WorldWideScience

Sample records for cultured skin keratinocytes

  1. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... that could explain regional variation in epithelial growth and wound healing. Normal human fibroblasts were cultured on polystyrene or maintained in collagen matrix and stimulated with keratinocytes cultured on membranes. The amount of HGF and KGF protein in the culture medium was determined every 24 h for 5...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...

  2. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Science.gov (United States)

    Nayak, Sunita; Dey, Sancharika; Kundu, Subhas C

    2013-01-01

    The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide) production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  3. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  4. Niacin protects against UVB radiation-induced apoptosis in cultured human skin keratinocytes

    OpenAIRE

    LIN, FUQUAN; XU, WEN; GUAN, CUIPING; ZHOU, MIAONI; HONG, WEISONG; FU, LIFANG; LIU, DONGYIN; XU, AIE

    2012-01-01

    Niacin and its related derivatives have been shown to have effects on cellular activities. However, the molecular mechanism of its reduced immunosuppressive effects and photoprotective effects remains unclear. In this study, we investigated the molecular mechanism of the photoprotective effect of niacin in ultraviolet (UV)-irradiated human skin keratinocytes (HaCaT cells). We found that niacin effectively suppressed the UV-induced cell death and cell apoptosis of HaCaT cells. Existing data ha...

  5. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  6. Niacin protects against UVB radiation-induced apoptosis in cultured human skin keratinocytes.

    Science.gov (United States)

    Lin, Fuquan; Xu, Wen; Guan, Cuiping; Zhou, Miaoni; Hong, Weisong; Fu, Lifang; Liu, Dongyin; Xu, Aie

    2012-04-01

    Niacin and its related derivatives have been shown to have effects on cellular activities. However, the molecular mechanism of its reduced immunosuppressive effects and photoprotective effects remains unclear. In this study, we investigated the molecular mechanism of the photoprotective effect of niacin in ultraviolet (UV)-irradiated human skin keratinocytes (HaCaT cells). We found that niacin effectively suppressed the UV-induced cell death and cell apoptosis of HaCaT cells. Existing data have shown that AKT activation is involved in the cell survival process. Yet, the potential mechanism of niacin in protection against UV-induced skin damage has thus far not fully been eluvidated. We observed that niacin pretreatment enhances UV induced activation of AKT (Ser473 phosphorylation) as well as that of the downstream signal mTOR (S6 and 4E-BP1 phosphorylation). The PI3K/AKT inhibitor, LY294002, and the mTOR inhibitor, rapamycin, largely neutralized the protective effects of niacin, suggesting that AKT and downstream signaling mTOR/S6 activation are necessary for the niacin-induced protective effects against UV-induced cell death and cell apoptosis. Collectively, our data suggest that niacin may be utilized to prevent UV-induced skin damage and provide a novel mechanism of its photoprotective effects against the UV radiation of sunlight by modulating both AKT and downstream mTOR signaling pathways.

  7. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  8. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  9. Melanosome transfer promoted by keratinocyte growth factor in light and dark skin-derived keratinocytes.

    Science.gov (United States)

    Cardinali, Giorgia; Bolasco, Giulia; Aspite, Nicaela; Lucania, Giuseppe; Lotti, Lavinia V; Torrisi, Maria R; Picardo, Mauro

    2008-03-01

    The transfer of melanin from melanocytes to keratinocytes is upregulated by UV radiation and modulated by autocrine and paracrine factors. Among them, the keratinocyte growth factor (KGF/FGF7) promotes melanosome transfer acting on the recipient keratinocytes through stimulation of the phagocytic process. To search for possible differences in the melanosome uptake of keratinocytes from different skin color, we analyzed the uptake kinetics and distribution pattern of fluorescent latex beads in primary cultures of light and dark skin-derived keratinocytes stimulated with KGF and we compared the direct effect of KGF on the melanosome transfer in co-cultures of human primary melanocytes with light and dark keratinocytes. KGF-promoted melanosome transfer was more significant in light keratinocytes compared to dark, due to an increased expression of KGF receptor in light skin keratinocytes. Colocalization studies performed by confocal microscopy using FITC-dextran as a phagocytic marker and fluorescent beads as well as inhibition of particle uptake by cytochalasin D, revealed that beads internalization induced by KGF occurs via actin-dependent phagocytosis. 3D image reconstruction by fluorescence microscopy and ultrastructural analysis through transmission electron microscopy showed differences in the distribution pattern of the beads in light and dark keratinocytes, consistent with the different melanosome distribution in human skin.

  10. Comparison of healing parameters in porcine full-thickness wounds transplanted with skin micrografts, split-thickness skin grafts, and cultured keratinocytes.

    Science.gov (United States)

    Kiwanuka, Elizabeth; Hackl, Florian; Philip, Justin; Caterson, Edward J; Junker, Johan P E; Eriksson, Elof

    2011-12-01

    Transplantation of skin micrografts (MGs), split-thickness skin grafts (STSGs), or cultured autologous keratinocytes (CKs) enhances the healing of large full-thickness wounds. This study compares these methods in a porcine wound model, investigating the utility of micrograft transplantation in skin restoration. Full-thickness wounds were created on Yorkshire pigs and assigned to one of the following treatment groups: MGs, STSGs, CKs, wet nontransplanted, or dry nontransplanted. Dry wounds were covered with gauze and the other groups' wounds were enclosed in a polyurethane chamber containing saline. Biopsies were collected 6, 12, and 18 days after wounding. Quantitative and qualitative wound healing parameters including macroscopic scar appearance, wound contraction, neoepidermal maturation, rete ridge formation, granulation tissue thickness and width, and scar tissue formation were studied. Transplanted wounds scored lower on the Vancouver Scar Scale compared with nontransplanted wounds, indicating a better healing outcome. All transplanted wounds exhibited significantly lower contraction compared with nontransplanted wounds. Wounds transplanted with either MGs, STSGs, or CKs showed a significant increase in re-epithelialization compared with nontransplanted wounds. Wounds transplanted with MGs or STSGs exhibited improved epidermal healing compared with nongrafted wounds. Furthermore, transplantation with STSGs or MGs led to less scar tissue formation compared with the nontransplanted wounds. No significant impact on scar formation was observed after transplantation of CKs. Qualitative and quantitative measurements collected from full-thickness porcine wounds show that transplantation of MGs improve wound healing parameters and is comparable to treatment with STSGs. Published by Elsevier Inc.

  11. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...

  12. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  13. Human allogeneic keratinocytes cultured on acellular xenodermis: the use in healing of burns and other skin defects

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Štolbová, V.; Klein, L.; Konigová, R.; Veselý, Pavel

    2006-01-01

    Roč. 16, č. 4 (2006), s. 63-71 ISSN 0959-2989 R&D Projects: GA AV ČR(CZ) IBS5052312 Institutional research plan: CEZ:AV0Z50520514 Keywords : acellular xenodermis * human keratinocytes * wound grafting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.922, year: 2006

  14. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    Science.gov (United States)

    Gschwandtner, M; Mildner, M; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T; Gutzmer, R; Elias, P M; Tschachler, E

    2013-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated genes and epidermal junction proteins was quantified by real-time PCR, Western blot, and immunofluorescence labeling. The barrier function of human skin models was tested by the application of biotin as tracer molecule. Results The addition of histamine to human keratinocyte cultures and organotypic skin models reduced the expression of the differentiation-associated proteins keratin 1/10, filaggrin, and loricrin by 80–95%. Moreover, the addition of histamine to skin models resulted in the loss of the granular layer and thinning of the epidermis and stratum corneum by 50%. The histamine receptor H1R agonist, 2-pyridylethylamine, suppressed keratinocyte differentiation to the same extent as did histamine. Correspondingly, cetirizine, an antagonist of H1R, virtually abrogated the effect of histamine. The expression of tight junction proteins zona occludens-1, occludin, claudin-1, and claudin-4, as well as that of desmosomal junction proteins corneodesmosin and desmoglein-1, was down-regulated by histamine. The tracer molecule biotin readily penetrated the tight junction barrier of skin cultures grown in the presence of histamine, while their diffusion was completely blocked in nontreated controls. Conclusions Our findings suggest a new mechanism by which mast cell activation and histamine release contribute to skin barrier defects in inflammatory skin diseases. PMID:23157658

  15. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  16. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  17. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  18. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  19. N-acetyltransferase in human skin and keratinocytes

    NARCIS (Netherlands)

    Vogel, Tanja; Bonifas, Jutta; Wiegman, Marjon; Pas, Hendrikus; Blömeke, Brunhilde; Coenraads, Pieter Jan; Schuttelaar, Marie-Louise

    Background: N-acetyltransferase 1 (NAT1) mediated Nacetylation in human skin and keratinocytes is an important detoxification pathway for aromatic amines including the strong sensitizer para-phenylenediamine (PPD), an important component of oxidative hair dyes. Objectives: Human skin and

  20. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  1. Panx1 regulates cellular properties of keratinocytes and dermal fibroblasts in skin development and wound healing.

    Science.gov (United States)

    Penuela, Silvia; Kelly, John J; Churko, Jared M; Barr, Kevin J; Berger, Amy C; Laird, Dale W

    2014-07-01

    Pannexin1 (Panx1), a channel-forming glycoprotein is expressed in neonatal but not in aged mouse skin. Histological staining of Panx1 knockout (KO) mouse skin revealed a reduction in epidermal and dermal thickness and an increase in hypodermal adipose tissue. Following dorsal skin punch biopsies, mutant mice exhibited a significant delay in wound healing. Scratch wound and proliferation assays revealed that cultured keratinocytes from KO mice were more migratory, whereas dermal fibroblasts were more proliferative compared with controls. In addition, collagen gels populated with fibroblasts from KO mice exhibited significantly reduced contraction, comparable to WT fibroblasts treated with the Panx1 blocker, probenecid. KO fibroblasts did not increase α-smooth muscle actin expression in response to TGF-β, as is the case for differentiating WT myofibroblasts during wound contraction. We conclude that Panx1 controls cellular properties of keratinocytes and dermal fibroblasts during early stages of skin development and modulates wound repair upon injury.

  2. Interleukin-8 production in response to tumor necrosis factor-alpha by cholesteatoma keratinocytes in cell culture.

    Science.gov (United States)

    Hilton, Christopher W; Ondrey, Frank G; Wuertz, Beverley R; Levine, Samuel C

    2011-02-01

    Keratinocytes harvested from acquired cholesteatoma and grown in cell culture will demonstrate increased interleukin-8 (IL-8) production in response to tumor necrosis factor (TNF)-alpha as compared with a control keratinocyte cell line. Immunohistochemical studies have identified IL-8 and TNF-alpha, mediators of bony destruction, in tissue samples of cholesteatoma. TNF-alpha stimulates IL-8 production in healthy epidermal keratinocyte cell lines. It is not known whether TNF-alpha stimulates IL-8 production in cultured cholesteatoma keratinocytes. Prospective controlled tissue culture experiment. Tissue from an acquired cholesteatoma was dissociated and grown in keratinocyte serum-free media for 8 weeks. Cholesteatoma keratinocytes and a control cell line of skin epidermal keratinocytes were treated with TNF-alpha. Conditioned media were harvested; production of IL-8 was measured by enzyme-linked immunosorbent assay, and cell counts were performed. At a zero concentration of TNF-alpha, mean production of IL-8 by cholesteatoma keratinocytes was 39,809 pg/mL/24hr/1 × 10(6) cells versus 1,907 pg/mL/24hr/1 × 10(6) cells from skin epidermal keratinocytes, a statistically significant difference (P alpha and a 2.44-fold increase in response to 20 pg/mL of TNF-alpha. The skin epidermal keratinocyte cell line demonstrated a 1.07- and 1.13-fold increase to respective concentrations of TNF-alpha. Cholesteatoma keratinocytes appear to retain cell signaling characteristics in vitro that distinguish them from skin epidermal keratinocytes. This finding may indicate that cholesteatoma keratinocytes undergo a change in behavior in vivo that is preserved after the cells are removed from the inflammatory environment of the middle ear. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

  3. Xenobiotic metabolism capacities of human skin in comparison with a 3D epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: activating enzymes (Phase I).

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Blatz, Veronika; Jäckh, Christine; Freytag, Eva-Maria; Fabian, Eric; Landsiedel, Robert; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    Skin is important for the absorption and metabolism of exposed chemicals such as cosmetics or pharmaceuticals. The Seventh Amendment to the EU Cosmetics Directive prohibits the use of animals for cosmetic testing for certain endpoints, such as genotoxicity; therefore, there is an urgent need to understand the xenobiotic metabolizing capacities of human skin and to compare these activities with reconstructed 3D skin models developed to replace animal testing. We have measured Phase I enzyme activities of cytochrome P450 (CYP) and cyclooxygenase (COX) in ex vivo human skin, the 3D skin model EpiDerm™ (EPI-200), immortalized keratinocyte-based cell lines and primary normal human epidermal keratinocytes. Our data demonstrate that basal CYP enzyme activities are very low in whole human skin and EPI-200 as well as keratinocytes. In addition, activities in monolayer cells differed from organotypic tissues after induction. COX activity was similar in skin, EPI-200 and NHEK cells, but was significantly lower in immortalized keratinocytes. Hence, the 3D model EPI-200 might represent a more suitable model for dermatotoxicological studies. Altogether, these data help to better understand skin metabolism and expand the knowledge of in vitro alternatives used for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  4. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  5. [Evaluation of the cytotoxicity of antiseptics used in current practice on cultures of fibroblasts and keratinocytes].

    Science.gov (United States)

    Fabreguette, A; Zhi Hua, S; Lasne, F; Damour, O

    1994-11-01

    Infection is the greatest problem in burn patients and topical antiseptics must be chosen with great care especially when cultured skin is grafted. We examined the cytotoxicity of 6 antiseptics commonly used on cultured human fibroblasts and keratinocytes. Cultured cells were exposed for 15 min to Hibitane (chlorhexidine), Biseptine (chlorhexidine + benzalkonium chloride + benzylic alcool), dermic Betadine (polvidone iodine + nonoxinol), scrub Betadine (polyvidone iodine + quaternary ammonium) and gynecologic Betadine (polyvidone iodine). The cell viability was determined using the MTT test. At therapeutic concentration all the antiseptics were cytotoxic for fibroblasts and keratinocytes. The data suggest that the antiseptics must be used in function of the time of the grafting of the cultured epithelium.

  6. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  7. Astaxanthin induces migration in human skin keratinocytes via Rac1 activation and RhoA inhibition

    OpenAIRE

    Ritto, Dakanda; Tanasawet, Supita; Singkhorn, Sawana; Klaypradit, Wanwimol; Hutamekalin, Pilaiwanwadee; Tipmanee, Varomyalin; Sukketsiri, Wanida

    2017-01-01

    BACKGROUND/OBJECTIVES Re-epithelialization has an important role in skin wound healing. Astaxanthin (ASX), a carotenoid found in crustaceans including shrimp, crab, and salmon, has been widely used for skin protection. Therefore, we investigated the effects of ASX on proliferation and migration of human skin keratinocyte cells and explored the mechanism associated with that migration. MATERIAL/METHOD HaCaT keratinocyte cells were exposed to 0.25-1 ?g/mL of ASX. Proliferation of keratinocytes ...

  8. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  9. Astaxanthin induces migration in human skin keratinocytes via Rac1 activation and RhoA inhibition.

    Science.gov (United States)

    Ritto, Dakanda; Tanasawet, Supita; Singkhorn, Sawana; Klaypradit, Wanwimol; Hutamekalin, Pilaiwanwadee; Tipmanee, Varomyalin; Sukketsiri, Wanida

    2017-08-01

    Re-epithelialization has an important role in skin wound healing. Astaxanthin (ASX), a carotenoid found in crustaceans including shrimp, crab, and salmon, has been widely used for skin protection. Therefore, we investigated the effects of ASX on proliferation and migration of human skin keratinocyte cells and explored the mechanism associated with that migration. HaCaT keratinocyte cells were exposed to 0.25-1 µg/mL of ASX. Proliferation of keratinocytes was analyzed by using MTT assays and flow cytometry. Keratinocyte migration was determined by using a scratch wound-healing assay. A mechanism for regulation of migration was explored via immunocytochemistry and western blot analysis. Our results suggest that ASX produces no significant toxicity in human keratinocyte cells. Cell-cycle analysis on ASX-treated keratinocytes demonstrated a significant increase in keratinocyte cell proliferation at the S phase. In addition, ASX increased keratinocyte motility across the wound space in a time-dependent manner. The mechanism by which ASX increased keratinocyte migration was associated with induction of filopodia and formation of lamellipodia, as well as with increased Cdc42 and Rac1 activation and decreased RhoA activation. ASX stimulates the migration of keratinocytes through Cdc42, Rac1 activation and RhoA inhibition. ASX has a positive role in the re-epithelialization of wounds. Our results may encourage further in vivo and clinical study into the development of ASX as a potential agent for wound repair.

  10. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  11. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  12. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  13. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  14. Cyclin D1 localizes in the cytoplasm of keratinocytes during skin differentiation and regulates cell–matrix adhesion

    Science.gov (United States)

    Fernández-Hernández, Rita; Rafel, Marta; Fusté, Noel P; Aguayo, Rafael S; Casanova, Josep M; Egea, Joaquim; Ferrezuelo, Francisco; Garí, Eloi

    2013-01-01

    The function of Cyclin D1 (CycD1) has been widely studied in the cell nucleus as a regulatory subunit of the cyclin-dependent kinases Cdk4/6 involved in the control of proliferation and development in mammals. CycD1 has been also localized in the cytoplasm, where its function nevertheless is poorly characterized. In this work we have observed that in normal skin as well as in primary cultures of human keratinocytes, cytoplasmic localization of CycD1 correlated with the degree of differentiation of the keratinocyte. In these conditions, CycD1 co-localized in cytoplasmic foci with exocyst components (Sec6) and regulators (RalA), and with β1 integrin, suggesting a role for CycD1 in the regulation of keratinocyte adhesion during differentiation. Consistent with this hypothesis, CycD1 overexpression increased β1 integrin recycling and drastically reduced the ability of keratinocytes to adhere to the extracellular matrix. We propose that localization of CycD1 in the cytoplasm during skin differentiation could be related to the changes in detachment ability of keratinocytes committed to differentiation. PMID:23839032

  15. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  16. Full-thickness skin wound healing using autologous keratinocytes and dermal fibroblasts with fibrin: bilayered versus single-layered substitute.

    Science.gov (United States)

    Idrus, Ruszymah Bt Hj; Rameli, Mohd Adha bin P; Low, Kiat Cheong; Law, Jia Xian; Chua, Kien Hui; Latiff, Mazlyzam Bin Abdul; Saim, Aminuddin Bin

    2014-04-01

    Split-skin grafting (SSG) is the gold standard treatment for full-thickness skin defects. For certain patients, however, an extensive skin lesion resulted in inadequacies of the donor site. Tissue engineering offers an alternative approach by using a very small portion of an individual's skin to harvest cells for propagation and biomaterials to support the cells for implantation. The objective of this study was to determine the effectiveness of autologous bilayered tissue-engineered skin (BTES) and single-layer tissue-engineered skin composed of only keratinocytes (SLTES-K) or fibroblasts (SLTES-F) as alternatives for full-thickness wound healing in a sheep model. Full-thickness skin biopsies were harvested from adult sheep. Isolated fibroblasts were cultured using medium Ham's F12: Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, whereas the keratinocytes were cultured using Define Keratinocytes Serum Free Medium. The BTES, SLTES-K, and SLTES-F were constructed using autologous fibrin as a biomaterial. Eight full-thickness wounds were created on the dorsum of the body of the sheep. On 4 wounds, polyvinyl chloride rings were used as chambers to prevent cell migration at the edge. The wounds were observed at days 7, 14, and 21. After 3 weeks of implantation, the sheep were euthanized and the skins were harvested. The excised tissues were fixed in formalin for histological examination via hematoxylin-eosin, Masson trichrome, and elastin van Gieson staining. The results showed that BTES, SLTES-K, and SLTES-F promote wound healing in nonchambered and chambered wounds, and BTES demonstrated the best healing potential. In conclusion, BTES proved to be an effective tissue-engineered construct that can promote the healing of full-thickness skin lesions. With the support of further clinical trials, this procedure could be an alternative to SSG for patients with partial- and full-thickness burns.

  17. CtBP1 overexpression in keratinocytes perturbs skin homeostasis.

    Science.gov (United States)

    Deng, Hui; Li, Fulun; Li, Hong; Deng, Yu; Liu, Jing; Wang, Donna; Han, Gangwen; Wang, Xiao-Jing; Zhang, Qinghong

    2014-05-01

    Carboxyl-terminal-binding protein-1 (CtBP1) is a transcriptional corepressor with multiple in vitro targets, but its in vivo functions are largely unknown. We generated keratinocyte-specific CtBP1 transgenic mice with a keratin-5 promoter (K5.CtBP1) to probe the pathological roles of CtBP1. At transgene expression levels comparable to endogenous CtBP1 in acute skin wounds, the K5.CtBP1 epidermis displayed hyperproliferation, loss of E-cadherin, and failed terminal differentiation. Known CtBP1 target genes associated with these processes, e.g., p21, Brca1, and E-cadherin, were downregulated in K5.CtBP1 skin. Surprisingly, K5.CtBP1 pups also exhibited a hair loss phenotype. We found that expression of the Distal-less 3 (Dlx3), a critical regulator of hair follicle differentiation and cycling, was decreased in K5.CtBP1 mice. Molecular studies revealed that CtBP1 directly suppressed Dlx3 transcription. Consistently, K5.CtBP1 mice displayed abnormal hair follicles with decreased expression of Dlx3 downstream targets Gata3, Hoxc13, and hair keratins. In summary, this CtBP1 transgenic model provides in vivo evidence for certain CtBP1 functions predicted from in vitro studies, reveals--to our knowledge--previously unreported functions and transcriptional activities of CtBP1 in the context of epithelial-mesenchymal interplay, and suggests that CtBP1 has a pathogenic role in hair follicle morphogenesis and differentiation.

  18. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  19. Fibronectin in cultured rat keratinocytes: distribution, synthesis, and relationship to cytoskeletal proteins

    DEFF Research Database (Denmark)

    Gibson, W T; Couchman, J R; Badley, R A

    1983-01-01

    immunofluorescence staining of cultures grown in the absence of a feeder layer using an antiserum which had been cross-adsorbed with foetal calf serum proteins to remove antibodies which recognised serum fibronectin. The distribution of fibronectin in areas of cell-cell and cell-substratum contact...... of overlap and colinearity of actin and fibronectin filaments. The ability of keratinocytes to produce fibronectin suggests that these cells can contribute to the formation of the basement membrane in skin. The localisation of fibronectin and its close association with actin also suggests that it is involved...

  20. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  1. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  2. Japanese Cedar (Cryptomeria japonica) pollen allergen induces elevation of intracellular calcium in human keratinocytes and impairs epidermal barrier function of human skin ex vivo.

    Science.gov (United States)

    Kumamoto, Junichi; Tsutsumi, Moe; Goto, Makiko; Nagayama, Masaharu; Denda, Mitsuhiro

    2016-01-01

    Cry j1 is the major peptide allergen of Japanese cedar (Sugi), Cryptomeria japonica. Since some allergens disrupt epidermal permeability barrier homeostasis, we hypothesized that Cry j1 might have a similar effect. Intracellular calcium level in cultured human keratinocytes was measured with a ratiometric fluorescent probe, Fura-2 AM. Application of Cry j1 significantly increased the intracellular calcium level of keratinocytes, and this increase was inhibited by trypsin inhibitor or a protease-activated receptor 2 (PAR-2) antagonist. We found that Cry j1 itself did not show protease activity, but application of Cry j1 to cultured keratinocytes induced a rapid (within 30 s) and transient increase of protease activity in the medium. This transient increase was blocked by trypsin inhibitor or PAR-2 antagonist. The effect of Cry j1 on transepidermal water loss (TEWL) of cultured human skin was measured in the presence and absence of a trypsin inhibitor and PAR-2 antagonist. Cry j1 significantly impaired the barrier function of human skin ex vivo, and this action was blocked by co-application of trypsin inhibitor or PAR-2 antagonist. Our results suggested that interaction of Cry j1 with epidermal keratinocytes leads to the activation of PAR-2, which induces elevation of intracellular calcium and disruption of barrier function. Blocking the interaction of Cry j1 with epidermal keratinocytes might ameliorate allergic reaction and prevent disruption of epidermal permeability barrier homeostasis.

  3. Testosterone Stimulates Duox1 Activity through GPRC6A in Skin Keratinocytes*

    Science.gov (United States)

    Ko, Eunbi; Choi, Hyun; Kim, Borim; Kim, Minsun; Park, Kkot-Nara; Bae, Il-Hong; Sung, Young Kwan; Lee, Tae Ryong; Shin, Dong Wook; Bae, Yun Soo

    2014-01-01

    Testosterone is an endocrine hormone with functions in reproductive organs, anabolic events, and skin homeostasis. We report here that GPRC6A serves as a sensor and mediator of the rapid action of testosterone in epidermal keratinocytes. The silencing of GPRC6A inhibited testosterone-induced intracellular calcium ([Ca2+]i) mobilization and H2O2 generation. These results indicated that a testosterone-GPRC6A complex is required for activation of Gq protein, IP3 generation, and [Ca2+]i mobilization, leading to Duox1 activation. H2O2 generation by testosterone stimulated the apoptosis of keratinocytes through the activation of caspase-3. The application of testosterone into three-dimensional skin equivalents increased the apoptosis of keratinocytes between the granular and stratified corneum layers. These results support an understanding of the molecular mechanism of testosterone-dependent apoptosis in which testosterone stimulates H2O2 generation through the activation of Duox1. PMID:25164816

  4. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes

    DEFF Research Database (Denmark)

    Brakebusch, C; Grose, R; Quondamatteo, F

    2000-01-01

    beta 1 integrins are ubiquitously expressed receptors that mediate cell-cell and cell-extracellular matrix interactions. To analyze the function of beta1 integrin in skin we generated mice with a keratinocyte-restricted deletion of the beta 1 integrin gene using the cre-loxP system. Mutant mice...

  5. Enhanced Keratinocyte Proliferation and Migration in Co-culture with Fibroblasts

    Science.gov (United States)

    Wang, Zhenxiang; Wang, Ying; Farhangfar, Farhang; Zimmer, Monica; Zhang, Yongxin

    2012-01-01

    Wound healing is primarily controlled by the proliferation and migration of keratinocytes and fibroblasts as well as the complex interactions between these two cell types. To investigate the interactions between keratinocytes and fibroblasts and the effects of direct cell-to-cell contact on the proliferation and migration of keratinocytes, keratinocytes and fibroblasts were stained with different fluorescence dyes and co-cultured with or without transwells. During the early stage (first 5 days) of the culture, the keratinocytes in contact with fibroblasts proliferated significantly faster than those not in contact with fibroblasts, but in the late stage (11th to 15th day), keratinocyte growth slowed down in all cultures unless EGF was added. In addition, keratinocyte migration was enhanced in co-cultures with fibroblasts in direct contact, but not in the transwells. Furthermore, the effects of the fibroblasts on keratinocyte migration and growth at early culture stage correlated with heparin-binding EGF-like growth factor (HB-EGF), IL-1α and TGF-β1 levels in the cultures where the cells were grown in direct contact. These effects were inhibited by anti-HB-EGF, anti-IL-1α and anti-TGF-β1 antibodies and anti-HB-EGF showed the greatest inhibition. Co-culture of keratinocytes and IL-1α and TGF-β1 siRNA-transfected fibroblasts exhibited a significant reduction in HB-EGF production and keratinocyte proliferation. These results suggest that contact with fibroblasts stimulates the migration and proliferation of keratinocytes during wound healing, and that HB-EGF plays a central role in this process and can be up-regulated by IL-1α and TGF-β1, which also regulate keratinocyte proliferation differently during the early and late stage. PMID:22911722

  6. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  7. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  8. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  9. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  10. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  11. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  12. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  13. Dermal fibroblast expression of stromal cell-derived factor-1 (SDF-1) promotes epidermal keratinocyte proliferation in normal and diseased skin.

    Science.gov (United States)

    Quan, Chunji; Cho, Moon Kyun; Shao, Yuan; Mianecki, Laurel E; Liao, Eric; Perry, Daniel; Quan, Taihao

    2015-12-01

    Stromal cells provide a crucial microenvironment for overlying epithelium. Here we investigated the expression and function of a stromal cell-specific protein, stromal cell-derived factor-1 (SDF-1), in normal human skin and in the tissues of diseased skin. Immunohistology and laser capture microdissection (LCM)-coupled quantitative real-time RT-PCR revealed that SDF-1 is constitutively and predominantly expressed in dermal stromal cells in normal human skin in vivo. To our surprise, an extremely high level of SDF-1 transcription was observed in the dermis of normal human skin in vivo, evidenced by much higher mRNA expression level than type I collagen, the most abundant and highly expressed protein in human skin. SDF-1 was also upregulated in the tissues of many human skin disorders including psoriasis, basal cell carcinoma (BCC), and squamous cell carcinoma (SCC). Double immunostaining for SDF-1 and HSP47 (heat shock protein 47), a marker of fibroblasts, revealed that fibroblasts were the major source of stroma-cell-derived SDF-1 in both normal and diseased skin. Functionally, SDF-1 activates the ERK (extracellular-signal-regulated kinases) pathway and functions as a mitogen to stimulate epidermal keratinocyte proliferation. Both overexpression of SDF-1 in dermal fibroblasts and treatment with rhSDF-1 to the skin equivalent cultures significantly increased the number of keratinocyte layers and epidermal thickness. Conversely, the stimulative function of SDF-1 on keratinocyte proliferation was nearly completely eliminated by interfering with CXCR4, a specific receptor of SDF-1, or by knock-down of SDF-1 in fibroblasts. Our data reveal that extremely high levels of SDF-1 provide a crucial microenvironment for epidermal keratinocyte proliferation in both physiologic and pathologic skin conditions.

  14. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A.Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  15. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  17. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  18. Effects of low-energy gallium-aluminum-arsenide laser irradiation on cultured fibroblasts and keratinocytes.

    Science.gov (United States)

    Pogrel, M A; Chen, J W; Zhang, K

    1997-01-01

    To assess whether the gallium-aluminum-arsenide low energy laser will increase cell proliferation, cell attachment, or cell migration in cultured fibroblasts and keratinocyte models. Monolayer cultures of fibroblasts and keratinocytes were subjected to gallium-aluminum-arsenide laser irradiation at varying power densities for varying time intervals. Cell proliferation was assessed by absorbent spectrophotometry while cell adhesion was assessed by a microcolorimetric assay for cells attached to bovine dermis collagen. Cell migration was assessed through a filter utilizing high power microscopic fields. There were no differences in cell proliferation, adhesion, or migration in either the fibroblasts or keratinocyte culture treated with the gallium-aluminum-arsenide laser at any power density or time compared with nontreated controls. The gallium-aluminum-arsenide laser, when utilized at powers 5-100 milliwatts and times of between 10-120 seconds has no biostimulatory effects on fibroblasts or keratinocyte cultures as assessed by cell proliferation, adhesion, or migration.

  19. Acellular porcine xenodermis as a temporary wound cover and substratum for cultured keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Stehlíček, P.; Veselý, Pavel

    2002-01-01

    Roč. 4, - (2002), s. 83-85 ISSN 1473-2262 Institutional research plan: CEZ:AV0Z5052915 Keywords : wound healing * cultured keratinocytes * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  20. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  1. Grafting of venous leg ulcers. An intraindividual comparison between cultured skin equivalents and full-thickness skin punch grafts

    NARCIS (Netherlands)

    Mol, M. A.; Nanninga, P. B.; van Eendenburg, J. P.; Westerhof, W.; Mekkes, J. R.; van Ginkel, C. J.

    1991-01-01

    Skin equivalents that consisted of a noncontracted collagen gel populated with allogeneic fibroblasts and covered with autologous cultured keratinocytes were used for grafting venous leg ulcers. The results were compared in the same patient with those obtained with a routinely used standard method

  2. The silver locus product (Silv/gp100/Pmel17) as a new tool for the analysis of melanosome transfer in human melanocyte-keratinocyte co-culture.

    Science.gov (United States)

    Singh, Suman K; Nizard, Carine; Kurfurst, Robin; Bonte, Frederic; Schnebert, Sylvianne; Tobin, Desmond J

    2008-05-01

    Melanosomes are melanocyte-specific lysosome-related organelles that are transferred to keratinocytes of the epidermis and anagen hair bulb. Transferred melanin forms supra-nuclear caps that protect epidermal keratinocytes against UV irradiation. The mechanism(s) responsible for melanosome transfer into keratinocytes and their subsequent intra-keratinocyte distribution has long remained one of the most enigmatic of heterotypic cell interactions. Although there have been many attempts to study this process, significant progress has been hindered by the absence of an adequate in vitro model. During our ongoing study of melanocyte-keratinocyte interactions in skin and hair follicle, we have developed a novel in vitro assay that exploits the specificity of Silv/Pmel17/gp100 expression for melanosome/melanin granules. Using matched cultures of keratinocytes and melanocytes isolated from normal healthy epidermis together with double immunofluorescence, we have determined that gp100 is a surprisingly useful tracker of transferred melanin. Moreover, transferred gp100 stained melanin granules emit a bright fluorescence signal, facilitating ready quantification of melanin transfer levels between melanocytes and keratinocytes. This quantitative approach was validated using known inducers and inhibitors of the melanocyte phenotype. This assay further confirmed that cytophagocytosis of melanocyte components (e.g. dendrite tips) by keratinocytes is one route for melanin incorporation into keratinocytes. Lastly, a role for the recently proposed filopodium as a direct conduit for melanin transfer was substantiated using this novel approach. In conclusion, this assay promises to significantly aid our investigations of the molecular basis of melanosome transfer and offers a new tool for the clinical evaluation of melanocyte modulators.

  3. Silver nanoparticles mediate differential responses in keratinocytes and fibroblasts during skin wound healing.

    Science.gov (United States)

    Liu, Xuelai; Lee, Pui-Yan; Ho, Chi-Ming; Lui, Vincent C H; Chen, Yan; Che, Chi-Ming; Tam, Paul K H; Wong, Kenneth K Y

    2010-03-01

    With advances in nanotechnology, pure silver has been recently engineered into nanometer-sized particles (diameter healing through the modulation of cytokines. Nonetheless, the question as to whether AgNPs can affect various skin cell types--keratinocytes and fibroblasts--during the wound-healing process still remains. Therefore, the aim of this study was to focus on the cellular response and events of dermal contraction and epidermal re-epithelialization during wound healing under the influence of AgNPs; for this we used a full-thickness excisional wound model in mice. The wounds were treated with either AgNPs or control with silver sulfadiazine, and the proliferation and biological events of keratinocytes and fibroblasts during healing were studied. Our results confirm that AgNPs can increase the rate of wound closure. On one hand, this was achieved through the promotion of proliferation and migration of keratinocytes. On the other hand, AgNPs can drive the differentiation of fibroblasts into myofibroblasts, thereby promoting wound contraction. These findings further extend our current knowledge of AgNPs in biological and cellular events and also have significant implications for the treatment of wounds in the clinical setting.

  4. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Science.gov (United States)

    Mauro, Marcella; Crosera, Matteo; Pelin, Marco; Florio, Chiara; Bellomo, Francesca; Adami, Gianpiero; Apostoli, Piero; De Palma, Giuseppe; Bovenzi, Massimo; Campanini, Marco; Larese Filon, Francesca

    2015-01-01

    Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs) have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1) and needle-abraded human skin (experiment 2). Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2), while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2) and those with intact skin (1.08 ± 0.20 ng·cm−2). To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI) uptake assays. The results indicate that a long exposure time (i.e., seven days) was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay) that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay). This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure. PMID:26193294

  5. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  6. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  7. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  8. Blood-group-related carbohydrates are expressed in organotypic cultures of human skin and oral mucosa

    DEFF Research Database (Denmark)

    Grøn, B; Andersson, A; Dabelsteen, Erik

    1999-01-01

    the function of cell-surface carbohydrates, we established organotypic cultures of skin and buccal mucosa. In these cultures, keratinocytes are grown at the air-liquid interface on a supporting matrix consisting of homologous fibroblasts embedded in a collagen type I gel. We examined the expression of blood-group...

  9. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  10. Cultures of skin fragments of Salamandra salamandra salamandra (L.) larvae.

    Science.gov (United States)

    Pederzoli, A; Restani, C

    1998-04-01

    As part of a study on the pigmentary system of Salamandra salamandra salamandra (L.), we cultured skin fragments of 7-10-day-old larvae in order to examine the expression of molecules implicated in cellular adhesion and migration and in regulating cell-cell relationships. Keratinocytes, fibroblasts, Leydig cells, xanthophores, and melanophores migrated from the fragments and were observed in the outgrowth. Keratinocytes and fibroblasts organized into an epidermal layer and an underlying "dermal portion." The chromatophores were always located below the epithelial cells, often with fibroblasts. We examined by immunocytochemistry the expression of fibronectin, beta1-integrin, L-CAM, and A-CAM in the cultures. Many keratinocytes, fibroblasts, and Leydig cells expressed all the signal molecules tested. Xanthophores and melanophores were only immunoreactive to the anti-adhesion molecules antisera. Since the molecules tested are known to play a role in cell adhesion, growth, and spreading, as well as in regulating tissue differentiation and in maintaining normal tissue morphology, we may hypothesize that in Salamandra salamandra salamandra fibronectin, beta1-integrin, L-, and A-CAMs concertedly act to stabilize the architecture of the outgrowth and regulate the relationships between chromatophores and those between chromatophores and the other elements of the skin culture.

  11. Geraniin supplementation increases human keratinocyte proliferation in serum-free culture

    Directory of Open Access Journals (Sweden)

    Indra Kusuma

    2013-04-01

    Full Text Available Background Various products used in cellular therapy utilize tissue culture techniques requiring keratinocyte culture. An efficient and clinically acceptable keratinocyte culture system requires supplements with mitogenic activity. Geraniin is a phytochemical with the potential as a supplement for expansion culture of keratinocytes. The objective of the present study was to verify the mitogenic activity of geraniin on human keratinocytes. Methods This was an experimental study using two samples of human foreskin obtained by circumcision of a male child. Epidermal keratinocytes were isolated from the foreskin samples and were divided into paired groups, comprising intervention and control groups. The intervention groups were cultured with geraniin supplementation, whereas the control groups with standard supplements, without the addition of geraniin. Mitochondrial activity of the cells was evaluated by means of the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium-bromide (MTT proliferation assay. Absorbance values in each of the groups was measured at 450 nm. Data analysis was performed with the paired t-test. Results Geraniin supplementation significantly increased the keratinocyte proliferation rates at dosages of 0.8 to 3.1 µM. An increase of 57% in the proliferation rate was obtained at a dosage of 1.6 µM, while at a dosage of 12.5 µM toxic effects were starting to appear. Geraniin presumably causes increased cellular energy status, resulting in increased proliferation rates. Conclusion The findings in this study provide evidence in support of the utilization of geraniin as a supplement for expansion culture of keratinocytes. Further studies may presumably identify the molecules acting as geraniin receptors and the intracellular mechanisms underlying the increase in proliferation rates.

  12. IgE-binding components of cultured human keratinocytes in atopic eczema/dermatitis syndrome and their crossreactivity with Malassezia furfur.

    Science.gov (United States)

    Kortekangas-Savolainen, O; Peltonen, S; Pummi, K; Kalimo, K; Savolainen, J

    2004-02-01

    Atopic eczema/dermatitis syndrome (AEDS) patients display immunoglobulin E (IgE) reactivity to several antigens, e.g. saprophytic yeasts as Malassezia furfur. AEDS patients also show IgE autoreactivity towards cells of their own tissue including epidermis. The aim of this study was to investigate the IgE autoreactivity of AEDS patients to cultured keratinocytes and to reveal potential crossreacting epitopes in cultured keratinocytes and M. furfur. Serum samples of 27 AEDS patients were analyzed, of these 13 were M. furfur radioallergosorbent test (RAST) positive and 14 negative. Four urticaria, three psoriasis, and seven nonatopic patients were included as controls. The studies were performed by using IgE immunoblotting and immunoblotting inhibition methods. Ten IgE-binding protein bands were detected in cultured human keratinocytes by IgE immunoblotting using sera from adult AEDS patients. Anti-keratinocyte IgE antibodies were more associated with elevated S-IgE level than M. furfur RAST. Clear crossreactivity with M. furfur could not be shown. The possible pathomechanism of anti-keratinocyte IgE antibodies is not due to IgE epitope mimicry of saprophytic yeast and local tissue in AEDS skin.

