Human interleukin for DA cells or leukemia inhibitory factor is released by Vero cells in human embryo coculture.

Science.gov (United States)

Papaxanthos-Roche, A; Taupin, J L; Mayer, G; Daniel, J Y; Moreau, J F

1994-09-01

In the light of the newly discovered implications of human interleukin for DA cells and leukemia inhibitory factor in embryology, we searched for the presence of this soluble cytokine in the supernatant of Vero cell coculture systems. Using a bioassay as well as a specific ELISA, we demonstrated that Vero cells are able to release large quantities of human interleukin for DA cells and leukemia inhibitory factor in the embryo-growing medium of such cocultures.

Observation of a cytopathogenic effect on cell lines used for routine viral cultures led to the diagnosis of lymphogranuloma venereum.

Science.gov (United States)

Busson, Laurent; Crucitti, Tania; De Foor, Marc; Van den Wijngaert, Sigi; Vandenberg, Olivier

2013-08-01

This article reports the fortuitous recovery of nine Chlamydia trachomatis serovar L strains in cell cultures (Vero and LLC-MK(2) cell line) designed for viral culture. Nine ano-genital swabs were inoculated on confluent Vero, MRC5 and LLC-MK(2) cell cultures. They were collected from HIV-positive patients who were primarily men who have sex with men (MSM) presenting ulcerations that mimicked herpes simplex infections. A cytopathogenic effect was observed on Vero and LLC-MK(2) cells on day 14. The presence of C trachomatis serovar L in the cell lines was confirmed by Real Time-PCR. C trachomatis serovar L can grow on Vero and LLC-MK(2) cell lines designed for viral cultures. Lymphogranuloma venereum must be considered as a differential diagnosis for herpes-like lesions, particularly in MSM with high-risk behaviours.

Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

International Nuclear Information System (INIS)

Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.

1986-01-01

The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated 35 S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with 32 P-ATP (in vitro method) or 32 Pi (in vivo method). Finally, analysis of 3 H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells

Benefits of oxygen and nitrogen plasma treatment in Vero cell affinity to poly(lactide-co-glycolide acid

Directory of Open Access Journals (Sweden)

Andrea Rodrigues Esposito

2013-01-01

Full Text Available Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. it is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. in this study, poly(lactide-co-glycolide, plga, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on vero cells culture. the plga membranes, which were characterized by sem and contact angle, showed increased surface rugosity and narrower contact angles. cell adhesion, cytotoxicity assay, sem and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction. Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. It is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. Plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. In this study, poly(lactide-co-glycolide, PLGA, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on Vero cells culture. The PLGA membranes, which were characterized by SEM and contact angle, showed increased surface rugosity and narrower contact angles. Cell adhesion, cytotoxicity assay, SEM and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction.

Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells

Directory of Open Access Journals (Sweden)

Kleber Juvenal Silva Farias

2013-01-01

Full Text Available Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2. Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU. These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.

Chloroquine inhibits dengue virus type 2 replication in Vero cells but not in C6/36 cells.

Science.gov (United States)

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU). These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.

A Study on Recovery from Potentially Lethal Damage induced by γ-Irradiation in Plateau-phase Vero Cells in vitro

International Nuclear Information System (INIS)

Kim, Il Han; Choi, Eun Kyung; Ha, Sung Whan; Park, Charn Il; Cha, Chang Yong

1988-01-01

Recovery from potentially lethal damage (PLDR) after irradiation was studied in plateau-phase culture of Vero cells in vitro. Unfed plateau-phase cells were irradiated with dose of 1 to 9 Gy using Cs-137 irradiator. Cells then were incubated again and left in situ for 0, 1, 2, 3, 4, 5, 6 and 24 hours and then were trypsinized, explanted, and subcultured in fresh RPMI-1640 media containing 0.33% agar. Cell survival was measured by colony forming ability. An adequate number of heavily irradiated Vero cells were added as feeder cells to make the total cell number constant in every culture dish. As the postirradiation in situ incubation time increased, surviving fraction increased saturation level at 2 to 4 hours after in situ incubation. As the radiation dose increased, the rate of PLDR also increased. In analysis of cell survival curve fitted to the linear-quadratic model, the linear inactivation coefficient (a) decreased largely and reached nearly to zero but the quadratic inactivation coefficient (b) increased minimally by increment of postirradiation in situ incubation time. So PLDR mainly affected the damage expressed as a. In the multitarget model, significant change was not obtained in D0 but in Dq. Therefore, shoulder region in cell survival curve was mainly affected by PLDR and terminal slope was not influenced at all. And dose-modifying factor by PLDR was relatively higher in shoulder region, that is, in low dose area below 3 Gy

[Establishment and application of a Vero cell line stably expressing raccoon dog SLAM, the cellular receptor of canine distemper virus].

Science.gov (United States)

Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei

2012-12-04

The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.

Serum-free microcarrier based production of replication deficient Influenza vaccine candidate virus lacking NS1 using Vero cells

Directory of Open Access Journals (Sweden)

Yan Mylene L

2011-08-01

Full Text Available Abstract Background Influenza virus is a major health concern that has huge impacts on the human society, and vaccination remains as one of the most effective ways to mitigate this disease. Comparing the two types of commercially available Influenza vaccine, the live attenuated virus vaccine is more cross-reactive and easier to administer than the traditional inactivated vaccines. One promising live attenuated Influenza vaccine that has completed Phase I clinical trial is deltaFLU, a deletion mutant lacking the viral Nonstructural Protein 1 (NS1 gene. As a consequence of this gene deletion, this mutant virus can only propagate effectively in cells with a deficient interferon-mediated antiviral response. To demonstrate the manufacturability of this vaccine candidate, a batch bioreactor production process using adherent Vero cells on microcarriers in commercially available animal-component free, serum-free media is described. Results Five commercially available animal-component free, serum-free media (SFM were evaluated for growth of Vero cells in agitated Cytodex 1 spinner flask microcarrier cultures. EX-CELL Vero SFM achieved the highest cell concentration of 2.6 × 10^6 cells/ml, whereas other SFM achieved about 1.2 × 10^6 cells/ml. Time points for infection between the late exponential and stationary phases of cell growth had no significant effect in the final virus titres. A virus yield of 7.6 Log10 TCID50/ml was achieved using trypsin concentration of 10 μg/ml and MOI of 0.001. The Influenza vaccine production process was scaled up to a 3 liter controlled stirred tank bioreactor to achieve a cell density of 2.7 × 10^6 cells/ml and virus titre of 8.3 Log10 TCID50/ml. Finally, the bioreactor system was tested for the production of the corresponding wild type H1N1 Influenza virus, which is conventionally used in the production of inactivated vaccine. High virus titres of up to 10 Log10 TCID50/ml were achieved. Conclusions We describe for the

Avian metapneumovirus M2:2 protein inhibits replication in Vero cells: modification facilitates live vaccine development.

Science.gov (United States)

Clubbe, Jayne; Naylor, Clive J

2011-11-28

Throughout the world, avian metapneumovirus (AMPV) infection of subtype A is principally controlled by two live vaccines both derived from UK field strain #8544. Improvements of those vaccines by use of reverse genetics technology was found to be hampered by the inability of #8544 to replicate in the commonly exploited Vero cell based reverse genetics system. A systematic reverse genetics based genome modification of a DNA copy of #8544, employing sequence data from a Vero grown, #8544 derived, live vaccine; was used to determine mutations required to facilitate virus recovery and replication in Vero cells. This identified a single coding substitution in the M2:2 reading frame as responsible. Furthermore, ablation of M2:2 was found to elicit the same outcome. M2:2 sequence analysis of seven AMPVs found Vero cell adaption to be associated with non similar amino acid changes in M2:2. The study shows that M2:2 modification of field virus #8544 will enable research leading to improved vaccines. This may have more general application to other AMPV field strains. Copyright © 2011 Elsevier Ltd. All rights reserved.

Adaptation of high-growth influenza H5N1 vaccine virus in Vero cells: implications for pandemic preparedness.

Directory of Open Access Journals (Sweden)

Yu-Fen Tseng

Full Text Available Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14, a reassortant virus between A/Vietnam/1194/2004 (H5N1 virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15 was generated and can grow over 10(8 TCID(50/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes.

A purified inactivated Japanese encephalitis virus vaccine made in Vero cells.

Science.gov (United States)

Srivastava, A K; Putnak, J R; Lee, S H; Hong, S P; Moon, S B; Barvir, D A; Zhao, B; Olson, R A; Kim, S O; Yoo, W D; Towle, A C; Vaughn, D W; Innis, B L; Eckels, K H

2001-08-14

A second generation, purified, inactivated vaccine (PIV) against Japanese encephalitis (JE) virus was produced and tested in mice where it was found to be highly immunogenic and protective. The JE-PIV was made from an attenuated strain of JE virus propagated in certified Vero cells, purified, and inactivated with formalin. Its manufacture followed current GMP guidelines for the production of biologicals. The manufacturing process was efficient in generating a high yield of virus, essentially free of contaminating host cell proteins and nucleic acids. The PIV was formulated with aluminum hydroxide and administered to mice by subcutaneous inoculation. Vaccinated animals developed high-titered JE virus neutralizing antibodies in a dose dependent fashion after two injections. The vaccine protected mice against morbidity and mortality after challenge with live, virulent, JE virus. Compared with the existing licensed mouse brain-derived vaccine, JE-Vax, the Vero cell-derived JE-PIV was more immunogenic and as effective as preventing encephalitis in mice. The JE-PIV is currently being tested for safety and immunogenicity in volunteers.

A NEW COPPER (II)-IMIDAZOLE DERIVATIVE EFFECTIVELY INHIBITS REPLICATION OF DENV-2 IN VERO CELL

Science.gov (United States)

Sucipto, Teguh Hari; Churrotin, Siti; Setyawati, Harsasi; Martak, Fahimah; Mulyatno, Kris Cahyo; Amarullah, Ilham Harlan; Kotaki, Tomohiro; Kameoka, Masanori; Yotopranoto, Subagyo; Soegijanto, and Soegeng

2018-01-01

Background: Dengue is a kind of infectious disease that was distributed in the tropical and sub-tropical areas. To date, there is no clinically approved dengue vaccine or antiviral for humans, even though there have been great efforts towards this end. Therefore, finding the effective compound against dengue virus (DENV) replication is very important. Among the complex compounds, copper(II)-imidazole derivatives are of interest because of their biological and medicinal benefits. Materials and Methods: In the present study, antiviral activity of [Cu(2,4,5-triphenylimidazole)2]n, was evaluated against different stages of dengue virus type 2 (DENV-2) replication in Vero cell using focus forming unit reduction assay and quantitative ELISA. Results: [Cu(2,4,5-triphenylimidazole)2]n inhibited DENV-2 replication in Vero cells with IC50 = 2.3 μg/ml and SI= 19.42 when cells were treated 2 days after virus infection, whereas its CC50 for cytotoxicity to Vero cells was 44.174 μg/ml. Conclusion: The compound has high anti-DENV2 activity, less toxicity, and a high possibility to be considered a drug candidate. PMID:29619441

Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

International Nuclear Information System (INIS)

Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

2008-01-01

Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Science.gov (United States)

Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad

2016-01-01

Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Directory of Open Access Journals (Sweden)

Mahmoud Huleihel

Full Text Available Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA was performed on the Raman spectra after principal component analysis (PCA with a leave one out (LOO approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Lipophilic organic pollutants induce changes in phospholipid and membrane protein composition leading to Vero cell morphological change.

Science.gov (United States)

Liao, Ting T; Wang, Lei; Jia, Ru W; Fu, Xiao H; Chua, Hong

2014-01-01

Membrane damage related to morphological change in Vero cells is a sensitive index of the composite biotoxicity of trace lipophilic chemicals. However, judging whether the morphological change in Vero cells happens and its ratio are difficult because it is not a quantitative characteristic. To find biomarkers of cell morphological change for quantitatively representing the ratio of morphological changed cell, the mechanism of cell membrane damage driven by typical lipophilic chemicals, such as trichlorophenol (TCP) and perfluorooctanesulphonate (PFOS), was explored. The ratio of morphologically changed cells generally increased with increased TCP or PFOS concentrations, and the level of four major components of phospholipids varied with concentrations of TCP or PFOS, but only the ratio of phosphatidylcholine (PC)/phosphatidylethanolamine (PE) decreased regularly as TCP or PFOS concentrations increased. Analysis of membrane proteins showed that the level of vimentin in normal cell membranes is high, while it decreases or vanishes after TCP exposure. These variations in phospholipid and membrane protein components may result in membrane leakage and variation in rigid structure, which leads to changes in cell morphology. Therefore, the ratio of PC/PE and amount of vimentin may be potential biomarkers for representing the ratio of morphological changed Vero cell introduced by trace lipophilic compounds, thus their composite bio-toxicity.

Prosopis juliflora Pods Alkaloid-rich Fraction: In vitro Anthelmintic Activity on Goat Gastrointestinal Parasites and Its Cytotoxicity on Vero Cells.

Science.gov (United States)

Lima, Helimar Gonçalves; Gomes, Danilo Cavalcante; Santos, Nathália Silva; Dias, Êuder Reis; Botura, Mariana Borges; Batatinha, Maria José Moreira; Branco, Alexsandro

2017-10-01

This study was designed to assess the in vitro anthelmintic activity of the fraction containing alkaloid from Prosopis juliflora pods on goat gastrointestinal nematodes using the egg hatch assay (EHA), larval migration inhibition assay (LMIA), and larval motility assay (LMA). The alkaloid-rich fraction (AF) - content juliprosopine as major alkaloid - was obtained from ethyl acetate extract after fractionation in Sephadex LH-20 chromatography column and its characterization were made by nuclear magnetic resonance analysis together with literature data comparison. The concentrations tested were 4.0, 2.67, 1.78, 1.19, and 0.79 mg/mL (EHA) and 4 mg/mL (LMIA and LMA). The in vitro cytotoxicity on Vero cell cultures was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and trypan blue tests. High ovicidal activity was observed with IC 50 and IC 90 values at 1.1 and 1.43 mg/mL for AF. On the other hand, this fraction showed low larvicidal activity and high toxic effect. Thus, P. juliflora pod alkaloid rich-fraction has ovicidal activity in vitro against goat gastrointestinal nematodes and cytotoxic in Vero cell cultures. Prosopis juliflora alkaloid-rich fraction (AF) showed in vitro anthelmintic effect against gastrointestinal nematodes of goatsThe AF was more effective against eggs than third larval stage (L 3 ) of gastrointestinal nematodesThe AF showed cytotoxicity activity on Vero cell lineThe juliprosopine was the main alkaloid found in the AF from P. juliflora pods. Abbreviations used: AF: Alkaloid-rich fraction; DMSO: Dimethyl sulfoxide; EE: Ethyl acetate extract; EHA: Egg hatch assay; IC50: Inhibitory concentration 50%; IC90: Inhibitory concentration 90%; L3: Infective larvae; LMA: Larval motility assay; LMIA: Larval migration inhibition assay; MTT: Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; PBS: Phosphate buffered saline; RPMI: Roswell Park Memorial Institute médium; TLC

Assessment of cytotoxicity of Portulaca oleracea Linn. against human colon adenocarcinoma and vero cell line

Science.gov (United States)

Mali, Prashant Y.

2015-01-01

Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374

[The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

Science.gov (United States)

Zuffa, T

1987-10-01

The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

The progressive adaptation of a georgian isolate of African swine fever virus to vero cells leads to a gradual attenuation of virulence in swine corresponding to major modifications of the viral genome.

Science.gov (United States)

Krug, Peter W; Holinka, Lauren G; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R; Borca, Manuel V

2015-02-01

African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been

[Cytotoxic effect of Vibrio cholerae non-O1 on Vero cells].

Science.gov (United States)

Figueroa-Arredondo, P; García-Lozano, H; Gutiérrez-Cogco, L; Valdespino-Gómez, J L

1994-01-01

At the present time there is still in Mexico a diarrhoeal outbreak due to Vibrio cholerae O1. In INDRE we have isolated from the same outbreak last year (jan-apr), 70 strains of Vibrio cholerae Non-O1. These were isolated from patients with a diarrhoeal illness different from cholera. Patients were of different ages and sex, and from various geographic areas. The isolated strains were confirmed by serological agglutination test with polyclonal antisera, and they neither belong to O1 serogroup or O139. We assayed all the 70 strains in Vero cells, searching for cytotoxic effect, probably attributed to cholera toxin, or any other toxin. The strains were screened by PCR for cholera toxin gene detection, and negative results were obtained. We have found only one CT-producer strain, but it was a rough one so, we are not able to affirm that is not a V. cholerae O1 serotype. Vibrio cholerae Non-O1 strains, tested in Vero cells assay, produced cytotoxic effect within 24 h. It was found that 48/70 strains (66.6%), had cytotoxic activity, showing rounding and then lysis of cells. From our results we concluded that this cytotoxic effect, is not cholera toxin related, instead we propose it could be due to an unknown virulence factor, probably a different toxin in mexican Vibrio cholerae Non-O1 strains.

Characterization and detection of Vero cells infected with Herpes Simplex Virus type 1 using Raman spectroscopy and advanced statistical methods.

Science.gov (United States)

Salman, A; Shufan, E; Zeiri, L; Huleihel, M

2014-07-01

Herpes viruses are involved in a variety of human disorders. Herpes Simplex Virus type 1 (HSV-1) is the most common among the herpes viruses and is primarily involved in human cutaneous disorders. Although the symptoms of infection by this virus are usually minimal, in some cases HSV-1 might cause serious infections in the eyes and the brain leading to blindness and even death. A drug, acyclovir, is available to counter this virus. The drug is most effective when used during the early stages of the infection, which makes early detection and identification of these viral infections highly important for successful treatment. In the present study we evaluated the potential of Raman spectroscopy as a sensitive, rapid, and reliable method for the detection and identification of HSV-1 viral infections in cell cultures. Using Raman spectroscopy followed by advanced statistical methods enabled us, with sensitivity approaching 100%, to differentiate between a control group of Vero cells and another group of Vero cells that had been infected with HSV-1. Cell sites that were "rich in membrane" gave the best results in the differentiation between the two categories. The major changes were observed in the 1195-1726 cm(-1) range of the Raman spectrum. The features in this range are attributed mainly to proteins, lipids, and nucleic acids. Copyright © 2014. Published by Elsevier Inc.

An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.

Science.gov (United States)

Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena

2015-08-20

Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cytotoxicity of extracts of spices to cultured cells.

Science.gov (United States)

Unnikrishnan, M C; Kuttan, R

1988-01-01

The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

ACAM2000 clonal Vero cell culture vaccinia virus (New York City Board of Health strain)--a second-generation smallpox vaccine for biological defense.

Science.gov (United States)

Monath, Thomas P; Caldwell, Joseph R; Mundt, Wolfgang; Fusco, Joan; Johnson, Casey S; Buller, Mark; Liu, Jian; Gardner, Bridget; Downing, Greg; Blum, Paul S; Kemp, Tracy; Nichols, Richard; Weltzin, Richard

2004-10-01

The threat of smallpox as a biological weapon has spurred efforts to create stockpiles of vaccine for emergency preparedness. In lieu of preparing vaccine in animal skin (the original method), we cloned vaccinia virus (New York City Board of Health strain, Dryvax by plaque purification and amplified the clone in cell culture. The overarching goal was to produce a modern vaccine that was equivalent to the currently licensed Dryvax in its preclinical and clinical properties, and could thus reliably protect humans against smallpox. A variety of clones were evaluated, and many were unacceptably virulent in animal models. One clonal virus (ACAM1000) was selected and produced at clinical grade in MRC-5 human diploid cells. ACAM1000 was comparable to Dryvax in immunogenicity and protective activity but was less neurovirulent for mice and nonhuman primates. To meet requirements for large quantities of vaccine after the events of September 11th 2001, the ACAM1000 master virus seed was used to prepare vaccine (designated ACAM2000) at large scale in Vero cells under serum-free conditions. The genomes of ACAM1000 and ACAM2000 had identical nucleotide sequences, and the vaccines had comparable biological phenotypes. ACAM1000 and ACAM2000 were evaluated in three Phase 1 clinical trials. The vaccines produced major cutaneous reactions and evoked neutralizing antibody and cell-mediated immune responses in the vast majority of subjects and had a reactogenicity profile similar to that of Dryvax.

Comparison analysis of microRNAs in response to dengue virus type 2 infection between the Vero cell-adapted strain and its source, the clinical C6/36 isolated strain.

Science.gov (United States)

Yang, Jiajia; Lin, Yao; Jiang, Liming; Xi, Juemin; Wang, Xiaodan; Guan, Jiaoqiong; Chen, Junying; Pan, Yue; Luo, Jia; Ye, Chao; Sun, Qiangming

2018-05-02

To elucidate the differences in microRNAs during dengue virus infection between Vero cell-adapted strain (DENV-2-Vero) and its source, the clinical C6/36 isolated strain (DENV-2-C6/36), a comparison analysis was performed in Vero cells by high throughput sequencing. The results showed that the expression of 16 known and 3 novel miRNAs exhibited marked differences. 5 known miRNAs were up-regulated in DENV-2-C6/36 group, while 11 known microRNAs were down-regulated in DENV-2-Vero group. The GO enrichment and KEGG pathway analysis showed that there was a distinct difference in regulating viral replication between two strains. In DENV-2-Vero infection group, significantly enriched GO terms included virion attachment to host cells, viral structural protein/genome processing and packaging. Meanwhile, the regulation of cell death and apoptosis between two groups were different in the early stage of infection. KEGG enrichment analysis showed that DENV-2-C6/36 infection induced more intense regulation of immune-related pathways, including Fc gamma R-mediated phagocytosis, etc. DENV-2-Vero infection could partially alleviate the immune defense of Vero cells compared with DENV-2-C6/36. The results indicated that the distinct microRNA changes induced by two DENV-2 strains may be partly related to their infective abilities. Our data provide useful insights that help elucidate the host-pathogen interactions following DENV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Differential Effect of Medium on the Ratio of ICM/TE of Bovine Embryos in a Co-culture System

Directory of Open Access Journals (Sweden)

Mohsen Forouzanfar

2010-01-01

Full Text Available Background: This study was undertaken to investigate the efficiency of two differentembryo somatic cell co-culture conditions, tissue culture medium 199 (TCM199–vero cellsand Menezo B2 (B2-vero cells, for the in vitro developmental quantity and quality of bovineembryos.Materials and Methods: Bovine oocytes were allowed to mature and subsequently undergofertilization in vitro. Their presumptive zygotes were cultured in either TCM199 or B2 culturemedia in conjunction with vero cells for up to nine days. The culture media were refreshedevery two days and the proportion of embryos that cleaved and further developed to themorula and blastocyst (early, expand and hatched stages were recorded. Hatched blastocystsunderwent differential staining in order to determine the numbers of inner cell mass (ICMand tropho ectoderm (TE and total cell number (TCN.Results: Of the two groups, no significant difference was seen between the proportions ofthe presumptive zygotes cleaved, those which developed to 8-16 cells, morula and reacheddays 7or 8 blastocyst stage or hatched. However, the values for TCN and TE of the TCM199-vero embryos were significantly greater than those of B2-vero embryos. The values for ICM/TCN and ICM/TE were significantly greater in the B2-vero group versus the TCM199-verogroup.Conclusion: Both TCM199 and B2 culture media in conjunction with vero cells were ofthe same efficiency when used for in vitro development of bovine presumptive zygotes.However, TCM199 was superior in providing embryos with more embryo cell numbers,whereas B2 medium was superior in providing embryos with greater ICM/TE and ICM/TCN ratios.

Generation of a Vero-Based Packaging Cell Line to Produce SV40 Gene Delivery Vectors for Use in Clinical Gene Therapy Studies

Directory of Open Access Journals (Sweden)

Miguel G. Toscano

2017-09-01

Full Text Available Replication-defective (RD recombinant simian virus 40 (SV40-based gene delivery vectors hold a great potential for clinical applications because of their presumed non-immunogenicity and capacity to induce immune tolerance to the transgene products in humans. However, the clinical use of SV40 vectors has been hampered by the lack of a packaging cell line that produces replication-competent (RC free SV40 particles in the vector production process. To solve this problem, we have adapted the current SV40 vector genome used for the production of vector particles and generated a novel Vero-based packaging cell line named SuperVero that exclusively expresses the SV40 large T antigen. SuperVero cells produce similar numbers of SV40 vector particles compared to the currently used packaging cell lines, albeit in the absence of contaminating RC SV40 particles. Our unique SV40 vector platform named SVac paves the way to clinically test a whole new generation of SV40-based therapeutics for a broad range of important diseases.

Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

International Nuclear Information System (INIS)

Sandvig, K.; Olsnes, S.

1988-01-01

Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of 45 Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

International Nuclear Information System (INIS)

Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.

2013-01-01

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

Energy Technology Data Exchange (ETDEWEB)

Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)

2013-07-05

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

International Nuclear Information System (INIS)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang

2012-01-01

Highlights: ► Vero cell-based HPAI H5N1 vaccine with stable high yield. ► Stable high yield derived from the YNVa H3N2 backbone. ► H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

Energy Technology Data Exchange (ETDEWEB)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China); Wang, Yue [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People' s Republic of China (China); Liao, Guoyang [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells

OpenAIRE

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR a...

Propagation of avian metapneumovirus subtypes A and B using chicken embryo related and other cell systems.

Science.gov (United States)

Coswig, Lia Treptow; dos Santos, Márcia Bianchi; Hafez, Hafez Mohamed; Ferreira, Helena Lage; Arns, Clarice Weis

2010-07-01

Primary isolation of avian metapneumovirus (aMPV) is carried out using tracheal organ culture (TOC) or chicken embryonated eggs with subsequent adaptation in chicken embryo fibroblasts (CEF) or Vero cultures. This study was conducted to evaluate six different cell lines and two avian culture systems for the propagation of aMPV subtypes A and B. The chicken embryo related (CER) cells were used successfully for primary isolation. In addition to Vero and baby hamster kidney (BHK-21) cells, CER cells were also shown to be the most appropriate for propagation of aMPV considering high titres. Propagation of A and B subtypes in CEF and TOC remained efficient after the primary isolation and several passages of viruses in the CER cell line. The growth curves were created using CER, Vero and BHK-21 cell lines. Compared with growth, both yielded higher titres in CER cells during the first 30 h after infection, but no significant difference was observed in the results obtained from CER and Vero cells. This data show that CER cells are adequate for aMPV subtypes A and B propagation, giving similar results to Vero cells. Copyright 2010 Elsevier B.V. All rights reserved.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Inhibition of Dengue Virus 3 in Mammalian Cell Culture by Synthetic ...

African Journals Online (AJOL)

HP

Purpose: To evaluate the inhibition of Dengue virus 3 by synthetic siRNAs targeting the untranslated regions UTR and structural regions of DENV3 genome in Vero-81 cell line. Methods: Vero-81 cells transfected with synthetic siRNAs were challenged by DENV3. The effectiveness of siRNAs was confirmed by four ...

Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines

Directory of Open Access Journals (Sweden)

Syahida Ahmad

2012-10-01

Full Text Available The direct feeding of Jatropha meal containing phorbol esters (PEs indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang and African green monkey kidney (Vero cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 μg/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA values as positive control i.e., 124.5 and 106.3 μg/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-δ and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-δ and caspase-3 as their mode of actions.

VERO MODA Settles in Taobao Mall

Institute of Scientific and Technical Information of China (English)

2010-01-01

@@ In the wake of the successive opening up of Jack&Jones' and ONLY's official flagship stores in Taobao Mall, the Danish Bestseller Fashion Group's other brand, VERO MODA, landed the Mall on July 2nd. At present, the first two brands' online sales have exceeded 500 million yuan per month. Based on the encouraging sales figures, VERO MODA, as Bestseller's third-largest brand on Taobao platform, is expected to scale new network marketing miracle.

Canine distemper virus utilizes different receptors to infect chicken embryo fibroblasts and vero cells.

Science.gov (United States)

Chen, Jun; Liang, Xiu; Chen, Pei-fu

2011-04-01

Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.

Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

Directory of Open Access Journals (Sweden)

Mendel Friedman

2013-08-01

Full Text Available Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1 in Vero cells by two independent assays: the green fluorescent protein (GFP assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed.

Effects of viscoelastic ophthalmic solutions on cell cultures

Directory of Open Access Journals (Sweden)

Madhavan Hajib

1998-01-01

Full Text Available The development of mild but significant inflammation probably attributable to viscoelastic ophthalmic solutions in cataract surgery was recently brought to the notice of the authors, and hence a study of the effects of these solutions available in India, on cell cultures was undertaken. We studied the effects of 6 viscoelastic ophthalmic solutions (2 sodium hyaluronate designated as A and B, and 4 hydroxypropylmethylcellulose designated as C, D, E and F on HeLa, Vero and BHK-21 cell lines in tissue culture microtitre plates using undiluted, 1:10 and 1:100 dilutions of the solutions, and in cover slip cultures using undiluted solutions. Phase contrast microscopic examination of the solutions was also done to determine the presence of floating particles. The products D and F produced cytotoxic changes in HeLa cell line and these products also showed the presence of floating particles under phase contrast microscopy. Other products did not have any adverse effects on the cell lines nor did they show floating particles. The viscoelastic ophthalmic pharmaceutical products designated D and F have cytotoxic effects on HeLa cell line which appears to be a useful cell line for testing these products for their toxicity. The presence of particulate materials in products D and F indicates that the methods used for purification of the solution are not effective.

Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

International Nuclear Information System (INIS)

Yeung, Y.-S.; Yip, C.-W.; Hon, C.-C.; Chow, Ken Y.C.; Ma, Iris C.M.; Zeng Fanya; Leung, Frederick C.C.

2008-01-01

We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level

Immunogenicity, safety and antibody persistence of a purified vero cell cultured rabies vaccine (Speeda) administered by the Zagreb regimen or Essen regimen in post-exposure subjects.

Science.gov (United States)

Shi, Nianmin; Zhang, Yibin; Zheng, Huizhen; Zhu, Zhenggang; Wang, Dingming; Li, Sihai; Li, Yuhua; Yang, Liqing; Zhang, Junnan; Bai, Yunhua; Lu, Qiang; Zhang, Zheng; Luo, Fengji; Yu, Chun; Li, Li

2017-06-03

To compare the safety, immunogenicity and long-term effect of a purified vero cell cultured rabies vaccine in post-exposure subjects following 2 intramuscular regimens, Zagreb or Essen regimen. Serum samples were collected before vaccination and on days 7, 14, 42, 180 and 365 post vaccination. Solicited adverse events were recorded for 7 d following each vaccine dose, and unsolicited adverse events throughout the entire study period. This study was registered with ClinicalTrials.gov (NCT01821911 and NCT01827917). No serious adverse events were reported. Although Zagreb regimen had a higher incidence of adverse reactions than Essen regimen at the first and second injection, the incidence was similar at the third and fourth injection between these 2 groups as well. At day 42, 100% subjects developed adequate rabies virus neutralizing antibody concentrations (≥ 0.5IU/ml) for both regimens. At days 180 and 365, the antibody level decreased dramatically, however, the percentage of subjects with adequate antibody concentrations still remained high (above 75% and 50% respectively). None of confirmed rabies virus exposured subjects had rabies one year later, and percentage of subjects with adequate antibody concentrations reached 100% at days 14 and 42. Rabies post-exposure prophylaxis vaccination with PVRV following a Zagreb regimen had a similar safety, immunogenicity and long-term effect to the Essen regimen in China.

Porcine platelet lysate as a supplement for animal cell culture

Science.gov (United States)

Aldén, Anna; Gonzalez, Lorena; Persson, Anna; Christensson, Kerstin; Holmqvist, Olov

2007-01-01

A novel supplementation of cell growth media based on a porcine platelet lysate was developed for culture of animal-derived cells. The platelet lysate was produced from porcine blood and contained lysate of platelets and plasma components. It showed satisfactory microbiological integrity and it carried only low amount of endotoxins (platelet lysate supported well proliferation of Vero (African green monkey transformed kidney epithelial cells), Chinese hamster ovary (CHO) and hybridoma cells comparable to fetal bovine serum (FBS). Platelet lysate shows promise as a viable choice over FBS as it can be produced in large quantities, high lot-to-lot consistency and with an attractive price structure. Furthermore it is a strong alternative to FBS for ethical reasons. It is expected that it can be used as a general supplementation for most animal cells for research studies on the proliferation of cells and their expression of products. PMID:19002989

Susceptibility of various cell lines to Neospora caninum tachyzoites cultivation

Directory of Open Access Journals (Sweden)

Khordadmehr, M.,

2014-05-01

Full Text Available Neospora caninum is a coccidian protozoan parasite which is a major cause of bovine abortions and neonatal mortality in cattle, sheep, goat and horse. Occasionally, cultured cells are used for isolation and multiplication of the agent in vitro with several purposes. In this study the tachyzoite yields of N. caninum were compared in various cell cultures as the host cell lines. Among the cell cultures tested, two presented good susceptibility to the agent: cell lines Vero and MA-104. SW742 and TLI (in vitro suspension culture of lymphoid cells infected with Theileria lestoquardi showed moderate sensitivity. No viable tachyzoite were detected in the culture of MDCK and McCoy cell lines. These results demonstrate that MA-104 and SW742 cells present adequate susceptibility to N. caninum compared to Vero cells, which have been largely used to multiply the parasite in vitro. Moreover, these have easy manipulation, fast multiplication and relatively low nutritional requirements. In addition, the result of this study showed that TLI cell line as a suspension cell culture is susceptible to Nc-1 tachyzoites infection and could be used as an alternative host cell line for tachyzoites culture in vitro studies.

Receptor-binding properties of modern human influenza viruses primarily isolated in Vero and MDCK cells and chicken embryonated eggs

International Nuclear Information System (INIS)

Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai

2003-01-01

To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses

Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

Energy Technology Data Exchange (ETDEWEB)

Conceição, R.A. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil); Ludovico, M.S. [Departamento de Microbiologia, Universidade Estadual de Londrina, Londrina, PR (Brazil); Andrade, C.G.T.J. [Departamento de Biologia Geral, Universidade Estadual de Londrina, Londrina, PR (Brazil); Yano, T. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil)

2012-04-13

The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 10{sup 7} CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.

A comparison of indirect immunofluorescence and electron microscopy for the diagnosis of some haemorrhagic viruses in cell cultures.

Science.gov (United States)

El Mekki, A A; van der Groen, G

1981-09-01

Yellow fever, dengue (types 1, 2 and 4), Chikungunya, Rift Valley fever, Ebola, Marburg, and Lassa viruses were inoculated into susceptible cell cultures and daily investigated by indirect immunofluorescence (IFA) and electron microscopy (EM) with a view to achieve an early detection-identification of these agents. Compared to the other cell lines tested (Vero, BHK-21 and Aedes albopictus), CV-1 cells were found to be more sensitive. Viral antigens were detected by IFA from a few hours post inoculation (CHIK and RVF) to a maximum of 3 days (YF and EBO). For most of the viruses studied, the cytopathic effect (CPE) commenced 2-3 days after the detection of viral antigens. Virus particles were detected by EM only in the case of EBO, MBG and LAS, before any CPE was observed in cell cultures.

A Cell Culture Model of Latent and Lytic Herpes Simplex Virus Type 1 Infection in Spiral Ganglion.

Science.gov (United States)

Liu, Yuehong; Li, Shufeng

2015-01-01

Reactivation of latent herpes simplex virus type 1 (HSV-1) in spiral ganglion neurons (SGNs) is supposed to be one of the causes of idiopathic sudden sensorineural hearing loss. This study aims to establish a cell culture model of latent and lytic HSV-1 infection in spiral ganglia. In the presence of acyclovir, primary cultures of SGNs were latently infected with HSV-1 expressing green fluorescent protein. Four days later, these cells were treated with trichostatin A (TSA), a known chemical reactivator of HSV-1. TCID50 was used to measure the titers of virus in cultures on Vero cells. RNA from cultures was detected for the presence of transcripts of ICP27 and latency-associated transcript (LAT) using reverse transcription polymerase chain reaction. There is no detectable infectious HSV-1 in latently infected cultures, whereas they could be observed in both lytically infected and latently infected/TSA-treated cultures. LAT was the only detectable transcript during latent infection, whereas lytic ICP27 transcript was detected in lytically infected and latently infected/TSA-treated cultures. Cultured SGNs can be both latently and lytically infected with HSV-1. Furthermore, latently infected SGNs can be reactivated using TSA, yielding infectious virus.

Dynamics of actin-based movement by Rickettsia rickettsii in vero cells.

Science.gov (United States)

Heinzen, R A; Grieshaber, S S; Van Kirk, L S; Devin, C J

1999-08-01

Actin-based motility (ABM) is a virulence mechanism exploited by invasive bacterial pathogens in the genera Listeria, Shigella, and Rickettsia. Due to experimental constraints imposed by the lack of genetic tools and their obligate intracellular nature, little is known about rickettsial ABM relative to Listeria and Shigella ABM systems. In this study, we directly compared the dynamics and behavior of ABM of Rickettsia rickettsii and Listeria monocytogenes. A time-lapse video of moving intracellular bacteria was obtained by laser-scanning confocal microscopy of infected Vero cells synthesizing beta-actin coupled to green fluorescent protein (GFP). Analysis of time-lapse images demonstrated that R. rickettsii organisms move through the cell cytoplasm at an average rate of 4.8 +/- 0.6 micrometer/min (mean +/- standard deviation). This speed was 2.5 times slower than that of L. monocytogenes, which moved at an average rate of 12.0 +/- 3.1 micrometers/min. Although rickettsiae moved more slowly, the actin filaments comprising the actin comet tail were significantly more stable, with an average half-life approximately three times that of L. monocytogenes (100.6 +/- 19.2 s versus 33.0 +/- 7.6 s, respectively). The actin tail associated with intracytoplasmic rickettsiae remained stationary in the cytoplasm as the organism moved forward. In contrast, actin tails of rickettsiae trapped within the nucleus displayed dramatic movements. The observed phenotypic differences between the ABM of Listeria and Rickettsia may indicate fundamental differences in the mechanisms of actin recruitment and polymerization.

Role of trypsin in the replication of Avian metapneumovirus subtype C (strain MN-2a) and its entry into the Vero cells.

Science.gov (United States)

Paudel, Sarita; Shin, Hyun-Jin

2015-12-01

To understand the molecular mechanisms of Avian metapneumovirus (aMPV) and the requirements involved in the infection and fusion, trypsin treatment was done in the different stages of virus; before infection, during entry and after virus infection followed by aMPV infection. The growth kinetics of aMPV was compared in time dependent manner. The effect of trypsin was found in the later stage of aMPV infection increasing the numbers of infected cells with the significant higher titer of infectious virions to that of trypsin treated before infection, during entry and aMPV. A serine protease inhibitor reduced aMPV replication in a significant way, whereas cysteine peptidase (E-64), aspartic protease (pepstatin A), and metalloprotease (phosphoramidon) inhibitors had no effect on aMPV replication. Inoculation of aMPV on Vero cells expressing the membrane-associated protease TMPRSS2 resulted in higher virus titers than that inoculated on normal Vero cells and is statistically significant (p < 0.05). Also, an inhibitor of clathrin/caveolae-mediated endocytosis had no effect on virus progeny, indicating that aMPV does not use the endocytic pathway for entry but undergoes direct fusion. The effect of lysosomotropic agents was not significant, suggesting that aMPV does not require low-pH environment in endosomes to fuse its envelope with the plasma membrane. Copyright © 2015 Elsevier Ltd. All rights reserved.

VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

Directory of Open Access Journals (Sweden)

Laura Lafon-Hughes

2014-10-01

Full Text Available Poly-ADP-ribose (PAR is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs and degraded by poly-ADP-ribose-glycohydrolase (PARG. Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair. Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt. In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO. PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications.

Identification of Contaminated Cells with Viruses, Bacteria, or Fungi by Fourier Transform Infrared Microspectroscopy

Directory of Open Access Journals (Sweden)

V. Erukhimovitch

2013-01-01

Full Text Available Fourier transform infrared microspectroscopy (FTIR-M can detect small molecular changes in cells and therefore was previously applied for the identification of different biological samples. In the present study, FTIR spectroscopy was used for the identification and discrimination of Vero cells infected with herpes viruses or contaminated with bacteria or fungi in cell culture. Vero cells in culture were infected herpes simplex virus type 1 (HSV-1 or contaminated with E. coli bacteria or Candida albicans fungi and analyzed by FTIR microscopy at 24 h postinfection/contamination. Specific different spectral changes were observed according to the infecting or contaminating agent. For instance, both pure fungi and cell culture contaminated with this fungi showed specific peaks at 1030 cm−1 and at 1373 cm−1 regions, while pure E. coli and cell culture contaminated with this bacteria showed a specific and unique peak at 1657 cm−1. These results support the potential of developing FTIR microspectroscopy as a simple, reagent free method for identification and discrimination between different tissue infection or contamination with various pathogens.

Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

Science.gov (United States)

Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

2016-08-02

In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

Capture of cell culture-derived influenza virus by lectins: strain independent, but host cell dependent.

Science.gov (United States)

Opitz, Lars; Zimmermann, Anke; Lehmann, Sylvia; Genzel, Yvonne; Lübben, Holger; Reichl, Udo; Wolff, Michael W

2008-12-01

Strategies to control influenza outbreaks are focused mainly on prophylactic vaccination. Human influenza vaccines are trivalent blends of different virus subtypes. Therefore and due to frequent antigenic drifts, strain independent manufacturing processes are required for vaccine production. This study verifies the strain independency of a capture method based on Euonymus europaeus lectin-affinity chromatography (EEL-AC) for downstream processing of influenza viruses under various culture conditions propagated in MDCK cells. A comprehensive lectin binding screening was conducted for two influenza virus types from the season 2007/2008 (A/Wisconsin/67/2005, B/Malaysia/2506/2004) including a comparison of virus-lectin interaction by surface plasmon resonance technology. EEL-AC resulted in a reproducible high product recovery rate and a high degree of contaminant removal in the case of both MDCK cell-derived influenza virus types demonstrating clearly the general applicability of EEL-AC. In addition, host cell dependency of EEL-AC was studied with two industrial relevant cell lines: Vero and MDCK cells. However, the choice of the host cell lines is known to lead to different product glycosylation profiles. Hence, altered lectin specificities have been observed between the two cell lines, requiring process adaptations between different influenza vaccine production systems.

Vero cell technology for rapid development of inactivated whole virus vaccines for emerging viral diseases.

Science.gov (United States)

Barrett, P Noel; Terpening, Sara J; Snow, Doris; Cobb, Ronald R; Kistner, Otfried

2017-09-01

Rapid development and production of vaccines against emerging diseases requires well established, validated, robust technologies to allow industrial scale production and accelerated licensure of products. Areas covered: A versatile Vero cell platform has been developed and utilized to deliver a wide range of candidate and licensed vaccines against emerging viral diseases. This platform builds on the 35 years' experience and safety record with inactivated whole virus vaccines such as polio vaccine. The current platform has been optimized to include a novel double inactivation procedure in order to ensure a highly robust inactivation procedure for novel emerging viruses. The utility of this platform in rapidly developing inactivated whole virus vaccines against pandemic (-like) influenza viruses and other emerging viruses such as West Nile, Chikungunya, Ross River and SARS is reviewed. The potential of the platform for development of vaccines against other emerging viruses such as Zika virus is described. Expert commentary: Use of this platform can substantially accelerate process development and facilitate licensure because of the substantial existing data set available for the cell matrix. However, programs to provide vaccines against emerging diseases must allow alternative clinical development paths to licensure, without the requirement to carry out large scale field efficacy studies.

Process analytical technology (PAT) in insect and mammalian cell culture processes: dielectric spectroscopy and focused beam reflectance measurement (FBRM).

Science.gov (United States)

Druzinec, Damir; Weiss, Katja; Elseberg, Christiane; Salzig, Denise; Kraume, Matthias; Pörtner, Ralf; Czermak, Peter

2014-01-01

Modern bioprocesses demand for a careful definition of the critical process parameters (CPPs) already during the early stages of process development in order to ensure high-quality products and satisfactory yields. In this context, online monitoring tools can be applied to recognize unfavorable changes of CPPs during the production processes and to allow for early interventions in order to prevent losses of production batches due to quality issues. Process analytical technologies such as the dielectric spectroscopy or focused beam reflectance measurement (FBRM) are possible online monitoring tools, which can be applied to monitor cell growth as well as morphological changes. Since the dielectric spectroscopy only captures cells with intact cell membranes, even information about dead cells with ruptured or leaking cell membranes can be derived. The following chapter describes the application of dielectric spectroscopy on various virus-infected and non-infected cell lines with respect to adherent as well as suspension cultures in common stirred tank reactors. The adherent mammalian cell lines Vero (African green monkey kidney cells) and hMSC-TERT (telomerase-immortalized human mesenchymal stem cells) are thereby cultured on microcarrier, which provide the required growth surface and allow the cultivation of these cells even in dynamic culture systems. In turn, the insect-derived cell lines S2 and Sf21 are used as examples for cells typically cultured in suspension. Moreover, the FBRM technology as a further monitoring tool for cell culture applications has been included in this chapter using the example of Drosophila S2 insect cells.

Konsentrasi Aman Kurkumin dan PGV-0 terhadap Sel Vero Berdasarkan Hasil Uji Sitotoksik

Directory of Open Access Journals (Sweden)

Dewi Marbawati

2015-08-01

Full Text Available Curcumin (1,7-bis(3-methoxyphenyl 4'hidroksi -1.6 heptadien, 3,5-dione is the yellow pigment of Curcuma longa. Curcumin has various biological activities such as antioxidant, antibacterial, antifungal, antiprotozoal and antivirus. Various benefits of curcumin can not be separated from the weakness which is not stable to pH and light. Pentagamavunon-0 (PGV-0 were made by changing the β diketone group on cluster analog of curcumin into monoketon while eliminating active methylene group so it is more stable to pH and light. PGV-0 also has potential as a stronger antioxidant and antiinflammatory agent than other curcumin analogues. The objective of this research was to determine the safe concentrations of curcumin and PGV-0 on vero cells due to the increased use of the two compounds through the cytotoxic test. This research includes experimental research. Cytotoxic test performed with microculture tetrazolium technique (MTT method. Use of MTT to evaluate the cytotoxic is based on changes of tetrazolium salt into formazan crystals by mitochondrial enzyme succinate dehydrogenase with the help of cellular NADH. The results showed that the safe concentrations of curcumin and PGV-0 on vero cells respectively are 6.25 and 1.5625 ppm. Based on the cytotoxic test the secure concentration of curcumin was higher than PGV-0.

Host DNA synthesis-suppressing factor in culture fluid of tissue cultures infected with measles virus

International Nuclear Information System (INIS)

Minagawa, T.; Nakaya, C.; Iida, H.

1974-01-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)

Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

International Nuclear Information System (INIS)

Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

1987-01-01

The rates of bicarbonate-dependent uptake and efflux of 22 Na + in Vero cells were studied and compared with the uptake and efflux of 36 Cl - . Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na + was much less affected by changes in pH. The bicarbonate-linked uptake of 22 Na + was dependent on internal Cl- but not on internal Na + . At a constant external concentration of HCO 3 -, the amount of 22 Na + associated with the cells increased when the internal concentration of HCO 3 - decreased and vice versa, which is compatible with the possibility that the ion pair NaCO 3 - is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of 36 Cl - both in the absence and presence of Na + . At alkaline internal pH, HCO 3 - stimulated the efflux of 36 Cl - from preloaded cells, while at acidic internal pH both Na + and HCO 3 - were required to induce 36 Cl - efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane

Evaluation of safety of Hammada salicornica in cell culture

Directory of Open Access Journals (Sweden)

F. Hosseini Hamedani

2017-11-01

Full Text Available Background and objectives: A pharmaceutical products that is planned to be used in clinic, should not only have beneficial effects but also be safe too. Preclinical studies in animals are costly and need considering ethical issues. Cell culture can be used before animal tests. Considering useful effects of these methods, we have evaluated safety of total methanol extract of Hammada salicornica and its aqueous and petroleum ether fractions in cell culture.Methods: Total methanol extract was prepared with the standard method of maceration. Different fractions were prepared by liquid-liquid fractionation and the extracts were then dried with rotary evaporator. After determination of bactericidal concentration of the extracts, 400 ug/mL, the cytotoxicity was tested at various concentrations regarding the minimum antibacterial concentration by MTT test. Hep-2c and VERO cell lines were used in MTT test. A range of concentrations (10-500 ug/mL of the extracts were prepared and were added to about 70% confluent 96 well plates. After exposure for 48 h, MTT solution was added to the wells, and 4 h later formazan crystals were solubilized and optical densities were read at 570 nm. Results: Cytotoxicity Index was calculated and significance test was performed using t-test comparing the Index of the test and control group at each concentration. No significant difference was observed. Conclusion: Various fractions of H. salicornica were not cytotoxic at concentrations above bactericidal concentrations (up to 500 ug/mL. The results need to be confirmed in animal studies before using in human subjects.

Buffalo (Bubalus bubalis in vitro embryo production in two different defined culture media

Directory of Open Access Journals (Sweden)

B. Gasparrini

2011-03-01

Full Text Available In vitro embryo production (IVEP is largely applied world wide to animal breeding. One of the principal steps of the IVEP is represented by embryo culture (Khurana and Niemann., 2000. In the past, embryos were grown in co-culture systems with other cells such as oviductal epithelial cells, cumulus cells, Buffalo rat liver (BRL and VERO cells (Duszewska et al., 2000. These cells are able to supply the nutrients for embryo development by their replication and metabolism. Nevertheless, the metabolic activity of these cells is also responsible of an early lowering of pH in the culture medium: that needs to be changed every two days. Furthermore, with this culture system it is impossible to standardize all the procedure: in fact the result is dependent from several variables, as the quality of the cells and their concentration in co-culture. The use of defined culture media is necessary to acquire a better comprehension of metabolism and biochemical requirements for IVEP........

[Cytotoxic effect of physalis peruviana in cell culture of colorectal and prostate cancer and chronic myeloid leukemia].

Science.gov (United States)

Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham

2009-01-01

The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.

Standardization and assessment of cell culture media quantities in roller poly ethylene terephthalate bottles employed in the industrial rabies viral vaccine production.

Science.gov (United States)

Jagannathan, S; Chaansha, S; Rajesh, K; Santhiya, T; Charles, C; Venkataramana, K N

2009-09-15

Vero cells are utilized for production of rabies vaccine. This study deals with the optimize quantity media require for the rabies vaccine production in the smooth roller surface. The rabies virus (Pasteur vaccine strain) is infected to monolayer of the various experimented bottles. To analyze the optimal quantity of media for the production of rabies viral harvest during the process of Vero cell derived rabies vaccine. The trials are started from 200 to 400 mL (PTARV-1, PTARV-2, PTARV-3, PTARV-4 and PTARV-5). The samples are taken in an appropriate time intervals for analysis of In Process Quality Control (IPQC) tests. The collected viral harvests are further processed to rabies vaccine in a pilot level and in addition to scale up an industrial level. Based on the evaluation the PTARV-2 (250 mL) show highly encouraging results for the Vero cell derived rabies vaccine production.

SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

International Nuclear Information System (INIS)

Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S

2014-01-01

Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit

Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

Science.gov (United States)

Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

2017-11-01

Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

Directory of Open Access Journals (Sweden)

Yamaguchi Ryoji

2009-10-01

Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

Antibody titers in animal bite victims after post exposure vaccination with intradermally administered purified vero cell rabies vaccine using modified thai red cross regimen

International Nuclear Information System (INIS)

Hafeez, S.; Tahir, Z.

2014-01-01

To determine the seroconversion following rabies vaccination by intradermal route in cases of animal bite attending Anti rabies center, Lahore for post exposure prophylaxis. Study Design: Cross sectional descriptive study. Place and Duration: Antirabies center, Birdwood road Lahore, Microbiology laboratory, office of Bacteriologist, Government of Punjab, Lahore. Patients and Methods: Victims of all ages and both sexes having exposure with suspected rabid animal within 24 - 72 hours were included, fulfilling inclusion and exclusion criteria, over 3 months period from February to April 20. Patients of Category II and III wounds were included. Purified vero cell vaccine (PVR V) with antigenic content> 2.5 ml was used for intradermal vaccination according to modified Thai Red Cross regimen (2-2-2-0-2). Each victim received 0.1 ml intradermal dose on each deltoid on day 0, 3, 7 and 28th day of bite. Blood samples from victims were taken on day 0, 14 and 35. Antibody titers were estimated by ELISA kit. Results: Fifty cases were studied including 20 children. Male female ratio was 4:1. Optimum serocon version (> 0.5 IU/ml) was achieved in all cases by day 14. Antibody levels increased further (> 4 IV/ml) in 92% cases on day 35. Geometric mean titers were 3.2 IU/ml and 6.2 IU/ml on day 14 and 35 respectively. Conclusion: Intradermal route for cell culture rabies vaccine for postexposure prophylaxis in animal bite victims was efficacious and safe. The smaller dosage of vaccine was economically affordable by patients in referral centers. (author)

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

International Nuclear Information System (INIS)

Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H

2016-01-01

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

Energy Technology Data Exchange (ETDEWEB)

Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)

2016-06-15

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

Accumulation of a soluble form of human nectin-2 is required for exerting the resistance against herpes simplex virus type 2 infection in transfected cells.

Science.gov (United States)

Fujimoto, Y; Ozaki, K; Iwamori, N; Takakuwa, H; Ono, E

2016-03-01

Cell entry of herpes simplex virus type 2 (HSV-2) requires the interaction of viral glycoprotein D (gD) with the receptor nectin-1 and herpesvirus entry mediator (HVEM). In addition, it is known that nectin-2 is also functional as a receptor for HSV-2, although the binding to the gD is weak. To examine an antiviral potential of a soluble form of human nectin-2 (hNectin-2Ig), transfected Vero cells expressing the entire ectodomain of nectin-2 fused to the Fc portion of human IgG were established. Specific binding of hNectin-2Ig to HSV-2 gD was confirmed by ELISA. Competitive ELISA demonstrated that accumulation of hNectin-2Ig in transfected cells increased significantly in a cell culture time dependent manner. Viral growth of several HSV-2 strains was significantly inhibited in the transfected cells that were cultured for 72 hr compared with control Vero cells, but not in cells that were cultured for 24 hr. These results indicate that accumulation of a soluble form of nectin-2 is required for exerting the resistance against HSV-2 infection.

Effect of cell culture system on the production of human viral antigens Efeito do sistema de cultura celular na produção de antígenos virais humanos

Directory of Open Access Journals (Sweden)

Ronaldo Zucatelli Mendonça

2004-06-01

Full Text Available A comparative study was performed in the production of different viral antigens by using microcarrier systems and traditional systems. Vero, BHK and MA 104 cells were cultivated in microcarriers (2mg/ml using a bioreactor with a working capacity of 3.7 liters, in parallel with conventional Roux bottles. After four days (BHK cells, and seven days of culture (Vero and MA-104 cells, the cells were infected with 0.1 MOI (multiplicity of infection of rabies virus, measles virus, poliovirus and rotavirus. The yields of the cells and virus in microcarriers and in the conventional system were determined. It was observed that in the microcarrier system, an average increase of twenty-fold more cells/ml was obtained in relation to the conventional monolayer culture, using Roux bottle. On the other hand, cells grown in Roux bottles presented 1.3 to 6.7 more viruses/ml culture than those in the microcarrier systems. However, the overall data showed that yieldings, in terms of viruses per batch, were statistically similar for both systems (p > 0.05. The amount of viral antigen production seems to depend not only on cell concentration, but also on other culture factors such as the characteristic of the cell-growth surface. Thus, the present findings provide a baseline for further improvements and strategies to be established for a scaling-up virus production since depending on the type of virus the optimal conditions found for a small-scale virus production seem unsuitable for large-scale production, requiring new standardization and evaluation.Foi realizado estudo comparativo na produção de diferentes antígenos virais usando sistema de microcarregador e sistema tradicional. Células Vero, BHK e MA-104 foram cultivadas em microcarregadores (2mg/ml utilizando-se biorreatores com capacidade de 3,7 litros e, em paralelo, no sistema convencional com garrafas Roux. Após quatro dias de cultura para as células BHK e sete dias para as células Vero e MA-104, as c

Insect Cell Culture

NARCIS (Netherlands)

Oers, van M.M.; Lynn, D.E.

2010-01-01

Insect cell cultures are widely used in studies on insect cell physiology, developmental biology and microbial pathology. In particular, insect cell culture is an indispensable tool for the study of insect viruses. The first continuously growing insect cell cultures were established from

Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study

Science.gov (United States)

Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon

2016-12-01

The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.

77 FR 42425 - Amendment of Air Traffic Service (ATS) Routes in the Vicinity of Vero Beach, FL

Science.gov (United States)

2012-07-19

...This action amends the legal descriptions of Jet Routes J-45 and J-79, and VHF omnidirectional range (VOR) Federal airways V-3, V-51, V-159, V-225, V-295 and V-537, in the vicinity of Vero Beach, FL. The FAA is taking this action because the name of the Vero Beach, FL, VOR Tactical Air Navigation (VORTAC) facility, which is included in the descriptions of the above routes, is being changed to the Treasure VORTAC.

Eficiencia de cultivo in vitro de Toxoplasma gondii en las líneas celulares THP1 y Vero

Directory of Open Access Journals (Sweden)

Jorge Andrés Cuellar

2012-03-01

Full Text Available Introducción. El cultivo in vitro es un método importante para la obtención de Toxoplasma gondii confines de diagnóstico clínico o biotecnológico. Objetivo. Determinar el porcentaje de invasión y producción de T. gondii en las líneas celulares THP1y Vero. Materiales y métodos. Se determinó la curva de crecimiento para las células Vero y THP1 por conteoen hemocitómetro. Posteriormente, se identificó el porcentaje de invasión de T. gondii en células THP1y Vero por citometría de flujo, en diferentes proporciones célula/taquizoíto de 1/5, 1/20, 1/50. Por otrolado, se calculó el índice de rendimiento de T. gondii, cepa RH, y del aislamiento CIBM1 en célulasTHP1. Resultados. Las células Vero crecen más rápidamente que las células THP1, con un crecimientoexponencial en un periodo de siete días. El aislamiento CIBM1 infecta las células THP1 en las tresproporciones diferentes de 1/5,1/20 y 1/50 con porcentajes de invasión de 57,1 %, 15,5 % y 12,2 %, yen células Vero, de 25,3 %, 17,8 % y 8,8 %. La cepa RH de T. gondii mostró porcentajes de invasiónmás bajos, de 32,6 %, 14,8 % y 8,1 % en células THP1 y de 22,3 %, 14,1 % y 3,4 % en células Vero. Conclusiones. El aislamiento CIBM1 presentó mayor rendimiento con respecto a la cepa RH de T.gondii en células THP1, siendo estas células una buena línea para estudiar el proceso de invasión yprobar candidatos farmacológicos para reducir la infección por T. gondii.   doi: http://dx.doi.org/10.7705/biomedica.v32i3.485

Alteration of cell cycle progression by Sindbis virus infection

Energy Technology Data Exchange (ETDEWEB)

Yi, Ruirong; Saito, Kengo [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Isegawa, Naohisa [Laboratory Animal Center, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Shirasawa, Hiroshi, E-mail: sirasawa@faculty.chiba-u.jp [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan)

2015-07-10

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.

