phenotype. In addition, our observation strongly suggests that in cases of LQTS due to mutation of the KCNQ1 gene (LQT1), an accurate clinical genetic evaluation should be done in order to program the most appropriate genetic tests.

  7. Diptera, Drosophilidae: historical occurrence in Brazil

    Directory of Open Access Journals (Sweden)

    Valente, V. L. S.

    2008-01-01

    Full Text Available This study presents a literature review of Drosophilidae (Diptera species occurrence in Brazil. The number of speciesrecorded is 304, with Drosophila being the genus with the greatest number of species, followed by Zygothrica,Hirtodrosophila and Diathoneura, which belong to the Drosophilinae subfamily. Drosophila was shown to be the mostinvestigated taxon in the family, with the best resolved species distribution. The low number of records of species fromother genera indicates the paucity of studies specifically designed to investigate these species. Records of species forsome regions of the country like the north and northeast, as well as for some biomes like Caatinga, Pantanal and thePampas, are likewise rare. Apart from the banana bait, different collection methods may be necessary, like thecollection at other oviposition resources, the use of baits other than fermenting fruit, and the adoption of samplingapproaches that do not use baits.

  8. Rehydration of forensically important larval Diptera specimens.

    Science.gov (United States)

    Sanford, Michelle R; Pechal, Jennifer L; Tomberlin, Jeffery K

    2011-01-01

    Established procedures for collecting and preserving evidence are essential for all forensic disciplines to be accepted in court and by the forensic community at large. Entomological evidence, such as Diptera larvae, are primarily preserved in ethanol, which can evaporate over time, resulting in the dehydration of specimens. In this study, methods used for rehydrating specimens were compared. The changes in larval specimens with respect to larval length and weight for three forensically important blow fly (Diptera: Calliphoridae) species in North America were quantified. Phormia regina (Meigen), Cochliomyia macellaria (F.), and Chrysomya rufifacies (Macquart) third-instar larvae were collected from various decomposing animals and preserved with three preservation methods (80% ethanol, 70% isopropyl alcohol, and hot-water kill then 80% ethanol). Preservative solutions were allowed to evaporate. Rehydration was attempted with either of the following: 80% ethanol, commercial trisodium phosphate substitute solution, or 0.5% trisodium phosphate solution. All three methods partially restored weight and length of specimens recorded before preservation. Analysis of variance results indicated that effects of preservation, rehydration treatment, and collection animal were different in each species. The interaction between preservative method and rehydration treatment had a significant effect on both P. regina and C. macellaria larval length and weight. In addition, there was a significant interaction effect of collection animal on larval C. macellaria measurements. No significant effect was observed in C. rufifacies larval length or weight among the preservatives or treatments. These methods could be used to establish a standard operating procedure for dealing with dehydrated larval specimens in forensic investigations.

  9. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Sukontason Kabkaew L

    2002-01-01

    Full Text Available We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  10. Development of Rhagoletis indifferens Curran (Diptera:Tephritidae) in crabapple

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens, Curran, 1932 (Diptera: Tephritidae), was reared from naturally-infested Chinese crabapple, Malus spectabilis (Ait.) Borkh. (Rosaceae), in Washington state, U.S.A. Pupae from Chinese crabapple were smaller than those from sweet cherry, Prunus avium (...

  11. Six new species of Microdon Meigen from Madagascar (Diptera: Syrphidae).

    Science.gov (United States)

    Reemer, Menno; Bot, Sander

    2015-10-28

    Six new species of the myrmecophilous hoverfly genus Microdon Meigen (Diptera: Syrphidae) are described from Madagascar. Redescriptions are given for the three other Madagascan species of this genus. Keys are presented to the Madagascan genera of the subfamily Microdontinae and to the Madagascan species of Microdon.

  12. Checklist of the family Simuliidae (Diptera of Finland

    Directory of Open Access Journals (Sweden)

    Jari Ilmonen

    2014-09-01

    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  13. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  14. Anopheles (Anopheles) pseudopunctipennis Theobald (Diptera: Culicidae): Neotype Designation and Description

    Science.gov (United States)

    2004-01-01

    Diptera Ð Culicidae). Guayaquil Univ., Guayaquil, Ecuador. Levi-Castillo, R. 1945. Los anofelinos de la Republica del Ecuador, vol. 1: 1Ð172. Artes ...BritishMuseumNatural History, Lon- don, England. Vargas, L., and A. Martinez Palacios. 1956. Anofelinos mexicanos . Taxonomia y distribucion. Secretaria

  15. A new species of Culcua Walker (Diptera: Stratiomyidae) from Vietnam

    Science.gov (United States)

    A new species of Culcua Walker (Diptera: Stratiomyidae), C. lingafelteri Woodley, new species, is described from northern Vietnam. It is diagnosed relative to other species using the recent revision of the genus by Rozkošný and Kozánek (2007). This is the first species of Culcua reported from Viet...

  16. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  17. World catalog of extant and fossil Corethrellidae (Diptera).

    Science.gov (United States)

    Borkent, Art

    2014-05-20

    A world catalog of extant and fossil frog-biting midges (Diptera: Corethrellidae) provides full type information, known life stages, and distribution of each species. There are 105 extant and seven fossil species of Corethrellidae but unnamed species are known from Costa Rica, Colombia and Madagascar. New information on types and other important specimens are provided.

  18. Contribuição ao conhecimento da tribu Ormiini. III: gênero Euphasiopteryx Townsend, 1915 (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Omar Tavares

    1965-01-01

    Full Text Available This is a contribution to the knowledge of the Tribu Ormiini in wich the author presents redescriptions of euphasiopteryx depleta (Wiedemann, 1830, Euphasiopteryx ochracea (Bigot, 1888 and describes a new species: Euphasiopteryx rosenoi sp. n. from Brazil.

  19. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  20. Toward the gene(s) for Wiedemann-Beckwith syndrome and associated tumors in two different regions of 11p15

    Energy Technology Data Exchange (ETDEWEB)

    Henry, J.; Chehenase, V.; Boulevin, C. [INSERM, Paris (France)] [and others

    1994-09-01

    Wiedemann-Beckwith syndrome (WBS) is a malformation syndrome associated with predisposition to different types of tumors (WT, ADCC). Cytogenetic and familial studies mapped the WBS locus to 11p15.5. Genomic imprinting has been implicated in the expression of the syndrome. Using 11p15 specific markers we have determined the parental origin of both chromosomes 11 in sporadic WBS cases. Probands in 5 out of 26 informative families (25%) displayed uniparental disomy (UPD) corresponding to a paternal isodisomy for region 11p15.5. Mosaic phenotypes reflect the timing of their origin and the fate of cells involved as well as the cell-specific pattern of imprinting. Somatic mosaicism for UPD may thus explain the incomplete forms of WBS, the association of hemihypertrophy in sporadic WBS and even some cases of isolated hemihypertrophy. Moreover, the risk (60%) of developing a tumor seems higher for patients with paternal 11p UPD than for WBS patients in general (7.5%). Two different genomic libraries specific for region 11p15.5 were constructed and screened to isolate and characterize the gene(s) responsible for WBS and/or tumor progression. The characterization and and the localization of these cDNAs are in progress. 5 CA repeats genetically mapped in 11p15 were used to isolate YACs (CEPH). These CA repeats are now physically mapped using a panel of hybrids specific for the 11p15 region, and the contigs of YACs mapping in the regions of interest will be used to isolate coding sequences.

  1. Immatures of Lutzia fuscanus (Wiedemann,1820)(Dipter-a:Culicidae)in ricefields:implications for biological con-trol of vector mosquitoes

    Institute of Scientific and Technical Information of China (English)

    Mihir Kumar Pramanik; Gautam Aditya

    2009-01-01

    Objective:Rice fields are dynamic mosquito larval habitats with assemblage of different predator taxa,inclu-ding the larva of the mosquitoes Lutzia.Entomological surveillance in the ricefields is essential to evaluate the potential of these predators as biological resource to regulate vector mosquito population.In view of this,a sur-vey of ricefields for immatures of different mosquito species including Lutzia was conducted.Methods:Survey of selected ricefields was carried out to evaluate the species composition of mosquitoes.Laboratory evaluation of the immatures of Lutzia mosquitoes was carried out to assess its predation potential using mosquitoes and chi-ronomid as preys.Results:The survey revealed the presence of five mosquito species belonging to the genera Anopheles and Culex and the predatory immatures of the mosquito Lutzia fuscana (Wiedemann,1820).The ra-tio of prey and predatory larva ranged between 1.46 and 4.78 during the study period,with a significant corre-lation on the relative abundance of the larval stages of Lt.fuscanus and Anopheles and Culex larvae.Under la-boratory conditions,a single IV instar larvae of Lt.fuscanus was found to consume on an average 5 to 15 equiv-alent instars of Anopheles sp.and Culex sp.larvae per day depending on its age.The prey consumption re-duced with the larval stage approaching pupation.When provided with equal numbers of chironomid and A-nopheles or Culex larvae,larva of Lt.fuscanus consumed mosquito larvae significantly more compared to chi-ronomids.Conclusion:The survey results and the preliminary study on predation are suggestive of the role of Lt.fuscanus in the regulation of vector mosquito populations naturally in the ricefields.Since Lt.fuscanus is common in many Asian countries,further studies on bioecology will be helpful to justify their use in mosquito control programme.

  2. The forgotten flies: the importance of non-syrphid Diptera as pollinators.

    Science.gov (United States)

    Orford, Katherine A; Vaughan, Ian P; Memmott, Jane

    2015-04-22

    Bees, hoverflies and butterflies are taxa frequently studied as pollinators in agricultural and conservation contexts. Although there are many records of non-syrphid Diptera visiting flowers, they are generally not regarded as important pollinators. We use data from 30 pollen-transport networks and 71 pollinator-visitation networks to compare the importance of various flower-visiting taxa as pollen-vectors. We specifically compare non-syrphid Diptera and Syrphidae to determine whether neglect of the former in the literature is justified. We found no significant difference in pollen-loads between the syrphid and non-syrphid Diptera. Moreover, there was no significant difference in the level of specialization between the two groups in the pollen-transport networks, though the Syrphidae had significantly greater visitation evenness. Flower visitation data from 33 farms showed that non-syrphid Diptera made up the majority of the flower-visiting Diptera in the agricultural studies (on average 82% abundance and 73% species richness), and we estimate that non-syrphid Diptera carry 84% of total pollen carried by farmland Diptera. As important pollinators, such as bees, have suffered serious declines, it would be prudent to improve our understanding of the role of non-syrphid Diptera as pollinators.

  3. Medical Entomology Studies - XV. A Revision of the Subgenus Paraedes of the Genus Aedes (Diptera: Culicidae)

    Science.gov (United States)

    1981-01-01

    Med. Res. 10: 430-75. Diptera Nematocera from the Federated Malay States museums. J. Fed. Malay States Mus. 14: l-139. Philippine nematocerous...Culicidae. p. 266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ

  4. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  5. [Highest mosquito records (Diptera: Culicidae) in Venezuela].

    Science.gov (United States)

    Navarro, Juan-Carlos; Del Ventura, Fabiola; Zorrilla, Adriana; Liria, Jonathan

    2010-03-01

    Mosquitoes (Diptera: Culicidae) are holometabolous insects with aquatic immature stages, which use a broad variety of larval habitats, from ground water bodies to Phytothelmata (water deposits in plants) and artificial deposits. The availability of breeding sites often determines the upper limits of mosquito ranges. We built a database with 9,607 records with 432 localities, 19 genera and 254 species. The Andean mountains have 77% of the highest mosquito records including Aedes euris with record at 3,133 m, followed by three species of Anopheles--subgenera Kerteszia--with the upper limit of 2,680 m. Wyeomyia bicornis and Culex daumastocampa at 2,550 m were the highest records in the Central-Coastal cordillera, while the highest record in Pantepui was Wyeomyia zinzala at 2,252 m. The species associated with phytothelmata (Bromeliaceae and Sarraceniaceae) represent 60% of the records. The upper limits of Culex quinquefasciatus and Anopheles (Kerteszia) species could represent the theoretical limit for transmission of filariasis or arboviruses, by Culex, and malaria by Anopheles (Kerteszia) in Venezuela. Similarly, a vector of Dengue, Aedes aegypti, has not been not recorded above 2,000 m.

  6. Attraction and Oviposition of Lucilia eximia (Diptera: Calliphoridae) to Resources Colonized by the Invasive Competitor Chrysomya albiceps (Diptera: Calliphoridae).

    Science.gov (United States)

    Spindola, Aline F; Zheng, Le; Tomberlin, Jeffery K; Thyssen, Patricia J

    2016-10-15

    The present study aimed to determine if the presence of immatures of the invasive blow fly species Chrysomya albiceps (Wiedemann) influences the adult behavior of the native species Lucilia eximia (Wiedemann) in Brazil. The level of attraction and oviposition by the native species was assessed in a dual-choice assay. The evaluation was based on sex and stage of ovarian development of L. eximia adults to a resource not colonized (NCR) or colonized (RPC) with eggs, different instars, or densities of C. albiceps A significant difference in attraction was observed based on sex and stages of ovarian development. Males and nongravid females were more attracted to RPC, whereas gravid females preferred NCR. Moreover, males exhibited the lowest response in all assays among the three sex categories examined. In general, adults preferably oviposited on NCR rather than RPC. Also, between the eggs and second instar treatments, L. eximia laid more eggs on RPC with eggs than second instars (predatory stage). Lucilia eximia attraction to second-instar C. albiceps at different densities was marginally significant. Overall, results indicate the invasive species, C. albiceps, is impacting the behavior of the native blow fly, L. eximia, with regards to its attraction and colonization of vertebrate carrion, which could explain why native blow fly populations have significantly decreased since the introduction of C. albiceps.

  7. Long-term impact of tongue reduction on speech intelligibility, articulation and oromyofunctional behaviour in a child with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Van Lierde, K M; Mortier, G; Huysman, E; Vermeersch, H

    2010-03-01

    The purpose of the present case study was to determine the long-term impact of partial glossectomy (using the keyhole technique) on overall speech intelligibility and articulation in a Dutch-speaking child with Beckwith-Wiedemann syndrome (BWS). Furthermore the present study is meant as a contribution to the further delineation of the phonation, resonance, articulation and language characteristics and oral behaviour in a child with BWS. Detailed information on the speech and language characteristics of children with BWS may lead to better guidance of pediatric management programs. The child's speech was assessed 9 years after partial glossectomy with regard to ENT characteristics, overall intelligibility (perceptual consensus evaluation), articulation (phonetic and phonological errors), voice (videostroboscopy, vocal quality), resonance (perceptual, nasometric assessment), language (expressive and receptive) and oral behaviour. A class III malocclusion, an anterior open bite, diastema, overangulation of lower incisors and an enlarged but normal symmetric shaped tongue were present. The overall speech intelligibility improved from severely impaired (presurgical) to slightly impaired (5 months post-glossectomy) to normal (9 years postoperative). Comparative phonetic inventory showed a remarkable improvement of articulation. Nine years post-glossectomy three types of distortions seemed to predominate: a rhotacism and sigmatism and the substitution of the alveolar /z/. Oral behaviour, vocal characteristics and resonance were normal, but problems with expressive syntactic abilities were present. The long-term impact of partial glossectomy, using the keyhole technique (preserving the vascularity and the nervous input of the remaining intrinsic tongue muscles), on speech intelligibility, articulation, and oral behaviour in this Dutch-speaking child with congenital macroglossia can be regarded as successful. It is not clear how these expressive syntactical problems

  8. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  9. Development of a larval diet for the South American fruit fly Anastrepha fraterculus (Diptera:Tephritidae)

    Science.gov (United States)

    Mass-rearing protocols must be developed. In particular, a cost-effective larval diet, to implement the sterile insect technique against Anastrepha fratercculus (Wiedemann). The key elements of this diet are the optimal nutrients and their concentrations, diet supports or bulking agents, and the pH ...

  10. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  11. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  12. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  13. Contrasting rates of mitochondrial molecular evolution in parasitic Diptera and Hymenoptera.

    Science.gov (United States)

    Castro, L R; Austin, A D; Dowton, M

    2002-07-01

    We investigated the putative association between the parasitic lifestyle and an accelerated rate of mt genetic divergence, compositional bias, and gene rearrangement, employing a range of parasitic and nonparasitic Diptera and Hymenoptera. Sequences were obtained for the cox1, cox2, 16S, 28S genes, the regions between the cox2 and atp8 genes, and between the nad3 and nad5 genes. Relative rate tests indicated generally that the parasitic lifestyle was not associated with an increased rate of genetic divergence in the Diptera but reaffirmed that it was in the Hymenoptera. Similarly, a departure from compositional stationarity was not associated with parasitic Diptera but was in parasitic Hymenoptera. Finally, mitochondrial (mt) gene rearrangements were not observed in any of the dipteran species examined. The results indicate that these genetic phenomena are not accelerated in parasitic Diptera compared with nonparasitic Diptera. A possible explanation for the differences in the rate of mt molecular evolution in parasitic Diptera and Hymenoptera is the extraordinary level of radiation that has occurred within the parasitic Hymenoptera but not in any of the dipteran parasitic lineages. If speciation events in the parasitic Hymenoptera are associated with founder events, a faster rate of molecular evolution is expected. Alternatively, biological differences between endoparasitic Hymenoptera and endoparasitic Diptera may also account for the differences observed in molecular evolution.

  14. Medical Entomology Studies - XVI. A Review of the Species of Subgenus Verrallina, Genus Aedes, from Sri Lanka and a Revised Description of the Subgenus (Diptera: Culicidae)

    Science.gov (United States)

    1984-01-01

    351-401. Diptera Nematocera from the Federated Malay States Museums. J. Fed. Malay States Mus. 14: 1-139, 2 pls. Diptera, Fam. Culicidae. In P...266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ. Press Hawaii

  15. Methods for external disinfection of blow fly (Diptera: Calliphoridae) eggs prior to use in wound debridement therapy.

    Science.gov (United States)

    Brundage, Adrienne L; Crippen, Tawni L; Tomberlin, Jeffery K

    2016-03-01

    Maggot debridement therapy (MDT) is the use of the larval stage of flies (i.e., Calliphoridae) to remove necrotic tissue and disinfect wounds. Effective MDT requires aseptic technique to prevent the unintentional introduction of pathogenic bacteria into a wound to be debrided; yet the external surface of Calliphoridae eggs is often heavily contaminated with bacteria. Studies of external disinfection of dipteran eggs have been reported, but neither their efficacy nor effect on egg viability has been adequately assessed. The present study evaluated the efficacy of ten disinfection techniques involving immersion, rinse, or a combination of both in formalin, Lysol, formaldehyde, bleach, ethanol, Sporgon, or benzalkonium chloride. All techniques resulted in significant decreases in culturable, aerobic bacterial load on Lucilia cuprina eggs. For L. cuprina, a 10 minute 3% Lysol immersion was the most efficacious, disinfecting 96.67% of egg samples, while resulting in 31.84% egg mortality. The 5% formalin immersion was least efficacious, disinfecting only 3.33% of L. cuprina egg samples, while resulting in 33.51% egg mortality. A formaldehyde immersion, one of the most commonly used disinfection techniques, was moderately effective, disinfecting 66.7% of egg samples, while resulting in 40.16% egg mortality. For Chrysomya rufifacies and Cochliomyia macellaria egg samples, the 10 minute 3% Lysol immersion disinfected 100% of the samples, and for Lucilia sericata, 80% of egg samples, while resulting in 33.97%, 7.34%, and 36.96% egg mortality, respectively. H2 CO disinfected 16.67% of Ch. rufifacies, 26.67% of C. macellaria, and 56.67% of L. sericata egg samples, while resulting in 21.98%, 10.18%, and 32.19% egg mortality, respectively. Due to its high disinfection efficacy and relatively low egg mortality, a 10 minutes 3% Lysol immersion is recommended for sterilizing Calliphoridae eggs prior to rearing of larvae for use in MDT.

  16. The African species of the subgenus Tipula Linnaeus, 1758 (Diptera, Tipulidae)

    NARCIS (Netherlands)

    Hollander, den J.

    1975-01-01

    An account is given on the African species of the subgenus Tipula (Diptera, Tipulidae) present in the Institute of Taxonomic Zoology (Zoological Museum), Amsterdam, and a new species, T. (Tipula) lourensi, is described.

  17. New Dicranoptycha Osten Sacken, 1859 Crane flies (Diptera: Limoniidae) of North and South Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2015-02-27

    Two new species of Dicranoptycha Osten Sacken, 1859, crane flies (Diptera, Limoniidae) from the Korean peninsula are described, illustrated and compared with already known and related species. An identification key and check-list of all Korean Dicranoptycha is presented.

  18. Systematics of the blackfly subgenus Trichodagmia Enderlein (Diptera: Simuliidae: Simulium) in the new world

    NARCIS (Netherlands)

    Hernández Triana, L.M.

    2011-01-01

    Systematics of the blackfly subgenus Trichodagmia ENDERLEIN (Diptera: Simuliidae: Simulium) in the New World The systematics of the New World subgenus Trichodagmia has been reassessed by employing an integrated taxonomic approach based upon revisionary taxonomy, phylogenetic (cladistics) analysis

  19. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  20. Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure-Activity Relationship of Saturated and Unsaturated Fatty Acids

    Science.gov (United States)

    2012-11-01

    VECTOR CONTROL, PEST MANAGEMENT, RESISTANCE, REPELLENTS Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure- Activity Relationship of...deterrent effects of a series of saturated and unsaturated fatty acids against Aedes aegypti (L), yellow fever mosquito (Diptera: Culicidae) using theK...corresponding C12:0 and C12:1 homologues. KEYWORDS fatty acid, biting deterrence, repellent, structure-activity relationship, Aedes aegypti Mosquitoes transmit

  1. An Update on the Potential of North American Mosquitoes (Diptera: Culicidae) to Transmit West Nile Virus

    Science.gov (United States)

    2004-09-22

    Ps. ferox SLE Mammals Day 2 km 0, 8 0 0 Distributionandbionomicsbasedonandgeneralized from information inCarpenter andLaCasse(1955), Darsie ...competence of Culexunivittatus(Diptera:Culicidae) forWestNile virus. J. Med. Entomol. 30: 449Ð456. Darsie , R. F., and R. A. Ward. 1981. IdentiÞcation and...Mitchell, and G. B. Craig Jr . 1993. Host-feeding patterns of Aedes albopictus (Diptera: Culicidae) at a temperate North American site. J. Med. Entomol. 30

  2. Species of Oukuriella Epler (Diptera, Chironomidae inside freshwater sponges in Brazil

    Directory of Open Access Journals (Sweden)

    Fabio de Oliveira Roque

    2004-06-01

    Full Text Available Larvae of Oukuriella Epler, 1986 (Diptera, Chironomidae inside freshwater sponges are reported for the first time in Brazil.Espécies de Oukuriella Epler (Diptera, Chironomidae no interior de esponjas de água doce no Brasil. Larvas de Oukuriella Epler, 1986 no interior de esponjas de água doce são registradas pela primeira vez no Brasil.

  3. Descriptions of syntypes of Brumptamyia brumpti (Lsrrousse, 1920 (Diptera: Psychodidae-Phlebotominae

    Directory of Open Access Journals (Sweden)

    Paul Williams

    1988-09-01

    Full Text Available The male and female of Brumptomyia brumpti (Larrousse, 1920, the type species of the genus Brumptomyia França & Parrot, 1921 (Diptera: Psychodidae - phlebotominae are redescribed from syntypes in the British Museum (Natural History.É apresentada a redescrição de sinotipos macho e fêmea de Brumptomya brumpti (Larrousse, 1920, a espécie típica do gênero Brumptomyia França e Parrot, 1921 (diptera: Psychodidae - Phlebotominae.

  4. Cardiocladius oliffi (Diptera: Chironomidae as a potential biological control agent against Simulium squamosum (Diptera: Simuliidae

    Directory of Open Access Journals (Sweden)

    Wilson Michael D

    2009-04-01

    Full Text Available Abstract Background The control of onchocerciasis in the African region is currently based mainly on the mass drug administration of ivermectin. Whilst this has been found to limit morbidity, it does not stop transmission. In the absence of a macrofilaricide, there is a need for an integrated approach for disease management, which includes vector control. Vector control using chemical insecticides is expensive to apply, and therefore the use of other measures such as biological control agents is needed. Immature stages of Simulium squamosum, reared in the laboratory from egg masses collected from the field at Boti Falls and Huhunya (River Pawnpawn in Ghana, were observed to be attacked and fed upon by larvae of the chironomid Cardiocladius oliffi Freeman, 1956 (Diptera: Chironomidae. Methods Cardiocladius oliffi was successfully reared in the rearing system developed for S. damnosum s.l. and evaluated for its importance as a biological control agent in the laboratory. Results Even at a ratio of one C. oliffi to five S. squamosum, they caused a significant decrease in the number of adult S. squamosum emerging from the systems (treatments. Predation was confirmed by the amplification of Simulium DNA from C. oliffi observed to have fed on S. squamosum pupae. The study also established that the chironomid flies could successfully complete their development on a fish food diet only. Conclusion Cardiocladius oliffi has been demonstrated as potential biological control agent against S. squamosum.

  5. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae).

    Science.gov (United States)

    Elleuch, Jihen; Tounsi, Slim; Ben Hassen, Najeh Belguith; Lacoix, Marie Noël; Chandre, Fabrice; Jaoua, Samir; Zghal, Raida Zribi

    2015-01-01

    Bacillus thuringiensis is successfully used in pest management strategies as an eco-friendly bioinsecticide. Isolation and identification of new strains with a wide variety of target pests is an ever growing field. In this paper, new B. thuringiensis isolates were investigated to search for original strains active against diptera and able to produce novel toxins that could be used as an alternative for the commercial H14 strain. Biochemical and molecular characterization revealed a remarkable diversity among the studied strains. Using the PCR method, cry4C/Da1, cry30Ea, cry39A, cry40 and cry54 genes were detected in four isolates. Three strains, BLB355, BLB196 and BUPM109, showed feeble activities against Aedes aegypti larvae. Interestingly, spore-crystal mixtures of BLB361, BLB30 and BLB237 were found to be active against Ceratitis capitata with an LC50 value of about 65.375, 51.735 and 42.972 μg cm(-2), respectively. All the studied strains exhibited important mortality levels using culture supernatants against C. capitata larvae. This suggests that these strains produce a wide range of soluble factors active against C. capitata larvae. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Chironomid (Diptera species recorded from UK lakes as pupal exuviae

    Directory of Open Access Journals (Sweden)

    L.P. Ruse

    2013-09-01

    Full Text Available An inventory of chironomid species (Diptera, Chironomidae data collected from 221 lake basins or reservoirs is detailed together with major physical and chemical characteristics of these waterbodies. Aquatic species of Chironomidae must rise to the water surface for adult emergence. Floating exuviae are transported by wind and water currents to lakeshores. Species data were obtained by collecting lake marginal floating pupal exuviae representing juvenile stages dwelling from across the lake. Among the 450 species found, several were new records for the British Isles.