  13. Immuno-ultrastructural localization of involucrin in squamous epithelium and cultured keratinocytes.

    Science.gov (United States)

    Warhol, M J; Roth, J; Lucocq, J M; Pinkus, G S; Rice, R H

    1985-02-01

    Involucrin immunoreactivity was localized ultrastructurally with protein A--gold in epidermis and cultured keratinocytes embedded in Lowicryl K4M. In the skin, immunoreactivity was found predominantly in cells of the granular layer and inner stratum corneum. The label was associated primarily with amorphous cytoplasmic material and especially keratohyaline granules. Some labeling was observed at the cell periphery, but little with keratin filaments. Tissue samples examined without aldehyde fixation showed relatively greater labeling in the outer stratum corneum than fixed tissue. In cultured cells, the labeling was also associated primarily with cytoplasmic granular material and to a lesser extent with the cell periphery. Upon treatment with the ionophore X537A, keratin filaments were found in aggregated arrays and the plasma membranes became convoluted. That involucrin immunoreactivity persisted in the cytoplasm in cultured cells and in vivo after cross-linking occurs could account for considerable isopeptide bonding detected in epidermal keratin fractions and indicates that not all the involucrin participates in envelope formation.

  14. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  15. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  16. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  17. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  18. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  19. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  20. Melanosome transfer to keratinocyte in the chicken embryonic skin is mediated by vesicle release associated with Rho-regulated membrane blebbing.

    Science.gov (United States)

    Tadokoro, Ryosuke; Murai, Hidetaka; Sakai, Ken-Ichiro; Okui, Takahiro; Yokota, Yasuhiro; Takahashi, Yoshiko

    2016-12-02

    During skin pigmentation in amniotes, melanin synthesized in the melanocyte is transferred to keratinocytes by a particle called the melanosome. Previous studies, mostly using dissociated cultured cells, have proposed several different models that explain how the melanosome transfer is achieved. Here, using a technique that labels the plasma membrane of melanocytes within a three-dimensional system that mimics natural tissues, we have visualized the plasma membrane of melanocytes with EGFP in chicken embryonic skin. Confocal time-lapse microscopy reveals that the melanosome transfer is mediated, at least in part, by vesicles produced by plasma membrane. Unexpectedly, the vesicle release is accompanied by the membrane blebbing of melanocytes. Blebs that have encapsulated a melanosome are pinched off to become vesicles, and these melanosome-containing vesicles are finally engulfed by neighboring keratinocytes. For both the membrane blebbing and vesicle release, Rho small GTPase is essential. We further show that the membrane vesicle-mediated melanosome transfer plays a significant role in the skin pigmentation. Given that the skin pigmentation in inter-feather spaces in chickens is similar to that in inter-hair spaces of humans, our findings should have important consequences in cosmetic medicine.

  1. Macromolecular metabolism of a differentiated rat keratinocyte culture system following exposure to sulfur mustard

    International Nuclear Information System (INIS)

    Vaughan, F.L.; Zaman, S.; Scavarelli, R.; Bernstein, I.A.

    1988-01-01

    A method for producing a stratified, squamous epithelium in vitro by cultivating rat keratinocytes on nylon membranes has been developed in this laboratory. This epidermal-like culture is being used to obtain a better understanding of the mechanism of skin vesication after topical exposure to the sulfur mustard bis(beta-chloroethyl) sulfide (BCES) dissolved in a selected solvent. Radiolabeled macromolecular precursors (thymidine, uridine, and leucine) have been used to study the effect of BCES on the synthesis of DNA, RNA, and protein, respectively, after topical exposure to the mustard at concentrations of 0.01-500 nmol/cm2 dissolved in 70% dimethyl sulfoxide (DMSO). From these and other studies it has been determined that exposure to even the low concentration of 0.01 nmol BCES/cm2 for 30 min results in significant inhibition of [ 3 H]thymidine incorporation, although complete recovery occurs by 24 h. Significant inhibition of [ 3 H]uridine and [ 14 C]leucine incorporation is observed only after exposure to much higher concentrations of BCES (10-500 nmol/cm2). This suggests a very early lesion in macromolecular metabolism with DNA being the primary target

  2. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  3. Low-concentration hydrogen peroxide can upregulate keratinocyte intracellular calcium and PAR-2 expression in a human keratinocyte-melanocyte co-culture system.

    Science.gov (United States)

    Li, Jian; Tang, Lu-Yan; Fu, Wen-Wen; Yuan, Jin; Sheng, You-Yu; Yang, Qin-Ping

    2016-12-01

    Hydrogen peroxide (H 2 O 2 ) may have a biphasic effect on melanin synthesis and melanosome transfer. High H 2 O 2 concentrations are involved in impaired melanosome transfer in vitiligo. However, low H 2 O 2 concentration promotes the beneficial proliferation and migration of melanocytes. The aim of this study was to explore low H 2 O 2 and its mechanism in melanosome transfer, protease-activated receptor-2 (PAR-2) expression and calcium balance. Melanosomes were fluorescein-labeled for clear visualization of their transfer. The expression of protease-activated receptor-2 (PAR-2) in keratinocytes was determined by western blot analysis. Flow cytometry was employed to evaluate the effects of H 2 O 2 on calcium levels in keratinocytes. Fluorescence microscopy showed the upregulation of melanosome transfer into keratinocytes following 0.3 mM H 2 O 2 treatment in the co-cultures rather than in the untreated control groups, which was associated with higher expression of PAR-2 protein and increased calcium concentration. The addition of a PAR-2 antagonist inhibited the positive activity of H 2 O 2 and calcium flow in keratinocytes. When calcium flow was blocked by a calcium chelator, the addition of H 2 O 2 did not increase the PAR-2 expression level in keratinocytes, therefore, inhibiting dendrite formation and melanosome transfer. Low H 2 O 2 concentration promotes melanosome transfer with increased PAR-2 expression level and calcium concentration in keratinocytes. In addition, the interaction between melanocytes and keratinocytes is more beneficial to enhance calcium levels in keratinocytes which mediate melanin transfer. Moreover, low H 2 O 2 concentration promotes dendrite formation, in which extracellular calcium and Par-2 were involved.

  4. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  5. Wound closure with human keratinocytes cultured on a polyurethane dressing overlaid on a cultured human dermal replacement.

    Science.gov (United States)

    Rennekampff, H O; Hansbrough, J F; Kiessig, V; Abiezzi, S; Woods, V

    1996-07-01

    Burn excision followed by immediate wound coverage has become the clinical standard for managing extensive burn injuries in much of the world. When sufficient autograft skin to achieve permanent wound closure is unavailable, cell culture technology has made the use of cultured human keratinocyte (HK) sheets clinically feasible. Whereas previous techniques have focused on development of multilayered, differentiated HK sheets, our attention has been drawn to using HK in a highly proliferative, less differentiated state. Time requirements for preparation of multistratified cultured HK are high, and preparatory steps may destroy important integrin adhesion molecules. We describe the use of HK cultured to single layer confluence on a polyurethane membrane(HD), with serum-free medium. HK-HD grafts were transplanted to full-thickness wounds on athymic mice (n = 31). A second group of mice (DG-HK-HD), n = 28) received a living human dermal replacement containing cultured fibroblasts before placement of HK-HD. Control mice received HD alone (n = 4). Basement membrane proteins on healed wounds and surface integrins on cultured HK were identified by means of immunostaining and direct microscopic visualization. HK cultured just to the confluent state on polyurethane membrane were positive for integrins alpha(5) and alpha(6), major integrins on proliferating HK. Histologic analysis showed epithelialized wounds in all groups after 21 days. Using an anti-human involucrin antibody we demonstrated the presence of HK in 64.5% of the HK-HD group, 61% of the DG-HK-HD group, and 0% in the HD group. Mice that received the living human dermal replacement containing cultured fibroblasts in combination with HK-HD grafts developed a thick, well-vascularized neodermis. Strong laminin and collagen IV staining was observed in wound areas covered with HK. These data show that full-thickness wounds can be closed by application of a single layer of proliferating HK cultured on a biocompatible

  6. Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

    Science.gov (United States)

    Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

    2011-03-01

    OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

  7. Short communication: Effects of Lactobacillus helveticus-fermented milk on the differentiation of cultured normal human epidermal keratinocytes.

    Science.gov (United States)

    Baba, H; Masuyama, A; Takano, T

    2006-06-01

    Effects of Lactobacillus helveticus-fermented milk whey on the differentiation of normal human epidermal keratinocytes were studied. Analysis using real-time reverse transcription-polymerase chain reaction revealed that addition of Lactobacillus helveticus-fermented milk whey to the culture medium enhanced mRNA expression of keratin 10, an early differentiation marker, as well as involucrin, a late differentiation marker. Whey of artificially acidified milk, prepared by the addition of dl-lactic acid to milk instead of fermentation, also promoted expression of both markers, but Lactobacillus helveticus-fermented milk whey was more effective in increasing expression of those markers. These results indicate that milk whey has the potential to induce multiple stages of keratinocyte differentiation and that fermentation with Lactobacillus helveticus increases that activity. Furthermore, we examined the expression of profilaggrin, which increases with epidermal terminal differentiation, and found that Lactobacillus helveticus-fermented milk whey enhanced expression of profilaggrin mRNA in a dose-dependent manner. Expression also occurred to a greater extent than with artificially acidified milk whey or other whey samples prepared with several lactic acid bacterial species. Because the proteolytically processed form of profilaggrin, filaggrin, is very important for normal epidermal hydration and flexibility, our results indicate that Lactobacillus helveticus-fermented milk whey has the potential to enhance the production of filaggrin-related natural moisturizing factor, because of its effect on the induction of epidermal differentiation, and is expected to be a useful skin moisturizing agent.

  8. CtBP1 over-expression in keratinocytes perturbs skin homeostasis

    Science.gov (United States)

    Deng, Hui; Li, Fulun; Li, Hong; Deng, Yu; Liu, Jing; Wang, Donna; Han, Gangwen; Wang, Xiao-Jing; Zhang, Qinghong

    2015-01-01

    Carboxyl-terminal binding protein-1 (CtBP1) is a transcriptional co-repressor with multiple in vitro targets, but its in vivo functions are largely unknown. We generated keratinocyte-specific CtBP1 transgenic mice with a keratin 5 promoter (K5.CtBP1) to probe the pathological roles of CtBP1. At transgene expression levels comparable with endogenous CtBP1 in acute skin wounds, K5.CtBP1 epidermis displayed hyperproliferation, loss of E-cadherin, and failed terminal differentiation. Known CtBP1 target genes associated with these processes, e.g., p21, Brca1, and E-cadherin were down-regulated in K5.CtBP1 skin. Surprisingly, K5.CtBP1 pups also exhibited a hair loss phenotype. We found that expression of the Distal-less 3 (Dlx3), a critical regulator of hair follicle differentiation and cycling, was decreased in K5.CtBP1 mice. Molecular studies revealed that CtBP1 directly suppressed Dlx3 transcription. Consistently, K5.CtBP1 mice displayed abnormal hair follicles with decreased expression of Dlx3 downstream targets Gata3, Hoxc13, and hair keratins. In sum, this first CtBP1 transgenic model provides in vivo evidence for certain CtBP1 functions predicted from in vitro studies, reveals to our knowledge previously unreported functions and transcriptional activities of CtBP1 in the context of epithelial-mesenchymal interplay, and suggest CtBP1 has a pathogenesis role in hair follicle morphogenesis and differentiation. PMID:24280726

  9. Risk factors for keratinocyte skin cancer in patients diagnosed with melanoma, a large retrospective study.

    Science.gov (United States)

    Espinosa, Pablo; Pfeiffer, Ruth M; García-Casado, Zaida; Requena, Celia; Landi, Maria Teresa; Kumar, Rajiv; Nagore, Eduardo

    2016-01-01

    Melanoma survivors are at an increased risk of developing other malignancies, including keratinocyte skin cancer (KSC). While it is known that many risk factors for melanoma also impact risk of KSC in the general population, no previous study has investigated risk factors for KSC development in melanoma patients. We assessed associations of personal and clinical characteristics, including skin phenotype and variations in the melanocortin 1 receptor (MC1R) gene, with KSC risk in melanoma patients. We used prospective follow-up information on 1200 patients treated for melanoma at the Instituto Valenciano de Oncología, Spain, between 2000 and 2011. We computed hazard ratios and 95% confidence intervals (CIs) for the association of clinical, personal and genetic characteristics with risk of KSC, squamous cell carcinoma (SCC), or basal cell carcinoma (BCC) from Cox proportional hazard models. Five-year cumulative incidence based on competing risk models of SCC, BCC or KSC overall was computed using multivariate subdistribution hazard models. To assess predictive performance of the models, we computed areas under the receiver-operating characteristic curves (AUCs, discriminatory power) using cross-validation. Median follow-up was 57.2 months; a KSC was detected in 163 patients (13.6%). In multivariable Cox models, age, sex, sunburns, chronic sun exposure, past personal history of non-melanoma skin cancer or other non-cutaneous neoplasia, and the MC1R variants p.D294H and p.R163Q were significantly associated with KSC risk. A cumulative incidence model including age, sex, personal history of KSC, and of other non-cutaneous neoplasia had an AUC of 0.76 (95% CI: 0.71-0.80). When p.D294H and p.R163Q variants were added to the model, the AUC increased to 0.81 (95% CI: 0.77-0.84) (p-value for difference skin characteristics, and sun exposure, p.R163Q and p.D294H MC1R variants significantly increased KSC risk among melanoma patients. Our findings may help identify patients

  10. Low levels of glutathione are sufficient for survival of keratinocytes after UV irradiation and for healing of mouse skin wounds.

    Science.gov (United States)

    Telorack, Michèle; Abplanalp, Jeannette; Werner, Sabine

    2016-08-01

    Reduced levels of the cellular antioxidant glutathione are associated with premature skin aging, cancer and impaired wound healing, but the in vivo functions of glutathione in the skin remain largely unknown. Therefore, we analyzed mice lacking the modifier subunit of the glutamate cysteine ligase (Gclm), the enzyme that catalyzes the rate-limiting step of glutathione biosynthesis. Glutathione levels in the skin of these mice were reduced by 70 %. However, neither skin development and homeostasis, nor UVA- or UVB-induced apoptosis in the epidermis were affected. Histomorphometric analysis of excisional wounds did not reveal wound healing abnormalities in young Gclm-deficient mice, while the area of hyperproliferative epithelium as well as keratinocyte proliferation were affected in aged mice. These findings suggest that low levels of glutathione are sufficient for wound repair in young mice, but become rate-limiting upon aging.

  11. Effects of the marine toxin palytoxin on human skin keratinocytes: role of ionic imbalance.

    Science.gov (United States)

    Pelin, M; Zanette, C; De Bortoli, M; Sosa, S; Loggia, R Della; Tubaro, A; Florio, C

    2011-03-28

    Palytoxin (PLTX), a marine toxin identified in Palythoa zoanthid corals and Ostreopsis dinoflagellates, represents an increasing hazard for human health. Recently, dermatological problems have been associated to cutaneous exposure to PLTX during Ostreopsis blooms arising the need for experimental data characterizing PLTX effects on the skin. This study highlights in vitro the cytotoxic effects of PLTX on human keratinocytes (HaCaT cell line). A short time exposure (4h) to PLTX reduced mitochondrial activity (MTT assay), cell mass (SRB assay) and plasma membrane integrity (LDH leakage) with different potencies: EC₅₀ values of 6.1 ± 1.3×10⁻¹¹, 4.7 ± 0.9 × 10⁻¹⁰ M and 1.8 ± 0.1 × 10⁻⁸ M, respectively. PLTX effect on mitochondrial activity was ouabain- and Na+-sensitive, but only partially sensitive to removal of Ca²+ ions. One hour exposure to the toxin also induced a Na+-dependent and Ca²+-independent superoxide anion production. These results indicate that among the chain of intracellular events following the interaction of PLTX with the Na+/K+-ATPase the first and crucial step is the increased intracellular Na+ concentration that triggers a sequence of cell dysfunction involving mitochondrial affection and oxidative stress, leading to an irreversible cell death. The PLTX concentrations inducing cytotoxicty seem to be lower than those of potential cutaneous human exposure during Ostreopsis ovata blooms, indicating the harmful potential of the toxin. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. Comparative toxicities of bismuth oxybromide and titanium dioxide exposure on human skin keratinocyte cells.

    Science.gov (United States)

    Gao, Xiaoya; Wang, Yawen; Peng, Shiqi; Yue, Bin; Fan, Caimei; Chen, Weiyi; Li, Xiaona

    2015-09-01

    Nano-sized bismuth oxybromide (BiOBr) particles are being considered for applications within the semiconductor industry. However, little is known about their potential impact on human health. In this study, we comparatively investigated the cytotoxicity of BiOBr and titanium dioxide (TiO2) nanoparticles (NPs) using human skin keratinocyte cell line (HaCaT) as a research model. Results indicate that lamellar-shaped BiOBr (length: 200 nm, width: 150 nm, and an average thickness: around 15 nm) has less toxic effects on cell viability and intracellular organelles than TiO2 (P25) NPs. BiOBr mainly induced late cell apoptosis, while for TiO2, both early apoptosis and late apoptosis were involved. Cell cycle arrest was found in cells on both NPs exposure, and more prominent in TiO2-treated cells. More cellular uptake was achieved after TiO2 exposure, particularly at 10 μg mL(-1), presence of TiO2 resulted in more than 2-fold increase in cellular granularity compared with BiOBr. Furthermore, TiO2 had a high potential to generate intracellular reactive oxygen species (ROS) in cells, where a 2.7-fold increase in TiO2 group and 2.0-fold increase in BiOBr group at the same concentration of 25 μg mL(-1). Higher cellular uptake and ROS stimulation should contribute to the more hazards of TiO2 than BiOBr NPs. This knowledge is a crucial component in the environmental and human hazard assessment of BiOBr and TiO2 NPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  14. Constitutive expression of hypoxia-inducible factor-1 α in keratinocytes during the repair of skin wounds in horses.

    Science.gov (United States)

    Deschene, Karine; Céleste, Christophe; Boerboom, Derek; Theoret, Christine L

    2011-01-01

    As a transient hypoxic state exists within skin wounds in horses and may be important for the healing process, this study sought to identify a molecular hypoxia response occurring in horse limb and body wounds healing by second intention. Hypoxia-inducible factor 1α (HIF1α) protein expression was studied throughout repair by Western blotting and immunofluorescence. Paradoxically, HIF1α was strongly expressed in intact skin and its expression decreased dramatically following wounding (pwounded tissue. HIF1α levels reincreased in parallel with the epithelialization process, and more rapidly in body wounds than in limb wounds (pequine keratinocytes in both intact and wounded skin, and may regulate the expression of CDKN1A in this cell type. © 2011 by the Wound Healing Society.

  15. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in human keratinocytes and ex vivo skin.

    Science.gov (United States)

    Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2013-05-01

    Nicotinamide (vitamin B3) protects from ultraviolet (UV) radiation-induced carcinogenesis in mice and from UV-induced immunosuppression in mice and humans. Recent double-blinded randomized controlled Phase 2 studies in heavily sun-damaged individuals have shown that oral nicotinamide significantly reduces premalignant actinic keratoses, and may reduce new non-melanoma skin cancers. Nicotinamide is a precursor of nicotinamide adenine dinucleotide (NAD(+)), an essential coenzyme in adenosine triphosphate (ATP) production. Previously, we showed that nicotinamide prevents UV-induced ATP decline in HaCaT keratinocytes. Energy-dependent DNA repair is a key determinant of cellular survival after exposure to DNA-damaging agents such as UV radiation. Hence, in this study we investigated whether nicotinamide protection from cellular energy loss influences DNA repair. We treated HaCaT keratinocytes with nicotinamide and exposed them to low-dose solar-simulated UV (ssUV). Excision repair was quantified using an assay of unscheduled DNA synthesis. Nicotinamide increased both the proportion of cells undergoing excision repair and the repair rate in each cell. We then investigated ssUV-induced cyclobutane pyrimidine dimers (CPDs) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxoG) formation and repair by comet assay in keratinocytes and with immunohistochemistry in human skin. Nicotinamide reduced CPDs and 8oxoG in both models and the reduction appeared to be due to enhancement of DNA repair. These results show that nicotinamide enhances two different pathways for repair of UV-induced photolesions, supporting nicotinamide's potential as an inexpensive, convenient and non-toxic agent for skin cancer chemoprevention.

  16. Different oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to non extreme daily-ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Claire Marionnet

    Full Text Available Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV spectrum referred as "daily UV radiation" (DUVR with a higher UVA (320-400 nm to UVB (280-320 nm irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure.

  17. [Expression of coxsackie-adenovirus receptor in keratinocytes of mouse skin after heat stimulation and the effect of coxsackie-adenovirus receptor on dendritic epidermal T lymphocytes].

    Science.gov (United States)

    Deng, Xiangdong; Chen, Fuxing; Liu, Junquan; Zhou, Zhonghai; Jia, Chiyu

    2014-02-01

    To study the influence of heat stimulation on expression of coxsackie-adenovirus receptor (CAR) in keratinocytes (KCs) of mouse skin and the effect of CAR on production of cell growth factors by dendritic epidermal T lymphocytes (DETCs). (1) Twenty BALB/c mice were divided into heat stimulation group (HS) and control group (C) according to the random number table, with 10 mice in each group. Mice in group HS were inflicted with scald milder than superficial-thickness by dressing wet hot gauze, which had been soaked in 100°C hot water for 3 min, in the hair removed area on the back for 1 to 3 s, while mice in group C were sham injured by dressing a wet gauze which had been soaked in water of room temperature for 3 min in the hair removed area on the back for 1 to 3 s. Square full-thickness skin specimens measuring 2.0 cm × 2.0 cm in size were obtained from the center of the bare skin. The expression of CAR in skin tissue sections were detected by immunohistochemistry staining. The mRNA and protein expression levels of CAR in skin tissue sections were respectively determined by real-time fluorescent quantitation RT-PCR and Western blotting. (2) KCs were isolated and cultured from full-thickness skin obtained from the trunk of 2 fetal BALB/c mice, and they were divided into 2 groups according to the random number table, with 5 wells in each group. The cells in group HS and group C were respectively cultured in 42°C and 37°C, 5% CO2 incubator for 1 h, and then all the cells were cultured in 37 °, 5% CO2 incubator for 6 h. The apoptosis of the cells and their expression of CAR were detected by flow cytometer. (3) Five BALB/c mice were sacrificed, and full-thickness skin was obtained from the trunk. The DETCs were divided into 7 groups according to the random number table after being isolated and purified from the skin specimens. Cells in group C were cultured without any stimulation, and cells in the 0.5, 1.0, 2.0, 4.0, 8.0, and 16.0 mg/L CAR groups were

  18. Production of superoxide anions by keratinocytes initiates P. acnes-induced inflammation of the skin.

    Directory of Open Access Journals (Sweden)

    Philippe A Grange

    2009-07-01

    Full Text Available Acne vulgaris is a chronic inflammatory disorder of the sebaceous follicles. Propionibacterium acnes (P. acnes, a gram-positive anareobic bacterium, plays a critical role in the development of these inflammatory lesions. This study aimed at determining whether reactive oxygen species (ROS are produced by keratinocytes upon P. acnes infection, dissecting the mechanism of this production, and investigating how this phenomenon integrates in the general inflammatory response induced by P. acnes. In our hands, ROS, and especially superoxide anions (O2(*-, were rapidly produced by keratinocytes upon stimulation by P. acnes surface proteins. In P. acnes-stimulated keratinocytes, O2(*- was produced by NAD(PH oxidase through activation of the scavenger receptor CD36. O2(*- was dismuted by superoxide dismutase to form hydrogen peroxide which was further detoxified into water by the GSH/GPx system. In addition, P. acnes-induced O2(*- abrogated P. acnes growth and was involved in keratinocyte lysis through the combination of O2(*- with nitric oxide to form peroxynitrites. Finally, retinoic acid derivates, the most efficient anti-acneic drugs, prevent O2(*- production, IL-8 release and keratinocyte apoptosis, suggesting the relevance of this pathway in humans.

  19. Decorin gene expression and its regulation in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. → Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. → Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. → Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  20. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  1. Characterization of a human epidermis model reconstructed from hair follicle keratinocytes and comparison with two commercially models and native skin.

    Science.gov (United States)

    Guiraud, B; Hernandez-Pigeon, H; Ceruti, I; Mas, S; Palvadeau, Y; Saint-Martory, C; Castex-Rizzi, N; Duplan, H; Bessou-Touya, S

    2014-10-01

    Outer root sheath (ORS) cells of human hair follicles are a readily available, non-invasive source of keratinocytes for epidermis reconstruction. The aim of this study was to characterize a model of epidermis reconstructed from ORS cells (ORS-derived model) and to evaluate its reproducibility, in comparison with native human skin and two marketed reconstructed skin models (model A, Episkin(®) and model B, Skinethic(®) ). Cell morphology and tissue architecture of the three models were analysed histologically and proliferation and differentiation marker expression by immunohistochemistry and mRNA quantification. All models displayed the same general epidermal architecture as native epidermis, but with a thicker stratum corneum in models A and B. Compared with native epidermis, Ki67 was correctly localized in epidermal basal cells in all models, as K10 in suprabasal layers. In all skin models, transglutaminase 1 (TGM1) was prematurely expressed in suprabasal layers. However, this expression was only observed from the upper stratum spinosum in the ORS-derived model. In this model, filaggrin and loricrin were correctly located in the stratum granulosum. Filaggrin, involucrin, loricrin and TGM1 mRNAs (markers of keratinocyte terminal differentiation) were transcriptionally expressed in all models. In the ORS-derived model, transcriptional expression level was similar to that of native skin. ORS cell-based reconstructed epidermis is a valid and reproducible model for human epidermis and it may be used to evaluate the effects of active substances and cosmetic formulations. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  2. Hibiscus syriacus Extract from an Established Cell Culture Stimulates Skin Wound Healing

    Directory of Open Access Journals (Sweden)

    O. di Martino

    2017-01-01

    Full Text Available Higher plants are the source of a wide array of bioactive compounds that support skin integrity and health. Hibiscus syriacus, family Malvaceae, is a plant of Chinese origin known for its antipyretic, anthelmintic, and antifungal properties. The aim of this study was to assess the healing and hydration properties of H. syriacus ethanolic extract (HSEE. We established a cell culture from Hibiscus syriacus leaves and obtained an ethanol soluble extract from cultured cells. The properties of the extract were tested by gene expression and functional analyses on human fibroblast, keratinocytes, and skin explants. HSEE treatment increased the healing potential of fibroblasts and keratinocytes. Specifically, HSEE significantly stimulated fibronectin and collagen synthesis by 16 and 60%, respectively, while fibroblasts contractility was enhanced by 30%. These results were confirmed on skin explants, where HSEE accelerated the wound healing activity in terms of epithelium formation and fibronectin production. Moreover, HSEE increased the expression of genes involved in skin hydration and homeostasis. Specifically, aquaporin 3 and filaggrin genes were enhanced by 20 and 58%, respectively. Our data show that HSEE contains compounds capable of stimulating expression of biomarkers relevant to skin regeneration and hydration thereby counteracting molecular pathways leading to skin damage and aging.

  3. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  4. Extracts of Sarcoptes scabiei De Geer Downmodulate Secretion of IL-8 by Skin Keratinocytes and Fibroblasts and of GM-CSF by Fibroblasts in the Presence of Proinflammatory Cytokines

    Science.gov (United States)

    Mullins, Jeremi S.; Arlian, Larry G.; Morgan, Marjorie S.

    2009-01-01

    Previous in vitro studies showed that molecules in an extract of the mite Sarcoptes scabiei variety canis De Geer could modulate the secretion of cytokines from cultured normal human epidermal keratinocytes and dermal fibroblasts in the absence of proinflammatory cytokines in the cell culture media. The purpose of this study was to investigate whether scabies extract could also modulate cytokine and chemokine secretion from epidermal keratinocytes and dermal fibroblasts in the presence of proinflammatory cytokines that are likely present in the scabietic lesion in vivo. In particular, could the downmodulating properties of this ectoparasitic mite on skin cells be maintained in the presence of proinflammatory cytokines? We found that even in the presence of the proinflammatory cytokines interleukin (IL)-1α, IL-1β, and a mixture of tumor necrosis factor (TNF)α + IL-17, scabies extract still downregulated the levels of IL-8 secretion from keratinocytes and fibroblasts and of granulocyte/macrophage-colony stimulating factor (GM-CSF) secretion from fibroblasts that were induced by stimulation of the cells with proinflammatory cytokines alone. This study also showed that scabies molecules induced secretions of growth-related oncogene α (GROα), transforming growth factor α (TGFα), and cutaneous T-cell attracting chemokine (CTACK) from keratinocytes and IL-6 and granulocyte-colony stimulating factor (G-CSF) from fibroblasts. These findings, coupled with the previous findings that molecules in scabies extract could downregulate expression of intracellular adhesion molecule-1 (ICAM-1) and E-selectin by normal dermal microvascular endothelial cells and secretion of IL-1ra from keratinocytes, suggest that multiple factors from scabies mites play a role in the characteristic delayed inflammatory response to a primary infestation with S. scabiei. These are adaptations that favor invasion of the host by the parasite. PMID:19645287

  5. [Promoter effect of mercury chloride and methyl-mercury on human keratinocytes in culture].

    Science.gov (United States)

    Zefferino, R; Elia, G; Petrozzi, M T; Leone, A; Corsi, P; Ambrosi, L

    2002-01-01

    Mercury has received considerable media focus because it is present in dental amalgams and seafood. There is potential exposure in gas meters, thermometers and fluorescent lamps workers. To evaluate its possible epigenetic carcinogen effect, cultures of human keratinocytes were treated with increasing doses of HgCl2 for 30 min, 24 h and of CH3HgCl for 24 h, respectively. The red neutral method was used to evaluate the doses of HgCl2 and CH3HgCl which had no cytotoxic effect. Then, the dye transfer method was used to investigate the gap junctions-mediated intercellular communication (GJIC). Cells were microinjected with Lucifer Yellow CH by using the Eppendorf Apparatus and the Leica inverted microscope. After 30 min incubation at the concentration of 10 microM, HgCl2 did not exert inhibition of GJIC. Conversely, after 24 h at the concentration of 10 nM, HgCl2 inhibited GJIC. Incubation with CH3HgCl at the concentration of 250 nM for 24 h reduced the number of fluorescent cells, thus denoting a inhibition of GJIC. Taken together our data demonstrated that: i) HgCl2 and CH3HgCl exerted an inhibitory effect upon GJIC; ii) HgCl2 resulted to inhibit GJIC at concentrations 25 folds lower than CH3HgCl. Further studies will be addressed to evaluate whether the reversal of GJIC inhibition could be obtained by withdrawal of toxic substance, or by the addition of a GJIC activator like the retinoic acid. Finally to shed light on the possible effect of mercury derivates at the transcriptional or translational levels, the expression profile of the connexin 43 gene after HgCl2 and CH3HgCl exposure of cultured human keratinocytes will be investigated.

  6. Epidemiology of non-keratinocytic skin cancers among persons with acquired immunodeficiency syndrome in the U.S.

    Science.gov (United States)

    Lanoy, Emilie; Dores, Graça M.; Madeleine, Margaret M.; Toro, Jorge R.; Fraumeni, Joseph F.; Engels, Eric A.

    2009-01-01

    Objective Immunosuppression may increase risk for some skin cancers. We evaluated skin cancer epidemiology among persons with acquired immunodeficiency syndrome (AIDS). Design We linked data from population-based U.S. AIDS and cancer registries to evaluate risk of non-keratinocytic skin cancers (melanoma, Merkel cell carcinoma, and appendageal carcinomas, including sebaceous carcinoma) in 497,142 persons with AIDS. Methods Standardized incidence ratios (SIRs) were calculated to relate skin cancer risk to that in the general population. We used logistic regression to compare risk according to demographic factors, CD4 count, and a geographic index of ultraviolet radiation exposure. Results From 60 months before to 60 months after AIDS onset, persons with AIDS had elevated risks of melanoma (SIR=1.3, 95%CI 1.1-1.4, n=292 cases) and, more strongly, of Merkel cell carcinoma (SIR=11, 95%CI 6.3-17, n=17) and sebaceous carcinoma (SIR=8.1, 95%CI 3.2-17, n=7). Risk for appendageal carcinomas increased with progressive time relative to AIDS onset (p-trend=0.03). Risk of these skin cancers was higher in non-Hispanic whites than other racial/ethnic groups, and melanoma risk was highest among men who have sex with men. Melanoma risk was unrelated to CD4 count at AIDS onset (p=0.32). Risks for melanoma and appendageal carcinomas rose with increasing ultraviolet radiation exposure (p-trend<10-4 and p-trend=10-3, respectively). Conclusions Among persons with AIDS, there is a modest excess risk of melanoma which is not strongly related to immunosuppression and may relate to ultraviolet radiation exposure. In contrast, the greatly increased risks for Merkel cell and sebaceous carcinoma suggest an etiologic role for immunosuppression. PMID:19114864

  7. The IL-8 release from cultured human keratinocytes, mediated by antibodies to bullous pemphigoid autoantigen 180, is inhibited by dapsone

    Science.gov (United States)

    Schmidt, E; Reimer, S; Kruse, N; Bröcker, E-B; Zillikens, D

    2001-01-01

    Bullous pemphigoid (BP) is a subepidermal blistering disease associated with autoantibodies to the hemidesmosomal 180 kD BP autoantigen (BP180). However, the binding of autoantibodies to BP180 alone is not sufficient for blister formation in this disease and the infiltration of neutrophils into the skin is required. Dapsone and nicotinamide inhibit neutrophil chemotaxis and are used effectively in treating BP. IL-8 is a known chemoattractant for neutrophils and has been implicated in the inflammatory process of both human and experimental murine BP. We have recently shown that antibodies to BP180 mediate a dose and time-dependent release of IL-6 and IL-8 from cultured normal human epidermal keratinocytes (NHEK). In the present study, we addressed the question whether dapsone or nicotinamide influence this cytokine release. We demonstrate that dapsone, but not nicotinamide, in its pharmacological range, inhibits the IL-8, but not the IL-6 release from NHEK, induced by anti-BP180 IgG, in a dose-dependent fashion as detected by ELISA. IL-8 mRNA levels, as determined by RT-PCR, were the same in cells treated with BP IgG alone compared to cells treated with BP IgG plus dapsone. This observation suggests that dapsone inhibits the BP IgG-induced IL-8 release from cultured NHEK by mechanisms at the post-transcriptional level. Our findings contribute to the understanding how dapsone leads to a reduced influx of neutrophils into BP lesions and, finally, to the cessation of blister formation in this disease. PMID:11359455

  8. Cultured autologous keratinocytes in the treatment of large and deep burns: a retrospective study over 15 years.

    Science.gov (United States)

    Auxenfans, Celine; Menet, Veronique; Catherine, Zulma; Shipkov, Hristo; Lacroix, Pierre; Bertin-Maghit, Marc; Damour, Odile; Braye, Fabienne

    2015-02-01

    The aim was to review the use and indications of cultured autologous epidermis (CAE) in extensive burns and to evaluate the efficiency of our strategy of burn treatment. This retrospective study comprised 15 years (1997-2012). all patients who received CAE. patients who died before complete healing and patients who received exclusively cultured allogeneic keratinocytes. Evaluation criteria were clinical. Time and success of wound healing after CAE graft were evaluated. A total of 63 patients were included with severity Baux score of 107 (from 70 to 140) and mean percentage of TBSA of 71% (from 40% to 97%). The CAE were used as Cuono method, in STSG donor sites and deep 2nd degree burns and in combination with large-meshed STSG (1:6-1:12) in extensively burned patients. Cuono method was used in 6 patients. The final take was 16% (0-30) because of the great fragility of the obtained epidermis. Nine patients with deep 2nd degree burns (mean TBSA 81%, from 60 to 97%) were successfully treated with only CAE without skin grafting. Combined technique (STSG meshed at 1:6-1:12 covered with CAE) was used in 27 patients (mean TBSA 69%, from 49% to 96%) with 85% success rate. Finally, donor sites treated with CAE in 49 patients could be harvested several times thanks to rapid epithelialization (time of wound healing was 7 days (from 5 to 10 days)). The CAE allow rapid healing of STSG donor sites and deep 2nd second degree burns in extensively burned patients. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  9. Artificial skin--culturing of different skin cell lines for generating an artificial skin substitute on cross-weaved spider silk fibres.

    Directory of Open Access Journals (Sweden)

    Hanna Wendt

    Full Text Available BACKGROUND: In the field of Plastic Reconstructive Surgery the development of new innovative matrices for skin repair is in urgent need. The ideal biomaterial should promote attachment, proliferation and growth of cells. Additionally, it should degrade in an appropriate time period without releasing harmful substances, but not exert a pathological immune response. Spider dragline silk from Nephila spp meets these demands to a large extent. METHODOLOGY/PRINCIPAL FINDINGS: Native spider dragline silk, harvested directly out of Nephila spp spiders, was woven on steel frames. Constructs were sterilized and seeded with fibroblasts. After two weeks of cultivating single fibroblasts, keratinocytes were added to generate a bilayered skin model, consisting of dermis and epidermis equivalents. For the next three weeks, constructs in co-culture were lifted on an originally designed setup for air/liquid interface cultivation. After the culturing period, constructs were embedded in paraffin with an especially developed program for spidersilk to avoid supercontraction. Paraffin cross-sections were stained in Haematoxylin & Eosin (H&E for microscopic analyses. CONCLUSION/SIGNIFICANCE: Native spider dragline silk woven on steel frames provides a suitable matrix for 3 dimensional skin cell culturing. Both fibroblasts and keratinocytes cell lines adhere to the spider silk fibres and proliferate. Guided by the spider silk fibres, they sprout into the meshes and reach confluence in at most one week. A well-balanced, bilayered cocultivation in two continuously separated strata can be achieved by serum reduction, changing the medium conditions and the cultivation period at the air/liquid interphase. Therefore spider silk appears to be a promising biomaterial for the enhancement of skin regeneration.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Human in vitro skin organ culture as a model system for evaluating DNA repair.