Alteration of cell cycle progression by Sindbis virus infection

International Nuclear Information System (INIS)

Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi

2015-01-01

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G 1 phase preferred to proliferate during S/G 2 phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G 1 phase than in cells infected during S/G 2 phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases

Porcine Epidemic Diarrhea Virus 3C-Like Protease-Mediated Nucleocapsid Processing: Possible Link to Viral Cell Culture Adaptability.

Science.gov (United States)

Jaru-Ampornpan, Peera; Jengarn, Juggragarn; Wanitchang, Asawin; Jongkaewwattana, Anan

2017-01-15

Porcine epidemic diarrhea virus (PEDV) causes severe diarrhea and high mortality rates in newborn piglets, leading to massive losses to the swine industry worldwide during recent epidemics. Intense research efforts are now focusing on defining viral characteristics that confer a growth advantage, pathogenicity, or cell adaptability in order to better understand the PEDV life cycle and identify suitable targets for antiviral or vaccine development. Here, we report a unique phenomenon of PEDV nucleocapsid (N) cleavage by the PEDV-encoded 3C-like protease (3Cpro) during infection. The identification of the 3Cpro cleavage site at the C terminus of N supported previous observations that PEDV 3Cpro showed a substrate requirement slightly different from that of severe acute respiratory syndrome coronavirus (SARS-CoV) 3Cpro and revealed a greater flexibility in its substrate recognition site. This cleavage motif is present in the majority of cell culture-adapted PEDV strains but is missing in emerging field isolates. Remarkably, reverse-genetics-derived cell culture-adapted PEDV AVCT12 harboring uncleavable N displayed growth retardation in Vero E6-APN cells compared to the wild-type virus. These observations altogether shed new light on the investigation and characterization of the PEDV nucleocapsid protein and its possible link to cell culture adaptation. Recurrent PEDV outbreaks have resulted in enormous economic losses to swine industries worldwide. To gain the upper hand in combating this disease, it is necessary to understand how this virus replicates and evades host immunity. Characterization of viral proteins provides important clues to mechanisms by which viruses survive and spread. Here, we characterized an intriguing phenomenon in which the nucleocapsids of some PEDV strains are proteolytically processed by the virally encoded main protease. Growth retardation in recombinant PEDV carrying uncleavable N suggests a replication advantage provided by the cleavage

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

Energy Technology Data Exchange (ETDEWEB)

Clark, Kristina B. [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); Hsiao, Hui-Mien; Bassit, Leda [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Crowe, James E. [Departments of Pediatrics, Pathology, Microbiology, and Immunology, Vanderbilt University, Nashville, TN (United States); Schinazi, Raymond F. [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Perng, Guey Chuen [Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Villinger, Francois [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); New Iberia Research Center, University of Louisiana at Lafayette, New Iberia, LA (United States)

2016-06-15

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

International Nuclear Information System (INIS)

Clark, Kristina B.; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E.; Schinazi, Raymond F.; Perng, Guey Chuen; Villinger, Francois

2016-01-01

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

A low-cost method to test cytotoxic effects of Crotalus vegrandis (Serpentes: Viperidae venom on kidney cell cultures Un método de bajo costo para probar los efectos citotóxicos del veneno de Crotalus vegrandis (Serpentes: Viperidae en cultivos de células renales

Directory of Open Access Journals (Sweden)

María E. Girón

2005-06-01

Full Text Available The pathogenesis of the renal lesion upon envenomation by snakebite has been related to myolysis, hemolysis, hypotension and/or direct venom nephrotoxicity caused by the venom. Both primary and continuous cell culture systems provide an in vitro alternative for quantitative evaluation of the toxicity of snake venoms. Crude Crotalus vegrandis venom was fractionated by molecular exclusion chromatography. The toxicity of C. vegrandis crude venom, hemorrhagic, and neurotoxic fractions were evaluated on mouse primary renal cells and a continuous cell line of Vero cells maintained in vitro. Cells were isolated from murine renal cortex and were grown in 96 well plates with Dulbecco's Modified Essential Medium (DMEM and challenged with crude and venom fractions. The murine renal cortex cells exhibited epithelial morphology and the majority showed smooth muscle actin determined by immune-staining. The cytotoxicity was evaluated by the tetrazolium colorimetric method. Cell viability was less for crude venom, followed by the hemorrhagic and neurotoxic fractions with a CT50 of 4.93, 18.41 and 50.22 µg/mL, respectively. The Vero cell cultures seemed to be more sensitive with a CT50 of 2.9 and 1.4 µg/mL for crude venom and the hemorrhagic peak, respectively. The results of this study show the potential of using cell culture system to evaluate venom toxicity.La patogénesis de la lesion renal ha sido relacionada a la miolisis, hemólisis, hipotensión y/o el efecto directo del veneno. Tanto el cultivo primario o el cultivo celular continuo proveen una alternativa in vitro para la evaluación cuantitativa de la toxicidad de venenos de serpiente. El veneno crudo de Crotalus vegrandis fue fraccionado por una cromatografía de exclusión molecular. La toxicidad del veneno crudo de C. vegrandis, sus fracciones hemorrágicas y neurotóxicas fueron evaluadas en células renales primarias de ratón y una línea continua de células Vero mantenidas in vitro. Las c

Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

Science.gov (United States)

Stampfer, Martha R; Garbe, James C

2015-02-24

Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

DETECTION OF HUMAN ANTI-ZIKA VIRUS IgG BY ELISA USING AN ANTIGEN FROM in vitro INFECTED VERO CELLS: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

Laura Masami SUMITA

Full Text Available SUMMARY Zika virus (ZKV infection is a huge public health problem in Brazil because of the increased incidence of microcephaly in neonates from infected mothers. Detection of specific IgG antibodies in maternal serum samples constitutes an important approach for diagnosing ZKV infection and evaluating its relationship with neonatal microcephaly. However, as there is no serological test produced in Brazil to detect IgM and IgG antibodies against ZKV, we sought to examine specific IgG in serum samples from patients or suspected mothers to detect previous infection and to test for specificity with regard to flaviviral infections occurring in the same area. Brazilian Zika virus native antigens were obtained from infected Vero cell layers or free virions in the culture medium and then used in ELISA. We tested sera from eight ZKV RNA-diagnosed infected patients (ZKVR, seven neonates with microcephaly and their mothers after delivery (MM, 140 dengue virus IgM-positive (DM and IgG (DG-positive patients, and 100 yellow fever (YF-vaccinated patients. According to the ELISA, ZKVR samples were mostly positive (7/8, and all the MM serum samples were positive for ZKV IgG (7/7. In contrast, cross-reactions for dengue or yellow fever-vaccinated patients were observed, including DM (48/95, DG (10/45 or YF (3/100 serum samples; however, these cross-reactions exhibited low antigen avidity so that 6 M urea largely removed this cross-reactivity, with only a few cross-reacting samples remaining (8/140. ELISA based on extracted virions was much more specific, with all ZKVR (8/8 and MM sera being positive for ZKV IgG (7/7 and only borderline cross-reactivity found for DM (6/95, DG (3/45 or YF (4/100-vaccinated serum samples. This technique (ELISA can identify specific IgG in ZKV-infected patients and may be helpful in diagnosing congenital infetions after maternal RNA virus clearance or in epidemiological studies.

Production of high titer attenuated poliovirus strains on the serum-free PER.C6(®) cell culture platform for the generation of safe and affordable next generation IPV.

Science.gov (United States)

Sanders, Barbara P; Oakes, Isabel de los Rios; van Hoek, Vladimir; Liu, Ying; Marissen, Wilfred; Minor, Philip D; Wimmer, Eckard; Schuitemaker, Hanneke; Custers, Jerome H H V; Macadam, Andrew; Cello, Jeronimo; Edo-Matas, Diana

2015-11-27

As poliovirus eradication draws closer, alternative Inactivated Poliovirus Vaccines (IPV) are needed to overcome the risks associated with continued use of the Oral Poliovirus Vaccine and of neurovirulent strains used during manufacture of conventional (c) IPV. We have previously demonstrated the susceptibility of the PER.C6(®) cell line to cIPV strains; here we investigated the suspension cell culture platform for growth of attenuated poliovirus strains. We examined attenuated Sabin strain productivity on the PER.C6(®) cell platform compared to the conventional Vero cell platform. The suitability of the suspension cell platform for propagation of rationally-attenuated poliovirus strains (stabilized Sabin type 3 S19 derivatives and genetically attenuated and stabilized MonoCre(X) strains), was also assessed. Yields were quantified by infectious titer determination and D-antigen ELISA using either serotype-specific polyclonal rabbit sera for Sabin strains or monoclonal cIPV-strain-specific antibodies for cIPV, S19 and MonoCre(X) strains. PER.C6(®) cells supported the replication of Sabin strains to yields of infectious titers that were in the range of cIPV strains at 32.5°C. Sabin strains achieved 30-fold higher yields (pSabin strain productivity on the PER.C6(®) cell platform was maintained at 10l scale. Yields of infectious titers of S19 and MonoCre(X) strains were 0.5-1 log10 lower than seen for cIPV strains, whereas D-antigen yield and productivities in doses/ml using rationally-attenuated strains were in line with yields reported for cIPV strains. Sabin and rationally-attenuated polioviruses can be grown to high infectious titers and D-antigen yields. Sabin strain infection shows increased productivity on the PER.C6(®) cell platform as compared to the conventional Vero cell platform. Novel cell platforms with the potential for higher yields could contribute to increased affordability of a next generation of IPV vaccines needed for achieving and

Evaluation of different continuous cell lines in the isolation of mumps virus by the shell vial method from clinical samples

Science.gov (United States)

Reina, J; Ballesteros, F; Mari, M; Munar, M

2001-01-01

Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211

Zika Virus Exhibits Lineage-Specific Phenotypes in Cell Culture, in Aedes aegypti Mosquitoes, and in an Embryo Model

Directory of Open Access Journals (Sweden)

Katherine A. Willard

2017-12-01

Full Text Available Zika virus (ZIKV has quietly circulated in Africa and Southeast Asia for the past 65 years. However, the recent ZIKV epidemic in the Americas propelled this mosquito-borne virus to the forefront of flavivirus research. Based on historical evidence, ZIKV infections in Africa were sporadic and caused mild symptoms such as fever, skin rash, and general malaise. In contrast, recent Asian-lineage ZIKV infections in the Pacific Islands and the Americas are linked to birth defects and neurological disorders. The aim of this study is to compare replication, pathogenicity, and transmission efficiency of two historic and two contemporary ZIKV isolates in cell culture, the mosquito host, and an embryo model to determine if genetic variation between the African and Asian lineages results in phenotypic differences. While all tested isolates replicated at similar rates in Vero cells, the African isolates displayed more rapid viral replication in the mosquito C6/36 cell line, yet they exhibited poor infection rates in Aedes aegypti mosquitoes compared to the contemporary Asian-lineage isolates. All isolates could infect chicken embryos; however, infection with African isolates resulted in higher embryo mortality than infection with Asian-lineage isolates. These results suggest that genetic variation between ZIKV isolates can significantly alter experimental outcomes.

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

International Nuclear Information System (INIS)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-01-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of 125 I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of 125 I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies

Perfusion based cell culture chips

DEFF Research Database (Denmark)

Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

2010-01-01

Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

Cell Culture Made Easy.

Science.gov (United States)

Dye, Frank J.

1985-01-01

Outlines steps to generate cell samples for observation and experimentation. The procedures (which use ordinary laboratory equipment) will establish a short-term primary culture of normal mammalian cells. Information on culture vessels and cell division and a list of questions to generate student interest and involvement in the topics are…

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

Energy Technology Data Exchange (ETDEWEB)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-03-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.

A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

DEFF Research Database (Denmark)

Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael

2006-01-01

culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

A biocompatible micro cell culture chamber (microCCC) for the culturing and on-line monitoring of eukaryote cells

DEFF Research Database (Denmark)

Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M

2006-01-01

culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

Purification and characterization of enterovirus 71 viral particles produced from vero cells grown in a serum-free microcarrier bioreactor system.

Directory of Open Access Journals (Sweden)

Chia-Chyi Liu

Full Text Available BACKGROUND: Enterovirus 71 (EV71 infections manifest most commonly as a childhood exanthema known as hand-foot-and-mouth disease (HFMD and can cause neurological disease during acute infection. PRINCIPAL FINDING: In this study, we describe the production, purification and characterization of EV71 virus produced from Vero cells grown in a five-liter serum-free bioreactor system containing 5 g/L Cytodex 1 microcarrier. The viral titer was >10(6 TCID(50/mL by 6 days post infection when a MOI of 10(-5 was used at the initial infection. Two EV71 virus fractions were separated and detected when the harvested EV71 virus concentrate was purified by sucrose gradient zonal ultracentrifugation. The EV71 viral particles detected in the 24-28% sucrose fractions had an icosahedral structure 30-31 nm in diameter and had low viral infectivity and RNA content. Three major viral proteins (VP0, VP1 and VP3 were observed by SDS-PAGE. The EV71 viral particles detected in the fractions containing 35-38% sucrose were 33-35 nm in size, had high viral infectivity and RNA content, and were composed of four viral proteins (VP1, VP2, VP3 and VP4, as shown by SDS-PAGE analyses. The two virus fractions were formalin-inactivated and induced high virus neutralizing antibody responses in mouse immunogenicity studies. Both mouse antisera recognized the immunodominant linear neutralization epitope of VP1 (residues 211-225. CONCLUSION: These results provide important information for cell-based EV71 vaccine development, particularly for the preparation of working standards for viral antigen quantification.

Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

Directory of Open Access Journals (Sweden)

Mary M Melia

Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

Effect of ultrasound on herpes simplex virus infection in cell culture

Directory of Open Access Journals (Sweden)

Iwai Soichi

2011-09-01

Full Text Available Abstract Background Ultrasound has been shown to increase the efficiency of gene expression from retroviruses, adenoviruses and adeno-associated viruses. The effect of ultrasound to stimulate cell membrane permeabilization on infection with an oncolytic herpes simplex virus type 1 (HSV-1 was examined. Results Vero monkey kidney cells were infected with HSV-1 and exposed to 1 MHz ultrasound after an adsorption period. The number of plaques was significantly greater than that of the untreated control. A combination of ultrasound and microbubbles further increased the plaque number. Similar results were obtained using a different type of HSV-1 and oral squamous cell carcinoma (SCC cells. The appropriate intensity, duty cycle and time of ultrasound to increase the plaque number were 0.5 W/cm2, 20% duty cycle and 10 sec, respectively. Ultrasound with microbubbles at an intensity of 2.0 W/cm2, at 50% duty cycle, or for 40 sec reduced cell viability. Conclusion These results indicate that ultrasound promotes the entry of oncolytic HSV-1 into cells. It may be useful to enhance the efficiency of HSV-1 infection in oncolytic virotherapy.

Removal of transmissible spongiform encephalopathy prion from large volumes of cell culture media supplemented with fetal bovine serum by using hollow fiber anion-exchange membrane chromatography.

Science.gov (United States)

Chou, Ming Li; Bailey, Andy; Avory, Tiffany; Tanimoto, Junji; Burnouf, Thierry

2015-01-01

Cases of variant Creutzfeldt-Jakob disease in people who had consumed contaminated meat products from cattle with bovine spongiform encephalopathy emphasize the need for measures aimed at preventing the transmission of the pathogenic prion protein (PrPSc) from materials derived from cattle. Highly stringent scrutiny is required for fetal bovine serum (FBS), a growth-medium supplement used in the production of parenteral vaccines and therapeutic recombinant proteins and in the ex vivo expansion of stem cells for transplantation. One such approach is the implementation of manufacturing steps dedicated to removing PrPSc from materials containing FBS. We evaluated the use of the QyuSpeed D (QSD) adsorbent hollow-fiber anion-exchange chromatographic column (Asahi Kasei Medical, Tokyo, Japan) for the removal of PrPSc from cell culture media supplemented with FBS. We first established that QSD filtration had no adverse effect on the chemical composition of various types of culture media supplemented with 10% FBS or the growth and viability characteristics of human embryonic kidney (HEK293) cells, baby hamster kidney (BHK-21) cells, African green monkey kidney (Vero) cells, and Chinese hamster ovary (CHO-k1) cells propagated in the various culture-medium filtrates. We used a 0.6-mL QSD column for removing PrPSc from up to 1000 mL of Dulbecco's modified Eagle's medium containing 10% FBS previously spiked with the 263K strain of hamster-adapted scrapie. The Western blot analysis, validated alongside an infectivity assay, revealed that the level of PrPSc in the initial 200mL flow-through was reduced by 2.5 to > 3 log10, compared with that of the starting material. These results indicate that QSD filtration removes PrPSc from cell culture media containing 10% FBS, and demonstrate the ease with which QSD filtration can be implemented in at industrial-scale to improve the safety of vaccines, therapeutic recombinant proteins, and ex vivo expanded stem cells produced using growth

Cell Culturing of Cytoskeleton

Science.gov (United States)

2004-01-01

Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc., has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc., is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.

9 CFR 101.6 - Cell cultures.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6..., SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures...

Stability of the glycoprotein gene of avian metapneumovirus (Canada goose isolate 15a/01) after serial passages in cell cultures.

Science.gov (United States)

Chockalingam, Ashok K; Chander, Yogesh; Halvorson, David A; Goyal, Sagar M

2010-06-01

The glycoprotein (G) gene sequences of avian metapneumovirus (aMPV) subtypes A, B, C, and D are variable in size and number of nucleotides. The G gene of early U.S. turkey isolates of aMPV-C have been reported to be 1798 nucleotides (nt) (585 aa) in length, whereas the G genes of more recent turkey isolates have been reported to be 783 nucleotides. In some studies, the G gene of aMPV-C turkey isolates was found to be truncated to a smaller G gene of 783 nt (261 aa) upon serial passages in Vero cells. This is believed to be due to the deletion of 1015 nt near the end of the open reading frame. The purpose of this study was to determine variation, if any, in the G gene of an aMPV-C isolated from a wild bird (Canada goose [Branta canadensis]) following serial passages in Vero cells. No size variation was observed for up to 50 passages, except for a few amino acid changes in the extracellular domain at the 50th passage level. The G gene of this wild bird isolate appears to be unique from subtype C metapneumoviruses of turkeys.

Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms.

Science.gov (United States)

Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T

2016-02-21

The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to +6.0 Gy (CyberKnife: +0.5 Gy to +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to +0.2 mm /-0.8 mm to +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

Infection of epithelial cells with dengue virus promotes the expression of proteins favoring the replication of certain viral strains.

Science.gov (United States)

Martínez-Betancur, Viviana; Marín-Villa, Marcel; Martínez-Gutierrez, Marlén

2014-08-01

Dengue virus (DENV) is the causative agent of dengue and severe dengue. To understand better the dengue virus-host interaction, it is important to determine how the expression of cellular proteins is modified due to infection. Therefore, a comparison of protein expression was conducted in Vero cells infected with two different DENV strains, both serotype 2: DENV-2/NG (associated with dengue) and DENV-2/16681 (associated with severe dengue). The viability of the infected cells was determined, and neither strain induced cell death at 48 hr. In addition, the viral genomes and infectious viral particles were quantified, and the genome of the DENV-2/16681 strain was determined to have a higher replication rate compared with the DENV-2/NG strain. Finally, the proteins from infected and uninfected cultures were separated using two-dimensional gel electrophoresis, and the differentially expressed proteins were identified by mass spectrometry. Compared with the uninfected controls, the DENV-2/NG- and DENV-2/16681-infected cultures had five and six differentially expressed proteins, respectively. The most important results were observed when the infected cultures were compared to each other (DENV-2/NG vs. DENV-2/16681), and 18 differentially expressed proteins were identified. Based on their cellular functions, many of these proteins were linked to the increase in the replication efficiency of DENV. Among the proteins were calreticulin, acetyl coenzyme A, acetyl transferase, and fatty acid-binding protein. It was concluded that the infection of Vero cells with DENV-2/NG or DENV-2/16681 differentially modifies the expression of certain proteins, which can, in turn, facilitate infection. © 2013 Wiley Periodicals, Inc.

Criopreservação de formas de cultura do Trypanosoma cruzi Cryopreservation of Trypanosoma cruzi culture form

Directory of Open Access Journals (Sweden)

Lúcia Maria C. Galvão

1981-09-01

Full Text Available Formas de cultura de diferentes cepas do T.cruzi foram submetidas a vários processos de criopreservação. As percentagens de recuperação, avaliadas pela motilidade dos parasitas, foram consideradas como adequadas com algumas das técnicas empregadas, variando entre 60 a 80%. A estabilidade das características biológicas do material criopreservado foi investigada através do estudo das curvas de crescimento e diferenciação em meio acelular, infectividade para celulas de cultura de tecido ("Vero", diferenciação intracelular em cultura de tecido assim como infectividade e curso da infecção em animais de laboratório. De um modo geral essas características nao foram significativamente alteradas no material congelado e estocado por diferentes períodos de tempo.A systematic study of the cryopreservation of T. cruzi culture forms was per formed using different parasite strains and freezing methods. The recovery rates with some of the methods as evaluated by motility of the thawed parasites were fairly high (60-80%. The following aspects have been used to investigate the stability of the parasites' biological characteristics atter cryopreservation: growth and differentiation in acelular medium, infectivity to tissue culture "Vero" cells, intracellular differentiation and infectivity to animals. Those characteristics had not been significantly changed by the cryopreservation procedures.

Microfluidic cell culture systems for drug research.

Science.gov (United States)

Wu, Min-Hsien; Huang, Song-Bin; Lee, Gwo-Bin

2010-04-21

In pharmaceutical research, an adequate cell-based assay scheme to efficiently screen and to validate potential drug candidates in the initial stage of drug discovery is crucial. In order to better predict the clinical response to drug compounds, a cell culture model that is faithful to in vivo behavior is required. With the recent advances in microfluidic technology, the utilization of a microfluidic-based cell culture has several advantages, making it a promising alternative to the conventional cell culture methods. This review starts with a comprehensive discussion on the general process for drug discovery and development, the role of cell culture in drug research, and the characteristics of the cell culture formats commonly used in current microfluidic-based, cell-culture practices. Due to the significant differences in several physical phenomena between microscale and macroscale devices, microfluidic technology provides unique functionality, which is not previously possible by using traditional techniques. In a subsequent section, the niches for using microfluidic-based cell culture systems for drug research are discussed. Moreover, some critical issues such as cell immobilization, medium pumping or gradient generation in microfluidic-based, cell-culture systems are also reviewed. Finally, some practical applications of microfluidic-based, cell-culture systems in drug research particularly those pertaining to drug toxicity testing and those with a high-throughput capability are highlighted.

Use of an adaptable cell culture kit for performing lymphocyte and monocyte cell cultures in microgravity

Science.gov (United States)

Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.

1998-01-01

The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground

Principles of cancer cell culture.

Science.gov (United States)

Cree, Ian A

2011-01-01

The basics of cell culture are now relatively common, though it was not always so. The pioneers of cell culture would envy our simple access to manufactured plastics, media and equipment for such studies. The prerequisites for cell culture are a well lit and suitably ventilated laboratory with a laminar flow hood (Class II), CO(2) incubator, benchtop centrifuge, microscope, plasticware (flasks and plates) and a supply of media with or without serum supplements. Not only can all of this be ordered easily over the internet, but large numbers of well-characterised cell lines are available from libraries maintained to a very high standard allowing the researcher to commence experiments rapidly and economically. Attention to safety and disposal is important, and maintenance of equipment remains essential. This chapter should enable researchers with little prior knowledge to set up a suitable laboratory to do basic cell culture, but there is still no substitute for experience within an existing well-run laboratory.

Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

International Nuclear Information System (INIS)

Nishiyama, Y.; Rapp, F.

1981-01-01

Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants

Bacterial cell culture

OpenAIRE

sprotocols

2014-01-01

### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

Replication of cultured lung epithelial cells

International Nuclear Information System (INIS)

Guzowski, D.; Bienkowski, R.

1986-01-01

The authors have investigated the conditions necessary to support replication of lung type 2 epithelial cells in culture. Cells were isolated from mature fetal rabbit lungs (29d gestation) and cultured on feeder layers of mitotically inactivated 3T3 fibroblasts. The epithelial nature of the cells was demonstrated by indirect immunofluorescent staining for keratin and by polyacid dichrome stain. Ultrastructural examination during the first week showed that the cells contained myofilaments, microvilli and lamellar bodies (markers for type 2 cells). The following changes were observed after the first week: increase in cell size; loss of lamellar bodies and appearance of multivesicular bodies; increase in rough endoplasmic reticulum and golgi; increase in tonafilaments and well-defined junctions. General cell morphology was good for up to 10 wk. Cells cultured on plastic surface degenerated after 1 wk. Cell replication was assayed by autoradiography of cultures exposed to ( 3 H)-thymidine and by direct cell counts. The cells did not replicate during the first week; however, between 2-10 wk the cells incorporated the label and went through approximately 6 population doublings. They have demonstrated that lung alveolar epithelial cells can replicate in culture if they are maintained on an appropriate substrate. The coincidence of ability to replicate and loss of markers for differentiation may reflect the dichotomy between growth and differentiation commonly observed in developing systems

Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

Science.gov (United States)

An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

2000-01-01

A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

Traditional and Modern Cell Culture in Virus Diagnosis.

Science.gov (United States)

Hematian, Ali; Sadeghifard, Nourkhoda; Mohebi, Reza; Taherikalani, Morovat; Nasrolahi, Abbas; Amraei, Mansour; Ghafourian, Sobhan

2016-04-01

Cell cultures are developed from tissue samples and then disaggregated by mechanical, chemical, and enzymatic methods to extract cells suitable for isolation of viruses. With the recent advances in technology, cell culture is considered a gold standard for virus isolation. This paper reviews the evolution of cell culture methods and demonstrates why cell culture is a preferred method for identification of viruses. In addition, the advantages and disadvantages of both traditional and modern cell culture methods for diagnosis of each type of virus are discussed. Detection of viruses by the novel cell culture methods is considered more accurate and sensitive. However, there is a need to include some more accurate methods such as molecular methods in cell culture for precise identification of viruses.

Molecular characterization of canine distemper vi- rus circulating in ...

African Journals Online (AJOL)

2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

Application of cell co-culture system to study fat and muscle cells.

Science.gov (United States)

Pandurangan, Muthuraman; Hwang, Inho

2014-09-01

Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.

Ebola virus infection inversely correlates with the overall expression levels of promyelocytic leukaemia (PML protein in cultured cells

Directory of Open Access Journals (Sweden)

Szekely Laszlo

2003-04-01

Full Text Available Abstract Background Ebola virus causes severe, often fatal hemorrhagic fever in humans. The mechanism of escape from cellular anti-viral mechanisms is not yet fully understood. The promyelocytic leukaemia (PML associated nuclear body is part of the interferon inducible cellular defense system. Several RNA viruses have been found to interfere with the anti-viral function of the PML body. The possible interaction between Ebola virus and the PML bodies has not yet been explored. Results We found that two cell lines, Vero E6 and MCF7, support virus production at high and low levels respectively. The expression of viral proteins was visualized and quantified using high resolution immunofluorescence microscopy. Ebola encoded NP and VP35 accumulated in cytoplasmic inclusion bodies whereas VP40 was mainly membrane associated but it was also present diffusely in the cytoplasm as well as in the euchromatic areas of the nucleus. The anti-VP40 antibody also allowed the detection of extracellular virions. Interferon-alpha treatment decreased the production of all three viral proteins and delayed the development of cytopathic effects in both cell lines. Virus infection and interferon-alpha treatment induced high levels of PML protein expression in MCF7 but much less in Vero E6 cells. No disruption of PML bodies, a common phenomenon induced by a variety of different viruses, was observed. Conclusion We have established a simple fixation and immunofluorescence staining procedure that allows specific co-detection and precise sub-cellular localization of the PML nuclear bodies and the Ebola virus encoded proteins NP, VP35 and VP40 in formaldehyde treated cells. Interferon-alpha treatment delays virus production in vitro. Intact PML bodies may play an anti-viral role in Ebola infected cells.

Differentiation of mammalian skeletal muscle cells cultured on microcarrier beads in a rotating cell culture system

Science.gov (United States)

Torgan, C. E.; Burge, S. S.; Collinsworth, A. M.; Truskey, G. A.; Kraus, W. E.