  7. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  8. Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae) associated with Mimosa hostilis (Mimosaceae) in Brazil

    OpenAIRE

    Valéria Cid Maia; G. Wilson Fernandes; Henrique Magalhães; Jean Carlos Santos

    2010-01-01

    Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae) associated with Mimosa hostilis (Mimosaceae) in Brazil Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae, Lopesiini), L. mimosae Maia, sp. nov. and L. pernambucensis Maia, sp. nov., that induce galls on Mimosa hostilis Benth. (Mimosaceae) are described and illustrated based on material from "caatinga" in Pernambuco, Brazil.

  9. Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae associated with Mimosa hostilis (Mimosaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia

    2010-01-01

    Full Text Available Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae associated with Mimosa hostilis (Mimosaceae in Brazil Two new species of Lopesia Rübsaamen (Diptera, Cecidomyiidae, Lopesiini, L. mimosae Maia, sp. nov. and L. pernambucensis Maia, sp. nov., that induce galls on Mimosa hostilis Benth. (Mimosaceae are described and illustrated based on material from "caatinga" in Pernambuco, Brazil.

  10. Traumatic Myiasis Caused by an Association of Sarcophaga tibialis (Diptera: Sarcophagidae) and Lucilia sericata (Diptera: Calliphoridae) in a Domestic Cat in Italy.

    Science.gov (United States)

    Pezzi, Marco; Whitmore, Daniel; Chicca, Milvia; Lanfredi, Margherita; Leis, Marilena

    2015-08-01

    We describe here a rare case of traumatic myiasis occurred in August 2014, caused by an association of 2 Diptera species, Sarcophaga tibialis Macquart (Diptera: Sarcophagidae) and Lucilia sericata (Meigen) (Diptera: Calliphoridae), in a domestic cat in northern Italy. Species identification was based on adult male morphology. The present case is the first report of S. tibialis as an agent of myiasis in Italy, and also the first ever report of myiasis caused by an association of S. tibialis and L. sericata. The cat developed an extensive traumatic myiasis in a large wound on the rump, which was treated pharmacologically and surgically. The biology, ecology, and distribution of S. tibialis and L. sericata are also discussed. A literature review is provided on cases of myiasis caused by S. tibialis, and cases of myiasis by L. sericata involving cats worldwide and humans and animals in Italy.

  11. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae).

    Science.gov (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas

    2016-01-01

    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included.

  12. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae)

    Science.gov (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas

    2016-01-01

    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included. PMID:27019632

  13. Checklist and distribution maps of the blow flies of Venezuela (Diptera, Calliphoridae, Mesembrinellidae).

    Science.gov (United States)

    Velásquez, Yelitza; Martínez-Sánchez, Ana Isabel; Thomas, Arianna; Rojo, Santos

    2017-01-01

    A checklist of the 39 species of blow flies (Calliphoridae and Mesembrinellidae) so far known to occur in Venezuela is provided, based on a thorough literature review and the examination of ca. 500 specimens deposited in the main entomological collections of the country. Data from the literature and museum collections were used to generate distribution maps for 37 species. Three species are recorded from Venezuela for the first time: Chrysomya putoria (Wiedemann, 1830), Mesembrinella spicata Aldrich, 1925 and Mesembrinella umbrosa Aldrich, 1922.

  14. Nomenclatural Studies Toward a World List of Diptera Genus-Group Names. Part V: Pierre-Justin-Marie Macquart.

    Science.gov (United States)

    Evenhuis, Neal L; Pape, Thomas; Pont, Adrian C

    2016-09-30

    The Diptera genus-group names of Pierre-Justin-Marie Macquart are reviewed and annotated. A total of 399 available genus-group names in 69 families of Diptera are listed alphabetically, for each name giving author, year and page of original publication, originally included species, type species and method of fixation, current status of the name, family placement, and a list of any emendations of it that have been found in the literature. Remarks are given to clarify nomenclatural or taxonomic information. In addition, an index to all the species-group names of Diptera proposed by Macquart (3,611, of which 3,543 are available) is given with bibliographic reference (year and page) to each original citation.        The following type species are designated herein: Agculocera nigra Macquart, 1855 for Onuxicera Macquart, 1855, present designation [Tachinidae]; Trixa imhoffi Macquart, 1834, for Semiomyia Macquart, 1848, present designation [Tachinidae].        The following type species are designated herein with fixation under ICZN Code Art. 70.3.2: Azelia nebulosa Robineau-Desvoidy, 1830 for Atomogaster Macquart, 1835, present designation [Muscidae]; Tachydromia vocatoria Fallén, 1816 for Chelipoda Macquart, 1835, present designation [Empididae]; Eriocera macquarti Enderlein, 1912 for Eriocera Macquart, 1838, present designation [Limoniidae]; Limosina acutangula Zetterstedt, 1847 for Heteroptera Macquart, 1835, present designation [Sphaeroceridae]; Phryxe pavoniae Robineau-Desvoidy, 1830 for Masicera Macquart, 1834, present designation [Tachinidae]; Pachymyia macquartii Townsend, 1916 for Pachymyia Macquart, 1844, present designation [Tachinidae].        Earlier valid subsequent type-species designations have been found in this study for the following: Anisophysa Macquart, 1835 [Sepsidae]; Diphysa Macquart, 1838 [Stratiomyidae]; Pachyrhina Macquart, 1834 [Tipulidae]; Silbomyia Macquart, 1844 [Calliphoridae].        One name is raised from

  15. Fumigant Toxicity of Phenylpropanoids Identified in Asarum sieboldii Aerial Parts to Lycoriella ingenua (Diptera: Sciaridae) and Coboldia fuscipes (Diptera: Scatopsidae).

    Science.gov (United States)

    Yi, Jee Hwan; Perumalsamy, Haribalan; Sankarapandian, Karuppasamy; Choi, Byeoung-Ryeol; Ahn, Young-Joon

    2015-06-01

    Lycoriella ingenua (Dufour) (Diptera: Sciaridae) and Coboldia fuscipes (Meigen) (Diptera: Scatopsidae) are two of the most economically important insect pests of cultivated mushrooms. The toxicities to the fly larvae of the three phenylpropanoids (methyleugenol, myristicin, and safrole) from aerial parts of Asarum sieboldii Miquel (Aristolochiaceae) were compared with those of the currently available carbamate insecticide benfuracarb. In a contact+fumigant mortality bioassay with L. ingenua and C. fuscipes larvae, methyleugenol (1.46 and 2.33 µg/cm2) was the most toxic compound, followed by safrole (2.03 and 2.59 µg/cm2) and myristicin (3.59 and 4.96 µg/cm2), based on 24-h LC50 values. The phenylpropanoids were less toxic than benfuracarb (LC50, 0.75 and 0.55 µg/cm2). In vapor-phase mortality tests with the larvae, the phenylpropanoids were consistently more toxic in closed versus open containers, indicating that the effect of the compounds was largely a result of vapor action. Global efforts to reduce the level of highly toxic synthetic insecticides in the agricultural environment justify further studies on A. sieboldii plant-derived products as potential fumigants for the control of mushroom fly populations in mushroom houses and mushroom compost.

  16. Effects of tree and herb biodiversity on Diptera, a hyperdiverse insect order.

    Science.gov (United States)

    Scherber, Christoph; Vockenhuber, Elke A; Stark, Andreas; Meyer, Hans; Tscharntke, Teja

    2014-04-01

    Biodiversity experiments have shown that plant diversity has largely positive effects on insect diversity and abundance. However, such relationships have rarely been studied in undisturbed and more complex ecosystems such as forests. Flies (Diptera) are among the most dominant taxa in temperate ecosystems, influencing many ecosystem processes. As it is unknown how Diptera respond to changes in forest biodiversity, we examined how community characteristics of Diptera respond to varying levels of tree and herb diversity and vegetation structure. The study was conducted in the Hainich National Park (Central Germany) on 84 plots along a gradient of tree (from two to nine species) and herb (from two to 28 species) diversity. We found that herb and canopy cover as well as spatial effects were the best predictors of Diptera community composition, consisting of 62 families, including 99 Empidoidea and 78 Phoridae species. Abundance of Empidoidea was positively influenced by herb diversity, indicating bottom-up control. A complex causal pathway influenced Dipteran species richness: species-rich forest stands, with low beech cover, had lower canopy cover, resulting in higher Dipteran species richness. In addition, Diptera benefited from a more dense and diverse herb community. Individual species responded differentially to herb layer diversity, indicating that effects of plant diversity on higher trophic levels depend on species identity. We conclude that tree and herb canopy cover as well as herb diversity predominately shape Dipteran communities in temperate deciduous forests, which is in contrast to expectations from grassland studies exhibiting much closer relationships between plant and insect diversity.

  17. Checklist of the Diptera (Insecta of Finland: an introduction and a summary of results

    Directory of Open Access Journals (Sweden)

    Jere Kahanpää

    2014-09-01

    Full Text Available Nearly thirty-five years have passed since Hackman published his “Check list of the Finnish Diptera” (1980. The number of true flies (Diptera known from Finland has increased by more than two thousand species since then. At the same time, hundreds of erroneous records have been recognized and purged from the checklist. ZooKeys issue 441 provides a new checklist of the Diptera species of the Republic of Finland. This introductory paper presents the rationale behind the project, provides technical documentation on the checklist format and sources used, and summarizes the results. The remaining papers in this issue cover one or more Diptera families in detail. Two electronic appendices are provided: supporting data (additional references to first published records and the previous checklist and a complete list of Finnish Diptera taxa in Darwin Core compliant format for easy computer access and processing. The new checklist records 6920 fly species from Finland, 2932 belonging to the nematoceran or lower flies and 3989 to the suborder Brachycera. The changes since 1980 are most prominent in the Lower Diptera. For example, more than 400 non-biting midges (Chironomidae have been added since 1980, and the number of moth flies (Psychodidae known from Finland has more than tripled. Among the larger families, large increases in known Finnish species are also seen in Cecidomyiidae (161% increase, Pipunculidae (98%, and Chironomidae (90%.

  18. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  19. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  20. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  1. Composition features of sarcophagus Diptera in urbanized areas of south Karelia

    Directory of Open Access Journals (Sweden)

    Lavrukova Olga Sergeevna

    2017-06-01

    Full Text Available The article deals with the study of the complex of synanthropic sarcophagus Diptera and the influence of urbanization on its composition and structure. On human corpses nine species belonging to four families were found. They developed in different parts of the corpses. Calculations were produced using PCA. The basis of the population of Diptera consists of three species - Calliphora vicina, Lucilia caesar and Protophormia terraenovae. Significant seasonal aspects resulting in changes in species composition, circumstances of finding a corpse and its condition play the main role in the formation of the complex of sarcophagus Diptera. The most successful in reproduction, development and occupation of ecological niches are those species that can be easily adapted to changing circumstances with a wide range of food.

  2. Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century

    Directory of Open Access Journals (Sweden)

    Nelson Papavero

    2012-03-01

    Full Text Available Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century. This paper presents a historical resume of the first notices about Brazilian Diptera during the 16th century, given by Francisco Pires in 1552 (the oldest mention known, José de Anchieta, Leonardo do Valle, Pero de Magalhães de Gandavo, Jean de Léry and Gabriel Soares de Souza, ending with Fernão Cardim, who made the last mentions of Brazilian Diptera in that century.

  3. Bartonella species in bat flies (Diptera: Nycteribiidae) from western Africa.

    Science.gov (United States)

    Billeter, S A; Hayman, D T S; Peel, A J; Baker, K; Wood, J L N; Cunningham, A; Suu-Ire, R; Dittmar, K; Kosoy, M Y

    2012-03-01

    Bat flies are obligate ectoparasites of bats and it has been hypothesized that they may be involved in the transmission of Bartonella species between bats. A survey was conducted to identify whether Cyclopodia greefi greefi (Diptera: Nycteribiidae) collected from Ghana and 2 islands in the Gulf of Guinea harbour Bartonella. In total, 137 adult flies removed from Eidolon helvum, the straw-coloured fruit bat, were screened for the presence of Bartonella by culture and PCR analysis. Bartonella DNA was detected in 91 (66·4%) of the specimens examined and 1 strain of a Bartonella sp., initially identified in E. helvum blood from Kenya, was obtained from a bat fly collected in Ghana. This is the first study, to our knowledge, to report the identification and isolation of Bartonella in bat flies from western Africa.

  4. The complete mitochondrial genome of Dixella aestivalis (Diptera: Nematocera: Dixidae).

    Science.gov (United States)

    Briscoe, Andrew G; Sivell, Duncan; Harbach, Ralph E

    2017-01-01

    Dixidae, meniscus midges, belong to the suborder Nematocera of the order Diptera. The family includes 197 known species classified in nine genera. The complete mitochondrial genome of the Dixella aestivalis (Meigen) from the United Kingdom is reported here, along with its annotation and comparison with the genome of an unidentified species of Dixella from China. The circular genome consists of 16 465 bp and has a gene content consisting of 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes and a non-coding, A + T-rich, control region. The mitochondrial genome of D. aestivalis can be used to identify genetic markers for species identification, and will be valuable for resolving phylogenetic relationships within the genus, family Dixidae and suborder Nematocera.

  5. Invasion Biology of Aedes japonicus japonicus (Diptera: Culicidae)

    Science.gov (United States)

    Fonseca, Dina M.

    2014-01-01

    Aedes japonicus japonicus (Theobald) (Diptera: Culicidae) has recently expanded beyond its native range of Japan and Korea into large parts of North America and Central Europe. Population genetic studies begun immediately after the species was detected in North America revealed genetically distinct introductions that subsequently merged, likely contributing to the successful expansion. Interactions, particularly in the larval stage, with other known disease vectors give this invasive subspecies the potential to influence local disease dynamics. Its successful invasion likely does not involve superior direct competitive abilities, but it is associated with the use of diverse larval habitats and a cold tolerance that allows an expanded seasonal activity range in temperate climates. We predict a continued but slower expansion of Ae. j. japonicus in North America and a continued rapid expansion into other areas as this mosquito will eventually be considered a permanent resident of much of North America, Europe, Asia, and parts of Hawaii. PMID:24397520

  6. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei

    2011-09-01

    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

  7. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri

    2011-06-01

    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.

  8. Description of the Pupa of Aedes (Ochlerotatus) Grossbecki Dyar and Knab (Diptera: Culicidae)

    Science.gov (United States)

    1991-12-01

    Diptera: Culicidae). Bull. Illinois Nat. 25:83-126. Hist. Surv. 24:1-96. Darsie , R.F., Jr . and R.A. Ward. 1981. Iden- Siverly, R.E. 1972. Mosquitoes of...Diptera: Culicidae). Mosq. Syst. 16:227- onomists’ glossary of mosquito anatomy. 270. Plexus Publ. Inc., Marlton, New Jersey. Ward, R.A. and R.F. Darsie , Jr ...Knight and Stone 1977, Knight 1978, Wood Maryland, Prince George’s County, Fort et al. 1979, Darsie and Ward 1981, Ward Washington, coll. no. BH 901, 28

  9. Cordiamyia globosa gen.n. e sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associado com Cordia Verbenacea DC. (Boraginaceae no Brasil Cordiamyia globosa gen.n. and sp.n. (Diptera, Cecidomyiidae associated with Cordia verbekacea DC. (Boraginaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia

    1996-01-01

    Full Text Available Cordiamyia globosa gen.n., sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associated with Cordia verbenacea (Boraginaceae, in Brazil, is described and illustrated (larva, pupa, male, female and gall.

  10. Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associada a Psidium cattleianum Sabine (Myrtaceae no Brasil Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associated with Psidium cattleianum Sabine (Myrtaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Alessandro C. Angelo

    1999-03-01

    Full Text Available A new species of Dasineura Rondani, 1840 (Diptera, Cecidomyiidae which causes galls on Psidium cattleianum Sabine, 1821 is described and illustrated (larva, pupa, male, female. The gall is characterized and some biological notes are given.

  11. Morphological observations on the egg and first instar larva of Metacutereba apicalis (Diptera: Cuterebidae Observações morfológicas do ovo e da larva de primeiro estágio de Metacuterebra apicalis (Diptera: Cuterebridae

    Directory of Open Access Journals (Sweden)

    Antônio Cesar Rios Leite

    1989-03-01

    Full Text Available Descriptions are given of the egg and first intar larvar of Metacutereba apicalis (Diptera: Cuterebridae when viewed by light and scanning electronic microscopes.O ovo e a larva de primeiro estágio de Metacuterebra apicalis (Diptera, Cuterebridae são descritos a nível de microscopia óptica e eletrônica de varredura.

  12. An emerging example of tritrophic coevolution between flies (Diptera: Fergusoninidae) and nematodes (Nematoda: Neotylenchidae) on Myrtaceae host plants

    Science.gov (United States)

    A unique obligate mutualism occurs between species of Fergusonina Malloch flies (Diptera: Fergusoninidae) and nematodes of the genus Fergusobia Currie (Nematoda: Neotylenchidae). These mutualists together form different types of galls on Myrtaceae, mainly in Australia. The galling association appear...

  13. The salivary secretome of the tsetse fly Glossina pallipides (Diptera: Glossinidae) infected by salivary gland hypertrophy virus

    NARCIS (Netherlands)

    Kariithi, H.M.; Ince, I.A.; Boeren, S.; Abd-Alla, A.M.M.; Parker, A.G.; Aksoy, S.; Vlak, J.M.; Oers, van M.M.

    2011-01-01

    Background The competence of the tsetse fly Glossina pallidipes (Diptera; Glossinidae) to acquire salivary gland hypertrophy virus (SGHV), to support virus replication and successfully transmit the virus depends on complex interactions between Glossina and SGHV macromolecules. Critical requisites to

  14. Mosquitoes (Diptera: Culicidae) From the Northwestern Brazilian Amazon: Padauari River.

    Science.gov (United States)

    Hutchings, R S G; Hutchings, R W; Menezes, I S; Motta, M de A; Sallum, M A M

    2016-11-01

    The mosquito fauna (Culicidae) from remote northern areas of the State of Amazonas were sampled using Centers for Disease Control and Prevention, Shannon, Malaise, and Suspended traps, together with net sweeping and immature collections. One hundred and seven collections were performed in five localities along the Padauari River, State of Amazonas, Brazil, during June 2010. The 20,557 mosquitoes collected are distributed in 17 genera, representing 117 different species, of which four are new distributional records for the State of Amazonas. Furthermore, there are 10 morphospecies that may represent undescribed new taxa, eight of which are also new records for the State of Amazonas. The genus Culex had the highest number of species and the largest number of individuals. Aedes and Psorophora both represented 10% of the total sample and had the second highest number of species and individuals. The most abundant species was Culex (Melanoconion) gnomatos Sallum, Hutchings & Ferreira, followed by Aedes (Ochlerotatus) fulvus (Wiedemann), Culex (Melanoconion) vaxus Dyar, Culex (Melanoconion) portesi Senevet & Abonnenc, Psorophora (Janthinosoma) amazonica Cerqueira, Culex (Culex) mollis Dyar & Knab, Psorophora (Janthinosoma) albigenu (Peryassú), and Culex (Melanoconion) theobaldi Lutz. The epidemiological and ecological implications of mosquito species found are discussed and are compared with other mosquito inventories from the Amazon region. The results represent the most diverse standardized inventory of mosquitoes along the Padauari River, with the identification of 127 species-level taxa distributed in five localities, within two municipalities (Barcelos and Santa Isabel do Rio Negro). © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Morphology of immature stages of Atherigona reversura (Diptera: Muscidae), with notes on the recent invasion of North America

    DEFF Research Database (Denmark)

    Grzywacz, Andrzej; Pape, Thomas; Hudson, William G.

    2013-01-01

    The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology of the se......The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology...

  16. Cutaneous neoplasm in Phaeotabanus litigiosus (Diptera, Tabanidae collected on the Marambaia Island, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    RR Guimarães

    2016-02-01

    Full Text Available A female specimen of Phaeotabanus litigiosus (Diptera: Tabanidae collected on Marambaia Island was found with a tumor in the abdominal integument. Histopathological examination revealed an epithelial dysplasia with anisokariosis and hyperchromasia. This is the first record of a neoplasm found in tabanid collected from natural environment. Key Words: Atlantic island; displasia; horse fly; insect disease; insect vector; neotropical region

  17. [The mosquitoes (Diptera Culicidae) of Morocco. Bibliographic review (1916-2001) and inventory of the species].

    Science.gov (United States)

    Trari, B; Dakki, M; Himmi, O; el Agbani, M A

    2003-11-01

    The history of the Culicidae of Morocco was related from bibliographical data. A synthesis of the almost entire works carried out on these Insects (Diptera) since 1916 allowed to bring out the main stages of research of which they were the subject, while emphasizing the important periods of large malaria epidemics in Morocco. A short list of species is also given.

  18. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae)

    OpenAIRE

    Rodrigo Vieira; José Manuel Ayala Landa

    2014-01-01

    Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae). The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  19. Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2014-12-01

    Full Text Available Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records. The female of Ctenodontina nairae Vieira, 2012 is described for the first time. Description and illustrations of the habitus, wing and terminalia of the female are provided. The distribution is extended to Bolivia and Peru.

  20. Pollinating flies (Diptera): A major contribution to plant diversity and agricultural production

    Science.gov (United States)

    Diptera are one of the three largest and most diverse animal groups of the world. As an often neglected, but important group of pollinators, they play a significant role in agrobiodiversity and biodiversity of plants everywhere. Flies are present in almost all habitats and biomes and for many food p...

  1. Vertical stratification of beetles (Coleoptera) and flies (Diptera) in temperate forest canopies.

    Science.gov (United States)

    Maguire, Dorothy Y; Robert, Katleen; Brochu, Kristen; Larrivée, Maxim; Buddle, Christopher M; Wheeler, Terry A

    2014-02-01

    Forest canopies support high arthropod biodiversity, but in temperate canopies, little is known about the spatial distribution of these arthropods. This is an important first step toward understanding ecological roles of insects in temperate canopies. The objective of this study was to assess differences in the species composition of two dominant and diverse taxa (Diptera and Coleoptera) along a vertical gradient in temperate deciduous forest canopies. Five sugar maple trees from each of three deciduous forest sites in southern Quebec were sampled using a combination of window and trunk traps placed in three vertical strata (understory, mid-canopy, and upper-canopy) for three sampling periods throughout the summer. Coleoptera species richness and abundance did not differ between canopy heights, but more specimens and species of Diptera were collected in the upper-canopy. Community composition of Coleoptera and Diptera varied significantly by trap height. Window traps collected more specimens and species of Coleoptera than trunk traps, although both trap types should be used to maximize representation of the entire Coleoptera community. There were no differences in abundance, diversity, or composition of Diptera collected between trap types. Our data confirm the relevance of sampling all strata in a forest when studying canopy arthropod biodiversity.

  2. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae(Cocquillett)(Diptera:Tephritidae)

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  3. Picture-winged fly (Euxesta, Chaetopsis spp.; Diptera: Ulidiidae) semiochemical investigations

    Science.gov (United States)

    Picture-winged flies (Euxesta, Chaetopsis spp., Diptera: Ulidiidae) are severe primary pests of sweet corn in southern Florida. Females oviposit in silks and larvae consume the silks and kernels, rendering the ear unmarketable. Growers treat their fields with numerous broad spectrum insecticide ap...

  4. First North American record of the Palaearctic rhinophorid Stevenia deceptoria (Loew) (Diptera: Rhinophoridae).

    Science.gov (United States)

    O'hara, James E; Cerretti, Pierfilippo; Dahlem, Gregory A

    2015-12-16

    The Rhinophoridae (Diptera) have a cosmopolitan distribution and a known fauna of about 150 species (Cerretti & Pape 2007). So far as known, all species are parasitoids of terrestrial woodlice (sow bugs) of the order Isopoda (Oniscoidea) (Pape 2010). Female rhinophorids lay eggs in the vicinity of potential hosts and the planidial first instars parasitize sow bugs as they pass by (Pape 1998).

  5. A remarkable new species of Eutrichopoda Townsend, 1908 (Diptera: Tachinidae: Phasiinae).

    Science.gov (United States)

    Dios, Rodrigo De Vilhena Perez; Nihei, Silvio Shigueo

    2016-06-08

    A new Tachinidae species, Eutrichopoda flavipenna sp. nov. (Diptera: Tachinidae: Phasiinae), from Brazil and Paraguay is described and illustrated by photographs and line drawings. The remarkable yellow, feather-like setae on the hind tibia distinguishes the new species from all other species in the tribe Trichopodini.

  6. The oldest accurate record of Scenopinidae in the Lowermost Eocene amber of France (Diptera: Brachycera).

    Science.gov (United States)

    Garrouste, Romain; Azar, Dany; Nel, Andre

    2016-03-22

    Eocenotrichia magnifica gen. et sp. nov. (Diptera: Scenopinidae: Metatrichini) is described and illustrated from the Lowermost Eocene amber of Oise (France) and represents the oldest definitive window fly fossil. The present discovery in the Earliest Eocene supports the Late Cretaceous-Paleocene age currently proposed for the emergence of Metatrichini.

  7. An Annotated Bibliography of the Mosquitoes and Mosquito-Borne Diseases of Guam (Diptera: Culicidae)

    Science.gov (United States)

    1976-01-01

    Nematocera . University Press of Hawaii, Honolulu, Hawaii. 618 pp. Family Culicidae; see A. Stone and M.D. Delfinado, 1973. 359 Edgren, D.C., V.S...Culicidae, in Delfinado, M.D. and D.E. Hardy (Eds.), A Catalog of the Diptera of the Oriental Region, Vol. 1: Nematocera , pp. 266-343. University Press

  8. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei

    2011-09-01

    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.Sobre o primeiro taquinídeo (Diptera, Tachinidae carregando polinários de Asclepiadoideae na Região Neotropical. Esta contribuição relata a primeira espécie neotropical de Tachinidae possivelmente associada à polinização de Asclepiadoideae: uma fêmea de Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini transportando dois polinários de Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae presos à sua probóscide. O espécime foi coletado no Paraguai, Departamento Canindeyú. O polinário é ilustrado e caracterizado. Este é o primeiro registro de antofilia para G. parviflorus e para o gênero.

  9. A new species of Anastrepha (Diptera: Tephritidae) from Euphorbia tehuacana (Euphorbiaceae) in Mexico.

    Science.gov (United States)

    Norrbom, Allen L; Castillo-Meza, Ana Lucía; García-Chávez, Juan Héctor; Aluja, Martín; Rull, Juan

    2014-03-24

    Anastrepha tehuacana, a new species of Tephritidae (Diptera) from Tehuacán, Puebla, Mexico reared from seeds of Euphorbia tehuacana (Brandegee) V.W. Steinm. (Euphorbiaceae), is described and illustrated. Its probable relationship to A. relicta Hernández-Ortiz is discussed.