    Science.gov (United States)

    Liu, Hannah; Tuchinda, Papapit; Fishelevich, Rita; Harberts, Erin; Gaspari, Anthony A

    2014-06-01

    UV-exposures result in accumulation of genetic lesions that facilitate the development of skin cancer. Numerous pharmacologic agents are currently under development to both inhibit formation of DNA lesions and enhance repair. Drugs must be evaluated in vitro, currently performed in cell culture systems, before being tested on humans. Current systems do not account for the architecture and diverse cellularity of intact human skin. To establish a novel, functionally viable, and reproducible in vitro skin organ culture system for studying the effects of various pharmacologic agents on DNA repair. Human skin was obtained from neonatal foreskins. Intact skin punches derived from foreskins were cultured in vitro prior to exposure to UV-irradiation, and evaluated for DNA-damage using a DNA dot blot. Serial skin biopsies were obtained from patients with actinic keratoses treated with topical imiquimod. Expression of immune-stimulating and DNA repair genes was evaluated in ex vivo and in vitro samples. DNA dot blots revealed active repair of UV induced lesions in our in vitro skin organ culture. The photo-protective effect of sunscreen was detected, while imiquimod treatment did not enhance DNA repair in vitro. The DNA repair molecules XPA and XPF were up-regulated in the skin of imiquimod treated patients with actinic keratoses and imiquimod treated bone marrow-derived cell lines, but not keratinocytes. Our in vitro human skin organ culture model detected repair of UV-induced DNA lesions, and may be easily adapted to investigate various photo-protective drugs intended to prevent or treat skin cancer. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  12. Silver nanoparticles protect human keratinocytes against UVB radiation-induced DNA damage and apoptosis: potential for prevention of skin carcinogenesis

    Science.gov (United States)

    Arora, Sumit; Tyagi, Nikhil; Bhardwaj, Arun; Rusu, Lilia; Palanki, Rohan; Vig, Komal; Singh, Shree R.; Singh, Ajay P.; Palanki, Srinivas; Miller, Michael E.; Carter, James E.; Singh, Seema

    2015-01-01

    Ultraviolet (UV)-B radiation from the sun is an established etiological cause of skin cancer, which afflicts more than a million lives each year in the United States alone. Here, we tested the chemopreventive efficacy of silver-nanoparticles (AgNPs) against UVB-irradiation-induced DNA damage and apoptosis in human immortalized keratinocytes (HaCaT). AgNPs were synthesized by reduction-chemistry and characterized for their physicochemical properties. AgNPs were well tolerated by HaCaT cells and their pretreatment protected them from UVB-irradiation-induced apoptosis along with significant reduction in cyclobutane-pyrimidine-dimer formation. Moreover, AgNPs pre-treatment led to G1-phase cell-cycle arrest in UVB-irradiated HaCaT cells. AgNPs were efficiently internalized in UVB-irradiated cells and localized into cytoplasmic and nuclear compartments. Furthermore, we observed an altered expression of various genes involved in cell-cycle, apoptosis and nucleotide-excision repair in HaCaT cells treated with AgNPs prior to UVB-irradiation. Together, these findings provide support for potential utility of AgNPs as novel chemopreventive agents against UVB-irradiation-induced skin carcinogenesis. PMID:25804413

  13. Development of biomimetic tilapia collagen nanofibers for skin regeneration through inducing keratinocytes differentiation and collagen synthesis of dermal fibroblasts.

    Science.gov (United States)

    Zhou, Tian; Wang, Nanping; Xue, Yang; Ding, Tingting; Liu, Xin; Mo, Xiumei; Sun, Jiao

    2015-02-11

    In this study, tilapia skin collagen sponge and electrospun nanofibers were developed for wound dressing. The collagen sponge was composed of at least two α-peptides, and its denaturation temperature was 44.99 °C. It did not change the number of spleen-derived lymphocytes in BALB/c mice, the ratio of CD4+/CD8+ lymphocytes, and the level of IgG or IgM in Sprague-Dawley rat. The contact angle, tensile strength, and weight loss temperature of collagen nanofibers were 21.2°, 6.72±0.44 MPa, and 300 °C, respectively. The nanofibers could promote the viabilities of human keratinocytes (HaCaTs) and human dermal fibroblasts (HDFs), inducing epidermal differentiation through the gene expression of involucrin, filaggrin, and type I transglutaminase of HaCaTs, and they could also accelerate migration of HaCaTs with the expression of matrix metalloproteinase-9 and transforming growth factor-β1 (TGF-β1). Besides, the nanofibers could upregulate the protien level of Col-I in HDFs both via a direct effect and TGF-β1 secreted from HaCaTs, thus facilitating the formation of collagen fibers. Furthermore, the collagen nanofibers stimulated the skin regeneration rapidly and effectively in vivo. These biological effects could be explained as the contributions from the biomimic extracellular cell matrix structure, hydrophilicity, and the multiple amino acids of the collagen nanofibers.

  14. A flexible thermoresponsive cell culture substrate for direct transfer of keratinocyte cell sheets.

    Science.gov (United States)

    Praveen, Wulligundam; Madathil, Bernadette K; Sajin Raj, R S; Kumary, T V; Anil Kumar, P R

    2017-10-25

    Most cell sheet engineering systems require a support or carrier to handle the harvested cell sheets. In this study, polyethylene terephthalate-based overhead projection transparency sheets (OHPS) were subjected to surface hydrolysis by alkali treatment to increase pliability and hydrophilicity and enable poly(N-isopropylacrylamide-co-glycidylmethacrylate) copolymer (NGMA) coating to impart thermoresponsiveness. NGMA was applied on the modified OHPS by the technique of spin coating using an indigenously designed spin coater. The spin coating had the advantage of using low volumes of the polymer and a reduced coating time. The surface chemistry and thermoresponsive coating was analyzed by Fourier transform infrared spectroscopy and water contact angle. Human keratinocyte cells were cultured on the spin coated surface and scaffold-free cell sheets were successfully harvested by simple variation of temperature. These cell sheets were found to be viable, exhibited epithelial characteristic and cell-cell contact as confirmed by positive immunostaining for ZO-1. The integrity and morphology of the cell sheet was confirmed by stereomicroscopy and E-SEM. These results highlight the potential of the NGMA spin coated modified OHPS to serve as a thermoresponsive culture surface-cum-flexible transfer tool.

  15. Frozen cultured sheets of epidermal keratinocytes in reepithelialization and repair of the cornea after photorefractive keratectomy.

    Science.gov (United States)

    Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid

    2002-09-01

    To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.

  16. Sauchinone, a lignan from Saururus chinensis, protects human skin keratinocytes against ultraviolet B-induced photoaging by regulating the oxidative defense system

    International Nuclear Information System (INIS)

    Park, Gunhyuk; Oh, Myung-Sook; Kim, Hyo-Geun; Sim, Yeomoon; Sung, Sang-Hyun

    2013-01-01

    Ultraviolet (UV) radiation from sunlight induces matrix metalloproteinase (MMP) expression, which are responsible for collagenous extracellular matrix proteins breakdown in skin, causing photoaging. Sauchinone is reported to have various bioactivity such as antioxidative, hepatoprotective, and anti-inflammatory effects. In the present study, we investigated the protective effect of sauchinone against UVB (50 mJ/cm 2 )-induced photoaging in HaCaT human epidermal keratinocytes. Sauchinone, at 5-40 μM, significantly protected keratinocytes against UVB-induced damage as assessed by cell viability and toxicity assay. Additionally, sauchinone, at 20-40 μM, prevented the upregulation of MMP-1 proteins and reduction of type 1 collagen induced by UVB. Other assays revealed that, in keratinocytes, sauchinone decreased reactive oxygen species (ROS) production and increased glutathione levels and heme oxygenase-1. Sauchinone also inhibited UVB-induced phosphorylation of mitogen-activated protein kinase (MAPK) signaling pathways. These results demonstrated that sauchinone protects skin keratinocytes through inhibition of extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38 MAPK signaling via upregulation of oxidative defense enzymes. (author)

  17. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  18. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  19. Study of proliferation and 3D epidermal reconstruction from foreskin, auricular and trunk keratinocytes in children.

    Science.gov (United States)

    Mcheik, Jiad N; Barrault, Christine; Pedretti, Nathalie; Garnier, Julien; Juchaux, Franck; Levard, Guillaume; Morel, Frank; Bernard, François-Xavier; Lecron, Jean-Claude

    2015-03-01

    Severe burns in children are conventionally treated with split-thickness skin autografts or epidermal sheets. An alternative approach is to graft isolated keratinocytes. We evaluated foreskin and other anatomic sites as donor sources for autologous keratinocyte graft in children. We studied in vitro capacities of isolated keratinocytes to divide and reconstitute epidermal tissue. Keratinocytes were isolated from foreskin, auricular skin, chest and abdominal skin by enzymatic digestion. Living cell recovery, in vitro proliferation, epidermal reconstruction capacities and differentiation status were analyzed. In vitro studies revealed the higher yield of living keratinocyte recovery from foreskin and higher potential in terms of proliferative capacity, regeneration and differentiation. Cultured keratinocytes from foreskin express lower amounts of differentiation markers than those isolated from trunk and ear. Histological analysis of reconstituted human epidermis derived from foreskin and inguinal keratinocytes showed a structured multilayered epithelium, whereas those obtained from ear pinna-derived keratinocytes were unstructured. Our studies highlight the potential of foreskin tissue for autograft applications in boys. A suitable alternative donor site for autologous cell transplantation in female paediatric burn patients remains an open question in our department. We tested the hypothesis that in vitro studies and RHE reconstructive capacities of cells from different body sites can be helpful to select an optimal site for keratinocyte isolation before considering graft protocols for girls. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  20. Delayed culture of Leishmania in skin biopsies.

    Science.gov (United States)

    Dedet, J P; Pratlong, F; Pradinaud, R; Moreau, B

    1999-01-01

    Between January 1997 and October 1998, 16 skin biopsies collected from 13 patients with cutaneous leishmaniasis in French Guiana were inoculated in culture medium after travel for 3-17 days from the place of biopsy to the culture laboratory in France. Each biopsy fragment was introduced near the flame of a Bunsen burner into the transport medium (RPMI medium supplemented with 10% fetal calf serum) which was maintained at ambient temperature during postal delivery to France. In France the biopsies were ground in sterile saline before being inoculated into NNN culture tubes. The cultures were incubated at 25 degrees C and subcultured every week until the 5th week. The cultures were positive in 9 cases, remained negative in 4, and were contaminated in 3 cases. Positive results were obtained at all seasons and for 3 different Leishmania species. The study indicates that delayed culture can yield useful results from biopsies taken in field conditions.

  1. Promotion of hair follicle development and trichogenesis by Wnt-10b in cultured embryonic skin and in reconstituted skin

    International Nuclear Information System (INIS)

    Ouji, Yukiteru; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-01-01

    We previously showed that Wnt-10b promoted the differentiation of primary skin epithelial cells (MPSEC) toward hair shaft and inner root sheath of the hair follicle (IRS) cells in vitro. In the present study, we found that Wnt-10b promotes the development of hair follicles using a culture of mouse embryonic skin tissue and trichogenesis using a reconstitution experiment with nude mice. Hair follicle development was observed in skin taken from mouse embryos on embryonic day 10.5 following a 2-day culture with recombinant Wnt-10b (rWnt-10b), however, not without rWnt-10b. Brown hair growth was observed at the site of reconstituted skin in Balb/c nude mice where dermal fibroblasts and keratinocytes, derived from C3H/HeN new born mice, were transplanted with Wnt-10b-producing COS cells (Wnt-COS). Without the co-transplantation of Wnt-COS, no hair growth was observed. Our results suggest an important role of Wnt-10b in the initiation of hair follicle development and following trichogenesis

  2. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  3. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-02-01

    Human keratinocytes in culture were labelled with /sup 14/C-dihomo-gamma-linolenic acid, /sup 14/C-arachidonic acid or /sup 14/C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes.

  4. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-01-01

    Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

  5. Cultured allogenic keratinocytes for extensive burns: a retrospective study over 15 years.

    Science.gov (United States)

    Auxenfans, Celine; Shipkov, Hristo; Bach, Christine; Catherine, Zulma; Lacroix, Pierre; Bertin-Maghit, Marc; Damour, Odile; Braye, Fabienne

    2014-02-01

    The aim was to review the use and indications of cultured allogenic keratinocytes (CAlloK) in extensive burns and their efficiency. This retrospective study comprised 15 years (1997-2012). all patients who received CAlloK. patients who died before complete healing. Evaluation criteria were clinical. Time and success of wound healing after CAlloK use were evaluated. The CAlloK were used for 2 indications - STSG donor sites and deep 2nd degree burns in extensively burned patients. A total of 70 patients were included with severity Baux score of 99.2 (from 51 to 144) and mean percentage of TBSA of 63.49% (from 21 to 96%). Fifty nine patients received CAlloK for STSG donor sites with a mean number of applications of 4 and mean surface of 3800 cm(2) per patient. Treated donor sites were re-harvested 2.5 times. The mean time of complete epithelialization was 7 days. In 11 patients, CAlloK were used for deep 2nd degree burns. The mean percentage of burned surface was 73.7%. The mean surface of CAlloK per patient was 2545 cm(2). Complete healing was achieved in 6.4 days. The CAlloK allow rapid healing of STSG donor-sites and deep 2nd second degree burns in extensively burned patients. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  6. Wnt signaling induces differentiation of progenitor cells in organotypic keratinocyte cultures

    Directory of Open Access Journals (Sweden)

    Liu Bob Y

    2007-02-01

    Full Text Available Abstract Background Interfollicular skin develops normally only when the activity of the progenitor cells in the basal layer is counterbalanced by the exit of cells into the suprabasal layers, where they differentiate and cornify to establish barrier function. Distinct stem and progenitor compartments have been demonstrated in hair follicles and sebaceous glands, but there are few data to describe the control of interfollicular progenitor cell activity. Wnt signaling has been shown to be an important growth-inducer of stem cell compartments in skin and many other tissues. Results Here, we test the effect of ectopic Wnt1 expression on the behavior of interfollicular progenitor cells in an organotypic culture model, and find that Wnt1 signaling inhibits their growth and promotes terminal differentiation. Conclusion These results are consistent with the phenotypes reported for transgenic mice engineered to have gain or loss of function of Wnt signaling in skin, which would recommend our culture model as an accurate one for molecular analysis. Since it is known that canonical ligands are expressed in skin, it is likely that this pathway normally regulates the balance of growth and differentiation, and suggests it could be important to pathogenesis.

  7. Oxidative stress drives CD8+T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  8. Differential role of basal keratinocytes in UV-induced immunosuppression and skin cancer

    NARCIS (Netherlands)

    J. Jans (Judith); G.A. Garinis (George); W. Schul; A. van Oudenaren (Adri); M.J. Moorhouse (Michael); M. Smid (Marcel); Y.-G. Sert (Yurda-Gul); A. van der Velde (Albertina); Y.M. Rijksen (Yvonne); F.R. de Gruijl (Frank); P.J. van der Spek (Peter); A. Yasui (Akira); J.H.J. Hoeijmakers (Jan); P.J. Leenen (Pieter); G.T.J. van der Horst (Gijsbertus)

    2006-01-01

    textabstractCyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4PPs) comprise major UV-induced photolesions. If left unrepaired, these lesions can induce mutations and skin cancer, which is facilitated by UV-induced immunosuppression. Yet the contribution of lesion and cell type

  9. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  10. Airborne polychlorinated biphenyls (PCBs) reduce telomerase activity and shorten telomere length in immortal human skin keratinocytes (HaCat)

    Science.gov (United States)

    Senthilkumar, P.K.; Klingelhutz, A.J.; Jacobus, J.A.; Lehmler, H.; Robertson, L.W.; Ludewig, G.

    2011-01-01

    PCBs, a group of 209 individual congeners, are ubiquitous environmental pollutants and classified as probable human carcinogens. One major route of exposure is by inhalation of these industrial compounds, possibly daily from inner city air and/or indoor air in contaminated buildings. Hallmarks of aging and carcinogenesis are changes in telomere length and telomerase activity. We hypothesize that semi-volatile PCBs, like those found in inner city air, are capable of disrupting telomerase activity and altering telomere length. To explore this possibility, we exposed human skin keratinocytes to a synthetic Chicago Airborne Mixture (CAM) of PCBs, or the prominent airborne PCB congeners, PCB28 or PCB52 for up to 48 days and determined telomerase activity, telomere length, cell proliferation, and cell cycle distribution. PCBs 28, 52 and CAM significantly reduced telomerase activity from days 18–48. Telomere length was shortened by PCB52 from day 18 and PCB28 and CAM from days 30 on. All PCBs decreased cell proliferation from day 18; only PCB52 produced a small increase of cells in G0/G1 of the cell cycle. This significant inhibition of telomerase activity and reduction of telomere length by PCB congeners suggest a potential mechanism by which these compounds could lead to accelerated aging and cancer. PMID:21530622

  11. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    Energy Technology Data Exchange (ETDEWEB)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-05-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of /sup 14/C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three /sup 14/C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin.

  12. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-01-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of 14 C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three 14 C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin

  13. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn [Korea Institute of Radiation and Medical Sciences, Daejeon (Korea, Republic of)

    2016-05-15

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists.

  14. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  15. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  16. Lactobacillus reuteri Protects Epidermal Keratinocytes from Staphylococcus aureus-Induced Cell Death by Competitive Exclusion

    Science.gov (United States)

    Prince, Tessa; McBain, Andrew J.

    2012-01-01

    Recent studies have suggested that the topical application of probiotic bacteria can improve skin health or combat disease. We have utilized a primary human keratinocyte culture model to investigate whether probiotic bacteria can inhibit Staphylococcus aureus infection. Evaluation of the candidate probiotics Lactobacillus reuteri ATCC 55730, Lactobacillus rhamnosus AC413, and Lactobacillus salivarius UCC118 demonstrated that both L. reuteri and L. rhamnosus, but not L. salivarius, reduced S. aureus-induced keratinocyte cell death in both undifferentiated and differentiated keratinocytes. Keratinocyte survival was significantly higher if the probiotic was applied prior to (P 0.05). The protective effect of L. reuteri was not dependent on the elaboration of inhibitory substances such as lactic acid. L. reuteri inhibited adherence of S. aureus to keratinocytes by competitive exclusion (P = 0.026). L. salivarius UCC118, however, did not inhibit S. aureus from adhering to keratinocytes (P > 0.05) and did not protect keratinocyte viability. S. aureus utilizes the α5β1 integrin to adhere to keratinocytes, and blocking of this integrin resulted in a protective effect similar to that observed with probiotics (P = 0.03). This suggests that the protective mechanism for L. reuteri-mediated protection of keratinocytes was by competitive exclusion of the pathogen from its binding sites on the cells. Our results suggest that use of a topical probiotic prophylactically could inhibit the colonization of skin by S. aureus and thus aid in the prevention of infection. PMID:22582077

  17. A convenient fluorometric method to study sulfur mustard-induced apoptosis in human epidermal keratinocytes monolayer microplate culture.

    Science.gov (United States)

    Ray, Radharaman; Hauck, Stephanie; Kramer, Rachel; Benton, Betty

    2005-01-01

    Sulfur mustard [SM; bis-(2-chloroethyl) sulfide], which causes skin blistering or vesication [(1991). Histo- and cytopathology of acute epithelial lesions. In: Papirmeister, B., Feister, A. J., Robinson, S. I., Ford, R. D., eds. Medical Defense Against Mustard Gas: Toxic Mechanisms and Pharmacological Implications. Boca Raton: CRC Press, pp. 43-78.], is a chemical warfare agent as well as a potential terrorism agent. SM-induced skin blistering is believed to be due to epidermal-dermal detachment as a result of epidermal basal cell death via apoptosis and/or necrosis. Regarding the role of apoptosis in SM pathology in animal skin, the results obtained in several laboratories, including ours, suggest the following: 1) cell death due to SM begins via apoptosis that proceeds to necrosis via an apoptotic-necrotic continuum and 2) inhibiting apoptosis decreases SM-induced microvesication in vivo. To study the mechanisms of SM-induced apoptosis and its prevention in vitro, we have established a convenient fluorometric apoptosis assay using monolayer human epidermal keratinocytes (HEK) adaptable for multiwell plates (24-, 96-, or 384-well) and high-throughput applications. This assay allows replication and multiple types of experimental manipulation in sister cultures so that the apoptotic mechanisms and the effects of test compounds can be compared statistically. SM affects diverse cellular mechanisms, including endoplasmic reticulum (ER) Ca2+ homeostasis, mitochondrial functions, energy metabolism, and death receptors, each of which can independently trigger apoptosis. However, the biochemical pathway in any of these apoptotic mechanisms is characterized by a pathway-specific sequence of caspases, among which caspase-3 is a key member. Therefore, we exposed 80-90% confluent HEK cultures to SM and monitored apoptosis by measuring the fluorescence generated due to hydrolysis of a fluorogenic caspase-3 substrate (acetyl- or benzyl oxycarbonyl

  18. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  19. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (Pculture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  20. Regulation of hypoxia-inducible factor-1α and related genes in equine digital lamellae and in cultured keratinocytes.

    Science.gov (United States)

    Pawlak, E A; Geor, R J; Watts, M R; Black, S J; Johnson, P J; Belknap, J K

    2014-03-01

    Hypoxia-inducible factor-1α (HIF-1A) is an important protein in the regulation/induction of many genes in the cellular and tissue response to hypoxia and a central mediator in inflammatory signalling. As both hypoxia and inflammatory events are purported to occur in the lamellar epidermis in sepsis-related laminitis in the equid, HIF-1A may play a central role in this disease process. To assess the regulation of HIF-1A and HIF-1A-related genes in the equine keratinocyte in vitro and in the lamellar tissue of horses with sepsis-related laminitis. In vivo and in vitro experiments. Real-time quantitative PCR (RT-qPCR) and immunoblotting were performed to assess the mRNA and protein concentrations of HIF-1A and the mRNA concentrations of HIF-1A-related genes in cultured equine keratinocytes and in lamellar samples from black walnut extract (BWE)- and carbohydrate overload (CHO)-induced laminitis. Hypoxia-inducible factor-1α was further localised via indirect immunofluorescence in frozen lamellar tissue sections. Hypoxia-inducible factor-1α appears to be regulated primarily at the post transcriptional level in the cultured equine keratinocyte, resulting in increased HIF-1A in response to hypoxia but not to lipopolysaccharide exposure. Hypoxia-inducible factor-1α is present at high concentrations in the normal equine lamina, and is increased in Obel grade 1 (OG1) stage laminitis in the CHO model of laminitis. Equine lamellar mRNA concentrations of cyclo-oxygenase-2 and inducible nitric oxide synthase, but not glucose transporter 1, are increased in the BWE and CHO models of laminitis. These data indicate that the normal equine lamellae are profoundly hypoxic in comparison with other tissues. The increased mRNA concentrations of cyclo-oxygenase-2 and inducible nitric oxide synthase 2 in equine keratinocytes exposed to hypoxia and lipopolysaccharide, and in lamellar tissue from BWE and CHO models of sepsis-related laminitis, suggest that the marked lamellar

  1. Anti-UV activity of Kampo medicines and constituent plant extracts: re-evaluation with skin keratinocyte system.

    Science.gov (United States)

    Kato, Takao; Hino, Shunsuke; Horie, Norio; Shimoyama, Tetsuo; Kaneko, Tadayoshi; Kusama, Kaoru; Sakagami, Hiroshi

    2014-01-01

    In order to search for new biological activity of Kampo medicines and their constituent plant extracts, we investigated their ability to protect the cells from UV irradiation (referred to as 'anti-UV activity') using the human immortalised skin keratinocyte cell line HaCaT. Anti-UV activity was represented by the selectivity index (SI), defined as the ratio of the concentration that reduced the viable cell number by 50% to the concentration that increased the viability of UV-irradiated cells to 50%. HaCaT cells were highly resistant to UV irradiation, approximately 20% of cells survived even when the exposure time was prolonged to 480 min. Sodium ascorbate, a popular antioxidant, used as positive control, had excellent anti-UV activity (SI=200). Among 10 Kampo medicines, Shosaikoto (SI=34) had the highest anti-UV activity, followed by Hangesyashinto (SI>28), Unseiin (SI>23) and Ninjinyoeito (SI=23), Saireito (SI>19), whereas another four Kampo medicines were much less active (SIUV activity (SI=38), followed by Polyporus sclerotium (SI>26), Gardenia fruit (SI>23), Japanese Gentian (SI>20) and Saposhnikovia root (SI>20). Glycyrrhizin also had potent anti-UV activity (SI=36). The SI values determined with the present HaCaT system were generally one order higher than those obtained with previously reported HSC-2 human oral squamous cell carcinoma system, although there was good correlation between these two systems (R(2)=0.9118). Conclusion. The present study highlights the improved sensitivity of anti-UV activity detection with the HaCaT system, and suggests the possible application of Kampo medicines as a component of sunscreening cosmetics. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  2. Leptin deficiency in mice counteracts imiquimod (IMQ)-induced psoriasis-like skin inflammation while leptin stimulation induces inflammation in human keratinocytes.

    Science.gov (United States)

    Stjernholm, Theresa; Ommen, Pernille; Langkilde, Ane; Johansen, Claus; Iversen, Lars; Rosada, Cecilia; Stenderup, Karin

    2017-04-01

    Leptin is an adipocyte-derived cytokine secreted mostly by adipose tissue. Serum leptin levels are elevated in obese individuals and correlate positively with body mass index (BMI). Interestingly, serum leptin levels are also elevated in patients with psoriasis and correlate positively with disease severity. Psoriasis is associated with obesity; patients with psoriasis have a higher incidence of obesity, and obese individuals have a higher risk of developing psoriasis. Additionally, obese patients with psoriasis experience a more severe degree of psoriasis. In this study, we hypothesised that leptin may link psoriasis and obesity and plays an aggravating role in psoriasis. To investigate leptin's role in psoriasis, we applied the widely accepted imiquimod (IMQ)-induced psoriasis-like skin inflammation mouse model on leptin-deficient (ob/ob) mice and evaluated psoriasis severity. Moreover, we stimulated human keratinocytes with leptin and investigated the effect on proliferation and expression of pro-inflammatory proteins. In ob/ob mice, clinical signs of erythema, infiltration and scales in dorsal skin and inflammation in ear skin, as measured by ear thickness, were attenuated and compared with wt mice. Moreover, IL-17A and IL-22 mRNA expression levels, as well as increased epidermal thickness, were significantly less induced. In vitro, the effect of leptin stimulation on human keratinocytes demonstrated increased proliferation and induced secretion of several pro-inflammatory proteins; two hallmarks of psoriasis. In conclusion, leptin deficiency attenuated IMQ-induced psoriasis-like skin inflammation in a mouse model, and leptin stimulation induced a pro-inflammatory phenotype in human keratinocytes, thus, supporting an aggravating role of leptin in psoriasis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Reconstruction of epidermis by grafting of keratinocytes cultured on polymer support - clinical study

    Czech Academy of Sciences Publication Activity Database

    Dvořánková, B.; Holíková, Z.; Vacík, Jiří; Königová, R.; Kapounková, Z.; Michálek, Jiří; Přádný, Martin; Smetana, Karel

    2003-01-01

    Roč. 42, č. 3 (2003), s. 219-223 ISSN 0011-9059 R&D Projects: GA MŠk LN00A065; GA MZd ND6340; GA AV ČR IBS4050005 Institutional research plan: CEZ:AV0Z4050913 Keywords : keratinocytes * graft * polymer support Subject RIV: FH - Neurology Impact factor: 0.736, year: 2003

  4. Melanosome transfer to and translocation in the keratinocyte.

    Science.gov (United States)

    Boissy, Raymond E

    2003-01-01

    Complexion coloration in humans is primarily regulated by the amount and type of melanin synthesized by the epidermal melanocyte. However, additional and equally contributing factors consist of (1) efficient transfer of melanin from the melanocytes to the neighboring keratinocytes and (2) distribution and degradation of the transferred melanosomes by the recipient keratinocytes. Once synthesized in the cell body of the epidermal melanocyte, pigmented melanosomes are translocated down the dendrites and captured at the dendritic tips via various cytoskeletal elements. Molecules recently identified that participate in this process consist of Rab27a, myosin-Va and melanophilin. Eventually, these peripherally localized melanosomes are transferred to keratinocytes by a presently undefined mechanism. The protease-activated receptor-2 (PAR-2) and unidentified surface lectins and glycoproteins facilitate this transfer process. Once incorporated into the keratinocytes, melanosomes are distributed individually or as clusters, aggregated towards the apical pole of the nucleus, and degraded as the keratinocytes undergo terminal differentiation and desquamation. Ultraviolet irradiation (UVR) can modulate the process of melanosome transfer from the melanocytes to the keratinocytes. UVR can upregulate expression of PAR-2 and lectin-binding receptors and increase phagocytic activity of cultured keratinocytes. Therefore, many cellular and molecular events that occur after melanogenesis contribute to skin color.

  5. Sulfur mustard-stimulated proteases and their inhibitors in a cultured normal human epidermal keratinocytes model: A potential approach for anti-vesicant drug development.

    Science.gov (United States)

    Jin, Xiannu; Ray, Radharaman; Ray, Prabhati

    2016-01-01

    Protease stimulation in cultured normal human epidermal keratinocytes (NHEK) due to sulfur mustard (SM) exposure is well documented. However, the specific protease(s) stimulated by SM and the protease substrates remain to be determined. In this study, we observed that SM stimulates several proteases and the epidermal-dermal attachment protein laminin-5 is one of the substrates. We propose that following SM exposure of the skin, laminin-5 degradation causes the detachment of the epidermis from the dermis and, therefore, vesication. We utilized gelatin zymography, Western blotting, immuno-fluorescence staining, and real-time polymerase chain reaction (RT-PCR) analyses to study the SM-stimulated proteases and laminin-5 degradation in NHEK. Two major protease bands (64 kDa and 72 kDa) were observed by zymography in SM-exposed cells. Addition of serine protease inhibitor (aprotinin, 100 μM), or the metalloprotease inhibitor (amastatin, 100 μM) to NHEK cultures prior to SM exposure decreased the SM-stimulated protease bands seen by zymography. These inhibitors completely or partially prevented SM-induced laminin-5 γ2 degradation as seen by Western blotting as well as immuno-fluorescence staining. Our results from Western blotting and RT-PCR studies also indicated that the membrane-type matrix metalloproteinase-1 (MT-MM-1) may be involved in SM-induced skin blistering. To summarize, our results in the NHEK model indicate the following: (a) SM stimulates multiple proteases including serine protease(s), and metalloproteases; (b) SM decreases the level of laminin-5 γ2, which is prevented by either a serine protease inhibitor or a metalloprotease inhibitor and (c) MT-MMP-1 maybe one of the proteases that is involved in skin blistering due to SM exposure.

  6. Sulfur mustard-stimulated proteases and their inhibitors in a cultured normal human epidermal keratinocytes model: A potential approach for anti-vesicant drug development

    Directory of Open Access Journals (Sweden)

    Xiannu Jin

    Full Text Available Protease stimulation in cultured normal human epidermal keratinocytes (NHEK due to sulfur mustard (SM exposure is well documented. However, the specific protease(s stimulated by SM and the protease substrates remain to be determined. In this study, we observed that SM stimulates several proteases and the epidermal-dermal attachment protein laminin-5 is one of the substrates. We propose that following SM exposure of the skin, laminin-5 degradation causes the detachment of the epidermis from the dermis and, therefore, vesication. We utilized gelatin zymography, Western blotting, immuno-fluorescence staining, and real-time polymerase chain reaction (RT-PCR analyses to study the SM-stimulated proteases and laminin-5 degradation in NHEK. Two major protease bands (64 kDa and 72 kDa were observed by zymography in SM-exposed cells. Addition of serine protease inhibitor (aprotinin, 100 μM, or the metalloprotease inhibitor (amastatin, 100 μM to NHEK cultures prior to SM exposure decreased the SM-stimulated protease bands seen by zymography. These inhibitors completely or partially prevented SM-induced laminin-5 γ2 degradation as seen by Western blotting as well as immuno-fluorescence staining. Our results from Western blotting and RT-PCR studies also indicated that the membrane-type matrix metalloproteinase-1 (MT-MM-1 may be involved in SM-induced skin blistering.To summarize, our results in the NHEK model indicate the following: (a SM stimulates multiple proteases including serine protease(s, and metalloproteases; (b SM decreases the level of laminin-5 γ2, which is prevented by either a serine protease inhibitor or a metalloprotease inhibitor and (c MT-MMP-1 maybe one of the proteases that is involved in skin blistering due to SM exposure. Keywords: Sulfur mustard, Serine protease, Metalloprotease, Protease inhibiter, Zymography, Laminin-5 γ2

  7. Skin cell culture on an ear-shaped scaffold created by fused deposition modelling.

    Science.gov (United States)

    Cai, H; Azangwe, G; Shepherd, D E T

    2005-01-01

    Tissue engineering, where cells attach and grow on a scaffold, has the potential to produce replacement ears made from natural tissues and replace the need for rubber prosthetic ears. This study investigated the feasibility of using the rapid prototyping technique of Fused Deposition Modelling (FDM) to produce an ear-shaped scaffold. A three-dimensional image of the ear was used to manufacture ear-shaped scaffolds from ABS (acrylonitrile/butadiene/styrene) plastic using FDM. Human dermal fibroblasts were seeded on the scaffold (coated with fibronectin) to attach and grow in culture medium in an incubator for two weeks. Human keratinocytes were then seeded on to the fibroblast layer to attempt to produce a more realistic skin covering. The morphology of the cells were observed using scanning electron microscopy. The results show that a realistic ear-shaped scaffold can be made using FDM. Human fibroblasts were found to attach and grow. Human keratinocytes were successfully attached and grown on top of the fibroblasts and this resulted in a skin covering over the scaffold. This study shows that FDM has great potential as a manufacturing technique for ear-shaped scaffolds for tissue engineering.

  8. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  9. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  10. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  11. Monitoring UV-induced signalling pathways in an ex vivo skin organ culture model using phospho-antibody array.

    Science.gov (United States)

    Lenain, Christelle; Gamboa, Bastien; Perrin, Agnes; Séraïdaris, Alexia; Bertino, Béatrice; Rival, Yves; Bernardi, Mathieu; Piwnica, David; Méhul, Bruno

    2017-09-08

    We investigated UV-induced signalling in an ex vivo skin organ culture model using phospho-antibody array. Phosphorylation modulations were analysed in time-course experiments following exposure to solar-simulated UV and validated by Western blot analyses. We found that UV induced P-p38 and its substrates, P-ERK1/2 and P-AKT, which were previously shown to be upregulated by UV in cultured keratinocytes and in vivo human skin. This indicates that phospho-antibody array applied to ex vivo skin organ culture is a relevant experimental system to investigate signalling events following perturbations. As the identified proteins are components of pathways implicated in skin tumorigenesis, UV-exposed skin organ culture model could be used to investigate the effect on these pathways of NMSC cancer drug candidates. In addition, we found that phospho-HCK is induced upon UV exposure, producing a new candidate for future studies investigating its role in the skin response to UV and UV-induced carcinogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Hyperforin/HP-β-Cyclodextrin Enhances Mechanosensitive Ca2+Signaling in HaCaT Keratinocytes and in Atopic Skin Ex Vivo Which Accelerates Wound Healing.

    Science.gov (United States)

    Takada, Hiroya; Yonekawa, Jun; Matsumoto, Masami; Furuya, Kishio; Sokabe, Masahiro

    2017-01-01

    Cutaneous wound healing is accelerated by mechanical stretching, and treatment with hyperforin, a major component of a traditional herbal medicine and a known TRPC6 activator, further enhances the acceleration. We recently revealed that this was due to the enhancement of ATP-Ca 2+ signaling in keratinocytes by hyperforin treatment. However, the low aqueous solubility and easy photodegradation impede the topical application of hyperforin for therapeutic purposes. We designed a compound hydroxypropyl- β -cyclodextrin- (HP- β -CD-) tetracapped hyperforin, which had increased aqueous solubility and improved photoprotection. We assessed the physiological effects of hyperforin/HP- β -CD on wound healing in HaCaT keratinocytes using live imaging to observe the ATP release and the intracellular Ca 2+ increase. In response to stretching (20%), ATP was released only from the foremost cells at the wound edge; it then diffused to the cells behind the wound edge and activated the P2Y receptors, which caused propagating Ca 2+ waves via TRPC6. This process might facilitate wound closure, because the Ca 2+ response and wound healing were inhibited in parallel by various inhibitors of ATP-Ca 2+ signaling. We also applied hyperforin/HP- β -CD on an ex vivo skin model of atopic dermatitis and found that hyperforin/HP- β -CD treatment for 24 h improved the stretch-induced Ca 2+ responses and oscillations which failed in atopic skin.

  13. Liposomal ursolic acid (merotaine) increases ceramides and collagen in human skin.

    Science.gov (United States)

    Yarosh, D B; Both, D; Brown, D

    2000-01-01

    Skin wrinkling and xerosis associated with aging result from decreases of dermal collagen and stratum corneum ceramide content. This study demonstrates that ursolic acid incorporated into liposomes (Merotaine) increases both the ceramide content of cultured normal human epidermal keratinocytes and the collagen content of cultured normal human dermal fibroblasts. In clinical tests, Merotaine increased the ceramide content in human skin over an 11-day period. Merotaine has effects on keratinocyte differentiation and dermal fibroblast collagen synthesis similar to retinoids. However, unlike retinoids, Merotaine increases ceramide content of human keratinocytes. Ursolic acid may bind to members of the glucocorticoid receptor family to initiate changes in keratinocyte gene transcription. Copyright 2001 S. Karger AG, Basel

  14. Efficacy of quantifying melanosome transfer with flow cytometry in a human melanocyte-HaCaT keratinocyte co-culture system in vitro.

    Science.gov (United States)

    Ma, Hui-Jun; Zhao, Guang; Zi, Shao-Xia; Li, Dong-Guang; Liu, Wen; Yang, Qing-Qi

    2010-08-01

    In this study, we describe a simple, specific, reproducible and quantitative assay system to assess melanosome transfer. We first established a co-culture model of normal human epidermal melanocytes and HaCaT keratinocytes. The cells were co-cultured for 72 h in a serum-free keratinocyte growth media and double labelled with Fluorescein isothiocyanate (FITC)-conjugated antibody against the melanosome-specific protein gp100, and with Phycoerythrin (PE)-conjugated antibody against the keratinocyte-specific marker cytokeratin. Then, the cells were examined using co-focal microscope and flow cytometry. The increased melanosome transfer from melanocytes to HaCaT keratinocytes was observed in a time-dependent manner. To verify the accessibility of this method, two known melanosome transfer inhibitors and two known melanosome transfer stimulators were applied. Consistent with previous investigation, soybean trypsin inhibitor (STI), niacinamide inhibited melanosome transfer, alpha-melanocyte stimulating hormone (alpha-MSH) and keratinocyte growth factor (KGF) increased melanosome transfer, respectively, in a dose-dependent manner. The model used in this study could thus represent a rapid and reliable tool to identify modulators of human melanosome transfer.

  15. Molecular mechanism(s) for UV-B irradiation-induced glutathione depletion in cultured human keratinocytes.

    Science.gov (United States)

    Zhu, Ming; Bowden, G Tim

    2004-01-01

    Glutathione (GSH) plays a central role in maintenance of cellular redox homeostasis and protection against oxidative injury. Ultraviolet B (UV-B) irradiation-induced GSH depletion is believed to be involved in the pathogenesis of several cutaneous disorders. In this study, the molecular mechanism(s) of UV-B-induced GSH depletion was investigated in cultured human keratinocytes, HaCaT cells. We found that UV-B irradiation caused GSH depletion in a dose- and time-dependent manner in HaCaT cells. The mechanistic studies showed that UV-B-induced GSH depletion did not result from the GSH efflux. UV-B irradiation appeared to cause a slight decrease in enzymatic activity of gamma-glutamate cysteine ligase (GCL), a rate-limiting enzyme in GSH biosynthesis. UV-B irradiation resulted in the GCL cleavage through the activation of a caspase cascade. Inhibition of total caspase activity by the general caspase inhibitor, zVAD-fmk, partially reversed the UV-B-induced GSH depletion. More importantly, we found that UV-B irradiation could dramatically decrease the cystine uptake through the functional inhibition of the system Xc(-), a cystine transporter on the cell membrane. The results suggest that the inactivation of cystine transporter system Xc(-) was a major contributor to the UV-B-mediated decrease of GSH levels in human keratinocytes.

  16. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin

    Science.gov (United States)

    Cai, Qing; Ren, Qu; Wei, Lizhao

    2015-01-01

    Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25–3.12 μM) has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes. PMID:26382065

  17. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin.

    Directory of Open Access Journals (Sweden)

    Tianhui Niu

    Full Text Available Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25-3.12 μM has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes.

  18. Inhibition of melanosome transfer from melanocytes to keratinocytes by lectins and neoglycoproteins in an in vitro model system.

    Science.gov (United States)

    Minwalla, L; Zhao, Y; Cornelius, J; Babcock, G F; Wickett, R R; Le Poole, I C; Boissy, R E

    2001-06-01

    We propose that some of the critical molecules involved in the transfer of melanosomes from melanocytes to keratinocytes include plasma membrane lectins and their glycoconjugates. To investigate this mechanism, co-cultures of human melanocytes and keratinocytes derived from neonatal foreskins were established. The process of melanosome transfer was assessed by two experimental procedures. The first involved labeling melanocyte cultures with the fluorochrome CFDA. Labeled melanocytes were subsequently co-cultured with keratinocytes, and the transfer of fluorochrome assessed visually by confocal microscopy and quantitatively by flow cytometry. The second investigative approach involved co-culturing melanocytes with keratinocytes, and processing the co-cultures after 3 days for electron microscopy to quantitate the numbers of melanosomes in keratinocytes. Results from these experimental approaches indicate significant transfer of dye or melanosomes from melanocytes to keratinocytes that increased with time of co-culturing. Using these model systems, we subsequently tested a battery of lectins and neoglycoproteins for their effect in melanosome transfer. Addition of these selected molecules to co-cultures inhibited transfer of fluorochrome by approximately 15-44% as assessed by flow cytometry, and of melanosomes by 67-93% as assessed by electron microscopy. Therefore, our results suggest the roles of selected lectins and glycoproteins in melanosome transfer to keratinocytes in the skin.