2000-01-01

The growth and repair of adult skeletal muscle are due in part to activation of muscle precursor cells, commonly known as satellite cells or myoblasts. These cells are responsive to a variety of environmental cues, including mechanical stimuli. The overall goal of the research is to examine the role of mechanical signalling mechanisms in muscle growth and plasticity through utilisation of cell culture systems where other potential signalling pathways (i.e. chemical and electrical stimuli) are controlled. To explore the effects of decreased mechanical loading on muscle differentiation, mammalian myoblasts are cultured in a bioreactor (rotating cell culture system), a model that has been utilised to simulate microgravity. C2C12 murine myoblasts are cultured on microcarrier beads in a bioreactor and followed throughout differentiation as they form a network of multinucleated myotubes. In comparison with three-dimensional control cultures that consist of myoblasts cultured on microcarrier beads in teflon bags, myoblasts cultured in the bioreactor exhibit an attenuation in differentiation. This is demonstrated by reduced immunohistochemical staining for myogenin and alpha-actinin. Western analysis shows a decrease, in bioreactor cultures compared with control cultures, in levels of the contractile proteins myosin (47% decrease, p < 0.01) and tropomyosin (63% decrease, p < 0.01). Hydrodynamic measurements indicate that the decrease in differentiation may be due, at least in part, to fluid stresses acting on the myotubes. In addition, constraints on aggregate size imposed by the action of fluid forces in the bioreactor affect differentiation. These results may have implications for muscle growth and repair during spaceflight.

Oscillating Cell Culture Bioreactor

Science.gov (United States)

Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

2010-01-01

To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

International Nuclear Information System (INIS)

Fan, Ping; He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan

2011-01-01

Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10 3 , 1 x 10 4 or 1 x 10 5 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10 4 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single

Long-term culture and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized mesenchymal cells.

Science.gov (United States)

Garba, Abubakar; Acar, Delphine D; Roukaerts, Inge D M; Desmarets, Lowiese M B; Devriendt, Bert; Nauwynck, Hans J

2017-09-01

Mesenchymal cells are multipotent stromal cells with self-renewal, differentiation and immunomodulatory capabilities. We aimed to develop a co-culture model for differentiating hematopoietic cells on top of immortalized mesenchymal cells for studying interactions between hematopoietic and mesenchymal cells, useful for adequately exploring the therapeutic potential of mesenchymal cells. In this study, we investigated the survival, proliferation and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized porcine bone marrow mesenchymal cells for a period of five weeks. Directly after collection, primary porcine bone marrow mesenchymal cells adhered firmly to the bottom of the culture plates and showed a fibroblast-like appearance, one week after isolation. Upon immortalization, porcine bone marrow mesenchymal cells were continuously proliferating. They were positive for simian virus 40 (SV40) large T antigen and the mesenchymal cell markers CD44 and CD55. Isolated red bone marrow cells were added to these immortalized mesenchymal cells. Five weeks post-seeding, 92±6% of the red bone marrow hematopoietic cells were still alive and their number increased 3-fold during five weekly subpassages on top of the immortalized mesenchymal cells. The red bone marrow hematopoietic cells were originally small and round; later, the cells increased in size. Some of them became elongated, while others remained round. Tiny dendrites appeared attaching hematopoietic cells to the underlying immortalized mesenchymal cells. Furthermore, weekly differential-quick staining of the cells indicated the presence of monoblasts, monocytes, macrophages and lymphocytes in the co-cultures. At three weeks of co-culture, flow cytometry analysis showed an increased surface expression of CD172a, CD14, CD163, CD169, CD4 and CD8 up to 37±0.8%, 40±8%, 41±4%, 23±3% and 19±5% of the hematopoietic cells, respectively. In conclusion, continuous mesenchymal cell

3D Cell Culture in Alginate Hydrogels

Directory of Open Access Journals (Sweden)

Therese Andersen

2015-03-01

Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

Initial cytotoxicity assays of media for sulfate-reducing bacteria: An endodontic biopharmaceutical product under development.

Science.gov (United States)

Heggendorn, Fabiano Luiz; Silva, Gabriela Cristina de Carvalho; Cardoso, Elisama Azevedo; Castro, Helena Carla; Gonçalves, Lúcio Souza; Dias, Eliane Pedra; Lione, Viviane de Oliveira Freitas; Lutterbach, Márcia Teresa Soares

2016-01-01

This study assessed the cell viability of the inoculation vehicle of BACCOR (a combination of sulfate-reducing bacteria plus a culture media for bacteria), a biopharmaceutical product under development for dental use as aid in fractured endodontic file removal from the root canal. Different culture media for bacteria were evaluated: modified Postgate E (MCP-E mod), Modified Postgate E without Agar-agar (MCP-E w/Ag), Postgate C with Agar-agar (MCP-C Ag) and Postgate C without Agar-agar (MCP-C w/Ag). Cytotoxicity was quantified by the MTT test, exposing L929 and Vero cell lines to the vehicles over 24 h. The exposure of L929 cell line to MCP-E w/Ag resulted in biocompatibility (52% cell viability), while the exposure of the Vero kidney line revealed only MCP-E mod as cytotoxic. When diluted, all the vehicles showed biocompatibility with both cell lines. MCP-E w/Ag was the vehicle chosen for BACCOR, because of its biocompatibility with the cells used.

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

International Nuclear Information System (INIS)

Hayashi, N; Takada, Y; Mizuno, T; Nakae, H; Murai, T

2016-01-01

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

Energy Technology Data Exchange (ETDEWEB)

Hayashi, N [Graduate school of Health Sciences, Fujita Health University, Tayoake, Aichi (Japan); Takada, Y; Mizuno, T; Nakae, H [Department of Radiology, Ogaki Tokushukai Hospital, Ogaki, Gifu (Japan); Murai, T [Department of Radiation Oncology, Nagoya City University, Nagoya, Aichi (Japan)

2016-06-15

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

Cell culture experiments planned for the space bioreactor

Science.gov (United States)

Morrison, Dennis R.; Cross, John H.

1987-01-01

Culturing of cells in a pilot-scale bioreactor remains to be done in microgravity. An approach is presented based on several studies of cell culture systems. Previous and current cell culture research in microgravity which is specifically directed towards development of a space bioprocess is described. Cell culture experiments planned for a microgravity sciences mission are described in abstract form.

Advances in cell culture: anchorage dependence

Science.gov (United States)

Merten, Otto-Wilhelm

2015-01-01

Anchorage-dependent cells are of great interest for various biotechnological applications. (i) They represent a formidable production means of viruses for vaccination purposes at very large scales (in 1000–6000 l reactors) using microcarriers, and in the last decade many more novel viral vaccines have been developed using this production technology. (ii) With the advent of stem cells and their use/potential use in clinics for cell therapy and regenerative medicine purposes, the development of novel culture devices and technologies for adherent cells has accelerated greatly with a view to the large-scale expansion of these cells. Presently, the really scalable systems—microcarrier/microcarrier-clump cultures using stirred-tank reactors—for the expansion of stem cells are still in their infancy. Only laboratory scale reactors of maximally 2.5 l working volume have been evaluated because thorough knowledge and basic understanding of critical issues with respect to cell expansion while retaining pluripotency and differentiation potential, and the impact of the culture environment on stem cell fate, etc., are still lacking and require further studies. This article gives an overview on critical issues common to all cell culture systems for adherent cells as well as specifics for different types of stem cells in view of small- and large-scale cell expansion and production processes. PMID:25533097

SARS – Koch´Postulates proved.

Indian Academy of Sciences (India)

SARS – Koch´Postulates proved. Novel coronavirus identified from fluids of patients. Virus cultured in Vero cell line. Sera of patients have antibodies to virus. Cultured virus produces disease in Macaque monkeys. -produces specific immune response; -isolated virus is SARS CoV; -pathology similar to human.

Suspension culture of pluripotent stem cells: effect of shear on stem cell fate.

Science.gov (United States)

Keller, Kevin C; Rodrigues, Beatriz; zur Nieden, Nicole I

2014-01-01

Despite significant promise, the routine usage of suspension cell culture to manufacture stem cell-derived differentiated cells has progressed slowly. Suspension culture is an innovative way of either expanding or differentiating cells and sometimes both are combined into a single bioprocess. Its advantages over static 2D culturing include a homogeneous and controllable culture environment and producing a large quantity of cells in a fraction of time. This feature makes suspension cell culture ideal for use in stem cell research and eventually ideal in the large-scale production of differentiated cells for regenerative medicine. Because of their tremendous differentiation capacities and unlimited growth properties, pluripotent stem cells (PSCs) in particular are considered potential sources for future cell-replacement therapies. Currently, expansion of PSCs is accomplished in 2D, which only permits a limited amount of cell growth per culture flask before cells need to be passaged. However, before stem cells can be applied clinically, several aspects of their expansion, such as directed growth, but also differentiation, need to be better controlled. This review will summarize recent advantages in suspension culture of PSCs, while at the same time highlighting current challenges.

Controlling the diversity of cell populations in a stem cell culture

NARCIS (Netherlands)

Heo, Inha; Clevers, Hans

2015-01-01

Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

The evolution of chicken stem cell culture methods.

Science.gov (United States)

Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

2017-12-01

1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

Mammalian Cell Culture Simplified.

Science.gov (United States)

Moss, Robert; Solomon, Sondra

1991-01-01

A tissue culture experiment that does not require elaborate equipment and that can be used to teach sterile technique, the principles of animal cell line maintenance, and the concept of cell growth curves is described. The differences between cancerous and normal cells can be highlighted. The procedure is included. (KR)

Renal Epithelial Cell Injury Induced by Calcium Oxalate Monohydrate Depends on their Structural Features: Size, Surface, and Crystalline Structure.

Science.gov (United States)

Sun, Xin-Yuan; Ouyang, Jian-Ming; Gan, Qiong-Zhi; Liu, Ai-Jie

2016-11-01

Urinary crystals in normal and kidney stone patients often differ in crystal sizes and surface structures, but the effects of different crystal properties on renal tubular epithelial cells remain unclear. This study aimed to compare the cytotoxicity of micron/nano-calcium oxalate monohydrate (COM) crystals with sizes of 50 nm, 200 nm, 1 μm, 3 μm, and 10 μm to African green monkey renal epithelial (Vero) cells, to reveal the effect of crystal size and surface structure on cell injury, and to investigate the pathological mechanism of calcium oxalate kidney stones. Cell viability, cellular biochemical parameters, and internalized crystal amount in Vero cells were closely associated with the size of COM crystals. At the same concentration (200 μg/mL), COM-1 μm induced the most serious injury to Vero cells and caused the most significant change to cellular biochemical parameters, which were related to the specific porous structure and highest internalized amount in Vero cells. By contrast, COM-50 nm and COM-200 nm crystals lost their small size effect because of serious aggregation and weakened their toxicity to cells. COM-3 μm and COM-10 μm crystals were too large for cells to completely internalize; these crystals also exhibited a low specific surface area and thus weakened their toxicity. The excessive expression of intracellular ROS and reduction of the free-radical scavenger SOD were the main reasons for cell injury and eventually caused necrotic cell death. Crystal size, surface structure, aggregation, and internalization amount were closely related to the cytotoxicity of COM crystals.

Rabbit uterine epithelial cells: Co-culture with spermatozoa

International Nuclear Information System (INIS)

Boice, M.L.

1988-01-01

A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined

Application of speckle image correlation for real-time assessment of metabolic activity in herpes virus-infected cells

Science.gov (United States)

Vladimirov, A. P.; Malygin, A. S.; Mikhailova, J. A.; Borodin, E. M.; Bakharev, A. A.; Poryvayeva, A. P.

2014-09-01

Earlier we reported developing a speckle interferometry technique and a device designed to assess the metabolic activity of a cell monolayer cultivated on a glass substrate. This paper aimed at upgrading the technique and studying its potential for real-time assessment of herpes virus development process. Speckle dynamics was recorded in the image plane of intact and virus-infected cell monolayer. HLE-3, L-41 and Vero cells were chosen as research targets. Herpes simplex virus-1-(HSV-1)- infected cell cultures were studied. For 24 h we recorded the digital value of optical signal I in one pixel and parameter η characterizing change in the distribution of the optical signal on 10 × 10-pixel areas. The coefficient of multiple determination calculated by η time dependences for three intact cell cultures equals 0.94. It was demonstrated that the activity parameters are significantly different for intact and virus-infected cells. The difference of η value for intact and HSV-1-infected cells is detectable 10 minutes from the experiment start.

Application of speckle image correlation for real-time assessment of metabolic activity in herpes virus-infected cells

International Nuclear Information System (INIS)

Vladimirov, A P; Malygin, A S; Mikhailova, J A; Borodin, E M; Bakharev, A A; Poryvayeva, A P

2014-01-01

Earlier we reported developing a speckle interferometry technique and a device designed to assess the metabolic activity of a cell monolayer cultivated on a glass substrate. This paper aimed at upgrading the technique and studying its potential for real-time assessment of herpes virus development process. Speckle dynamics was recorded in the image plane of intact and virus-infected cell monolayer. HLE-3, L-41 and Vero cells were chosen as research targets. Herpes simplex virus-1-(HSV-1)- infected cell cultures were studied. For 24 h we recorded the digital value of optical signal I in one pixel and parameter η characterizing change in the distribution of the optical signal on 10 × 10-pixel areas. The coefficient of multiple determination calculated by η time dependences for three intact cell cultures equals 0.94. It was demonstrated that the activity parameters are significantly different for intact and virus-infected cells. The difference of η value for intact and HSV-1-infected cells is detectable 10 minutes from the experiment start.

X-ray microanalysis of single and cultured cells

International Nuclear Information System (INIS)

Wroblewski, J.; Roomans, G.M.

1984-01-01

X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

Cell Adhesion to Plasma-Coated PVC

Directory of Open Access Journals (Sweden)

Elidiane C. Rangel

2014-01-01

Full Text Available To produce environments suitable for cell culture, thin polymer films were deposited onto commercial PVC plates from radiofrequency acetylene-argon plasmas. The proportion of argon in the plasmas, PAr, was varied from 5.3 to 65.8%. The adhesion and growth of Vero cells on the coated surfaces were examined for different incubation times. Cytotoxicity tests were performed using spectroscopic methods. Carbon, O, and N were detected in all the samples using XPS. Roughness remained almost unchanged in the samples prepared with 5.3 and 28.9% but tended to increase for the films deposited with PAr between 28.9 and 55.3%. Surface free energy increased with increasing PAr, except for the sample prepared at 28.9% of Ar, which presented the least reactive surface. Cells proliferated on all the samples, including the bare PVC. Independently of the deposition condition there was no evidence of cytotoxicity, indicating the viability of such coatings for designing biocompatible devices.

Particle Trajectories in Rotating Wall Cell Culture Devices

Science.gov (United States)

Ramachandran N.; Downey, J. P.

1999-01-01

Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.

Effects of interferon on cultured cells persistently infected with viruses

Energy Technology Data Exchange (ETDEWEB)

Crespi, M

1986-01-01

The role of interferon (IFN) in viral persistence at the cellular level was investigated. Two types of persistent infections were chosen. The first type was cell lines which contained hepatitis B virus (HBV) DNA (PLC/PRF/5 and Hep 3B cells) uninfected control hepatoma cells, (Mahlavu, HA22T and Hep G2 cells) or simian virus 40 (SV40) DNA (C2, C6, C11 cells) and control uninfected (CV-1 cells). In the second type of infection Vero cells persistently infected with SSPE or Sendai virus were used. The aim of this work was to determine what effect IFN had in these infections in terms of its antiviral and antiproliferative effects; which of the two major IFN-induced pathways, E enzyme or protein kinase were induced; whether there were any differences in sensitivity to IFN between the DNA and RNA virus persistent infections. The anti-viral effect of IFN was examined by its ability to inhibit Sindbis virus replication using a radioimmunoassay system. The antiproliferative effect of IFN was determined by cell counting and /sup 3/H-thymidine incorporation. The activation of the ribonuclease F, determined by the inhibition of /sup 3/H-leucine incorporation after introduction of 2-5 actin into the cells, was variable, being activated in all cell lines with the exception of the PLC/PRF/5, Hep 3B and Hep G2 cells. Major differences between the two DNA persistent infections and the two RNA persistent infections were found. No correlation was found between the presence of HBV or SV40 persistent infections and the sensitivity of the cell lines to IFN. Both the SSPE and Sendai virus persistent infections were resistant to the antiviral and antiproliferative effect of IFN.

Usability and Applicability of Microfluidic Cell Culture Systems

DEFF Research Database (Denmark)

Hemmingsen, Mette

possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing......, these devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment...

Good Cell Culture Practice for stem cells and stem-cell-derived models.

Science.gov (United States)

Pamies, David; Bal-Price, Anna; Simeonov, Anton; Tagle, Danilo; Allen, Dave; Gerhold, David; Yin, Dezhong; Pistollato, Francesca; Inutsuka, Takashi; Sullivan, Kristie; Stacey, Glyn; Salem, Harry; Leist, Marcel; Daneshian, Mardas; Vemuri, Mohan C; McFarland, Richard; Coecke, Sandra; Fitzpatrick, Suzanne C; Lakshmipathy, Uma; Mack, Amanda; Wang, Wen Bo; Yamazaki, Daiju; Sekino, Yuko; Kanda, Yasunari; Smirnova, Lena; Hartung, Thomas

2017-01-01

The first guidance on Good Cell Culture Practice (GCCP) dates back to 2005. This document expands this to include aspects of quality assurance for in vitro cell culture focusing on the increasingly diverse cell types and culture formats used in research, product development, testing and manufacture of biotechnology products and cell-based medicines. It provides a set of basic principles of best practice that can be used in training new personnel, reviewing and improving local procedures, and helping to assure standard practices and conditions for the comparison of data between laboratories and experimentation performed at different times. This includes recommendations for the documentation and reporting of culture conditions. It is intended as guidance to facilitate the generation of reliable data from cell culture systems, and is not intended to conflict with local or higher level legislation or regulatory requirements. It may not be possible to meet all recommendations in this guidance for practical, legal or other reasons. However, when it is necessary to divert from the principles of GCCP, the risk of decreasing the quality of work and the safety of laboratory staff should be addressed and any conclusions or alternative approaches justified. This workshop report is considered a first step toward a revised GCCP 2.0.

Long-term maintenance of human induced pluripotent stem cells by automated cell culture system.

Science.gov (United States)

Konagaya, Shuhei; Ando, Takeshi; Yamauchi, Toshiaki; Suemori, Hirofumi; Iwata, Hiroo

2015-11-17

Pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells, are regarded as new sources for cell replacement therapy. These cells can unlimitedly expand under undifferentiated conditions and be differentiated into multiple cell types. Automated culture systems enable the large-scale production of cells. In addition to reducing the time and effort of researchers, an automated culture system improves the reproducibility of cell cultures. In the present study, we newly designed a fully automated cell culture system for human iPS maintenance. Using an automated culture system, hiPS cells maintained their undifferentiated state for 60 days. Automatically prepared hiPS cells had a potency of differentiation into three germ layer cells including dopaminergic neurons and pancreatic cells.

High-Throughput Cancer Cell Sphere Formation for 3D Cell Culture.

Science.gov (United States)

Chen, Yu-Chih; Yoon, Euisik

2017-01-01

Three-dimensional (3D) cell culture is critical in studying cancer pathology and drug response. Though 3D cancer sphere culture can be performed in low-adherent dishes or well plates, the unregulated cell aggregation may skew the results. On contrary, microfluidic 3D culture can allow precise control of cell microenvironments, and provide higher throughput by orders of magnitude. In this chapter, we will look into engineering innovations in a microfluidic platform for high-throughput cancer cell sphere formation and review the implementation methods in detail.

Liver Cell Culture Devices

NARCIS (Netherlands)

Andria, B.; Bracco, A.; Cirino, G.; Chamuleau, R. A. F. M.

2010-01-01

In the last 15 years many different liver cell culture devices, consisting of functional liver cells and artificial materials, have been developed. They have been devised for numerous different applications, such as temporary organ replacement (a bridge to liver transplantation or native liver

Manipulating mammalian cell morphologies using chemical-mechanical polished integrated circuit chips

Science.gov (United States)

Moussa, Hassan I.; Logan, Megan; Siow, Geoffrey C.; Phann, Darron L.; Rao, Zheng; Aucoin, Marc G.; Tsui, Ting Y.

2017-12-01

Tungsten chemical-mechanical polished integrated circuits were used to study the alignment and immobilization of mammalian (Vero) cells. These devices consist of blanket silicon oxide thin films embedded with micro- and nano-meter scale tungsten metal line structures on the surface. The final surfaces are extremely flat and smooth across the entire substrate, with a roughness in the order of nanometers. Vero cells were deposited on the surface and allowed to adhere. Microscopy examinations revealed that cells have a strong preference to adhere to tungsten over silicon oxide surfaces with up to 99% of cells adhering to the tungsten portion of the surface. Cells self-aligned and elongated into long threads to maximize contact with isolated tungsten lines as thin as 180 nm. The orientation of the Vero cells showed sensitivity to the tungsten line geometric parameters, such as line width and spacing. Up to 93% of cells on 10 μm wide comb structures were aligned within ± 20° of the metal line axis. In contrast, only 22% of cells incubated on 0.18 μm comb patterned tungsten lines were oriented within the same angular interval. This phenomenon is explained using a simple model describing cellular geometry as a function of pattern width and spacing, which showed that cells will rearrange their morphology to maximize their contact to the embedded tungsten. Finally, it was discovered that the materials could be reused after cleaning the surfaces, while maintaining cell alignment capability.

Characterization of glucocerebrosidase in peripheral blood cells and cultured blastoid cells

NARCIS (Netherlands)

Aerts, J. M.; Heikoop, J.; van Weely, S.; Donker-Koopman, W. E.; Barranger, J. A.; Tager, J. M.; Schram, A. W.

1988-01-01

We have characterized glucocerebrosidase in various cell types of peripheral blood of control subjects and in cultured human blastoid cells. The intracellular level of glucocerebrosidase in cultured blastoid cells (10-30 nmol substrate hydrolyzed/h.mg protein) resembles closely values observed for

Biosynthesis of 14C-phytoene from tomato cell suspension cultures (Lycopersicon esculentum) for utilization in prostate cancer cell culture studies.

Science.gov (United States)

Campbell, Jessica K; Rogers, Randy B; Lila, Mary Ann; Erdman, John W

2006-02-08

This work describes the development and utilization of a plant cell culture production approach to biosynthesize and radiolabel phytoene and phytofluene for prostate cancer cell culture studies. The herbicide norflurazon was added to established cell suspension cultures of tomato (Lycopersicon esculentum cv. VFNT cherry), to induce the biosynthesis and accumulation of the lycopene precursors, phytoene and phytofluene, in their natural isomeric forms (15-cis-phytoene and two cis-phytofluene isomers). Norflurazon concentrations, solvent carrier type and concentration, and duration of culture exposure to norflurazon were screened to optimize phytoene and phytofluene synthesis. Maximum yields of both phytoene and phytofluene were achieved after 7 days of treatment with 0.03 mg norflurazon/40 mL fresh medium, provided in 0.07% solvent carrier. Introduction of 14C-sucrose to the tomato cell culture medium enabled the production of 14C-labeled phytoene for subsequent prostate tumor cell uptake studies. In DU 145 prostate tumor cells, it was determined that 15-cis-phytoene and an oxidized product of phytoene were taken up and partially metabolized by the cells. The ability to biosynthesize, radiolabel, and isolate these carotenoids from tomato cell cultures is a novel, valuable methodology for further in vitro and in vivo investigations into the roles of phytoene and phytofluene in cancer chemoprevention.

An inactivated cell-culture vaccine against yellow fever.

Science.gov (United States)

Monath, Thomas P; Fowler, Elizabeth; Johnson, Casey T; Balser, John; Morin, Merribeth J; Sisti, Maggie; Trent, Dennis W

2011-04-07

Yellow fever is a lethal viral hemorrhagic fever occurring in Africa and South America. A highly effective live vaccine (17D) is widely used for travelers to and residents of areas in which yellow fever is endemic, but the vaccine can cause serious adverse events, including viscerotropic disease, which is associated with a high rate of death. A safer, nonreplicating vaccine is needed. In a double-blind, placebo-controlled, dose-escalation, phase 1 study of 60 healthy subjects between 18 and 49 years of age, we investigated the safety and immunogenicity of XRX-001 purified whole-virus, β-propiolactone-inactivated yellow fever vaccine produced in Vero cell cultures and adsorbed to aluminum hydroxide (alum) adjuvant. On two visits 21 days apart, subjects received intramuscular injections of vaccine that contained 0.48 μg or 4.8 μg of antigen. Levels of neutralizing antibodies were measured at baseline and on days 21, 31, and 42. The vaccine induced the development of neutralizing antibodies in 100% of subjects receiving 4.8 μg of antigen in each injection and in 88% of subjects receiving 0.48 μg of antigen in each injection. Antibody levels increased by day 10 after the second injection, at which time levels were significantly higher with the 4.8-μg formulation than with the 0.48-μg formulation (geometric mean titer, 146 vs. 39; Pvaccine groups than in the placebo group: mild pain, tenderness, and (much less frequently) itching at the injection site. One case of urticaria was observed on day 3 after the second dose of 4.8 μg of vaccine. A two-dose regimen of the XRX-001 vaccine, containing inactivated yellow fever antigen with an alum adjuvant, induced neutralizing antibodies in a high percentage of subjects. XRX-001 has the potential to be a safer alternative to live attenuated 17D vaccine. (Funded by Xcellerex; ClinicalTrials.gov number, NCT00995865.).

Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices.

Science.gov (United States)

Halldorsson, Skarphedinn; Lucumi, Edinson; Gómez-Sjöberg, Rafael; Fleming, Ronan M T

2015-01-15

Culture of cells using various microfluidic devices is becoming more common within experimental cell biology. At the same time, a technological radiation of microfluidic cell culture device designs is currently in progress. Ultimately, the utility of microfluidic cell culture will be determined by its capacity to permit new insights into cellular function. Especially insights that would otherwise be difficult or impossible to obtain with macroscopic cell culture in traditional polystyrene dishes, flasks or well-plates. Many decades of heuristic optimization have gone into perfecting conventional cell culture devices and protocols. In comparison, even for the most commonly used microfluidic cell culture devices, such as those fabricated from polydimethylsiloxane (PDMS), collective understanding of the differences in cellular behavior between microfluidic and macroscopic culture is still developing. Moving in vitro culture from macroscopic culture to PDMS based devices can come with unforeseen challenges. Changes in device material, surface coating, cell number per unit surface area or per unit media volume may all affect the outcome of otherwise standard protocols. In this review, we outline some of the advantages and challenges that may accompany a transition from macroscopic to microfluidic cell culture. We focus on decisive factors that distinguish macroscopic from microfluidic cell culture to encourage a reconsideration of how macroscopic cell culture principles might apply to microfluidic cell culture. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Isolation and culture of larval cells from C. elegans.

Directory of Open Access Journals (Sweden)

Sihui Zhang

Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.

Cell culture isolation and sequence analysis of genetically diverse US porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene.

Science.gov (United States)

Oka, Tomoichiro; Saif, Linda J; Marthaler, Douglas; Esseili, Malak A; Meulia, Tea; Lin, Chun-Ming; Vlasova, Anastasia N; Jung, Kwonil; Zhang, Yan; Wang, Qiuhong

2014-10-10

The highly contagious and deadly porcine epidemic diarrhea virus (PEDV) first appeared in the US in April 2013. Since then the virus has spread rapidly nationwide and to Canada and Mexico causing high mortality among nursing piglets and significant economic losses. Currently there are no efficacious preventive measures or therapeutic tools to control PEDV in the US. The isolation of PEDV in cell culture is the first step toward the development of an attenuated vaccine, to study the biology of PEDV and to develop in vitro PEDV immunoassays, inactivation assays and screen for PEDV antivirals. In this study, nine of 88 US PEDV strains were isolated successfully on Vero cells with supplemental trypsin and subjected to genomic sequence analysis. They differed genetically mainly in the N-terminal S protein region as follows: (1) strains (n=7) similar to the highly virulent US PEDV strains; (2) one similar to the reportedly US S INDEL PEDV strain; and (3) one novel strain most closely related to highly virulent US PEDV strains, but with a large (197aa) deletion in the S protein. Representative strains of these three genetic groups were passaged serially and grew to titers of ∼5-6log10 plaque forming units/mL. To our knowledge, this is the first report of the isolation in cell culture of an S INDEL PEDV strain and a PEDV strain with a large (197aa) deletion in the S protein. We also designed primer sets to detect these genetically diverse US PEDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

Introducing Mammalian Cell Culture and Cell Viability Techniques in the Undergraduate Biology Laboratory.