  10. Morphological, Molecular, and Chromosomal Discrimination of Cryptic Anopheles (Nyssorhynchus) (Diptera: Culicidae) from South America

    Science.gov (United States)

    1998-09-01

    Elliott, R 1968. Studies on man-vector contact in some ma- larious areas in Colombia. Bull. WHO 38: 239-253. Falleroni, D. 1926. Fauna anofelica italiana ...Presencia de1 A. (N.) darlingi (Diptera: Cu- licidae), en alrededores de la ciudad de Iquitos Loreto- Peru. Bol. Sot. Per. Enf. Inf. Trop. 5: 10-12

  11. Description of the Immature Stages of Anopheles (Nyssorhynchus) rondoni (Neiva & Pinto) (Diptera: Culicidae)

    Science.gov (United States)

    1997-05-01

    Neiva & Pinto) (Diptera: Culicidae) Maria Anice Mureb Sallum/+, Richard C Wilkerson* Núcleo de Pesquisa Taxonômica e Sistemática em Entomologia ...Taxonômica e Sistemática em Entomologia Médica, Universidade de São Paulo, São Paulo. The following specimens were used for setal counts and measurements (the

  12. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri

    2011-06-01

    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.Neodexiopsis Malloch da Bolivia com descrição de uma espécie nova (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae é um gênero muito bem representado na região Neotropical, conhecido por quase 100 espécies. Na Bolívia, ele é conhecido por apenas quatro espécies: N. declivis, N. incurva, N. oculata e N. recedens, todas descritas por Stein. O estudo do material da América do Sul depositado no Muséum national d'Histoire naturelle (Paris, France, permitiu a descrição de uma nova espécie para a ciência. Uma chave para o reconhecimento das cinco espécies presentes na Bolívia é fornecida.

  13. Corrections and additions to Catalogue of Neotropical Diptera (Tabanidae of Coscarón & Papavero (2009

    Directory of Open Access Journals (Sweden)

    Augusto Loureiro Henriques

    2012-09-01

    Full Text Available Some corrections and omitted taxonomic information for the "Catalogue of Neotropical Diptera. Tabanidae" are presented. Fifteen recently described species are listed for the Neotropical region. Presently, the Neotropical region has 1,205 Tabanidae species, besides 35 unrecognized species and 29 nomina nuda.

  14. Nomenclatural studies toward a world list of Diptera genus-group names. Part V

    DEFF Research Database (Denmark)

    Evenhuis, Neal L.; Pape, Thomas; Pont, Adrian C.

    and method of fixation, current status of the name, family placement, and a list of any emendations of it that have been found in the literature. Remarks are given to clarify nomenclatural or taxonomic information. In addition, an index to all the species-group names of Diptera proposed by Macquart (3...

  15. Systematics and phylogeny of Centrioncidae, a new afromontane family of Diptera (Schizophora)

    NARCIS (Netherlands)

    Feijen, H.R.

    1983-01-01

    Arguments are put forward for the erection of a new family of Diptera, named Centrioncidae. Centrioncus prodiopsis, its only previously described representative, was originally placed in the Sepsidae and later transferred to the Diopsidae. This species is now redescribed and five more Centrioncus ar

  16. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2014-03-01

    Full Text Available Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae. The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  17. Trapping African fig fly (Diptera: Drosophilidae) with combinations of vinegar and wine

    Science.gov (United States)

    The African fig fly, Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States. Tests were conducted in southern Florida that recorded the response of Z. indianus to baits that included Merlot wine, rice vinegar, et...

  18. Wine and vinegar-based attractants for the African fig fly (Diptera: Drosophilidae)

    Science.gov (United States)

    The African fig fly (AFF), Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States after first being detected in Florida in 2005. This drosophilid is a primary pest of figs in Brazil, so there were initial concern...

  19. Checklist and distribution maps of the blow flies of Venezuela (Diptera, Calliphoridae, Mesembrinellidae)

    Science.gov (United States)

    Velásquez, Yelitza; Martínez-Sánchez, Ana Isabel; Thomas, Arianna; Rojo, Santos

    2017-01-01

    Abstract A checklist of the 39 species of blow flies (Calliphoridae and Mesembrinellidae) so far known to occur in Venezuela is provided, based on a thorough literature review and the examination of ca. 500 specimens deposited in the main entomological collections of the country. Data from the literature and museum collections were used to generate distribution maps for 37 species. Three species are recorded from Venezuela for the first time: Chrysomya putoria (Wiedemann, 1830), Mesembrinella spicata Aldrich, 1925 and Mesembrinella umbrosa Aldrich, 1922. PMID:28228670

  20. Upswing of collections of horse flies (Diptera, Tabanidae held at the National Museums of Kenya, Nairobi

    Directory of Open Access Journals (Sweden)

    Ježek Jan

    2017-03-01

    Full Text Available History of zoogeographical views and actual distribution of 23 determined species of Tabanidae from three subfamilies, five tribes and 8 genera (Philoliche Wiedemann, 1828 - 4 species; Chrysops Meigen, 1803 - 3; Thaumastocera Grünberg, 1906 - 1; Ancala Enderlein, 1922 - 1; Atylotus Osten-Sacken, 1876 - 1; Tabanus Linnaeus, 1758 - 8; Haematopota Meigen, 1803 - 4; Hippocentrum Austen, 1908 - 1 mainly from Kenya are summarized, using the names of recent African countries. Tabanus sericiventris Loew, 1858 is new for Kenya. Lower taxonomical units as Tabanus insignis f. neavei Austen, 1912 and T. marmorosus ssp. congicola Bequaert, 1930 are discussed. A complete new references to all identified taxa are given.

  1. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina Lista de los quironómidos (Chironomidae: Diptera del Parque Nacional Nahuel Huapi, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano Donato

    2008-06-01

    Full Text Available This paper presents the first inventory of modern and subfossil taxa of the Family Chironomidae (Insecta: Diptera from Nahuel Huapi National Park in Patagonia, Argentina. The catalogued fauna contains 104 species in 48 genera and 6 sub-families for modern fauna and 52 morphotypes in 36 genera and 4 subfamilies for sub-fossil fauna.Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  2. Registros de mayor altitud para mosquitos (Diptera: Culicidae en Venezuela

    Directory of Open Access Journals (Sweden)

    Juan-Carlos Navarro

    2010-03-01

    Full Text Available Los mosquitos (Diptera: Culicidae son insectos holometábolos con estadios inmaduros acuáticos que utilizan una amplia variedad de hábitats larvales, desde cuerpos de agua en el suelo hasta Fitotelmata (depósitos de agua en las plantas y depósitos artificiales. La disponibilidad de sitios de reproducción a menudo determina el límite superior del ámbito de los mosquitos. Nosotros construimos una base de datos de 9 607 registros, 432 localidades, 19 géneros y 254 especies. La coordillera Andina posee el 77% de los registros con mayor altitud incluyendo Aedes euris con un registro a 3 300 m, seguido por tres especies de Anopheles -subgénero Kerteszia- con una altitud máxima de 2 680 m. Wyeomyia bicornis y Culex daumastocampa a 2 550 m fueron los registros de mayor altitud en la cordillera Costera- Central, mientras que el record más alto en Pantepui fue Wyeomyia zinzala a 2 252 m. El 60% de los registros de máxima altitud están representados por especies asociadas con fitotelmata (Bromeliaceae y Sarraceniaceae. Los límites superiores de Culex quinquefasciatus y Anopheles (Kerteszia podría representar el límite teórico para la transmisión de filariasis o arbovirus, por Culex y malaria por Anopheles (Kerteszia en Venezuela. Del mismo modo, un vector del dengue, Aedes aegypti, no ha sido registrado por encima de 2 000 m.Highest mosquito records (Diptera: Culicidae in Venezuela. Mosquitoes (Diptera: Culicidae are holometabolous insects with aquatic immature stages, which use a broad variety of larval habitats, from ground water bodies to Phytothelmata (water deposits in plants and artificial deposits. The availability of breeding sites often determines the upper limits of mosquito ranges. We built a database with 9 607 records with 432 localities, 19 genera and 254 species. The Andean mountains have 77% of the highest mosquito records including Aedes euris with record at 3 133 m, followed by three species of Anopheles -subgenera

  3. Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae) no Pantanal Sul-mato-grossense, Brasil

    OpenAIRE

    2011-01-01

    Cochliomyia macellaria (Diptera: Calliphoridae), known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throu...

  4. Adhesive attachments of the endangered botfly, Portschinskia magnifica (Diptera: Oestridae).

    Science.gov (United States)

    Yang, Y Z; Zhang, D

    2014-10-01

    Portschinskia magnifica (Diptera: Oestridae) is an endangered subcutaneous parasitic fly that is mainly distributed in Eurasia. The external morphology of the main adhesive attachments that include the pretarsus and tarsus is studied using scanning electron microscopy. Two types of tenent setae that are characterised as spoon-like tip and pointed-like tip, which can increase the contact points for attachment to a surface, are described in this study. Hairs around the bristle of the empodium in P. magnifica are much denser than those of other flies, and thus, we proposed that the dense hairs around the empodium may be a more efficient way to perform the sensory function. Compared with saprophagous flies that are reported previously, the microsculpture of the unguitractor plate is obviously different in that microplates are scale-like and similar to those of the water bug, Ranatra linearis. In addition, microtrichia found in the lateral region of the unguitractor plate provides stronger fixation between two surfaces. These results provide anatomical information that allows us to understand the role of the pretarsus as an attachment device.

  5. The larval head of Exechia (Mycetophilidae) and Bibio (Bibionidae) (Diptera).

    Science.gov (United States)

    Bauernfeind, René; Schneeberg, Katharina; Beutel, Rolf Georg

    2015-07-01

    Exechia and Bibio have retained several plesiomorphic groundplan features of Diptera and Bibionomorpha, including a fully exposed and sclerotized head capsule, the transverse undivided labrum, the absence of movable premandibles, and undivided mandibles without combs. The fusion of the hypostomal bridge with the head capsule and largely reduced antennae are derived features shared by both taxa. The absence of teeth at the anterior hypostomal margin is a potential autapomorphy of Bibionomorpha. A basal position of Anisopodidae is suggested by a number of plesiomorphies retained in this family. Apomorphies of Bibionomorpha excluding Anisopodidae are the reduction of tentorial elements, the partial fusion of the labrum and clypeus, one-segmented antennae, the absence of a separate submental sclerite, the loss of the labial palpus, and the reduction of the pharyngeal filter apparatus. Head structures of Bibio are largely unmodified. The subprognathous orientation is one of few autapomorphic features. In contrast, the mouthparts of Exechia are highly modified in correlation with the specialized food uptake. The rasping counterrotating movements of maxillae and mandibles with teeth oriented in opposite directions are carried out by strongly developed extensors and flexors of the paired mouthparts. The modified labium mechanically supports the "drill head" formed by the mandibles und maxillae. The necessary stability of the head capsule is provided by the hypostomal bridge which also compensates the far-reaching reduction of the tentorium.

  6. Chironomid (Diptera, Chironomidae species assemblages in northeastern Algerian hydrosystems

    Directory of Open Access Journals (Sweden)

    N. Chaib

    2013-04-01

    Full Text Available The aim of this paper was to analyze the distribution of chironomids (Diptera, Chironomidae, and determine their substrate preferences, from two hydrosystems located in northeastern Algeria: the Kebir-East and the Seybouse wadis. Sixty-five species were recorded in 49 sampling sites distributed along the main courses of the two hydrographic nets and their tributaries. The majority of taxa comprised cosmopolitan species widely distributed along these two hydrosystems. Cricotopus (Cricotopus bicinctus showed the highest abundance and frequency of occurrence (29.52% and was widespread in almost all the sampling sites. Species richness ranged from 4 to 23, Shannon diversity between 0.15 and 0.90, Evenness from 0.23 to 1. A cluster analysis was carried out to represent the different groups of sites sharing similar species composition. Agglomerative cluster analysis grouped the sampling sites into four clusters according to the community data. An Indval analysis was then carried out to detect indicator species for each group of the sampling sites. Cricotopus (Isocladius sylvestris was indicator of the first group of the sampling sites. Orthocladius pedestris, Rheocricotopus chalybeatus and C. bicinctus were indicators of the second group, and Polypedilum cultellatum of the third group. The fourth group was not characterized by any species. Indval analysis allowed also to determine species preferences for substrate size: Corynoneura scutellata and Dicrotendipes nervosus emphasized a preference to fine gravel, and Glyptotendipes pallens to fine sand.

  7. Diel periodicity of Drosophila suzukii (Diptera: Drosophilidae) under field conditions

    Science.gov (United States)

    Evans, Richard K.; Toews, Michael D.

    2017-01-01

    Drosophila suzukii Matsumura (Diptera: Drosophilidae), an economically important pest of blueberry and other thin-skinned fruits, persists and prolifically reproduces under seemingly lethal climatic conditions in the field. However, behavioral and physiological mechanisms employed by D. suzukii to tolerate such extreme climatic conditions in the field are unknown. The primary objective of this project was to investigate diel periodicity of D. suzukii and their reproductive success under field conditions as related by climatic factors such as temperature and relative humidity. Results show that D. suzukii reproductive success was significantly higher during the night (including dawn and dusk periods) than the day in terms of oviposition, pupation, adult eclosion, and the number of progeny per female. Female D. suzukii reproductive success was not significantly different between specific regions of a blueberry bush in relation to the amount of shade provided by the canopy. Our studies indicate that D. suzukii flight activity is crepuscular and is sensitive to fluctuations in temperature and relative humidity. Results also suggest that the majority of fly activity during peak hours is concentrated in areas around the border and within the center of blueberry orchards with little activity in the surrounding wooded areas. These findings suggest that D. suzukii prefers microclimate with mild temperatures and high humidity, and does not function well when exposed to direct sunlight with extreme heat. The authors propose that D. suzukii management strategies should be implemented during the early morning and immediately before darkness to maximize efficacy. PMID:28187140

  8. Blood meal analysis of culicoides (Diptera: ceratopogonidae) in central Tunisia.

    Science.gov (United States)

    Slama, Darine; Haouas, Najoua; Mezhoud, Habib; Babba, Hamouda; Chaker, Emna

    2015-01-01

    To evaluate the host preferences of Culicoides species (Diptera: Ceratopogonidae) in Central Tunisia, we identified the source of blood meals of field collected specimens by sequencing of the cytochrome b (cyt b) mitochondrial locus and Prepronociceptine single copy nuclear gene. The study includes the most common and abundant livestock associated species of biting midges in Tunisia: C. imicola, C. jumineri, C. newsteadi, C. paolae, C. cataneii, C. circumscriptus, C. kingi, C. pseudojumineri, C. submaritimus, C. langeroni, C. jumineri var and some unidentified C. species. Analysis of cyt b PCR products from 182 field collected blood-engorged females' midges revealed that 92% of them fed solely on mammalian species, 1.6% on birds, 2.4% on insects and 0.8% on reptiles. The blast results identified the blood origin of biting midges to the species level with exact or nearly exact matches (≥98%). The results confirm the presence of several Culicoides species, including proven vectors in Central Tunisia. Blood meal analyses show that these species will indeed feed on bigger mammals, thereby highlighting the risk that these viruses will be able to spread in Tunisia.

  9. Evolution and Structural Analyses of Glossina morsitans (Diptera; Glossinidae Tetraspanins

    Directory of Open Access Journals (Sweden)

    Edwin K. Murungi

    2014-11-01

    Full Text Available Tetraspanins are important conserved integral membrane proteins expressed in many organisms. Although there is limited knowledge about the full repertoire, evolution and structural characteristics of individual members in various organisms, data obtained so far show that tetraspanins play major roles in membrane biology, visual processing, memory, olfactory signal processing, and mechanosensory antennal inputs. Thus, these proteins are potential targets for control of insect pests. Here, we report that the genome of the tsetse fly, Glossina morsitans (Diptera: Glossinidae encodes at least seventeen tetraspanins (GmTsps, all containing the signature features found in the tetraspanin superfamily members. Whereas six of the GmTsps have been previously reported, eleven could be classified as novel because their amino acid sequences do not map to characterized tetraspanins in the available protein data bases. We present a model of the GmTsps by using GmTsp42Ed, whose presence and expression has been recently detected by transcriptomics and proteomics analyses of G. morsitans. Phylogenetically, the identified GmTsps segregate into three major clusters. Structurally, the GmTsps are largely similar to vertebrate tetraspanins. In view of the exploitation of tetraspanins by organisms for survival, these proteins could be targeted using specific antibodies, recombinant large extracellular loop (LEL domains, small-molecule mimetics and siRNAs as potential novel and efficacious putative targets to combat African trypanosomiasis by killing the tsetse fly vector.

  10. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  11. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe.

    Science.gov (United States)

    Alten, B; Ozbel, Y; Ergunay, K; Kasap, O E; Cull, B; Antoniou, M; Velo, E; Prudhomme, J; Molina, R; Bañuls, A-L; Schaffner, F; Hendrickx, G; Van Bortel, W; Medlock, J M

    2015-12-01

    The distribution of phlebotomine sand flies is widely reported to be changing in Europe. This can be attributed to either the discovery of sand flies in areas where they were previously overlooked (generally following an outbreak of leishmaniasis or other sand fly-related disease) or to true expansion of their range as a result of climatic or environmental changes. Routine surveillance for phlebotomines in Europe is localized, and often one of the challenges for entomologists working in non-leishmaniasis endemic countries is the lack of knowledge on how to conduct, plan and execute sampling for phlebotomines, or how to adapt on-going sampling strategies for other haematophagous diptera. This review brings together published and unpublished expert knowledge on sampling strategies for European phlebotomines of public health concern in order to provide practical advice on: how to conduct surveys; the collection and interpretation of field data; suitable techniques for the preservation of specimens obtained by different sampling methods; molecular techniques used for species identification; and the pathogens associated with sand flies and their detection methods.

  12. Biogeography of Drosophila (Diptera: Drosophilidae) in East and Southeast Asia.

    Science.gov (United States)

    Liu, Fu-Guo Robert; Tsaur, Shun-Chern; Huang, Hsiao-Ting

    2015-01-01

    The causes of high biological diversity in biodiversity hotspots have long been a major subject of study in conservation biology. To investigate this matter, we conducted a phylogeographic study of five Drosophila (Diptera: Drosophilidae) species from East and Southeast Asia: Drosophila albomicans Duda, D. formosana Duda, D. immigrans Sturtevant, D. melanogaster Meigen, and D. simulans Sturtevant. We collected 185 samples from 28 localities in eight countries. From each collected individual, we sequenced the autosomal extra sex comb gene (esc) and seven mitochondrial genes, including nicotinamide adenine dinucleotide hydrate-reductase dehydrogenase subunit 4 (ND4), ND4L, tRNA-His, tRNA-Pro, tRNA-Thr, partial ND5, and partial ND6. Phylogenetic analyses using maximum- likelihood and Bayesian methods revealed interesting population structure and identified the existence of two distinct D. formosana lineages (Southeast Asian and Taiwanese populations). Genetic differentiation among groups of D. immigrans suggests the possibility of endemic speciation in Taiwan. In contrast, D. melanogaster remained one extensively large population throughout East and Southeast Asia, including nearby islets. A molecular clock was used to estimate divergence times, which were compared with past geographical events to infer evolutionary scenarios. Our findings suggest that interglacial periods may have caused population isolation, thus enhancing population differentiation more strongly for some of the Drosophila species. The population structure of each Drosophila species in East and Southeast Asia has been influenced by past geographic events.

  13. DNA-based identification of forensically important Australian Sarcophagidae (Diptera).

    Science.gov (United States)

    Meiklejohn, Kelly A; Wallman, James F; Dowton, Mark

    2011-01-01

    The utility of the forensically important Sarcophagidae (Diptera) for time since death estimates has been severely limited, as morphological identification is difficult and thermobiological histories are inadequately documented. A molecular identification method involving the sequencing of a 658-bp 'barcode' fragment of the mitochondrial cytochrome oxidase subunit I (COI) gene from 85 specimens, representing 16 Australian species from varying populations, was evaluated. Nucleotide sequence divergences were calculated using the Kimura-two-parameter distance model and a neighbour-joining phylogenetic tree generated. All species were resolved as reciprocally monophyletic, except Sarcophaga dux. Intraspecific and interspecific variation ranged from 0.000% to 1.499% (SE = 0.044%) and 6.658% to 8.983% (SE = 0.653%), respectively. The COI 'barcode' sequence was found to be suitable for the molecular identification of the studied Australian Sarcophagidae: 96.5% of the examined specimens were assigned to the correct species. Given that the sarcophagid fauna is poorly described, it is feasible that the few incorrectly assigned specimens represent cryptic species. The results of this research will be instrumental for implementation of the Australian Sarcophagidae in forensic entomology.

  14. Identification of Belgian mosquito species (Diptera: Culicidae) by DNA barcoding.

    Science.gov (United States)

    Versteirt, V; Nagy, Z T; Roelants, P; Denis, L; Breman, F C; Damiens, D; Dekoninck, W; Backeljau, T; Coosemans, M; Van Bortel, W

    2015-03-01

    Since its introduction in 2003, DNA barcoding has proven to be a promising method for the identification of many taxa, including mosquitoes (Diptera: Culicidae). Many mosquito species are potential vectors of pathogens, and correct identification in all life stages is essential for effective mosquito monitoring and control. To use DNA barcoding for species identification, a reliable and comprehensive reference database of verified DNA sequences is required. Hence, DNA sequence diversity of mosquitoes in Belgium was assessed using a 658 bp fragment of the mitochondrial cytochrome oxidase I (COI) gene, and a reference data set was established. Most species appeared as well-supported clusters. Intraspecific Kimura 2-parameter (K2P) distances averaged 0.7%, and the maximum observed K2P distance was 6.2% for Aedes koreicus. A small overlap between intra- and interspecific K2P distances for congeneric sequences was observed. Overall, the identification success using best match and the best close match criteria were high, that is above 98%. No clear genetic division was found between the closely related species Aedes annulipes and Aedes cantans, which can be confused using morphological identification only. The members of the Anopheles maculipennis complex, that is Anopheles maculipennis s.s. and An. messeae, were weakly supported as monophyletic taxa. This study showed that DNA barcoding offers a reliable framework for mosquito species identification in Belgium except for some closely related species. © 2014 John Wiley & Sons Ltd.

  15. Response of Lucilia sericata (Diptera: Calliphoridae) to Screwworm Oviposition Attractant.

    Science.gov (United States)

    Chaudhury, M F; Zhu, J J; Skoda, S R

    2015-07-01

    The sheep blowfly, Lucilia sericata Meigen (Diptera: Calliphoridae), causes sheep myiasis in various parts of the world. Female flies are attracted to sheep following various olfactory cues emanating from the sheep's body, and oviposit on suitable substrates on sheep ultimately causing myiasis. Earlier workers attempted to reduce fly population in the field, with some success, using traps baited with various attractants. This research was conducted to determine if L. sericata would respond to a recently developed synthetic attractant that has attracted gravid screwworms, Cochliomyia hominivorax Coquerel, and stimulated them to oviposit. Results of the laboratory bioassays demonstrated that gravid females L. sericata were attracted to substrates treated with the synthetic screwworm attractant composed of five compounds--dimethyl disulfide, dimethyl trisulfide, phenol, p-cresol, and indole. Tests with various combinations of these compounds suggest that the sulfur compounds and indole are the most important compounds to elicit attraction and stimulate oviposition, while phenol and p-cresol may have minor roles. Semiochemical baits based on these compounds may be useful in the field to trap gravid L. sericata. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  16. Anopheles lindesayi japonicus Yamada (Diptera: Culicidae) in Korea: comprehensive review, new collection records, and description of larval habitats

    Science.gov (United States)

    2007-09-01

    in this study were found to be in association with larvae of: An. koreicus Yamada and Watanabe. An. sinensis Wiedemann. An. sineroides Yamada. Culex ...Entomoi. lost 16: 989 pp. Tanaka. K. 2003. Studies on the pupal mosquitoes of Japan (9). Genus Lutzia. with establishment of two new subgenera...identified sites. This study reports the collection of 538 specimens from 16 sites as part of the authors’ 2004-2007 anopheline surveillance. Larvae

  17. An illustrated key to adult males of neotropical Fannia Robineau-Desvoidy belonging to pusio sub-group (Diptera, Fanniidae).

    Science.gov (United States)

    Couri, M S

    2005-11-01

    The 11 neotropical species of Fannia belonging to the pusio sub-group (canicularis group), are keyed F. dodgei Seago; F. femoralis (Stein); F. pamplonae Couri & Araújo; F. parafemoralis Araújo & Couri; F. paraisensis Araújo & Couri; F. punctivervis Malloch; F. pusio (Wiedemann); F. sabroskyi Seago; F. snyderi Seago; F. trimaculata (Stein); F. trimaculatoides Couri & Pamplona. The key is addressed only to the males and the illustrations help in the visualization of the characters.

  18. A taxonomic revision of the Southern South American species of the genus Fannia Robineau-Desvoidy (Diptera: Fanniidae)

    OpenAIRE

    Martha Cecilia Dominguez

    2007-01-01

    The Southern South American species of the genus Fannia Robineau-Desvoidy are revised. Twenty five valid species are recognized for the region in the present study: Fannia albitarsis Stein, Fannia anthracina (Walker), Fannia bigoti Stein, Fannia canicularis (Linnaeus), Fannia confusa Pont & Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein), Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani), Fannia heydenii (Wiedemann), Fannia hirtifemur (Stei...

  19. Bithoracochaeta Stein: descriptions and first records from Colombia (Diptera, Muscidae, Coenosiinae

    Directory of Open Access Journals (Sweden)

    Marcia S. Couri

    2005-01-01

    Full Text Available Bithoracochaeta Stein is a Neotropical genus of Muscidae, Coenosiinae, known from ten species recorded from Argentina, Brazil, Costa Rica, Cuba, Ecuador, Guyana, Jamaica, Mexico, Panama, Paraguay, Peru, Puerto Rico, Surinam, Uruguay and Venezuela. The genus is recorded for the first time from Colombia, with the occurrence of the following species: B. annulata Stein, 1911; B. calopus (Bigot, 1885; B. flavicoxa Malloch, 1934; B. leucoprocta (Wiedemann, 1830; B. maricaensis Couri & Motta, 1995 and B. varicornis (Coquilett, 1900. B. nigricoxa, spec. nov. is described from Mexico and Brazil. A brief diagnosis of the known species and a complete description of the new species are given.Bithoracochaeta Stein é um gênero Neotropical de Muscidae, Coenosiinae, com 10 espécies descritas da Argentina, Brasil, Costa Rica, Cuba, Equador, Guiana, Jamaica, México, Panamá, Paraguai, Peru, Porto Rico, Suriname, Uruguai e Venezuela. O gênero é registrado pela primeira vez na Colômbia, com a ocorrência das seguintes espécies: B. annulata Stein, 1911; B. calopus (Bigot, 1885; B. flavicoxa Malloch, 1934; B. leucoprocta (Wiedemann, 1830; B. maricaensis Couri & Motta, 1995 e B. varicornis (Coquilett, 1900. B. nigricoxa spec. nov. é descrita do México e do Brasil. Uma breve diagnose das espécies conhecidas e a descrição completa da nova espécie são apresentadas.

  20. Blowflies (Diptera, Calliphoridae) Associated with Pig Carcasses in a Caatinga Area, Northeastern Brazil.

    Science.gov (United States)

    Alves, A C F; Santos, W E; Farias, R C A P; Creão-Duarte, A J

    2014-04-01

    Studies that focused on Calliphoridae associated with pig carcasses are abundant in southern and southeastern Brazil; however, there are few in northeast. Here, we present an inventory of the blowfly species associated with the stages of decomposition of pig carcasses in a caatinga area during dry and rainy seasons. The study took place at the Private Reserve for the Environmental Inheritance "Fazenda Almas," state of Paraíba, Brazil. Using a modified version of the Shannon trap, 32,909 adult specimens belonging to eight species were captured. During the dry season, Cochliomyia macellaria (Fabricius) (52.2%) and Chrysomya albiceps (Wiedemann) (39.9%) were the most abundant species. In the rainy season, when the majority of individuals were captured (93.7%), Chloroprocta idioidea (Robineau-Desvoidy) (71.1%) was the most abundant. Five decomposition stages were recognized, being the active decay the most attractive to colonization by blowflies, except for Lucilia eximia (Wiedemann), which was more abundant in the bloated stage.