  19. In vitro culture of skin-homing T lymphocytes from inflammatory skin diseases

    DEFF Research Database (Denmark)

    Bang, Karen; Lund, Marianne; Mogensen, Søren C

    2005-01-01

    was for AD 1.20, MF 0.65 and psoriasis 0.85. Patients with AD treated with cyclosporin-A had almost no growth of CD8+ cells in vitro. Our findings indicate a changed homeostasis among skin-homing lymphocytes for in vitro culture. Our culture system of skin-homing T lymphocytes leads to a prominent cellular...

  20. Defective glucocorticoid receptor signaling and keratinocyte-autonomous defects contribute to skin phenotype of mouse embryos lacking the Hsp90 co-chaperone p23.

    Directory of Open Access Journals (Sweden)

    Marta Madon-Simon

    Full Text Available p23 is a small acidic protein with intrinsic molecular chaperone activity. It is best known as a co-chaperone of the major cytosolic molecular chaperone Hsp90. p23 binds the N-terminus of Hsp90 and stabilizes the ATP-bound and N-terminally closed Hsp90 dimer. It is in this configuration that many Hsp90 clients are most stably bound. Considering the important role of p23 in the Hsp90 cycle, it came as a surprise that it is not absolutely essential for viability in the budding yeast or for mouse development. Mice without p23 develop quite normally until birth and then all die perinatally because of immature lungs. The only other apparent phenotype of late stage embryos and newborns is a skin defect, which we have further characterized here. We found that skin differentiation is impaired, and that both apoptosis and cell proliferation are augmented in the absence of p23; the consequences are a severe thinning of the stratum corneum and reduced numbers of hair follicles. The altered differentiation, spontaneous apoptosis and proliferation are all mimicked by isolated primary keratinocytes indicating that they do require p23 functions in a cell-autonomous fashion. Since the phenotype of p23-null embryos is strikingly similar to that of embryos lacking the glucocorticoid receptor, a paradigmatic Hsp90-p23 client protein, we investigated glucocorticoid signaling. We discovered that it is impaired in vivo and for some aspects in isolated keratinocytes. Our results suggest that part of the phenotype of p23-null embryos can be explained by an impact on this particular Hsp90 client, but do not exclude that p23 by itself or in association with Hsp90 affects skin development and homeostasis through yet other pathways.

  1. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  2. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  3. In vitro biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate composite using cultures of human periodontal ligament fibroblasts and keratinocytes.

    Science.gov (United States)

    Teixeira, L N; Crippa, G E; Trabuco, A C; Gimenes, R; Zaghete, M A; Palioto, D B; de Oliveira, P T; Rosa, A L; Beloti, M M

    2010-03-01

    The aim of this work was to evaluate the biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate (P(VDF-TrFE)/BT) membrane to be used in guided tissue regeneration (GTR). Fibroblasts from human periodontal ligament (hPDLF) and keratinocytes (SCC9) were plated on P(VDF-TrFE)/BT and polytetrafluorethylene membranes at a cell density of 20,000 cells well(-1) and cultured for up to 21 days. Cell morphology, adhesion and proliferation were evaluated in hPDLF and keratinocytes, while total protein content and alkaline phosphatase (ALP) activity were assayed only for hPDLF. Using a higher cell density, real-time polymerase chain reaction (PCR) was performed to assess the expression of typical genes of hPDLF, such as periostin, PDLs17, S100A4 and fibromodulin, and key phenotypic markers of keratinocytes, including involucrin, keratins 1, 10 and 14. Expression of the apoptotic genes bax, bcl-2 and survivin was evaluated for both cultures. hPDLF adhered and spread more on P(VDF-TrFE)/BT, whereas keratinocytes showed a round shape on both membranes. hPDLF adhesion was greater on P(VDF-TrFE)/BT at 2 and 4h, while keratinocyte adhesion was similar for both membranes. Whereas proliferation was significantly higher for hPDLF on P(VDF-TrFE)/BT at days 1 and 7, no signs of keratinocyte proliferation could be noticed for both membranes. Total protein content was greater on P(VDF-TrFE)/BT at 7, 14 and 21 days, and higher levels of ALP activity were observed on P(VDF-TrFE)/BT at 21 days. Real-time PCR revealed higher expression of phenotypic markers of hPDLF and keratinocytes as well as greater expression of apoptotic genes in cultures grown on P(VDF-TrFE)/BT. These results indicate that, by favoring hPDLF adhesion, spreading, proliferation and typical mRNA expression, P(VDF-TrFE)/BT membrane should be considered an advantageous alternative for GTR. Copyright 2009 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  4. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  5. Cultured skin microbiota attracts malaria mosquitoes

    Directory of Open Access Journals (Sweden)

    Takken Willem

    2009-12-01

    Full Text Available Abstract Background Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human body odours. It is hypothesized that host attractiveness and selection of An. gambiae is affected by the species composition, density, and metabolic activity of the skin microbiota. A study is presented in which the production and constituency of volatile organic compounds (VOCs by human skin microbiota is examined and the behavioural responses of An. gambiae to VOCs from skin microbiota are investigated. Methods Blood agar plates incubated with skin microbiota from human feet or with a reference strain of Staphylococcus epidermidis were tested for their attractiveness to An. gambiae in olfactometer bioassays and indoor trapping experiments. Entrained air collected from blood agar plates incubated with natural skin microbiota or with S. epidermidis were analysed using GC-MS. A synthetic blend of the compounds identified was tested for its attractiveness to An. gambiae. Behavioural data were analysed by a χ2-test and GLM. GC-MS results were analysed by fitting an exponential regression line to test the effect of the concentration of bacteria. Results More An. gambiae were caught with blood agar plates incubated with skin bacteria than with sterile blood agar plates, with a significant effect of incubation time and dilution of the skin microbiota. When bacteria from the feet of four other volunteers were tested, similar effects were found. Fourteen putative attractants were found in the headspace of the skin bacteria. A synthetic blend of 10 of these was attractive to An. gambiae. Conclusions The discovery that volatiles produced by human skin microorganisms in vitro mediate An. gambiae host-seeking behaviour creates new opportunities for the

  6. Non-genetic risk factors for cutaneous melanoma and keratinocyte skin cancers: An umbrella review of meta-analyses.

    Science.gov (United States)

    Belbasis, Lazaros; Stefanaki, Irene; Stratigos, Alexander J; Evangelou, Evangelos

    2016-12-01

    Skin cancers have a complex disease mechanism, involving both genetic and non-genetic risk factors. Numerous meta-analyses have been published claiming statistically significant associations between non-genetic risk factors and skin cancers without applying a thorough methodological assessment. The present study maps the literature on the non-genetic risk factors of skin cancers, assesses the presence of statistical biases and identifies the associations with robust evidence. We searched PubMed up to January 20, 2016 to identify systematic reviews and meta-analyses of observational studies that examined associations between non-genetic factors and skin cancers. For each meta-analysis, we estimated the summary effect size by random-effects and fixed-effects models, the 95% confidence interval and the 95% prediction interval. We also assessed the between-study heterogeneity (I 2 metric), evidence for small-study effects and excess significance bias. Forty-four eligible papers were identified and included a total of 85 associations. Twenty-one associations were significant at Pmelanoma, skin type, sunburns, premalignant skin lesions, common and atypical nevi for melanoma) presented high level of credibility. The majority of meta-analyses on non-genetic risk factors for skin cancers suffered from large between-study heterogeneity and small-study effects or excess significance bias. The associations with convincing and highly suggestive evidence were mainly focused on skin photosensitivity and phenotypic characteristics. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  7. Time-dependent bioactivity of preparations from cactus pear (Opuntia ficus indica) and ice plant (Mesembryanthemum crystallinum) on human skin fibroblasts and keratinocytes.

    Science.gov (United States)

    Deters, A M; Meyer, U; Stintzing, F C

    2012-07-13

    Traditionally and nowadays preparations from two xerophytic plants, the ice plant and cactus pear are used in dermatologic and cosmetic preparations. In spite of their daily use, little is known concerning the bioactivity of such extracts on skin cells. The purpose of this study was to investigate the effect of pressed juices from ice plant (McP) and two cactus pear polysaccharides (cold water soluble, NwPS; non swelling pectin, NPec) on the cell physiology of normal human dermal fibroblasts (NHDF) and HaCaT-keratinocytes due to composition, concentration and incubation time. Cactus pear polysaccharides were analyzed by high performance anion exchange chromatography with pulsed amperometric detection after hydrolysis with trifluoroacetic acid. Ice plant pressed juices were filtrated through a 1.2 μm (McPI) and 0.2 μm filter (McPII). Cell proliferation was measured with BrdU incorporation assay. Reduction of tetrazolium salts was applied to determine the metabolic activity (MTT) while necrotic effects were assessed by LDH-release measurements. Cactus pear polysaccharides differed predominantly in their glucose and uronic acid content. The filtration of pressed juices altered the amounts of high molecular weight compounds. The proliferation of NHDF and HaCaTs was significantly stimulated by cactus pear polysaccharides and ice plant pressed juices not until 72 h of incubation. McPI significantly increased the proliferation of NHDF and HaCaTs while significant effect of McPII was only observed in case of HaCaT-keratinocytes. A dependence on concentration was not observed. Metabolic activity was neither influenced by McPI nor by McPII independent of incubation time. The HaCaT proliferation was not significantly influenced by low concentrations of cactus pear polysaccharides however it was inhibited by 100 μg/mL NPec. 100 μg/mL of NwPS and 1 μg/mL NPec stimulated the proliferation of fibroblasts. The metabolic activity of NHDF was not affected neither by NPec nor by

  8. Filopodia are conduits for melanosome transfer to keratinocytes.

    Science.gov (United States)

    Scott, Glynis; Leopardi, Sonya; Printup, Stacey; Madden, Brian C

    2002-04-01

    Melanosomes are specialized melanin-synthesizing organelles critical for photoprotection in the skin. Melanosome transfer to keratinocytes, which involves whole organelle donation to another cell, is a unique biological process and is poorly understood. Time-lapse digital movies and electron microscopy show that filopodia from melanocyte dendrites serve as conduits for melanosome transfer to keratinocytes. Cdc42, a small GTP-binding protein, is known to mediate filopodia formation. Melanosome-enriched fractions isolated from human melanocytes expressed the Cdc42 effector proteins PAK1 and N-WASP by western blotting. Expression of constitutively active Cdc42 (Cdc42(V12)) in melanocytes co-cultured with keratinocytes induced a highly dendritic phenotype with extensive contacts between melanocytes and keratinocytes through filopodia, many of which contained melanosomes. These results suggest a unique role for filopodia in organelle transport and, in combination with our previous work showing the presence of SNARE proteins and rab3a on melanosomes, suggest a novel model system for melanosome transfer to keratinocytes.

  9. Cultured skin microbiota attracts malaria mosquitoes

    NARCIS (Netherlands)

    Verhulst, N.O.; Beijleveld, H.; Knols, B.G.J.; Takken, W.; Schraa, G.; Bouwmeester, H.J.; Smallegange, R.C.

    2009-01-01

    Background - Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human

  10. Cultured skin microbiota attracts malaria mosquitoes

    NARCIS (Netherlands)

    Verhulst, Niels O.; Beijleveld, Hans; Knols, Bart Gj; Takken, Willem; Schraa, Gosse; Bouwmeester, Harro J.; Smallegange, Renate C.

    2009-01-01

    Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human body odours.

  11. Cultured skin microbiota attracts malaria mosquitoes

    NARCIS (Netherlands)

    Verhulst, N.O.; Beijleveld, H.; Knols, B.G.J.; Takken, W.; Schraa, G.; Bouwmeester, H.J.; Smallegange, R.C.

    2009-01-01

    Background: Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human

  12. Possible role of Malassezia furfur in psoriasis: modulation of TGF-beta1, integrin, and HSP70 expression in human keratinocytes and in the skin of psoriasis-affected patients.

    Science.gov (United States)

    Baroni, Adone; Paoletti, Iole; Ruocco, Eleonora; Agozzino, Marina; Tufano, Maria Antonietta; Donnarumma, Giovanna

    2004-01-01

    Psoriasis is a disease characterized by an abnormal pattern of keratinocyte growth and differentiation. Malassezia furfur forms part of the normal human skin flora. It may also be involved in the pathogenesis of psoriasis. To define the role of M. furfur in the pathogenesis of psoriasis, we investigated how M. furfur regulates molecules involved in cell migration and proliferation. The experiments were performed using human keratinocytes and skin biopsies from M. furfur-positive and -negative psoriasis-affected patients. In addition, we examined the signal transduction mechanisms involved. Western blot analysis was performed on human keratinocytes lysates treated or untreated with M. furfur and on biopsies from healthy and psoriasis patients. Signal transduction mechanisms involved were evaluated by electrophoretic mobility shift assay using the AP-1 inhibitor curcumin. We found that M. furfur up-regulates transforming growth factor-beta1 (TGF-beta1), integrin chain, and HSP70 expression in human keratinocytes via AP-1-dependent mechanism. In the biopsies of M. furfur-positive psoriasis-affected patients, an increase in TGF-beta1, integrin chains, and HSP70 expression was found. Our data suggest that M. furfur can induce the overproduction of molecules involved in cell migration and hyperproliferation, thereby favoring the exacerbation of psoriasis.

  13. Bathing in carbon dioxide-enriched water alters protein expression in keratinocytes of skin tissue in rats

    Science.gov (United States)

    Kälsch, Julia; Pott, Leona L.; Takeda, Atsushi; Kumamoto, Hideo; Möllmann, Dorothe; Canbay, Ali; Sitek, Barbara; Baba, Hideo A.

    2017-04-01

    Beneficial effects of balneotherapy using naturally occurring carbonated water (CO2 enriched) have been known since the Middle Ages. Although this therapy is clinically applied for peripheral artery disease and skin disorder, the underlying mechanisms are not fully elucidated.

  14. Expression profile of cornified envelope structural proteins and keratinocyte differentiation-regulating proteins during skin barrier repair.

    NARCIS (Netherlands)

    Koning, H.D. de; Bogaard, E.H.J. van den; Bergboer, J.G.M.; Kamsteeg, M.; Vlijmen-Willems, I.M.J.J. van; Hitomi, K.; Henry, J.; Simon, M.; Takashita, N.; Ishida-Yamamoto, A.; Schalkwijk, J.; Zeeuwen, P.L.J.M.

    2012-01-01

    BACKGROUND: Recent studies have emphasized the importance of heritable and acquired skin barrier abnormalities in common inflammatory diseases such as psoriasis and atopic dermatitis (AD). To date, no comprehensive studies on the effect of experimental barrier disruption on cornified envelope

  15. [Importance of skin contamination in blood culture readings].

    Science.gov (United States)

    Kunze, M; Volkman, H; Köhler, W

    1979-11-01

    The importance of the skin contamination for the results of blood cultures was emphasized by model examinations. In the method of blood taking without previous desinfection of the skin the quota of positive blood cultures increased by the twofold to threefold per culture and test person (5.7 to 18.8% and 11.3 to 26.3%, respectively). In large-volume blood takings the contamination rate becomes smaller with increasing blood volume. The rejecting of a first blood sample is to be recommended, when the possibility is given. With an increased quantity o blood per taking by blood bactericidia a decreased contamination rate is to be expected. By the results of the examinations the necessity of a consequent desinfection of the skin is to be emphasized, also when closed systems of blood cultures are used.

  16. Breast cancer resistance protein identifies clonogenic keratinocytes in human interfollicular epidermis.

    Science.gov (United States)

    Ma, Dongrui; Chua, Alvin Wen Choong; Yang, Ennan; Teo, Peiyun; Ting, Yixin; Song, Colin; Lane, Ellen Birgitte; Lee, Seng Teik

    2015-03-24

    There is a practical need for the identification of robust cell-surface markers that can be used to enrich for living keratinocyte progenitor cells. Breast cancer resistance protein (ABCG2), a member of the ATP binding cassette (ABC) transporter family, is known to be a marker for stem/progenitor cells in many tissues and organs. We investigated the expression of ABCG2 protein in normal human epidermis to evaluate its potential as a cell surface marker for identifying and enriching for clonogenic epidermal keratinocytes outside the pilosebaceous tract. Immunofluorescence and immunoblotting studies of human skin showed that ABCG2 is expressed in a subset of basal layer cells in the epidermis. Flow cytometry analysis showed approximately 2-3% of keratinocytes in non-hair-bearing epidermis expressing ABCG2; this population also expresses p63, β1 and α6 integrins and keratin 14, but not CD34, CD71, C-kit or involucrin. The ABCG2-positive keratinocytes showed significantly higher colony forming efficiency when co-cultured with mouse 3T3 feeder cells, and more extensive long-term proliferation capacity in vitro, than did ABCG2-negative keratinocytes. Upon clonal analysis, most of the freshly isolated ABCG2-positive keratinocytes formed holoclones and were capable of generating a stratified differentiating epidermis in organotypic culture models. These data indicate that in skin, expression of the ABCG2 transporter is a characteristic of interfollicular keratinocyte progentior cells and suggest that ABCG2 may be useful for enriching keratinocyte stem cells in human interfollicular epidermis.

  17. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  18. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  19. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  20. Susceptible cytotoxicity to ultraviolet B light in fibroblasts and keratinocytes cultured from autoimmune-prone MRL/Mp-lpr/lpr mice

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, F.; Lyon, M.B.; Norris, D.A. (Univ. of Colorado School of Medicine, Denver (USA))

    1989-09-01

    The MRL/Mp-lpr/lpr (MRL/l) mouse is an autoimmune model of spontaneous lupus erythematosus (LE), in addition to lupus nephritis. In order to better understand the mechanisms of photosensitivity in LE, in vitro photocytotoxicity was examined by using fibroblasts and keratinocytes cultured from MRL/l mice, control MRL/Mp- +/+ (MRL/n) mice, and normal BALB/c mice. A colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and the acridine orange/ethidium bromide assay were used for determination of cytotoxicity. Fibroblasts cultured from newborn MRL/l mice showed higher susceptibility to single ultraviolet light B (UVB) light irradiation at a dose of 100-500 mJ than those from MRL/n, F1 hybrid of (MRL/l x MRL/n mice), and BALB/c mice. However, the susceptibility to UVB was not observed in young (1-month-old) and adult (4-month-old) MRL/l mice. UVA light irradiation was not cytotoxic. Keratinocytes cultured from MRL mice showed lower cytotoxicity to UVB irradiation than fibroblasts cultured. However, keratinocytes from newborn MRL/l mice showed higher cytotoxicity to 50 mJ UVB irradiation than cells from MRL/n mice. Syngeneic or allogeneic sera augmented UVB-induced cytotoxicity of fibroblasts cultured. UVB irradiation of spleen cells induced no significant difference of cytotoxicity between MRL/l and MRL/n mice. Based on the results of F1 hybrid of (MRL/l x MRL/n) mice, the susceptibility seemed to be associated with autoimmune traits and to be regulated by genetical background.

  1. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  2. An in vitro model for detecting skin irritants: methyl green-pyronine staining of human skin explant cultures

    NARCIS (Netherlands)

    Jacobs, J. J. L.; Lehé, C.; Cammans, K. D. A.; Das, P. K.; Elliott, G. R.

    2002-01-01

    We evaluated the potential of human organotypic skin explant cultures (hOSECs) for screening skin irritants. Test chemicals were applied to the epidermis of the skin explants which were incubated for 4, 24 or 48 h in tissue culture medium. A decrease in epidermal RNA staining, visualised in frozen

  3. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  4. DNA repair response in human epidermal keratinocytes from donors of different age

    Energy Technology Data Exchange (ETDEWEB)

    Liu, S.C.; Parsons, C.S.; Hanawalt, P.C.

    1982-11-01

    We have compared the excision-repair and growth properties of epidermal keratinocytes from humans of different ages. Keratinocytes isolated from newborn and adult abdominal skin at autopsy were cultured on collagen gels. Repair replication was assayed by the 5-bromodeoxyuridine density-labeling method following ultraviolet (UV) irradiation (254 nm) of the cultures. The keratinocytes from newborn donors proliferated more rapidly and attained a higher concentration at confluence than did those from aged donors. Semiconservative DNA replication was inhibited by UV radiation to an equal extent in cell cultures from newborns and adults. After a UV dose of 13 J/m2, the time course of DNA repair was similar for the respective cultures. Furthermore, there were no significant differences in the time course of repair for keratinocytes in the proliferative or the plateau phase of growth. The dose-response curves for repair replication in cells from both young and old donors maximized at about 50 J/m2 but the attenuation in repair at higher doses appeared somewhat greater in cells from older donors. We conclude that no significant age-related differences exist in the rate and extent of the repair-replication response of human epidermal keratinocytes to UV-radiation damage in DNA. However, it remains to be determined whether other cellular recovery responses to damaged DNA are also relatively unrelated to age.

  5. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  6. Macelignan inhibits melanosome transfer mediated by protease-activated receptor-2 in keratinocytes.

    Science.gov (United States)

    Choi, Eun-Jung; Kang, Young-Gyu; Kim, Jaekyung; Hwang, Jae-Kwan

    2011-01-01

    Skin pigmentation is the result of melanosome transfer from melanocytes to keratinocytes. Protease-activated receptor-2 (PAR-2) is a key mediator of melanosome transfer, which occurs as the melanocyte extends its dendrite toward surrounding keratinocytes that take up melanosomes by phagocytosis. We investigated the effects of macelignan isolated from Myristica fragrans HOUTT. (nutmeg) on melanosome transfer and the regulation of PAR-2 in human keratinocytes (HaCaT). HaCaT cells stimulated by the PAR-2-activating peptide Ser-Leu-Ile-Gly-Arg-Leu-NH₂ (SLIGRL) were treated with macelignan; PAR-2 expression was then determined by reverse transcription-polymerase chain reaction (RT-PCR), Western blot, and immunocytochemistry. We evaluated the effects of macelignan on calcium mobilization and keratinocyte phagocytosis. In addition, B16F10 melanoma cells and keratinocytes were co-cultured to assess the effects of macelignan on prostaglandin E₂ (PGE₂) secretion and subsequent dendrite formation. Macelignan decreased HaCaT PAR-2 mRNA and protein levels in a dose-dependent manner. Furthermore, macelignan markedly reduced intracellular calcium mobilization and significantly downregulated keratinocyte phagocytosis, as shown by decreased ingestion of Escherichia coli bioparticles and fluorescent microspheres. In co-culture experiments, macelignan reduced keratinocyte PGE₂ secretion, thereby preventing dendrite formation in B16F10 melanoma cells compared with SLIGRL-treated controls. Macelignan inhibits melanosome transfer by downregulating PAR-2, thereby reducing keratinocyte phagocytosis and PGE₂ secretion, which in turn inhibits dendrite formation in B16F10 melanoma cells. Taken together, our findings suggest that macelignan could be used as a natural depigmenting agent to ameliorate hyperpigmentation.

  7. Keratinocyte growth factor promotes melanosome transfer to keratinocytes.

    Science.gov (United States)

    Cardinali, Giorgia; Ceccarelli, Simona; Kovacs, Daniela; Aspite, Nicaela; Lotti, Lavinia Vittoria; Torrisi, Maria Rosaria; Picardo, Mauro

    2005-12-01

    Melanogenesis and melanosome transfer from the melanocytes to the neighboring keratinocytes are induced by ultraviolet radiation and modulated by autocrine and paracrine factors. Keratinocyte growth factor (KGF/fibroblast growth factor (FGF)7) is a paracrine mediator of human keratinocyte growth and differentiation. We evaluated the influence of KGF on melanosome transfer in co-cultures of keratinocytes and melanocytes. Immunofluorescence analysis using anti-tyrosinase and anti-human cytokeratin antibodies, phagocytic assays using fluorescent latex beads, and ultrastructural analysis indicated that KGF is able to induce melanosome transfer acting only on the recipient keratinocytes and as a consequence of a general role of KGF in the promotion of the phagocytic process. Inhibition of proteinase-activated receptor-2, to block the Rho-dependent phagocytic pathway, or of the Src family tyrosine kinases, to inhibit the Rac-dependent pathway, showed that KGF promotes phagocytosis through both mechanisms. Increased expression of the KGF receptor (KGFR) on the keratinocytes by transfection led to increased phagocytosis of latex beads following KGF treatment, suggesting that the KGF effect is directly mediated by KGFR expression and activation. Moreover, confocal microscopic analysis revealed that KGFR localize in phagosomes during KGF-induced phagocytosis, suggesting a direct role of the receptor in regulating both the early steps of uptake and the intracellular traffic of the phagosomes.

  8. Topical administration of reversible SAHH inhibitor ameliorates imiquimod-induced psoriasis-like skin lesions in mice via suppression of TNF-α/IFN-γ-induced inflammatory response in keratinocytes and T cell-derived IL-17.

    Science.gov (United States)

    Lin, Ze-Min; Ma, Meng; Li, Heng; Qi, Qing; Liu, Yu-Ting; Yan, Yu-Xi; Shen, Yun-Fu; Yang, Xiao-Qian; Zhu, Feng-Hua; He, Shi-Jun; Tang, Wei; Zuo, Jian-Ping

    2018-03-01

    DZ2002, a reversible S-adenosyl-l-homocysteine hydrolase (SAHH) inhibitor with immunosuppressive properties and potent therapeutic activity against various autoimmune diseases in mice. The present study was designed to characterize the potential therapeutic effects of DZ2002 on murine model of psoriasis and reveal the correlated mechanisms. In this report, we demonstrated that in vitro, DZ2002 significantly decreased the expression of pro-inflammatory cytokines and adhesion molecule including IL-1α, IL-1β, IL-6, IL-8, TNF-α and ICAM-1 by inhibiting the phosphorylation of p38 MAPK, ERK and JNK in TNF-α/IFN-γ-stimulated HaCaT human keratinocytes. Topical administration of DZ2002 alleviated the imiquimod (IMQ)-induced psoriasis-like skin lesions and inflammation in mice, the therapeutic effect was comparable with the Calcipotriol. Moreover, the inflammatory skin disorder was restored by DZ2002 treatment characterized by reducing both of the CD3 + T cell accumulation and the psoriasis-specific cytokines expression. Further, we found that DZ2002 improved IMQ-induced splenomegaly and decreased the frequency of splenic IL-17-producing T cells. Our finding offered the convincing evidence that SAHH inhibitor DZ2002 might attenuate psoriasis by simultaneously interfering the abnormal activation and differentiation of keratinocytes and accumulation of IL-17-producing T cells in skin lesions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Keratinocyte-melanocyte interactions during melanosome transfer.

    Science.gov (United States)

    Seiberg, M

    2001-08-01

    The epidermal-melanin unit is composed of one melanocyte and approximately 36 neighboring keratinocytes, working in synchrony to produce and distribute melanin. Melanin is synthesized in melanosomes, transferred to the dendrite tips, and translocated into keratinocytes, forming caps over the keratinocyte nuclei. The molecular and cellular mechanisms involved in melanosome transfer and the keratinocyte-melanocyte interactions required for this process are not yet completely understood. Suggested mechanisms of melanosome transfer include melanosome release and endocytosis, direct inoculation ('injection'), keratinocyte-melanocyte membrane fusion, and phagocytosis. Studies of the keratinocyte receptor protease-activated receptor-2 (PAR-2) support the phagocytosis theory. PAR-2 controls melanosome ingestion and phagocytosis by keratinocytes and exerts a regulatory role in skin pigmentation. Modulation of PAR-2 activity can enhance or decrease melanosome transfer and affects pigmentation only when there is keratinocyte-melanocyte contact. Moreover, PAR-2 is induced by UV irradiation and inhibition of PAR-2 activation results in the prevention of UVB-induced tanning. The role of PAR-2 in mediating UV-induced responses remains to be elucidated.

  10. Basic Red 51, a permitted semi-permanent hair dye, is cytotoxic to human skin cells: Studies in monolayer and 3D skin model using human keratinocytes (HaCaT).

    Science.gov (United States)

    Zanoni, Thalita B; Tiago, Manoela; Faião-Flores, Fernanda; de Moraes Barros, Silvia B; Bast, Aalt; Hageman, Geja; de Oliveira, Danielle Palma; Maria-Engler, Silvya S

    2014-06-05

    The use of hair dyes is closely associated with the increase of cancer, inflammation and other skin disorders. The recognition that human skin is not an impermeable barrier indicates that there is the possibility of human systemic exposure. The carcinogenic potential of hair dye ingredients has attracted the attention of toxicologists for many decades, mainly due to the fact that some ingredients belong to the large chemical family of aromatic amines. Herein, we investigated the cytotoxicity of Basic Red 51 (BR51) in immortalized human keratinocytes (HaCaT). BR51 is a temporary hair dye that belongs to the azo group (NN); the cleavage of this bond may result in the release of toxic aromatic amines. The half maximal effective concentration (EC50) in HaCaT cells is 13μg/mL. BR51 induced a significant decrease on expression of p21 in a dose dependent manner. p53 was not affected, whereas BR51 decreased procaspase 8 and cleaved procaspase 9. These results proved that caspase 3 is fully involved in BR51-induced apoptosis. The dye was also able to stop this cell cycle on G2 in sub-toxic doses. Moreover, we reconstructed a 3D artificial epidermis using HaCaT cells; using this model, we observed that BR51 induced cell injury and cells were undergoing apoptosis, considering the fragmented nuclei. Subsequently, BR51 induced reactive oxygen species (ROS) leading to an increase on the levels of 8-oxo-dG. In conclusion, we provide strong evidence that consumer and/or professional exposure to BR51 poses risk to human health. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Culture Media and Individual Hosts Affect the Recovery of Culturable Bacterial Diversity from Amphibian Skin.

    Science.gov (United States)

    Medina, Daniel; Walke, Jenifer B; Gajewski, Zachary; Becker, Matthew H; Swartwout, Meredith C; Belden, Lisa K

    2017-01-01

    One current challenge in microbial ecology is elucidating the functional roles of the large diversity of free-living and host-associated bacteria identified by culture-independent molecular methods. Importantly, the characterization of this immense bacterial diversity will likely require merging data from culture-independent approaches with work on bacterial isolates in culture. Amphibian skin bacterial communities have become a recent focus of work in host-associated microbial systems due to the potential role of these skin bacteria in host defense against the pathogenic fungus Batrachochytrium dendrobatidis (Bd), which is associated with global amphibian population declines and extinctions. As there is evidence that some skin bacteria may inhibit growth of Bd and prevent infection in some cases, there is interest in using these bacteria as probiotic therapy for conservation of at-risk amphibians. In this study, we used skin swabs from American toads ( Anaxyrus americanus ) to: (1) assess the diversity and community structure of culturable amphibian skin bacteria grown on high and low nutrient culture media, (2) determine which culture media recover the highest proportion of the total skin bacterial community of individual toads relative to culture-independent data, and (3) assess whether the plated communities from the distinct media types vary in their ability to inhibit Bd growth in in-vitro assays. Overall, we found that culture media with low nutrient concentrations facilitated the growth of more diverse bacterial taxa and grew distinct communities relative to media with higher nutrient concentrations. Use of low nutrient media also resulted in culturing proportionally more of the bacterial diversity on individual toads relative to the overall community defined using culture-independent methods. However, while there were differences in diversity among media types, the variation among individual hosts was greater than variation among media types, suggesting

  12. The effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, Kari; Jansen, C.T.; Puustinen, Tapio

    1986-01-01

    [ 14 C]Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm 2 (erythemally effective, EE) substantial amounts of 14 C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E 2 (PGE 2 ) and following UVB irradiation of 9 mJ/cm 2 (EE) the formation of prostaglandin E 2 was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E 2 . However, in the presence of etretin the UVB irradiation induced transfer of [ 14 C]arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis. (author)

  13. Model of human epidermis reconstructed in vitro with keratinocytes and melanocytes on dead de-epidermized human dermis

    Directory of Open Access Journals (Sweden)

    Jussara Rehder

    Full Text Available CONTEXT: Recent progress in the field of epithelial culture techniques has allowed the development of culture systems in which the reconstructed epidermis presents characteristics of morphological differentiation similar to those seen in vivo. Human epidermis reconstructed in vitro may be used as the best alternative for the in vitro testing of the toxicology and efficiency of products for topical use, as well as in the treatment of skin burns and chronic skin ulcers. OBJECTIVE: To demonstrate a method for obtaining human epidermis reconstructed in vitro, using keratinocytes and melanocytes cultivated on dead de-epidermized human dermis. TYPE OF STUDY: Experimental/laboratory. SETTING: Skin Cell Culture Laboratory of the Faculdade de Ciências Médicas, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. PROCEDURE: Human keratinocytes and melanocytes cultured in vitro were grown on a biological matrix (dead de-epidermized human dermis and the system was kept at an air-liquid interface, in a suitable culturing medium, until a stratified human epidermis was formed, maintaining the histological characteristics of the epidermis in vivo. RESULTS: It was histologically demonstrated that it is possible to reproduce a differentiated epidermis through keratinocytes and melanocytes cultured on dead de-epidermized human dermis, thus obtaining a correctly positioned human epidermis reconstructed in vitro with functional keratinocytes and melanocytes that is similar to in vivo epidermis. CONCLUSIONS: It is possible to obtain a completely differentiated human epidermis reconstructed in vitro from keratinocyte and melanocyte cultures on a dead de-epidermized human dermis.

  14. Automated identification of epidermal keratinocytes in reflectance confocal microscopy

    Science.gov (United States)

    Gareau, Dan

    2011-03-01

    Keratinocytes in skin epidermis, which have bright cytoplasmic contrast and dark nuclear contrast in reflectance confocal microscopy (RCM), were modeled with a simple error function reflectance profile: erf( ). Forty-two example keratinocytes were identified as a training set which characterized the nuclear size a = 8.6+/-2.8 μm and reflectance gradient b = 3.6+/-2.1 μm at the nuclear/cytoplasmic boundary. These mean a and b parameters were used to create a rotationally symmetric erf( ) mask that approximated the mean keratinocyte image. A computer vision algorithm used an erf( ) mask to scan RCM images, identifying the coordinates of keratinocytes. Applying the mask to the confocal data identified the positions of keratinocytes in the epidermis. This simple model may be used to noninvasively evaluate keratinocyte populations as a quantitative morphometric diagnostic in skin cancer detection and evaluation of dermatological cosmetics.

  15. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes.

    Science.gov (United States)

    Kodet, Ondřej; Lacina, Lukáš; Krejčí, Eliška; Dvořánková, Barbora; Grim, Miloš; Štork, Jiří; Kodetová, Daniela; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, Karel

    2015-01-05

    Nodular melanoma is one of the most life threatening tumors with still poor therapeutic outcome. Similarly to other tumors, permissive microenvironment is essential for melanoma progression. Features of this microenvironment are arising from molecular crosstalk between the melanoma cells (MC) and the surrounding cell populations in the context of skin tissue. Here, we study the effect of melanoma cells on human primary keratinocytes (HPK). Presence of MC is as an important modulator of the tumor microenvironment and we compare it to the effect of nonmalignant lowly differentiated cells also originating from neural crest (NCSC). Comparative morphometrical and immunohistochemical analysis of epidermis surrounding nodular melanoma (n = 100) was performed. Data were compared to results of transcriptome profiling of in vitro models, in which HPK were co-cultured with MC, normal human melanocytes, and NCSC, respectively. Differentially expressed candidate genes were verified by RT-qPCR. Biological activity of candidate proteins was assessed on cultured HPK. Epidermis surrounding nodular melanoma exhibits hyperplastic features in 90% of cases. This hyperplastic region exhibits aberrant suprabasal expression of keratin 14 accompanied by loss of keratin 10. We observe that MC and NCSC are able to increase expression of keratins 8, 14, 19, and vimentin in the co-cultured HPK. This in vitro finding partially correlates with pseudoepitheliomatous hyperplasia observed in melanoma biopsies. We provide evidence of FGF-2, CXCL-1, IL-8, and VEGF-A participation in the activity of melanoma cells on keratinocytes. We conclude that the MC are able to influence locally the differentiation pattern of keratinocytes in vivo as well as in vitro. This interaction further highlights the role of intercellular interactions in melanoma. The reciprocal role of activated keratinocytes on biology of melanoma cells shall be verified in the future.

  16. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  17. Melanosome transfer evaluation by quantitative measurement of Pmel 17 in human normal melanocyte-keratinocyte co-cultures: effect of an Alaria esculenta extract.

    Science.gov (United States)

    Verdy, Clotilde; Branka, Jean-Eric; Mekideche, Nicole

    2012-01-01

    Numerous strategies have been proposed to evaluate melanosome transfer. Methods allowing quantitative measurements of this transfer in human normal cellular models, however, are very few and often require extremely specialized devices that are expensive and difficult to use. As a part of the melanosome-specific membrane-bound glycoprotein, Pmel 17 is released from the melanosome membrane by ectodomain shedding. We reasoned, therefore, that it should be possible to evaluate melanosome transfer by quantifying this "soluble" Pmel 17. The Pmel 17 ELISA assay developed permits a detection of 10 to 1000 ng/ml of this glycoprotein in human normal melanocyte-keratinocyte co-culture media. As expected, niacinamide, a well-known melanosome transfer inhibitor, significantly reduced the Pmel 17 quantities found in the culture media. This validated our experimental design. We then used our model to show that a whitening cosmetic active compound, i.e., an Alaria esculenta extract, can (at least in part) enable a significant decrease in the melanosome transfer to produce a lightening effect without affecting melanin production. This research provides a simple and efficient method to quantify melanosome transfer in a human normal co-culture model. It is a particularly useful tool with which to facilitate the development of new active whitening compounds.

  18. Cobertura de grandes quemados con cultivo de queratinocitos: casuística de nuestra Unidad y protocolo de tratamiento Massive burn coverage with keratinocytes cultured: our casuistry and treatment protocol

    Directory of Open Access Journals (Sweden)

    I. González Alaña

    2012-09-01

    Full Text Available El paciente gran quemado sigue siendo hoy en día un difícil reto al que se enfrentan múltiples profesionales sanitarios. La elevada mortalidad de estos pacientes se justifica por la severa alteración del estado general que sufren, las múltiples complicaciones que se asocian y por la ausencia de piel válida para cubrir las quemaduras, como sucede en el caso de los quemados de gran extensión. Este último inconveniente se solventa de diferentes maneras, siendo una de las más importantes el cultivo de queratinocitos. En la Unidad de Quemados del Hospital Universitario de Cruces en Baracaldo (Vizcaya, España, iniciamos la aplicación de esta técnica en 2001, con una experiencia acumulada en esta década de 14 pacientes. El objetivo de este artículo es mostrar nuestro protocolo de aplicación del procedimiento para la cobertura de quemados extensos, los criterios de inclusión y la terapéutica pre y postaplicación de las láminas de queratinocitos que empleamos en nuestra Unidad. Así mismo, presentamos las características de los pacientes tratados y nuestra propia experiencia en la aplicación de esta técnica que, a pesar de lograr resultados cada vez más satisfactorios y ser en ocasiones la única alternativa para un paciente extensamente quemado, tiene todavía hoy en día tantos detractores.The severe burn patient continues being nowadays a difficult challenge which multiple sanitary professionals face. The high mortality of these patients justifies itself by the severe alteration of the general condition, the multiple complications that they suffer and the absence of skin for their coverage, as is the case of extensive burns. This last disadvantage is settled in different ways, being one of the most important the treatment with keratinocytes culture. In the Cruces Universitary Hospital Burn Unit in Baracaldo (Vizcaya, Spain, we began the clinical application of this technique in 2001, with a 14 patients accumulated experience in

  19. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  20. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary

    2007-09-01

    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  1. Characterization of hair follicle development in engineered skin substitutes.