Science.gov (United States)

Bowey-Dellinger, Kristen; Dixon, Luke; Ackerman, Kristin; Vigueira, Cynthia; Suh, Yewseok K; Lyda, Todd; Sapp, Kelli; Grider, Michael; Crater, Dinene; Russell, Travis; Elias, Michael; Coffield, V McNeil; Segarra, Verónica A

2017-01-01

Undergraduate students learn about mammalian cell culture applications in introductory biology courses. However, laboratory modules are rarely designed to provide hands-on experience with mammalian cells or teach cell culture techniques, such as trypsinization and cell counting. Students are more likely to learn about cell culture using bacteria or yeast, as they are typically easier to grow, culture, and manipulate given the equipment, tools, and environment of most undergraduate biology laboratories. In contrast, the utilization of mammalian cells requires a dedicated biological safety cabinet and rigorous antiseptic techniques. For this reason, we have devised a laboratory module and method herein that familiarizes students with common cell culture procedures, without the use of a sterile hood or large cell culture facility. Students design and perform a time-efficient inquiry-based cell viability experiment using HeLa cells and tools that are readily available in an undergraduate biology laboratory. Students will become familiar with common techniques such as trypsinizing cells, cell counting with a hemocytometer, performing serial dilutions, and determining cell viability using trypan blue dye. Additionally, students will work with graphing software to analyze their data and think critically about the mechanism of death on a cellular level. Two different adaptations of this inquiry-based lab are presented-one for non-biology majors and one for biology majors. Overall, these laboratories aim to expose students to mammalian cell culture and basic techniques and help them to conceptualize their application in scientific research.

Multizone Paper Platform for 3D Cell Cultures

Science.gov (United States)

Derda, Ratmir; Hong, Estrella; Mwangi, Martin; Mammoto, Akiko; Ingber, Donald E.; Whitesides, George M.

2011-01-01

In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc). The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously (“cells-in-gels-in-paper” or CiGiP), this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM) gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers) containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, “sections” all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures. PMID:21573103

Morphology of primary human venous endothelial cell cultures before and after culture medium exchange.

Science.gov (United States)

Krüger-Genge, A; Fuhrmann, R; Jung, F; Franke, R P

2015-01-01

The evaluation of the interaction of human, venous endothelial cells (HUVEC) with body foreign materials on the cellular level cannot be performed in vivo, but is investigated in vitro under standard culture conditions. To maintain the vitality, proliferation and morphology of HUVEC seeded on body foreign substrates over days, the cell culture medium is usually exchanged every second day. It is well known, that alterations in the microenvironment of cells bear the risk of influencing cell morphology and function. In the current study the influence of cell culture medium exchange on HUVEC cytoskeletal microfilament structure and function was investigated. HUVEC in the third passage were seeded on extracellular matrix (ECM) - which was secreted from bovine corneal endothelial cells on glass- until functional confluence was reached. The experiment started 11 days after HUVEC seeding with an exchange of the cell culture medium followed by a staining of the actin microfilaments with phalloidin-rhodamin 1.5 and 5 minutes after medium exchange. The microfilaments were documented by use of an Olympus microscope (IMT-2) equipped with a UV lamp and online connected to a TV chain (Sony XC 50 ST/monochrome) implying an OPTIMAS - Image analysis system. Prostacyclin was analysed in the cell culture supernatant. 1.5 min after culture medium exchange in the functionally confluent cultures a slight disturbance of the actin microfilament structure with a broadening of the marginal filament band, a partial disconnection of cell-cell contacts and the appearance of intercellular fenestrations were observed. 5 minutes after medium exchange a redevelopment of the slightly disturbed microfilament structure with a condensation and narrowing of the marginal filament band was seen. 12 h later a further consolidation of the microfilament structure occurred. In addition, a perturbation of the cultured HUVEC occurred after cell culture medium exchange. The prostacyclin concentration in the

Mutation in cultured mammalian cells

International Nuclear Information System (INIS)

Nakamura, N.; Okada, S.

1982-01-01

Mammalian cell cultures were exposed to gamma-rays at various dose rates. Dose-rate effects were observed in cultured somatic cells of the mouse for cell killing and mutations resistant to 6-thioguanine (TGsup(r)) and to methotrexate (MTXsup(r)). Linear quadratic model may be applied to cell killing and TGsup(r) mutations in some cases but can not explain the whole data. Results at low doses with far low dose-rate were not predictable from data at high doses with acute or chronic irradiation. Radioprotective effects of dimethyl sulfoxide were seen only after acute exposure but not after chronic one, suggesting that damages by indirect action of radiations may be potentially reparable by cells. TGsup(r) mutations seem to contain gross structural changes whereas MTXsup(r) ones may have smaller alterations. (Namekawa, K.)

Cell-free DNA in a three-dimensional spheroid cell culture model

DEFF Research Database (Denmark)

Aucamp, Janine; Calitz, Carlemi; Bronkhorst, Abel J.

2017-01-01

Background Investigating the biological functions of cell-free DNA (cfDNA) is limited by the interference of vast numbers of putative sources and causes of DNA release into circulation. Utilization of three-dimensional (3D) spheroid cell cultures, models with characteristics closer to the in vivo...... cultures can serve as effective, simplified in vivo-simulating “closed-circuit” models since putative sources of cfDNA are limited to only the targeted cells. In addition, cfDNA can also serve as an alternative or auxiliary marker for tracking spheroid growth, development and culture stability. Biological...... significance 3D cell cultures can be used to translate “closed-circuit” in vitro model research into data that is relevant for in vivo studies and clinical applications. In turn, the utilization of cfDNA during 3D culture research can optimize sample collection without affecting the stability of the growth...

Cell culture techniques in honey bee research

Science.gov (United States)

Cell culture techniques are indispensable in most if not all life science disciplines to date. Wherever cell culture models are lacking scientific development is hampered. Unfortunately this has been and still is the case in honey bee research because permanent honey bee cell lines have not yet been...

MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications

International Nuclear Information System (INIS)

Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K

2011-01-01

MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions

Immobilization of Electroporated Cells for Fabrication of Cellular Biosensors: Physiological Effects of the Shape of Calcium Alginate Matrices and Foetal Calf Serum

Directory of Open Access Journals (Sweden)

Nikos Katsanakis

2009-01-01

Full Text Available In order to investigate the physiological effect of transfected cell immobilization in calcium alginate gels, we immobilized electroporated Vero cells in gels shaped either as spherical beads or as thin membrane layers. In addition, we investigated whether serum addition had a positive effect on cell proliferation and viability in either gel configuration. The gels were stored for four weeks in a medium supplemented or not with 20% (v/v foetal calf serum. Throughout a culture period of four weeks, cell proliferation and cell viability were assayed by optical microscopy after provision of Trypan Blue. Non-elaborate culture conditions (room temperature, non-CO2 enriched culture atmosphere were applied throughout the experimental period in order to evaluate cell viability under less than optimal storage conditions. Immobilization of electroporated cells was associated with an initially reduced cell viability, which was gradually increased. Immobilization was associated with maintenance of cell growth for the duration of the experimental period, whereas electroporated cells essentially died after a week in suspension culture. Considerable proliferation of immobilized cells was observed in spherical alginate beads. In both gel configurations, addition of serum was associated with increased cell proliferation. The results of the present study could contribute to an improvement of the storability of biosensors based on electroporated, genetically or membrane-engineered cells.

Microfluidic engineered high cell density three-dimensional neural cultures

Science.gov (United States)

Cullen, D. Kacy; Vukasinovic, Jelena; Glezer, Ari; La Placa, Michelle C.

2007-06-01

Three-dimensional (3D) neural cultures with cells distributed throughout a thick, bioactive protein scaffold may better represent neurobiological phenomena than planar correlates lacking matrix support. Neural cells in vivo interact within a complex, multicellular environment with tightly coupled 3D cell-cell/cell-matrix interactions; however, thick 3D neural cultures at cell densities approaching that of brain rapidly decay, presumably due to diffusion limited interstitial mass transport. To address this issue, we have developed a novel perfusion platform that utilizes forced intercellular convection to enhance mass transport. First, we demonstrated that in thick (>500 µm) 3D neural cultures supported by passive diffusion, cell densities =104 cells mm-3), continuous medium perfusion at 2.0-11.0 µL min-1 improved viability compared to non-perfused cultures (p death and matrix degradation. In perfused cultures, survival was dependent on proximity to the perfusion source at 2.00-6.25 µL min-1 (p 90% viability in both neuronal cultures and neuronal-astrocytic co-cultures. This work demonstrates the utility of forced interstitial convection in improving the survival of high cell density 3D engineered neural constructs and may aid in the development of novel tissue-engineered systems reconstituting 3D cell-cell/cell-matrix interactions.

Cell sources for in vitro human liver cell culture models

Science.gov (United States)

Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny

2016-01-01

In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro. However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro. Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595

Growth of melanocytes in human epidermal cell cultures

International Nuclear Information System (INIS)

Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

1990-01-01

Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

Cell Culture as an Alternative in Education.

Science.gov (United States)

Nardone, Roland M.

1990-01-01

Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)

The usefulness of three-dimensional cell culture in induction of cancer stem cells from esophageal squamous cell carcinoma cell lines

International Nuclear Information System (INIS)

Fujiwara, Daisuke; Kato, Kazunori; Nohara, Shigeo; Iwanuma, Yoshimi; Kajiyama, Yoshiaki

2013-01-01

Highlights: •Spheroids were created from esophageal carcinoma cells using NanoCulture® Plates. •The proportion of strongly ALDH-positive cells increased in 3-D culture. •Expression of cancer stem cell-related genes was enhanced in 3-D culture. •CA-9 expression was enhanced, suggesting hypoxia had been induced in 3-D culture. •Drug resistance was increased. 3-D culture is useful for inducing cancer stem cells. -- Abstract: In recent years, research on resistance to chemotherapy and radiotherapy in cancer treatment has come under the spotlight, and researchers have also begun investigating the relationship between resistance and cancer stem cells. Cancer stem cells are assumed to be present in esophageal cancer, but experimental methods for identification and culture of these cells have not yet been established. To solve this problem, we created spheroids using a NanoCulture® Plate (NCP) for 3-dimensional (3-D) cell culture, which was designed as a means for experimentally reproducing the 3-D structures found in the body. We investigated the potential for induction of cancer stem cells from esophageal cancer cells. Using flow cytometry we analyzed the expression of surface antigen markers CD44, CD133, CD338 (ABCG2), CD318 (CDCP1), and CD326 (EpCAM), which are known cancer stem cell markers. None of these surface antigen markers showed enhanced expression in 3-D cultured cells. We then analyzed aldehyde dehydrogenase (ALDH) enzymatic activity using the ALDEFLUOR reagent, which can identify immature cells such as stem cells and precursor cells. 3-D-cultured cells were strongly positive for ALDH enzyme activity. We also analyzed the expression of the stem cell-related genes Sox-2, Nanog, Oct3/4, and Lin28 using RT-PCR. Expression of Sox-2, Nanog, and Lin28 was enhanced. Analysis of expression of the hypoxic surface antigen marker carbonic anhydrase-9 (CA-9), which is an indicator of cancer stem cell induction and maintenance, revealed that CA-9 expression

Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

Directory of Open Access Journals (Sweden)

DA Ribeiro

2011-01-01

Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

Directory of Open Access Journals (Sweden)

A.M. NOSOV

2014-06-01

Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures. 

Substrate utilisation by plant-cell cultures

Energy Technology Data Exchange (ETDEWEB)

Fowler, M W

1982-01-01

Plant cell cultures have been grown on a wide range of carbon sources in addition to the traditional ones of sucrose and glucose. Biomass yields and growth rates vary greatly between the different carbon sources and there is a variation in response between different cell cultures to individual carbon sources. Some attempts have been made to grow cell cultures on 'waste' and related carbon sources, such as lactose, maltose, starch, molasses and milk whey. Only maltose was found to support growth to anything near the levels observed with glucose and sucrose. In the case of molasses carbon source cell growth was either non-existent or only just measurable. All the data point to glucose as being the most suitable carbon source, principally on the grounds of biomass yield and growth rate. It should be noted, however, that other carbon sources do appear to have a major (positive) influence on natural product synthesis. Uptake into the cell is an important aspect of carbohydrate utilisation. There is strong evidence that from disaccharides upwards, major degradation to smaller units occurs before uptake. In some cases the necessary enzymes appear to be excreted into the culture broth, in others they may be located within the cell wall; invertase that hydrolyses sucrose is a good example. Once the products of carbohydrate degradation and mobilisation enter the cell they may suffer one of two fates, oxidation or utilisation for biosynthesis. The precise split between these two varies depending on such factors as cell growth rate, cell size, nutrient broth composition and carbohydrate status of the cells. In general rapidly growing cells have a high rate of oxidation, whereas cells growing more slowly tend to be more directed towards biosynthesis. Carbohydrate utilisation is a key area of study, underpinning as it does both biomass yield and natural product synthesis. (Refs. 13).

Biona-C Cell Culture pH Monitoring System

Science.gov (United States)

Friedericks, C.

1999-01-01

Sensors 2000! is developing a system to demonstrate the ability to perform accurate, real-time measurements of pH and CO2 in a cell culture media in Space. The BIONA-C Cell Culture pH Monitoring System consists of S2K! developed ion selective sensors and control electronics integrated with the fluidics of a cell culture system. The integrated system comprises a "rail" in the Cell Culture Module (CCM) of WRAIR (Space Biosciences of Walter Read Army Institute of Research). The CCM is a Space Shuttle mid-deck locker experiment payload. The BIONA-C is displayed along with associated graphics and text explanations. The presentation will stimulate interest in development of sensor technology for real-time cell culture measurements. The transfer of this technology to other applications will also be of interest. Additional information is contained in the original document.

Rotary orbital suspension culture of embryonic stem cell-derived neural stem/progenitor cells: impact of hydrodynamic culture on aggregate yield, morphology and cell phenotype.

Science.gov (United States)

Laundos, Tiago L; Silva, Joana; Assunção, Marisa; Quelhas, Pedro; Monteiro, Cátia; Oliveira, Carla; Oliveira, Maria J; Pêgo, Ana P; Amaral, Isabel F

2017-08-01

Embryonic stem (ES)-derived neural stem/progenitor cells (ES-NSPCs) constitute a promising cell source for application in cell therapies for the treatment of central nervous system disorders. In this study, a rotary orbital hydrodynamic culture system was applied to single-cell suspensions of ES-NSPCs, to obtain homogeneously-sized ES-NSPC cellular aggregates (neurospheres). Hydrodynamic culture allowed the formation of ES-NSPC neurospheres with a narrower size distribution than statically cultured neurospheres, increasing orbital speeds leading to smaller-sized neurospheres and higher neurosphere yield. Neurospheres formed under hydrodynamic conditions (72 h at 55 rpm) showed higher cell compaction and comparable percentages of viable, dead, apoptotic and proliferative cells. Further characterization of cellular aggregates provided new insights into the effect of hydrodynamic shear on ES-NSPC behaviour. Rotary neurospheres exhibited reduced protein levels of N-cadherin and β-catenin, and higher deposition of laminin (without impacting fibronectin deposition), matrix metalloproteinase-2 (MMP-2) activity and percentage of neuronal cells. In line with the increased MMP-2 activity levels found, hydrodynamically-cultured neurospheres showed higher outward migration on laminin. Moreover, when cultured in a 3D fibrin hydrogel, rotary neurospheres generated an increased percentage of neuronal cells. In conclusion, the application of a constant orbital speed to single-cell suspensions of ES-NSPCs, besides allowing the formation of homogeneously-sized neurospheres, promoted ES-NSPC differentiation and outward migration, possibly by influencing the expression of cell-cell adhesion molecules and the secretion of proteases/extracellular matrix proteins. These findings are important when establishing the culture conditions needed to obtain uniformly-sized ES-NSPC aggregates, either for use in regenerative therapies or in in vitro platforms for biomaterial development or

Protein biosynthesis in cultured human hair follicle cells.

Science.gov (United States)

Weterings, P J; Vermorken, A J; Bloemendal, H

1980-10-31

A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.

21 CFR 864.2280 - Cultured animal and human cells.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...

Culture of human mesenchymal stem cells using a candidate pharmaceutical grade xeno-free cell culture supplement derived from industrial human plasma pools.

Science.gov (United States)

Díez, José M; Bauman, Ewa; Gajardo, Rodrigo; Jorquera, Juan I

2015-03-13

Fetal bovine serum (FBS) is an animal product used as a medium supplement. The animal origin of FBS is a concern if cultured stem cells are to be utilized for human cell therapy. Therefore, a substitute for FBS is desirable. In this study, an industrial, xeno-free, pharmaceutical-grade supplement for cell culture (SCC) under development at Grifols was tested for growth of human mesenchymal stem cells (hMSCs), cell characterization, and differentiation capacity. SCC is a freeze-dried product obtained through cold-ethanol fractionation of industrial human plasma pools from healthy donors. Bone marrow-derived hMSC cell lines were obtained from two commercial suppliers. Cell growth was evaluated by culturing hMSCs with commercial media or media supplemented with SCC or FBS. Cell viability and cell yield were assessed with an automated cell counter. Cell surface markers were studied by indirect immunofluorescence assay. Cells were cultured then differentiated into adipocytes, chondrocytes, osteoblasts, and neurons, as assessed by specific staining and microscopy observation. SCC supported the growth of commercial hMSCs. Starting from the same number of seeded cells in two consecutive passages of culture with medium supplemented with SCC, hMSC yield and cell population doubling time were equivalent to the values obtained with the commercial medium and was consistent among lots. The viability of hMSCs was higher than 90%, while maintaining the characteristic phenotype of undifferentiated hMSCs (positive for CD29, CD44, CD90, CD105, CD146, CD166 and Stro-1; negative for CD14 and CD19). Cultured hMSCs maintained the potential for differentiation into adipocytes, chondrocytes, osteoblasts, and neurons. The tested human plasma-derived SCC sustains the adequate growth of hMSCs, while preserving their differentiation capacity. SCC can be a potential candidate for cell culture supplement in advanced cell therapies.

Differential marker expression by cultures rich in mesenchymal stem cells

Science.gov (United States)

2013-01-01

Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471

Chromosomal instability and telomere shortening in long-term culture of hematopoietic stem cells: insights from a cell culture model of RPS14 haploinsufficiency.

Science.gov (United States)

Thomay, K; Schienke, A; Vajen, B; Modlich, U; Schambach, A; Hofmann, W; Schlegelberger, B; Göhring, G

2014-01-01

The fate of cultivated primary hematopoietic stem cells (HSCs) with respect to genetic instability and telomere attrition has not yet been described in great detail. Thus, knowledge of the genetic constitution of HSCs is important when interpreting results of HSCs in culture. While establishing a cell culture model for myelodysplastic syndrome with a deletion in 5q by performing RPS14 knockdown, we found surprising data that may be of importance for any CD34+ cell culture experiments. We performed cytogenetic analyses and telomere length measurement on transduced CD34+ cells and untransduced control cells to observe the effects of long-term culturing. Initially, CD34+ cells had a normal median telomere length of about 12 kb and showed no signs of chromosomal instability. During follow-up, the median telomere length seemed to decrease and, simultaneously, increased chromosomal instability could be observed - in modified and control cells. One culture showed a clonal monosomy 7 - independent of prior RPS14 knockdown. During further culturing, it seemed that the telomeres re-elongated, and chromosomes stabilized, while TERT expression was not elevated. In summary, irrespective of our results of RPS14 knockdown in the long-term culture of CD34+ cells, it becomes clear that cell culture artefacts inducing telomere shortening and chromosomal instability have to be taken into account and regular cytogenetic analyses should always be performed. © 2013 S. Karger AG, Basel.

A single-cell and feeder-free culture system for monkey embryonic stem cells.

Science.gov (United States)

Ono, Takashi; Suzuki, Yutaka; Kato, Yosuke; Fujita, Risako; Araki, Toshihiro; Yamashita, Tomoko; Kato, Hidemasa; Torii, Ryuzo; Sato, Naoya

2014-01-01

Primate pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), hold great potential for research and application in regenerative medicine and drug discovery. To maximize primate PSC potential, a practical system is required for generating desired functional cells and reproducible differentiation techniques. Much progress regarding their culture systems has been reported to date; however, better methods would still be required for their practical use, particularly in industrial and clinical fields. Here we report a new single-cell and feeder-free culture system for primate PSCs, the key feature of which is an originally formulated serum-free medium containing FGF and activin. In this culture system, cynomolgus monkey ESCs can be passaged many times by single-cell dissociation with traditional trypsin treatment and can be propagated with a high proliferation rate as a monolayer without any feeder cells; further, typical PSC properties and genomic stability can be retained. In addition, it has been demonstrated that monkey ESCs maintained in the culture system can be used for various experiments such as in vitro differentiation and gene manipulation. Thus, compared with the conventional culture system, monkey ESCs grown in the aforementioned culture system can serve as a cell source with the following practical advantages: simple, stable, and easy cell maintenance; gene manipulation; cryopreservation; and desired differentiation. We propose that this culture system can serve as a reliable platform to prepare primate PSCs useful for future research and application.

Stimulation of the proliferation of hemopoietic stem cells in irradiated bone marrow cell culture

International Nuclear Information System (INIS)

Mori, K.J.; Izumi, H.; Seto, A.

1981-01-01

Long-term hemopoiesis was established in bone marrow cell culture in vitro. This culture was shown to support the recovery proliferation of hemopoietic stem cells completely in vitro after irradiation. Hemopoietic stem cells were stimulated into proliferation in culture when normal bone marrow cells were overlayed on top of the irradiated adherent cell colonies. These results indicate that proliferation and differentiation of hemopoietic stem cells in vitro are also supported by stromahemopoietic cell interactions

Cell Culture in Microgravity: Opening the Door to Space Cell Biology

Science.gov (United States)

Pellis, Neal R.; Dawson, David L. (Technical Monitor)

1999-01-01

Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.

How do culture media influence in vitro perivascular cell behavior?

Science.gov (United States)

Huber, Birgit; Volz, Ann-Cathrin; Kluger, Petra Juliane

2015-12-01

Perivascular cells are multilineage cells located around the vessel wall and important for wall stabilization. In this study, we evaluated a stem cell media and a perivascular cell-specific media for the culture of primary perivascular cells regarding their cell morphology, doubling time, stem cell properties, and expression of cell type-specific markers. When the two cell culture media were compared to each other, perivascular cells cultured in the stem cell medium had a more elongated morphology and a faster doubling rate and cells cultured in the pericyte medium had a more typical morphology, with several filopodia, and a slower doubling rate. To evaluate stem cell properties, perivascular cells, CD146(-) cells, and mesenchymal stem cells (MSCs) were differentiated into the adipogenic, osteogenic, and chondrogenic lineages. It was seen that perivascular cells, as well as CD146(-) cells and MSCs, cultured in stem cell medium showed greater differentiation than cells cultured in pericyte-specific medium. The expression of pericyte-specific markers CD146, neural/glial antigen 2 (NG2), platelet-derived growth factor receptor-β (PDGFR-β), myosin, and α-smooth muscle actin (α-SMA) could be found in both pericyte cultures, as well as to varying amounts in CD146(-) cells, MSCs, and endothelial cells. The here presented work shows that perivascular cells can adapt to their in vitro environment and cell culture conditions influence cell functionality, such as doubling rate or differentiation behavior. Pericyte-specific markers were shown to be expressed also from cells other than perivascular cells. We can further conclude that CD146(+) perivascular cells are inhomogeneous cell population probably containing stem cell subpopulations, which are located perivascular around capillaries. © 2015 International Federation for Cell Biology.

Fusion protein is the main determinant of metapneumovirus host tropism.

Science.gov (United States)

de Graaf, Miranda; Schrauwen, Eefje J A; Herfst, Sander; van Amerongen, Geert; Osterhaus, Albert D M E; Fouchier, Ron A M

2009-06-01

Human metapneumovirus (HMPV) and avian metapneumovirus subgroup C (AMPV-C) infect humans and birds, respectively. This study confirmed the difference in host range in turkey poults, and analysed the contribution of the individual metapneumovirus genes to host range in an in vitro cell-culture model. Mammalian Vero-118 cells supported replication of both HMPV and AMPV-C in contrast to avian quail fibroblast (QT6) cells in which only AMPV-C replicated to high titres. Inoculation of Vero-118 and QT6 cells with recombinant HMPV in which genes were exchanged with those of AMPV-C revealed that the metapneumovirus fusion (F) protein is the main determinant for host tropism. Chimeric viruses in which polymerase complex proteins were exchanged between HMPV and AMPV-C replicated less efficiently compared with HMPV in QT6 cells. Using mini-genome systems, it was shown that exchanging these polymerase proteins resulted in reduced replication and transcription efficiency in QT6 cells. Examination of infected Vero-118 and QT6 cells revealed that viruses containing the F protein of AMPV-C yielded larger syncytia compared with viruses containing the HMPV F protein. Cell-content mixing assays revealed that the F protein of AMPV-C was more fusogenic compared with the F protein of HMPV, and that the F2 region is responsible for the difference observed between AMPV-C and HMPV F-promoted fusion in QT6 and Vero-118 cells. This study provides insight into the determinants of host tropism and membrane fusion of metapneumoviruses.

Biogelx: Cell Culture on Self-Assembling Peptide Gels.

Science.gov (United States)

Harper, Mhairi M; Connolly, Michael L; Goldie, Laura; Irvine, Eleanore J; Shaw, Joshua E; Jayawarna, Vineetha; Richardson, Stephen M; Dalby, Matthew J; Lightbody, David; Ulijn, Rein V

2018-01-01

Aromatic peptide amphiphiles can form self-supporting nanostructured hydrogels with tunable mechanical properties and chemical compositions. These hydrogels are increasingly applied in two-dimensional (2D) and three-dimensional (3D) cell culture, where there is a rapidly growing need to store, grow, proliferate, and manipulate naturally derived cells within a hydrated, 3D matrix. Biogelx Limited is a biomaterials company, created to commercialize these bio-inspired hydrogels to cell biologists for a range of cell culture applications. This chapter describes methods of various characterization and cell culture techniques specifically optimized for compatibility with Biogelx products.

Development of a microfluidic perfusion 3D cell culture system

Science.gov (United States)

Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

2018-04-01

Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

Cardiac Cells Beating in Culture: A Laboratory Exercise

Science.gov (United States)

Weaver, Debora

2007-01-01

This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

Improved endothelial cell seeding with cultured cells and fibronectin-coated grafts

International Nuclear Information System (INIS)

Seeger, J.M.; Klingman, N.

1985-01-01

A possible approach to the low seeding efficiency of endothelial cells into prosthetic grafts is to increase the number of cells to be seeded in cell culture and improve seeding efficiency by graft precoating with fibronectin. The effect of cell culture on cell adhesion is unknown, however, and fibronectin also binds fibrin, which may increase the thrombogenicity of the graft luminal surface. To investigate these questions, freshly harvested canine jugular vein endothelial cells from six animals and similar cells harvested from six primary and eight secondary cell cultures were labeled with 111 Indium and seeded into 5 cm, 4 mm PTFE grafts coated with fibronectin, using similar uncoated PTFE grafts as controls. Platelet accumulation and distribution on six similar coated and uncoated grafts placed in canine carotid, external jugular arterial venous shunts for 2 hr were also determined using autogenous 111 Indium-labeled platelets. Significant differences between group means were determined using the paired Student's t test. Results reveal that seeding efficiency is significantly better in all groups of coated grafts compared to uncoated grafts (P less than 0.01). Cells derived from cell culture also had significantly higher seeding efficiencies than freshly harvested cells when seeded into coated grafts (P less than 0.05) and tended to have higher seeding efficiencies than harvested cells when seeded into uncoated grafts (P = 0.53). Fibronectin coating increased mean platelet accumulation on the entire graft luminal surface, but not to a statistically significant degree (P greater than 0.1). Whether this increased seeding efficiency will improve graft endothelialization remains to be investigated

Dynamic cell culture system: a new cell cultivation instrument for biological experiments in space

Science.gov (United States)

Gmunder, F. K.; Nordau, C. G.; Tschopp, A.; Huber, B.; Cogoli, A.

1988-01-01

The prototype of a miniaturized cell cultivation instrument for animal cell culture experiments aboard Spacelab is presented (Dynamic cell culture system: DCCS). The cell chamber is completely filled and has a working volume of 200 microliters. Medium exchange is achieved with a self-powered osmotic pump (flowrate 1 microliter h-1). The reservoir volume of culture medium is 230 microliters. The system is neither mechanically stirred nor equipped with sensors. Hamster kidney (Hak) cells growing on Cytodex 3 microcarriers were used to test the biological performance of the DCCS. Growth characteristics in the DCCS, as judged by maximal cell density, glucose consumption, lactic acid secretion and pH, were similar to those in cell culture tubes.

Quantitative volumetric Raman imaging of three dimensional cell cultures

KAUST Repository

Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

2017-01-01

in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies

System-level modeling and simulation of the cell culture microfluidic biochip ProCell

DEFF Research Database (Denmark)

Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

2010-01-01

Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre......-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed...

Culturing of PC12 Cells, Neuronal Cells, Astrocytes Cultures and Brain Slices in an Open Microfluidic System

DEFF Research Database (Denmark)

Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane

The brain is the center of the nervous system, where serious neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s are products of functional loss in the neural cells (1). Typical techniques used to investigate these diseases lack precise control of the cellular surroundings......, in addition to isolating the neural tissue from nutrient delivery and to creating unwanted gradients (2). This means that typical techniques used to investigate neurodegenerative diseases cannot mimic in vivo conditions, as closely as desired. We have developed a novel microfluidic system for culturing PC12...... cells, neuronal cells, astrocytes cultures and brain slices. The microfluidic system provides efficient nutrient delivery, waste removal, access to oxygen, fine control over the neurochemical environment and access to modern microscopy. Additionally, the setup consists of an in vitro culturing...