  1. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  2. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  3. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  4. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  5. Attraction of Ceratitis capitata (Diptera: Tephritidae) and Nontarget Insects to the Attractant BioLure and its Individual Components in Hawaii.

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  6. Confirming Hypoderma tarandi (Diptera: Oestridae) human ophthalmomyiasis by larval DNA barcoding.

    Science.gov (United States)

    Rukke, Bjørn Arne; Cholidis, Symira; Johnsen, Arild; Ottesen, Preben

    2014-06-01

    DNA barcoding is a practical tool for species identification, when morphological classification of an organism is difficult. Herein we describe the utilisation of this technique in a case of ophthalmomyiasis interna. A 12-year-old boy was infested during a summer holiday in northern Norway, while visiting an area populated with reindeer. Following medical examination, a Diptera larva was surgically removed from the boy's eye and tentatively identified from its morphological traits as Hypoderma tarandi (L.) (Diptera: Oestridae). Ultimately, DNA barcoding confirmed this impression. The larval cytochrome c oxidase subunit 1 (COI) DNA sequence was matched with both profiles of five adult H. tarandi from the same region where the boy was infested, and other established profiles of H. tarandi in the Barcode of Life Data Systems (BOLD) identification engine.

  7. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos

    2011-12-01

    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.Pupa e adulto macho previamente desconhecidos de Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. A pupa de Neobezzia fittkaui Wirth & Ratanaworabhan, 1972 foi coletada em macrófitas aquáticas flutuantes (Salvinia auriculata Aubl., Salviniaceae na Ilha da Marchantaria próximo a Manaus, Brasil e o adulto macho criado foi descrito, fotografado e ilustrado pela primeira vez. Esta é a primeira descrição para a pupa do gênero Neobezzia Wirth & Ratanaworabhan.

  8. Multiple species of scuttle flies (Diptera: Phoridae) as contaminants in forensic entomology laboratory insect colony.

    Science.gov (United States)

    Zuha, R M; Jenarthanan, L X Q; Disney, R H L; Omar, B

    2015-09-01

    In forensic entomology, larval rearing usually includes the presence of biological contaminants including scuttle flies (Diptera: Phoridae). Scuttle flies are recognized as forensically important insects and have been reported causing nuisance and contamination in laboratory environments. This paper reports for the first time the finding of multiple scuttle fly species affecting colonies of third instar larvae of the Oriental latrine blowfly, Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae), reared indoors at the Forensic Science Simulation Site, Universiti Kebangsaan Malaysia. Adult scuttle flies were discovered inside a rearing container after the emergence of adult C. megacephala., The scuttle fly species are Megaselia scalaris (Loew), M. spiracularis Schmitz and Puliciphora borinquenensis (Wheeler). Notes on the life history and biology of these species are discussed herein.

  9. First Report of Zaprionus indianus (Diptera: Drosophilidae) in Commercial Fruits and Vegetables in Pennsylvania

    Science.gov (United States)

    Joshi, Neelendra K.; Biddinger, David J.; Demchak, Kathleen; Deppen, Alan

    2014-01-01

    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed. PMID:25434039

  10. The Effect of Clothing on the Rate of Decomposition and Diptera Colonization on Sus scrofa Carcasses.

    Science.gov (United States)

    Card, Allison; Cross, Peter; Moffatt, Colin; Simmons, Tal

    2015-07-01

    Twenty Sus scrofa carcasses were used to study the effect the presence of clothing had on decomposition rate and colonization locations of Diptera species; 10 unclothed control carcasses were compared to 10 clothed experimental carcasses over 58 days. Data collection occurred at regular accumulated degree day intervals; the level of decomposition as Total Body Score (TBSsurf ), pattern of decomposition, and Diptera present was documented. Results indicated a statistically significant difference in the rate of decomposition, (t427  = 2.59, p = 0.010), with unclothed carcasses decomposing faster than clothed carcasses. However, the overall decomposition rates from each carcass group are too similar to separate when applying a 95% CI, which means that, although statistically significant, from a practical forensic point of view they are not sufficiently dissimilar as to warrant the application of different formulae to estimate the postmortem interval. Further results demonstrated clothing provided blow flies with additional colonization locations.

  11. First report of Zaprionus indianus (Diptera: Drosophilidae) in commercial fruits and vegetables in Pennsylvania.

    Science.gov (United States)

    Joshi, Neelendra K; Biddinger, David J; Demchak, Kathleen; Deppen, Alan

    2014-01-01

    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed.

  12. The evolution of head structures in lower Diptera

    Directory of Open Access Journals (Sweden)

    Katharina Schneeberg

    2014-12-01

    Full Text Available The head of adult dipterans is mainly characterized by modifications and more or less far-reaching reductions of the mouthparts (e.g., mandibles and maxillae, linked with the specialization on liquid food and the reduced necessity to process substrates mechanically. In contrast, the compound eyes and the antennae, sense organs used for orientation and for finding a suitable mating partner and oviposition site, are well developed. Some evolutionary novelties are specific adaptations to feeding on liquefied substrates, such as labellae with furrows or pseudotracheae on their surface, and the strongly developed pre– and postcerebral pumping apparatuses. In some dipteran groups specialized on blood, the mandibles are still present as piercing stylets. They are completely reduced in the vast majority of families. Within the group far-reaching modifications of the antennae take place, with a strongly reduced number of segments and a specific configuration in Brachycera. The feeding habits and mouthparts of dipteran larvae are much more diverse than in the adults. The larval head is prognathous and fully exposed in the dipteran groundplan and most groups of lower Diptera. In Tipuloidea and Brachycera it is partly or largely retracted, and the sclerotized elements of the external head capsule are partly or fully reduced. The larval head of Cyclorrhapha is largely reduced. A complex and unique feature of this group is the cephaloskeleton. The movability of the larvae is limited due to the lack of thoracic legs. This can be partly compensated by the mouthparts, which are involved in locomotion in different groups. The mouth hooks associated with the cyclorrhaphan cephaloskeleton provide anchorage in the substrate.

  13. A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae

    Directory of Open Access Journals (Sweden)

    Hüseyin Özdikmen

    2011-03-01

    Full Text Available A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae. A junior homonym was detected among neotropical sciarid flies genera and the following replacement name is proposed: Novaniarella nom. nov. for Aniarella Enderlein, 1911 (nec Bolivar, 1906. Accordingly, new combinations are herein proposed for the species currently included in this genus: Novaniarella azteca (Lane, 1959 comb. nov., Novaniarella brevis (Rubsaamen, 1894 comb. nov. and Novaniarella pelluscens (Enderlein, 1911 comb. nov.

  14. The Brazilian Malaria Vector Anopheles (Kerteszia) Cruzii: Life Stages and Biology (Diptera: Culicidae)

    Science.gov (United States)

    1991-11-01

    Mosquitos no litoral paranaense. I - Idade fisioldgica de no Parque National da Serra dos Orgaos, Anopheles cruzii (Diptera, Culicidae). Arq. Estado do...no Parque National da Peryassii, A.G. 1908. OS culicideos do Brazil. Serra dos Grgaos, Estado do Rio de Janeiro, Inst. de Manguinhos, Rio de Janeiro...Kerteszia no litoral Guimar%es, A.E. and V.N.M. Victoria. 1986. do estado de Santa Catarina. Rev. Bras. Mosquitos no Parque National da Serra dos

  15. Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae). Revision

    Science.gov (United States)

    1988-01-01

    Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio sistematico de los...subgenero Nyssorhynchus do Brasil. Arq. Hig. Saude Publica 8:141-162. 1950. Do diagnostico diferencial entre A (N) strodel e A (N) pessoai na fase larvaria...Mex. , D. F. , Secr. Salubr. Asist. 181 p. Vargas V. M. 1956. Clave numerica para identificacion de larvas en cuarta fase de Anophelini en Costa Rica

  16. A Revision of the Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae)

    Science.gov (United States)

    1988-01-01

    Middle America. Contrib. Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio...N) pessoai na fase larvaria. Rev. Bras. Malariol. 2:38-48. Galvao, A. L. A. and F. A. D. Amaral 1938. Sobre urn novo anofelino de Campos do Jordao...Salubr. Taxonomia y distribution. Mex., D. F., P* identification de larvas en cuarta fase de Rev. Biol. Trop. 4:27-34. identification de larvas

  17. MOSQUITO (DIPTERA: CULICIDAE) AS A BIOINDICATOR OF ENVIRONMENTAL HEALTH AND DISEASE OUTBREAK

    OpenAIRE

    Sugeng Juwono Mardihusodo

    2006-01-01

    Quality of public health is greatly influenced by a lot of environmental factors, especially biotic factors among wich is a group of hematophagus mosquitoes (Diptera: Culicidae) showing high competence as disease vector(s). The vector mosquitoes belong to different species of different genera: *Anopheles, Aedes, Culex*, and *Mansonia.*In hypersensitive individuals, mosquito bites may induce pain and itching on the skin where the mosquito suck blood, allergic dermat...

  18. Four cases of pediculosis caused by Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) from peninsular Malaysia.

    Science.gov (United States)

    Pakeer, O; Jeffery, J; Mohamed, A M; Ahmad, F; Baharudin, O

    2007-12-01

    Four cases of pediculosis, two in adults and two in children, caused by the crab-louse, Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) is reported from peninsular Malaysia. This is the second report of the problem to be documented from the country. Although P. pubis is closely associated with genital hairs, it is, however, also found to occur on the eyelashes, eyebrows, hairs of the body, head and axilla. The few reported cases of pthiriasis probably do not reflect the true situation.

  19. Palpada panorama sp. n. (Diptera: Syrphidae), a big-eyed hoverfly from Peru and Suriname.

    Science.gov (United States)

    Reemer, Menno; Morales, Mirian N

    2016-03-15

    The hoverfly species Palpada panorama sp. n. (Diptera: Syrphidae) is described based on specimens from Peru and Suriname. It belongs to the scutellaris species group and it is most similar to P. erratica (Curran, 1930), from which it differs most notably by the strongly enlarged ommatidia in the upper half of the eye. Additional differences between these two species and an adjustment for the latest identification key for the species of the scutellaris group are given.

  20. Review of the genus Parerigone Brauer (Diptera: Tachinidae) with five new species from China.

    Science.gov (United States)

    Wang, Qiang; Zhang, Chuntian; Wang, Xinhua

    2015-02-18

    The genus Parerigone (Diptera, Tachinidae) is reviewed. Five new species from China, P. atrisetosa sp. nov., P. flava sp. nov., P. flavisquama sp. nov., P. laxifrons sp. nov. and P. wangi sp. nov., are described and illustrated. Parerigone flavihirta (Chao & Sun) is proposed as a new synonym of P. takanoi Mesnil. Diagnosis of species examined and a key to the 15 species of Parerigone are provided.

  1. New species of Lopesia (Diptera, Cecidomyiidae associated with Eichhornia azurea (Pontederiaceae from Brazil

    Directory of Open Access Journals (Sweden)

    Maria V. Urso-Guimarães

    2014-12-01

    Full Text Available A new species of gall midge, Lopesia eichhorniae sp. nov. (Cecidomyiidae, Diptera, associated with rhizomes of Eichhornia azurea (Sw. Kunth (Pontederiaceae is described. This is the first record of Lopesia galls in this species of macrophyte, quite common in natural and artificial lakes in Southeast Brazil. Illustrations of the adults (male and female, pupa, larva, and gall of the new species are presented.

  2. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos

    2011-12-01

    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.

  3. Second Supplement to "A Catalog of the Mosquitoes of the World" (Diptera: Culicidae)

    Science.gov (United States)

    1984-01-01

    female)‘, P ( pupa ), L (larva) and E (egg). An asterisk (*) to the right of the symbols indicates an accompanying illustration. Type-depositories are...Acta Parasitol. Sinica 2:397-403. Chen Han-Bin. 1980. Study on the Culex vishnui subgroup in China with discussions on the taxonomic status of C...Danilov, V.N. 1982. Mosquito fauna (Diptera, Culicidae) of the Ethiopian zoogeographical region 2. A new species of Mansonia (CoquiZtettidia) and a key

  4. Sampling Outdoor, Resting Anopheles gambiae and Other Mosquitoes (Diptera: Culicidae) in Western Kenya with Clay Pots

    OpenAIRE

    Odiere, M.; Bayoh, M. N.; Gimnig, J; Vulule, J; Irungu, L.; Walker, E.

    2007-01-01

    Clay pots were analyzed as devices for sampling the outdoor resting fraction of Anopheles gambiae Giles (Diptera: Culicidae) and other mosquito species in a rural, western Kenya. Clay pots (Anopheles gambiae resting pots, herein AgREPOTs), outdoor pit shelters, indoor pyrethrum spray collections (PSC), and Colombian curtain exit traps were compared in collections done biweekly for nine intervals from April to June 2005 in 20 housing compounds. Of 10,517 mosquitoes sampled, 4,668 An. gambiae s...

  5. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano DONATO

    2008-01-01

    Full Text Available Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  6. Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Letícia Barros de Alencar

    2013-06-01

    Full Text Available Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil. There are 11 species of Richardia known to Brazil. Of these, only four are known to occur in the Brazilian Amazon Region, where the diversity of Richardia is underestimated. Herein we describe and illustrate Richardia intemperata sp. nov. and Richardia parispina sp. nov. from Amazonas, Brazil. An illustrated key to males from this region is also provided.

  7. Morphological description of the fourth instar larva: Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae).

    Science.gov (United States)

    Slama, Darine; Khedher, Asma; Bdira, Sassi; Khayech, Fethi; Delecolle, Jean-claude; Mezhoud, Habib; Babba, Hamouda; Emna, Chaker

    2013-01-01

    This study was carried out of the region of Monastir in Central Tunisia, between July and August 2010. Larvae were collected using a floatation technique with magnesium sulfate in mud samples. The fourth instar larva of Culicoides cataneii Clastrier, 1957 and Culicoides sahariensis Callot, Kremer, Bailly-Choumara, 1970 are described, illustrated and drawn. Measurements of instars IV are also presented. This is the first record of Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae) to Tunisia.

  8. Sand Flies (Diptera: Psychodidae: Phlebotominae): Significance, Surveillance, and Control in Contingency Operations

    Science.gov (United States)

    2015-01-01

    The breeding places of Phlebotomus in Panama (Diptera: Psychodidae) Annals of the Entomological Society of America 54:317–322. Hoel, D. F., D. L...Jones, T.M., A. Balmford, and R.J. Quinnell. 2000. Adaptive female choice for middle-aged mates in a lekking sandfly. Proceedings of the Royal Society ...this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden, to Washington Headquarters

  9. Baby Killers: Documentation and Evolution of Scuttle Fly (Diptera: Phoridae) Parasitism of Ant (Hymenoptera: Formicidae) Brood

    OpenAIRE

    Brown, Brian; Hash, John; Hartop, Emily; Porras, Wendy; Amorim, Dalton

    2017-01-01

    Numerous well-documented associations occur among species of scuttle flies (Diptera: Phoridae) and ants (Hymenoptera: Formicidae), but examples of brood parasitism are rare and the mechanisms of parasitism often remain unsubstantiated. We present two video-documented examples of ant brood (larvae and pupae) parasitism by scuttle flies. In footage from Estação Biológica de Boracéia in Brazil, adult females of Ceratoconus setipennis Borgmeier can be seen attacking workers of Linepithema h...

  10. New records of Forcipomyia (Pterobosca) incubans (Diptera: Ceratopogonidae) parasitizing wings of Odonata in Brazil

    OpenAIRE

    Guillermo-Ferreira, Rhainer; Vilela,Diogo Silva

    2013-01-01

    Forcipomyia (Pterobosca) incubans Macfie (1937) (Diptera: Ceratopogonidae) is recorded here for the first time for Brazil. Females were collected in the Brazilian Neotropical Savanna parasitizing the wings of Erythrodiplax juliana Ris (1911), Erythrodiplax aff. anomala Brauer (1865) and Erythemis credula Hagen (1861), all Libellulidae dragonflies. A map of potential distribution of this species in the New World is also provided. The results suggest that its distribution may range from souther...

  11. Phlebotomus Sandflies of the Paloich Area in the Sudan (Diptera, Psychodidae)

    Science.gov (United States)

    1964-10-01

    and other arthropods of pUblic health and veterinary significance. DECK 2 PHLEBOTOMUS SANDFLIES OF THE PALOICH AREA IN THE SUDAN (DIPTERA...species was collected at Tir on oiled paper in December 1962. Nothing is known of its habits. Phlebotomus (Sergentomyia) clydei Sinton . This...39: 103. Kirk & Lewis, 1951, Trans. R. En!. Soc. Lond.l02: 413. Type species: Phlebotomus hospitii Sinton , by orig. desig. New synonymy

  12. Enterobactérias associadas a adultos de Musca domestica (Linnaeus, 1758 (Diptera: Muscidae e Chrysomya megacephala (Fabricius, 1754 (Diptera: Calliphoridae no Jardim Zoológico, Rio de Janeiro Enterobacteria associated to adults of Musca domestica (Linnaeus, 1758 (Diptera: Muscidae and Chrysomya megacephala (Fabricius, 1754 (Diptera: Calliphoridae at the Zoo of Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    V.C. Oliveira

    2006-08-01

    Full Text Available Enterobactérias foram identificadas em adultos de Musca domestica (Linnaeus, 1758 (Diptera: Muscidae e Chrysomya megacephala (Fabricius, 1754 (Diptera: Calliphoridae. Ambas as espécies foram capturadas no Jardim Zoológico da cidade do Rio de Janeiro e tiveram a superfície externa do corpo lavada e o sistema digestivo dissecado, para análise bacteriológica. Identificaram-se Escherichia coli, Citrobacter sp., Proteus mirabilis, Morganella sp., Klebsiella sp., Pseudomonas sp., Enterobacter sp. e Salmonella Agona. P. mirabilis foi o isolado bacteriano mais freqüente. Em duas amostragens (8% de C. megacephala, isolou-se Salmonella Agona. As amostras de E. coli não foram enteropatogênicas. M. domestica e C. megacephala são potenciais veiculadoras de bactérias causadoras de enterites em humanos e animais.Enterobacteria were identified in adults of Musca domestica (Linnaeus, 1758 (Diptera: Muscidae and Chrysomya megacephala (Fabricius, 1754 (Diptera: Calliphoridae. Both species were captured in the Zoo of Rio de Janeiro. They had their external body surface washed and their digestive system dissected for bacteriological analysis. Escherichia coli, Citrobacter sp., Proteus mirabilis, Morganella sp., Klebsiella sp., Pseudomonas sp., Enterobacter sp. and Salmonella serovar Agona were isolated in the samples. P. mirabilis was the species most frequent isolated. Strains of Salmonella Agona were isolated from two samples (8% of C. megacephala. Enteropathogenic E. coli was not isolated. M. domestica and C. megacephala showed themselves as potential vectors of agents related to enteric diseases in humans and other animals.

  13. Diptera of sanitary importance associated with composting of biosolids in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Alejandra Labud

    2003-12-01

    Full Text Available OBJECTIVE: Odorous compounds produced at the biosolids composting plant in Bariloche (NW Patagonia attract a variety of insects, mainly belonging to the order Diptera. In order to characterize these flies, collected specimens were taxonomically identified, their community characteristics were described and their sanitary and synanthropic importance and autochthonous or introduced character were determined. METHODS: Sampling was performed from October 1999 until March 2000. Adults were collected using an entomological net, and larvae and puparia were obtained from the composting material and incubated to obtain adults. Richness, abundance and sex ratio were calculated. RESULTS: A total of 9 taxa of Diptera were identified: Sarconesia chlorogaster, Phaenicia sericata, Calliphora vicina, Cochliomya macellaria, Ophyra sp, Muscina stabulans, Musca domestica, Sarcophaga sp and Fannia sp. Specimens of Anthomyiidae, Acaliptratae and one larva of Eristalis tenax were also found. Ophyra sp. was the most abundant taxa. All the captured Diptera belonged to introduced taxa. Most of them are considered to be eusynanthropic and/or hemisynanthropic and have sanitary importance as they may cause myiasis and pseudomyiasis. The high number of females registered and the finding of immature stages indicated that flies can develop their complete life cycle on biosolid composting windrows. CONCLUSIONS: The characterization of flies obtained in this study may be useful for defining locations of urban or semi-urban composting facilities. It also highlights the importance of sanitary precautions at such plants.

  14. A Modified Trap for Adult Sampling of Medically Important Flies (Insecta: Diptera

    Directory of Open Access Journals (Sweden)

    Kamran Akbarzadeh

    2012-12-01

    Full Text Available Background: Bait-trapping appears to be a generally useful method of studying fly populations. The aim of this study was to construct a new adult flytrap by some modifications in former versions and to evaluate its applicability in a subtropical zone in southern Iran.Methods: The traps were constructed with modification by adding some equipment to a polyethylene container (18× 20× 33 cm with lid. The fresh sheep meat was used as bait. Totally 27 adult modified traps were made and tested for their efficacies to attract adult flies. The experiment was carried out in a range of different topographic areas of Fars Province during June 2010.Results: The traps were able to attract various groups of adult flies belonging to families of: Calliphoridae, Sarcophagidae, Muscidae, and Faniidae. The species of Calliphora vicina (Diptera: Calliphoridae, Sarcophaga argyrostoma (Diptera: Sarcophagidae and Musca domestica (Diptera: Muscidae include the majority of the flies collected by this sheep-meat baited trap.Conclusion: This adult flytrap can be recommended for routine field sampling to study diversity and population dynamics of flies where conducting of daily collection is difficult.

  15. Análise cladística de Euprepina Hull (Diptera, Bombyliidae, Bombyliinae Cladistic analysis of Euprepina Hull, (Diptera, Bombyliidae, Bombyliinae

    Directory of Open Access Journals (Sweden)

    Carlos José Einicker Lamas

    1999-01-01

    Full Text Available A cladistic analysis of Euprepina Hull, 1971 (Diptera, Bombyliidae, Bombyliinae, a Neotropical genus that includes ten species, was made. The cladogram was obtained from eight studied species, based on a data matrix with 21 characters, using the program Hennig86. Character states were polarized following outgroup analysis, and an hypothetical ancestor was included in the analysis in order to root the tree. The options used, "ie*" and "xs w", resulted in four most parsimonious trees with ci = 79, ri = 80 and length 115. The monophiletism of Euprepina was supported by two synapomorphies.

  16. A check list of necrophagous flies (Diptera: Calyptratae from urban area in Medellín, Colombia Lista de moscas necrófagas (Diptera: Calyptratae del área urbana del municipio de Medellín, Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Salazar-Ortega

    2012-06-01

    Full Text Available An updated checklist of necrophagous flies (Diptera, Calyptratae occurring in the urban area of Medellín-Colombia is presented. 27 species belonging to 4 families are reported. Data were obtained from field work and recent bibliography references.Se presenta una lista actualizada de moscas necrófagas (Diptera, Calyptratae presentes en el área urbana del municipio de Medellín. Se registran 27 especies incluidas en cuatro familias. Los datos se obtuvieron a partir de recolectas en campo y referencias bibliográficas.

  17. Neolasioptera ramicola, a new species of Cecidomyiidae (Diptera associated with Physalis angulata (Solanaceae Neolasioptera ramicola, uma nova espécie de Cecidomyiidae (Diptera associada com Physalis angulata (Solanaceae

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia

    2009-06-01

    Full Text Available Neolasioptera ramicola Maia, a new species of Cecidomyiidae (Diptera that induces stem galls on Physalis angulata (Solanaceae is described and illustrated (larva, pupa, male, female and gall based on material from Bento Gonçalves, Rio Grande do Sul, Brazil.Neolasioptera ramicola Maia, uma nova espécie de Cecidomyiidae (Diptera que induz galhas caulinares em Physalis angulata (Solanaceae é descrita e ilustrada (larva, pupa, male, fêmea e galha com base em material coletado em Bento Gonçalves, Rio Grande do Sul, Brasil.

  18. Wiedemann un itinerario plástico

    Directory of Open Access Journals (Sweden)

    Mario Rivero

    1969-03-01

    Full Text Available La conquista del espacio y la conquista del plancton, del mundo estelar y el microbiano y la conquista del propio mundo subjetivo expresivo, se constituyen, hoy por hoy, en argumento de asombrosa objetividad dentro de la más radical concepción de la pintura moderna: la no figurativa.

  19. Seasonal patterns in tree swallow prey (Diptera) abundance are affected by agricultural intensification.

    Science.gov (United States)

    Paquette, Sébastien Rioux; Garant, Dany; Pelletier, Fanie; Bélisle, Marc

    2013-01-01

    In many parts of the world, farmland bird species are declining at faster rates than other birds. For aerial insectivores, this decline has been related to a parallel reduction in the abundance of their invertebrate prey in agricultural landscapes. While the effects of agricultural intensification (AI) on arthropod communities at the landscape level have been substantially studied in recent years, seasonal variation in these impacts has not been investigated. To assess the contention that intensive cultures negatively impact food resources for aerial insectivorous birds, we analyzed the spatiotemporal distribution patterns of Diptera, the main food resource for breeding tree swallows Tachycineta bicolor), across a gradient of AI in southeastern Quebec, Canada. Linear mixed models computed from a data set of 5000 samples comprising >150,000 dipterans collected over three years (2006-2008) suggest that both Diptera abundance and biomass varied greatly during swallow breeding season, following a quadratic curve. Globally, AI had a negative effect on Diptera abundance (but not biomass), but year-by-year analyses showed that in one of three years (2008), dipterans were more abundant in agro-intensive landscapes. Analyses also revealed a significant interaction between the moment in the season and AI: In early June, Diptera abundances were similar regardless of the landscape, but differences increased as the season progressed, with highly intensive landscapes harboring fewer prey, possibly creating an "ecological trap" for aerial insectivores. While global trends in our results are in agreement with expectations (negative impact of Al on insect abundance), strong discrepancies in 2008 highlight the difficulty of predicting the abundance of insect communities. Our study indicates that predicting the effects of AI may prove more challenging than generally assumed, even when large data sets are collected, and that temporal variation within a season is important to take into

  20. The blowflies of the Madeira Archipelago: species diversity, distribution and identification (Diptera, Calliphoridae s. l.)