    Directory of Open Access Journals (Sweden)

    Penkanok Sriwiriyanont

    Full Text Available Generation of skin appendages in engineered skin substitutes has been limited by lack of trichogenic potency in cultured postnatal cells. To investigate the feasibility and the limitation of hair regeneration, engineered skin substitutes were prepared with chimeric populations of cultured human keratinocytes from neonatal foreskins and cultured murine dermal papilla cells from adult GFP transgenic mice and grafted orthotopically to full-thickness wounds on athymic mice. Non-cultured dissociated neonatal murine-only skin cells, or cultured human-only skin keratinocytes and fibroblasts without dermal papilla cells served as positive and negative controls respectively. In this study, neonatal murine-only skin substitutes formed external hairs and sebaceous glands, chimeric skin substitutes formed pigmented hairs without sebaceous glands, and human-only skin substitutes formed no follicles or glands. Although chimeric hair cannot erupt readily, removal of upper skin layer exposed keratinized hair shafts at the skin surface. Development of incomplete pilosebaceous units in chimeric hair corresponded with upregulation of hair-related genes, LEF1 and WNT10B, and downregulation of a marker of sebaceous glands, Steroyl-CoA desaturase. Transepidermal water loss was normal in all conditions. This study demonstrated that while sebaceous glands may be involved in hair eruption, they are not required for hair development in engineered skin substitutes.

  2. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  3. Liposome-encapsulated ursolic acid increases ceramides and collagen in human skin cells.

    Science.gov (United States)

    Both, Dawn M; Goodtzova, Karina; Yarosh, Daniel B; Brown, David A

    2002-01-01

    Skin wrinkling and xerosis associated with aging result from decreases in dermal collagen and stratum corneum ceramide content. This study demonstrated that ursolic acid incorporated into liposomes (URA liposomes) increases both the ceramide content of cultured normal human epidermal keratinocytes (NHEK), and the collagen content of cultured normal human dermal fibroblasts. In addition, URA liposomes increased the ceramide content of the skin of human subjects, with increases in hydroxy ceramides occurring after only 3 days of treatment. Both URA liposomes and retinoic acid decreased markers of keratinocyte differentiation (keratin 1, keratin 10 and involucrin) in cultured NHEK. Thus, URA liposomes have effects on keratinocyte differentiation and dermal fibroblast collagen synthesis similar to those of retinoids. However, this study showed that URA liposomes increase ceramides in NHEK, in contrast to the decreases previously shown to be caused by retinoids. URA liposomes have the potential to be used alone or in combination with other agents to restore or maintain skin ceramide and collagen content.

  4. Perlecan expression influences the keratin 15-positive cell population fate in the epidermis of aging skin.

    Science.gov (United States)

    Dos Santos, Morgan; Michopoulou, Anna; André-Frei, Valérie; Boulesteix, Sophie; Guicher, Christine; Dayan, Guila; Whitelock, John; Damour, Odile; Rousselle, Patricia

    2016-04-01

    The epidermis is continuously renewed by stem cell proliferation and differentiation. Basal keratinocytes append the dermal-epidermal junction, a cell surface-associated, extracellular matrix that provides structural support and influences their behaviour. It consists of laminins, type IV collagen, nidogens, and perlecan, which are necessary for tissue organization and structural integrity. Perlecan is a heparan sulfate proteoglycan known to be involved in keratinocyte survival and differentiation. Aging affects the dermal epidermal junction resulting in decreased contact with keratinocytes, thus impacting epidermal renewal and homeostasis. We found that perlecan expression decreased during chronological skin aging. Our in vitro studies revealed reduced perlecan transcript levels in aged keratinocytes. The production of in vitro skin models revealed that aged keratinocytes formed a thin and poorly organized epidermis. Supplementing these models with purified perlecan reversed the phenomenon allowing restoration of a well-differentiated multi-layered epithelium. Perlecan down-regulation in cultured keratinocytes caused depletion of the cell population that expressed keratin 15. This phenomenon depended on the perlecan heparan sulphate moieties, which suggested the involvement of a growth factor. Finally, we found defects in keratin 15 expression in the epidermis of aging skin. This study highlighted a new role for perlecan in maintaining the self-renewal capacity of basal keratinocytes.

  5. [Effects of Xiaoyao Powder Extract in co-culture model of melanoma cells and keratinocytes on expression of tyrosinase and its related protein].

    Science.gov (United States)

    Zhang, Ning; Liu, Hui; Zhang, Ming-lei; Liu, Bin; Ren, Yan-dong; Wang, Xue; Li, Jian-min

    2014-06-01

    To observe the effects and mechanism of Xiaoyao Powder extract on the content of melanin in co-culture model of melanoma cells and keratinocytes. Eluting components of Xiaoyao Powder was collected by AB-8 macroporous resin column. Different concentration extracts of Xiaoyao Powder were added into the co-culture model of A375 melanoma cells and HaCat ke- ratinocytes. Hunt method was used to detected the content of melanin. RT-PCR assay was used to detect the effects of the extract of Xi- aoyao Powder on the TYR,TRP-1 and TRP-2 mRNA expression in A375 melanoma cells. Compared with the control group,the extract of Xiaoyao Powder down-regulated content of melanin and mRNA expression of TYR,TRP-1 and TRP-2 in A375 melanoma cells by 82.23% ,93. 01% and 29. 11% ,23.78% ,20. 05% ;25. 13% ,15.02% ,11.64% ,respectively(P Powder can decrease the melanogenesis by down-regulating the mRNA expression of tyrosinase and its related protein.

  6. Antibacterial activity of polihexanide formulations in a co-culture of HaCaT keratinocytes and Staphylococcus aureus and at different pH levels.

    Science.gov (United States)

    Wiegand, Cornelia; Eberlein, Thomas; Andriessen, Anneke

    2017-05-01

    Complex stalled wounds feature an alkaline milieu that favors tissue destruction and microbial growth. The presence of bacteria in turn perpetuates the inflammatory response. However, only limited knowledge exists of pH dependency on the antibacterial efficacy of polyhexamethylene biguanide (PHMB) or the influence of surfactants or delivery vehicle used in antiseptic formulations. So far, PHMB alone has been shown to protect the keratinocytes from bacterial damage in such a co-culture system as well as exhibiting increased antimicrobial activity at higher pH values. Here, the interaction of PHMB with the surfactants macrogolum and undecylenamidopropyl betaine that are most commonly used as additives in antiseptics and rinsing solutions such as Lavasept and Prontosan has been explored in addition to the PHMB-containing biocellulose dressing Suprasorb X + PHMB. Undecylenamidopropyl betaine was found to lower the antimicrobial activity of polihexanide in the co-culture system, while macrogolum and the biocellulose increased polihexanide efficiency to reduce Staphylococcus aureus especially in the presence of serum. The increasing antibacterial efficacy of PHMB with rising pH was not altered by undecylenamidopropyl betaine, macrogolum, or the biocellulose. The results suggest that application of PHMB with macrogolum or by delivery through a biocellulose dressing might be advantageous for management of wound infections. © 2017 by the Wound Healing Society.

  7. Ultraviolet radiation stimulates a biphasic pattern of 1,2-diacylglycerol formation in cultured human melanocytes and keratinocytes by activation of phospholipases C and D

    International Nuclear Information System (INIS)

    Carsberg, C.J.; Friedmann, P.S.; Ohanian, J.

    1995-01-01

    Ultraviolet radiation (UVR) induces melanin synthesis by human epidermal melanocytes, and phospholipid-derived 1,2-diacyl-glycerols (DAGs) have been implicated in mediating this response. In previous experiments, addition of the synthetic DAG l-oleoyl-2-acetylglycerol to cultured pigment cells stimulated melanogensis. The purpose of the present study was to analyse the effects of UVR on the endogenous generation of DAGs. It was found that in a number of cultured cell types, including human melanocytes and B16 mouse melanoma cells, but also human keratinocytes and Swiss 3T3 fibroblasts, exposure to a single dose of UVR stimulated a biphasic increase in endogenous DAG formation. An early transient rise, over seconds, was followed by a more sustained delayed rise over minutes. The early rise in DAG levels was accompanied by a transient rise in inositol trisphosphate formation, indicating activation of phosphatidylinositol-specific phospholipase C. The delayed rise was accompanied by activation of phospholipase D. The endogenous DAG formation by pigment cells is further evidence for the involvement of DAGs in UVR-induced epidermal melanin synthesis. Since DAG formation is also seen in other cells types, it is possible that DAGs may be involved in an array of UVR-induced responses. (author)

  8. Effects of advanced glycation end-products (AGEs) on skin ...

    African Journals Online (AJOL)

    kappa B (NF-κB) localization and cell viability were measured in vivo. Keratinocytes from normal skin were cultured in AGE-enriched conditional media, and the cell viability, apoptosis, adhesion and migration were detected in order to find the ...

  9. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  11. The effects of culture, skin color, and other nonclinical issues on acne treatment.

    Science.gov (United States)

    Baldwin, Hilary E; Friedlander, Sheila Fallon; Eichenfield, Lawrence F; Mancini, Anthony J; Yan, Albert C

    2011-09-01

    The effective and safe treatment of acne vulgaris often is affected by individual patient characteristics, including skin color and cultural background. Skin of color is especially prone to hyperpigmentation, both from lesions and from irritating therapy. Clinicians also should be aware of cultural attitudes and folk remedies that may adversely affect dermatologic conditions such as acne. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. α6 Integrin (α6high/Transferrin Receptor (CD71low Keratinocyte Stem Cells Are More Potent for Generating Reconstructed Skin Epidermis Than Rapid Adherent Cells

    Directory of Open Access Journals (Sweden)

    Elodie Metral

    2017-01-01

    Full Text Available The epidermis basal layer is composed of two keratinocyte populations: Keratinocyte Stem cells (KSC and Transitory Amplifying (TA cells that arise from KSC division. Unfortunately, no specific marker exists to differ between KSC and TA cells. Here, we aimed at comparing two different methods that pretended to isolate these two populations: (i the rapid adhesion method on coated substrate and (ii the flow cytometry method, which is based on the difference in cell surface expressions of the α6 integrin and transferrin receptor (CD71. Then, we compared different parameters that are known to discriminate KSC and TA populations. Interestingly, we showed that both methods allow enrichment in stem cells. However, cell sorting by flow cytometry (α6high/CD71low phenotype leads to a better enrichment of KSC since the colony forming efficiency is five times increased versus total cell suspension, whereas it is only 1.4 times for the adhesion method. Moreover, α6high/CD71low cells give rise to a thicker pluristratified epithelium with lower seeding density and display a low Ki67 positive cells number, showing that they have reached the balance between proliferation and differentiation. We clearly demonstrated that cells isolated by a rapid adherent method are not the same population as KSC isolated by flow cytometry following α6high/CD71low phenotype.

  13. Insertion Testing of Polyethylene Glycol Microneedle Array into Cultured Human Skin with Biaxial Tension

    Science.gov (United States)

    Takano, Naoki; Tachikawa, Hiroto; Miyano, Takaya; Nishiyabu, Kazuaki

    Aiming at the practical use of polyethylene glycol (PEG) microneedles for transdermal drug delivery system (DDS), a testing apparatus for their insertion into cultured human skin has been developed. To simulate the variety of conditions of human skin, biaxial tension can be applied to the cultured human skin. An adopted testing scheme to apply and control the biaxial tension is similar to the deep-draw forming technique. An attention was also paid to the short-time setup of small, thin and wet cultured skin. One dimensional array with four needles was inserted and influence of tension was discussed. It was found that tension, deflection of skin during insertion and original curvature of skin are the important parameters for microneedles array design.

  14. Clinical results of an autologous engineered skin.

    Science.gov (United States)

    Llames, Sara; García, Eva; García, Verónica; del Río, Marcela; Larcher, Fernando; Jorcano, Jose Luis; López, Eva; Holguín, Purificación; Miralles, Francisca; Otero, Jesús; Meana, Alvaro

    2006-01-01

    An artificial complete skin (dermis and epidermis) model has been developed in the Tissue engineering unit of the Centro Comunitario de Sangre y Tejidos del Principado de Asturias (CCST) and CIEMAT. This engineered skin has been employed for the treatment of severe epithelial injuries. In this paper, the clinical results obtained with this engineered skin during the last 18 months were evaluated. (a) Culture: Cells (fibroblasts and keratinocytes) were obtained from biopsies by a double enzymatic digestion. After an expansion period, fibroblasts were seeded in an artificial dermis based on human plasma. Keratinocytes were seeded over this dermal surface. (b) 20 skin biopsies were processed (13 burned patients, 5 giant nevus, 1 GVHD, 1 neurofibromatosis), which came from different hospitals across the country. About 97,525 cm(2) of engineered skin were cultured. The engineered skin took in all patients. The take percentage depended on previous pathology (burned patients 10-90%; non-critical patients 70-90%). The epithelization obtained was permanent in all cases. During the follow-up period, epithelial loss, blistering injuries or skin retractions were not observed. The aesthetic and functional results were acceptable. This artificial skin has demonstrated to be useful for the definitive treatment of patients with severe skin injuries. This work shows that it is possible to produce this prototype in an hospitalarian laboratory and distribute it to different hospitals across the country.

  15. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    ) vaccinia virus expression of full length cDNAs. These are listed both in alphabetical order and with increasing SSP number, together with their M(r), pI, cellular localization and credit to the investigator(s) that aided in the identification. Furthermore, we list 239 microsequenced proteins recorded......The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... identified (protein name, organelle components, etc.) using one or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry and (v...

  17. Preparation of cultured skin for transplantation using insulin-like growth factor I in conjunction with insulin-like growth factor binding protein 5, epidermal growth factor, and vitronectin.

    Science.gov (United States)

    Dawson, Rebecca A; Upton, Zee; Malda, Jos; Harkin, Damien G

    2006-06-27

    Cultured skin for transplantation is routinely prepared by growing patient keratinocytes in the presence of semidefined sources of growth factors including serum and feeder cells, but these materials require substantial risk remediation and can contribute to transplant rejection. We have therefore investigated the potential of a novel combination of recombinant and purified growth factors to replace serum and feeder cells in cultures of human keratinocytes suitable for clinical application. Our technique was investigated with respect to culture establishment, serial propagation, colony-forming efficiency, immunocytochemistry, epidermal reconstruction, and suitability to support transplantation by aerosolization. We demonstrate that insulin-like growth factor (IGF)-I--used in conjunction with epidermal growth factor (EGF), insulin-like growth factor binding protein (IGFBP)-5 and vitronectin--supports growth in the absence of serum. Moreover, a threefold greater number of cells are generated within 7 days compared to those grown under current best practice conditions using serum (P<0.05). The resulting test cultures are suitable for epidermal reconstruction and support the option for delivery in the form of an aerosolized cell suspension. Serial propagation, with the view to producing confluent sheets for extensive injuries, was achieved but with less consistency and this result correlated with a significant decline in colony-forming efficiency compared to controls. IGF-I used in conjunction with IGFBP-5, EGF, and vitronectin provides a superior alternative to serum for the rapid expansion and transplantation of cultured keratinocytes within the first week of treatment. Nevertheless, further optimization is required with respect to elimination of feeder cells and serial expansion of cultures for treatment of extensive injuries.

  18. Skin Color, Cultural Capital, and Beauty Products: An Investigation of the Use of Skin Fairness Products in Mumbai, India

    Directory of Open Access Journals (Sweden)

    Hemal Shroff

    2018-01-01

    Full Text Available The use of skin fairness products that frequently contain toxic ingredients is associated with significant adverse health side effects. Due to the high prevalence of use in Asian and African countries, skin fairness product use is recognized as a growing public health concern. The multi-million-dollar skin fairness product industry has also been criticized for perpetuating racism and social inequalities by reinforcing beliefs about the benefits of skin fairness for cultural capital. No quantitative studies have assessed people’s beliefs about fairness and reasons for using or not using these products in India, one of the largest global markets for skin fairness products. The current study explored skin fairness product use among 1,992 women and men aged 16–60 years in the city of Mumbai, India using a self-report questionnaire. A total of 37.6% of the sample reported currently using skin fairness products, with women being two times more likely to use these products. Among current users, 17% reported past experiences of adverse side effects, and “Media/TV/Adverts” were the most common prompts for using fairness products, followed by “Friends” and “Family.” Men were significantly more likely than women to endorse beliefs about fairness being more attractive and were more likely to perceive family and peers as viewing fairness as beneficial for cultural capital. There were no differences between women and men currently using products in their desire to look as fair as media celebrities. Among non-users, women were significantly more likely than men to report concerns about product efficacy and side effects as reasons for non-use, while men were significantly more likely to report socioeconomic reasons for non-use. Implications of these findings are discussed in light of growing public health concerns about the use of fairness products, and potential for advocacy and public health interventions to address the use of skin fairness

  19. Skin Color, Cultural Capital, and Beauty Products: An Investigation of the Use of Skin Fairness Products in Mumbai, India.

    Science.gov (United States)

    Shroff, Hemal; Diedrichs, Phillippa C; Craddock, Nadia

    2017-01-01

    The use of skin fairness products that frequently contain toxic ingredients is associated with significant adverse health side effects. Due to the high prevalence of use in Asian and African countries, skin fairness product use is recognized as a growing public health concern. The multi-million-dollar skin fairness product industry has also been criticized for perpetuating racism and social inequalities by reinforcing beliefs about the benefits of skin fairness for cultural capital. No quantitative studies have assessed people's beliefs about fairness and reasons for using or not using these products in India, one of the largest global markets for skin fairness products. The current study explored skin fairness product use among 1,992 women and men aged 16-60 years in the city of Mumbai, India using a self-report questionnaire. A total of 37.6% of the sample reported currently using skin fairness products, with women being two times more likely to use these products. Among current users, 17% reported past experiences of adverse side effects, and "Media/TV/Adverts" were the most common prompts for using fairness products, followed by "Friends" and "Family." Men were significantly more likely than women to endorse beliefs about fairness being more attractive and were more likely to perceive family and peers as viewing fairness as beneficial for cultural capital. There were no differences between women and men currently using products in their desire to look as fair as media celebrities. Among non-users, women were significantly more likely than men to report concerns about product efficacy and side effects as reasons for non-use, while men were significantly more likely to report socioeconomic reasons for non-use. Implications of these findings are discussed in light of growing public health concerns about the use of fairness products, and potential for advocacy and public health interventions to address the use of skin fairness products.

  20. Heterozygous mutations in the tumor suppressor gene PATCHED provoke basal cell carcinoma-like features in human organotypic skin cultures.

    Science.gov (United States)

    Brellier, F; Bergoglio, V; Valin, A; Barnay, S; Chevallier-Lagente, O; Vielh, P; Spatz, A; Gorry, P; Avril, M-F; Magnaldo, T

    2008-11-20

    Basal cell carcinoma of the skin is the most common type of cancer in humans. The majority of these tumors displays aberrant activation of the SONIC HEDGEHOG (SHH)/PATCHED pathway, triggered by mutations in the PATCHED tumor suppressor gene, which encodes a transmembrane receptor of SHH. In this study, we took advantage of the natural genotype (PATCHED(+/-)) of healthy keratinocytes expanded from patients with the nevoid basal cell carcinoma or Gorlin syndrome to mimic heterozygous somatic mutations thought to occur in the PATCHED gene early upon basal cell carcinoma development in the general population. PATCHED(+/-) epidermis developed on a dermal equivalent containing wild-type (WT) PATCHED(+/+) fibroblasts exhibited striking invasiveness and hyperproliferation, as well as marked differentiation impairment. Deciphering the phenotype of PATCHED(+/-) keratinocytes revealed slight increases of the transcriptional activators GLI1 and GLI2-the latter known to provoke basal cell carcinoma-like tumors when overexpressed in transgenic mice. PATCHED(+/-) keratinocytes also showed a substantial increase of the cell cycle regulator cyclin D1. These data show for the first time the physiological impact of constitutive heterozygous PATCHED mutations in primary human keratinocytes and strongly argue for a yet elusive mechanism of haploinsufficiency leading to cancer proneness.

  1. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  2. Anti-degenerative effect of Apigenin, Luteolin and Quercetin on human keratinocyte and chondrocyte cultures: SAR evaluation.

    Science.gov (United States)

    Crascì, Lucia; Cardile, Venera; Longhitano, Giusy; Nanfitò, Francesco; Panico, Annamaria

    2017-11-06

    Background Inflammation is a dynamic process that occur on vascularized tissue in response to different stimuli causing cell injury and tissue degeneration. Reactive oxygen and nitrogen species (ROS and RNS) and advanced glycation end products (AGEs) have a key mediatory role in the development and progression of degenerative tissue process. The bioflavonoids possess a broad-spectrum of pharmacological activities. Their capability is related to their chemical structure. Methods In this study we evaluated and compare antioxidant, anti-glycative and anti-degenerative actions of two flavones apigenin and luteolin and a flavonol quercetin, in function of their hydroxyl groups arrangement. Moreover we assay, on NCTC 2544 and chondrocytes cultures, the flavonoids capacity to modulate NO and glycosamminoglycans levels, index of antidegenerative capacity. Results All tested flavonoids act as free radicals scavengers (ROO • and NO • ) and advanced glycation end products inhibitors, in agreement with their BDE, IP and molecular planarity. Quercetin showed a high ORAC value (2.70±0.12 ORAC Units), according to a low BDE (74.54 Kcal/mol) and IP (174.44 Kcal/mol) values. Luteolin is the most active compound in the NO (48.19±0.18%) and AGEs (60.06±0.52%) inhibition, in function of a low torsion angle (16.3°) between the 3-OH moiety and C'6 carbon atom. Conclusion All tested flavonoids posses a protective role on degenerative tissue events. They acts in different manner depending on the functional groups, the biological substrate and the concentration used. In any case, it can be considered a suitable product preventing a degenerative processes. © Georg Thieme Verlag KG Stuttgart · New York.

  3. Clinical characteristics associated with Borrelia burgdorferi sensu lato skin culture results in patients with erythema migrans.

    Directory of Open Access Journals (Sweden)

    Franc Strle

    Full Text Available Clinical characteristics associated with isolation of Borrelia burgdorferi sensu lato from skin have not been fully evaluated. To gain insight into predictors for a positive EM skin culture, we compared basic demographic, epidemiologic, and clinical data in 608 culture-proven and 501 culture-negative adult patients with solitary EM. A positive Borrelia spp. skin culture was associated with older age, a time interval of >2 days between tick bite and onset of the skin lesion, EM ≥ 5 cm in diameter, and location of the lesion on the extremities, whereas several other characteristics used as clinical case definition criteria for the diagnosis of EM (such as tick bite at the site of later EM, information on expansion of the skin lesion, central clearing were not. A patient with a 15-cm EM lesion had almost 3-fold greater odds for a positive skin culture than patients with a 5-cm lesion. Patients with a free time interval between the tick bite and onset of EM had the same probability of a positive skin culture as those who did not recall a tick bite (OR=1.02; however, the two groups had >3-fold greater odds for EM positivity than patients who reported a tick bite with no interval between the bite and onset of the lesion. In conclusion, several yet not all clinical characteristics used in EM case definitions were associated with positive Borrelia spp. skin culture. The findings are limited to European patients with solitary EM caused predominantly by B. afzelii but may not be valid for other situations.

  4. Clinical characteristics associated with Borrelia burgdorferi sensu lato skin culture results in patients with erythema migrans.

    Science.gov (United States)

    Strle, Franc; Lusa, Lara; Ružić-Sabljić, Eva; Maraspin, Vera; Lotrič Furlan, Stanka; Cimperman, Jože; Ogrinc, Katarina; Rojko, Tereza; Videčnik Zorman, Jerneja; Stupica, Daša

    2013-01-01

    Clinical characteristics associated with isolation of Borrelia burgdorferi sensu lato from skin have not been fully evaluated. To gain insight into predictors for a positive EM skin culture, we compared basic demographic, epidemiologic, and clinical data in 608 culture-proven and 501 culture-negative adult patients with solitary EM. A positive Borrelia spp. skin culture was associated with older age, a time interval of >2 days between tick bite and onset of the skin lesion, EM ≥ 5 cm in diameter, and location of the lesion on the extremities, whereas several other characteristics used as clinical case definition criteria for the diagnosis of EM (such as tick bite at the site of later EM, information on expansion of the skin lesion, central clearing) were not. A patient with a 15-cm EM lesion had almost 3-fold greater odds for a positive skin culture than patients with a 5-cm lesion. Patients with a free time interval between the tick bite and onset of EM had the same probability of a positive skin culture as those who did not recall a tick bite (OR=1.02); however, the two groups had >3-fold greater odds for EM positivity than patients who reported a tick bite with no interval between the bite and onset of the lesion. In conclusion, several yet not all clinical characteristics used in EM case definitions were associated with positive Borrelia spp. skin culture. The findings are limited to European patients with solitary EM caused predominantly by B. afzelii but may not be valid for other situations.

  5. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: rhrice@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  6. Organotypic culture of human skin to study melanocyte migration

    NARCIS (Netherlands)

    Le Poole, I. C.; van den Wijngaard, R. M.; Westerhof, W.; Dormans, J. A.; van den Berg, F. M.; Verkruisen, R. P.; Dingemans, K. P.; Das, P. K.

    1994-01-01

    An ex vivo model system was developed to investigate melanocyte migration. Within this model system, melanocytes migrate among other epidermal cells in the epibolic outgrowth of skin explants. This process is initiated by loss of contact inhibition of epidermal cells at the rim of the explants and

  7. Increased permeability of reconstructed human epidermis from UVB-irradiated keratinocytes.

    Science.gov (United States)

    Löwenau, Lilian Julia; Zoschke, Christian; Brodwolf, Robert; Volz, Pierre; Hausmann, Christian; Wattanapitayakul, Suvara; Boreham, Alexander; Alexiev, Ulrike; Schäfer-Korting, Monika

    2017-07-01

    Extrinsic (photo) aging accelerates chronologically aging in the skin due to cumulative UV irradiation. Despite recent insights into the molecular mechanisms of fibroblast aging, age-related changes of the skin barrier function have been understudied. In contrast, the constantly increasing subpopulation of aged patients causes a clinical need for effective and safe (dermatological) treatment. Herein, we reconstructed human epidermis from UVB-irradiated keratinocytes (UVB-RHE). UVB-irradiated keratinocytes show higher activity of senescence associated β-galactosidase, less cell proliferation, and reduced viability. Higher amounts of β-galactosidase are also detectable in UVB-RHE. Moreover, UVB-RHE release more interleukin-1α and -8 into the culture medium and present altered differentiation with a thinner stratum corneum compared to normal RHE. For the first time, the permeation of testosterone and caffeine through UVB-irradiated RHE indicate a clear influence of the UVB stress on the skin barrier function. Impaired barrier function was confirmed by the increased permeation of testosterone and caffeine as well as by the increased penetration of dendritic core-multishell nanocarriers into the constructs. Taken together, UVB-RHE emulate hallmarks of skin aging and might contribute to an improved non-clinical development of medicinal or cosmetic products. Copyright © 2016. Published by Elsevier B.V.

  8. Stories on the Skin: Tattoo Culture at a South Florida University

    Science.gov (United States)

    Leader, Karen J.

    2015-01-01

    This paper describes a multidisciplinary creative and research project at a South Florida public university. "Stories on the Skin: Tattoo Culture at FAU" has explored and presented tattoos as a shared cultural experience, rather than as a symptom, or a fad. Considering relevant scholarship in various disciplines, tattoo emerges as a…

  9. Protease-activated receptor 2, a receptor involved in melanosome transfer, is upregulated in human skin by ultraviolet irradiation.

    Science.gov (United States)

    Scott, G; Deng, A; Rodriguez-Burford, C; Seiberg, M; Han, R; Babiarz, L; Grizzle, W; Bell, W; Pentland, A

    2001-12-01

    Previous studies have shown that the protease-activated receptor 2 is involved in skin pigmentation through increased phagocytosis of melanosomes by keratinocytes. Ultraviolet irradiation is a potent stimulus for melanosome transfer. We show that protease-activated receptor 2 expression in human skin is upregulated by ultraviolet irradiation. Subjects with skin type I, II, or III were exposed to two or three minimal erythema doses of irradiation from a solar simulator. Biopsies were taken from nonexposed and irradiated skin 24 and 96 h after irradiation and protease-activated receptor 2 expression was detected using immunohistochemical staining. In nonirradiated skin, protease-activated receptor 2 expression was confined to keratinocytes in the lower one-third of the epidermis. After ultraviolet irradiation protease-activated receptor 2 expression was observed in keratinocytes in the upper two-thirds of the epidermis or the entire epidermis at both time points studied. Subjects with skin type I showed delayed upregulation of protease-activated receptor 2 expression, however, compared with subjects with skin types II and III. Irradiated cultured human keratinocytes showed upregulation in protease-activated receptor 2 expression as determined by immunofluorescence microscopy and Western blotting. Cell culture supernatants from irradiated keratinocytes also exhibited a dose-dependent increase in protease-activated receptor-2 cleavage activity. These results suggest an important role for protease-activated receptor-2 in pigmentation in vivo. Differences in protease-activated receptor 2 regulation in type I skin compared with skin types II and III suggest a potential mechanism for differences in tanning in subjects with different skin types.

  10. Correlation between endogenous glutathione content and sensitivity of cultured human skin cells to radiation at defined wavelengths in the solar ultraviolet range

    International Nuclear Information System (INIS)

    Tyrrell, R.M.; Pidoux, M.

    1988-01-01

    Glutathione depletion of cultured human skin fibroblasts by treatment with buthionine-S.R.-sulfoximine (BSO) sensitises them to solar UV radiation. We now show that there is a close quantitative correlation between cellular glutathione content and sensitivity to radiation at 365 nm. A weaker correlation is observed when cells are depleted of glutathione using diethylmaleimide. Both fibroblasts and epidermal keratinocytes derived from the same foreskin biopsy are sensitised to radiation at 313 nm by glutathione depletion. At low to intermediate fluence levels, 10 mM cysteamine present during irradiation at 302 nm is able to almost completely reverse the sensitising effects of glutathione depletion suggesting that the endogenous thiol protects against radiation at this wavelength by a free radical scavenging mechanism. At 313 nm, the sensitisation is not reversed by cysteamine suggesting that glutathione plays a more specific role in protection against radiation at longer wavelengths. Xeroderma pigmentosum group A fibroblasts (excision deficient) are also sensitised to radiation at 313 and 365 nm by depletion of glutathione. The results provide further evidence that endogenous glutathione is involved in protecting human skin cells against a wide range of solar radiation damage. (author)

  11. Caspase-3 activation and DNA damage in pig skin organ culture after solar irradiation.

    Science.gov (United States)

    Bacqueville, Daniel; Mavon, Alain

    2008-01-01

    In the present study, a convenient and easy-to-handle skin organ culture was developed from domestic pig ears using polycarbonate Transwell culture inserts in 12-well plate. This alternative model was then tested for its suitability in analyzing the short-term effects of a single solar radiation dose (from 55 to 275 kJ.m(-2)). Differentiation of the pig skin was maintained for up to 48 h in culture, and its morphology was similar to that of fresh human skin. Solar irradiation induced a significant release of the cytosolic enzymes lactate dehydrogenase and extracellular signal-related kinase 2 protein in the culture medium 24 h after exposure. These photocytotoxic effects were associated with the formation of sunburn cells, thymine dimers and DNA strand breaks in both the epidermis and dermis. Interestingly, cell death was dose dependent and associated with p53 protein upregulation and strong caspase-3 activation in the basal epidermis. None of these cellular responses was observed in non-irradiated skin. Finally, topical application of a broad-spectrum UVB + A sunfilter formulation afforded efficient photoprotection in irradiated explants. Thus, the ex vivo pig ear skin culture may be a useful tool in the assessment of solar radiation-induced DNA damage and apoptosis, and for evaluating the efficacy of sunscreen formulations.

  12. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  13. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  14. Melanin Transferred to Keratinocytes Resides in Nondegradative Endocytic Compartments.

    Science.gov (United States)

    Correia, Maria S; Moreiras, Hugo; Pereira, Francisco J C; Neto, Matilde V; Festas, Tiago C; Tarafder, Abul K; Ramalho, José S; Seabra, Miguel C; Barral, Duarte C

    2018-03-01

    Melanin transfer from melanocytes to keratinocytes and subsequent accumulation in the supranuclear region is a critical process in skin pigmentation and protection against UVR. We have previously proposed that the main mode of transfer between melanocytes and keratinocytes is through exo/endocytosis of the melanosome core, termed melanocore. In this study, we developed an in vitro uptake assay using melanocores secreted by melanocytes. We show that the uptake of melanocores, but not melanosomes, by keratinocytes is protease-activated receptor-2-dependent. Furthermore, we found that the silencing of the early endocytic regulator Rab5b, but not the late endocytic regulators Rab7a or Rab9a, significantly impairs melanocore uptake by keratinocytes. After uptake, we observed that melanin accumulates in compartments that are positive for both early and late endocytic markers. We found that melanin does not localize to either highly degradative or acidic organelles, as assessed by LysoTracker and DQ-BSA staining, despite the abundance of these types of organelles within keratinocytes. Therefore, we propose that melanocore uptake leads to storage of melanin within keratinocytes in hybrid endocytic compartments that are not highly acidic or degradative. By avoiding lysosomal degradation, these specialized endosomes may allow melanin to persist within keratinocytes for long periods. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Reduced Nrf2 activation in PI3K phosphorylation-impaired vitiliginous keratinocytes increases susceptibility to ROS-generating chemical-induced apoptosis.

    Science.gov (United States)

    Kim, Hyangmi; Park, Chang Seo; Lee, Ai-Young

    2017-12-01

    Keratinocytes in affected epidermis of vitiligo patients are known to have impaired activation of the PI3K/AKT pathway. Based on critical roles of keratinocytes and oxidative stress in vitiligo development, this study examined whether keratinocytes with impaired PI3K activation were more vulnerable to apoptosis caused by oxidative stress from phenolic compounds, p-tert-butylphenol (4-TBP) and hydroquinone (HQ). Cell viability assay, FACS analysis, ELISA for TNF-α or IL-1a, ROS assay, Western blot analysis for Nrf2 expression, and confocal microscopy with anti-Nrf2 and phospho-PI3K antibodies were done on primary cultured normal human keratinocytes with or without PI3K knockdown in the presence or absence of chemical treatment or antioxidant. Immunofluorescence staining using anti-Nrf2, phospho-PI3K, TNF-ɑ, and IL-1ɑ antibodies, ROS assay using dihydroethidium, and TUNEL assay were performed on sets of depigmented and normally pigmented skin from vitiligo patients. Results showed that 4-TBP or HQ treatment increased apoptosis and the expression levels of TNF-ɑ, IL-1ɑ, and ROS in PI3K-knockdown keratinocytes which reduced Nrf2 nuclear translocation compared to control keratinocytes. These changes were significantly recovered by an antioxidant treatment. Depigmented epidermis of vitiligo patients also showed lower levels of Nrf2 and phospho-PI3K but higher levels of ROS, TNF-ɑ, IL-1ɑ, and ROS with more TUNEL-positive cells. Therefore, impaired PI3K activation in keratinocytes in depigmented epidermis of vitiligo patients are vulnerable to apoptosis caused by ROS-generating chemicals due to reduced Nrf2 activation. © 2017 Wiley Periodicals, Inc.

  16. Interleukin 7 is produced by murine and human keratinocytes.

    Science.gov (United States)

    Heufler, C; Topar, G; Grasseger, A; Stanzl, U; Koch, F; Romani, N; Namen, A E; Schuler, G

    1993-09-01

    Interleukin 7 (IL-7) was originally identified as a growth factor for B cell progenitors, and subsequently has been shown to exert proliferative effects on T cell progenitors and mature peripheral T cells as well. Constitutive IL-7 mRNA expression so far had been demonstrated in bone marrow stromal cell lines, thymus, spleen, and among nonlymphoid tissues in liver and kidney. Here we show that both murine and human keratinocytes express IL-7 mRNA and release IL-7 protein in biologically relevant amounts. The physiological or pathological relevance of keratinocyte-derived IL-7 is presently unknown. Our finding that keratinocytes can produce IL-7 in concert with reports that IL-7 is a growth factor for in vivo primed antigen-specific T cells, as well as for T lymphoma cells suggests, however, that keratinocyte-derived IL-7 is important in the pathogenesis of inflammatory skin diseases and cutaneous T cell lymphoma.

  17. House Dust Mites Induce Production of Endothelin-1 and Matrix Metalloproteinase-9 in Keratinocytes via Proteinase-Activated Receptor-2 Activation.

    Science.gov (United States)

    Yamada, Yoshihito; Matsumoto, Tatsumi

    2017-01-01

    Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by skin barrier dysfunction and abnormal immune response. House dust mites (HDM) are a major source of allergens, some of which have cysteine and serine protease activities. Keratinocytes stimulated by HDM-derived proteases have been suggested to contribute to the pathogenesis of AD by producing various cytokines. However, whether keratinocytes contribute to the induction of pruritus in AD, especially by producing pruritus-related mediators upon stimulation with HDM-derived proteases, has not been fully elucidated. We examined whether the production of endothelin-1 (ET-1), matrix metalloproteinase (MMP)-2, and MMP-9 in keratinocytes can be induced by stimulation with Dermatophagoides farinae extracts, and if so, whether pretreatment with a protease inhibitor or proteinase-activated receptor-2 (PAR-2) antagonist affects the production of these mediators in keratinocytes. Although MMP-2 levels were undetectable in the culture supernatants, the production of ET-1 and MMP-9 was increased upon stimulation with HDM extracts in a concentration- and time-dependent manner and suppressed by pretreatment of HDM extracts with serine protease inhibitor, but not with cysteine protease inhibitor. Mite-derived serine proteases also induced ET-1 and MMP-9 production in a concentration- and time-dependent manner. Moreover, pretreatment with a PAR-2 antagonist inhibited the production of ET-1 and MMP-9 in keratinocytes. These results suggest that the activation of PAR-2 on keratinocytes by HDM-derived serine proteases induces the production of ET-1 and MMP-9, and may contribute to the induction of pruritus in AD. © 2017 S. Karger AG, Basel.

  18. Methods of epithelial tissue culture in albino rabbit skin

    Directory of Open Access Journals (Sweden)

    Anarluki J

    1998-05-01

    Full Text Available With the intention of research of various methods of epithelial tissue culture we've studied five French Albino rabbits with an average of 8 weeks. In order to evaluate and control growth and proliferation of autologus cultured tissue samples were obtained on 1st, 5th and 8th days. After fixation of these samples and passing them through various processes, histologic sections were prepared. These sections were stained with H-E and studied by light microscope, we succeeded in developing the original donor surface by 18 times.

  19. HaCaT Cells as a Reliable In Vitro Differentiation Model to Dissect the Inflammatory/Repair Response of Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Irma Colombo

    2017-01-01

    Full Text Available Cultured primary human keratinocytes are frequently employed for studies of immunological and inflammatory responses; however, interpretation of experimental data may be complicated by donor to donor variability, the relatively short culture lifetime, and variations between passages. To standardize the in vitro studies on keratinocytes, we investigated the use of HaCaT cells, a long-lived, spontaneously immortalized human keratinocyte line which is able to differentiate in vitro, as a suitable model to follow the release of inflammatory and repair mediators in response to TNFα or IL-1β. Different treatment conditions (presence or absence of serum and differentiation stimuli (increase in cell density as a function of time in culture and elevation of extracellular calcium were considered. ELISA and Multiplex measurement technologies were used to monitor the production of cytokines and chemokines. Taken together, the results highlight that Ca2+ concentration in the medium, cell density, and presence of serum influences at different levels the release of proinflammatory mediators by HaCaT cells. Moreover, HaCaT cells maintained in low Ca2+ medium and 80% confluent are similar to normal keratinocytes in terms of cytokine production suggesting that HaCaT cells may be a useful model to investigate anti-inflammatory interventions/therapies on skin diseases.