Maintenance of mesenchymal stem cells culture due to the cells with reduced attachment rate

Directory of Open Access Journals (Sweden)

Shuvalova N. S.

2013-01-01

Full Text Available Aim. The classic detachment techniques lead to changes in cells properties. We offer a simple method of cultivating the population of cells that avoided an influence on the surface structures. Methods. Mesenchymal stem cells (MSC from human umbilical cord matrix were obtained and cultivated in standard conditions. While substituting the culture media by a fresh portion, the conditioned culture medium, where the cells were maintained for three days, was transferred to other culture flacks with addition of serum and growth factors. Results. In the flacks, one day after medium transfer, we observed attached cells with typical MSC morphology. The cultures originated from these cells had the same rate of surface markers expression and clonogenic potential as those replated by standard methods. Conclusions. MSC culture, derived by preserving the cells with reduced attachment ability, actually has the properties of «parent» passage. Using this method with accepted techniques of cells reseeding would allow maintaining the cells that avoided an impact on the cell surface proteins.

Evaluation of the osteogenic differentiation of gingiva-derived stem cells grown on culture plates or in stem cell spheroids: Comparison of two- and three-dimensional cultures.

Science.gov (United States)

Lee, Sung-Il; Ko, Youngkyung; Park, Jun-Beom

2017-09-01

Three-dimensional cell culture systems provide a convenient in vitro model for the study of complex cell-cell and cell-matrix interactions in the absence of exogenous substrates. The current study aimed to evaluate the osteogenic differentiation potential of gingiva-derived stem cells cultured in two-dimensional or three-dimensional systems. To the best of our knowledge, the present study is the first to compare the growth of gingiva-derived stem cells in monolayer culture to a three-dimensional culture system with microwells. For three-dimensional culture, gingiva-derived stem cells were isolated and seeded into polydimethylsiloxane-based concave micromolds. Alkaline phosphatase activity and alizarin red S staining assays were then performed to evaluate osteogenesis and the degree of mineralization, respectively. Stem cell spheroids had a significantly increased level of alkaline phosphatase activity and mineralization compared with cells from the two-dimensional culture. In addition, an increase in mineralized deposits was observed with an increase in the loading cell number. The results of present study indicate that gingiva-derived stem cell spheroids exhibit an increased osteogenic potential compared with stem cells from two-dimensional culture. This highlights the potential of three-dimensional culture systems using gingiva-derived stem cells for regenerative medicine applications requiring stem cells with osteogenic potential.

A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

Science.gov (United States)

Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

2018-02-01

Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

Mesenchymal stem cells enhance the metastasis of 3D-cultured hepatocellular carcinoma cells

International Nuclear Information System (INIS)

Liu, Chang; Liu, Yang; Xu, Xiao-xi; Guo, Xin; Sun, Guang-wei; Ma, Xiao-jun

2016-01-01

Accumulating evidences have demonstrated that mesenchymal stem cells (MSC) could be recruited to the tumor microenvironment. Umbilical cord mesenchymal stem cells (UCMSC) were attractive vehicles for delivering therapeutic agents against cancer. Nevertheless, the safety of UCMSC in the treatment of tumors including hepatocellular carcinoma (HCC) was still undetermined. In this study, an in vitro co-culture system was established to evaluate the effect of UCMSC on the cell growth, cancer stem cell (CSC) characteristics, drug resistance, metastasis of 3D-cultured HCC cells, and the underlying mechanism was also investigated. It was found that after co-cultured with UCMSC, the metastatic ability of 3D-cultured HCC cells was significantly enhanced as indicated by up-regulation of matrix metalloproteinase (MMP), epithelial-mesenchymal transition (EMT)-related genes, and migration ability. However, cell growth, drug resistance and CSC-related gene expression of HCC cells were not affected by UCMSC. Moreover, EMT was reversed, MMP-2 expression was down-regulated, and migration ability of HCC cell was significantly inhibited when TGF-β receptor inhibitor SB431542 was added into the co-culture system. Therefore, these data indicated that UCMSC could significantly enhance the tumor cell metastasis, which was due to the EMT of HCC cells induced by TGF-β. The online version of this article (doi:10.1186/s12885-016-2595-4) contains supplementary material, which is available to authorized users

Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

Science.gov (United States)

Bonazza, Camila; Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Batista, Fabrício Pereira; Paredes-Gamero, Edgar J; Girão, Manoel J B C; Oliva, Maria Luiza V; Castro, Rodrigo Aquino

2016-01-01

Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2) and progesterone (P4) effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation). These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

Radiosensitivity of normal human epidermal cells in culture

International Nuclear Information System (INIS)

Dover, R.; Potten, C.S.

1983-01-01

Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells.

Science.gov (United States)

Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

2017-01-01

Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

Culture and Characterization of Circulating Endothelial Progenitor Cells in Patients with Renal Cell Carcinoma.

Science.gov (United States)

Gu, Wenyu; Sun, Wei; Guo, Changcheng; Yan, Yang; Liu, Min; Yao, Xudong; Yang, Bin; Zheng, Junhua

2015-07-01

Although emerging evidence demonstrates increased circulating endothelial progenitor cells in patients with solid tumors, to our knowledge it is still unknown whether such cells can be cultured from patients with highly angiogenic renal cell carcinoma. We cultured and characterized circulating endothelial progenitor cells from patients with renal cell carcinoma. The circulating endothelial progenitor cell level (percent of CD45(-)CD34(+) VEGF-R2(+) cells in total peripheral blood mononuclear cells) was quantified in 47 patients with renal cell carcinoma and 40 healthy controls. Peripheral blood mononuclear cells were then isolated from 33 patients with renal cell carcinoma and 30 healthy controls to culture and characterize circulating endothelial progenitor cells. The circulating endothelial progenitor cell level was significantly higher in patients with renal cell carcinoma than in healthy controls (0.276% vs 0.086%, p cells first emerged significantly earlier in patient than in control preparations (6.72 vs 14.67 days, p culture success rate (87.8% vs 40.0% of participants) and the number of colonies (10.06 vs 1.83) were significantly greater for patients than for controls (each p cell level correlated positively with the number of patient colonies (r = 0.762, p Cells cultured from patients and controls showed a similar growth pattern, immunophenotype, ability to uptake Ac-LDL and bind lectin, and form capillary tubes in vitro. However, significantly more VEGF-R2(+) circulating endothelial progenitor cells were found in preparations from patients with renal cell carcinoma than from healthy controls (21.1% vs 13.4%, p cell colonies, a higher cell culture success rate and more colonies were found for patients with renal cell carcinoma than for healthy controls. Results indicate the important significance of VEGF-R2(+) circulating endothelial progenitors in patients with renal cell carcinoma. Copyright © 2015 American Urological Association Education and Research

The impact of cell culture equipment on energy loss.

Science.gov (United States)

Davies, Lleucu B; Kiernan, Michael N; Bishop, Joanna C; Thornton, Catherine A; Morgan, Gareth

2014-01-01

Light energy of discrete wavelengths supplied via lasers and broadband intense pulsed light have been used therapeutically for many years. In vitro models complement clinical studies, especially for the elucidation of underlying mechanisms of action. Clarification that light energy reaches the cells is necessary when developing protocols for the treatment of cells using in vitro models. Few studies report on energy loss in cell culture equipment. The ability of energy from light with therapeutic potential to reach cells in culture needs to be determined; this includes determining the proportion of light energy lost within standard cell culture media and cell culture vessels. The energy absorption of cell culture media, with/without the pH indicator dye phenol red, and the loss of energy within different plastics and glassware used typically for in vitro cell culture were investigated using intense pulsed light and a yellow pulsed dye laser. Media containing phenol red have a distinctive absorption peak (560 nm) absent in phenol red-free media and restored by the addition of phenol red. For both light sources, energy loss was lowest in standard polystyrene tissue culture flasks or multi-well plates and highest in polypropylene vessels or glass tubes. The effects of phenol red-free media on the absorption of energy varied with the light source used. Phenol red-free media are the media of choice; polystyrene vessels with flat surfaces such as culture flasks or multi-well plates should be used in preference to polypropylene or glass vessels.

Surface modified alginate microcapsules for 3D cell culture

Science.gov (United States)

Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

2016-06-01

Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning

DEFF Research Database (Denmark)

Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin

2005-01-01

SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture........ The contact angle of SU-8 surface was significantly reduced from 90° to 25° after the surface modification. The treated SU-8 surfaces provided a cell culture environment that was comparable with cell culture flask surface in terms of generation time and morphology....

Identification of differences in gene expression in primary cell cultures of human endometrial epithelial cells and trophoblast cells following their interaction

DEFF Research Database (Denmark)

Høgh, Mette; Islin, Henrik; Møller, Charlotte

2006-01-01

The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...

Establishment of automated culture system for murine induced pluripotent stem cells

Directory of Open Access Journals (Sweden)

Koike Hiroyuki

2012-11-01

Full Text Available Abstract Background Induced pluripotent stem (iPS cells can differentiate into any cell type, which makes them an attractive resource in fields such as regenerative medicine, drug screening, or in vitro toxicology. The most important prerequisite for these industrial applications is stable supply and uniform quality of iPS cells. Variation in quality largely results from differences in handling skills between operators in laboratories. To minimize these differences, establishment of an automated iPS cell culture system is necessary. Results We developed a standardized mouse iPS cell maintenance culture, using an automated cell culture system housed in a CO2 incubator commonly used in many laboratories. The iPS cells propagated in a chamber uniquely designed for automated culture and showed specific colony morphology, as for manual culture. A cell detachment device in the system passaged iPS cells automatically by dispersing colonies to single cells. In addition, iPS cells were passaged without any change in colony morphology or expression of undifferentiated stem cell markers during the 4 weeks of automated culture. Conclusions Our results show that use of this compact, automated cell culture system facilitates stable iPS cell culture without obvious effects on iPS cell pluripotency or colony-forming ability. The feasibility of iPS cell culture automation may greatly facilitate the use of this versatile cell source for a variety of biomedical applications.

Youth Culture and Cell Phone

Directory of Open Access Journals (Sweden)

mohammad saeed zokaei

2009-11-01

Full Text Available Iranian youth’s leisure culture has been immediately affected by the digital media culture. As a communicative media, cell phone has crossed borders of youth norms and identity; and in addition to facilitating their communication, has changed its patterns. Applying Bourdieu’s concepts of habitus and field, and relied on the qualitative and quantitative data gathered from the mobile youth users, the present study argues that mobile has produced a new field in which youth’s opportunities for leisure, entertainment, communication, and independence have extended. In addition, cell phone has facilitated and compensated for some defects in public sphere, and therefore empowered youth agency, individuality, and power. Despite this strengthening, cell phone does not cross borders of gender and class differences, or the levels of social capital.

Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

Directory of Open Access Journals (Sweden)

Camila Bonazza

Full Text Available Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2 and progesterone (P4 effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation. These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

Cell culture density affects the proliferation activity of human adipose tissue stem cells.

Science.gov (United States)

Kim, Dae Seong; Lee, Myoung Woo; Ko, Young Jong; Chun, Yong Hoon; Kim, Hyung Joon; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee

2016-01-01

In this study, we investigated the effect of cell density on the proliferation activity of human mesenchymal stem cells (MSCs) derived from adipose tissue (AT-MSCs) over time in culture. Passage #4 (P4) and #12 (P12) AT-MSCs from two donors were plated at a density of 200 (culture condition 1, CC1) or 5000 (culture condition 2, CC2) cells cm(-2) . After 7 days of incubation, P4 and P12 AT-MSCs cultured in CC1 were thin and spindle-shaped, whereas those cultured in CC2 had extensive cell-to-cell contacts and an expanded cell volume. In addition, P4 and P12 AT-MSCs in CC1 divided more than three times, while those in CC2 divided less than once on average. Flow cytometric analysis using 5(6)-carboxyfluorescein diacetate N-succinimidyl ester dye showed that the fluorescence intensity of AT-MSCs was lower in CC1 than in CC2. Furthermore, expression of proliferation-associated genes, such as CDC45L, CDC20A and KIF20A, in P4 AT-MSCs was higher in CC1 than in CC2, and this difference was also observed in P12 AT-MSCs. These data demonstrated that cell culture density affects the proliferation activity of MSCs, suggesting that it is feasible to design a strategy to prepare suitable MSCs using specific culture conditions. Copyright © 2016 John Wiley & Sons, Ltd.

Nanotechnology, Cell Culture and Tissue Engineering

Directory of Open Access Journals (Sweden)

Kazutoshi Haraguchi

2011-01-01

Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

Recombinant Protein Production and Insect Cell Culture and Process

Science.gov (United States)

Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

1997-01-01

A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

Metabolite profiling of microfluidic cell culture conditions for droplet based screening

DEFF Research Database (Denmark)

Björk, Sara M.; Sjoström, Staffan L.; Svahn, Helene Andersson

2015-01-01

We investigate the impact of droplet culture conditions on cell metabolic state by determining key metabolite concentrations in S. cerevisiae cultures in different microfluidic droplet culture formats. Control of culture conditions is critical for single cell/clone screening in droplets......, such as directed evolution of yeast, as cell metabolic state directly affects production yields from cell factories. Here, we analyze glucose, pyruvate, ethanol, and glycerol, central metabolites in yeast glucose dissimilation to establish culture formats for screening of respiring as well as fermenting yeast...... limited cultures, whereas the metabolite profiles of cells cultured in the alternative wide tube droplet incubation format resemble those from aerobic culture. Furthermore, we demonstrate retained droplet stability and size in the new better oxygenated droplet incubation format....

A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function

Science.gov (United States)

Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.

2018-01-01

Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488

Sponge cell culture? A molecular identification method for sponge cells

NARCIS (Netherlands)

Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

2003-01-01

Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure.

Science.gov (United States)

Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y

2016-11-01

To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.

21st Century Cell Culture for 21st Century Toxicology.

Science.gov (United States)

Pamies, David; Hartung, Thomas

2017-01-17

There is no good science in bad models. Cell culture is especially prone to artifacts. A number of novel cell culture technologies have become more broadly available in the 21st century, which allow overcoming limitations of traditional culture and are more physiologically relevant. These include the use of stem-cell derived human cells, cocultures of different cell types, scaffolds and extracellular matrices, perfusion platforms (such as microfluidics), 3D culture, organ-on-chip technologies, tissue architecture, and organ functionality. The physiological relevance of such models is further enhanced by the measurement of biomarkers (e.g., key events of pathways), organ specific functionality, and more comprehensive assessment cell responses by high-content methods. These approaches are still rarely combined to create microphysiological systems. The complexity of the combination of these technologies can generate results closer to the in vivo situation but increases the number of parameters to control, bringing some new challenges. In fact, we do not argue that all cell culture needs to be that sophisticated. The efforts taken are determined by the purpose of our experiments and tests. If only a very specific molecular target to cell response is of interest, a very simple model, which reflects this, might be much more suited to allow standardization and high-throughput. However, the less defined the end point of interest and cellular response are, the better we should approximate organ- or tissue-like culture conditions to make physiological responses more probable. Besides these technologic advances, important progress in the quality assurance and reporting on cell cultures as well as the validation of cellular test systems brings the utility of cell cultures to a new level. The advancement and broader implementation of Good Cell Culture Practice (GCCP) is key here. In toxicology, this is a major prerequisite for meaningful and reliable results, ultimately

Microfluidic perfusion culture of human induced pluripotent stem cells under fully defined culture conditions.

Science.gov (United States)

Yoshimitsu, Ryosuke; Hattori, Koji; Sugiura, Shinji; Kondo, Yuki; Yamada, Rotaro; Tachikawa, Saoko; Satoh, Taku; Kurisaki, Akira; Ohnuma, Kiyoshi; Asashima, Makoto; Kanamori, Toshiyuki

2014-05-01

Human induced pluripotent stem cells (hiPSCs) are a promising cell source for drug screening. For this application, self-renewal or differentiation of the cells is required, and undefined factors in the culture conditions are not desirable. Microfluidic perfusion culture allows the production of small volume cultures with precisely controlled microenvironments, and is applicable to high-throughput cellular environment screening. Here, we developed a microfluidic perfusion culture system for hiPSCs that uses a microchamber array chip under defined extracellular matrix (ECM) and culture medium conditions. By screening various ECMs we determined that fibronectin and laminin are appropriate for microfluidic devices made out of the most popular material, polydimethylsiloxane (PDMS). We found that the growth rate of hiPSCs under pressure-driven perfusion culture conditions was higher than under static culture conditions in the microchamber array. We applied our new system to self-renewal and differentiation cultures of hiPSCs, and immunocytochemical analysis showed that the state of the hiPSCs was successfully controlled. The effects of three antitumor drugs on hiPSCs were comparable between microchamber array and 96-well plates. We believe that our system will be a platform technology for future large-scale screening of fully defined conditions for differentiation cultures on integrated microfluidic devices. © 2013 Wiley Periodicals, Inc.

An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.

LENUS (Irish Health Repository)

McDonnell, R J

1997-12-12

An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.

Quantitative volumetric Raman imaging of three dimensional cell cultures

Science.gov (United States)

Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

2017-03-01

The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell-material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

The Effect of Primary Cancer Cell Culture Models on the Results of Drug Chemosensitivity Assays: The Application of Perfusion Microbioreactor System as Cell Culture Vessel

Science.gov (United States)

Chen, Yi-Dao; Huang, Shiang-Fu; Wang, Hung-Ming

2015-01-01

To precisely and faithfully perform cell-based drug chemosensitivity assays, a well-defined and biologically relevant culture condition is required. For the former, a perfusion microbioreactor system capable of providing a stable culture condition was adopted. For the latter, however, little is known about the impact of culture models on the physiology and chemosensitivity assay results of primary oral cavity cancer cells. To address the issues, experiments were performed. Results showed that minor environmental pH change could significantly affect the metabolic activity of cells, demonstrating the importance of stable culture condition for such assays. Moreover, the culture models could also significantly influence the metabolic activity and proliferation of cells. Furthermore, the choice of culture models might lead to different outcomes of chemosensitivity assays. Compared with the similar test based on tumor-level assays, the spheroid model could overestimate the drug resistance of cells to cisplatin, whereas the 2D and 3D culture models might overestimate the chemosensitivity of cells to such anticancer drug. In this study, the 3D culture models with same cell density as that in tumor samples showed comparable chemosensitivity assay results as the tumor-level assays. Overall, this study has provided some fundamental information for establishing a precise and faithful drug chemosensitivity assay. PMID:25654105

Bags versus flasks: a comparison of cell culture systems for the production of dendritic cell-based immunotherapies.

Science.gov (United States)

Fekete, Natalie; Béland, Ariane V; Campbell, Katie; Clark, Sarah L; Hoesli, Corinne A

2018-04-19

In recent years, cell-based therapies targeting the immune system have emerged as promising strategies for cancer treatment. This review summarizes manufacturing challenges related to production of antigen presenting cells as a patient-tailored cancer therapy. Understanding cell-material interactions is essential because in vitro cell culture manipulations to obtain mature antigen-producing cells can significantly alter their in vivo performance. Traditional antigen-producing cell culture protocols often rely on cell adhesion to surface-treated hydrophilic polystyrene flasks. More recent commercial and investigational cancer immunotherapy products were manufactured using suspension cell culture in closed hydrophobic fluoropolymer bags. The shift to closed cell culture systems can decrease risks of contamination by individual operators, as well as facilitate scale-up and automation. Selecting closed cell culture bags over traditional open culture systems entails different handling procedures and processing controls, which can affect product quality. Changes in culture vessels also entail changes in vessel materials and geometry, which may alter the cell microenvironment and resulting cell fate decisions. Strategically designed culture systems will pave the way for the generation of more sophisticated and highly potent cell-based cancer vaccines. As an increasing number of cell-based therapies enter the clinic, the selection of appropriate cell culture vessels and materials becomes a critical consideration that can impact the therapeutic efficacy of the product, and hence clinical outcomes and patient quality of life. © 2018 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

In vitro evaluation of poly(ethylene glycol)-block-poly(ε-caprolactone) methyl ether copolymer coating effects on cells adhesion and proliferation

Energy Technology Data Exchange (ETDEWEB)

Rusen, Laurentiu [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Neacsu, Patricia; Cimpean, Anisoara [University of Bucharest, Department of Biochemistry and Molecular Biology, Bucharest (Romania); Valentin, Ion; Brajnicov, Simona; Dumitrescu, L.N. [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Banita, Janina [University of Bucharest, Faculty of Chemistry, Bucharest (Romania); IBAR, Institute of Biochemistry of the Romanian Academy, 296 Splaiul Independentei, RO-060031 Bucharest (Romania); Dinca, Valentina, E-mail: valentina.dinca@inflpr.ro [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania); Dinescu, Maria [National Institute for Lasers, Plasma and Radiation Physics, Bucharest (Romania)

2016-06-30

Understanding and controlling natural and synthetic biointerfaces is known to be the key to a wide variety of application within cell culture and tissue engineering field. As both material characteristics and methods are important in tailoring biointerfaces characteristics, in this work we explore the feasibility of using Matrix Assisted Pulsed Laser Evaporation technique for obtaining synthetic copolymeric biocoatings (i.e. poly(ethylene glycol)-block-poly(ε-caprolactone) methyl ether) for evaluating in vitro Vero and MC3T3-E1 pre-osteoblasts cell response. Characterization and evaluation of the coated substrates were carried out using different techniques. The Fourier transform infrared spectroscopy data demonstrated that the main functional groups in the MAPLE-deposited films remained intact. Atomic Force Microscopy images showed the coatings to be continuous, with the surface roughness depending on the deposition parameters. Moreover, the behaviour of the coatings in medium mimicking the pH and temperature of the human body was studied and corelated to degradation. Spectro-ellipsometry (SE) and AFM measurements revealed the degradation trend during immersion time by the changes in coating thickness and roughness. In vitro biocompatibility was studied by indirect contact tests on Vero cells in accordance with ISO 10993-5/2009. The results obtained in terms of cell morphology (phase contrast microscopy) and cytotoxicity (LDH and MTT assays) proved biocompatibility. Furthermore, direct contact assays on MC3T3-E1 pre-osteoblasts demonstrated the capacity of all analyzed specimens to support cell adhesion, normal cellular morphology and growth.

In vitro evaluation of poly(ethylene glycol)-block-poly(ɛ-caprolactone) methyl ether copolymer coating effects on cells adhesion and proliferation

Science.gov (United States)

Rusen, Laurentiu; Neacsu, Patricia; Cimpean, Anisoara; Valentin, Ion; Brajnicov, Simona; Dumitrescu, L. N.; Banita, Janina; Dinca, Valentina; Dinescu, Maria

2016-06-01

Understanding and controlling natural and synthetic biointerfaces is known to be the key to a wide variety of application within cell culture and tissue engineering field. As both material characteristics and methods are important in tailoring biointerfaces characteristics, in this work we explore the feasibility of using Matrix Assisted Pulsed Laser Evaporation technique for obtaining synthetic copolymeric biocoatings (i.e. poly(ethylene glycol)-block-poly(ɛ-caprolactone) methyl ether) for evaluating in vitro Vero and MC3T3-E1 pre-osteoblasts cell response. Characterization and evaluation of the coated substrates were carried out using different techniques. The Fourier transform infrared spectroscopy data demonstrated that the main functional groups in the MAPLE-deposited films remained intact. Atomic Force Microscopy images showed the coatings to be continuous, with the surface roughness depending on the deposition parameters. Moreover, the behaviour of the coatings in medium mimicking the pH and temperature of the human body was studied and corelated to degradation. Spectro-ellipsometry (SE) and AFM measurements revealed the degradation trend during immersion time by the changes in coating thickness and roughness. In vitro biocompatibility was studied by indirect contact tests on Vero cells in accordance with ISO 10993-5/2009. The results obtained in terms of cell morphology (phase contrast microscopy) and cytotoxicity (LDH and MTT assays) proved biocompatibility. Furthermore, direct contact assays on MC3T3-E1 pre-osteoblasts demonstrated the capacity of all analyzed specimens to support cell adhesion, normal cellular morphology and growth.

Three-dimensional hydrogel cell culture systems for modeling neural tissue

Science.gov (United States)

Frampton, John

Two-dimensional (2-D) neural cell culture systems have served as physiological models for understanding the cellular and molecular events that underlie responses to physical and chemical stimuli, control sensory and motor function, and lead to the development of neurological diseases. However, the development of three-dimensional (3-D) cell culture systems will be essential for the advancement of experimental research in a variety of fields including tissue engineering, chemical transport and delivery, cell growth, and cell-cell communication. In 3-D cell culture, cells are provided with an environment similar to tissue, in which they are surrounded on all sides by other cells, structural molecules and adhesion ligands. Cells grown in 3-D culture systems display morphologies and functions more similar to those observed in vivo, and can be cultured in such a way as to recapitulate the structural organization and biological properties of tissue. This thesis describes a hydrogel-based culture system, capable of supporting the growth and function of several neural cell types in 3-D. Alginate hydrogels were characterized in terms of their biomechanical and biochemical properties and were functionalized by covalent attachment of whole proteins and peptide epitopes. Methods were developed for rapid cross-linking of alginate hydrogels, thus permitting the incorporation of cells into 3-D scaffolds without adversely affecting cell viability or function. A variety of neural cell types were tested including astrocytes, microglia, and neurons. Cells remained viable and functional for longer than two weeks in culture and displayed process outgrowth in 3-D. Cell constructs were created that varied in cell density, type and organization, providing experimental flexibility for studying cell interactions and behavior. In one set of experiments, 3-D glial-endothelial cell co-cultures were used to model blood-brain barrier (BBB) structure and function. This co-culture system was

Cell-cycle distributions and radiation responses of Chinese hamster cells cultured continuously under hypoxic conditions

International Nuclear Information System (INIS)

Tokita, N.; Carpenter, S.G.; Raju, M.R.

1984-01-01

Cell-cycle distributions were measured by flow cytometry for Chinese hamster (CHO) cells cultured continuously under hypoxic conditions. DNA histograms showed an accumulation of cells in the early S phase followed by a traverse delay through the S phase, and a G 2 block. During hypoxic culturing, cell viability decreased rapidly to less than 0.1% at 120 h. Radiation responses for cells cultured under these conditions showed an extreme radioresistance at 72 h. Results suggest that hypoxia induces a condition similar to cell synchrony which itself changes the radioresistance of hypoxic cells. (author)

Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.

Science.gov (United States)

Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali

2011-03-01

Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.

Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures.

Science.gov (United States)

Gebhard, C; Gabriel, C; Walter, I

2016-06-01

Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. © 2015 The Authors. Anatomia, Histologia, Embryologia Published by Blackwell Verlag GmbH.

A microwell cell culture platform for the aggregation of pancreatic β-cells.

Science.gov (United States)

Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

2012-08-01

Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered.

Quantitative volumetric Raman imaging of three dimensional cell cultures

KAUST Repository

Kallepitis, Charalambos

2017-03-22

The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell–material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

Cell division requirement for activation of murine leukemia virus in cell culture by irradiation

International Nuclear Information System (INIS)

Otten, J.A.; Quarles, J.M.; Tennant, R.W.

1976-01-01

Actively dividing cultures of AKR mouse cells were exposed to relatively low dose-rates of γ radiation and tested for activation of endogenous leukemia viruses. Efficient and reproducible induction of virus was obtained with actively dividing cells, but cultures deprived of serum to inhibit cell division before and during γ irradiation were not activated, even when medium with serum was added immediately after irradiation. These results show that cell division was required for virus induction but that a stable intermediate similar to the state induced by halogenated pyrimidines was not formed. In actively dividing AKR cell cultures, virus activation appeared to be proportional to the dose of γ radiation; the estimated frequency of activation was 1-8 x 10 - 5 per exposed cell and the efficiency of activation was approximately 0.012 inductions per cell per rad. Other normal primary and established mouse cell cultures tested were not activated by γ radiation. The requirement of cell division for radiation and chemical activation may reflect some common mechanism for initiation of virus expression

Metabolic studies of 2'-fluoro-5-iodo-1-β-D-arabinofuranosylcytosine (FIAC)

International Nuclear Information System (INIS)

Van Nostrand, M.; Oshana, S.; Speelman, D.J.; McLaren, C.; Chen, M.S.

1986-01-01

Metabolic studies of FIAC were carried out in herpes simplex virus type 1 and mock infected Vero cells using HPLC purified [2- 14 C]FIAC. HSV-1 infected and mock infected Vero cells were incubated with 2 μM [2- 14 C]FIAC for 24 hrs. DNA purified from both viral and mock infected cells was hydrolyzed with DNAase 1 and venom phosphodiesterase. The resulting deoxynucleoside monophosphate derivatives were analyzed by HPLC (Whatman SAX column). Only FIAU, the deamination product of FIAC, was found in DNA from both HSV-1 infected and mock infected Vero cells, while FAC, FMAU and FIAC were not detected. Whereas 0.112% of Tdr in DNA from mock infected cells was substituted by FIAU 1.056% of the Tdr in viral DNA from HSV-1 infected cells was substituted by FIAU. HPLC analysis (Whatman SAX column) of medium from HSV-1 infected cell cultures showed that all [2- 14 C] FIAC had been metabolized to [2- 14 C]FIAU, while no [2- 14 C]FIAU could be detected in the medium of mock infected cells. HPLC analysis of HC10 4 extracts of HSV-1 infected cells showed that the percentages of various phosphorylated derivatives were 10% FIAU, 76% FIAU monophosphate, 9% FIAU diphosphate and 5% FIAU triphosphate. These data showed conclusively that FIAU is the active antiviral metabolite of FIAC

T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity

Science.gov (United States)

Bradley, Jillian H.; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P.; Gregg, Randal K.