    Science.gov (United States)

    Prado e Castro, Catarina; Szpila, Krzysztof; Martínez-Sánchez, Anabel; Rego; Silva, Isamberto; Serrano, Artur R.M.; Boieiro, Mário

    2016-01-01

    Abstract Knowledge on the taxonomic diversity and distribution of blowflies from the Madeira Archipelago is updated. New and interesting findings are reported for poorly studied islands and islets of this archipelago, together with a brief analysis of the diversity of Macaronesian Calliphoridae s. l. Seven blowfly species were collected during this study, including the first records of Calliphora vicina Robineau-Desvoidy, 1830, Chrysomya albiceps (Wiedemann, 1819), Lucilia sericata (Meigen, 1826), Pollenia rudis (Fabricius, 1794) and Stomorhina lunata (Fabricius, 1805) from Porto Santo, and of Calliphora vicina, Lucilia sericata and Stomorhina lunata from Desertas Islands. The presence of Calliphora loewi Enderlein, 1903 in Madeira Laurisilva forest is discussed and its first instar larva is redescribed, revealing important differences in relation to its original description. An identification key to the adult Madeiran blowflies is provided for the first time. PMID:27917052

  1. Mitotic and polytene chromosome analysis in the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Garcia-Martinez, V; Hernandez-Ortiz, E; Zepeta-Cisneros, C S; Robinson, A S; Zacharopoulou, A; Franz, G

    2009-01-01

    The present study constitutes the first attempt to construct a polytene chromosome map of an Anastrepha species, Anastrepha ludens (Loew), a major agricultural pest. The mitotic karyotype has a diploid complement of 12 acrocentric chromosomes, including five pairs of autosomes and an XX/XY sex chromosome pair. The analysis of salivary gland polytene chromosomes has shown a total number of five polytene elements that correspond to the five autosomes. The characteristic features and the most prominent landmarks of each chromosome are described. By comparing chromosome banding patterns, the possible chromosomal homology between A. ludens and Ceratitis capitata (Wiedemann) is presented. This work shows that polytene maps of A. ludens are suitable for cytogenetic studies in this species and may be used as reference for other Anastrepha species, most of which are also serious agricultural pests.

  2. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  3. Tabanidae (Diptera of Amazônia XX: description of Tabanus pseudonebulosus n.sp.

    Directory of Open Access Journals (Sweden)

    Inocêncio de Sousa Gorayeb

    2006-03-01

    Full Text Available Tabanus pseudonebulosus, new species, is described based on 217 female specimens and 5 males collected in Venezuela (Guarico, Aguaio, Santa Elena, and Palmarito and in Brazil (Pará: Santana do Araguaia, Serra das Andorinhas in São Geraldo do Araguaia, Serra Norte Carajás and Gorotire; Amazonas: Canutama; Mato Grosso do Sul: Corumbá, mostly in open vegetation, scrub forest and in rocky environments. Observed intraspecific variation in the specimens is presented and related to collection localities, and morphological differences are diagnosed in relation to the similar species Tabanus nebulosus DeGeer 1776 and T. importunus Wiedemann 1828. Morphometrical data and indices for specimens in different localities are provided. Drawings and photo of the new species are presented.

  4. Implications of Rhagoletis zephyria, 1894 (Diptera: Tephritidae), captures for apple maggot surveys and fly ecology in Washington state, U.S.A

    Science.gov (United States)

    The apple maggot, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), is an introduced quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in Washington state, U.S.A. A morphologically similar native fly, Rhagoletis zephyria Snow, 1894, infests snowberries (Symphoricarpos spp.) ...

  5. Diversity of Anastrepha spp. (Diptera: Tephritidae) and associated braconid parasitoids from native and exotic hosts in southeastern Bahia, Brazil.

    Science.gov (United States)

    Silva, Janisete G; Dutra, Vivian S; Santos, Mirian S; Silva, Nívea M O; Vidal, Daniela B; Nink, Ricardo A; Guimarães, Jorge A; Araujo, Elton L

    2010-10-01

    We documented fruit fly-host associations and infestation rates over 5 yr in the state of Bahia, Brazil, by systematically collecting native and introduced fruits in backyard and commercial orchards, experimental stations, and patches of native vegetation. Fruit were collected in multiple sites in the southern and southernmost regions of Bahia. A total of 942.22 kg from 27 fruit species in 15 plant families was collected throughout this study. Of these, 15 plant species from six families were infested by Anastrepha species. A total of 11,614 fruit flies was reared from the fruit (5,178 females and 6,436 males). No specimens of Ceratitis capitata (Wiedemann) were recovered. Eleven Anastrepha species were recovered from the collected fruit: Anastrepha antunesi Lima (0.04%), Anastrepha distincta Greene (0.1%), Anastrepha fraterculus (Wiedemann) (53.5%), Anastrepha leptozona Hendel (4.5%), Anastrepha manihoti Lima (0.1%), Anastrepha montei Lima (1.0%), Anastrepha obliqua (Macquart) (33.0%), Anastrepha pickeli Lima (2.0%), Anastrepha serpentina (Wiedemann) (1.0%), Anastrepha sororcula Zucchi (3.0%), and Anastrepha zenildae Zucchi (1.8%). We recovered 1,265 parasitoids (Hymenoptera: Braconidae) from Anastrepha pupae. Three species of braconids were found to parasitize larvae of nine Anastrepha species. The most common parasitoid species recovered was Doryctobracon areolatus (Szépligeti) (81.7%), followed by Utetes anastrephae (Viereck) (12.2%) and Asobara anastrephae (Muesebeck) (6.1%). We report A. fraterculus infesting Malay apple Syzygium malaccense (L.) Merr. & L. M. Perry and A. fraterculus, A. sororcula, and A. zenildae infesting araza Eugenia stipitata McVaugh for the first time in Brazil.

  6. Effect of Lunar Phases, Tides, and Wind Speed on the Abundance of Diptera Calliphoridae in a Mangrove Swamp.

    Science.gov (United States)

    Batista-da-Silva, J A

    2014-02-01

    Abiotic factors, such as lunar phases and tides, have a significant effect on insect development. Reproduction and immature development are usually interlinked to these abiotic factors. The tide is at its highest levels at full moon or new moon, hindering the feeding of the immature or causing their drowning. The oviposition by adult females is also compromised on these days because much of the available food is submerged. Another important abiotic factor is the wind, which displaces odoriferous particles in the air. Wind speed and direction are important elements to indicate potential sources of food for insects. I report on the effects of lunar phases, tides, and wind speed on the Calliphoridae fauna in mangrove swamps. The different species collected were identified, and the predominant species in the area were quantified. A total of 1,710 flies were collected over a 1-year period. Six Calliphoridae flies, Chloroprocta idioidea (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Chrysomya albiceps (Wiedemann), Chrysomya putoria (Wiedemann), Cochliomyia macellaria (Fabricius), and Lucilia eximia (Wiedemann) were collected. Data indicated that lunar phases have a significant effect on the abundance of C. albiceps (r = 0.39, p < 0.01), and that the variation of the tides also affected the abundance of C. putoria (r = 0.40, p < 0.00), C. macellaria (r = 0.41, p < 0.00), and C. idioidea (r = 0.31, p < 0.04). The wind speed, however, did not affect these species.

  7. Laboratory Evaluation of Diflubenzuron as a Feed-Through for Control of Immature Sand Flies (Diptera: Psychodidae)

    Science.gov (United States)

    2007-03-01

    Phlebotomine sand ßies are the vectors of the proto- zoan parasites that cause leishmaniasis. Sand ßies also are vectors of the disease agents Bartonella ...terrestrial larvae of several species of Diptera, including house ßies, Musca domestica L.; face ßies, Musca autumnalis De Geer; stable ßies, Stomoxys cal

  8. Effects of seasonality and resource limitation on organic matter turnover by Chironomidae (Diptera) in southern Appalachian headwater streams

    Science.gov (United States)

    Angela Romito; Susan Eggert; Jeffrey Diez; J. Wallace

    2010-01-01

    Despite their high abundance, secondary production, and known reliance on detrital material, the role of chironomids (Diptera) in fine particulate organic matter (FPOM) dynamics has not been well quantified. We conducted field trials using fluorescent pigment markers to estimate seasonal rates of consumption, annual secondary production, assimilation efficiency (AE),...

  9. Attractiveness of MM-X traps baited with human or synthetic odor to mosquitoes (Diptera: Culicidae) in The Gambia

    NARCIS (Netherlands)

    Qiu, Y.T.; Smallegange, R.C.; Braak, ter C.J.F.; Spitzen, J.; Loon, van J.J.A.; Jawara, M.; Milligan, P.; Galimard, A.M.S.; Beek, van T.A.; Knols, B.G.J.; Takken, W.

    2007-01-01

    Chemical cues play an important role in the host-seeking behavior of blood-feeding mosquitoes (Diptera: Culicidae). A field study was carried out in The Gambia to investigate the effects of human odor or synthetic odor blends on the attraction of mosquitoes. MM-X traps baited with 16 odor blends to

  10. Oviposition responses of Anopheles gambiae s.s. (Diptera: Culicidae) and identification of volatiles from bacteria-containing solutions

    NARCIS (Netherlands)

    Lindh, J.M.; Kännaste, A.; Knols, B.G.J.; Faye, I.; Borg-Karlson, A.K.

    2008-01-01

    In this study, a dual-choice oviposition bioassay was used to screen responses of gravid An. gambiae toward 17 bacterial species, previously isolated from Anopheles gambiae s.l. (Diptera: Culicidae) midguts or oviposition sites. The 10 isolates from oviposition sites have been identified by

  11. A new genus and species of Cecidomyiidae (Diptera) from leaf blister galls on Ribes (Grosulariaceae)in North America

    Science.gov (United States)

    Ribesia sarae Gagné, new genus, new species(Diptera: Cecidomyiidae), is described from simple leaf blister galls on Ribes aureum(Grossulariaceae) from Montana. The female abdomen is superficially similar to that of CystiphoraKieffer and SackenomyiaFelt. The three genera are compared. Because of stro...

  12. House fly (Musca domestica) (Diptera: Muscidae) mortality after exposure to commercial fungal formulations in a sugar bait

    Science.gov (United States)

    House flies (Musca domestica L.) (Diptera: Muscidae) are major pests of livestock. Biological control is an important tool in an integrated control framework. Increased mortality in filth flies has been documented with entomopathogenic fungi, and several strains are commercially available. Three str...

  13. Behavioral responses of Drosophila suzukii (Diptera: Drosophilidae) to visual stimuli under laboratory, semi-field, and field conditions

    Science.gov (United States)

    Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) is an invasive pest in the United States that attacks soft-skinned ripening fruit such as raspberries, blackberries, and blueberries. Little is known regarding specific cues D. suzukii utilizes to locate and select host fruit, and inconsistenc...

  14. [The mushroom bodies of the lower nematocera: a link between those of the higher Diptera and other mecopteroids].

    Science.gov (United States)

    Panov, A A

    2012-01-01

    Nematoceran Diptera are nonuniform in the structure of their mushroom bodies. Members of the more basal families (Ptychopteridae, Pediciidae, and Tipulidae) have bipartite mushroom bodies, characteristic of members of the other mecopteroid complex orders. In members of Bibionomorpha (Bibionidae and Anisopodidae), tripartite mushroom bodies have been found characteristic of Brachycera Orthorrhapha.

  15. The geographic distribution of Rhagoletis pomonella (Diptera:Tephritidae) in the western United States: Introduced species or native population?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a major pest of commercially grown domesticated apple (Malus domestica) in North America. The shift of the fly from its native host hawthorn (Crataegus mollis) to apple in the eastern U.S. is often cited as an example of inc...

  16. List of descriptions and other taxonomic proposals on american sand flies (Diptera, Psychodidae, Phlebotominae: 1975-1993

    Directory of Open Access Journals (Sweden)

    Carlos Brisóla Marcondes

    1995-01-01

    Full Text Available A check-list of new species, descriptions of other sex of previously described species, redescriptions, proposals of synonymy, and new status for species previously in synonymy or described as subspecies for american sand flies (Diptera, Psychodidae, Phlebotominae, for the period 1975-1993, and not included in the revision of Martins el at. (1978, are presented.

  17. A comparative analysis of resistance testing methods in Aedes albopictus (Diptera: Culicidae) from St. Johns County, Florida

    Science.gov (United States)

    Aedes albopictus Skuse (Diptera: Culicidae) was tested for resistance to permethrin, bifenthrin, and malathion using Centers for Disease Control and Prevention (CDC) bottle bioassays and topical toxicology assays on adults and larval bioassays. Eggs were collected from 3 locations across St. Johns C...

  18. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad

    Science.gov (United States)

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  19. New records for the horse fly fauna (Diptera: Tabanidae) of Jordan with remarks on ecology and zoogeography.

    Science.gov (United States)

    The horse fly fauna (Diptera: Tabanidae) of Jordan is the richest in the Levant, with 24 known species. During the 20-year project “the ecology and zoogeography of the Lepidoptera of the Near East,” USDA, Agricultural Research Service scientists in Gainesville, FL and Israeli scientists regularly c...

  20. Biological control of Tipula paludosa (Diptera : Nematocera) using entomopathogenic nematodes (Steinernema spp.) and Bacillus thuringiensis subsp israelensis

    NARCIS (Netherlands)

    Østergaard, J.; Belau, C.; Strauch, O.; Ester, A.; Rozen, van K.; Ehlers, R.U.

    2006-01-01

    Tipula paludosa (Diptera: Nematocera) is the major insect pest in grassland in Northwest Europe and has been accidentally introduced to North America. Oviposition occurs during late August and first instars hatch from September until mid-October. Laboratory and field trials were conducted to assess

  1. Nota sobre culicídeos (Diptera: Culicidae da bacia do rio Purus, Acre, Amazônia (Brasil

    Directory of Open Access Journals (Sweden)

    Delsio Natal

    1992-04-01

    Full Text Available Foram feitas coletas de mosquito (Diptera: Culicidae na área do projeto de Colonização Pedro Peixoto, no Estado do Acre, Brasil. Obteve-se um total de 4.588 exemplares pertencentes a 53 espécies ou grupos. Salienta-se a ocorrência de Anopheles (Nyssorhynchus oswaldoi.

  2. Effect of fungus gnat Bradysia impatiens (Diptera: Sciaridae) feeding on subsequent Pythium aphanidermatum infection of geranium seedlings (Pelargonium x hortorum)

    Science.gov (United States)

    Dark-winged fungus gnats in the genus Bradysia (Diptera: Sciaridae) and root rot pathogens in the genus Pythium (Oomycetes) are important pests of greenhouse floriculture. Observations have pointed to a possible correlation between Pythium root rot disease and fungus gnat infestations; however, inte...

  3. Temperature-mediated kill and oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the presence of Spinosad

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the...

  4. Impact of prolonged absence of low temperature on adult eclosion patterns of western cherry fruit fly (Diptera: Tephritidae)

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the U.S.A. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in ...

  5. Reduction in Emergence of Rhagoletis indifferens (Diptera: Tephritidae) from Sweet Cherries with Different Egg and Larval Distributions Using Newer Insecticides

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is the major insect pest of sweet cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. To reduce fly populations in unharvested fruit following the completion of commercial harvest, it is important to cont...

  6. Biological control of Tipula paludosa (Diptera : Nematocera) using entomopathogenic nematodes (Steinernema spp.) and Bacillus thuringiensis subsp israelensis

    NARCIS (Netherlands)

    Østergaard, J.; Belau, C.; Strauch, O.; Ester, A.; Rozen, van K.; Ehlers, R.U.

    2006-01-01

    Tipula paludosa (Diptera: Nematocera) is the major insect pest in grassland in Northwest Europe and has been accidentally introduced to North America. Oviposition occurs during late August and first instars hatch from September until mid-October. Laboratory and field trials were conducted to assess

  7. Medical Entomology Studies - XI. The Subgenus Stegomyia of Aedes in the Oriental Region with Keys to the Species (Diptera: Culicidae)

    Science.gov (United States)

    1979-01-01

    aegypti Linnaeus, 1762 ( Insecta , Diptera); proposed validation and interpretation under the plenary powers of the species so named. Z. N. (S.) 1216...Liverpool School of Tropical Medicine and Medical Parasitology. Part II. Filariasis. Mem. Lpool. Sch. Trop. Med. 4 (Ap. ) ii: l-14. Huang: Aedes

  8. Miíase por Lucilia eximia (Diptera: Calliphoridae em Didelphis albiventris (Mammalia: Didelphidae no Brasil Central

    Directory of Open Access Journals (Sweden)

    Edison Cansi

    2011-12-01

    Abstract. In May 2009 were collected 18 larvae of Lucilia eximia (Wiedemann, a fly responsible for primary and secondary myiasis in livestock and humans. The larvae were taken from the myiasis on anal and auricular regions of an opossum Didelphis albiventris (Lund, in Brasília Zoo, and later identified in the laboratory. After 15 days, 15 adults emerged from L. eximia. This is the first record of this blowfly causing a primary myiasis in a marsupial species in the Brasília Cerrado.

  9. A taxonomic revision of the Southern South American species of the genus Fannia Robineau-Desvoidy (Diptera: Fanniidae

    Directory of Open Access Journals (Sweden)

    Martha Cecilia Dominguez

    2007-01-01

    Full Text Available The Southern South American species of the genus Fannia Robineau-Desvoidy are revised. Twenty five valid species are recognized for the region in the present study: Fannia albitarsis Stein, Fannia anthracina (Walker, Fannia bigoti Stein, Fannia canicularis (Linnaeus, Fannia confusa Pont & Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein, Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani, Fannia heydenii (Wiedemann, Fannia hirtifemur (Stein, Fannia incisurata (Zetterstedt, Fannia petrocchiae Shannon & Del Ponte, Fannia punctiventris Malloch, Fannia pusilla (Bigot, Fannia pusio (Wiedemann, Fannia scalaris (Fabricius, Fannia schnusei Stein, Fannia setosa (Bigot, Fannia tucumanensis Albuquerque, Fannia tumidifemur Stein and three new species from Argentina are described: two from the province of San Luis (Fannia roigi sp. nov. and Fannia hermani sp. nov. and one from the province of Mendoza (Fannia losgateados sp. nov.. The unknown male of Fannia fusconotata is described for the first time. The Neotropical Fannia euchaetophora Carvalho is synonymized with Fannia flavicornis Stein. Redescriptions are provided for all known species and genitalic illustrations given for both sexes. Keys for each sex are given, and knowledge on the geographical distribution of all species is updated and summarized.Las especies de Fannia de America del Sur Austral son revisadas. Se reconocen 25 especies para la region en el presente estudio: Fannia albitarsis Stein, Fannia anthracina (Walker, Fannia bigoti Stein, Fannia canicularis (Linnaeus, Fanniaconfusa Pont&Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein, Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani, Fannia heydenii (Wiedemann, Fannia hirtifemur (Stein, Fannia incisurata (Zetterstedt, Fannia petrocchiae Shannon & Del Ponte, Fannia punctiventris Malloch, Fannia pusilla (Bigot, Fannia pusio (Wiedemann, Fannia

  10. How much can diptera-borne viruses persist over unfavourable seasons?

    Science.gov (United States)

    Charron, Maud V P; Balenghien, Thomas; Seegers, Henri; Langlais, Michel; Ezanno, Pauline

    2013-01-01

    Diptera are vectors of major human and animal pathogens worldwide, such as dengue, West-Nile or bluetongue viruses. In seasonal environments, vector-borne disease occurrence varies with the seasonal variations of vector abundance. We aimed at understanding how diptera-borne viruses can persist for years under seasonal climates while vectors overwinter, which should stop pathogen transmission during winter. Modeling is a relevant integrative approach for investigating the large panel of persistence mechanisms evidenced through experimental and observational studies on specific biological systems. Inter-seasonal persistence of virus may occur in hosts due to viremia duration, chronic infection, or vertical transmission, in vector resistance stages, and due to a low continuous transmission in winter. Using a generic stochastic modeling framework, we determine the parameter ranges under which virus persistence could occur via these different mechanisms. The parameter ranges vary according to the host demographic regime: for a high host population turnover, persistence increases with the mechanism parameter, whereas for a low turnover, persistence is maximal for an optimal range of parameter. Persistence in hosts due to long viremia duration in a few hosts or due to vertical transmission is an effective strategy for the virus to overwinter. Unexpectedly, a low continuous transmission during winter does not give rise to certain persistence, persistence barely occurring for a low turnover of the susceptible population. We propose a generic framework adaptable to most diptera-borne diseases. This framework allows ones to assess the plausibility of each persistence mechanism in real epidemiological situations and to compare the range of parameter values theoretically allowing persistence with the range of values determined experimentally.

  11. Conservation of capa peptide-induced nitric oxide signalling in Diptera.

    Science.gov (United States)

    Pollock, Valerie P; McGettigan, James; Cabrero, Pablo; Maudlin, Ian M; Dow, Julian A T; Davies, Shireen-A

    2004-11-01

    In D. melanogaster Malpighian (renal) tubules, the capa peptides stimulate production of nitric oxide (NO) and guanosine 3', 5'-cyclic monophosphate (cGMP), resulting in increased fluid transport. The roles of NO synthase (NOS), NO and cGMP in capa peptide signalling were tested in several other insect species of medical relevance within the Diptera (Aedes aegypti, Anopheles stephensi and Glossina morsitans) and in one orthopteran out-group, Schistocerca gregaria. NOS immunoreactivity was detectable by immunocytochemistry in tubules from all species studied. D. melanogaster, A. aegypti and A. stephensi express NOS in only principal cells, whereas G. morsitans and S. gregaria show more general NOS expression in the tubule. Measurement of associated NOS activity (NADPH diaphorase) shows that both D. melanogaster capa-1 and the two capa peptides encoded in the A. gambiae genome, QGLVPFPRVamide (AngCAPA-QGL) and GPTVGLFAFPRVamide (AngCAPA-GPT), all stimulate NOS activity in D. melanogaster, A. aegypti, A. stephensi and G. morsitans tubules but not in S. gregaria. Furthermore, capa-stimulated NOS activity in all the Diptera was inhibited by the NOS inhibitor l-NAME. All capa peptides stimulate an increase in cGMP content across the dipteran species, but not in the orthopteran S. gregaria. Similarly, all capa peptides tested stimulate fluid secretion in D. melanogaster, A. aegypti, A. stephensi and G. morsitans tubules but are either without effect or are inhibitory on S. gregaria. Consistent with these results, the Drosophila capa receptor was shown to be expressed in Drosophila tubules, and its closest Anopheles homologue was shown to be expressed in Anopheles tubules. Thus, we provide the first demonstration of physiological roles for two putative A. gambiae neuropeptides. We also demonstrate neuropeptide modulation of fluid secretion in tsetse tubule for the first time. Finally, we show the generality of capa peptide action, to stimulate NO/cGMP signalling and

  12. How Much Can Diptera-Borne Viruses Persist over Unfavourable Seasons?

    Science.gov (United States)

    Charron, Maud V. P.; Balenghien, Thomas; Seegers, Henri; Langlais, Michel; Ezanno, Pauline

    2013-01-01

    Diptera are vectors of major human and animal pathogens worldwide, such as dengue, West-Nile or bluetongue viruses. In seasonal environments, vector-borne disease occurrence varies with the seasonal variations of vector abundance. We aimed at understanding how diptera-borne viruses can persist for years under seasonal climates while vectors overwinter, which should stop pathogen transmission during winter. Modeling is a relevant integrative approach for investigating the large panel of persistence mechanisms evidenced through experimental and observational studies on specific biological systems. Inter-seasonal persistence of virus may occur in hosts due to viremia duration, chronic infection, or vertical transmission, in vector resistance stages, and due to a low continuous transmission in winter. Using a generic stochastic modeling framework, we determine the parameter ranges under which virus persistence could occur via these different mechanisms. The parameter ranges vary according to the host demographic regime: for a high host population turnover, persistence increases with the mechanism parameter, whereas for a low turnover, persistence is maximal for an optimal range of parameter. Persistence in hosts due to long viremia duration in a few hosts or due to vertical transmission is an effective strategy for the virus to overwinter. Unexpectedly, a low continuous transmission during winter does not give rise to certain persistence, persistence barely occurring for a low turnover of the susceptible population. We propose a generic framework adaptable to most diptera-borne diseases. This framework allows ones to assess the plausibility of each persistence mechanism in real epidemiological situations and to compare the range of parameter values theoretically allowing persistence with the range of values determined experimentally. PMID:24023929

  13. Distribution Modeling of three screwworm species in the ecologically diverse landscape of North West Pakistan.

    Science.gov (United States)

    Zaidi, Farrah; Fatima, Syeda Hira; Khisroon, Muhammad; Gul, Ayesha

    2016-10-01

    North West Pakistan (NWP) is characterized by four eco-zones: Northern Montane Region, North Western Hills, Submontane Region and Indus Plains. Present study identified 1037 cases of traumatic myiasis in the region during 2012-2015. Screw worm larvae were classified as 12 species: Chrysomya bezziana (Villeneuve), Chryomya megacephala (Fabricius), Chrysomya rufifacies (Macquart), Lucilia cuprina (Wiedemann), Lucilia sericata (Meigen), Lucilia illustris (Meigen), Lucilia porphyrina (Walker), Hemipyrellia ligguriens (Wiedemann), Calliphora vicina (Robineau-Desvoidy), Wohlfahrtia magnifica (Schiner), Sarcophaga crassipalpalis (Macquart), Sarchophaga species. Among these C. bezziana, L. cuprina and W. magnifica with approximately 882 case reports were the principal agents of traumatic myiasis. The species W. magnifica is a first report from Pakistan. In order to investigate spatial distribution of these dominant species we used MaxEnt niche model. Our results revealed a well-established occurrence of C. bezziana and L. cuprina in the four eco-regions while W. magnifica is currently contained in the Submontane Region. Several hot spot areas of infestation were detected all characterized by high human population density showing synanthropic nature of these species. Wohlfahrtia magnifica was excluded from Northern Montane Region with severe winters and Southern Indus Plains with harsh summers revealing that invasive species are initially sensitive to extreme of temperatures. Presence of L. cuprina in the wet areas of North Humid Belt (Maximum annual precipitation: 1641mm) depicted a moisture preference of the species. In perspective of changing climate and future predictions of severe events such as droughts and flooding in NWP, W. magnifica can potentially alter the species composition. Considering these findings in an eco-geographically dynamic region of Pakistan we predict that two factors (1) Growing human population (2) Climatic conditions, equally contribute to range

  14. Lucilia silvarum Meigen, 1826 (Diptera: Calliphoridae)--a new species of interest for forensic entomology in Europe.

    Science.gov (United States)

    Fremdt, Heike; Szpila, Krzysztof; Huijbregts, Johannes; Lindström, Anders; Zehner, Richard; Amendt, Jens

    2012-10-10

    In Europe, the blowfly genus Lucilia is represented in Forensic Entomology mainly by the species L. ampullacea, L. caesar, L. illustris and L. sericata. In the US, Lucilia silvarum is rarely recorded as a carrion breeding species but usually as a more or less exclusive parasite of frogs and toads. We present three forensic cases from different European countries reporting, for the first time, L. silvarum on human bodies that were found close to lakes, wetlands, or riversides. To use this species for post-mortem interval estimations, thermal development data is needed. The first step is accurate identification by morphological and molecular means. Therefore, we analysed a 611 bp part of the mitochondrial COI region for 23 specimens of L. silvarum from 9 different geographical regions, all of which give the same haplotype. Differences within the haplotype varied by up to 0.2%. Comparison between the haplotype found and those published on GenBank showed up to 1.2% variance. Moreover, we present an updated key for the morphological identification of the third larval instars of European Lucilia spp. of forensic importance, adding not only L. silvarum, but also L. cuprina which was recorded in Europe for the first time about 20 years ago.

  15. Wing pattern variation in the Patagonian biting midge, Forcipomyia (Forcipomyia multipicta Ingram & Macfie (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    Gustavo R. SPINELLI

    2012-01-01

    Full Text Available Examination of the type-series and non-type specimens of the Patagonian biting midge, Forcipomyia (Forcipomyia multipicta Ingram & Macfie (Diptera: Ceratopogonidae, revealed considerable variation in wing patterns of both sexes. One pattern includes several distinct light spot areas, whereas another pattern (e.g, in the holotype only features marginal light spots in cell r3, while other light spots are barely perceptible or absent. The cause(s of the differential lack of dark macrotrichia in certain areas of the wing membrane in specimens of some series could not be attributed either to their age, sex, or method of preservation.