  20. Expression of C4.4A in an in Vitro Human Tissue-Engineered Skin Model

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Larouche, Danielle; Rochette-Drouin, Olivier

    2017-01-01

    , the biological function of C4.4A remains unknown. To enable further studies, we evaluated the expression of C4.4A in monolayer cultures of normal human keratinocytes and in tissue-engineered skin substitutes (TESs) produced by the self-assembly approach, which allow the formation of a fully differentiated...

  1. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  2. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway

    International Nuclear Information System (INIS)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-01-01

    Highlights: ► UVB radiated skin keratinocytes show cyclophilin D (Cyp-D) upregulation. ► NAC inhibits UVB induced Cyp-D expression, while H 2 O 2 facilitates it. ► Cyp-D-deficient cells are significantly less susceptible to UVB induced cell death. ► Over-expression of Cyp-D causes spontaneous keratinocytes cell death. -- Abstract: UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H 2 O 2 ) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H 2 O 2 -induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H 2 O 2 -induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D’s critical role in UVB/oxidative stress-induced skin cell death.

  3. Melatonin increases survival of HaCaT keratinocytes by suppressing UV-induced apoptosis.

    Science.gov (United States)

    Fischer, T W; Zbytek, B; Sayre, R M; Apostolov, E O; Basnakian, A G; Sweatman, T W; Wortsman, J; Elsner, P; Slominski, A

    2006-01-01

    Melatonin is a potent antioxidant and direct radical scavenger. As keratinocytes represent the major population in the skin and UV light causes damage to these cells, the possible protective effects of melatonin against UV-induced cell damage in HaCaT keratinocytes were investigated in vitro. Cells were preincubated with melatonin at graded concentrations from 10(-9) to 10(-3) m for 30 min prior to UV irradiation at doses of 25 and 50 mJ/cm2. Biological markers of cellular viability such as DNA synthesis and colony-forming efficiency as well as molecular markers of apoptosis were measured. DNA synthesis was determined by [3H]-thymidine incorporation into insoluble cellular fraction, clonogenicity through plating efficiency experiments and apoptosis by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay. DNA synthesis experiments showed a strong protective effect by preincubation with melatonin at concentrations of 10(-4) m (P UV incubation protective effect. These results indicate that preincubation is a requirement for melatonin to exert its protective effects. The mechanism of melatonin's protective effect (10(-6) to 10(-3) m) includes inhibition of apoptosis as measured by TUNEL assay. Moreover, the biological significance of these effects is supported by clonogenic studies showing a significantly higher number of colonies in cultures treated with melatonin compared to controls. Thus, pretreatment with melatonin led to strong protection against UVB-induced damage in keratinocytes.

  4. Carácterísticas histológicas de piel cultivada in vitro Histological Characteristics Of Skin Culture In Vitro

    Directory of Open Access Journals (Sweden)

    Arango

    2009-12-01

    Full Text Available Los injertos de piel cultivados in vitro han sido utilizados tanto en la regeneración de tejidos de áreas cruentas de la piel (úlceras crónicas y quemaduras de diversos grados, como para el tratamiento de genodermatosis. En nuestro medio existe un alto índice de pacientes con úlceras crónicas y un total de 2319 pacientes quemados, en un período de 10 años. El tratamiento convencional de estos pacientes genera estadías de hospitalización prolongadas y costos hospitalarios muy elevados. En este trabajo se establecieron las condiciones para el cultivo y expansión de queratinocitos y fibroblastos humanos, con el propósito de generar un equivalente cutáneo. A su vez, se evaluaron sus características histológicas con el objeto de ofrecer otras opciones de tratamiento. Las células se obtuvieron a partir de piel proveniente de donantes de órganos y de sobrantes de procedimientos quirúrgicos. Se logró un mayor éxito en la obtención de cultivos primarios, con muestras provenientes de donantes menores de 40 años (65%, comparado con los obtenidos de mayores (33%. En el equivalente cutáneo producido con estas células se demostró que los queratinocitos y los fibroblastos, presentan características funcionales, estructurales y morfológicas semejantes a la piel intacta. El equivalente cutáneo además de conservar las características funcionales y estructurales de la piel intacta, presenta otras ventajas en términos de costos, manipulación y estabilidad frente a otros productos similares importados.In vitro skin culture have been used in the regeneration of skin wound (chronic ulcers and burns, and for genodermatosis treatment. In our country there is a high patient number with chronic ulcers and 2319 burned in a period of 10 years. Conventional treatment generates long hospitalization stays and high costs. We established culture conditions of keratinocytes and fibroblasts expansion, to generate a cutaneous substitute in order to

  5. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  6. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  7. Clinical condition and comorbidity as determinants for blood culture positivity in patients with skin and soft-tissue infections

    NARCIS (Netherlands)

    van Daalen, F. V.; Kallen, M. C.; van den Bosch, C. M. A.; Hulscher, M. E. J. L.; Geerlings, S. E.; Prins, J. M.

    2017-01-01

    The utility of performing blood cultures in patients with a suspected skin infection is debated. We investigated the association between blood culture positivity rates and patients' clinical condition, including acute disease severity and comorbidity. We performed a retrospective study, including

  8. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway.

    Science.gov (United States)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-09-07

    UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H(2)O(2)) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H(2)O(2)-induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H(2)O(2)-induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D's critical role in UVB/oxidative stress-induced skin cell death. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Transduction of the E6 and E7 genes of epidermodysplasia-verruciformis-associated human papillomaviruses alters human keratinocyte growth and differentiation in organotypic cultures

    NARCIS (Netherlands)

    Boxman, I. L.; Mulder, L. H.; Noya, F.; de Waard, V.; Gibbs, S.; Broker, T. R.; ten Kate, F.; Chow, L. T.; ter Schegget, J.

    2001-01-01

    Epidermodysplasia-verruciformis-associated human papilloma virus DNA has been detected in skin cancers, in premalignant and benign skin lesions, and in plucked hairs from immunocompetent and immunosuppressed patients. The role of epidermodysplasia-verruciformis-associated human papilloma virus in

  10. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  11. Altered expression of keratinocyte growth factor and its receptor in psoriasis.

    Science.gov (United States)

    Finch, P W; Murphy, F; Cardinale, I; Krueger, J G

    1997-12-01

    One of the biological characteristics of psoriasis is excessive flaking of the skin. This is directly related to the marked hyperplasia of epidermal keratinocytes and to incomplete epidermal differentiation. Keratinocyte growth factor (KGF), a potent mitogen for human keratinocytes, is expressed by stromal cells. Alterations in the KGF signaling pathway might account for the epidermal hyperplasia associated with psoriasis. To test this hypothesis, we investigated the expression of KGF and its receptor (KGFR) in psoriasis tissue. KGF and KGFR mRNA levels were found to be frequently elevated in psoriatic skin specimens as compared with normal skin. Increased KGF transcript expression was localized to the dermal layer of the involved skin specimen using in situ hybridization. In contrast, KGFR transcript and protein expression was localized to the basal layer of keratinocytes in normal skin and to the basal and suprabasal layers of the psoriatic epidermis, coincident with the expanded proliferative keratinocyte pool. To identify molecules that might regulate KGFR expression we investigated the effects of various pharmacological agents and cytokines on KGFR synthesis by keratinocytes. Phorbol ester, interleukin-6, interferon-gamma, and ultraviolet B (UVB) treatment all led to substantial down-regulation of KGFR expression. The down-regulation of KGFR synthesis by UVB suggests a possible mechanism for the antiproliferative action of this agent in the treatment of psoriasis. Taken together, these results suggest that increased KGFR-mediated signaling in keratinocytes in the lesional epidermis might account in part for the epidermal hyperplasia in psoriasis.

  12. Differential effects of chemical irritants in rabbit and human skin organ cultures

    NARCIS (Netherlands)

    Sandt, J.J.M. van de; Rutten, A.A.J.J.L.

    1995-01-01

    The toxicity of well known irritants was investigated in rabbit and human skin organ cultures. Test chemicals were selected from various categories of irritants and included both water-soluble and water-insoluble compounds. Using a highly standardized protocol, test chemicals were applied topically

  13. Mutations of ATIC and ADSL affect purinosome assembly in cultured skin fibroblasts from patients with AICA-ribosiduria and ADSL deficiency.

    Science.gov (United States)

    Baresova, Veronika; Skopova, Vaclava; Sikora, Jakub; Patterson, David; Sovova, Jana; Zikanova, Marie; Kmoch, Stanislav

    2012-04-01

    The purinosome is a multienzyme complex composed by the enzymes active in de novo purine synthesis (DNPS) that cells transiently assemble in their cytosol upon depletion or increased demand of purines. The process of purinosome formation has thus far been demonstrated and studied only in human epithelial cervical cancer cells (HeLa) and human liver carcinoma cells (C3A) transiently expressing recombinant fluorescently labeled DNPS proteins. Using parallel immunolabeling of various DNPS enzymes and confocal fluorescent microscopy, we proved purinosome assembly in HeLa, human hepatocellular liver carcinoma cell line (HepG2), sarcoma osteogenic cells (Saos-2), human embryonic kidney cells (HEK293), human skin fibroblasts (SF) and primary human keratinocytes (KC) cultured in purine-depleted media. Using the identical approach, we proved in cultured skin fibroblasts from patients with AICA-ribosiduria and ADSL deficiency that various mutations of ATIC and ADSL destabilize to various degrees of purinosome assembly and found that the ability to form purinosomes correlates with clinical phenotypes of individual ADSL patients. Our results thus shown that the assembly of functional purinosomes is fully dependent on the presence of structurally unaffected ATIC and ADSL complexes and presumably also on the presence of all the other DNPS proteins. The results also corroborate the hypothesis that the phenotypic severity of ADSL deficiency is mainly determined by structural stability and residual catalytic capacity of the corresponding mutant ADSL protein complexes, as this is prerequisite for the formation and stability of the purinosome and at least partial channeling of succinylaminoimidazolecarboxamide riboside-ADSL enzyme substrates-through the DNPS pathway.

  14. Clinical application and histological properties of autologous tissue-engineered skin equivalents using an acellular dermal matrix.

    Science.gov (United States)

    Takami, Yoshihiro; Yamaguchi, Ryo; Ono, Shimpei; Hyakusoku, Hiko

    2014-01-01

    We developed a transplantable tissue-engineered skin equivalent composed of autologous cultured keratinocytes, fibroblasts, and a decellularized allogeneic dermis (acellular allogeneic dermal matrix; ADM) obtained from cadavers. In a process taking 3 weeks, cultured autologous keratinocytes from burn patients were expanded and then grown on ADMs. The tissue-engineered autologous skin equivalents (TESEs) were then transplanted in a one-stage procedure to the debrided third-degree burn wounds of 4 patients. The mean graft survival rate was 96%. Delayed graft loss and graft fragility were not observed. Histological and immunohistological findings indicated that the transplanted TESE had similar characteristics to normal human split-thickness skin grafts. These results suggest that the TESE using ADM can be used for permanent repair of full-thickness skin defects.

  15. Dental metal-induced innate reactivity in keratinocytes

    NARCIS (Netherlands)

    Rachmawati, D.; Buskermolen, J.K.; Scheper, R.J.; Gibbs, S.; von Blomberg, B.M.E.; van Hoogstraten, I.M.W.

    2015-01-01

    Gold, nickel, copper and mercury, i.e. four metals frequently used in dental applications, were explored for their capacity to induce innate immune activation in keratinocytes (KC). Due to their anatomical location the latter epithelial cells are key in primary local irritative responses of skin and

  16. Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro

    International Nuclear Information System (INIS)

    Kondo, S.; Hozumi, Y.; Aso, K.

    1990-01-01

    A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect

  17. Skin bioengineering and stem cells for severe burn treatment

    International Nuclear Information System (INIS)

    Lataillade, J.J.; Trouillas, M.; Alexaline, M.; Brachet, M.; Bey, E.; Duhamel, P.; Leclerc, T.; Bargues, L.

    2015-01-01

    Severely burned patients need definitive and efficient wound coverage. The outcome of massive burns has improved with cultured epithelial auto-grafts (CEA). In spite of its fragility, percentage of success, cost of treatment and long-term tendency to contracture, this surgical technique has been developed in some burn centres. The first improvements involved combining CEA and dermis-like substitutes. Cultured skin substitutes provide faster skin closure and satisfying functional results. These methods have been used successfully in massive burns. A second improvement was to enable skin regeneration by using epidermal stem cells. Stem cells can differentiate into keratinocytes, to promote wound repair and to regenerate skin appendages. Human mesenchymal stem cells foster wound healing and were used in cutaneous radiation syndrome. Skin regeneration and tissue engineering methods remain a complex challenge and offer the possibility of new treatment for injured and burned patients. (authors)

  18. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  19. Amarogentin Displays Immunomodulatory Effects in Human Mast Cells and Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Wölfle

    2015-01-01

    Full Text Available Keratinocytes express the bitter taste receptors TAS2R1 and TAS2R38. Amarogentin as an agonist for TAS2R1 and other TAS2Rs promotes keratinocyte differentiation. Similarly, mast cells are known to express bitter taste receptors. The aim of this study was to assess whether bitter compounds display immunomodulatory effects on these immunocompetent cells in the skin, so that they might be a target in chronic inflammatory diseases such as atopic dermatitis and psoriasis. Here, we investigated the impact of amarogentin on substance P-induced release of histamine and TNF-α from the human mast cell line LAD-2. Furthermore, the effect of amarogentin on HaCaT keratinocytes costimulated with TNF-α and histamine was investigated. Amarogentin inhibited in LAD-2 cells substance P-induced production of newly synthesized TNF-α, but the degranulation and release of stored histamine were not affected. In HaCaT keratinocytes histamine and TNF-α induced IL-8 and MMP-1 expression was reduced by amarogentin to a similar extent as with azelastine. In conclusion amarogentin displays immunomodulatory effects in the skin by interacting with mast cells and keratinocytes.

  20. Photo-protective effect of calcipotriol upon skin photoreaction to UVA and UVB

    International Nuclear Information System (INIS)

    Youn, J.I.; Park, B.S.; Chung, J.H.; Lee, J.H.

    1997-01-01

    It has been shown that 1,25-dihydroxyvitamin D 3 has a photo-protective effect against UVB injury in mouse skin and cultured rat keratinocytes by induction of metallothionein (MT). Calcipotriol is a synthetic analogue of 1,25-dihydroxyvitamin D 3 with equi-potent cell regulating properties, but with a lower risk of calcium-related side effects. The aim of the present study was to see whether calcipotriol has a photo-protective property both in vitro and in vivo. We examined the effect of calcipotriol on UV-induced damage of cultured human keratinocytes through a cell viability assay, and measurement of DNA synthesis by cultured keratinocytes, on UV-induced damage of mouse skin and on minimal erythema dose (MED). We found that calcipotriol was protective against UVB-induced reduction in DNA synthetic activity of cultured keratinocytes in relatively low doses (20 and 40 mJ/cm 2 ) of UVB. With photo-testing following application of calcipotriol, five subjects among 10 healthy volunteers and three among six psoriasis patients showed an increase in MED compared with the vehicle-treated site. These findings imply that calcipotriol may be photo-protective and that more extensive studies with various doses of UV irradiation and modes of calcipotriol delivery are required. (au)

  1. Blue light-induced oxidative stress in live skin.

    Science.gov (United States)

    Nakashima, Yuya; Ohta, Shigeo; Wolf, Alexander M

    2017-07-01

    Skin damage from exposure to sunlight induces aging-like changes in appearance and is attributed to the ultraviolet (UV) component of light. Photosensitized production of reactive oxygen species (ROS) by UVA light is widely accepted to contribute to skin damage and carcinogenesis, but visible light is thought not to do so. Using mice expressing redox-sensitive GFP to detect ROS, blue light could produce oxidative stress in live skin. Blue light induced oxidative stress preferentially in mitochondria, but green, red, far red or infrared light did not. Blue light-induced oxidative stress was also detected in cultured human keratinocytes, but the per photon efficacy was only 25% of UVA in human keratinocyte mitochondria, compared to 68% of UVA in mouse skin. Skin autofluorescence was reduced by blue light, suggesting flavins are the photosensitizer. Exposing human skin to the blue light contained in sunlight depressed flavin autofluorescence, demonstrating that the visible component of sunlight has a physiologically significant effect on human skin. The ROS produced by blue light is probably superoxide, but not singlet oxygen. These results suggest that blue light contributes to skin aging similar to UVA. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Isolation and culture of primary adult skin fibroblasts from the Asian elephant (Elephas maximus

    Directory of Open Access Journals (Sweden)

    Puntita Siengdee

    2018-01-01

    Full Text Available Background Primary cultures from Asian elephants (Elephas maximus allow scientists to obtain representative cells that have conserved most of their original characteristics, function, physiology and biochemistry. This technique has thus gained significant importance as a foundation for further cellular, cell biology and molecular research. Therefore, the aim of this study was to describe conditions for the successful establishment of primary adult fibroblasts from Asian elephant carcasses. Methods Ear tissue sample collection from Asian elephant carcasses and our recommendations are given. We describe here a simple modified protocol for successful isolation and maintenance of primary adult fibroblasts from elephant ear skin. Ear samples from each individual (five 3 × 3 cm2 pieces were brought to the laboratory within 3 h after collection, kept in transportation medium at 0–4 °C. The ear tissues were prepared by a combination of 10% collagenase type II digestion procedure together with a simple explant procedure. Primary fibroblasts were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM with 20% fetal calf serum (FCS in a humidified atmosphere containing 5% CO2. After the third passage, fibroblasts were routinely trypsinized with 0.25% trypsin/EDTA and cultured in DMEM with 10% FCS at 37 °C and 5% CO2. Traditional cell counting method was used to measure cell viability and growth curve. Long-term storage of cells used freezing medium consisting of 40% FCS (v/v. Results We explored the most suitable conditions during sample collection (post-mortem storage time and sample storage temperature, which is the most important step in determining primary outgrowth. Our study successfully established and cultured primary adult skin fibroblasts obtained from post-mortem E. maximus ear skin tissues from six carcasses, with a success rate of around 83.3%. Outgrowth could be seen 4–12 days after explantation, and epithelial

  3. Construction of a Three-Dimensional in vitro skin model on polycaprolactone fibers.

    Science.gov (United States)

    Liu, Qi; Zhang, Ru-Zhi; Xu, Bin

    2017-05-16

    To observe the morphological characteristics and the biological properties of human epidermal cells when cultured at an air-liquid interface in polycaprolactone (PCL) fibers as a three-dimensional scaffold for tissue engineering. In this study, the melanocytes and keratinocytes were obtained from human scalp skin, seeded onto a PCL film, and cocultured for 2 weeks to construct a three-dimensional (3D) skin model. The cells were then characterized by hematoxylin and eosin (H&E) staining, by immunohistochemical staining with antibodies to cytokeratin 15 (CK15), Ki-67, CD34, CD200 and HMB45 and by transmission electron microscopy. Keratinocytes and melanocytes grew well in the co-culture system. Hematoxylin and eosin staining revealed that the cells adhered to the PCLfiber scaffold well, the keratinocyte layer became a multilayered concentric structure and the surface became distinctly keratinized at the air-liquid interface. Immunohistochemical analyses exhibited a scattered distribution of cells expressing CK15, CD34, CD200, Ki-67 and/or HMB45. Transmission electron microscopy revealed that the keratinocytes contained a number of keratin fibrils and membrane-coated granules. The PCL scaffold has excellent adhesiveness and biocompatibility with human epidermal cells, and is suitable for constructing 3D skin models for tissue engineering in the future.

  4. Antibodies against keratinocyte antigens other than desmogleins 1 and 3 can induce pemphigus vulgaris–like lesions

    Science.gov (United States)

    Nguyen, Vu Thuong; Ndoye, Assane; Shultz, Leonard D.; Pittelkow, Mark R.; Grando, Sergei A.

    2000-01-01

    Pemphigus is an autoimmune disease of skin adhesion associated with autoantibodies against a number of keratinocyte antigens, such as the adhesion molecules desmoglein (Dsg) 1 and 3 and acetylcholine receptors. The notion that anti-Dsg antibodies alone are responsible for blisters in patients with pemphigus vulgaris (PV) stems from the ability of rDsg1 and rDsg3 to absorb antibodies that cause PV-like skin blisters in neonatal mice. Here, we demonstrate that PV IgGs eluted from rDsg1-Ig-His and rDsg3-Ig-His show similar antigenic profiles, including the 38-, 43-, 115-, and 190-kDa keratinocyte proteins and a non–Dsg 3 130-kDa polypeptide present in keratinocytes from Dsg 3 knockout mouse. We injected into Dsg 3–lacking mice the PV IgGs that did not cross-react with the 160-kDa Dsg 1 or its 45-kDa immunoreactive fragment and that showed no reactivity with recombinant Dsg 1. We used both the Dsg3null mice with a targeted mutation of the Dsg3 gene and the “balding” Dsg3bal/Dsg3bal mice that carry a spontaneous null mutation in Dsg3. These PV IgGs caused gross skin blisters with PV-like suprabasal acantholysis and stained perilesional epidermis in a fishnet-like pattern, indicating that the PV phenotype can be induced without anti–Dsg 3 antibody. The anti–Dsg 1 antibody also was not required, as its presence in PV IgG does not alter the PV-like phenotype in skin organ cultures and because pemphigus foliaceus IgGs produce a distinct phenotype in Dsg3null mice. Therefore, mucocutaneous lesions in PV patients could be caused by non-Dsg antibodies. PMID:11120754

  5. Cultural competency, race, and skin tone bias among pharmacy, nursing, and medical students: implications for addressing health disparities.

    Science.gov (United States)

    White-Means, Shelley; Zhiyong Dong; Hufstader, Meghan; Brown, Lawrence T

    2009-08-01

    The Institute of Medicine report, Unequal Treatment, asserts that conscious and unconscious bias of providers may affect treatments delivered and contribute to health disparities. The primary study objective is to measure, compare, and contrast objective and subjective cognitive processes among pharmacy, nursing, and medical students to discern potential implications for health disparities. Data were collected using a cultural competency questionnaire and two implicit association tests (IATs). Race and skin tone IATs measure unconscious bias. Cultural competency scores were significantly higher for non-Hispanic Blacks and Hispanics in medicine and pharmacy compared with non-Hispanic Whites. Multiracial nursing students also had significantly higher cultural competency scores than non-Hispanic Whites. The IAT results indicate that these health care preprofessionals exhibit implicit race and skin tone biases: preferences for Whites versus Blacks and light skin versus dark skin. Cultural competency curricula and disparities research will be advanced by understanding the factors contributing to cultural competence and bias.

  6. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  7. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  8. The caspase-1 inhibitor CARD18 is specifically expressed during late differentiation of keratinocytes and its expression is lost in lichen planus.

    Science.gov (United States)

    Qin, Haihong; Jin, Jiang; Fischer, Heinz; Mildner, Michael; Gschwandtner, Maria; Mlitz, Veronika; Eckhart, Leopold; Tschachler, Erwin

    2017-08-01

    CARD18 contains a caspase recruitment domain (CARD) via which it binds to caspase-1 and thereby inhibits caspase-1-mediated activation of the pro-inflammatory cytokine interleukin (IL)-1β. To determine the expression profile and the role of CARD18 during differentiation of keratinocytes and to compare the expression of CARD18 in normal skin and in inflammatory skin diseases. Human keratinocytes were induced to differentiate in monolayer and in 3D skin equivalent cultures. In some experiments, CARD18-specific siRNAs were used to knock down expression of CARD18. CARD18 mRNA levels were determined by quantitative real-time PCR, and CARD18 protein was detected by Western blot and immunofluorescence analyses. In situ expression was analyzed in skin biopsies obtained from healthy donors and patients with psoriasis and lichen planus. CARD18 mRNA was expressed in the epidermis at more than 100-fold higher levels than in any other human tissue. Within the epidermis, CARD18 was specifically expressed in the granular layer. In vitro CARD18 was strongly upregulated at both mRNA and protein levels in keratinocytes undergoing terminal differentiation. In skin equivalent cultures the expression of CARD18 was efficiently suppressed by siRNAs without impairing stratum corneum formation. Epidermal expression of CARD18 was increased after ultraviolet (UV)B irradiation of skin explants. In skin biopsies of patients with psoriasis no consistent regulation of CARD18 expression was observed, however, in lesional epidermis of patients with lichen planus, CARD18 expression was either greatly diminished or entirely absent whereas in non-lesional areas expression was comparable to normal skin. Our results identify CARD18 as a differentiation-associated keratinocyte protein that is altered in abundance by UV stress. Its downregulation in lichen planus indicates a potential role in inflammatory reactions of the epidermis in this disease. Copyright © 2017 Japanese Society for Investigative

  9. Abnormal phenotype of cultured fibroblasts in human skin with chronic radiotherapy damage

    International Nuclear Information System (INIS)

    Delanian, S.; Martin, M.; Lefaix, J.-L.; Bravard, A.; Luccioni, C.

    1998-01-01

    Purpose: The pathophysiological aspects of radiation-induced fibrosis (RIF) have not been well characterized. We therefore cultured human fibroblasts from samples of skin with RIF to investigate the long-term effects of therapeutic irradiation. Materials and methods: Biopsies of normal and RIF skin were obtained from patients previously irradiated for cancer, without recurrence. Cells were extracted from dermis samples by the outgrowth technique, seeded as monolayers and cultured at confluence. Enzyme activities and proteins were assayed, RNA was isolated and Northern blot analysis was performed on surviving cells between passages 2 and 5. Results: RIF cell cultures displayed heterogeneous fibroblasts populations. The initial outgrowth consisted of one-third small cells that floated rapidly, one-third spindle-shaped cells migrating far from the explant to form islets and one-third large pleiomorphic cells. In subsequent subcultures, surviving cells exhibited either myofibroblastic characteristics with a normal proliferative capacity or senescent morphology with a reduced proliferative capacity. These RIF cells had a brief finite lifespan, with dramatically reduced growth rate during their initial outgrowth and the following passages. Study of the antioxidant metabolism showed that Mn superoxide dismutase and catalase activities were significantly weaker in surviving RIF cells than healthy fibroblasts. These exhausted RIF cells exhibited no overexpression of transforming growth factor β or tissue inhibitor of metalloproteinase. Conclusion: Irradiation may lead to apparently contradictory effects such as fibrosis and necrosis in clinical practice. In cell culture, we observed two main cellular phenotypes which may be related to both processes, i.e. myofibroblast-like cells and fibrocyte-like cells. These two phenotypes may represent two steps in the differentiation induced as a long-term effect of therapeutic irradiation of the skin. Cell culture probably

  10. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  11. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients.

    Science.gov (United States)

    Elango, Tamilselvi; Thirupathi, Anand; Subramanian, Swapna; Ethiraj, Purushoth; Dayalan, Haripriya; Gnanaraj, Pushpa

    2017-08-01

    Psoriasis is a chronic inflammatory skin disease characterized by hyper proliferation of keratinocytes. Recent data show that the epidermis thickening in psoriasis may be related to imbalance of homeostasis caused by abnormal apoptotic process. Maintenance of keratinocyte apoptotic process is very important in psoriasis. Methotrexate (MTX) has been used for many years to restore the normal skin in psoriasis condition. However, the exact mechanism of MTX in psoriasis condition is poorly understood. The aim of this study was to examine the role of MTX on keratinocyte apoptosis pathway in psoriasis patients. A total of 58 psoriasis vulgaris patients were recruited for this study. Nonlesional skin biopsies served as control. Skin biopsies of psoriatic patients were collected and analyzed for cytosolic, mitochondria and total cytochrome c by ELISA. Expression of caspase-9, NFκBp65, pAkt1 by western blot, real-time PCR and immunohistochemical analysis of c-FLIP protein was analyzed in nonlesional and lesional skin biopsies before (day 0) and after (at the end of 6 and 12 weeks) MTX treatment. After MTX treatment, a significant increase in cytochrome c was observed when compared with before MTX treatment in psoriasis patients (p psoriasis by controlling the acanthosis.

  12. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  13. Hyaluronate fragments reverse skin atrophy by a CD44-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Gürkan Kaya

    2006-12-01

    Full Text Available BACKGROUND: Skin atrophy is a common manifestation of aging and is frequently accompanied by ulceration and delayed wound healing. With an increasingly aging patient population, management of skin atrophy is becoming a major challenge in the clinic, particularly in light of the fact that there are no effective therapeutic options at present. METHODS AND FINDINGS: Atrophic skin displays a decreased hyaluronate (HA content and expression of the major cell-surface hyaluronate receptor, CD44. In an effort to develop a therapeutic strategy for skin atrophy, we addressed the effect of topical administration of defined-size HA fragments (HAF on skin trophicity. Treatment of primary keratinocyte cultures with intermediate-size HAF (HAFi; 50,000-400,000 Da but not with small-size HAF (HAFs; 400,000 Da induced wild-type (wt but not CD44-deficient (CD44-/- keratinocyte proliferation. Topical application of HAFi caused marked epidermal hyperplasia in wt but not in CD44-/- mice, and significant skin thickening in patients with age- or corticosteroid-related skin atrophy. The effect of HAFi on keratinocyte proliferation was abrogated by antibodies against heparin-binding epidermal growth factor (HB-EGF and its receptor, erbB1, which form a complex with a particular isoform of CD44 (CD44v3, and by tissue inhibitor of metalloproteinase-3 (TIMP-3. CONCLUSIONS: Our observations provide a novel CD44-dependent mechanism for HA oligosaccharide-induced keratinocyte proliferation and suggest that topical HAFi application may provide an attractive therapeutic option in human skin atrophy.

  14. Protective effect of silk lutein on ultraviolet B-irradiated human keratinocytes

    Directory of Open Access Journals (Sweden)

    Sutatip Pongcharoen

    2013-01-01

    Full Text Available Carotenoids are efficient antioxidants that are of great importance for human health. Lutein and zeaxanthin are carotinoids present in high concentrations in the human retina which are involved in the photoprotection of the human eye. Lutein may also protect the skin from ultraviolet (UV-induced damage. The present study investigated the protective effect of lutein extracted from yellow silk cocoons of Bombyx mori on human keratinocytes against UVB irradiation. A human keratinocyte cell line and primary human keratinocytes were used to investigate the UVB protection effects of silk lutein and plant lutein. Silk lutein showed no cytotoxicity to keratinocytes. Treatment with silk lutein prior to UVB irradiation enhanced cell viability and cell proliferation, and reduced cell apoptosis. The protective effects of silk lutein may be superior to those of plant lutein. Silk lutein may have a benefit for protection of keratinocytes against UVB-irradiation.

  15. Secretion of wound healing mediators by single and bi-layer skin substitutes.

    Science.gov (United States)

    Maarof, Manira; Law, Jia Xian; Chowdhury, Shiplu Roy; Khairoji, Khairul Anuar; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2016-10-01

    Limitations of current treatments for skin loss caused by major injuries leads to the use of skin substitutes. It is assumed that secretion of wound healing mediators by these skin substitutes plays a role in treating skin loss. In our previous study, single layer keratinocytes (SK), single layer fibroblast (SF) and bilayer (BL; containing keratinocytes and fibroblasts layers) skin substitutes were fabricated using fibrin that had shown potential to heal wounds in preclinical studies. This study aimed to quantify the secretion of wound healing mediators, and compare between single and bi-layer skin substitutes. Skin samples were digested to harvest fibroblasts and keratinocytes, and expanded to obtain sufficient cells for the construction of skin substitutes. Acellular fibrin (AF) construct was used as control. Substitutes i.e. AF, SK, SF and BL were cultured for 2 days, and culture supernatant was collected to analyze secretion of wound healing mediators via multiplex ELISA. Among 19 wound healing mediators tested, BL substitute secreted significantly higher amounts of CXCL1 and GCSF compared to SF and AF substitute but this was not significant with respect to SK substitute. The BL substitute also secreted significantly higher amounts of CXCL5 and IL-6 compared to other substitutes. In contrast, the SK substitute secreted significantly higher amounts of VCAM-1 compared to other substitutes. However, all three skin substitutes also secreted CCL2, CCL5, CCL11, GM-CSF, IL8, IL-1α, TNF-α, ICAM-1, FGF-β, TGF-β, HGF, VEGF-α and PDGF-BB factors, but no significant difference was seen. Secretion of these mediators after transplantation may play a significant role in promoting wound healing process for the treatment of skin loss.

  16. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  17. Repair of the three main types of bipyrimidine DNA photoproducts in human keratinocytes exposed to UVB and UVA radiations.

    Science.gov (United States)

    Courdavault, Sophie; Baudouin, Caroline; Charveron, Marie; Canguilhem, Bruno; Favier, Alain; Cadet, Jean; Douki, Thierry

    2005-07-12

    Induction of DNA damage by solar UV radiation is a key event in the development of skin cancers. Bipyrimidine photoproducts, including cyclobutane pyrimidine dimers (CPDs), (6-4) photoproducts (64 PPs) and their Dewar valence isomers, have been identified as major UV-induced DNA lesions. In order to identify the predominant and most persistent lesions, we studied the repair of the three types of photolesions in primary cultures of human keratinocytes. Specific and quantitative data were obtained using HPLC associated with tandem mass spectrometry. As shown in other cell types, 64 PPs are removed from UVB-irradiated keratinocytes much more efficiently than CPDs. In contrast, CPDs are still present in high amounts when cells recover their proliferation capacities after cell cycle arrest and elimination of a part of the population by apoptosis. The predominance of CPDs is still maintained when keratinocytes are exposed to a combination of UVB and UVA. Under these conditions, 64 PPs are converted into their Dewar valence isomers that are as efficiently repaired as their (6-4) precursors. Exposure of cells to pure UVA radiation generates thymine cyclobutane dimers that are slightly less efficiently repaired than CPDs produced upon UVB irradiation. Altogether, our results show that CPDs are the most frequent and the less efficiently repaired bipyrimidine photoproducts irrespectively of the applied UV treatment.

  18. N-Acetyl-D-glucosamine oligosaccharides induce mucin secretion from colonic tissue and induce differentiation of human keratinocytes.

    Science.gov (United States)

    Deters, Alexandra; Petereit, Frank; Schmidgall, Jörg; Hensel, Andreas

    2008-02-01

    Chitin oligosaccharides (DP2, DP3, DP4, DP5 and DP7) were investigated for their effects on epithelial cells and tissue (skin keratinocytes in-vitro and ex-vivo, and gastrointestinal epithelial membranes exvivo). Oligomers DP2, DP3 and DP5 at 10microg mL(-1) significantly stimulated the mitochondrial activity of cultured keratinocytes in-vitro (primary cells and HaCaT cell line), with highest activity observed for the pentamer (150% of untreated control). The effects were dose dependent. This higher energy status of primary cells was triggered into a higher differentiation status, as determined by the early and late differentiation markers keratins K1/K10 and involucrin, respectively. In contrast, increased mitogenic cell proliferation was not induced by the oligosaccharides. Toxic effects on keratinocytes were absent. Additionally for the first time a mucin-stimulating effect of chitin oligosaccharides DP3 and DP5 was observed in an ex-vivo model based on intestinal epithelial mucosa tissue. Mucin secretion was time dependent, leading to the secretion of polymers comparable to those normally secreted under physiological conditions. Mucin induction was observed from colonic tissue isolated from humans and pigs. Also, porcine stomach mucosa was stimulated by DP5, while ileum tissue reacted to only a minor extent. Potential developments towards products with wound-healing capacity and activity against chronic bowel disease are discussed.

  19. Essential role of RAB27A in determining constitutive human skin color.

    Directory of Open Access Journals (Sweden)

    Yasuko Yoshida-Amano

    Full Text Available Human skin color is predominantly determined by melanin produced in melanosomes within melanocytes and subsequently distributed to keratinocytes. There are many studies that have proposed mechanisms underlying ethnic skin color variations, whereas the processes involved from melanin synthesis in melanocytes to the transfer of melanosomes to keratinocytes are common among humans. Apart from the activities in the melanogenic rate-limiting enzyme, tyrosinase, in melanocytes and the amounts and distribution patterns of melanosomes in keratinocytes, the abilities of the actin-associated factors in charge of melanosome transport within melanocytes also regulate pigmentation. Mutations in genes encoding melanosome transport-related molecules, such as MYO5A, RAB27A and SLAC-2A, have been reported to cause a human pigmentary disease known as Griscelli syndrome, which is associated with diluted skin and hair color. Thus we hypothesized that process might play a role in modulating skin color variations. To address that hypothesis, the correlations of expression of RAB27A and its specific effector, SLAC2-A, to melanogenic ability were evaluated in comparison with tyrosinase, using human melanocytes derived from 19 individuals of varying skin types. Following the finding of the highest correlation in RAB27A expression to the melanogenic ability, darkly-pigmented melanocytes with significantly higher RAB27A expression were found to transfer significantly more melanosomes to keratinocytes than lightly-pigmented melanocytes in co-culture and in human skin substitutes (HSSs in vivo, resulting in darker skin color in concert with the difference observed in African-descent and Caucasian skins. Additionally, RAB27A knockdown by a lentivirus-derived shRNA in melanocytes concomitantly demonstrated a significantly reduced number of transferred melanosomes to keratinocytes in co-culture and a significantly diminished epidermal melanin content skin color intensity (

  20. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Directory of Open Access Journals (Sweden)

    Xiuju Dai

    Full Text Available Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal.

  1. Development of Transgenic Cloned Pig Models of Skin Inflammation by DNA Transposon-Directed Ectopic Expression of Human β1 and α2 Integrin

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Madsen, Johannes; Primo, Maria Nascimento; Li, Juan; Liu, Ying; Kragh, Peter M.; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Svensson, Lars; Petersen, Thomas K.; Callesen, Henrik; Bolund, Lars; Mikkelsen, Jacob Giehm

    2012-01-01

    Integrins constitute a superfamily of transmembrane signaling receptors that play pivotal roles in cutaneous homeostasis by modulating cell growth and differentiation as well as inflammatory responses in the skin. Subrabasal expression of integrins α2 and/or β1 entails hyperproliferation and aberrant differentiation of keratinocytes and leads to dermal and epidermal influx of activated T-cells. The anatomical and physiological similarities between porcine and human skin make the pig a suitable model for human skin diseases. In efforts to generate a porcine model of cutaneous inflammation, we employed the Sleeping Beauty DNA transposon system for production of transgenic cloned Göttingen minipigs expressing human β1 or α2 integrin under the control of a promoter specific for subrabasal keratinocytes. Using pools of transgenic donor fibroblasts, cloning by somatic cell nuclear transfer was utilized to produce reconstructed embryos that were subsequently transferred to surrogate sows. The resulting pigs were all transgenic and harbored from one to six transgene integrants. Molecular analyses on skin biopsies and cultured keratinocytes showed ectopic expression of the human integrins and localization within the keratinocyte plasma membrane. Markers of perturbed skin homeostasis, including activation of the MAPK pathway, increased expression of the pro-inflammatory cytokine IL-1α, and enhanced expression of the transcription factor c-Fos, were identified in keratinocytes from β1 and α2 integrin-transgenic minipigs, suggesting the induction of a chronic inflammatory phenotype in the skin. Notably, cellular dysregulation obtained by overexpression of either β1 or α2 integrin occurred through different cellular signaling pathways. Our findings mark the creation of the first cloned pig models with molecular markers of skin inflammation. Despite the absence of an overt psoriatic phenotype, these animals may possess increased susceptibility to severe skin damage

  2. Histamine effect on melanocyte proliferation and vitiliginous keratinocyte survival.

    Science.gov (United States)

    Kim, Nan-Hyung; Lee, Ai-Young

    2010-12-01

    Repigmention of vitiligo requires melanocyte proliferation and migration. Keratinocytes have been shown to play a role in this process. Data from this laboratory showed that bee venom (BV) stimulated melanocyte proliferation and migration as well as melanogenesis. As histamine release is associated with BV, its effect on melanocyte proliferation and migration was examined. Cultured normal human melanocytes treated with histamine were studied with and without receptor-specific antagonists or agonists. The effect of histamine on vitiliginous keratinocytes, in cultured cells treated with a PI3K inhibitor in the presence of TNF-α, was also examined. Histamine exerted a more significant effect on melanocyte proliferation than on melanogenesis. This occurred through the H2 receptor with complex signalling to ERK, CREB, and Akt activation, which stimulated melanocyte migration. Histamine and the H2 receptor agonist also increased survival of vitiliginous, but not normal, keratinocytes, with NF-κB activation. Because expression levels of the H2 receptor was significantly decreased in depigmented compared to normally pigmented epidermis, in patients with vitiligo, histamine may increase the survival of vitiliginous keratinocytes. Overall, histamine stimulated the proliferation and migration of melanocytes and the vitiliginous keratinocyte survival, providing the basis for novel therapeutic approaches to vitiligo repigmentation. © 2010 John Wiley & Sons A/S.