2017-11-01

Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter. When

Tumor necrosis factor (cachetin) decreases adipose cell differentiation in primary cell culture

International Nuclear Information System (INIS)

Martin, R.J.; Jones, D.D.; Jewell, D.E.; Hausman, G.J.

1986-01-01

Cachetin has been shown to effect gene product expression in the established adipose cell line 3T3-L1. Expression of messenger RNA for lipoprotein lipase is suppressed in cultured adipocytes. The purpose of this study was to determine the effect of Cachetin on adipose cell differentiation in primary cell culture. Stromalvascular cells obtained from the inguinal fat pad of 4-5 week old Sprague-Dawley rats were grown in culture for two weeks. During the proliferative growth phase all cells were grown on the same medium and labelled with 3 H-thymidine. Cachetin treatment (10 -6 to 10 -10 M) was initiated on day 5, the initial phase of preadipocyte differentiation. Adipocytes and stromal cells were separated using density gradient, and 3 H-thymidine was determined for both cell types. Thymidine incorporation into adipose cells was decreased maximally (∼ 50%) at 10 -10 M. Stromalvascular cells were not influenced at any of the doses tested. Adipose cell lipid content as indicated by oil red-O staining was decreased by Cachetin. Esterase staining by adipose cells treated with Cachetin was increased indicating an increase in intracellular lipase. These studies show that Cachetin has specific effects on primary adipose cell differentiation

Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

Science.gov (United States)

Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

1996-01-01

In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

Characterization of primary human mammary epithelial cells isolated and propagated by conditional reprogrammed cell culture.

Science.gov (United States)

Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang

2018-02-20

Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.

Antitumor Activity of Rat Mesenchymal Stem Cells during Direct or Indirect Co-Culturing with C6 Glioma Cells.

Science.gov (United States)

Gabashvili, A N; Baklaushev, V P; Grinenko, N F; Mel'nikov, P A; Cherepanov, S A; Levinsky, A B; Chehonin, V P

2016-02-01

The tumor-suppressive effect of rat mesenchymal stem cells against low-differentiated rat C6 glioma cells during their direct and indirect co-culturing and during culturing of C6 glioma cells in the medium conditioned by mesenchymal stem cells was studied in an in vitro experiment. The most pronounced antitumor activity of mesenchymal stem cells was observed during direct co-culturing with C6 glioma cells. The number of live C6 glioma cells during indirect co-culturing and during culturing in conditioned medium was slightly higher than during direct co-culturing, but significantly differed from the control (C6 glioma cells cultured in medium conditioned by C6 glioma cells). The cytotoxic effect of medium conditioned by mesenchymal stem cells was not related to medium depletion by glioma cells during their growth. The medium conditioned by other "non-stem" cells (rat astrocytes and fibroblasts) produced no tumor-suppressive effect. Rat mesenchymal stem cells, similar to rat C6 glioma cells express connexin 43, the main astroglial gap junction protein. During co-culturing, mesenchymal stem cells and glioma C6 cells formed functionally active gap junctions. Gap junction blockade with connexon inhibitor carbenoxolone attenuated the antitumor effect observed during direct co-culturing of C6 glioma cells and mesenchymal stem cells to the level produced by conditioned medium. Cell-cell signaling mediated by gap junctions can be a mechanism of the tumor-suppressive effect of mesenchymal stem cells against C6 glioma cells. This phenomenon can be used for the development of new methods of cell therapy for high-grade malignant gliomas.

Advances in tissue engineering through stem cell-based co-culture.

Science.gov (United States)

Paschos, Nikolaos K; Brown, Wendy E; Eswaramoorthy, Rajalakshmanan; Hu, Jerry C; Athanasiou, Kyriacos A

2015-05-01

Stem cells are the future in tissue engineering and regeneration. In a co-culture, stem cells not only provide a target cell source with multipotent differentiation capacity, but can also act as assisting cells that promote tissue homeostasis, metabolism, growth and repair. Their incorporation into co-culture systems seems to be important in the creation of complex tissues or organs. In this review, critical aspects of stem cell use in co-culture systems are discussed. Direct and indirect co-culture methodologies used in tissue engineering are described, along with various characteristics of cellular interactions in these systems. Direct cell-cell contact, cell-extracellular matrix interaction and signalling via soluble factors are presented. The advantages of stem cell co-culture strategies and their applications in tissue engineering and regenerative medicine are portrayed through specific examples for several tissues, including orthopaedic soft tissues, bone, heart, vasculature, lung, kidney, liver and nerve. A concise review of the progress and the lessons learned are provided, with a focus on recent developments and their implications. It is hoped that knowledge developed from one tissue can be translated to other tissues. Finally, we address challenges in tissue engineering and regenerative medicine that can potentially be overcome via employing strategies for stem cell co-culture use. Copyright © 2014 John Wiley & Sons, Ltd.

Stimulation of DNA synthesis in cultured rat alveolar type II cells

International Nuclear Information System (INIS)

Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

1985-01-01

Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture

Enhanced resolution of membranes in cultured cells by cryoimmobilization and freeze-substitution.

Science.gov (United States)

Wild, P; Schraner, E M; Adler, H; Humbel, B M

2001-05-15

Investigations of cellular processes demand immediate arresting of the process at any given time and excellent retention of cellular material and excellent visibility of membranes. To achieve this goal we used cryofixation to arrest cellular processes instantly and tested diverse freeze-substitution protocols. Madin-Darby kidney cells and Vero cells were grown on carbon-coated sapphire disks. For cryofixation the sapphire disks covered with a cell monolayer were injected with the aid of a guillotine into liquid propane or ethane or a mixture of both cooled by liquid nitrogen. Freezing of the cryogen was prevented by using a partially insulated cylinder and by vigorous stirring that results in a substantial decrement of the freezing point of the cryogen. Cell monolayers can be cryofixed successfully using the guillotine in a safety hood at ambient temperature and humidity or at 37 degrees C and 45% humidity. The freezing unit can also be placed in a laminar flow for working under biohazard conditions. For visualizing cell membranes at high contrast and high resolution, cells were substituted in the presence of various concentrations of glutaraldehyde and osmium tetroxide and the temperature was raised to diverse final temperatures. Substitution for 4 hours at -90 degrees C in anhydrous acetone containing 0.25% anhydrous glutaraldehyde and 0.5% osmium tetroxide followed by a temperature rise of 5 degrees C/hour to 0 degrees C and final incubation for 1 hour at 0 degrees C resulted in high contrast and excellent visibility of subcellular components at the level of the membrane bilayer. The high spatial and temporal resolution makes this methodology an excellent tool for studying cell membrane-bound processes, such as virus-cell interactions. Copyright 2001 Wiley-Liss, Inc.

EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE

NARCIS (Netherlands)

MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ

A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of

Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells in irradiated bone marrow cell culture in vitro

International Nuclear Information System (INIS)

Fujitake, Hideki; Okamoto, Yuruko; Okubo, Hiroshi; Miyanomae, Takeshi; Kumagai, Keiko; Mori, K.J.

1981-01-01

Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 10 7 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 10 6 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 10 7 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)

21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...

Retinal pigment epithelium culture;a potential source of retinal stem cells.

Science.gov (United States)

Akrami, Hassan; Soheili, Zahra-Soheila; Khalooghi, Keynoush; Ahmadieh, Hamid; Rezaie-Kanavi, Mojgan; Samiei, Shahram; Davari, Malihe; Ghaderi, Shima; Sanie-Jahromi, Fatemeh

2009-07-01

To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in size. After removing the sclera and choroid, remaining tissues were washed in phosphate buffer saline and RPE cells were isolated using dispase enzyme solution and cultured in Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12 supplemented with 10% fetal calf serum. Primary cultures of RPE cells were established and spheroid colonies related to progenitor/stem cells developed in a number of cultures. The colonies included purely pigmented or mixed pigmented and non-pigmented cells. After multiple cellular passages, several types of photoreceptors and neural-like cells were detected morphologically. Cellular plasticity in RPE cell cultures revealed promising results in terms of generation of stem/progenitor cells from human RPE cells. Whether the spheroids and neural-like retinal cells were directly derived from retinal stem cells or offspring of trans-differentiating or de-differentiating RPE cells remains to be answered.

Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

OpenAIRE

Sundin, D R; Mecham, J O

1989-01-01

The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

Enrichment of skin-derived neural precursor cells from dermal cell populations by altering culture conditions.

Science.gov (United States)

Bayati, Vahid; Gazor, Rohoullah; Nejatbakhsh, Reza; Negad Dehbashi, Fereshteh

2016-01-01

As stem cells play a critical role in tissue repair, their manipulation for being applied in regenerative medicine is of great importance. Skin-derived precursors (SKPs) may be good candidates for use in cell-based therapy as the only neural stem cells which can be isolated from an accessible tissue, skin. Herein, we presented a simple protocol to enrich neural SKPs by monolayer adherent cultivation to prove the efficacy of this method. To enrich neural SKPs from dermal cell populations, we have found that a monolayer adherent cultivation helps to increase the numbers of neural precursor cells. Indeed, we have cultured dermal cells as monolayer under serum-supplemented (control) and serum-supplemented culture, followed by serum free cultivation (test) and compared. Finally, protein markers of SKPs were assessed and compared in both experimental groups and differentiation potential was evaluated in enriched culture. The cells of enriched culture concurrently expressed fibronectin, vimentin and nestin, an intermediate filament protein expressed in neural and skeletal muscle precursors as compared to control culture. In addition, they possessed a multipotential capacity to differentiate into neurogenic, glial, adipogenic, osteogenic and skeletal myogenic cell lineages. It was concluded that serum-free adherent culture reinforced by growth factors have been shown to be effective on proliferation of skin-derived neural precursor cells (skin-NPCs) and drive their selective and rapid expansion.

T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity.

Science.gov (United States)

Bradley, Jillian H; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P; Gregg, Randal K

2017-11-01

Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter

Identification of a population of cells with hematopoietic stem cell properties in mouse aorta-gonad-mesonephros cultures

International Nuclear Information System (INIS)

Nobuhisa, Ikuo; Ohtsu, Naoki; Okada, Seiji; Nakagata, Naomi; Taga, Tetsuya

2007-01-01

The aorta-gonad-mesonephros (AGM) region is a primary source of definitive hematopoietic cells in the midgestation mouse embryo. In cultures of dispersed AGM regions, adherent cells containing endothelial cells are observed first, and then non-adherent hematopoietic cells are produced. Here we report on the characterization of hematopoietic cells that emerge in the AGM culture. Based on the expression profiles of CD45 and c-Kit, we defined three cell populations: CD45 low c-Kit + cells that had the ability to form hematopoietic cell colonies in methylcellulose media and in co-cultures with stromal cells; CD45 low c-Kit - cells that showed a granulocyte morphology; CD45 high c-Kit low/- that exhibited a macrophage morphology. In co-cultures of OP9 stromal cells and freshly prepared AGM cultures, CD45 low c-Kit + cells from the AGM culture had the abilities to reproduce CD45 low c-Kit + cells and differentiate into CD45 low c-Kit - and CD45 high c-Kit low/- cells, whereas CD45 low c-Kit - and CD45 high c-Kit low/- did not produce CD45 low c-Kit + cells. Furthermore, CD45 low c-Kit + cells displayed a long-term repopulating activity in adult hematopoietic tissue when transplanted into the liver of irradiated newborn mice. These results indicate that CD45 low c-Kit + cells from the AGM culture have the potential to reconstitute multi-lineage hematopoietic cells

Cell fiber-based three-dimensional culture system for highly efficient expansion of human induced pluripotent stem cells.

Science.gov (United States)

Ikeda, Kazuhiro; Nagata, Shogo; Okitsu, Teru; Takeuchi, Shoji

2017-06-06

Human pluripotent stem cells are a potentially powerful cellular resource for application in regenerative medicine. Because such applications require large numbers of human pluripotent stem cell-derived cells, a scalable culture system of human pluripotent stem cell needs to be developed. Several suspension culture systems for human pluripotent stem cell expansion exist; however, it is difficult to control the thickness of cell aggregations in these systems, leading to increased cell death likely caused by limited diffusion of gases and nutrients into the aggregations. Here, we describe a scalable culture system using the cell fiber technology for the expansion of human induced pluripotent stem (iPS) cells. The cells were encapsulated and cultured within the core region of core-shell hydrogel microfibers, resulting in the formation of rod-shaped or fiber-shaped cell aggregations with sustained thickness and high viability. By encapsulating the cells with type I collagen, we demonstrated a long-term culture of the cells by serial passaging at a high expansion rate (14-fold in four days) while retaining its pluripotency. Therefore, our culture system could be used for large-scale expansion of human pluripotent stem cells for use in regenerative medicine.

Cystine uptake by cultured cells originating from dog proximal tubule segments

International Nuclear Information System (INIS)

States, B.; Reynolds, R.; Lee, J.; Segal, S.

1990-01-01

Large numbers of kidney epithelial cells were cultured successfully from isolated dog proximal tubule segments. Cells in primary culture and in first passage retained the cystine-dibasic amino acid co-transporter system which is found in vivo and in freshly isolated proximal tubule segments. In contrast to other cultured cells, the cystine-glutamate anti-porter was absent in primary cultures. However, this anti-porter system seemed to be developing in cells in first passage. The intracellular ratio of cysteine:reduced glutathione (CSH:GSH) was maintained at 1:36 in both primary cultures and in low passage cells. Incubation of cells in primary culture for 5 min at 37 degrees C with 0.025 mM [ 35 S]L-cystine resulted in incorporation of approximately 36 and 8.5% of the label into intracellular CSH and GSH, respectively. These cultured cells, therefore, seem to be an excellent model system for the eventual elucidation of (a) the inticacies of cystine metabolism and (b) regulation of (1) the cystine-dibasic amino acid co-transporter system and (2) the development of the cysteine-glutamate anti-porter system

Inhibition of apoptosis using exosomes in Chinese hamster ovary cell culture.

Science.gov (United States)

Han, Seora; Rhee, Won Jong

2018-05-01

Animal cell culture technology for therapeutic protein production has shown significant improvement over the last few decades. Chinese hamster ovary (CHO) cells have been widely adapted for the production of biopharmaceutical drugs. In the biopharmaceutical industry, it is crucial to develop cell culture media and culturing conditions to achieve the highest productivity and quality. However, CHO cells are significantly affected by apoptosis in the bioreactors, resulting in a substantial decrease in product quantity and quality. Thus, to overcome the obstacle of apoptosis in CHO cell culture, it is critical to develop a novel method that does not have minimal concern of safety or cost. Herein, we showed for the first time that exosomes, which are nano-sized extracellular vesicles, derived from CHO cells inhibited apoptosis in CHO cell culture when supplemented to the culture medium. Flow cytometric and microscopic analyses revealed that substantial amounts of exosomes were delivered to CHO cells. Higher cell viability after staurosporine treatment was observed by exosome supplementation (67.3%) as compared to control (41.1%). Furthermore, exosomes prevented the mitochondrial membrane potential loss and caspase-3 activation, meaning that the exosomes enhanced cellular activities under pro-apoptotic condition. As the exosomes supplements are derived from CHO cells themselves, it is not only beneficial for the biopharmaceutical productivity of CHO cell culture to inhibit apoptosis, but also from a regulatory standpoint to diminish any safety concerns. Thus, we conclude that the method developed in this research may contribute to the biopharmaceutical industry where minimizing apoptosis in CHO cell culture is beneficial. © 2018 Wiley Periodicals, Inc.

Isolation and Characterization of Poliovirus in Cell Culture Systems.

Science.gov (United States)

Thorley, Bruce R; Roberts, Jason A

2016-01-01

The isolation and characterization of enteroviruses by cell culture was accepted as the "gold standard" by clinical virology laboratories. Methods for the direct detection of all enteroviruses by reverse transcription polymerase chain reaction, targeting a conserved region of the genome, have largely supplanted cell culture as the principal diagnostic procedure. However, the World Health Organization's Global Polio Eradication Initiative continues to rely upon cell culture to isolate poliovirus due to the lack of a reliable sensitive genetic test for direct typing of enteroviruses from clinical specimens. Poliovirus is able to infect a wide range of mammalian cell lines, with CD155 identified as the primary human receptor for all three seroytpes, and virus replication leads to an observable cytopathic effect. Inoculation of cell lines with extracts of clinical specimens and subsequent passaging of the cells leads to an increased virus titre. Cultured isolates of poliovirus are suitable for testing by a variety of methods and remain viable for years when stored at low temperature.This chapter describes general procedures for establishing a cell bank and routine passaging of cell lines. While the sections on specimen preparation and virus isolation focus on poliovirus, the protocols are suitable for other enteroviruses.

SAHA-induced TRAIL-sensitisation of Multiple Myeloma cells is enhanced in 3D cell culture.

Science.gov (United States)

Arhoma, A; Chantry, A D; Haywood-Small, S L; Cross, N A

2017-11-15

Multiple Myeloma (MM) is currently incurable despite many novel therapies. Tumour Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL) is a potential anti-tumour agent although effects as a single agent are limited. In this study, we investigated whether the Histone Deacetylase (HDAC) inhibitor SAHA can enhance TRAIL-induced apoptosis and target TRAIL resistance in both suspension culture, and 3D cell culture as a model of disseminated MM lesions that form in bone. The effects of SAHA and/or TRAIL in 6 Multiple Myeloma cell lines were assessed in both suspension cultures and in an Alginate-based 3D cell culture model. The effect of SAHA and/or TRAIL was assessed on apoptosis by assessment of nuclear morphology using Hoechst 33342/Propidium Iodide staining. Viable cell number was assessed by CellTiter-Glo luminescence assay, Caspase-8 and -9 activities were measured by Caspase-Glo™ assay kit. TRAIL-resistant cells were generated by culture of RPMI 8226 and NCI-H929 by acute exposure to TRAIL followed by selection of TRAIL-resistant cells. TRAIL significantly induced apoptosis in a dose-dependent manner in OPM-2, RPMI 8226, NCI-H929, U266, JJN-3 MM cell lines and ADC-1 plasma cell leukaemia cells. SAHA amplified TRAIL responses in all lines except OPM-2, and enhanced TRAIL responses were both via Caspase-8 and -9. SAHA treatment induced growth inhibition that further increased in the combination treatment with TRAIL in MM cells. The co-treatment of TRAIL and SAHA reduced viable cell numbers all cell lines. TRAIL responses were further potentiated by SAHA in 3D cell culture in NCI-H929, RPMI 8226 and U266 at lower TRAIL + SAHA doses than in suspension culture. However TRAIL responses in cells that had been selected for TRAIL resistance were not further enhanced by SAHA treatment. SAHA is a potent sensitizer of TRAIL responses in both TRAIL sensitive and resistant cell lines, in both suspension and 3D culture, however SAHA did not sensitise TRAIL-sensitive cell

Flux analysis of mammalian cell culture

NARCIS (Netherlands)

Martens, D.E.; Tramper, J.

2010-01-01

Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific

Plant cell culture initiation

NARCIS (Netherlands)

Hall, R.D.

2000-01-01

The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our

Differentiation of Human Pluripotent Stem Cells into Functional Endothelial Cells in Scalable Suspension Culture

Directory of Open Access Journals (Sweden)

Ruth Olmer

2018-05-01

Full Text Available Summary: Endothelial cells (ECs are involved in a variety of cellular responses. As multifunctional components of vascular structures, endothelial (progenitor cells have been utilized in cellular therapies and are required as an important cellular component of engineered tissue constructs and in vitro disease models. Although primary ECs from different sources are readily isolated and expanded, cell quantity and quality in terms of functionality and karyotype stability is limited. ECs derived from human induced pluripotent stem cells (hiPSCs represent an alternative and potentially superior cell source, but traditional culture approaches and 2D differentiation protocols hardly allow for production of large cell numbers. Aiming at the production of ECs, we have developed a robust approach for efficient endothelial differentiation of hiPSCs in scalable suspension culture. The established protocol results in relevant numbers of ECs for regenerative approaches and industrial applications that show in vitro proliferation capacity and a high degree of chromosomal stability. : In this article, U. Martin and colleagues show the generation of hiPSC endothelial cells in scalable cultures in up to 100 mL culture volume. The generated ECs show in vitro proliferation capacity and a high degree of chromosomal stability after in vitro expansion. The established protocol allows to generate hiPSC-derived ECs in relevant numbers for regenerative approaches. Keywords: hiPSC differentiation, endothelial cells, scalable culture

Electrospinning PCL Scaffolds Manufacture for Three-Dimensional Breast Cancer Cell Culture

Directory of Open Access Journals (Sweden)

Marc Rabionet

2017-08-01

Full Text Available In vitro cell culture is traditionally performed within two-dimensional (2D environments, providing a quick and cheap way to study cell properties in a laboratory. However, 2D systems differ from the in vivo environment and may not mimic the physiological cell behavior realistically. For instance, 2D culture models are thought to induce cancer stem cells (CSCs differentiation, a rare cancer cell subpopulation responsible for tumor initiation and relapse. This fact hinders the development of therapeutic strategies for tumors with a high relapse percentage, such as triple negative breast cancer (TNBC. Thus, three-dimensional (3D scaffolds have emerged as an attractive alternative to monolayer culture, simulating the extracellular matrix structure and maintaining the differentiation state of cells. In this work, scaffolds were fabricated through electrospinning different poly(ε-caprolactone-acetone solutions. Poly(ε-caprolactone (PCL meshes were seeded with triple negative breast cancer (TNBC cells and 15% PCL scaffolds displayed significantly (p < 0.05 higher cell proliferation and elongation than the other culture systems. Moreover, cells cultured on PCL scaffolds exhibited higher mammosphere forming capacity and aldehyde dehydrogenase activity than 2D-cultured cells, indicating a breast CSCs enrichment. These results prove the powerful capability of electrospinning technology in terms of poly(ε-caprolactone nanofibers fabrication. In addition, this study has demonstrated that electrospun 15% PCL scaffolds are suitable tools to culture breast cancer cells in a more physiological way and to expand the niche of breast CSCs. In conclusion, three-dimensional cell culture using PCL scaffolds could be useful to study cancer stem cell behavior and may also trigger the development of new specific targets against such malignant subpopulation.

H5N1 whole-virus vaccine induces neutralizing antibodies in humans which are protective in a mouse passive transfer model.

Directory of Open Access Journals (Sweden)

M Keith Howard

Full Text Available BACKGROUND: Vero cell culture-derived whole-virus H5N1 vaccines have been extensively tested in clinical trials and consistently demonstrated to be safe and immunogenic; however, clinical efficacy is difficult to evaluate in the absence of wide-spread human disease. A lethal mouse model has been utilized which allows investigation of the protective efficacy of active vaccination or passive transfer of vaccine induced sera following lethal H5N1 challenge. METHODS: We used passive transfer of immune sera to investigate antibody-mediated protection elicited by a Vero cell-derived, non-adjuvanted inactivated whole-virus H5N1 vaccine. Mice were injected intravenously with H5N1 vaccine-induced rodent or human immune sera and subsequently challenged with a lethal dose of wild-type H5N1 virus. RESULTS: Passive transfer of H5N1 vaccine-induced mouse, guinea pig and human immune sera provided dose-dependent protection of recipient mice against lethal challenge with wild-type H5N1 virus. Protective dose fifty values for serum H5N1 neutralizing antibody titers were calculated to be ≤1∶11 for all immune sera, independently of source species. CONCLUSIONS: These data underpin the confidence that the Vero cell culture-derived, whole-virus H5N1 vaccine will be effective in a pandemic situation and support the use of neutralizing serum antibody titers as a correlate of protection for H5N1 vaccines.

Development of an automated chip culture system with integrated on-line monitoring for maturation culture of retinal pigment epithelial cells

Directory of Open Access Journals (Sweden)

Mee-Hae Kim

2017-10-01

Full Text Available In cell manufacturing, the establishment of a fully automated, microfluidic, cell culture system that can be used for long-term cell cultures, as well as for process optimization is highly desirable. This study reports the development of a novel chip bioreactor system that can be used for automated long-term maturation cultures of retinal pigment epithelial (RPE cells. The system consists of an incubation unit, a medium supply unit, a culture observation unit, and a control unit. In the incubation unit, the chip contains a closed culture vessel (2.5 mm diameter, working volume 9.1 μL, which can be set to 37 °C and 5% CO2, and uses a gas-permeable resin (poly- dimethylsiloxane as the vessel wall. RPE cells were seeded at 5.0 × 104 cells/cm2 and the medium was changed every day by introducing fresh medium using the medium supply unit. Culture solutions were stored either in the refrigerator or the freezer, and fresh medium was prepared before any medium change by warming to 37 °C and mixing. Automated culture was allowed to continue for 30 days to allow maturation of the RPE cells. This chip culture system allows for the long-term, bubble-free, culture of RPE cells, while also being able to observe cells in order to elucidate their cell morphology or show the presence of tight junctions. This culture system, along with an integrated on-line monitoring system, can therefore be applied to long-term cultures of RPE cells, and should contribute to process control in RPE cell manufacturing.

[Biological characteristics of mesenchymal stem cell and hematopoietic stem cell in the co-culture system].

Science.gov (United States)

Wei, Wei; Xu, Chao; Ye, Zhi-Yong; Huang, Xiao-Jun; Yuan, Jia-En; Ma, Tian-Bao; Lin, Han-Biao; Chen, Xiu-Qiong

2016-10-25

The aim of the present study was to obtain the qualified hematopoietic stem/progenitor cells (HSC/HPC) and human umbilical cord-mesenchymal stem cells (MSC) in vitro in the co-culture system. Cord blood mononuclear cells were separated from umbilical cord blood by Ficoll lymphocyte separation medium, and then CD34 + HSC was collected by MACS immunomagnetic beads. The selected CD34 + HSC/HPC and MSC were transferred into culture flask. IMDM culture medium with 15% AB-type cord plasma supplemented with interleukin-3 (IL-3), IL-6, thrombopoietin (TPO), stem cell factor (SCF) and FMS-like tyrosine kinase 3 ligand (Flt-3L) factors were used as the co-culture system for the amplification of HSC/HPC and MSC. The cellular growth status and proliferation on day 6 and 10 after co-culture were observed by using inverted microscope. The percentage of positive expression of CD34 in HSC/HPC, as well as the percentages of positive expressions of CD105, CD90, CD73, CD45, CD34 and HLA-DR in the 4 th generation MSC, was tested by flow cytometry. Semisolid colony culture was used to test the HSC/HPC colony forming ability. The osteogenic, chondrogenesis and adipogenic ability of the 4 th generation MSC were assessed. The karyotype analysis of MSC was conducted by colchicines. The results demonstrated that the HSC/HPC of co-culture group showed higher ability of amplification, CFU-GM and higher CD34 + percentage compared with the control group. The co-cultured MSC maintained the ability to differentiate into bone cells, fat cells and chondrocytes. And the karyotype stability of MSC remained normal. These results reveal that the appropriate co-culture system for MSC and HSC is developed, and via this co-culture system we could gain both two kinds of these cells. The MSCs under the co-culture system maintain the biological characteristics. The CFU-GM ability, cell counting and the flow cytometry results of HSC/HPC under the co-culture system are conform to the criterion, showing that

Production of betalaines by Myrtillocactus cell cultures. Passage from heterotrophic state to autotrophic state with Asparagus cell cultures

Energy Technology Data Exchange (ETDEWEB)

Bulard, C; Mary, J; Chaumont, D; Gudin, C

1982-11-01

Myrtillocactus tissue cultures are grown from the epicotyl of young plantlets. With an appropriate growing medium it is possible, after transfer of fragments of these cultures to a liquid environment, to obtain dissociation and proliferation of cells. The production of betalaic pigments is induced in solid surroundings by adjustement of the growing medium composition and can be maintained in a liquid environment. The multiplication of pigmented cells in suspension may thus be obtained. The conversion of Asparagus cell suspensions from the heterotrophic state (use of lactose as source of carbon) to the autotrophic state (carbon supplied by CO/sub 2/) is obtained by a gradual reduction in the sugar concentration of the medium combined with a rise in the CO/sub 2/ content of the gas mixture atmosphere injected into the cultivator. The passage to the autotrophic state of a Myrtillocactus suspension would enable the production conditions of a metabolite (Betalaine) to be studied by micro-algae culture techniques.

Hypoxic contraction of cultured pulmonary vascular smooth muscle cells

International Nuclear Information System (INIS)

Murray, T.R.; Chen, L.; Marshall, B.E.; Macarak, E.J.