  16. Pollinator diversity (Hymenoptera and Diptera in semi-natural habitats in Serbia during summer

    Directory of Open Access Journals (Sweden)

    Mudri-Stojnić Sonja

    2012-01-01

    Full Text Available The aim of this study was to assess species diversity and population abundance of the two main orders of pollinating insects, Hymenoptera and Diptera. The survey was conducted in 16 grassland fragments within agro-ecosystems in Vojvodina, as well as in surrounding fields with mass-flowering crops. Pollinators were identified and the Shannon-Wiener Diversity Index was used to measure their diversity. Five families, 7 subfamilies, 26 genera and 63 species of insects were recorded. All four big pollinator groups investigated were recorded; hoverflies were the most abundant with 32% of the total number of individuals, followed by wild bees - 29%, honeybees - 23% and bumblebees with 16%.

  17. Culex Verutus, a New Species of the Subgenus Culex (Diptera: Culicidae) from Sierra Leone

    Science.gov (United States)

    1986-01-01

    216 Cu7ex verutus, a new species of the subgenu s1 Cu7ex (Diptera: Culicidae) from Sierra Leone Ralph E. Harbach’ Walter Reed Biosystematics...sp. from Sierra Leone are described and illus- trated. The new species is compared to other members of the guiarti group. This paper describes a...new species of Cu7ex collected in Sierra Leone by Dr. Yiau-Min Huang and Mr. James Pecor during field studies conducted in 1984. The species has been

  18. Sex-biased captures of sarcosaprophagous Diptera in carrion-baited traps.

    Science.gov (United States)

    Martín-Vega, Daniel; Baz, Arturo

    2013-01-01

    The use of carrion-baited traps is a common and widely extended practice in the study of sarcosaprophagous Diptera. However, it implies different areas of bias, one of them being the different responses of males and females to carrion bait, which results in possible biased sex ratios in the captures. In the present study, the use of carrion-baited traps revealed significant female-biased captures in the families Calliphoridae, Muscidae, and Sarcophagidae, whereas the collected species of the families Piophilidae, Heleomyzidae, and Ulidiidae showed different patterns in the observed sex ratios. Possible explanations according to existing literature and the types of mating behaviors of the different families are discussed.

  19. Taxonomic notes and new records of the genus Tabanus Linnaeus 1758 (Diptera: Tabanidae) from Malaysia

    Science.gov (United States)

    Al-Talafha, Hazem; Yaakop, Salmah Binti; Ghani, Idris Bin Abd

    2016-11-01

    Horsefly (Diptera: Tabanidae) fauna of Malaysia consists currently of 120 species belonging to eight genera. The present study added four new records to this hematophagous family. The new records were Tabanus crassus (Walker, 1850), T. griseipalpis Schuurmans Stekhoven (1926), T. melanognathus (Bigot, 1890), and T. mesogaus Burton (1978). Tabanus auricircus Philip (1979) was recorded here for the first time from peninsular Malaysia, whereas T. perakiensis Ricardo (1911) was recorded from Sabah for the first time. Key characters for new records were illustrated based on the examined materials and range of distribution for each species was given.

  20. Revision of the genus Melanagromyza in California, with descriptions of three new species (Diptera: Agromyzidae).

    Science.gov (United States)

    Shi, Li; Gaimari, Stephen D

    2015-08-20

    The 27 Californian species of the genus Melanagromyza Hendel (Diptera: Agromyzidae) are reviewed, including descriptions of three new species (Melanagromyza californiana sp. nov., M. chemsaki sp. nov. and M. gonzalesina sp. nov.) and the first record for one species (Melanagromyza martini Spencer) for California and the USA. All species in California are described or redescribed, with illustrations and photographs, and a key to the species is presented. Maps for the species in California, along with host distributions, are provided, with comments on biology and host plants.

  1. A new species, new immature stages, and new synonymy in Australian Dasybasis flies (Diptera: Tabanidae: Diachlorini).

    Science.gov (United States)

    Ferguson, David J; Yeates, David K

    2015-04-09

    Australian beach sand is a productive habitat for lower brachyceran fly larvae but often overlooked by collectors. We collected two species of tabanid larvae from coastal beach sand in southern New South Wales in August 2013. Both species belong to the Dasybasis macrophthalma species-group of Mackerras (1959), one a new species, and the other D. exulans (Erichson, 1842). We describe both new immature stages and the new species adult as Dasybasis rieki sp. nov. (Diptera: Tabanidae: Diachlorini). Trojan (1994b) elevated the D. macrophthalma species group to the genus Sznablius. We review the evidence for the generic status of Sznablius, and synonymize it with Dasybasis.

  2. A review of the New World Coproica (Diptera: Sphaeroceridae) with a description of 8 new species.

    Science.gov (United States)

    Bergeron, Matthew D; Marshall, Stephen A; Swann, John E

    2015-04-30

    The New World species of Coproica Rondani, 1861 (Diptera: Sphaeroceridae) are reviewed on the basis of over 17,000 examined specimens. The genus is divided into three major clades: the C. acutangula, C. vagans, and C. urbana species groups. Eight new species (C. bifurcata, C. bispatha, C. brachystyla, C. diabolica, C. emarginata, C. galapagosensis, C. novacula, and C. testudinea) are described, and redescriptions are provided for eleven additional species. Included are two keys (one for the twenty New World species only and one for all described species), updated New World distribution records, and illustrations of male and female genitalic structures.

  3. Phthiria sharafi sp. nov., a new record of the subfamily Phthiriinae (Bombyliidae, Diptera) from Saudi Arabia.

    Science.gov (United States)

    El-Hawagry, Magdi S; Al Dhafer, Hathal M

    2014-10-10

    This new species (Phthiria sharafi sp. nov.) represents the first record of the subfamily Phthiriinae (Bombyliidae, Diptera) from Saudi Arabia. The species was collected from Garf Raydah Protected Area, Abha, Asir Province, south-western part of Saudi Arabia, using a Malaise trap erected in a site rich in olive, cactus and Juniper trees. The type locality has an Afrotropical influence, with the Afrotropical elements predominant, and a closer affiliation to the Afrotropical region than to the Palearctic region or the Eremic zone. 

  4. Origin and development of the tergotrochanteral muscle in Chironomus (Diptera: Nematocera).

    Science.gov (United States)

    Lebart-Pedebas, M C

    1992-01-01

    The origin and the development of the tubular tergo-trochanteral muscle (TTD) was studied by light and electron microscopy in Chironomus (Diptera: Nematocera). Unlike the flight muscles, the TTD was found to develop from myoblasts located around a larval axon, without contribution from a larval muscle. The myoblasts fuse together to form myotubes. Innervation of the TTD arises from the larval axon. The myotubes send out sarcoplasmic extensions towards the axon branches issued from the larval axon. The first differentiated synapses are described. The TTD begins to grow later than the flight muscles. The implications of this developmental lag are discussed.

  5. A sex pheromone receptor in the Hessian fly Mayetiola destructor (Diptera, Cecidomyiidae

    Directory of Open Access Journals (Sweden)

    Martin N. Andersson

    2016-09-01

    Full Text Available The Hessian fly, Mayetiola destructor Say (Diptera, Cecidomyiidae, is a pest of wheat and belongs to a group of gall-inducing herbivores. This species has a unique life history and several ecological features that differentiate it from other Diptera such as Drosophila melanogaster and blood-feeding mosquitoes. These features include a short, non-feeding adult life stage (1-2 days and the use of a long-range sex pheromone produced and released by adult females. Sex pheromones are detected by members of the odorant receptor (OR family within the Lepidoptera, but no receptors for similar long-range sex pheromones have been characterized from the Diptera. Previously, 122 OR genes have been annotated from the Hessian fly genome, with many of them showing sex-biased expression in the antennae. Here we have expressed, in HEK293 cells, five MdesORs that display male-biased expression in antennae, and we have identified MdesOR115 as a Hessian fly sex pheromone receptor. MdesOR115 responds primarily to the sex pheromone component (2S,8E,10E-8,10-tridecadien-2-yl acetate, and secondarily to the corresponding Z,E-isomer. Certain sensory neuron membrane proteins (i.e., SNMP1 are important for responses of pheromone receptors in flies and moths. The Hessian fly genome is unusual in that it encodes six SNMP1 paralogues, of which five are expressed in antennae. We co-expressed each of the five antennal SNMP1 paralogues together with each of the five candidate sex pheromone receptors from the Hessian fly and found that they do not influence the response of MdesOR115, nor do they confer responsiveness in any of the non-responsive ORs to any of the sex pheromone components identified to date in the Hessian fly. Using Western blots, we detected protein expression of MdesOrco, all MdesSNMPs, and all MdesORs except for MdesOR113, potentially explaining the lack of response from this OR. In conclusion, we report the first functional characterization of an OR from the

  6. Host Plant Record for the Fruit Flies, Anastrepha fumipennis and A. nascimentoi (Diptera, Tephritidae)

    Science.gov (United States)

    Uramoto, Keiko; Martins, David S.; Lima, Rita C. A.; Zucchi, Roberto A.

    2008-01-01

    The first host plant record for Anastrepha fumipennis Lima (Diptera: Tephritidae) in Geissospermum laeve (Vell.) Baill (Apocynaceae) and for A. nascimentoi Zucchi found in Cathedra bahiensis Sleumer (Olacaceae) was determined in a host plant survey of fruit flies undertaken at the “Reserva Natural da Companhia Vale do Rio Doce”. This reserve is located in an Atlantic Rain Forest remnant area, in Linhares county, state of Espírito Santo, Brazil. The phylogenetic relationships of Anastrepha species and their hosts are discussed. The occurrence of these fruit fly species in relation to the distribution range of their host plants is also discussed. PMID:20302458

  7. A pictorial key and diagnosis of the Brazilian genera of Micropezidae (Diptera, Nerioidea

    Directory of Open Access Journals (Sweden)

    Gustavo Borges Ferro

    2014-03-01

    Full Text Available A pictorial key and diagnosis of the Brazilian genera of Micropezidae (Diptera, Nerioidea. This paper provides the first pictorial key and diagnosis for the Brazilian genera of the Micropezidae, based on external morphological characters illustrated with photographs. The key includes 13 genera: Cardiacephala Macquart, Cliobata Enderlein, Grallipeza Rondani, Metasphen Frey, Micropeza Meigen, Parasphen Enderlein, Planipeza Marshall, Plocoscelus Enderlein, Poecilotylus Hennig, Ptilosphen Enderlein, Rainieria Rondani, Scipopus Enderlein and Taeniaptera Macquart. For each genus, the species known to occur in Brazil are listed and their distribution records, including new ones, are provided.

  8. Description of Lutzomyia (Pifanomyia robusta n. sp. (Diptera, Psychodidae, Phlebotominae from Peruvian Equadorean interandean areas

    Directory of Open Access Journals (Sweden)

    Eunice A. Bianchi Galati

    1995-04-01

    Full Text Available Description of Lutzomyia robusta, n. sp. (Diptera, Psychodidae, Phlebotominae from interandean areas of Peru and Equador. Lutzomyia robusta, n. sp., probable vector of human bartonellosis and cutaneous leishmaniasis, is described and illustrated. This species presents strong affinity with L. serrana (Damasceno & Arouck, 1949 but they can be distinguished by variance analysis of four male characteristics and only one female characteristic. In the variance analysis, populations of L. serrana, of Amazonian areas of Brazil, Peru and Bolivia, the coast of Equador and other areas of Brazil were studied. The synonymy of Lutzomyia guayasi (Rodriguez and L. serrana was corroborated.

  9. New locality record of Isomyia paurogonita Fang & Fan, 1986 (Diptera: Calliphoridae) from Peninsular Malaysia and Borneo.

    Science.gov (United States)

    Heo, C C; Aisha, S; Kurahashi, H; Omar, B

    2013-03-01

    Isomyia paurogonita Fang & Fan, 1986 (Diptera: Calliphoridae), a rare species of the subfamily Rhiniinae (tribe Cosminini) was recorded for the first time in Malaysia. We collected one male and two females during a field trip conducted at Genting Highland, Pahang, peninsular Malaysia in May 2011. A 3-day old cow liver was offered as attractant and dipterans collected were transferred to the laboratory for specimens processing and identification. The adults of I. paurogonita were attracted to the odour and then captured by using a sweep net. Isomyia paurogonita was also recorded from two other localities in Peninsular and Malaysian Borneo, namely Gombak Utara, Selangor and Sibu, Sarawak.

  10. [Mosquitoes (Diptera, Culicidae) of Smir marshes (northwest of Morocco): inventory and biotypology].

    Science.gov (United States)

    El Joubari, M; Louah, A; Himmi, O

    2014-02-01

    The Smir marshes are a favorable environment for the growth of many mosquitoes (Diptera, Culicidae). The inventory of Culicidae species reveals 14 species, is 33% of the species of Morocco, distributed in four genera: Culex, Culiseta, Ochlerotatus and Anopheles (with 5, 2, 5 and 2 species respectively) which Anopheles labranchiae, vector of the agent of the malaria in Morocco until 2004. In this study, we investigated the spatiotemporal mesological affinities and we tried to explain the biotypology of mosquito populations of the site. These analyzes revealed several groups of stations and species according to various parameters, especially salinity.

  11. Two torymid species (Hymenoptera: Chalcidoidea, Torymidae developing on Artemisia gall midges (Diptera: Cecidomyiidae

    Directory of Open Access Journals (Sweden)

    Lotfalizadeh Hossein

    2015-12-01

    Full Text Available Two parasitoid wasps, Torymus artemisiae Mayr and Torymoides violaceus (Nikol’skaya, were reared on Artemisia herba-alba (Asteraceae galles, in central Iran. Torymus artemisiae and T. violaceus were developed from the gall midges: Rhopalomyia navasi Tavares and R. hispanica Tavares, respectively. The occurrence of these two parasitic wasps in Iran, and their associations with R. navasi and R. hispanica, are new. Data on the wasps’ biological associations and geographical distribution are provided. The parasitoid compositions of the genus Rhopalomyia (Diptera: Cecidomyiidae were also discussed.

  12. The Anopheles (Anopheles) Crucians Subgroup in the United States (Diptera: Culicidae)

    Science.gov (United States)

    1976-01-01

    collected in light traps and dog-baited traps. Mosq. News 33:39-41. Darsie , R. F., Jr . 1949. Pupae of the anopheline mosquitoes of the north- eastern...United States (Diptera: Culicidae). Rev. de Entomol. 20:509-30. Darsie , R. F., Jr . 1973. A record of changes in mosquito taxonomy in the United States...of America, 1955-1972. Mosq. Syst. 5:187-93. 60 Darsie , R. F., Jr ., D. MacCreary, and L. A. Stearns. 1951. An annotated list of the mosquitoes of

  13. Toxicity of Thiophenes from Echinops transiliensis (Asteraceae) against Aedes aegypti (Diptera: Culicidae) Larvae

    Science.gov (United States)

    2014-01-01

    Toxicity of Thiophenes from Echinops transiliensis (Asteraceae) against Aedes aegypti (Diptera: Culicidae) Larvae by Hiroshi Nakano*a)b)c), Abbas...larvicides against Aedes aegypti . Structural differences among compounds 3, 5, and 8 consisted in differing AcO and OH groups attached to C(3’’) and C(4...mg/ml), 4 (LC50 , 17.95 mg/ml), 6 (LC50 , 18.55 mg/ml), and 7 (LC50 , 19.97 mg/ml). These data indicated that A. aegypti larvicidal activities of

  14. Parasitoid wasps (Hymenoptera from puparia of sarcosaprophagous flies (Diptera: Calliphoridae; Sarcophagidae in Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Adriana OLIVA

    2008-01-01

    Full Text Available Se registró la emergencia de parasitoides (Hymenoptera de crías experimentales de Diptera sarcosaprófagas (Calliphoridae, Sarcophagidae, atraídas a cebos de carne bovina, en Buenos Aires (Argentina durante 1998-2003. Se determinaron cuatro taxones: Tachinaephagus zealandicus Ashmead (Encyrtidae, Brachymeria podagrica (Fabricius (Chalcididae, Nasonia vitripennis (Walker (Pteromaliidae y Alysia sp. (Braconidae: Alysiinae. Sólo las dos primeras especies resultaron abundantes en todos los años. Se ha graficado el número total de emergencias de cada especie para cada mes, junto con las temperaturas promedio máxima y mínima.

  15. Natural enemies of the gall-maker Eugeniamyia dispar (Diptera, Cecidomyiidae: predatory ants and parasitoids

    Directory of Open Access Journals (Sweden)

    MENDONÇA M. de S., Jr.

    2002-01-01

    Full Text Available Natural enemies of the gall maker Eugeniamyia dispar (Diptera: Cecidomyiidae were studied on the urban area of Porto Alegre, RS, Brazil from October 1993 to March 1996. Galls and associated arthropods were followed weekly in the field on individual host plants (Eugenia uniflora, Myrtaceae and also in the laboratory. Three species of ants attacked the galls, the most common being Pseudomyrmex sp. A proportion of galls was parasitised by Rileya sp. (Eurytomidae. The adults of this solitary ectoparasitoid were also attacked by the ants and fell prey to spider webs.

  16. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae).

    Science.gov (United States)

    Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L

    2012-12-15

    -grouping of Luciliinae with Calliphorinae. Relationships within Chrysomya were not well resolved. Whole mt genome data, supported the previously demonstrated paraphyly of Lucilia cuprina with respect to L. sericata and allowed us to conclude that it is due to hybrid introgression prior to the last common ancestor of modern sericata populations, rather than due to recent hybridisation, nuclear pseudogenes or incomplete lineage sorting.

  17. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  18. Taxonomia e morfologia de espécies neotropicais de Graphomya Robineau-Desvoidy (Diptera, Muscidae Taxonomic study of neotropical species of Graphomya Robineau-Desvoidy (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Bianca Marques

    2007-12-01

    Full Text Available Graphomya Robineau-Desvoidy (Diptera, Muscidae pode ser reconhecido por padrões cromáticos característicos no mesonoto e abdômen e pelas cerdas catepisternais 0:2. Das 14 espécies citadas na literatura para a Região Neotropical, sete são redescritas, com descrições das terminálias masculina e feminina - G. analis (Macquart, G. maculata (Scopoli, G. meridionalis Townsend, G. mexicana Giglio-Tos, G. occidentalis Arntfield, G. podexaurea(Enderlein e G. tropicalis Malloch, aqui revalidada. Ilustrações coloridas do mesonoto e do abdômen são apresentadas para facilitar o reconhecimento das espécies. O neótipo de G. maculata é designado. A fêmea de G. podexaurea é registrada pela primeira vez. O registro geográfico das seguintes espécies é ampliado: G. meridionalis para o Equador e Peru; G. mexicana e G. podexaurea para o Brasil; G. tropicalis para Colômbia e Brasil.Graphomya Robineau-Desvoidy (Diptera, Muscidae is recognized by characteristic color patterns on mesonotum and abdomen and by the disposition of the katepisternal setae 0:2. From the 14 species recorded in the Neotropical Region, seven are redescribed with the descriptions of male and female terminalia - G. analis (Macquart, G. maculata (Scopoli, G. meridionalis Townsend, G. mexicana Giglio-Tos, G. occidentalis Arntfield, G. podexaurea(Enderlein and G. tropicalis Malloch, herein revalidated. Colored illustrations of mesonotum and abdomen are presented in order to aid the recognition of the species. The neotype of G. maculata is designated. The female of G. podexaurea is recorded for the first time. The geographic record of the following species is enlarged: G. meridionalis for Ecuador and Peru; G. mexicana and G. podexaurea for Brazil and G. tropicalis for Colombia and Brazil.

  19. Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae no Pantanal Sul-mato-grossense, Brasil

    Directory of Open Access Journals (Sweden)

    Wilson Werner Koller

    2011-03-01

    Full Text Available Cochliomyia macellaria (Diptera: Calliphoridae, known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throughout the study period and collections were carried out on a weekly basis. A total of 159,397 Calliphoridae were caught and C. macellaria (57.33% was the most abundant species. C. macellaria occurred all over the year showing a bimodal behavior with peaks in May-July (late autumn/early winter and October-December (spring.Cochliomyia macellaria (Diptera: Calliphoridae, conhecida como mosca-varejeira, ocorre no continente americano e apresenta importância médico-veterinária e forense. O presente estudo teve como objetivo conhecer a flutuação sazonal dessa espécie na região do Pantanal. De dezembro/2004 a novembro/2007 foram realizadas coletas de dípteros na fazenda Nhumirim, sub-região da Nhecolândia, Pantanal sul-mato-grossense. Foram utilizadas quatro armadilhas orientadas pelo vento, iscadas com fígado bovino deteriorado. As armadilhas permaneceram ativas durante todo o período de estudo, e coletas foram realizadas semanalmente. Foram capturados 159.397 califorídeos, sendo C. macellaria (57,33% a espécie mais abundante. C. macellaria foi observada em todos os meses do ano, apresentando comportamento bimodal com picos populacionais em maio/julho (final de outono/início de inverno e outubro/dezembro (primavera.

  20. Estirpes de Bacillus thuringiensis efetivas contra insetos das ordens Lepidoptera, Coleoptera e Diptera Bacillus thuringiensis strains effective against insects of Lepidoptera, Coleoptera and Diptera orders

    Directory of Open Access Journals (Sweden)

    Lílian Botelho Praça

    2004-01-01

    Full Text Available O objetivo deste trabalho foi selecionar entre 300 estirpes de Bacillus thuringiensis as efetivas simultaneamente contra larvas de Spodoptera frugiperda J.E. Smith e Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, Anthonomus grandis Boheman (Coleoptera: Curculionidae, Aedes aegypti Linnaeus e Culex quinquefasciatus Say (Diptera: Culicidae. Foram selecionadas duas estirpes de B. thuringiensis, denominadas S234 e S997, que apresentaram atividade contra as três ordens de insetos. As estirpes foram caracterizadas por métodos morfológicos, bioquímicos e moleculares. As mesmas apresentaram duas proteínas principais de 130 e 65 kDa, produtos de reação em cadeia da polimerase de tamanho esperado para a detecção dos genes cry1Aa, cry1Ab, cry1Ac, cry1B e cry2 e cristais bipiramidais, cubóides e esféricos.The aim of this work was to select among 300 strains of Bacillus thuringiensis those which are simultaneously effective against larvae of Spodoptera frugiperda J.E. Smith and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, Anthonomus grandis Boheman (Coleoptera: Curculionidae, Aedes aegypti Linnaeus and Culex quinquefasciatus Say (Diptera: Culicidae. Two strains of B. thuringiensis were selected, S234 and S997, which presented activity against those three insect orders. Both strains were characterized by morphological, biochemical and molecular methods. They have presented two main proteins with 130 and 65 kDa, polimerase chain reaction products with expected sizes for detection of the genes cry1Aa, cry1Ab, cry1Ac, cry1B and cry2 and bipiramidal, cubical and spherical crystals.

  1. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  2. Evaluating the Effects of Different Vegetation Types on Necrophagous Fly Communities (Diptera: Calliphoridae; Sarcophagidae): Implications for Conservation

    Science.gov (United States)

    Pereira de Sousa, José Roberto; Carvalho-Filho, Fernando da Silva; Juen, Leandro; Esposito, Maria Cristina

    2016-01-01

    The present study was conducted in five different phytogeographic zones of the Brazilian state of Maranhão, three of which (the Amazon Forest, Cerrado, and Palm Groves) are more heterogeneous, whereas the other two (Marshlands and Mangroves) are more homogeneous. In each zone, nine sites were visited for the collection of necrophagous flies using bait traps in 2010, 2011, and 2012. The calliphorid and sarcophagid communities observed at each site were compared in terms of species richness, composition, and abundance. The more heterogeneous zones had higher species richness, except in the case of the sarcophagids in the forest habitats. The calliphorids Chloroprocta idioidea (Robineau- Desvoidy, 1830), Mesembrinella bicolor (Fabricius, 1805), Hemilucilia semidiaphana (Rondani, 1850) and Lucilia eximia (Wiedemann, 1819) were more closely associated with the Cerrado, Palm Grove and Amazon Forest zones, and Chrysomya megacephala (Fabricius, 194) with the Mangrove. In the sarcophagids, Peckia (Euboettcheria) subducta (Lopes, 1935) and P. (Pattonella) palidipilosa (Curran & Walley, 1934) were associated with the Amazon Forest, and P. (Sarcodexia) lambens (Wiedemann, 1830) and Tricharaea (Sarcophagula) occidua (Fabricius, 1794) with the Palm Grove and Cerrado zones. In the calliphorids, the greatest dissimilarity was recorded between the Amazon Forest and the Mangrove and Lowland grassland zones. In the sarcophagids, by contrast, the greatest dissimilarities were recorded between the Amazon Forest and all the other four zones. In general, then, the phytogeographic zones with the highest environmental heterogeneity were characterized by the greatest species richness and abundance of necrophagous flies. PMID:27798664

  3. Development Period of Forensic Importance Calliphoridae (Diptera: Brachycera in Urban Area Under Natural Conditions in Manaus, Amazonas, Brazil

    Directory of Open Access Journals (Sweden)

    Alex Barros-Souza

    2012-06-01

    Resumo. Para descrever o tempo de desenvolvimento dos imaturos de Calliphoridae sob condições naturais, dois experimentos foram realizados no Campus II do Instituto Nacional de Pesquisas da Amazônia (INPA, Manaus, Amazonas, um na estação chuvosa e o outro na estação menos chuvosa. Cadáveres de porcos domésticos (25kg cada foram utilizados como substrato atrativo para a ovipostura dos califorídeos. Fêmeas grávidas de Calliphoridae foram coletadas e os ovos foram transferidos para potes plásticos contendo placas de Petri com carne bovina moída. As espécies criadas, com respectivo tempo de desenvolvimento de ovo a adulto (em dias, na estação mais chuvosa e menos chuvosa, foram: Chrysomya albiceps (Wiedemann, 14,5 e 9,4 dias, Chrysomya megacephala (Fabricius, 10,7 e 9,4, Hemilucilia segmentaria (Fabricius, 11,5 e 10,7 Lucilia eximia (Wiedemann 19,4 e 14,3 e Paralucilia paraensis (Mello, 11,8 dias, essa criada somente na estação menos chuvosa. Este é o primeiro registro do tempo de desenvolvimento de P. paraensis.