  3. Visualization of the melanosome transfer-inhibition in a mouse epidermal cell co-culture model.

    Science.gov (United States)

    Kim, Hae Jong; Kazi, Julhash U; Lee, You-Ree; Nguyen, Dung H; Lee, Hyang-Bok; Shin, Jeong-Hyun; Soh, Jae-Won; Kim, Eun-Ki

    2010-02-01

    Transfer of melanin-containing melanosomes from melanocytes to neighboring keratinocytes results in skin pigmentation. To provide a more practical method of visualizing melanosomes in melanocytes as well as in keratinocytes, we attempted to use murine cell lines instead of human primary cells. We generated various fluorescent fusion proteins of tyrosinase, a melanin synthesis enzyme located in the melanosome, by using green fluorescent protein and red fluorescent protein. The intracellular localization of tyrosinase was then examined by fluorescence and confocal microscopy. Co-culture of murine melanocytes and keratinocytes was optimized and melanosome transfer was either stimulated with alphaMSH or partially inhibited by niacinamide. To the best of our knowledge, this is the first study showing that a murine co-culture model, in addition to human primary cell co-culture, can be a good tool for depigmenting agent screening by monitoring melanosome transfer.

  4. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays an import...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....... an important role in modulating the interferon (IFN) response in skin. These RAC1 mutant mice showed increased sensitivity in an irritant contact dermatitis model, abnormal keratinocyte differentiation, and increased expression of immune response genes including the IFN signal transducer STAT1. Loss of RAC1......Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...

  5. Cultured Human Epidermis Combined With Meshed Skin Autografts Accelerates Epithelialization and Granulation Tissue Formation in a Rat Model.

    Science.gov (United States)

    Sakamoto, Michiharu; Morimoto, Naoki; Inoie, Masukazu; Takahagi, Miki; Ogino, Shuichi; Jinno, Chizuru; Suzuki, Shigehiko

    2017-06-01

    As the take rate of cultured epidermal autografts in burn wound treatment is variable, widely expanded meshed auto skin grafts are often used in combination with cultured epidermal autograft to increase the take rate and achieve definitive wound coverage. However, a long time (3-4 weeks) required to prepare a cultured epidermis sheet is a disadvantage. Allogeneic cultured epidermis can be prepared in advance and cryopreserved to be used in combination with auto meshed skin grafts for treating third-degree burns. Nevertheless, the human cultured epidermis (hCE) has not been proved to accelerate wound healing after meshed skin grafting. Here, we investigated the effect of hCE on wound healing in a rat model of meshed skin grafting. Human cultured epidermis was prepared from human neonatal foreskin and assessed by the release of growth factors into the culture medium using enzyme-linked immunosorbent assay. Skin wounds were inflicted on male F344 rats and treated by the application of widely meshed (6:1 ratio) autogenous skin grafts with or without hCE (n = 8 rats per group). Wound area, neoepithelium length, granulation tissue formation, and neovascularization were evaluated on day 7 postgrafting. Human cultured epidermis secreted IL-1α, Basic fibroblast growth factor, platelet-derived growth factor-AA, TGF-α, TGF-β1, and vascular endothelial growth factor in vitro. In rats, hCE accelerated wound closure (P = 0.003), neoepithelium growth (P = 0.019), and granulation tissue formation (P = 0.043), and increased the number of capillaries (P = 0.0003) and gross neovascularization area (P = 0.008) compared with the control group. The application of hCE with meshed grafts promoted wound closure, possibly via secretion of growth factors critical for cell proliferation and migration, suggesting that hCE can enhance the healing effect of widely expanded skin autografts.

  6. Resistance to 1,25-dihydroxyvitamin D. Association with heterogeneous defects in cultured skin fibroblasts

    International Nuclear Information System (INIS)

    Liberman, U.A.; Eil, C.; Marx, S.J.

    1983-01-01

    The authors evaluated the interaction of [ 3 H]1,25(OH) 2 D3 with skin fibroblasts cultured from normal subjects or from affected members of six kindreds with rickets and resistance to 1-alpha, 25(OH) 2 D [1,25(OH) 2 D]. They analyzed two aspects of the radioligand interaction; nuclear uptake with dispersed, intact cells at 37 degrees C and binding at 0 degrees C with soluble extract (cytosol) prepared from cells disrupted in buffer. With normal fibroblasts the affinity and capacity of nuclear uptake of [ 3 H]1,25(OH) 2 D3 were 0.5 nM and 10,300 sites per cell, respectively; for binding with cytosol these were 0.13 nM and 8,900 sites per cell, respectively. The following four patterns of interaction with [ 3 H]1,25(OH) 2 D3 were observed with cells cultured from affected patients. In all cases where the radioligand bound with high affinity in nucleus or cytosol, the nucleus- or cytosol-associated radioligand exhibited normal sedimentation velocity on sucrose density gradients. When two kindreds exhibited similar patterns (i.e. pattern a or c) with the analyses of cultured fibroblasts, clinical features in affected members suggested that the underlying genetic defects were not identical. In conclusion: (a) Fibroblasts cultured from human skin manifest nuclear uptake and cytosol binding of [ 3 H]1,25(OH) 2 D3 that is an expression of the genes determining these processes in target tissues. (b) Based upon data from clinical evaluations and from analyses of cultured fibroblasts, severe resistance to 1,25(OH) 2 D resulted from five or six distinct genetic mutations in six kindreds

  7. Histamine enhances keratinocyte-mediated resolution of inflammation by promoting wound healing and response to infection.

    Science.gov (United States)

    Gutowska-Owsiak, D; Selvakumar, T A; Salimi, M; Taylor, S; Ogg, G S

    2014-03-01

    The role of the epidermis in the immune response is well known. While multiple cytokines are implicated in keratinocyte-mediated infection clearance and wound healing, little is known about the involvement of keratinocytes in promoting resolution of inflammation. To assess effects of histamine stimulation on keratinocyte function. We performed a combined microarray/Gene Ontology analysis of histamine-stimulated keratinocytes. Functional changes were tested by apoptosis assessment and scratch assays. Histamine receptor involvement was also assessed by blocking wound closure with specific antagonists. Histamine treatment had extensive effects on keratinocytes, including effects on proinflammatory responses and cellular functions promoting wound healing. At the functional level, there was reduced apoptosis and enhancement of wound healing in vitro. At the receptor level, we identified involvement of all keratinocyte-expressed histamine receptors (HRHs), with HRH1 blockage resulting in the most prominent effect. Histamine activates wound healing and infection clearance-related functions of keratinocytes. While enhancement of histamine-mediated wound healing is mediated predominantly via the HRH1 receptor, other keratinocyte-expressed receptors are also involved. These effects could promote resolution of skin inflammation caused by infection or superficial injury. © 2014 British Association of Dermatologists.

  8. LABELLING DIFFERENT SKIN COLOR AS CULTURAL DETERMINISM REPRESENTED IN MAYA ANGELOU‘S POEM THE CALLING OF NAMES

    Directory of Open Access Journals (Sweden)

    Mohamad Ikhwan Rosyidi

    2017-12-01

    Full Text Available The aim of this study is to describe representation of labelling different color skin as a construction of American towards color skin people in America reflected on one of Maya Angelou‘s poems The Calling of Names (1994. This study will use structural-semiotic approach, especially applying Riffaterre‘s semiotics of poetry (1984. This semiotic theory will operate on heuristic and hermeneutic readings for uncovering description of representation of how color skin people is perceived and, of course, labelled as different people by white people. This labelling performance for color skin people results, first, the acts of calling particular name of people which raises racism on different skin colour, second, racism, prejudice, discrimination which leads to bias and disparity creating inequity and inequality towards Black or Coloured people in American society and long continuum of labelling different skin colour as a result of cultural determninism in American Society.

  9. Minoxidil specifically decreases the expression of lysine hydroxylase in cultured human skin fibroblasts.

    Science.gov (United States)

    Hautala, T; Heikkinen, J; Kivirikko, K I; Myllylä, R

    1992-01-01

    The levels of lysine hydroxylase protein and the levels of the mRNAs for lysine hydroxylase and the alpha- and beta-subunits of proline 4-hydroxylase were measured in cultured human skin fibroblasts treated with 1 mM-minoxidil. The data demonstrate that minoxidil decreases the amount of lysine hydroxylase protein, this being due to a decrease in the level of lysine hydroxylase mRNA. The effect of minoxidil appears to be highly specific, as no changes were observed in the amounts of mRNAs for the alpha- and beta-subunits of proline 4-hydroxylase. Images Fig. 1. Fig. 2. Fig. 3. PMID:1314568

  10. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  11. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  12. Marker profiling of normal keratinocytes identifies the stroma from squamous cell carcinoma of the oral cavity as a modulatory microenvironment in co-culture

    Czech Academy of Sciences Publication Activity Database

    Lacina, L.; Dvořánková, B.; Smetana Jr, K.; Chovanec, M.; Plzák, J.; Tachezy, R.; Kideryová, L.; Kučerová, L.; Čada, Z.; Bouček, Jan; Kodet, R.; André, S.; Gabius, H. J.

    2007-01-01

    Roč. 83, 11-12 (2007), s. 837-848 ISSN 0955-3002 Grant - others:XE(XE) MRTN-CT-2005-019561; GA MZd(CZ) NR9049 Institutional research plan: CEZ:AV0Z50200510 Source of funding: R - rámcový projekt EK ; V - iné verejné zdroje Keywords : cell biology * skin * stem cells Subject RIV: EC - Immunology Impact factor: 1.468, year: 2007

  13. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  14. Cytoprotective function of sAppalpha in human keratinocytes.

    Science.gov (United States)

    Wehner, Sven; Siemes, Christina; Kirfel, Gregor; Herzog, Volker

    2004-12-01

    sAPPalpha, the soluble form of the beta-amyloid precursor protein, has been shown to act as a potent epidermal growth factor by stimulating keratinocyte proliferation and migration. In this report we provide evidence for a cytoprotective role of sAPPalpha. As a model we used HaCaT cells and normal human keratinocytes (NHK) cultured in the absence of fetal calf serum and bovine pituitary extract. Under these conditions keratinocytes began to undergo apoptosis at increasing rates after 96 h of culture. Surprisingly, keratinocytes were protected from apoptosis by the addition of 50 nM recombinant sAPPalpha. Subsequent experiments were performed to elucidate the regulatory basis of the cytoprotective role of sAPPalpha. We found that recombinant sAPPalpha facilitated the substrate adhesion of keratinocytes in the first 30 minutes after seeding. The basis for this adhesion-promoting function was shown by the ability of recombinant sAPPalpha to continuously coat the culture dish thereby promoting the ability to bind keratinocytes. A second mechanism explaining the cytoprotective role was found in the significant inhibition of apoptosis by recombinant sAPPalpha. In HaCaT cells moderate UV-B irradiation was sufficient to induce apoptosis. In contrast, induction of apoptosis in NHK required additionally the depletion of endogenous sAPPalpha suggesting that sAPPalpha mediates protection against UV-B irradiation. Staurosporine-induced apoptosis rates were significantly reduced by about 59% after addition of recombinant sAPPalpha. These results show that sAPPalpha exerts a pronounced cytoprotective effect and that this effect is mediated by facilitated cell adhesion and by the antiapoptotic function of sAPPalpha.

  15. RhoB promotes cancer initiation by protecting keratinocytes from UVB-induced apoptosis but limits tumor aggressiveness.

    Science.gov (United States)

    Meyer, Nicolas; Peyret-Lacombe, Alexis; Canguilhem, Bruno; Médale-Giamarchi, Claire; Mamouni, Kenza; Cristini, Agnese; Monferran, Sylvie; Lamant, Laurence; Filleron, Thomas; Pradines, Anne; Sordet, Olivier; Favre, Gilles

    2014-01-01

    The role of UVB-induced apoptosis in the formation of squamous cell carcinoma (SCC) is recognized. We previously identified the small RhoB (Ras homolog gene family, member B) GTPase, an early response gene to cellular stress, as a critical protein controlling apoptosis of human keratinocytes after UVB exposure. Here we generated SKH1 (hairless immunocompetent mouse) mice invalidated for RhoB to evaluate its role in UVB-induced skin carcinogenesis in vivo. We show that rhob-/- mice have a lower risk of developing UVB-induced keratotic tumors and actinic keratosis that is associated with a higher sensitivity of UVB-exposed keratinocytes to apoptosis. We extend this observation to primary cultures of normal human keratinocytes in which RhoB was downregulated with small interfering RNA (siRNA) and further show that the hypersensitivity to apoptosis depends on B-cell lymphoma 2 (Bcl-2) downregulation. In rhob-/- mice, the UVB-induced tumors were preferentially undifferentiated and highly proliferative. Finally, we show in humans an almost constant loss of RhoB expression in undifferentiated SCCs. These undifferentiated and RhoB-deficient tumors have elevated phosphorylated histone H2AX (γH2AX) and 53BP1, two markers of DNA double-strand breaks. Together, our results indicate that UVB-induced RhoB expression participates in in vivo SCC initiation by increasing keratinocyte survival. Conversely, RhoB may limit tumor aggressiveness as loss of RhoB expression in tumor cells is associated with tumor progression.

  16. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Effects of bosentan on collagen type I synthesis on in vitro culture of scleroderma skin fibroblasts

    Directory of Open Access Journals (Sweden)

    S. Soldano

    2011-01-01

    Full Text Available The present study evaluated the effects of a non-selective endothelin (ETA/B receptors antagonist, on collagen type I (COLI synthesis on in vitro culture of scleroderma (SSc skin fibroblasts (Fb. Fb were obtained from skin biopsies of 6 female SSc patients (mean age 64. 1±6 years, after informed consent and Ethical Committee Approval. Cells were treated with endothelin-I [ET-I, 100nM] for 24 and 48 hrs, pre-treated for I hr with ETA/B receptors antagonist [10nM] alone or followed by ET-I for 24 and 48 hrs. Untreated Fb were used as controls. Immunocytochemistry and western blot analysis were performed to evaluate COLI synthesis. ET-I increased COLI synthesis both at 24 and 48 hrs when compared to controls. ETA/B receptor antagonost blocks the increased COLI synthesis ET-I-mediated both at 24 and 48 hrs vs. ET-I. Results showed that ET-I receptors blockage by ETA/B receptors antagonist might prevent the excessive synthesis of COLI, supporting its positive action in the management of skin fibrosis.

  18. Free radical injury in skin cultured fibroblasts from Alzheimer's disease patients.

    Science.gov (United States)

    Tesco, G; Latorraca, S; Piersanti, P; Sorbi, S; Piacentini, S; Amaducci, L

    1992-12-26

    Oxygen radical production is postulated to be a major cause of cell damage in aging. We have studied the response to toxic oxygen metabolites of fibroblast cell lines derived from skin biopsies of patients with familial and sporadic Alzheimer's disease compared with those derived from normal controls. Fibroblasts were damaged by the generation of oxygen metabolites during the enzymatic oxidation of acetaldehyde by 50 mU of xanthine-oxidase. To quantify cell damage we measured lactate dehydrogenase activity in the culture medium and cell viability in fibroblast cultures from four normal subjects, five FAD, and four AD patients after 2 hours of Xo incubation. We found a significant increase of LDH activity in FAD vs. controls and also in AD vs. controls, suggesting that AD cells are more susceptible to oxygen radical damage than are normal controls.

  19. Cultural Memory Inscribed in the Skin: Symbols of Nation as Tattoo Art in New Zealand

    Directory of Open Access Journals (Sweden)

    Claudia Bell

    2014-11-01

    Full Text Available In New Zealand there is a strand of cultural memory popularly known as 'kiwiana'. The term embraces everyday popular cultural practices - beach activities in summer, food rituals  - as well as an array of vintage artefacts.  The latter are locally manufactured items originating mainly in the 1940s-50s, when import restrictions limited the availability of household goods.  Local makers created products for the domestic market, for instance grocery items (and their logo-bearing containers, household crockery and toys. Those items, intrinsically representations of white (pakeha culture, are fondly recalled by the baby boomers, and have become popular collectibles.  Images of the same items have now become prevalent as decorative motifs on home wares and clothing.Recently a further celebratory strand of kiwiana has now appeared: the inscription of its motifs as extensive permanent skin tattoos. While Maori have always practiced meaningful skin tattoo, and whilst body tattoos in general have joined the realm of fashion, this is something new.  Here we see a recasting of the kiwiana images of popular cultural memory, now drawn onto the body.  One wearer of such a tattoo, a 26 year old plumber, said 'I love New Zealand. I am very proud of who we are and I wouldn't change being a kiwi for the world'. His design, a map of New Zealand on his back in filled with kiwiana items, shows his personal subscription to the populist representations that are utilised as apolitical definition of kiwi­ ness.  Kiwiana tattoo as a growing everyday practice is the focus of this paper.

  20. Different cytokine profiles of skin-derived T cell cultures from patients with atopic dermatitis and psoriasis

    DEFF Research Database (Denmark)

    Martel, Britta Cathrina; Dyring-Andersen, Beatrice; Skov, Lone

    2016-01-01

    OBJECTIVES: To investigate differences in expression of surface markers, cytokine profiles, and presence of CD4(+)CD8(+) T cells in skin-derived T cell cultures from patients with extrinsic atopic dermatitis (AD), intrinsic AD, and psoriasis expanded in the presence of IL-2 and IL-4. MATERIAL: Skin...... biopsies from patients with extrinsic AD (n = 6), intrinsic AD (n = 9) and psoriasis (n = 9). METHODS: Skin-derived T cell cultures were analyzed for expression of six surface markers, 11 intracellular cytokines, and three T cell subtype signature transcription factors by flow cytometry, and secreted...... cytokines by multiplex. RESULTS: A different IFN-γ profile emerged between the extrinsic AD and psoriatic T cell cultures; however, there was no difference in IL-17 profile. No differences with regard to cytokine expression were found between extrinsic AD and intrinsic AD cultures; however, cutaneous...

  1. Advances in Skin Substitutes—Potential of Tissue Engineered Skin for Facilitating Anti-Fibrotic Healing

    Directory of Open Access Journals (Sweden)

    Mathew Varkey

    2015-07-01

    Full Text Available Skin protects the body from exogenous substances and functions as a barrier to fluid loss and trauma. The skin comprises of epidermal, dermal and hypodermal layers, which mainly contain keratinocytes, fibroblasts and adipocytes, respectively, typically embedded on extracellular matrix made up of glycosaminoglycans and fibrous proteins. When the integrity of skin is compromised due to injury as in burns the coverage of skin has to be restored to facilitate repair and regeneration. Skin substitutes are preferred for wound coverage when the loss of skin is extensive especially in the case of second or third degree burns. Different kinds of skin substitutes with different features are commercially available; they can be classified into acellular skin substitutes, those with cultured epidermal cells and no dermal components, those with only dermal components, and tissue engineered substitutes that contain both epidermal and dermal components. Typically, adult wounds heal by fibrosis. Most organs are affected by fibrosis, with chronic fibrotic diseases estimated to be a leading cause of morbidity and mortality. In the skin, fibroproliferative disorders such as hypertrophic scars and keloid formation cause cosmetic and functional problems. Dermal fibroblasts are understood to be heterogeneous; this may have implications on post-burn wound healing since studies have shown that superficial and deep dermal fibroblasts are anti-fibrotic and pro-fibrotic, respectively. Selective use of superficial dermal fibroblasts rather than the conventional heterogeneous dermal fibroblasts may prove beneficial for post-burn wound healing.

  2. In vitro micro-physiological immune-competent model of the human skin.

    Science.gov (United States)

    Ramadan, Qasem; Ting, Fiona Chia Wan

    2016-05-21

    Skin allergy, in particular, allergic contact dermatitis and irritant contact dermatitis, are common occupational and environmental health problems affecting the quality of life of a significant proportion of the world population. Since all new ingredients to be incorporated into a product are potential skin allergens, it is essential that these ingredients be first tested for their allergenic potential. However, despite the considerable effort using animal models to understand the underlying mechanism of skin sensitization, to date, the molecular and cellular responses due to skin contact with sensitizers are still not fully understood. To replace animal testing and to improve the prediction of skin sensitization, significant attention has been directed to the use of reconstructed organotypic in vitro models of human skin. Here we describe a miniaturized immune competent in vitro model of human skin based on 3D co-culture of immortalized human keratinocytes (HaCaT) as a model of the epidermis barrier and human leukemic monocyte lymphoma cell line (U937) as a model of human dendritic cells. The biological model was fitted in a microfluidic-based cell culture system that provides a dynamic cellular environment that mimics the in vivo environment of skin. The dynamic perfusion of culture media significantly improved the tight junction formation as evidenced by measuring higher values of TEER compared to static culture. This setting also maintained the high viability of cells over extended periods of time up to 17 days. The perfusion-based culture also allows growth of the cells at the air-liquid interface by exposing the apical side of the cells to air while providing the cell nutrients through a basolateral fluidic compartment. The microsystem has been evaluated to investigate the effect of the chemical and physical (UV irradiation) stimulation on the skin barrier (i.e. the TJ integrity). Three-tiered culture differential stimulation allowed the investigation of the

  3. Sulfur mustard induces the formation of keratin aggregates in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Dillman, James F.; McGary, Kriston L.; Schlager, John J.

    2003-01-01

    The vesicant sulfur mustard is an alkylating agent that has the capacity to cross-link biological molecules. We are interested in identifying specific proteins that are altered upon sulfur mustard exposure. Keratins are particularly important for the structural integrity of skin, and several genetically inherited blistering diseases have been linked to mutations in keratin 5 and keratin 14. We examined whether sulfur mustard exposure alters keratin biochemistry in cultured human epidermal keratinocytes. Western blotting with specific monoclonal antibodies revealed the formation of stable high-molecular-weight 'aggregates' containing keratin 14 and/or keratin 5. These aggregates begin to form within 15 min after sulfur mustard exposure. These aggregates display a complex gel electrophoresis pattern between ∼100 and ∼200 kDa. Purification and analysis of these aggregates by one- and two-dimensional gel electrophoresis and mass spectrometry confirmed the presence of keratin 14 and keratin 5 and indicate that at least some of the aggregates are composed of keratin 14-keratin 14, keratin 14-keratin 5, or keratin 5-keratin 5 dimers. These studies demonstrate that sulfur mustard induces keratin aggregation in keratinocytes and support further investigation into the role of keratin aggregation in sulfur mustard-induced vesication

  4. Induction of differentiation in psoriatic keratinocytes by propylthiouracil and fructose

    Directory of Open Access Journals (Sweden)

    Santhosh Arul

    2016-12-01

    Full Text Available Psoriasis is characterized by uncontrolled proliferation and poor differentiation. Sirtuin1 (SIRT1 a class III deacetylase, crucial for differentiation in normal keratinocytes, is reduced in psoriasis. Down regulated SIRT1 levels may contribute to poor differentiation in psoriasis. In addition, the levels of early differentiation factors Keratin1 (K1 and Keratin10 (K10 are depleted in psoriasis. We attempted to study a possible effect of fructose, a SIRT1 upregulator and Propylthiouracil (PTU to augment differentiation in psoriatic keratinocytes. Keratinocytes were cultured from lesional biopsies obtained from psoriatic patients and control cells were obtained from patients undergoing abdominoplasty. Cells were treated with fructose and PTU individually. K1 and K10 transcript levels were measured to evaluate early differentiation; SIRT1 protein expression was also studied to decipher its role in the mechanism of differentiation. The K1, K10 transcript levels, SIRT1 protein and transcript levels in fructose treated psoriatic keratinocytes were improved. This suggests keratinocyte differentiation was induced by fructose through SIRT1 upregulation. Whereas PTU induced differentiation, as confirmed by improved K1, K10 transcript levels followed a non-SIRT1 mechanism. We conclude that the use of fructose and PTU may be an adjunct to the existing therapies for psoriasis.

  5. High levels of plasma IL-10 and expression of IL-10 by keratinocytes during visceral leishmaniasis predict subsequent development of post-kala-azar dermal leishmaniasis

    DEFF Research Database (Denmark)

    Gasim, S; Elhassan, A M; Khalil, E A

    1998-01-01

    report here that PKDL development can be predicted before treatment of visceral leishmaniasis, and that IL-10 is involved in the pathogenesis. Before treatment of visceral leishmaniasis, Leishmania parasites were present in skin which appeared normal on all patients. However, IL-10 was detected...... in the keratinocytes and/or sweat glands of all patients who later developed PKDL (group 1) and not in any of the patients who did not develop PKDL (group 2). Furthermore, the levels of IL-10 in plasma as well as in peripheral blood mononuclear cell culture supernatants were higher in group 1 than in group 2....

  6. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  7. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  8. Application of low level laser on skin cell lines

    CSIR Research Space (South Africa)

    Ndhundhuma, IM

    2010-01-01

    Full Text Available Lasers have emerged as powerful tools for tissue engineering. To examine cellular growth, and cell to cell interactions, in vitro skin models have been developed combining two major cell types of skin, keratinocytes and fibroblasts. The main...

  9. BITTERSWEET CULTURAL ACCEPTANCE AS A REPRESENTATION OF SKIN COLOUR DIFFERENTIATION IN TONI MORRISON‟S SHORT STORY SWEETNESS

    Directory of Open Access Journals (Sweden)

    Mohamad Ikhwan Rosyidi

    2017-04-01

    Full Text Available This study aims to describe the bittersweet cultural acceptance as Black and White colour skin recognition as a representation of skin colour differentiation in Toni Morrison‘s short story Sweetness. It applies to use descriptive-qualitative data. The material object analyzed is the study of Toni Morrison short story Sweetness published in New Yorker magazine (February 9, 2015. The formal object is the study of this short story seen from the bittersweet cultural acceptance as Black and White colour skin recognition as a representation of skin colour differentiation. Data are analyzed by applying Pierce‘s theory of Semiotics. The result will be the differentiation of people can be seen from the genetic skin differences, different usage of bible, public places, and salaries. These differentiations are iconic signs. The differences of public place entering allowances and holding a holy book as a main fundamental substance in marriage indicate the indexical sign as references towards the differentiation. Moreover, all of them become the symbolic bittersweet cultural acceptance as a representation of skin colour differentiation reflected on Toni Morrison‘s Short Story Sweetness.

  10. Dimethyl Sulfoxide Enhances Effectiveness of Skin Antiseptics and Reduces Contamination Rates of Blood Cultures

    Science.gov (United States)

    LaSala, Paul R.; Han, Xiang-Yang; Rolston, Kenneth V.; Kontoyiannis, Dimitrios P.

    2012-01-01

    Effective skin antisepsis is of central importance in the prevention of wound infections, colonization of medical devices, and nosocomial transmission of microorganisms. Current antiseptics have a suboptimal efficacy resulting in substantial infectious morbidity, mortality, and increased health care costs. Here, we introduce an in vitro method for antiseptic testing and a novel alcohol-based antiseptic containing 4 to 5% of the polar aprotic solvent dimethyl sulfoxide (DMSO). The DMSO-containing antiseptic resulted in a 1- to 2-log enhanced killing of Staphylococcus epidermidis and other microbes in vitro compared to the same antiseptic without DMSO. In a prospective clinical validation, blood culture contamination rates were reduced from 3.04% for 70% isopropanol–1% iodine (control antiseptic) to 1.04% for 70% isopropanol–1% iodine–5% DMSO (P antiseptics containing strongly polarized but nonionizing (polar aprotic) solvents. PMID:22378911

  11. Stem cell recovering effect of copper-free GHK in skin.

    Science.gov (United States)

    Choi, Hye-Ryung; Kang, Youn-A; Ryoo, Sun-Jong; Shin, Jung-Won; Na, Jung-Im; Huh, Chang-Hun; Park, Kyoung-Chan

    2012-11-01

    The peptide Gly-His-Lys (GHK) is a naturally occurring copper(II)-chelating motifs in human serum and cerebrospinal fluid. In industry, GHK (with or without copper) is used to make hair and skin care products. Copper-GHK plays a physiological role in the process of wound healing and tissue repair by stimulating collagen synthesis in fibroblasts. We also reported that copper-GHK promotes the survival of basal stem cells in the skin. However, the effects of copper-free GHK (GHK) have not been investigated well. In this study, the effects of GHK were studied using cultured normal human keratinocytes and skin equivalent (SE) models. In monolayer cultured keratinocytes, GHK increased the proliferation of keratinocytes. When GHK was added during the culture of SE models, the basal cells became more cuboidal than control model. In addition, there was linear and intense staining of α6 and β1 integrin along the basement membrane. The number of p63 and proliferating cell nuclear antigen positive cells was also significantly increased in GHK-treated SEs than in control SEs. Western blot and slide culture experiment showed that GHK increased the expression of integrin by keratinocytes. All these results showed that GHK increased the stemness and proliferative potential of epidermal basal cells, which is associated with increased expression of integrin. In conclusion, copper-free GHK showed similar effects with copper-GHK. Thus, it can be said that copper-free GHK can be used in industry to obtain the effects of copper-GHK in vivo. Further study is necessary to explore the relationship between copper-free GHK and copper-GHK. Copyright © 2012 European Peptide Society and John Wiley & Sons, Ltd.

  12. Oxidative stress in skin fibroblasts cultures from patients with Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Arenas Joaquín

    2010-10-01

    Full Text Available Abstract Background In the substantia nigra of Parkinson's disease (PD patients, increased lipid peroxidation, decreased activities of the mitochondrial complex I of the respiratory chain, catalase and glutathione-peroxidase, and decreased levels of reduced glutathione have been reported. These observations suggest that oxidative stress and mitochondrial dysfunction play a role in the neurodegeneration in PD. We assessed enzymatic activities of respiratory chain and other enzymes involved in oxidative processes in skin fibroblasts cultures of patients with PD. Methods We studied respiratory chain enzyme activities, activities of total, Cu/Zn- and Mn-superoxide-dismutase, gluthatione-peroxidase and catalase, and coenzyme Q10 levels in skin fibroblasts cultures from 20 Parkinson's disease (PD patients and 19 age- and sex- matched healthy controls. Results When compared with controls, PD patients showed significantly lower specific activities for complex V (both corrected by citrate synthase activity and protein concentrations. Oxidized, reduced and total coenzyme Q10 levels (both corrected by citrate synthase and protein concentrations, and activities of total, Cu/Zn- and Mn-superoxide-dismutase, gluthatione-peroxidase and catalase, did not differ significantly between PD-patients and control groups. Values for enzyme activities in the PD group did not correlate with age at onset, duration, scores of the Unified Parkinson's Disease Rating scales and Hoehn-Yahr staging. Conclusions The main result of this study was the decreased activity of complex V in PD patients. This complex synthesizes ATP from ADP using an electrochemical gradient generated by complexes I-IV. These results suggest decreased energetic metabolism in fibroblasts of patients with PD.

  13. Sensitivity of cultured skin fibroblasts from patients with neurofibromatosis to DNA-damaging agents

    International Nuclear Information System (INIS)

    Woods, W.G.; McKenzie, B.; Letourneau, M.A.; Byrne, T.D.

    1986-01-01

    Neurofibromatosis (NF) is an autosomal dominant disorder associated with various constitutional abnormalities as well as a striking predisposition for malignant and nonmalignant neoplasms, both in cells originating in and not originating in the neural crest. We have examined the sensitivity of cultured skin fibroblasts from patients with neurofibromatosis to several types of DNA damage. Fibroblasts in Dulbecco's modified Eagle's medium were plated at 10(2) to 2 X 10(4) cells per 75 cm2 tissue culture plates, and exposed to various doses of gamma radiation (leads to DNA scission), actinomycin D, or mitomycin C. Cells were reincubated for 15 to 40 days until surviving colonies exhibited greater than 30-50 cells. Plates were then stained with 1% methylene blue and the colonies counted, with surviving fraction determined relative to plating efficiency. Nine skin fibroblast cell strains from normal individuals were studied as controls. One neurofibromatosis (NF) cell strain, SB23, exhibited normal sensitivity to all three DNA-damaging agents studied in early (7-8) and middle (12-13) in vitro passage. Strain GM0622, on the other hand, exhibited normal sensitivity to the three DNA-damaging agents studied at early passage, but showed a significant decrease in survival after exposure to both gamma radiation (D0 = 106 rad) and actinomycin D (D0 = 0.024 mcg/ml) with increasing passage. Strain GM1639 exhibited decreased survival after actinomycin D exposure at early passage (D0 = 0.017 mcg/ml), with normal survival after exposure to gamma radiation and mitomycin C at the same passage

  14. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  15. Salamanders on the bench - A biocompatibility study of salamander skin secretions in cell cultures.

    Science.gov (United States)

    von Byern, Janek; Mebs, Dietrich; Heiss, Egon; Dicke, Ursula; Wetjen, Oliver; Bakkegard, Kristin; Grunwald, Ingo; Wolbank, Susanne; Mühleder, Severin; Gugerell, Alfred; Fuchs, Heidemarie; Nürnberger, Sylvia

    2017-09-01

    Salamanders have evolved a wide variety of antipredator mechanisms and behavior patterns, including toxins and noxious or adhesive skin secretions. The high bonding strength of the natural bioadhesives makes these substances interesting for biomimetic research and applications in industrial and medical sectors. Secretions of toxic species may help to understand the direct effect of harmful substances on the cellular level. In the present study, the biocompatibility of adhesive secretions from four salamander species (Plethodon shermani, Plethodon glutinosus, Ambystoma maculatum, Ambystoma opacum) were analyzed using the MTT assay in cell culture and evaluated against toxic secretions of Pleurodeles waltl, Triturus carnifex, Pseudotriton ruber, Tylototriton verrucosus, and Salamandra salamandra. Their effect on cells was tested in direct contact (direct culture) or under the influence of the extract (indirect exposure) in accordance with the protocol of the international standard norm ISO 10993-5. Human dermal fibroblasts (NHDF), umbilical vein endothelial cells (HUVEC), and articular chondrocytes (HAC), as well as the cell lines C2C12 and L929 were used in both culture types. While the adhesive secretions from Plethodon shermani are cytocompatible and those of Ambystoma opacum are even advantageous, those of Plethodon glutinosus and Ambystoma maculatum appear to be cytotoxic to NDHF and HUVEC. Toxic secretions from Salamandra salamandra exhibited harmful effects on all cell types. Pseudotriton ruber and Triturus carnifex secretions affected certain cell types marginally; those from Pleurodeles waltl and Tylototriton verrucosus were generally well tolerated. The study shows for the first time the effect of salamander secretions on the viability of different cell types in culture. Two adhesive secretions appeared to be cell compatible and are therefore promising candidates for future investigations in the field of medical bioadhesives. Among the toxic secretions

  16. Release of arachidonic and linoleic acid metabolites in skin organ cultures as characteristics of in vitro skin irritancy

    NARCIS (Netherlands)

    Sandt, J.J.M. van de; Maas, W.J.M.; Doornink, P.C.; Rutten, A.A.J.J.L.

    1995-01-01

    In vitro techniques make a major contribution to the development of alternatives to the in vivo 'Draize' skin irritation test, and the development of sensitive and generally applicable in vitro endpoints of cutaneous toxicity is an area of intensive research. To investigate in vitro characteristics

  17. Nanostructured anti-bacterial poly-lactic-co-glycolic acid films for skin tissue engineering applications.

    Science.gov (United States)

    Karahaliloğlu, Zeynep; Ercan, Batur; Chung, Stanley; Taylor, Erik; Denkbaş, Emir B; Webster, Thomas J

    2014-12-01

    Major issues faced with the use of today's skin grafts are infection, scar tissue formation, insufficient keratinocyte (or skin producing cells) proliferation and high production costs. To overcome these limitations, we propose here for the first time, a nanofeatured poly(lactide-co-glycolide) (PLGA) membrane as a next generation antibacterial skin graft material. An alkaline surface treatment method was used to create random nanofeatures on PLGA membranes where sodium hydroxide (NaOH) concentration and exposure times were altered to control surface morphology. Most significantly, and without the use of antibiotics, results showed a decrease in Staphylococcus aureus (a dangerous pathogen infecting skin grafts) growth for up to ∼40% after 2 days of culture on nanofeatured PLGA membranes compared to untreated controls. Results also showed that while bacteria growth was stunted, mammalian cell growth was not. Specifically, cell culture results showed an increase in human epidermal keratinocyte density, while the density of scar tissue forming human dermal fibroblasts, did not change on nanofeatured PLGA surfaces compared to the untreated controls after 3 days of culture. These findings indicate that the alkaline treatment of PLGA membranes is a promising quick and effective manner to limit scar tissue formation and bacterial invasion while increasing skin cell proliferation for improving numerous wound-healing applications. © 2014 Wiley Periodicals, Inc.

  18. Comparison of post-Lyme Borreliosis symptoms in erythema migrans patients with positive and negative Borrelia burgdorferi sensu lato skin culture.

    Science.gov (United States)

    Stupica, Daša; Lusa, Lara; Cerar, Tjaša; Ružić-Sabljić, Eva; Strle, Franc

    2011-07-01

    Limited data exist on differences of erythema migrans patients with either positive or negative Borrelia burgdorferi sensu lato skin culture. We analyzed 252 adult patients with erythema migrans in whom skin biopsy specimen was cultured for the presence of B. burgdorferi sensu lato. Evaluations of epidemiological, clinical, and microbiological findings were conducted at baseline, 14 days, 2, 6, and 12 months after treatment with either doxycycline or cefuroxime axetil. One hundred fifty-one (59.9%) patients had positive skin culture (86.9% B. afzelii, 8.0% B. garinii, 5.1% B. burgdorferi sensu stricto) and 101 (40.1%) had negative skin culture. Patients in the culture-positive and culture-negative groups were comparable for the basic demographic, epidemiological, clinical, and laboratory characteristics at presentation. Statistically significantly worse selected treatment outcome parameters in the culture-positive group compared with the culture-negative group were established during follow-up. Treatment failure was documented in two patients who were culture positive and in none in the culture-negative group. Although findings for the pretreatment characteristics were comparable between the erythema migrans skin culture-positive and culture-negative patients, some parameters indicate that borrelia skin culture positivity may predict a less-favorable treatment outcome.

  19. Cultural adaptation, content validity and inter-rater reliability of the "STAR Skin Tear Classification System"

    Directory of Open Access Journals (Sweden)

    Kelly Cristina Strazzieri-Pulido

    2015-02-01

    Full Text Available AIMS: to perform the cultural adaptation of the STAR Skin Tear Classification System into the Portuguese language and to test the content validity and inter-rater reliability of the adapted version.METHODS: methodological study with a quantitative approach. The cultural adaptation was developed in three phases: translation, evaluation by a committee of judges and back-translation. The instrument was tested regarding content validity and inter-rater reliability.RESULTS: the adapted version obtained a regular level of concordance when it was applied by nurses using photographs of friction injuries. Regarding its application in clinical practice, the adapted version obtained a moderate and statistically significant level of concordance.CONCLUSION: the study tested the content validity and inter-rater reliability of the version adapted into the Portuguese language. Its inclusion in clinical practice will enable the correct identification of this type of injury, as well as the implementation of protocols for the prevention and treatment of friction injuries.

  20. Effect of a topical treatment in organotypic culture of human breast skin after exposure to gamma-rays

    Directory of Open Access Journals (Sweden)

    N Gagliano

    2009-08-01

    Full Text Available The early radiation of epidermal reactions can lead to healing of the lesion or radiation necrosis. There is no general agreement for either the prevention and/or treatment of radiation skin response, also as little is known about the immediate phases of this phenomenon. We investigated the early effects exerted by Healing and Wound Emulsion (HWE on human skin response after ionizing radiation. Epidermal morphology, Heat Shock Protein (HSP 70, and Transforming Growth Factor-b1 (TGF-b1 gene expression were investigated in organotypic human skin cultures undergoing a double dose of gamma-rays (2 Gy. HSP70 gene expression tended to be induced in the HWE group 6 hours after cream administration and was significantly up-regulated after 48 hours, when epidermal morphological alterations were evident. TGF- b1 seems not affected in cream treated samples. HWE may stimulate skin to mount an early defensive response against damage induced by gamma rays.