1990-01-01

The cellular events involved in generating the hypoxic pulmonary vasoconstriction response are not clearly understood, in part because of the multitude of factors that alter pulmonary vascular tone. The goal of the present studies was to determine if a cell culture preparation containing vascular smooth muscle (VSM) cells could be made to contract when exposed to a hypoxic atmosphere. Cultures containing only fetal bovine pulmonary artery VSM cells were assessed for contractile responses to hypoxic stimuli by two methods. In the first, tension forces generated by cells grown on a flexible growth surface (polymerized polydimethyl siloxane) were manifested as wrinkles and distortions of the surface under the cells. Wrinkling of the surface was noted to progressively increase with time as the culture medium bathing the cells was made hypoxic (PO2 approximately 25 mmHg). The changes were sometimes reversible upon return to normoxic conditions and appeared to be enhanced in cells already exhibiting evidence of some baseline tone. Repeated passage in culture did not diminish the hypoxic response. Evidence for contractile responses to hypoxia was also obtained from measurements of myosin light chain (MLC) phosphorylation. Conversion of MLC to the phosphorylated species is an early step in the activation of smooth muscle contraction. Lowering the PO2 in the culture medium to 59 mmHg caused a 45% increase in the proportion of MLC in the phosphorylated form as determined by two-dimensional gel electrophoresis. Similarly, cultures preincubated for 4 h with 32P and then exposed to normoxia or hypoxia for a 5-min experimental period showed more than twice as much of the label in MLCs of the hypoxic cells

Contributions of 3D Cell Cultures for Cancer Research.

Science.gov (United States)

Ravi, Maddaly; Ramesh, Aarthi; Pattabhi, Aishwarya

2017-10-01

Cancer cell lines have contributed immensely in understanding the complex physiology of cancers. They are excellent material for studies as they offer homogenous samples without individual variations and can be utilised with ease and flexibility. Also, the number of assays and end-points one can study is almost limitless; with the advantage of improvising, modifying or altering several variables and methods. Literally, a new dimension to cancer research has been achieved by the advent of 3Dimensional (3D) cell culture techniques. This approach increased many folds the ways in which cancer cell lines can be utilised for understanding complex cancer biology. 3D cell culture techniques are now the preferred way of using cancer cell lines to bridge the gap between the 'absolute in vitro' and 'true in vivo'. The aspects of cancer biology that 3D cell culture systems have contributed include morphology, microenvironment, gene and protein expression, invasion/migration/metastasis, angiogenesis, tumour metabolism and drug discovery, testing chemotherapeutic agents, adaptive responses and cancer stem cells. We present here, a comprehensive review on the applications of 3D cell culture systems for these aspects of cancers. J. Cell. Physiol. 232: 2679-2697, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Evaluation of a dental pulp-derived cell sheet cultured on amniotic membrane substrate.

Science.gov (United States)

Honjo, Ken-ichi; Yamamoto, Toshiro; Adachi, Tetsuya; Amemiya, Takeshi; Mazda, Osam; Kanamura, Narisato; Kita, Masakazu

2015-01-01

Mesenchymal stem cells (MSC) are transplanted for periodontal tissue regeneration, and the periodontal ligament (PDL) is regenerated using a cultured cell sheet. This cultured cell sheet is prepared using PDL-derived cells, growth factors, and amniotic membrane (AM). Dental pulp (DP)-derived cells can be easily obtained from extracted wisdom teeth, proliferate rapidly, and are less susceptible to bacterial infection than PDL-derived cells. Thus, to prepare a novel cell sheet, DP-derived cells were cultured on AM as a culture substrate for immunohistochemical examination. Wisdom teeth extracted from three adults were cut along the cement-enamel border. DP tissue was collected, minced, and primarily cultured. After three or four passage cultures, DP-derived cells were cultured on AM, followed by hematoxylin-eosin (H-E) and immunofluorescence staining. DP-derived cells cultured on AM formed a layered structure. Cells positive for vimentin, Ki-67, ZO-1, desmoplakin, CD29, 44, 105 or 146, STRO-1, collagen IV or VII or laminin 5 or α5 chain were localized. DP-derived cells proliferated on AM, while retaining the properties of DP, which allowed the cultured cell sheet to be prepared. In addition, the cultured cell sheet contained MSC, which suggests its potential application in periodontal tissue regeneration.

Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.

Directory of Open Access Journals (Sweden)

Song-I Chun

Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.

Establishment and characterization of American elm cell suspension cultures

Science.gov (United States)

Steven M. Eshita; Joseph C. Kamalay; Vicki M. Gingas; Daniel A. Yaussy

2000-01-01

Cell suspension cultures of Dutch elm disease (DED)-tolerant and DED-susceptible American elms clones have been established and characterized as prerequisites for contrasts of cellular responses to pathogen-derived elicitors. Characteristics of cultured elm cell growth were monitored by A700 and media conductivity. Combined cell growth data for all experiments within a...

Epithelial Cell Cultures

Directory of Open Access Journals (Sweden)

Imran S. Chaudhry

2011-01-01

Full Text Available The biological effects of only a finite number of tobacco toxins have been studied. Here, we describe exposure of cultures of human bronchial epithelial cells to low concentrations of tobacco carcinogens: nickel sulphate, benzo(bfluoranthene, N-nitrosodiethylamine, and 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK. After a 24-hour exposure, EGFR was expressed in cell membrane and cytoplasm, BCL-2 was expressed only in the irregular nuclei of large atypical cells, MKI67 was expressed in nuclei with no staining in larger cells, cytoplasmic BIRC5 with stronger nuclear staining was seen in large atypical cells, and nuclear TP53 was strongly expressed in all cells. After only a 24-hour exposure, cells exhibited atypical nuclear and cytoplasmic features. After a 48-hour exposure, EGFR staining was localized to the nucleus, BCL-2 was slightly decreased in intensity, BIRC5 was localized to the cytoplasm, and TP53 staining was increased in small and large cells. BCL2L1 was expressed in both the cytoplasm and nuclei of cells at 24- and 48-hour exposures. We illustrate that short-termexposure of a bronchial epithelial cell line to smoking-equivalent concentrations of tobacco carcinogens alters the expression of key proliferation regulatory genes, EGFR, BCL-2, BCL2L1, BIRC5, TP53, and MKI67, similar to that reported in biopsy specimens of pulmonary epithelium described to be preneoplastic lesions.

Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

International Nuclear Information System (INIS)

Mori, K.J.; Izumi, Hiroko; Seto, Akira

1981-01-01

A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

Immunocytochemical characterization of primary cell culture in canine transmissible venereal tumor

Directory of Open Access Journals (Sweden)

Luis M.M. Flórez

Full Text Available Abstract: Immunochemistry with anti-vimentin, anti-lysozyme, anti-alpha 1 antitrypsin, anti-CD3 and anti-CD79α antibodies has been used for characterization of primary cell culture in the transmissible venereal tumor (TVT. Samples for primary cell culture and immunohistochemistry assays were taken from eight dogs with cytological and clinical diagnosis of TVT. To validate the immunochemical results in the primary cell culture of TVT, a chromosome count was performed. For the statistical analysis, the Mann-Whitney test with p<0.05 was used. TVT tissues and culture cells showed intense anti-vimentin immunoreactivity, lightly to moderate immunoreactivity for anti-lysozyme, and mild for anti-alpha-antitrypsin. No marking was achieved for CD3 and CD79α. All culture cells showed chromosomes variable number of 56 to 68. This is the first report on the use of immunocytochemical characterization in cell culture of TVT. Significant statistic difference between immunochemistry in tissue and culture cell was not established, what suggests that the use of this technique may provide greater certainty for the confirmation of tumors in the primary culture. This fact is particularly important because in vitro culture of tumor tissues has been increasingly used to provide quick access to drug efficacy and presents relevant information to identify potential response to anticancer medicine; so it is possible to understand the behavior of the tumor.

Irradiated murine fibroblasts as feeder layer used in human cell culture

International Nuclear Information System (INIS)

Almeida, Tiago L.; Klingbeil, Fatima G.; Yoshito, Daniele; Caproni, Priscila; Mathor, Monica B.; Herson, Marisa R.

2007-01-01

In 1975, Rheinwald and Green published an in vitro model for keratinocyte cell cultures in which the use of murine fibroblasts, as a feeder layer was introduced. These cells are modified fibroblasts, which presence render keratinocyte cells to remain proliferative for longer periods of time. This optimization of culture outputs has allowed for several clinical applications of confluent keratinocyte cultures as skin substitutes or wound dressings in situations such as post burn extensive skin loss, loss of oral mucosa, and other skin disorders. Nevertheless, proliferation of fibroblast in co-culture with keratinocytes must be controlled by anti-proliferative measures such as irradiation; at the same time, keratinocytes require specific nutrients in the culture medium, which may interfere with the fibroblast feeder layer viability. Therefore, the thorough understanding of the impact of different issues such as culture media composition, irradiation dose and pre-plating storage conditions of irradiated fibroblast to be used as feeder layer in these co-culture systems is important. In this work, changes as far as viability and proliferative rates of irradiated fibroblasts in culture were evaluated in relation to the type of culture medium used, dose of gamma radiation exposure, storage and timing of cell plating post irradiation. Results indicate that the type of culture medium used and time-lag between irradiation, refrigeration and plating of irradiated cells do not have significant impact in culture outcomes. However, the dose of gamma radiation administered to the cells may influence the final quality of these cells if to be used as a feeder layer. (author)

Animal-cell culture media: History, characteristics, and current issues.

Science.gov (United States)

Yao, Tatsuma; Asayama, Yuta

2017-04-01

Cell culture technology has spread prolifically within a century, a variety of culture media has been designed. This review goes through the history, characteristics and current issues of animal-cell culture media. A literature search was performed on PubMed and Google Scholar between 1880 and May 2016 using appropriate keywords. At the dawn of cell culture technology, the major components of media were naturally derived products such as serum. The field then gradually shifted to the use of chemical-based synthetic media because naturally derived ingredients have their disadvantages such as large batch-to-batch variation. Today, industrially important cells can be cultured in synthetic media. Nevertheless, the combinations and concentrations of the components in these media remain to be optimized. In addition, serum-containing media are still in general use in the field of basic research. In the fields of assisted reproductive technologies and regenerative medicine, some of the medium components are naturally derived in nearly all instances. Further improvements of culture media are desirable, which will certainly contribute to a reduction in the experimental variation, enhance productivity among biopharmaceuticals, improve treatment outcomes of assisted reproductive technologies, and facilitate implementation and popularization of regenerative medicine.

Cell Culture Assay for Human Noroviruses [response

Energy Technology Data Exchange (ETDEWEB)

Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.

2007-07-01

We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools

Rheological characteristics of cell suspension and cell culture of Perilla frutescens.

Science.gov (United States)

Zhong, J J; Seki, T; Kinoshita, S; Yoshida, T

1992-12-05

Physical properties such as viscosity, fluid dynamic behavior of cell suspension, and size distribution of cell aggregates of a plant, Perilla frustescens, cultured in a liquid medium were studied. As a result of investigations using cells harvester after 12 days of cultivation in a flask, it was found that the apparent viscosity of the cell suspension did not change with any variation of cell concentration below 5 g dry cell/L but markedly increased when the cell concentration increased over 12.8 g dry cell/L. The cell suspension exhibited the characteristics of a Bingham plastic fluid with a small yield stress. The size of cell aggregates in the range 74 to 500 mum did not influence the rheological characteristics of the cell suspension. The rheological characteristics of cultivation mixtures of P. frutescens cultivated in a flask and in a bioreactor were also investigated. The results showed that the flow characteristics of the cell culture could be described by a Bingham plastic model. At the later stage of cultivation, the apparent viscosity increased steadily, even though the biomass concentration (by dry weight) decreased, due to the increase of individual cell size. (c) 1992 John Wiley & Sons, Inc.

Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

International Nuclear Information System (INIS)

Zhang, Fenxi; Hong, Yan; Liang, Wenmei; Ren, Tongming; Jing, Suhua; Lin, Juntang

2012-01-01

Highlights: ► Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). ► Presence of SCs dramatically increased proliferation and migration of UCMSCs. ► Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of “nurse” cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

Directory of Open Access Journals (Sweden)

Magnusson Magnus K

2010-07-01

Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

Energy Technology Data Exchange (ETDEWEB)

Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)

2012-10-12

Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

Development of Cell Culture Microdevice Actuated by Piezoelectric Thin Films for Delivering Mechanical Vibratory Stimuli to Cells

International Nuclear Information System (INIS)

Yamada, Y; Umegaki, G; Kawashima, T; Nagai, M; Shibata, T; Masuzawa, T; Kimura, T; Kishida, A

2012-01-01

In order to realize a cell culture microdevice actuated by piezoelectric thin films for on-chip regulation of cell functions, this paper reported on a feasibility study by using the microdevice with KOH-etched cavities surrounded by four (111) sidewalls as microchambers in order to introduce cells to be cultured. As a result, the vibration characteristic of the PZT actuator was improved by using an electric field -150 kV/cm at 70 C for 30 min in poling process. A feasibility study on cell culture for delivering mechanical vibratory stimuli to cells revealed the microdevice could be applicable to the culture with actual biological cells. In addition, it was found that O 2 -plasma treated parylene-C process could be applicable for obtaining homogeneous surface of cell culture microdevice.

Microfluidic Cell Culture Device

Science.gov (United States)

Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

2014-01-01

Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

Novel culturing platform for brain slices and neuronal cells

DEFF Research Database (Denmark)

Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya

2015-01-01

In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been...... tested successfully with brain slices and PC12 cells. The culture substrate can be modified using metal electrodes and/or nanostructures for conducting electrical measurements while culturing and for better mimicking the in vivo conditions....

Peptide Hydrogelation and Cell Encapsulation for 3D Culture of MCF-7 Breast Cancer Cells

Science.gov (United States)

Sun, Xiuzhi S.; Nguyen, Thu A.

2013-01-01

Three-dimensional (3D) cell culture plays an invaluable role in tumor biology by providing in vivo like microenviroment and responses to therapeutic agents. Among many established 3D scaffolds, hydrogels demonstrate a distinct property as matrics for 3D cell culture. Most of the existing pre-gel solutions are limited under physiological conditions such as undesirable pH or temperature. Here, we report a peptide hydrogel that shows superior physiological properties as an in vitro matrix for 3D cell culture. The 3D matrix can be accomplished by mixing a self-assembling peptide directly with a cell culture medium without any pH or temperature adjustment. Results of dynamic rheological studies showed that this hydrogel can be delivered multiple times via pipetting without permanently destroying the hydrogel architecture, indicating the deformability and remodeling ability of the hydrogel. Human epithelial cancer cells, MCF-7, are encapsulated homogeneously in the hydrogel matrix during hydrogelation. Compared with two-dimensional (2D) monolayer culture, cells residing in the hydrogel matrix grow as tumor-like clusters in 3D formation. Relevant parameters related to cell morphology, survival, proliferation, and apoptosis were analyzed using MCF-7 cells in 3D hydrogels. Interestingly, treatment of cisplatin, an anti-cancer drug, can cause a significant decrease of cell viability of MCF-7 clusters in hydrogels. The responses to cisplatin were dose- and time-dependent, indicating the potential usage of hydrogels for drug testing. Results of confocal microscopy and Western blotting showed that cells isolated from hydrogels are suitable for downstream proteomic analysis. The results provided evidence that this peptide hydrogel is a promising 3D cell culture material for drug testing. PMID:23527204

Dynamic cell culture system (7-IML-1)

Science.gov (United States)

Cogoli, Augusto

1992-01-01

This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.

Trivalent MDCK cell culture-derived influenza vaccine Optaflu (Novartis Vaccines).

Science.gov (United States)

Doroshenko, Alexander; Halperin, Scott A

2009-06-01

Annual influenza epidemics continue to have a considerable impact in both developed and developing countries. Vaccination remains the principal measure to prevent seasonal influenza and reduce associated morbidity and mortality. The WHO recommends using established mammalian cell culture lines as an alternative to egg-based substrates in the manufacture of influenza vaccine. In June 2007, the EMEA approved Optaflu, a Madin Darby canine kidney cell culture-derived influenza vaccine manufactured by Novartis Vaccines. This review examines the advantages and disadvantages of cell culture-based technology for influenza vaccine production, compares immunogenicity and safety data for Optaflu with that of currently marketed conventional egg-based influenza vaccines, and considers the prospects for wider use of cell culture-based influenza vaccines.

Fabrication of cell-benign inverse opal hydrogels for three-dimensional cell culture.

Science.gov (United States)

Im, Pilseon; Ji, Dong Hwan; Kim, Min Kyung; Kim, Jaeyun

2017-05-15

Inverse opal hydrogels (IOHs) for cell culture were fabricated and optimized using calcium-crosslinked alginate microbeads as sacrificial template and gelatin as a matrix. In contrast to traditional three-dimensional (3D) scaffolds, the gelatin IOHs allowed the utilization of both the macropore surface and inner matrix for cell co-culture. In order to remove templates efficiently for the construction of 3D interconnected macropores and to maintain high cell viability during the template removal process using EDTA solution, various factors in fabrication, including alginate viscosity, alginate concentration, alginate microbeads size, crosslinking calcium concentration, and gelatin network density were investigated. Low viscosity alginate, lower crosslinking calcium ion concentration, and lower concentration of alginate and gelatin were found to obtain high viability of cells encapsulated in the gelatin matrix after removal of the alginate template by EDTA treatment by allowing rapid dissociation and diffusion of alginate polymers. Based on the optimized fabrication conditions, gelatin IOHs showed good potential as a cell co-culture system, applicable to tissue engineering and cancer research. Copyright © 2017 Elsevier Inc. All rights reserved.

Bioreactors to influence stem cell fate: augmentation of mesenchymal stem cell signaling pathways via dynamic culture systems.

Science.gov (United States)

Yeatts, Andrew B; Choquette, Daniel T; Fisher, John P

2013-02-01

Mesenchymal stem cells (MSCs) are a promising cell source for bone and cartilage tissue engineering as they can be easily isolated from the body and differentiated into osteoblasts and chondrocytes. A cell based tissue engineering strategy using MSCs often involves the culture of these cells on three-dimensional scaffolds; however the size of these scaffolds and the cell population they can support can be restricted in traditional static culture. Thus dynamic culture in bioreactor systems provides a promising means to culture and differentiate MSCs in vitro. This review seeks to characterize key MSC differentiation signaling pathways and provides evidence as to how dynamic culture is augmenting these pathways. Following an overview of dynamic culture systems, discussion will be provided on how these systems can effectively modify and maintain important culture parameters including oxygen content and shear stress. Literature is reviewed for both a highlight of key signaling pathways and evidence for regulation of these signaling pathways via dynamic culture systems. The ability to understand how these culture systems are affecting MSC signaling pathways could lead to a shear or oxygen regime to direct stem cell differentiation. In this way the efficacy of in vitro culture and differentiation of MSCs on three-dimensional scaffolds could be greatly increased. Bioreactor systems have the ability to control many key differentiation stimuli including mechanical stress and oxygen content. The further integration of cell signaling investigations within dynamic culture systems will lead to a quicker realization of the promise of tissue engineering and regenerative medicine. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Radiation adaptive response for the growth of cultured glial cells

International Nuclear Information System (INIS)

Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.

2003-01-01

Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet

Pros and cons of fish skin cells in culture: long-term full skin and short-term scale cell culture from rainbow trout, Oncorhynchus mykiss.

Science.gov (United States)

Rakers, Sebastian; Klinger, Matthias; Kruse, Charli; Gebert, Marina

2011-12-01

Here, we report the establishment of a permanent skin cell culture from rainbow trout (Oncorhynchus mykiss). The cells of the fish skin cell culture could be propagated over 60 passages so far. Furthermore, we show for the first time that it is possible to integrate freshly harvested rainbow trout scales into this new fish skin cell culture. We further demonstrated that epithelial cells derived from the scales survived in the artificial micro-environment of surrounding fibroblast-like cells. Also, antibody staining indicated that both cell types proliferated and started to build connections with the other cell type. It seems that it is possible to generate an 'artificial skin' with two different cell types. This could lead to the development of a three-dimensional test system, which might be a better in vitro representative of fish skin in vivo than individual skin cell lines. Copyright © 2011 Elsevier GmbH. All rights reserved.

Preparation of labelled lipids by the use of plant cell cultures

International Nuclear Information System (INIS)

Mangold, H.K.

1978-01-01

The preparation of some radioacitvely labelled lipids by the use of plant cell cultures is discussed and further applications of the new method are suggested. Cell suspension cultures of rape (Brassica napus) and soya (Glycine max) have been used for the preparation of lipids labelled with radioisotopes. Radioactive acetic acid as well as various long-chain fatty acids are readily incorporated into the neutral and ionic lipids of plant cell cultures. In addition, 14 C-labelled glycerol, ethanolamine and choline are well utilized by the cells. Randomly labelled lipids have been obtained by incubating cell suspension cultures of rape and soya with [1- 14 C] acetic acid, and uniformly labelled lipids have been isolated from cultures that had been incubated with a mixture of [1- 14 C] acetic acid plus [2- 14 C] acetic acid. The use of techniques of plant cell cultures for the preparation of lipds labelled with stable or radioactive isotopesappears particularly rewarding because the uptake of precursors by the cells and their incorporation into various lipid compounds proceeds rapidly and often quanitatively.This new approach should be useful also for the biosynthesis of lipids whose acyl moieties contain a spn radical, a fluorescent group, or a light-sensitive label. Thus, plant cell cultures constitute valuable new tools for the biosynthetic preparation of a great variety of labelled lipids. (A.G.)

Further characterization of the adhesive-tumor-cell culture system for measuring the radiosensitivity of human tumor primary cultures

International Nuclear Information System (INIS)

Brock, W.A.; Bock, S.P.; Williams, M.; Baker, F.L.

1987-01-01

This study extends the use of the adhesive-tumor-cell culture system to include: over 100 sensitivity measurements at 2.0 Gy; tumorgenicity determinations in nude mice; and flow cytometry of the cells grown in the system. The malignant nature of the growing cells was proved by injecting cells into nude mice. Tumors resulted in 60% of the cases and the histology of each xenograft was similar to that of the human tumor. Flow cytometry was used to obtain DNA histograms of the original cell suspension and of cultures during the two week culture period in order to obtain quantitative information about the growth of aneuploid versus diploid populations. The results thus far demonstrate that 95% of aneuploid populations yield aneuploid growth; of the first 20 cases studied, only one suspension with an aneuploid peak resulted in diploid growth. Of further interest was the observation that it is not unusual for a minor aneuploid population to become the predominate growth fraction after two weeks in culture. These results demonstrate that the adhesive-tumor-cell culture system supports the growth of malignant cells, that multiple cell populations exist in cell suspensions derived from solid tumors, and that differences exist between the radiosensitivity of cells at 2.0 Gy in different histology types

Culture conditions defining glioblastoma cells behavior: what is the impact for novel discoveries?

Science.gov (United States)

Ledur, Pítia Flores; Onzi, Giovana Ravizzoni; Zong, Hui; Lenz, Guido

2017-09-15

In cancer research, the use of established cell lines has gradually been replaced by primary cell cultures due to their better representation of in vivo cancer cell behaviors. However, a major challenge with primary culture involves the finding of growth conditions that minimize alterations in the biological state of the cells. To ensure reproducibility and translational potentials for research findings, culture conditions need to be chosen so that the cell population in culture best mimics tumor cells in vivo . Glioblastoma (GBM) is one of the most aggressive and heterogeneous tumor types and the GBM research field would certainly benefit from culture conditions that could maintain the original plethora of phenotype of the cells. Here, we review culture media and supplementation options for GBM cultures, the rationale behind their use, and how much those choices affect drug-screening outcomes. We provide an overview of 120 papers that use primary GBM cultures and discuss the current predominant conditions. We also show important primary research data indicating that "mis-cultured" glioma cells can acquire unnatural drug sensitivity, which would have devastating effects for clinical translations. Finally, we propose the concurrent test of four culture conditions to minimize the loss of cell coverage in culture.

40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

Science.gov (United States)

2010-07-01

... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...

Prospects for the use of plant cell cultures in food biotechnology.

Science.gov (United States)

Davies, Kevin M; Deroles, Simon C

2014-04-01

Plant cell cultures can offer continuous production systems for high-value food and health ingredients, independent of geographical or environmental variations and constraints. Yet despite many improvements in culture technologies, cell line selection, and bioreactor design, there are few commercial successes. This is principally due to the culture yield and market price of food products not being sufficient to cover the plant cell culture production costs. A better understanding of the underpinning biological mechanisms that control the target metabolite biosynthetic pathways may allow the metabolic engineering of cell lines to provide for economically competitive product yields. However, uncertainty around the regulatory and public acceptance of products derived from engineered cell cultures presents a barrier to the uptake of the technology by food product companies. Copyright © 2014 Elsevier Ltd. All rights reserved.

A Novel Counter Sheet-flow Sandwich Cell Culture Device for Mammalian Cell Growth in Space

Science.gov (United States)

Sun, Shujin; Gao, Yuxin; Shu, Nanjiang; Tang, Zemei; Tao, Zulai; Long, Mian

2008-08-01

Cell culture and growth in space is crucial to understand the cellular responses under microgravity. The effects of microgravity were coupled with such environment restrictions as medium perfusion, in which the underlying mechanism has been poorly understood. In the present work, a customer-made counter sheet-flow sandwich cell culture device was developed upon a biomechanical concept from fish gill breathing. The sandwich culture unit consists of two side chambers where the medium flow is counter-directional, a central chamber where the cells are cultured, and two porous polycarbonate membranes between side and central chambers. Flow dynamics analysis revealed the symmetrical velocity profile and uniform low shear rate distribution of flowing medium inside the central culture chamber, which promotes sufficient mass transport and nutrient supply for mammalian cell growth. An on-orbit experiment performed on a recovery satellite was used to validate the availability of the device.

Enhanced chondrocyte culture and growth on biologically inspired nanofibrous cell culture dishes.

Science.gov (United States)

Bhardwaj, Garima; Webster, Thomas J

2016-01-01

Chondral and osteochondral defects affect a large number of people in which treatment options are currently limited. Due to its ability to mimic the natural nanofibrous structure of cartilage, this current in vitro study aimed at introducing a new scaffold, called XanoMatrix™, for cartilage regeneration. In addition, this same scaffold is introduced here as a new substrate onto which to study chondrocyte functions. Current studies on chondrocyte functions are limited due to nonbiologically inspired cell culture substrates. With its polyethylene terephthalate and cellulose acetate composition, good mechanical properties and nanofibrous structure resembling an extracellular matrix, XanoMatrix offers an ideal surface for chondrocyte growth and proliferation. This current study demonstrated that the XanoMatrix scaffolds promote chondrocyte growth and proliferation as compared with the Corning and Falcon surfaces normally used for chondrocyte cell culture. The XanoMatrix scaffolds also have greater hydrophobicity, three-dimensional surface area, and greater tensile strength, making them ideal candidates for alternative treatment options for chondral and osteochondral defects as well as cell culture substrates to study chondrocyte functions.

5-Fluorouracil-induced apoptosis in cultured oral cancer cells.

Science.gov (United States)

Tong, D; Poot, M; Hu, D; Oda, D

2000-03-01

Chemotherapy is commonly used to treat advanced oral squamous cell carcinoma (SCC) and is known to kill cancer cells through apoptosis. Our hypothesis states that 5-fluorouracil (5FU) also kills cultured oral epithelial cells through programmed cell death or apoptosis. Cultured oral cancer cells were exposed to an optimum dose of 20 mg/ml of 5FU. Cells were analyzed for changes in cell cycle distribution and induction of cell death including apoptosis. Normal control, human papilloma virus-immortalized (PP), ATCC SCC cell line (CA1) and two primary oral SCC cell lines (CA3 and -4) were studied. Inhibition of apoptosis by a pan-caspase inhibitor was used. SYTO 11 flow cytometry showed increased apoptosis in all 5FU-treated cell cultures compared to untreated controls. The results show biological variation in apoptotic response. CA1 had the lowest apoptotic rate of the cancer cell lines at 1.5%. Next lowest was CA3, followed by CA4 and PP. In addition, alteration in the G1 and S phase fractions were found. Untreated CA1 showed 28% G1, 53% S compared to 43% G1, and 40% S of treated. We investigated the pathway of apoptosis using the pan-caspase inhibitor IDN-1529 by methylthiazolyl diphenyl tetrazolium bromide (MTT) colorimetric analysis. Results showed mild inhibition of cell death when cells were incubated with 50 microM IDN-1529 for 24 h. This suggests a probable caspase-dependent apoptotic pathway. In conclusion, our data suggest that 5FU induces oral cancer cell death through apoptosis and that biological variation exists between normal and cancer cells and between different types of cancer cells themselves. Our data indicate that cultures of a useful in vitro model for chemosensitivity assays are possible. Our results also suggest a caspase-dependent pathway for chemocytotoxicity in oral SCC.

Transparent polymeric cell culture chip with integrated temperature control and uniform media perfusion

DEFF Research Database (Denmark)

Petronis, Sarunas; Stangegaard, Michael; Christensen, C.

2006-01-01

Modern microfabrication and microfluidic technologies offer new opportunities in the design and fabrication of miniaturized cell culture systems for online monitoring of living cells. We used laser micromachining and thermal bonding to fabricate an optically transparent, low-cost polymeric chip...... for long-term online cell culture observation under controlled conditions. The chip incorporated a microfluidic flow equalization system, assuring uniform perfusion of the cell culture media throughout the cell culture chamber. The integrated indium-tin-oxide heater and miniature temperature probe linked....... HeLa cells were cultured for up to 2 weeks within the cell culture chip and monitored using a time-lapse video recording microscopy setup. Cell attachment and spreading was observed during the first 10-20 h (lag phase). After approximately 20 h, cell growth gained exponential character...

Simple suspension culture system of human iPS cells maintaining their pluripotency for cardiac cell sheet engineering.