  4. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  5. Description of the male of Lepidodexia (Xylocamptopsis teffeensis (Townsend (Diptera, Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Karlla Patrícia Silva

    2012-03-01

    Full Text Available Description of the male of Lepidodexia (Xylocamptopsis teffeensis (Townsend (Diptera, Sarcophagidae. The male of Lepidodexia (Xylocamptopsis teffeensis (Townsend, 1927 is described and illustrated for the first time based on material housed in the entomological collection of Museu Nacional, Rio de Janeiro (MNRJ. This monotypic subgenus has been recorded in the Brazilian Amazon Rainforest, first in the state of Amazonas and now in the state of Pará. The general structure of the male terminalia is similar that of other Lepidodexia, especially of the subgenus Lepidodexia, by the short distiphallus, juxta with apical projection, and vesica with a membranous spinous lobe.Descrição do macho de Lepidodexia (Xylocamptopsis teffeensis (Townsend, 1927 (Diptera: Sarcophagidae. O macho de Lepidodexia (Xylocamptopsis teffeensis é descrito e ilustrado pela primeira vez, com base em material depositado na coleção entomológica do Museu Nacional, Rio de Janeiro (MNRJ. Esse subgênero monotípico tem sido registrado na Floresta Amazônica brasileira, primeiramente no estado do Amazonas e agora no Pará. A estrutura geral da terminália masculina é similar a de outras espécies de Lepidodexia, especialmente do subgênero Lepidodexia, pelo distifalo curto, juxta com projeção apical e vesica com lobo membranoso e espinhoso.

  6. Checklist dos Conopidae (Insecta, Diptera do Estado do Mato Grosso do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Leonardo Silvestre Gomes Rocha

    Full Text Available RESUMO Conopidae é uma família pouco estudada e de sistemática controversa entre os Diptera. Os adultos são nectarívoros e as larvas têm hábito parasitóide em Hymenoptera, Orthoptera, Blattaria e Diptera. São conhecidas 800 espécies e 56 gêneros com distribuição mundial. Uma lista de 15 espécies em quatro gêneros registradas para o estado do Mato Grosso do Sul, elaborada com base na bibliografia disponível e no material identificado de diversas coleções brasileiras, é fornecida. As coletas estão concentradas no município de Maracaju em bioma de Cerrado, com apenas uma exceção. Faz-se necessário incrementar as coletas em outras regiões e outros ambientes do estado, para que lacunas de amostragem sejam preenchidas.

  7. The adult head morphology of the hessian fly Mayetiola destructor (Diptera, Cecidomyiidae).

    Science.gov (United States)

    Schneeberg, Katharina; Polilov, Alexey; Harris, Marion O; Beutel, Rolf G

    2013-11-01

    The adult head of the Hessian fly Mayetiola destructor was examined and described in detail. Morphological features are evaluated with respect to phylogenetic implications and possible effects of miniaturisation. Preserved groundplan features of Diptera are the orthognathous orientation of the head, the vestiture of small microtrichia (possible autapomorphy), filiform antennae inserted frontally between the compound eyes, the presence of a clypeolabral muscle (possible autapomorphy), the presence of labellae (autapomorphy), and the presence of only one premental retractor. Potential synapomorphies of the groups assigned to Bibionomorpha are the origin of M. tentorioscapalis medialis on the frons and the loss of M. craniolacinialis. Further apomorphies of Cecidomyiidae identified in Mayetiola are the unusually massive anterior tentorial arm, the absence of the labro-epipharyngeal food channel, the absence of the lacinia, and the presence of antennal sensilla connected by a seta, a feature not known from any other group of Diptera. The very large size of the compound eyes (in relation to the entire head surface) and the complete loss of ocelli are possible effects of miniaturization. The large size of the brain (in relation to the cephalic lumen), the unusual shape of the optic lobes, and the absence of the frontal ganglion as a separate structure are probably also linked with size reduction.

  8. Indoor decomposition study in Malaysia with special reference to the scuttle flies (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Raja M. Zuha

    2016-09-01

    Full Text Available Scuttle flies (Diptera: Phoridae are a diversified insect group of forensic importance. Their frequent presence on human corpses indoors and in concealed environments can be the sole indicators to estimate the minimum post mortem interval (PMImin. However, bionomics of scuttle flies on decomposing animal carcasses are rarely documented indoors. The objective of this research is to observe and document the occurrence of scuttle flies on decomposing animal carcass placed inside a portable cabin maintained at room temperature (≈25.0 °C in Bangi, Malaysia. This study was conducted in two rounds for a period of 40-day each and samplings were carried out in different intervals. Adult scuttle flies were aspirated directly from the carcass and preserved in 70% ethanol. Their larvae and pupae were reared until adult stage to facilitate identification. Megaselia scalaris (Loew, Megaselia spiracularis (Schmitz and Dohrniphora cornuta (Bigot were the scuttle flies found on the carcasses with M. scalaris being the earliest and dominant to colonize the body. This cosmopolitan species proved to be the best indicator to estimate PMImin indoor but in the increased presence of other fly species, it might be relegated to a secondary role. The scuttle flies were also found to coexist with other dipterans of forensic importance in an indoor environment, mainly Chrysomya megacephala (Fabricius (Diptera: Calliphoridae. This information expands the knowledge on the bionomics of scuttle flies on decomposing animal remains indoors.

  9. Transcriptomes of three species of Tipuloidea (Diptera, Tipulomorpha) and implications for phylogeny of Tipulomorpha

    Science.gov (United States)

    Kang, Zehui; Zhang, Xiao; Ding, Shuangmei; Tang, Chufei; Wang, Yuyu; de Jong, Herman; Cameron, Stephen L.; Wang, Mengqing; Yang, Ding

    2017-01-01

    Tipulomorpha has long been a problematic taxon in terms of familial composition, phylogenetic relationships among families and position relative to other ‘lower’ Diptera. Whole-transcriptome shotgun sequencing provides a powerful basis for phylogenetic studies. We performed de novo transcriptome sequencing to produce the first transcriptome datasets representing the families Pediciidae, Limoniidae and Cylindrotomidae using high-throughput sequencing technologies. We assembled cDNA libraries for Pedicia vetusta (Alexander) (Pediciidae), Rhipidia sejuga Zhang, Li and Yang (Limoniidae) and Liogma simplicicornis Alexander (Cylindrotomidae). Using the Illumina RNA-Seq method, we obtained 28,252, 44,152 and 44,281 unigenes, from the three respective species. Based on sequence similarity searches, 12,475 (44.16%), 20,334 (46.05%) and 17,478 (39.47%) genes were identified. Analysis of genes highly conserved at the amino acid sequence level revealed there were 1,709 single-copy orthologs genes across the analyzed species. Phylogenetic trees constructed using maximum likelihood (ML) based on the 1,709 single-copy orthologs genes indicated that the relationship between the four major infraorders of lower Diptera was: Culicomorpha + (Tipulomorpha + (Psychodomorpha + (Bibionomorpha + Brachycera))). Trichoceridae belongs within Tipulomorpha as the sister-group of Tipuloidea. Highly supported relationships within the Tipuloidea are Pediciidae + (Limoniidae + (Cylindrotomidae + Tipulidae)). Four-cluster likelihood mapping was used to study potential incongruent signals supporting other topologies, however, results were congruent with the ML tree. PMID:28264066

  10. The mitochondrial genome of the garden pea leafminer Chromatomyia horticola (Goureau, 1851) (Diptera: Agromyzidae).

    Science.gov (United States)

    Wang, You-Zhu; Jin, Gui-Hua; Zhu, Jia-Ying; Wei, Shu-Jun

    2016-07-01

    Here we report the mitochondrial genome sequence of the garden pea leafminer Chromatomyia horticola (Goureau, 1851) (Diptera: Agromyzidae) (GenBank accession no. KR047789). This is the first species with sequenced mitochondrial genome from the genus Chromatomyia. The current length with partial A  +  T-rich region of this mitochondrial genome is 15,320 bp with an A  +  T content of 77.54%. All the 13 protein-coding, two rRNA, and 22 tRNA genes were sequenced, except for the A  +  T-rich region. As in most other sequenced mitochondrial genomes of Diptera, there is no rearrangement compared with the pupative ancestral arrangement of insects. All protein-coding genes start with the ATN start codon except for the gene cox1, which uses abnormal TTG. The A  +  T-rich region is located between rrnS and trnI with a sequenced length of 503 bp. Phylogenetic analysis using the Bayesian method based on the first and second codon positions of the 13 protein-coding genes recovered the monophyly of Agromyzidae with one species of Chromatomyia and four species of Liriomyza in our study. The superfamily Oestroidea (with Agromyzidae in analysis) is sister to the Opomyzoidea.

  11. Genome sequence of Phormia regina Meigen (Diptera: Calliphoridae): implications for medical, veterinary and forensic research.

    Science.gov (United States)

    Andere, Anne A; Platt, Roy N; Ray, David A; Picard, Christine J

    2016-10-28

    Blow flies (Diptera: Calliphoridae) are important medical, veterinary and forensic insects encompassing 8 % of the species diversity observed in the calyptrate insects. Few genomic resources exist to understand the diversity and evolution of this group. We present the hybrid (short and long reads) draft assemblies of the male and female genomes of the common North American blow fly, Phormia regina (Diptera: Calliphoridae). The 550 and 534 Mb draft assemblies contained 8312 and 9490 predicted genes in the female and male genomes, respectively; including > 93 % conserved eukaryotic genes. Putative X and Y chromosomes (21 and 14 Mb, respectively) were assembled and annotated. The P. regina genomes appear to contain few mobile genetic elements, an almost complete absence of SINEs, and most of the repetitive landscape consists of simple repetitive sequences. Candidate gene approaches were undertaken to annotate insecticide resistance, sex-determining, chemoreceptors, and antimicrobial peptides. This work yielded a robust, reliable reference calliphorid genome from a species located in the middle of a calliphorid phylogeny. By adding an additional blow fly genome, the ability to tease apart what might be true of general calliphorids vs. what is specific of two distinct lineages now exists. This resource will provide a strong foundation for future studies into the evolution, population structure, behavior, and physiology of all blow flies.

  12. Enhanced toxicity of binary mixtures of Bacillus thuringiensis subsp. israelensis and three essential oil major constituents to wild Anopheles sinensis (Diptera: Culicidae) and Aedes albopictus (Diptera: Culicidae).

    Science.gov (United States)

    Chang, Kyu-Sik; Shin, E-Hyun; Yoo, Dae-Hyun; Ahn, Young-Joon

    2014-07-01

    An assessment was made of the toxicity of 12 insecticides and three essential oils as well as Bacillus thuringiensis subsp. israelensis (Bti) alone or in combination with the oil major constituents (E)-anethole (AN), (E) -cinnamaldehyde (CA), and eugenol (EU; 1:1 ratio) to third instars of bamboo forest-collected Aedes albopictus (Skuse) and rice paddy field-collected Anopheles sinensis Wiedemann. An. sinensis larvae were resistant to various groups of the tested insecticides. Based on 24-h LC50 values, binary mixtures of Bti and CA, AN, or EU were significantly more toxic against Ae. albopictus larvae (0.0084, 0.0134, and 0.0237 mg/liter) and An. sinensis larvae (0.0159, 0.0388, and 0.0541 mg/liter) than either Bti (1.7884 and 2.1681 mg/liter) or CA (11.46 and 18.56 mg/liter), AN (16.66 and 25.11 mg/liter), or EU (24.60 and 31.09 mg/liter) alone. As judged by cotoxicity coefficient (CC) and synergistic factor (SF), the three binary mixtures operated in a synergy pattern (CC, 140.7-368.3 and SF, 0.0007-0.0010 for Ae. albopictus; CC, 75.1-245.3 and SF, 0.0008-0.0017 for An. sinensis). Global efforts to reduce the level of highly toxic synthetic insecticides in the aquatic environment justify further studies on the binary mixtures of Bti and essential oil constituents described, in particular CA, as potential larvicides for the control of malaria vector mosquito populations.

  13. Anomalías morfológicas en diferentes estructuras de cinco especies de Lutzomyia (Diptera: Psychodidae Morphological abnormalities in different structures of five species of Lutzomyia (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Daniela Vergara

    2008-12-01

    Full Text Available Se describen e ilustran diversos casos de anomalías morfológicas de cinco diferentes especies de Lutzomyia França (Diptera Psychodidae. Estas teratologías se observan en varias estructuras importantes para la identificación taxonómica de dichas especies. Los diferentes individuos pertenecientes a las especies L. columbiana, L. hartmanni, L. reburra, L. ayrozai y L. panamensis fueron capturados en diversos departamentos en Colombia.Diverse morphological anomalies in five different species of Lutzomyia França (Diptera: Pychodidae are described and illustrated. These theratologies are observed in various structures important for the taxonomic identification of the species. The different individuals that belong to the species L. columbiana, L. hartmanni, L. reburra, L. ayrozai and L. panamensis were captured in diverse departments in Colombia.

  14. Stenomicra (Diptera: Opomyzoidea in Argentina, with information on the biology of the genus Stenomicra (Diptera: Opomyzoidea en Argentina, con información sobre la biología del género

    Directory of Open Access Journals (Sweden)

    Raúl E. Campos

    2010-12-01

    Full Text Available This is the first literature record of the genus Stenomicra Coquillett (Diptera: Periscelididae from South America (Neotropical Region. New information on the biological cycle of Stenomicra species in the wild is provided, and four species of the genus Eryngium L. (Apiaceae are recorded as host plants for immature stages of this taxon. The specimens of Stenomicra sp. were collected in Sierra de la Ventana, Buenos Aires province, Argentina.En este estudio, se publica por primera vez para Sudamérica (Región Neotropical el género Stenomicra Coquillett (Diptera: Periscelididae. Se aporta información sobre su ciclo biológico en condiciones naturales y se mencionan cuatro especies del género Eryngium L. (Apiaceae, como plantas hospedadoras de los estados inmaduros. Los ejemplares de Stenomicra sp. fueron colectados en Sierra de la Ventana, Provincia de Buenos Aires, Argentina.

  15. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae) act as larvicide against Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae) Extratos de folhas de Melia azedarach Linnaeus (Sapindales: Meliaceae) atuam como larvicida de Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae)

    OpenAIRE

    2008-01-01

    The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae) on Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of diff...

  16. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  17. Toward an Automated Identification of Anastrepha Fruit Flies in the fraterculus group (Diptera, Tephritidae).

    Science.gov (United States)

    Perre, P; Faria, F A; Jorge, L R; Rocha, A; Torres, R S; Souza-Filho, M F; Lewinsohn, T M; Zucchi, R A

    2016-10-01

    In this study, we assess image analysis techniques as automatic identifiers of three Anastrepha species of quarantine importance, Anastrepha fraterculus (Wiedemann), Anastrepha obliqua (Macquart), and Anastrepha sororcula Zucchi, based on wing and aculeus images. The right wing and aculeus of 100 individuals of each species were mounted on microscope slides, and images were captured with a stereomicroscope and light microscope. For wing image analysis, we used the color descriptor Local Color Histogram; for aculei, we used the contour descriptor Edge Orientation Autocorrelogram. A Support Vector Machine classifier was used in the final stage of wing and aculeus classification. Very accurate species identifications were obtained based on wing and aculeus images, with average accuracies of 94 and 95%, respectively. These results are comparable to previous identification results based on morphometric techniques and to the results achieved by experienced entomologists. Wing and aculeus images produced equally accurate classifications, greatly facilitating the identification of these species. The proposed technique is therefore a promising option for separating these three closely related species in the fraterculus group.

  18. Vector competence of North American mosquitoes (Diptera: Culicidae) for West Nile virus.

    Science.gov (United States)

    Turell, M J; O'Guinn, M L; Dohm, D J; Jones, J W

    2001-03-01

    We evaluated the potential for several North American mosquito species to transmit the newly introduced West Nile (WN) virus. Mosquitoes collected in the New York City metropolitan area during the recent WN virus outbreak, at the Assateague Island Wildlife Refuge, VA, or from established colonies were allowed to feed on chickens infected with WN virus isolated from a crow that died during the 1999 outbreak. These mosquitoes were tested approximately 2 wk later to determine infection, dissemination, and transmission rates. Aedes albopictus (Skuse), Aedes atropalpus (Coquillett), and Aedes japonicus (Theobald) were highly susceptible to infection, and nearly all individuals with a disseminated infection transmitted virus by bite. Culex pipiens L. and Aedes sollicitans (Walker) were moderately susceptible. In contrast, Aedes vexans (Meigen), Aedes aegypti (L.), and Aedes taeniorhynchus (Wiedemann) were relatively refractory to infection, but individual mosquitoes inoculated with WN virus did transmit virus by bite. Infected female Cx. pipiens transmitted WN virus to one of 1,618 F1 progeny, indicating the potential for vertical transmission of this virus. In addition to laboratory vector competence, host-feeding preferences, relative abundance, and season of activity also determine the role that these species could play in transmitting WN virus.

  19. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  20. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  1. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Potential for mosquitoes (Diptera: Culicidae) from Florida to transmit Rift Valley fever virus.

    Science.gov (United States)

    Turell, Michael J; Britch, Seth C; Aldridge, Robert L; Kline, Daniel L; Boohene, Carl; Linthicum, Kenneth J

    2013-09-01

    We evaluated Aedes atlanticus Dyar and Knab, Aedes infirmatus Dyar and Knab, Aedes vexans (Meigen), Anopheles crucians Wiedemann, Coquillettidia perturbans (Walker), Culex nigripalpus Theobald, Mansonia dyari Belkin, Heinemann, and Page, and Psorophora ferox (Von Humboldt) from Florida to determine which of these species should be targeted for control should Rift Valley fever virus (RVFV) be detected in North America. Female mosquitoes that had fed on adult hamsters inoculated with RVFV were incubated for 7-21 d at 26 degrees C, then allowed to refeed on susceptible hamsters, and tested to determine infection, dissemination, and transmission rates. We also inoculated mosquitoes intrathoracically, held them for 7 d, and then allowed them to feed on a susceptible hamster to check for a salivary gland barrier. When exposed to hamsters with viremias > or = 10(7.6) plaque-forming units per milliliter of blood, at least some individuals in each of the species tested became infected; however, Cx. nigripalpus, An. crucians, and Ae. infirmatus were essentially incompetent vectors in the laboratory because of either a midgut escape or salivary gland barrier. Each of the other species should be considered as potential vectors and would need to be controlled if RVFV were introduced into an area where they were found. Additional studies need to be conducted with other geographic populations of these species and to determine how environmental factors affect transmission.

  3. Golden Ratio-Based and Tapered Diptera Inspired Wings: Their Design and Fabrication Using Standard MEMS Technology

    Institute of Scientific and Technical Information of China (English)

    X. Q. Bao; E. Cattan

    2011-01-01

    This work presents our understanding of insect wings, and the design and micromachining of artificial wings with golden ratio-based and tapered veins. The geometric anisotropy of Leading Edge Veins (LEVs) selected by Diptera has a function able to evade impact. As a Diptera example, the elliptic hollow LEVs of cranefly wings are mechanically and aerodynamically significant. In this paper, an artificial wing was designed to be a fractal structure by mimicking cranefly wings and incorporating cross-veins and discal cell. Standard technologies of Microelectromechanical Systems (MEMS) were employed to materialize the design using the selected material. One SU-8 wing sample, light and stiff enough to be comparable to fresh cranefly wings,was presented. The as-prepared SU-8 wings are faithful to real wings not only in weight and vein pattern, but also in flexural stiffness and mass distribution. Thus our method renders possible mimicking with good fidelity of natural wings with complex geometry and morphology.

  4. Mitochondrial genome sequences of Nematocera (lower Diptera): evidence of rearrangement following a complete genome duplication in a winter crane fly.

    Science.gov (United States)

    Beckenbach, Andrew T

    2012-01-01

    The complete mitochondrial DNA sequences of eight representatives of lower Diptera, suborder Nematocera, along with nearly complete sequences from two other species, are presented. These taxa represent eight families not previously represented by complete mitochondrial DNA sequences. Most of the sequences retain the ancestral dipteran mitochondrial gene arrangement, while one sequence, that of the midge Arachnocampa flava (family Keroplatidae), has an inversion of the trnE gene. The most unusual result is the extensive rearrangement of the mitochondrial genome of a winter crane fly, Paracladura trichoptera (family Trichocera). The pattern of rearrangement indicates that the mechanism of rearrangement involved a tandem duplication of the entire mitochondrial genome, followed by random and nonrandom loss of one copy of each gene. Another winter crane fly retains the ancestral diperan gene arrangement. A preliminary mitochondrial phylogeny of the Diptera is also presented.

  5. Scanning Electron Microscopy Investigations of Third-Instar Larva of Cordylobia rodhaini (Diptera: Calliphoridae), an Agent of Furuncular Myiasis.

    Science.gov (United States)

    Pezzi, M; Cultrera, R; Chicca, M; Leis, M

    2015-05-01

    A scanning electron microscopy study of the third larval instar of Cordylobia rodhaini Gedoelst (Diptera: Calliphoridae), causing obligatory furuncular myiasis, is presented here for the first time. The larvae were collected from a patient exposed to them in the tropical rainforest of Kibale National Park (Uganda). Distinctive features are described in sequence from the anterior region to the posterior region, highlighting the morphological features of antennae, maxillary palps, structures related to mouth opening, sensory structures, thoracic and abdominal spines, and anterior and posterior spiracles. The results are compared with those of other Calyptrata flies, mainly from the family Calliphoridae and, when possible, with Cordylobia anthropophaga Blanchard (Diptera: Calliphoridae), the only other species of genus Cordylobia investigated by scanning electron microscopy.

  6. Review of Thompsoniella Guimarães with description of a new species from Colombia (Diptera, Calliphoridae, Mesembrinellinae

    Directory of Open Access Journals (Sweden)

    Marta Wolff

    2014-12-01

    Full Text Available Review of Thompsoniella Guimarães with description of a new species from Colombia (Diptera, Calliphoridae, Mesembrinellinae. The Mesembrinellinae (Diptera, Calliphoridae are exclusively Neotropical with nine genera comprising 36 recognized species, including the genus Thompsoniella Guimarães with a single species, T. anomala Guimarães. We describe a new species, Thompsoniella andina sp. nov., from the Departments of Antioquia and Caldas, Colombia (Cordillera Central of the Andes, between 2600 - 2700 m and redescribe T. anomala. A key to the nine genera of Mesembrinellinae and a key to the males of the two species of Thompsoniella are provided. Color photographs to illustrate the two species of Thompsoniella and drawings of the male genitalia of both species are also provided. Here we record Thompsoniella for the first time in Colombia.

  7. [Parasitic effect of Opius concolor (Spzl) (Hymenoptera, Braconidae) on an intermediate host Ceratitis capitata Wied (Diptera, Trypetidae)].

    Science.gov (United States)

    Ben Hamouda, M H; Ben Salah, H

    1984-01-01

    The parasitic incidence of Opius concolor (Hymenoptera, Braconidae) on a replacement host, Ceratitis capitata (Diptera, Trypetidae) was studied using polyacrylamide gel electrophoresis and immunoelectrophoresis methods. A noticeable modification of C. capitata proteins was observed when parasited by O. concolor. But the most important phenomenon is the finding of common antigens between the host and the parasite. These results are discussed with regard to trophic and parasitic behaviour of the parasite.

  8. An illustrated catalogue of the types of Stratiomyidae (Diptera: Brachycera) in the collection of Museu Nacional, Rio de Janeiro, Brazil.

    Science.gov (United States)

    Fachin, Diego Aguilar; Couri, Márcia Souto; De Mello-Patiu, Cátia Antunes

    2016-02-26

    A catalogue of the type specimens of Stratiomyidae (Diptera: Brachycera) held in the collection of Museu Nacional, Rio de Janeiro, Brazil (MNRJ) is presented. A total number of 50 type specimens of 18 valid Neotropical species were recognized and are listed in alphabetical order of subfamily, genus and specific epithet. Photos of 12 primary types of the species and bibliographical data of the original descriptions, labels and condition of all type specimens are also provided.

  9. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  10. Calycomyza hyptidis Spencer (Diptera,Agromyzidae: descriptions, redescriptions and first record in Ocimum basilicum (Lamiaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Viviane Rodrigues de Sousa

    2013-06-01

    Full Text Available Calycomyza hyptidis Spencer (Diptera, Agromyzidae: descriptions, redescriptions and first record in Ocimum basilicum (Lamiaceae in Brazil. All phases of the leafminer Calycomyza hyptidis Spencer are for the first time described, including the larva, puparium and adult female. Illustrations are presented for male and female terminalia, mine, larva and pupa. The species is first recorded in leaves of Ocimum basilicum L. (Lamiaceae in Brazil.

  11. Leaf extracts of Melia azedarach Linnaeus (Sapindales: Meliaceae) act as larvicide against Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae)

    OpenAIRE

    2008-01-01

    The objective of this study was to compare the larvicidal effect of hydroethanolic extracts of fresh and dry leaves of Melia azedarach Linnaeus (Sapindales: Meliaceae) on Aedes aegypti (Linnaeus, 1762) (Diptera: Culicidae). All the extracts evaluated induced mortality among the third and fourth instar larvae of Aedes aegypti after 24 and 48 hours of exposure to the products. Although previous studies had demonstrated the action of seeds and fruits of Melia azedarach against the larvae of diff...

  12. Developmental Variation of Indian Thermophilic Variety of Scuttle Fly Megaselia (Megaselia) scalaris (Loew, 1866) (Diptera: Phoridae) on Different Substrates

    OpenAIRE

    Abesh Chakraborty; Atanu Naskar; Panchanan Parui; Dhriti Banerjee

    2016-01-01

    The scuttle flies (Diptera: Phoridae) are important in forensic dipterology, because of their necrophagous habit. They are amongst the first wave of insects visiting human corpses in mechanically barricaded environments; hence their immature stages are generally used for estimation of PMI. The effect of different substrates commonly used for developmental studies was studied to analyze the variation of growth of the thermophilic variety of Megaselia (M.) scalaris prevalent in India on GDM, ED...

  13. Bush Blitz aids description of three new species and a new genus of Australian beeflies (Diptera, Bombyliidae, Exoprosopini)

    OpenAIRE

    Christine Lambkin; Justin Bartlett

    2011-01-01

    Bush Blitz is a three-year multimillion dollar program to document the plants and animals in hundreds of properties across Australia’s National Reserve System. The core focus is on nature discovery – identifying and describing new species of plants and animals. The Bush Blitz program has enabled the collection and description of beeflies (Diptera, Bombyliidae) from surveys in Western Australia and Queensland. Three new species of Australian beeflies belonging to the Exoprosopini a...

  14. Posterior spiracles of fourth instar larvae of four species of phlebotomine sand flies (Diptera: Psychodidae under scanning electron microscopy

    Directory of Open Access Journals (Sweden)

    Pessoa Felipe Arley Costa

    2000-01-01

    Full Text Available In the present study, posterior spiracles of laboratory-reared fourth instar larvae of Lutzomyia longipalpis, L. migonei, L. lenti, and L. whitmani (Diptera: Psychodidae of the State of Ceará, Brazil, were examined under scanning electron microscopy. The number of papillae of spiracles examined varied according to the species examined, but no intraspecific differences were found. The importance of this structure to sand fly larva identification and phylogeny is commented.

  15. Dasiops luzestelae: a new species of the genus dasiops rondani (diptera: lonchaeidae) associated with passion fruit crops in colombia

    OpenAIRE

    Castro, Angela; Korytkowski, Cheslavo; Ebratt, Everth; Brochero, Helena L.

    2013-01-01

    Dasiops luzestelae n. sp. (Diptera: Lonchaeidae) is a species that previously was not described formally and is regarded as an undetermined pest affecting buds of Passiflora edulis f. flavicarpa Degener. This study evaluated material collected in 10 departments of Colombia where passion fruit crops constitute an important economic income. Data of geographical distribution and passion fruit crops associated with Dasiops luzestelae n. sp. are presented.

  16. How to inventory tropical flies (Diptera)--One of the megadiverse orders of insects.

    Science.gov (United States)

    Borkent, Art; Brown, Brian V

    2015-04-28

    A new approach to inventory Diptera species in tropical habitats is described. A 150 x 266 m patch of cloud forest at Zurquí de Moravia, Costa Rica (10.047N, 84.008W) at 1585 meters asl was sampled with two Malaise traps for slightly more than one year (Sept. 12, 2012-Oct. 18, 2013). Further concomitant sampling with a variety of trapping methods for three days every month and collecting during a one-week intensive "Diptera Blitz", with 19 collaborators collecting on-site, provided diverse additional samples used in the inventory. Two other Costa Rican sites at Tapantí National Park (9.720N, 83.774W, 1600 m) and Las Alturas (8.951N, 82.834W, 1540 m), 40 and 180 km southeast from Zurquí de Moravia, respectively, were each sampled with a single Malaise trap to allow for beta-diversity assessments. Tapantí National Park was sampled from Oct. 28, 2012-Oct. 13, 2013 and Las Alturas from Oct. 13, 2012-Oct. 13, 2013. A worldwide group of 54 expert systematists are identifying to species level all 72 dipteran families present in the trap samples. Five local technicians sampled and prepared material to the highest curatorial standards, ensuring that collaborator efforts were focused on species identification. This project, currently in its final, third year of operation (to end Sept. 1, 2015), has already recorded 2,348 species and with many more yet expected. Unlike previous All Taxon Biodiversity Inventories, this project has attainable goals and will provide the first complete estimate of species richness for one of the four megadiverse insect orders in a tropical region. Considering that this is the first complete survey of one of the largest orders of insects within any tropical region of the planet, there is clearly great need for a consistent and feasible protocol for sampling the smaller but markedly more diverse smaller insects in such ecosystems. By weight of their species diversity and remarkable divergence of habit, the Diptera are an excellent model to

  17. Seasonal, Locality, and Habitat Variation in Assemblages of Carrion-Associated Diptera in Gauteng Province, South Africa.

    Science.gov (United States)

    Parry, N J; Mansell, M W; Weldon, C W

    2016-11-01

    Seasonal, spatial, and habitat responses of carrion-associated Diptera assemblages can provide valuable information about the presence or absence of species and their relative abundance, and thereby enhance understanding of their responses to environmental variables and how this may have an impact on forensic investigations. Three different nature reserves (localities) within the Municipality of Tshwane, South Africa, were selected to determine whether species assemblages of carrion-feeding flies differ between seasons, localities, and habitat types. A total of 59,511 adult Diptera, identified to 35 species in eight different families, were collected using modified Redtop hanging traps, baited with liver and fish, during four seasons in three different habitat types. Species assemblages differed temporally, with season being the main factor determining species diversity and not locality or habitat. However, savanna and human-disturbed habitats supported a higher abundance and species richness than grassland habitats. Areas adjacent to the localities, such as large urban expanses in Dinokeng or agricultural holdings in Rietvlei, led to an increase in the abundance and mean species richness of carrion-associated Diptera, and in increased numbers of pest or invasive species such as Chrysomya megacephala (F.). Despite this, the overall species assemblages present in human-disturbed areas were very similar to those recorded in natural habitats.

  18. "Jejenes" (Diptera: Simuliidae of Nahuel Huapi National Park, Patagonia, Argentina: Preliminary results "Jejenes" (Diptera: Simuliidae del Parque Nacional Nahuel Huapi, Patagonia, Argentina: Resultados preliminares

    Directory of Open Access Journals (Sweden)

    Luis M. Hernández

    2009-06-01

    Full Text Available The Simuliidae is a family of Diptera with approximately 2072 described species worldwide. The females of the majority of the species feed from vertebrates' blood, which makes them a significant plague that affects both men as well as cattle, birds, and other vertebrates. The objective of this paper is to create an inventory of Simuliidae and to reveal certain aspects of the biology and distribution of this family of aquatic insects in the Nahuel Huapi National Park. Moreover, information on the zoogeography of Simuliidae in Patagonia is provided. Five genera, 3 subgenera and 32 species Simuliidae are recorded from Patagonia: Cnesia (three spp., Cnesiamima (one sp., Gigantodax (14 spp., Paraustrosimulium (one sp., Simulium (Ectemnaspis (one sp., S. (Psaroniocompsa (one sp. and S. ( Pternaspatha (11 spp., At present, we have collected all five genera, one subgenus of Simulium (Pternaspatha, and 19 species of Simuliidae in the park, which amounts to 57% of the Simuliidae fauna in this area. Puerto Blest, a characteristic area of the High-Andean phytogeographical province (humid forest, showed the highest diversity of Simuliidae.Los simúlidos pertenecen a una familia de Diptera (Simuliidae con alrededor de 2.072 especies descritas a nivel mundial. Las hembras de la mayoría de las especies se alimentan con sangre de vertebrados, lo cual las convierte en importantes plagas que afectan tanto al hombre como al ganado, aves y otros vertebrados. Los objetivos de este trabajo son llevar a cabo un inventario de Simuliidae y dar a conocer algunos aspectos de la biología y la distribución de esta familia de insectos acuáticos en el Parque Nacional Nahuel Huapi, Argentina. Además, se proporciona información sobre la biogeografía de Simuliidae en la Patagonia. Cinco géneros, un subgénero y 32 especies de simúlidos han sido registrados para Patagonia: Cnesia (3 spp., Cnesiamima (1 sp., Gigantodax (14 spp., Paraustrosimulium (1 sp., Simulium

  19. Nematocera flies recorded in Serra do Courel, northwest Spain, May 2012 (Diptera: Anisopodidae, Blepharoceridae, Cylindrotomidae, Limoniidae, Pediciidae, Tipulidae and Trichoceridae) including descriptions of two new species of Limoniidae.

    Science.gov (United States)

    Hancock, E Geoffrey; Hewitt, Stephen M; Horsfield, David; Lyszkowsi, Richard M; Macgowan, Iain; Ricarte, Antonio; Rotheray, Graham E; Watt, Kenneth

    2015-01-19

    During May 2012 Diptera were sampled in the Serro do Courel area of Lugo Province, Galicia, northwest Spain. The authors of this paper, members of the Malloch Society (see website) are active in attempting to understand the detailed ecology of flies. Much of this work is through targeting larval stages often with an emphasis on saproxylic situations. By rearing adults from larvae direct relationships between them and their detailed habitat requirements are established. The list of nematocerous Diptera that were sampled includes 36 species two of them new to science and records of six others new to the Iberian peninsula are provided. We describe Lipsothrix galiciensis Hancock & Hewitt sp. nov., and Prionolabis pjotri Hancock sp. nov. of the family Limoniidae and provide a key to adults of European Lipsothrix species. Such results from this brief opportunity indicate the potential of the area for further field work in these and other families of Diptera

  20. Nocturnal activity of phlebotomine sandflies (Diptera: Psychodidae) in a cutaneous leishmaniasis focus in Chichaoua, Morocco.

    Science.gov (United States)

    Guernaoui, S; Boussaa, S; Pesson, B; Boumezzough, A

    2006-02-01

    The nocturnal activity of phlebotomine sandflies (Diptera: Psychodidae) was studied "at an epidemic focus" on human cutaneous leishmaniasis due to Leishmania tropica Wright in Chichaoua province, in Morocco. Sandflies were collected using light and sticky-paper traps changed at 2-h intervals, inside and around houses, in August and October 2004. Overall, 633 sandflies, belonging to six species of Phlebotomus and three of Sergentomyia, were collected. Sandfly activity was nocturnal and higher at twilight. Several activity patterns were observed according to the species. Phlebotomus (Paraphlebotomus) sergenti Parrot, 1917, the suspected vector of L. tropica in this focus, was caught during each collection performed from 1900 to 0500 hours, the numbers of species caught peaked at 1900-2100 hours. There were seasonal variations of the nocturnal activity, which could be related to the variations in temperature and relative humidity.

  1. Seasonality and Relative Abundance of tabanids (Diptera, Tabanidae on Marambaia Island, Rio de Janeiro, Brazil.

    Directory of Open Access Journals (Sweden)

    Ronald Rodrigues Guimaraes

    2017-08-01

    Full Text Available Abstract. Tabanids collections were conducted on Marambaia Island, Atlantic Forest biome, Rio de Janeiro, Brazil. Thirty-one species were identified belonging to 16 genera. Seasonal variation and its relationship with the most important climatic factors during 1981 and 2013 and observations on the bionomics of each species are presented. Variação sazonal e abundância de tabânidas (Diptera, Tabanidae na Ilha da Marambaia, Rio de Janeiro, Brasil Resumo. Coletas de tabânidas foram realizadas na ilha de Marambaia, bioma da Mata Atlântica, Rio de Janeiro, Brasil. Trinta e uma espécies foram identificadas pertencentes a 16 gêneros. São apresentadas a variação sazonal, observações sobre bionomia e a relação com os fatores climáticos mais importantes durante os anos de 1981 e 2013.

  2. Molecular phylogeny and biogeography of the Hawaiian craneflies Dicranomyia (Diptera: Limoniidae.

    Directory of Open Access Journals (Sweden)

    Kari Roesch Goodman

    Full Text Available The Hawaiian Diptera offer an opportunity to compare patterns of diversification across large and small endemic radiations with varying species richness and levels of single island endemism. The craneflies (Limoniidae: Dicranomyia represent a small radiation of 13 described species that have diversified within the Hawaiian Islands. We used Bayesian and maximum likelihood approaches to generate a molecular phylogeny of the Hawaiian Dicranomyia using a combination of nuclear and mitochondrial loci, estimated divergence times and reconstructed ancestral ranges. Divergence time estimation and ancestral range reconstruction suggest that the colonization that led to most of the diversity within the craneflies arrived prior to the formation of Kauai and demonstrates that the two major clades within that radiation contrast sharply in their patterns of diversification.

  3. Morphology and Developmental Rate of the Blow Fly, Hemipyrellia ligurriens (Diptera: Calliphoridae: Forensic Entomology Applications

    Directory of Open Access Journals (Sweden)

    Nophawan Bunchu

    2012-01-01

    Full Text Available Hemipyrellia ligurriens (Diptera: Calliphoridae is a forensically important blow fly species presented in many countries. In this study, we determined the morphology of all stages and the developmental rate of H. ligurriens reared under natural ambient conditions in Phitsanulok province, northern Thailand. Morphological features of all stages based on observing under a light microscope were described and demonstrated in order to use for identification purpose. Moreover, development time in each stage was given. The developmental time of H. ligurriens to complete metamorphosis; from egg, larva, pupa to adult, took 270.71 h for 1 cycle of development. The results from this study may be useful not only for application in forensic investigation, but also for study in its biology in the future.

  4. Sarcophaga (Liosarcophaga) dux (Diptera: Sarcophagidae): A flesh fly species of medical importance.

    Science.gov (United States)

    Sukontason, Kabkaew L; Sanit, Sangob; Klong-Klaew, Tunwadee; Tomberlin, Jeffery K; Sukontason, Kom

    2014-04-01

    Although tropical climate of Thailand is suitably endowed with biodiversity of insects, flies of medical importance is not well investigated. Using information from literature search, fly survey approach and specialist's experience, we review database of Sarcophaga (Liosarcophaga) dux Thomson (Diptera: Sarcophagidae), one of the priorities flesh fly species of medical importance in Thailand. This review deals with morphology, bionomics and medical involvement. Important morphological characteristics of egg, larva, puparia and adult were highlighted with illustration and/or micrographs. Search pertaining to molecular analysis used for fly identification and developmental rate of larvae were included. Medical involvement of larvae was not only myiasis-producing agent in humans and animals, but associated with human death investigations. This information will enable us to accurate identify this species and to emphasis the increase medically important scene in Thailand.

  5. Thaumaleidae (Diptera) collected by the late Dr. W. Joost in the Caucasus Mountains.

    Science.gov (United States)

    Wagner, Rüdiger; Bellstedt, Ronald

    2015-11-05

    The aquatic insect collection of the late Dr. W. Joost contained two new species of Thaumaleidae (Diptera) from the Caucasus Mountains: Thaumalea monikae sp. n. and Thaumalea biacuminata sp. n. These two new species are herein described, and the most abundant species in Dr. Joost's collection, Thaumalea martinovskyi Joost, 1979, is redescribed based on the type material. Figures of male and female genitalia for all species are provided. All three species show morphological similarities to taxa from the Eastern Mediterranean area. Thaumalea monikae is related to the European T. bezzii-species group, T. biacuminata to the T. serrata-group, and T. martinovskyi to T. kyladica Wagner, 1981 and T. malickyi Theischinger, 1979 from the Eastern Mediterranean area.

  6. Effects of bioirrigation of non-biting midges (Diptera: Chironomidae) on lake sediment respiration

    Science.gov (United States)

    Baranov, Viktor; Lewandowski, Jörg; Romeijn, Paul; Singer, Gabriel; Krause, Stefan

    2016-06-01

    Bioirrigation or the transport of fluids into the sediment matrix due to the activities of organisms such as bloodworms (larvae of Diptera, Chironomidae), has substantial impacts on sediment respiration in lakes. However, previous quantifications of bioirrigation impacts of Chironomidae have been limited by technical challenges such as the difficulty to separate faunal and bacterial respiration. This paper describes a novel method based on the bioreactive tracer resazurin for measuring respiration in-situ in non-sealed systems with constant oxygen supply. Applying this new method in microcosm experiments revealed that bioirrigation enhanced sediment respiration by up to 2.5 times. The new method is yielding lower oxygen consumption than previously reported, as it is only sensitive to aerobic heterotrophous respiration and not to other processes causing oxygen decrease. Hence it decouples the quantification of respiration of animals and inorganic oxygen consumption from microbe respiration in sediment.

  7. The type specimens of Calyptratae (Diptera) housed in non-traditional institutions in Argentina.

    Science.gov (United States)

    Patitucci, Luciano Damián; Mulieri, Pablo Ricardo; Domínguez, M Cecilia; Mariluis, Juan Carlos

    2015-01-14

    The type material of species of Calyptratae Diptera belonging to Anthomyiidae, Calliphoridae, Fanniidae, Muscidae, Sarcophagidae, and Tachinidae, housed in the collections of non-traditional institutions in Argentina were examined. These collections were included in the recently created "Sistema Nacional de Datos Biológicos" (National Biological Data System). We examined four collections: "Administración Nacional de Laboratorios e Institutos de Salud 'Dr. Carlos G. Malbrán'" (ANLIS), "Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires" (INTA), "Instituto Argentino de Investigaciones de las Zonas Áridas" (IADIZA); and "Fundación Félix de Azara" (CFA). Comparison of the original descriptions of these species with the label information revealed the existence of 24 holotypes, 5 lectotypes, 11 syntypes, and 441 paratypes/paralectotypes. Complete information is given for each type, including reference to the original description, label data, and preservation condition. 

  8. The relationship between morphological and behavioral mimicry in hover flies (Diptera: Syrphidae).

    Science.gov (United States)

    Penney, Heather D; Hassall, Christopher; Skevington, Jeffrey H; Lamborn, Brent; Sherratt, Thomas N

    2014-02-01

    Palatable (Batesian) mimics of unprofitable models could use behavioral mimicry to compensate for the ease with which they can be visually discriminated or to augment an already close morphological resemblance. We evaluated these contrasting predictions by assaying the behavior of 57 field-caught species of mimetic hover flies (Diptera: Syrphidae) and quantifying their morphological similarity to a range of potential hymenopteran models. A purpose-built phylogeny for the hover flies was used to control for potential lack of independence due to shared evolutionary history. Those hover fly species that engage in behavioral mimicry (mock stinging, leg waving, wing wagging) were all large wasp mimics within the genera Spilomyia and Temnostoma. While the behavioral mimics assayed were good morphological mimics, not all good mimics were behavioral mimics. Therefore, while the behaviors may have evolved to augment good morphological mimicry, they do not advantage all good mimics.

  9. Mitochondrial Genomes Provide Insights into the Phylogeny of Lauxanioidea (Diptera: Cyclorrhapha).

    Science.gov (United States)

    Li, Xuankun; Li, Wenliang; Ding, Shuangmei; Cameron, Stephen L; Mao, Meng; Shi, Li; Yang, Ding

    2017-04-14

    The superfamily Lauxanioidea is a significant dipteran clade including over 2500 known species in three families: Lauxaniidae, Celyphidae and Chamaemyiidae. We sequenced the first five (three complete and two partial) lauxanioid mitochondrial (mt) genomes, and used them to reconstruct the phylogeny of this group. The lauxanioid mt genomes are typical of the Diptera, containing all 37 genes usually present in bilaterian animals. A total of three conserved intergenic sequences have been reported across the Cyclorrhapha. The inferred secondary structure of 22 tRNAs suggested five substitution patterns among the Cyclorrhapha. The control region in the Lauxanioidea has apparently evolved very fast, but four conserved structural elements were detected in all three complete mt genome sequences. Phylogenetic relationships based on the mt genome data were inferred by Maximum Likelihood and Bayesian methods. The traditional relationships between families within the Lauxanioidea, (Chamaemyiidae + (Lauxaniidae + Celyphidae)), were corroborated; however, the higher-level relationships between cyclorrhaphan superfamilies are mostly poorly supported.

  10. A fossil biting midge (Diptera: Ceratopogonidae) from early Eocene Indian amber with a complex pheromone evaporator

    Science.gov (United States)

    Stebner, Frauke; Szadziewski, Ryszard; Rühr, Peter T.; Singh, Hukam; Hammel, Jörg U.; Kvifte, Gunnar Mikalsen; Rust, Jes

    2016-10-01

    The life-like fidelity of organisms captured in amber is unique among all kinds of fossilization and represents an invaluable source for different fields of palaeontological and biological research. One of the most challenging aspects in amber research is the study of traits related to behaviour. Here, indirect evidence for pheromone-mediated mating behaviour is recorded from a biting midge (Ceratopogonidae) in 54 million-year-old Indian amber. Camptopterohelea odora n. sp. exhibits a complex, pocket shaped structure on the wings, which resembles the wing folds of certain moth flies (Diptera: Psychodidae) and scent organs that are only known from butterflies and moths (Lepidoptera) so far. Our studies suggests that pheromone releasing structures on the wings have evolved independently in biting midges and might be much more widespread in fossil as well as modern insects than known so far.

  11. Catalogue of the type material of Phlebotominae (Diptera, Psychodidae) deposited in the Instituto Evandro Chagas, Brazil

    Science.gov (United States)

    dos Santos, Thiago Vasconcelos; Pinheiro, Maria Sueli Barros; de Andrade, Andrey José

    2014-01-01

    Abstract The available type material of Phlebotominae (Diptera, Psychodidae) deposited in the “Coleção de Flebotomíneos” of the Instituto Evandro Chagas (ColFleb IEC) is now presented in an annotated catalogue comprising a total of 121 type specimens belonging to 12 species as follow: Nyssomyia richardwardi (2 female paratypes), Nyssomyia shawi (9 male and 25 female paratypes), Nyssomyia umbratilis (female holotype and 1 female paratype), Nyssomyia yuilli yuilli (1 male and 1 female paratypes), Pintomyia gruta (1 male and 2 female paratypes), Psychodopygus lainsoni (2 male syntypes), Psychodopygus leonidasdeanei (male holotype, female “allotype” and 45 female paratypes), Psychodopygus llanosmartinsi (2 female paratypes), Psychodopygus wellcomei (1 male and 4 female “syntypes”), Trichophoromyia readyi (male holotype, female “allotype” and 1 male paratype), Trichophoromyia adelsonsouzai (male holotype, 13 male 5 female paratypes), and Trichophoromyia brachipyga (1 male paratype). PMID:24715786

  12. Ovicidal activity of entomopathogenic hyphomycetes on Aedes aegypti (Diptera: Culicidae) under laboratory conditions.

    Science.gov (United States)

    Luz, C; Tai, M H H; Santos, A H; Rocha, L F N; Albernaz, D A S; Silva, H H G

    2007-09-01

    The ovicidal activity of 21 hyphomycete fungi species against Aedes aegypti (L.) (Diptera: Culicidae) was tested. Fungi with ovicidal activity developed on high numbers of eggs (> or =70%) during 25 d of exposure. A clear ovicidal activity with low values of hatch (1.3-40%) was observed after 25 d of incubation with Isaria farinosa (Holm: Fries) Fries, Paecilomyces carneus (Duché & Heim) Brown & Smith, Paecilomyces marquandii (Massee) Hughes, Isaria fumosorosea (Wize), Metarhizium anisopliae (Metschnikoff) Sorokin, Penicillium sp., Paecilomyces lilacinus (Thom) Samson, Beauveria bassiana (Balsamo) Vuillemin, and Evlachovaea kintrischica Borisov & Tarasov. More than 63% of eggs hatched after 25-d exposures to 11 other fungi species deemed as ineffective. These are the first results to show the effects of entomopathogenic fungi against eggs of Ae. aegypti, and they suggest their potential as control agents of this vector.

  13. Sex chromosomes in mitotic and polytene tissues of Anastrepha fraterculus (Diptera, Tephritidae) from Argentina: a review.

    Science.gov (United States)

    Giardini, María Cecilia; Milla, Fabián H; Lanzavecchia, Silvia; Nieves, Mariela; Cladera, Jorge L

    2015-01-01

    Cytogenetics, which is considered a fundamental tool to understand basic genetic and genomic issues of species, has greatly contributed to the description of polymorphisms both at inter- and intra-specific level. In fact, cytogenetics was one of the first approaches used to propose Anastrepha fraterculus (Diptera: Tephritidae) as a complex of cryptic species. Different morphological variants of sex chromosomes have been reported among Argentinean populations of Anastrepha fraterculus. However, since this high structural variability in sex chromosomes does not pose a reproductive barrier, their role in speciation is yet to be unveiled. This review provides an update on general aspects of cytogenetics in Argentinean Anastrepha fraterculus populations, focused on the prevalence of X-Y arrangements.

  14. Pupal dimensions as predictors of adult size in fitness studies of Aedes aegypti (Diptera: Culicidae).

    Science.gov (United States)

    Koenraadt, C J M

    2008-03-01

    Adult body size is a central life history character in mosquito fitness studies. I evaluated the predictive values of pupal cephalothorax length, cephalothorax width, and wet weight for adult size (wing length) of male and female Aedes aegypti (L.) (Diptera: Culicidae). Cephalothorax length was the most consistent and accurate predictor of adult size. Width of the cephalothorax and wet weight were more variable, and they significantly decreased shortly before adult emergence. I propose that cephalothorax length could be used as a proxy for adult size to test how physical and biological factors such as resource-limited environments and competition affect mosquito fitness with the advantage that the specimen does not need to be killed.

  15. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-04-01

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Evolution of Lower Brachyceran Flies (Diptera and Their Adaptive Radiation with Angiosperms

    Directory of Open Access Journals (Sweden)

    Bo Wang

    2017-04-01

    Full Text Available The Diptera (true flies is one of the most species-abundant orders of Insecta, and it is also among the most important flower-visiting insects. Dipteran fossils are abundant in the Mesozoic, especially in the Late Jurassic and Early Cretaceous. Here, we review the fossil record and early evolution of some Mesozoic lower brachyceran flies together with new records in Burmese amber, including Tabanidae, Nemestrinidae, Bombyliidae, Eremochaetidae, and Zhangsolvidae. The fossil records reveal that some flower-visiting groups had diversified during the mid-Cretaceous, consistent with the rise of angiosperms to widespread floristic dominance. These brachyceran groups played an important role in the origin of co-evolutionary relationships with basal angiosperms. Moreover, the rise of angiosperms not only improved the diversity of flower-visiting flies, but also advanced the turnover and evolution of other specialized flies.

  17. A survey of the family Muscidae (Diptera (except for Coenosiinae from Mbaracayú forest, Paraguay

    Directory of Open Access Journals (Sweden)

    Guilherme S. SCHÜHLI

    2011-01-01

    Full Text Available A survey of the Muscid (Diptera fauna of the Mbaracayú forest is presented. The forest is a UNESCO Biosphere Reserve located in Cuenca Alta del Río Jejuí, Canindeyú department, eastern Paraguay. The paper constitutes the first Muscid survey for Paraguay and contributes for the main priorities of the Paraguayan Plan Estratégico del Sistema Nacional de Áreas Silvestres Protegidas. The specimens were sampled in five different biomes within the park area during 1996. The sampling method employed continuous sampling with malaise traps. The survey accounted for 22 genera and 52 species, comprising four genera (Dolichophaonia Carvalho, Haematobia Le Peletier, Sarcopromusca Townsend, and Stomoxys Geoffroy and 21 species not yet registered for Paraguay. The results included sampled specimens information including biome, date and taxonomic position.

  18. Morphological and Molecular Evolution of Flesh Flies of Sarcophaginae (Diptera: Sarcophagidae)

    DEFF Research Database (Denmark)

    Buenaventura Ruiz, Ingrid Eliana

    A sizeable part of the large majority of animal life on Earth is the outcome of a fewevolutionary bursts of a certain lineage of insects: the episodic radiations of flies. Dipteransconstitute one of the most familiar groups of insects, since they are ubiquitous and of worldwidedistribution...... in Sarcophaginae are informative in resolvingphylogenetic relationships at various taxonomic levels. Despite the many interesting aspects in theevolution, biogeography, morphology, and biology of these flies, the evolutionary relationshipswithin this dipteran radiation are very poorly understood and the few...... to other regional faunas in the Afrotropical, Australasian, and Oriental regions.Hopefully, this thesis will inspire similar phylogenetic studies on other fly families, to betterunderstand Diptera radiations and how to troubleshoot challenging rapid evolutionary radiations.First and foremost...

  19. Graphomya Robineau-Desvoidy from Costa Rica: descriptions and first records (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    MS. Couri

    Full Text Available Graphomya Robineau-Desvoidy (Diptera, Muscidae occurs in temperate and tropical regions of the world. It is known in the Neotropical Region from fifteen species. The genus is here recorded for the first time from Costa Rica, on the basis of three species: G. auriceps Malloch, 1934; G. mexicana Giglio-Tos, 1893 and G. tropicalis Malloch, 1934. A key for the recognition of these three species is given. G. auriceps is redescribed, including the morphology of male and female terminalia and the male of G. tropicalis is described for the first time. For G. mexicana, a well-known species in the literature, only a brief diagnosis and the material examined are listed.

  20. Phylogeny of genus Glossina (Diptera: Glossinidae) according to ITS2 sequences

    Institute of Scientific and Technical Information of China (English)

    陈小爱; 李嵩; 李昌本; 赵寿元; Aksoy; Serap

    1999-01-01

    The flies of genus Glossina (Diptera: Glossinidae) are an important vector of African trypanosomiases which cause diseases in humans and animals. The ribosomal DNA Internal Transcribed Spacer-2 (ITS-2) region sequences from different Glossina species were PCR-amplified and analyzed in order to construct a molecular phylogeny for genus Glossina. Trees generated by parsimony confirmed the monophyletic taxonomic placement of genus Glossina where fusca group species formed the deepest branch followed by morsitans and palpalis groups, respectively. The placement of Glossina austeni by both the traditional morphological and biochemical criteria has been controversial. Results presented here, based on ITS-2 locus sequence analysis, suggest that Glossina austeni can be placed into a separate subgenerus which forms a sister-group relationship with the morsitans group species.