  1. Melatonin maintains mitochondrial membrane potential and attenuates activation of initiator (casp-9) and effector caspases (casp-3/casp-7) and PARP in UVR-exposed HaCaT keratinocytes.

    Science.gov (United States)

    Fischer, T W; Zmijewski, M A; Wortsman, J; Slominski, A

    2008-05-01

    Melatonin is a recognized antioxidant with high potential as a protective agent in many conditions related to oxidative stress such as neurodegenerative diseases, ischemia/reperfusion syndromes, sepsis and aging. These processes may be favorably affected by melatonin through its radical scavenging properties and/or antiapoptotic activity. Also, there is increasing evidence that these effects of melatonin could be relevant in keratinocytes, the main cell population of the skin where it would contribute to protection against damage induced by ultraviolet radiation (UVR). We therefore investigated the kinetics of UVR-induced apoptosis in cultured keratinocytes characterizing the morphological and mitochondrial changes, the caspases-dependent apoptotic pathways and involvement of poly(ADP-ribose) polymerase (PARP) activation as well as the protective effects of melatonin. When irradiated with UVB radiation (50 mJ/cm(2)), melatonin treated, cultured keratinocytes were more confluent, showed less cell blebbing, more uniform shape and less nuclear condensation as compared to irradiated, nonmelatonin-treated controls. Preincubation with melatonin also led to normalization of the decreased UVR-induced mitochondrial membrane potential. These melatonin effects were followed by suppression of the activation of mitochondrial pathway-related initiator caspase 9 (casp-9), but not of death receptor-dependent casp-8 between 24 and 48 hr after UVR exposure. Melatonin down-regulated effector caspases (casp-3/casp-7) at 24-48 hr post-UV irradiation and reduced PARP activation at 24 hr. Thus, melatonin is particularly active in UV-irradiated keratinocytes maintaining the mitochondrial membrane potential, inhibiting the consecutive activation of the intrinsic apoptotic pathway and reducing PARP activation. In conclusion, these data provide detailed evidence for specific antiapoptotic mechanisms of melatonin in UVR-induced damage of human keratinocytes.

  2. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Directory of Open Access Journals (Sweden)

    Karl Gledhill

    Full Text Available The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  3. Epidermal cell proliferation and terminal differentiation in skin organ culture after topical exposure to sodium dodecyl sulphate

    NARCIS (Netherlands)

    Sandt, J.J.M. van de; Bos, T.A.; Rutten, A.A.J.J.L.

    1995-01-01

    Epidermal cell proliferation and differentiation were investigated in vitro after exposure to the anionic surfactant sodium dodecyl sulfate (SDS). Human skin organ cultures were exposed topically to various concentrations of SDS for 22 h, after which the irritant was removed. Cell proliferation was

  4. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  5. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  6. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  7. ZNF750 is expressed in differentiated keratinocytes and regulates epidermal late differentiation genes.

    Directory of Open Access Journals (Sweden)

    Idan Cohen

    Full Text Available Disrupted skin barrier due to altered keratinocyte differentiation is common in pathologic conditions such as atopic dermatitis, ichthyosis and psoriasis. However, the molecular cascades governing keratinocyte terminal differentiation are poorly understood. We have previously demonstrated that a dominant mutation in ZNF750 leads to a clinical phenotype reminiscent of psoriasis and seborrheic dermatitis. Here we show that ZNF750 is a nuclear protein bearing a functional C-terminal nuclear localization signal. ZNF750 was specifically expressed in the epidermal suprabasal layers and its expression was augmented during differentiation, both in human skin and in-vitro, peaking in the granular layer. Silencing of ZNF750 in Ca2+-induced HaCaT keratinocytes led to morphologically apparent arrest in the progression of late differentiation, as well as diminished apoptosis and sustained proliferation. ZNF750 knockdown cells presented with markedly reduced expression of epidermal late differentiation markers, including gene subsets of epidermal differentiation complex and skin barrier formation such as FLG, LOR, SPINK5, ALOX12B and DSG1, known to be mutated in various human skin diseases. Furthermore, overexpression of ZNF750 in undifferentiated cells induced terminal differentiation genes. Thus, ZNF750 is a regulator of keratinocyte terminal differentiation and with its downstream targets can serve in future elucidation of therapeutics for common diseases of skin barrier.

  8. Double trisomy mosaic (47,XXX/48,XXX,+13) confirmed by FISH and skin fibroblast culture

    Energy Technology Data Exchange (ETDEWEB)

    Lieber, E.; Grady, V.; Dosik, H. [Interfaith Medical Center, Brooklyn, NY (United States)] [and others

    1994-09-01

    A 4 lb 8 oz female was born to a 49-year-old woman (P1200G12) at 40 weeks. The baby had tetralogy of Fallot, polydactyly, microcephaly, low set simple ears, posterior cleft of the soft palate and overlapping flexion deformities of both hands. The eyes were deep set. The clinical impression was trisomy 13. The baby is not doing well and needs a gastrotomy tube for feeding. Sucking is allright but swallowing is impeded. An MRI showed an anomaly of the corpus callosum. The ophthalmological examination showed no abnormalities. A chromosome study on a 2-day peripheral blood sample resulted in poor growth and poor morphology; however, 20 Giemsa-banded cells revealed a 47,XXX karyotype. A second specimen was obtained to search for mosaicism and a blood smear revealed nuclear projections on the neutrophils. FISH analysis using whole chromosome painting probe (Life Technologies) first identified the extra chromosome number 13, the final results showing five of sixty metaphase cells (8.3%) with trisomy 13. Cytogenetic analysis using Giemsa-banding technique revealed four cells in fifty examined (8.0%) with a 48,XXX,+13 karyotype. In order to further evaluate the mosaicism, cytogenetic analysis of a skin fibroblast culture was performed. Twenty one of twenty three cells examined (91.3%) showed the 48,XXX,+13 karyotype. FISH analysis of the skin biopsy revealed eighteen of twenty cells (90.9%) with the trisomy 13. The FISH technique is an important enhancement to routine cytogenetic studies when they do not immediately correlate with clinical impressions.

  9. Modulation of keratinocyte expression of antioxidants by 4-hydroxynonenal, a lipid peroxidation end product

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Ruijin [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Mishin, Vladimir; Black, Adrienne T. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Shakarjian, Michael P. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Kong, Ah-Ng Tony; Laskin, Debra L. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Medicine, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ (United States)

    2014-03-01

    4-Hydroxynonenal (4-HNE) is a lipid peroxidation end product generated in response to oxidative stress in the skin. Keratinocytes contain an array of antioxidant enzymes which protect against oxidative stress. In these studies, we characterized 4-HNE-induced changes in antioxidant expression in mouse keratinocytes. Treatment of primary mouse keratinocytes and PAM 212 keratinocytes with 4-HNE increased mRNA expression for heme oxygenase-1 (HO-1), catalase, NADPH:quinone oxidoreductase (NQO1) and glutathione S-transferase (GST) A1-2, GSTA3 and GSTA4. In both cell types, HO-1 was the most sensitive, increasing 86–98 fold within 6 h. Further characterization of the effects of 4-HNE on HO-1 demonstrated concentration- and time-dependent increases in mRNA and protein expression which were maximum after 6 h with 30 μM. 4-HNE stimulated keratinocyte Erk1/2, JNK and p38 MAP kinases, as well as PI3 kinase. Inhibition of these enzymes suppressed 4-HNE-induced HO-1 mRNA and protein expression. 4-HNE also activated Nrf2 by inducing its translocation to the nucleus. 4-HNE was markedly less effective in inducing HO-1 mRNA and protein in keratinocytes from Nrf2 −/− mice, when compared to wild type mice, indicating that Nrf2 also regulates 4-HNE-induced signaling. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that 4-HNE-induced HO-1 is localized in keratinocyte caveolae. Treatment of the cells with methyl-β-cyclodextrin, which disrupts caveolar structure, suppressed 4-HNE-induced HO-1. These findings indicate that 4-HNE modulates expression of antioxidant enzymes in keratinocytes, and that this can occur by different mechanisms. Changes in expression of keratinocyte antioxidants may be important in protecting the skin from oxidative stress. - Highlights: • Lipid peroxidation generates 4-hydroxynonenal, a reactive aldehyde. • 4-HNE induces antioxidant proteins in mouse keratinocytes. • Induction of

  10. T-plastin expression downstream to the calcineurin/NFAT pathway is involved in keratinocyte migration.

    Directory of Open Access Journals (Sweden)

    Cécilia Brun

    Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte

  11. Comparison of Four Antiseptic Preparations for Skin in the Prevention of Contamination of Percutaneously Drawn Blood Cultures: a Randomized Trial

    Science.gov (United States)

    Calfee, David P.; Farr, Barry M.

    2002-01-01

    A number of skin antiseptics have been used to prevent the contamination of blood cultures, but the comparative efficacies of these agents have not been extensively evaluated. We therefore sought to compare the efficacy of four skin antiseptics in preventing blood culture contamination in a randomized, crossover, investigator-blinded study conducted in an emergency department and the inpatient wards of a university hospital. The patient group included all patients from whom blood samples were obtained percutaneously for culture. Skin antisepsis was performed with 10% povidone-iodine, 70% isopropyl alcohol, tincture of iodine, or povidone-iodine with 70% ethyl alcohol (i.e., Persist). The blood culture contamination rate associated with each antiseptic was then determined. A total of 333 (2.62%) of 12,692 blood cultures were contaminated during the study period compared to 413 (3.21%) of 12,859 blood cultures obtained during the previous 12-month period (relative risk = 0.82; 95% confidence interval, 0.71 to 0.94; P = 0.006). During the study, the contamination rates were determined to be 2.93% with povidone-iodine, 2.58% with tincture of iodine, 2.50% with isopropyl alcohol, and 2.46% with Persist (P = 0.62). We detected no significant differences in the blood culture contamination rates among these four antiseptics, although there was some evidence suggesting greater efficacy among the alcohol-containing antiseptics. Among the evaluated antiseptics, isopropyl alcohol may be the optimal antiseptic for use prior to obtaining blood for culture, given its convenience, low cost, and tolerability. PMID:11980938

  12. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  13. Traumatic Acid Reduces Oxidative Stress and Enhances Collagen Biosynthesis in Cultured Human Skin Fibroblasts.

    Science.gov (United States)

    Jabłońska-Trypuć, Agata; Pankiewicz, Walentyn; Czerpak, Romuald

    2016-09-01

    Traumatic acid (TA) is a plant hormone (cytokinin) that in terms of chemical structure belongs to the group of fatty acids derivatives. It was isolated from Phaseolus vulgaris. TA activity and its influence on human cells and organism has not previously been the subject of research. The aim of this study was to examine the effects of TA on collagen content and basic oxidative stress parameters, such as antioxidative enzyme activity, reduced glutathione, thiol group content, and lipid peroxidation in physiological conditions. The results show a stimulatory effect of TA on tested parameters. TA caused a decrease in membrane phospholipid peroxidation and exhibited protective properties against ROS production. It also increases protein and collagen biosynthesis and its secretion into the culture medium. The present findings reveal that TA exhibits multiple and complex activity in fibroblast cells in vitro. TA, with its activity similar to unsaturated fatty acids, shows antioxidant and stimulatory effects on collagen biosynthesis. It is a potentially powerful agent with applications in the treatment of many skin diseases connected with oxidative stress and collagen biosynthesis disorders.

  14. Keratinocyte cytokine and chemokine receptors.

    Science.gov (United States)

    Tüzün, Yalçin; Antonov, Meltem; Dolar, Neslihan; Wolf, Ronni

    2007-10-01

    Chemokines are a superfamily of small, secreted proteins that regulate cell traffic in homeostatic and inflammatory conditions. Keratinocytes synthesize many chemokines, including members of the CC and CXC subfamilies, such as regulated on activation of normal T-cell expressed and secreted, gamma-interferon inducible protein-10, monokine induced by gamma-interferon, and thymus- and activation-regulated chemokine. They also express some chemokine receptors that mediate the inflammatory or immune response by attracting various kinds of leukocytes.

  15. Knockdown of filaggrin in a three-dimensional reconstructed human epidermis impairs keratinocyte differentiation

    NARCIS (Netherlands)

    Pendaries, Valérie; Malaisse, Jeremy; Pellerin, Laurence; Le Lamer, Marina; Nachat, Rachida; Kezic, Sanja; Schmitt, Anne-Marie; Paul, Carle; Poumay, Yves; Serre, Guy; Simon, Michel

    2014-01-01

    Atopic dermatitis is a chronic inflammatory skin disorder characterized by defects in the epidermal barrier and keratinocyte differentiation. The expression of filaggrin, a protein thought to have a major role in the function of the epidermis, is downregulated. However, the impact of this deficiency

  16. Ultraviolet B radiation up-regulates the expression of IL-15 in human skin

    Energy Technology Data Exchange (ETDEWEB)

    Mohamadzadeh, M.; Takashima, Akira; Dougherty, I. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)] [and others

    1995-11-01

    Ultraviolet B (UVB) radiation is a potent modulator of skin-related immune responses, particularly those involving the synthesis and the secretion of cytokines. The discovery of a new T cell mitogen, IL-15, prompted us to investigate its expression in skin and to examine the effects of UVB radiation on such expression. RNA from unirradiated and UVB-irradiated epidermal and dermal sheets derived from human foreskin as well as from unirradiated and UVB-irradiated skin cell populations were assayed for IL-15 expression by semiquantitative RT-PCR. Constitutive levels of IL-15 mRNA were detected in dermal sheets, but not in epidermal sheets. Following UVB treatment, IL-15 mRNA was induced in epidermal sheets and enhanced in dermal sheets. UVB-inducible epidermal expression of IL-15 mRNA was traced to HLA-DR{sup -} cells (presumably keratinocytes) and not to HLA-DR{sup +} cells (Langerhans cells). Cultured keratinocytes and dermal fibroblasts displayed basal levels of IL-15 mRNA that were also up-regulated following UVB exposure. Immunoblot analysis revealed secretion of IL-15 protein by keratinocytes that enhanced following UVB treatment. These results constitute the first report of IL-15 mRNA expression and protein production in human skin. In addition to expanding the known influence of UVB radiation on the capacity of keratinocytes and dermal fibroblasts to express immunomodulatory cytokines, these findings suggest a new mechanism by which UVB can promote Ag-independent T cell responses via elaboration of IL-15. 51 refs., 6 figs.

  17. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo

    Science.gov (United States)

    Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M.

    2017-01-01

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema. PMID:28829355

  18. Effective inhibition of melanosome transfer to keratinocytes by lectins and niacinamide is reversible.

    Science.gov (United States)

    Greatens, Amanda; Hakozaki, Tomohiro; Koshoffer, Amy; Epstein, Howard; Schwemberger, Sandy; Babcock, George; Bissett, Donald; Takiwaki, Hirotsugu; Arase, Seiji; Wickett, R Randall; Boissy, Raymond E

    2005-07-01

    Skin pigmentation results in part from the transfer of melanized melanosomes synthesized by melanocytes to neighboring keratinocytes. Plasma membrane lectins and their glycoconjugates expressed by these epidermal cells are critical molecules involved in this transfer process. In addition, the derivative of vitamin B(3), niacinamide, can inhibit melanosome transfer and induce skin lightening. We investigated the effects of these molecules on the viability of melanocytes and keratinocytes and on the reversibility of melanosome-transfer inhibition induced by these agents using an in vitro melanocyte-keratinocyte coculture model system. While lectins and neoglycoproteins could induce apoptosis in a dose-dependent manner to melanocytes or keratinocytes in monoculture, similar dosages of the lectins, as opposed to neoglycoproteins, did not induce apoptosis to either cell type when treated in coculture. The dosages of lectins and niacinamide not affecting cell viability produced an inhibitory effect on melanosome transfer, when used either alone or together in cocultures of melanocytes-keratinocytes. Cocultures treated with lectins or niacinamide resumed normal melanosome transfer in 3 days after removal of the inhibitor, while cocultures treated with a combination of lectins and niacinamide demonstrated a lag in this recovery. Subsequently, we assessed the effect of niacinamide on facial hyperpigmented spots using a vehicle-controlled, split-faced design human clinical trial. Topical application of niacinamide resulted in a dose-dependent and reversible reduction in hyperpigmented lesions. These results suggest that lectins and niacinamide at concentrations that do not affect cell viability are reversible inhibitors of melanosome transfer.

  19. Autocrine abscisic acid mediates the UV-B-induced inflammatory response in human granulocytes and keratinocytes.

    Science.gov (United States)

    Bruzzone, Santina; Basile, Giovanna; Mannino, Elena; Sturla, Laura; Magnone, Mirko; Grozio, Alessia; Salis, Annalisa; Fresia, Chiara; Vigliarolo, Tiziana; Guida, Lucrezia; De Flora, Antonio; Tossi, Vanesa; Cassia, Raul; Lamattina, Lorenzo; Zocchi, Elena

    2012-06-01

    UV-B is an abiotic environmental stress in both plants and animals. Abscisic acid (ABA) is a phytohormone regulating fundamental physiological functions in plants, including response to abiotic stress. We previously demonstrated that ABA is an endogenous stress hormone also in animal cells. Here, we investigated whether autocrine ABA regulates the response to UV-B of human granulocytes and keratinocytes, the cells involved in UV-triggered skin inflammation. The intracellular ABA concentration increased in UV-B-exposed granulocytes and keratinocytes and ABA was released into the supernatant. The UV-B-induced production of NO and of reactive oxygen species (ROS), phagocytosis, and cell migration were strongly inhibited in granulocytes irradiated in the presence of a monoclonal antibody against ABA. Moreover, presence of the same antibody strongly inhibited release of NO, prostaglandin E2 (PGE(2)), and tumor necrosis factor-α (TNF-α) by UV-B irradiated keratinocytes. Lanthionine synthetase C-like protein 2 (LANCL2) is required for the activation of the ABA signaling pathway in human granulocytes. Silencing of LANCL2 in human keratinocytes by siRNA was accompanied by abrogation of the UV-B-triggered release of PGE(2), TNF-α, and NO and ROS production. These results indicate that UV-B irradiation induces ABA release from human granulocytes and keratinocytes and that autocrine ABA stimulates cell functions involved in skin inflammation. Copyright © 2011 Wiley Periodicals, Inc.

  20. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  1. Lactobacillus rhamnosus GG inhibits the toxic effects of Staphylococcus aureus on epidermal keratinocytes.

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J; Cruickshank, Sheena M; O'Neill, Catherine A

    2014-09-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 10(8) CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. Cigarette smoke affects keratinocytes SRB1 expression and localization via H2O2 production and HNE protein adducts formation.

    Directory of Open Access Journals (Sweden)

    Claudia Sticozzi

    Full Text Available Scavenger Receptor B1 (SR-B1, also known as HDL receptor, is involved in cellular cholesterol uptake. Stratum corneum (SC, the outermost layer of the skin, is composed of more than 25% cholesterol. Several reports support the view that alteration of SC lipid composition may be the cause of impaired barrier function which gives rise to several skin diseases. For this reason the regulation of the genes involved in cholesterol uptake is of extreme significance for skin health. Being the first shield against external insults, the skin is exposed to several noxious substances and among these is cigarette smoke (CS, which has been recently associated with various skin pathologies. In this study we first have shown the presence of SR-B1 in murine and human skin tissue and then by using immunoblotting, immunoprecipitation, RT-PCR, and confocal microscopy we have demonstrated the translocation and the subsequent lost of SR-B1 in human keratinocytes (cell culture model after CS exposure is driven by hydrogen peroxide (H(2O(2 that derives not only from the CS gas phase but mainly from the activation of cellular NADPH oxidase (NOX. This effect was reversed when the cells were pretreated with NOX inhibitors or catalase. Furthermore, CS caused the formation of SR-B1-aldheydes adducts (acrolein and 4-hydroxy-2-nonenal and the increase of its ubiquitination, which could be one of the causes of SR-B1 loss. In conclusion, exposure to CS, through the production of H(2O(2, induced post-translational modifications of SR-B1 with the consequence lost of the receptor and this may contribute to the skin physiology alteration as a consequence of the variation of cholesterol uptake.

  3. Molecular alterations of tropoelastin and proteoglycans induced by tobacco smoke extracts and ultraviolet A in cultured skin fibroblasts

    International Nuclear Information System (INIS)

    Yin, Lei; Morita, Akimichi; Tsuji, Takuo

    2002-01-01

    Functional integrity of normal skin is dependent on the balance between the biosynthesis and degradation of extracellular matrix, primarily composed of collagen, elastin and proteoglycans. In our previous studies, we found that tobacco smoke extracts decreased expressions of type I and III procollagen and induced matrix metalloproteinase-1 (MMP-1) and MMP-3 in the cultured skin fibroblasts. We here further investigated the effects of tobacco smoke extracts or ultraviolet A (UVA) treatments on the expression of tropoelastin (soluble elastin protein), and versican and decorin (proteoglycans) in cultured skin fibroblasts. The mRNA of tropoelastin increased by tobacco smoke extracts or UVA irradiation. Versican was markedly shown to decrease after these treatments by using western blotting and the mRNA of versican V0 also significantly decreased. UVA treatment did not show remarkable change in decorin protein, but resulted in marked decrease of decorin D1 mRNA. In contrast to UVA irradiation, the treatments of tobacco smoke extracts resulted in significant increase in decorin, while mRNA of decorin D1 decreased as compared to the control. MMP-7 increased after the treatment of tobacco smoke extracts or UVA. These results indicated that common molecular features might underlie the skin premature aging induced by tobacco smoke extracts and UVA, including abnormal regulation of extracellular matrix deposition through elevated MMPs, reduced collagen production, abnormal tropoelastin accumulation, and altered proteoglycans. (author)

  4. Propionibacterium acnes induces autophagy in keratinocytes: involvement of multiple mechanisms.

    Science.gov (United States)

    Megyeri, Klára; Orosz, László; Bolla, Szilvia; Erdei, Lilla; Rázga, Zsolt; Seprényi, György; Urbán, Edit; Szabó, Kornélia; Kemény, Lajos

    2017-11-27

    Propionibacterium acnes is a dominant member of the cutaneous microbiota. Herein, we evaluate the effects of different P. acnes strains and propionic acid on autophagy in keratinocytes. Our results showed that P. acnes strain 889 altered the architecture of the mitochondrial network, elevated the levels of LC3B-II, Beclin-1 and phospho-AMPKα, stimulated autophagic flux, facilitated intracellular redistribution of LC3B, increased average number of autophagosomes per cell, and enhanced development of acidic vesicular organelles in the HPV-KER cell line. Propionic acid increased the level of phospho-AMPKα, enhanced lipidation of LC3B, stimulated autophagic flux, as well as facilitated translocation of LC3B into autophagosomes in HPV-KER cells. P. acnes strains 889, 6609 and heat-killed strain 889 also stimulated autophagosome formation in primary keratinocytes to varying degrees. These results indicate that cell wall components and secreted propionic acid metabolite of P. acnes evoke mitochondrial damage successively, thereby trigger AMPK-associated activation of autophagy, which in turn facilitates the removal of dysfunctional mitochondria and promotes survival of keratinocytes. Thus, we suggest that low-level colonization of hair follicles with non-invasive P. acnes strains, by triggering a local increase in autophagic activity, might exert a profound effect on several physiological processes responsible for the maintenance of skin tissue homeostasis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  6. Low power millimeter wave irradiation exerts no harmful effect on human keratinocytes in vitro.

    Science.gov (United States)

    Szabo, Imre; Manning, Michael R; Radzievsky, Alexander A; Wetzel, Michele A; Rogers, Thomas J; Ziskin, Marvin C

    2003-04-01

    Low power millimeter wave (LP-MW) irradiation has been successfully used in clinical practice as an independent and/or supplemental therapy in patients with various diseases. It is still not clear, however, whether exposed skin is directly affected by repeated LP-MW irradiation and whether cells of the epidermis can be activated by the absorbed energy. Keratinocytes, the most numerous component of the epidermis are believed to manifest functional responses to physical stimuli. In this study we analyzed whether LP-MW irradiation modulated the production of chemokines, including RANTES and IP-10 of keratinocytes in vitro. We also investigated whether LP-MW irradiation induces a heat stress reaction in keratinocytes, and stimulates heat shock protein 70 (Hsp70) production. Vital staining of keratinocytes with carboxyfluorescein succinimidyl ester and ethidium bromide was used to analyze the MW effect on the viability of adherent cells. In addition, we studied the effect of LP-MW irradiation on intercellular gap junctional communication in keratinocyte monolayers by Lucifer yellow dye transfer. We found no significant changes in constitutive RANTES and inducible IP-10 production following LP-MW irradiation. LP-MW exposure of keratinocyte monolayers did not alter Hsp70 production, unlike exposure to higher power MWs (HP-MW) or hyperthermia (43 degrees C; 1 h). LP-MW irradiation and hyperthermia did not alter the viability of adherent keratinocytes, while HP-MW irradiation induced cellular damage within the beam area. Finally, we found no alteration in the gap junctional intercellular communication of keratinocytes following LP-MW irradiation, which on the other hand, was significantly increased by hyperthermia. In summary, we detected no harmful effect of LP-MW irradiation on both keratinocyte function and structure in vitro, although these cells were sensitive to higher MW power that developed heat stress reaction and cellular damage. Our results provide further

  7. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  8. Inhibitory Activity of the Flower Buds of Lonicera japonica Thunb. against Histamine Production and L-Histidine Decarboxylase in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshihiro Inami

    2014-06-01

    Full Text Available In previous studies we found that anionic surfactants such as sodium laurate (SL and/or sodium dodecylsulfate (SDS exert actions on epidermal keratinocytes rather than mast cells to give rise of histamine production and skin itching through increasing the expression of the 53-kDa active form of l-histidine decarboxylase (HDC. In addition, with treatment of SL in a three-dimensional human keratinocyte culture, increases in both the 53-kDa HDC and histamine production are detected and thus this culture assay is applied to screen anti-itching materials from natural resources. In this study, the inhibitory activity of “Kin-gin-ka” (flower buds of Lonicera japonica Thunb., FLJ against histamine production and expression of the active form of HDC were examined in this culture assay. FLJ is a well-known traditional Chinese medicine, being used to treat fevers, coughs and some infectious diseases. The result showed both FLJ and chlorogenic acid had inhibitory activities against the expression of 53-kDa HDC and histamine production. However, chlorogenic acid showed a weaker effect on histamine production than that of FLJ, suggesting that other chemical constituents besides chlorogenic acid could contribute to the inhibitory activities. Thus, a further chemical study of FLJ is now under investigation.

  9. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  10. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  11. Prevalence and demographics of methicillin resistant Staphylococcus aureus in culturable skin and soft tissue infections in an urban emergency department

    Directory of Open Access Journals (Sweden)

    Fermann Gregory J

    2007-10-01

    Full Text Available Abstract Background The rising incidence of methicillin resistant Staph. aureus (MRSA infections is a concern for emergency practitioners. While studies have examined MRSA in inpatients, few have focused on emergency department populations. We sought to describe predictors of MRSA skin infections in an emergency department population. Methods This was a prospective observational cohort study conducted over three months in 2005. A convenience sample of patients with culturable skin infections presenting to a busy, urban emergency department was enrolled. Demographic and risk factor information was collected by structured interview. The predictive value of each risk factor for MRSA, as identified by culture, was tested using univariable logistic regression, and a multivariable predictive model was developed. Results Patients were 43% black, 40% female and mean age was 39 years (SD 14 years. Of the 182 patients with cultures, prevalence of MRSA was 58% (95%CI 50% to 65%. Significant predictors of MRSA were youth, lower body mass index, sexual contact in the past month, presence of an abscess cavity, spontaneous infection, and incarceration. The multivariable model had a C-statistic of 0.73 (95%CI 0.67 to 0.79 with four significant variables: age, group living, abscess cavity, and sexual contact within one month. Conclusion In this population of emergency department patients, MRSA skin infection was related to youth, recent sexual contact, presence of abscess, low body mass index, spontaneity of infection, incarceration or contact with an inmate, and group home living.

  12. Cerebrohepatorenal Syndrome (CHRS) of Zellweger: lysosomal enzyme activities, sulfation of glycosaminoglycans, and pipecolic acid levels in cultured skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, E.C.P.

    1985-01-01

    The defect in the cerebrohepatorenal syndrome (CHRS), a fatal hereditary disorder primarily affecting neurological development, is unknown. Three areas were studied for specific biochemical abnormalities which might aid in diagnosis and understanding of the disorder: (1) Clinico-pathological similarities to inherited degenerative neurologic disorders suggested decreased activity of certain lysosomal enzymes. Assays of ..beta..-galactosidase, ..beta..-hexosaminidase, ..cap alpha..-mannosidase, and arylsulfatase A activities in fibroblasts from four infants with CHRS indicated no deficiency of enzyme activities. (2) Undersulfation of glycosaminoglycans (GAGs) has been reported in patients with the clinically similar Lowe's syndrome. The rate and amount of incorporation of /sup 35/SO/sub 4/ = into intracellular /sup 35/S-GAGs up to 48 hours was comparable in fibroblasts from six CHRS infants and controls. Loss of /sup 35/-GAGs also followed a normal pattern. (3) Because pipecolic acid (PA) has been reported to be elevated in body fluids of patients with CHRS, cultured skin fibroblasts were examined for such an abnormality. Lysosomal enzyme activities and metabolism of sulfated glycosaminoglycans appear to be normal in cultured skin fibroblasts from infants with CHRS. Despite the sensitivity of the method, examination of pipecolic acid in cultured skin fibroblasts does not seem to be useful for diagnosis of CHRS.

  13. Calcipotriol inhibits the proliferation of hyperproliferative CD29 positive keratinocytes in psoriatic epidermis in the absence of an effect on the function and number of antigen-presenting cells

    DEFF Research Database (Denmark)

    Jensen, A.M.; Llado, Minna Fyhn Lykke; Skov, L.

    1998-01-01

    -presenting cells in psoriatic epidermis. In contrast, we found that calcipotriol significantly inhibited the proliferation of epidermal cells isolated from psoriatic skin after in vivo treatment, as determined by propidium iodide staining and flow cytometry. More specifically, we stained for CD29+ keratinocytes...... and found an even more significant reduction in proliferative capacity. This cell type contains the population of hyperproliferative keratinocytes in psoriatic epidermis. In conclusion, calcipotriol seems to act via an inhibitory effect on hyperproliferative basal keratinocytes of psoriatic epidermis...

  14. Bifidobacterium fermented milk and galacto-oligosaccharides lead to improved skin health by decreasing phenols production by gut microbiota.

    Science.gov (United States)

    Miyazaki, K; Masuoka, N; Kano, M; Iizuka, R

    2014-06-01

    A questionnaire survey found that women suffering from abnormal bowel movements have many skin problems such as a high frequency of dry skin. Although there are similarities between the structure and barrier function mechanism of the gut and skin, experimental data are insufficient to show an association between the intestinal environment and skin conditions. Phenols, for example phenol and p-cresol, as metabolites of aromatic amino acids produced by gut bacteria, are regarded as bioactive toxins and serum biomarkers of a disturbed gut environment. Recent studies have demonstrated that phenols disturb the differentiation of monolayer-cultured keratinocytes in vitro, and that phenols produced by gut bacteria accumulate in the skin via the circulation and disrupt keratinocyte differentiation in hairless mice. Human studies have demonstrated that restriction of probiotics elevated serum free p-cresol levels and harmed skin conditions (reduced skin hydration, disrupted keratinisation). In contrast, daily intake of the prebiotic galacto-oligosaccharides (GOS) restored serum free p-cresol levels and skin conditions in adult women. Moreover, a double-blind placebo-controlled trial demonstrated that the daily intake of fermented milk containing the probiotic Bifidobacterium breve strain Yakult and prebiotic GOS reduced serum total phenol levels and prevented skin dryness and disruption of keratinisation in healthy adult women. It is concluded that phenols produced by gut bacteria are one of the causes of skin problems. Probiotics and/or prebiotics, such as B. breve strain Yakult and/or GOS, are expected to help maintain a healthy skin by decreasing phenols production by gut microbiota. These findings support the hypothesis that probiotics and prebiotics provide health benefits to the skin as well as the gut.

  15. Study of epithelial differentiation and protein expression of keratinocyte-mesenchyme stem cell co-cultivation on electrospun nylon/B. vulgaris extract composite scaffold.

    Science.gov (United States)

    Hosseinzadeh, Simzar; Soleimani, Masoud; Vossoughi, Manuchehr; Ranjbarvan, Parviz; Hamedi, Shokoh; Zamanlui, Soheila; Mahmoudifard, Matin

    2017-06-01

    Employing of the composite electrospun scaffold containing herbal extract in conjugation with co-culturing of cells can open up new window to the design of efficient biomaterials for skin tissue regeneration. Here, we introduce the synergistic effect of composite electrospun nanofibrous scaffold of nylon66 loaded with Beta vulgaris (B. vulgaris) (extract of beet roots, a plants whose widely used in Iranian folk medicine as wound healing medicine) and co-culture of mesenchymal stem-cells (MSCs)-human keratinocyte (H-keratino) differentiation towards epithelial lineage. In vitro biocompatibility was examined through MTT assay and epithelial differentiation checked by real-time PCR and immunocytochemistry (ICC) assay after co-culturing of MSCs and H-keratino on proposed scaffold. Significant enhancement in cell proliferation was detected after cell culturing on the composite type of electrospun scaffold containing B. vulgaris. Moreover, after 14days of co-culturing process, gene expression results revealed that both composite and non-composite nylon66 electrospun scaffold promote epithelial differentiation compared to mono-cell culturing of H-keratino in terms of several markers as Cytokeratin 10, Cytokeratin 14 and Involucrin and ICC of some dermal proteins like Cytokeratin 14 and Loricrin. To the best of our knowledge, findings of this study will introduce new way for the generation of novel biomaterials for the development of current skin tissue engineering. Copyright © 2017. Published by Elsevier B.V.

  16. Neonatal adrenoleukodystrophy. Impaired plasmalogen biosynthesis and peroxisomal beta-oxidation due to a deficiency of catalase-containing particles (peroxisomes) in cultured skin fibroblasts

    NARCIS (Netherlands)

    Wanders, R. J.; Schutgens, R. B.; Schrakamp, G.; Tager, J. M.; van den Bosch, H.; Moser, A. B.; Moser, H. W.

    1987-01-01

    Neonatal adrenoleukodystrophy belongs to the newly recognized group of inherited diseases, the peroxisomal disorders. Based on the reported similarities between neonatal adrenoleukodystrophy and the cerebro-hepato-renal (Zellweger) syndrome, we have studied peroxisomal functions in cultured skin

  17. Novel biodegradable porous scaffold applied to skin regeneration.

    Science.gov (United States)

    Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling

    2013-01-01

    Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  18. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  19. Cell death induced on cell cultures and nude mouse skin by non-thermal, nanosecond-pulsed generated plasma.

    Directory of Open Access Journals (Sweden)

    Arnaud Duval

    Full Text Available Non-thermal plasmas are gaseous mixtures of molecules, radicals, and excited species with a small proportion of ions and energetic electrons. Non-thermal plasmas can be generated with any high electro-magnetic field. We studied here the pathological effects, and in particular cell death, induced by nanosecond-pulsed high voltage generated plasmas homogeneously applied on cell cultures and nude mouse skin. In vitro, Jurkat cells and HMEC exhibited apoptosis and necrosis, in dose-dependent manner. In vivo, on nude mouse skin, cell death occurred for doses above 113 J/cm(2 for the epidermis, 281 J/cm(2 for the dermis, and 394 J/cm(2 for the hypodermis. Using electron microscopy, we characterized apoptosis for low doses and necrosis for high doses. We demonstrated that these effects were not related to thermal, photonic or pH variations, and were due to the production of free radicals. The ability of cold plasmas to generate apoptosis on cells in suspension and, without any sensitizer, on precise skin areas, opens new fields of application in dermatology for extracorporeal blood cell treatment and the eradication of superficial skin lesions.

  20. A Patient with Multiple Keratinocytic Cancers (MKC: Uncommon Presentation in a Bulgarian Patient

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Keratinocyte skin cancers, including basal cell carcinoma (BCC and squamous cell carcinoma (SCC, are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not.  Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  1. A Patient with Multiple Keratinocytic Cancers (MKC): Uncommon Presentation in a Bulgarian Patient.

    Science.gov (United States)

    Tchernev, Georgi; Philipov, Stanislav; Chokoeva, Anastasiya Atanasova; Wollina, Uwe; Lotti, Torello; Lozev, Ilia; Yungareva, Irina; Maximov, Georgi Konstantinov

    2018-01-25

    Keratinocyte skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not. Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  2. TLR2 expression is increased in rosacea and stimulates enhanced serine protease production by keratinocytes.

    Science.gov (United States)

    Yamasaki, Kenshi; Kanada, Kimberly; Macleod, Daniel T; Borkowski, Andrew W; Morizane, Shin; Nakatsuji, Teruaki; Cogen, Anna L; Gallo, Richard L

    2011-03-01

    A diverse environment challenges skin to maintain temperature, hydration, and electrolyte balance while also maintaining normal immunological function. Rosacea is a common skin disease that manifests unique inflammatory responses to normal environmental stimuli. We hypothesized that abnormal function of innate immune pattern recognition could explain the enhanced sensitivity of patients with rosacea, and observed that the epidermis of patients with rosacea expressed higher amounts of Toll-like receptor 2 (TLR2) than normal patients. Increased expression of TLR2 was not seen in other inflammatory skin disorders such as atopic dermatitis or psoriasis. Overexpression of TLR2 on keratinocytes, treatment with TLR2 ligands, and analysis of TLR2-deficient mice resulted in a calcium-dependent release of kallikrein 5 from keratinocytes, a critical protease involved in the pathogenesis of rosacea. These observations show that abnormal TLR2 function may explain enhanced inflammatory responses to environmental stimuli and can act as a critical element in the pathogenesis of rosacea.

  3. Use of Clotted Human Plasma and Aprotinin in Skin Tissue Engineering: A Novel Approach to Engineering Composite Skin on a Porous Scaffold.

    Science.gov (United States)

    Paul, Michelle; Kaur, Pritinder; Herson, Marisa; Cheshire, Perdita; Cleland, Heather; Akbarzadeh, Shiva

    2015-10-01

    Tissue-engineered composite skin is a promising therapy for the treatment of chronic and acute wounds, including burns. Providing the wound bed with a dermal scaffold populated by autologous dermal and epidermal cellular components can further entice host cell infiltration and vascularization to achieve permanent wound closure in a single stage. However, the high porosity and the lack of a supportive basement membrane in most commercially available dermal scaffolds hinders organized keratinocyte proliferation and stratification in vitro and may delay re-epithelization in vivo. The objective of this study was to develop a method to enable the in vitro production of a human skin equivalent (HSE) that included a porous scaffold and dermal and epidermal cells expanded ex vivo, with the potential to be used for definitive treatment of skin defects in a single procedure. A collagen-glycosaminoglycan dermal scaffold (Integra(®)) was populated with adult fibroblasts. A near-normal skin architecture was achieved by the addition of coagulated human plasma to the fibroblast-populated scaffold before seeding cultured keratinocytes. This resulted in reducing scaffold pore size and improving contact surfaces. Skin architecture and basement membrane formation was further improved by the addition of aprotinin (a serine protease inhibitor) to the culture media to inhibit premature clot digestion. Histological assessment of the novel HSE revealed expression of keratin 14 and keratin 10 similar to native skin, with a multilayered neoepidermis morphologically comparable to human skin. Furthermore, deposition of collagen IV and laminin-511 were detected by immunofluorescence, indicating the formation of a continuous basement membrane at the dermal-epidermal junction. The proposed method was efficient in producing an in vitro near native HSE using the chosen off-the-shelf porous scaffold (Integra). The same principles and promising outcomes should be applicable to other biodegradable

  4. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  5. Use of primary cell cultures to measure the late effects in the skins of rhesus monkeys irradiated with protons

    Science.gov (United States)

    Cox, A. B.; Wood, D. H.; Lett, J. T.

    Previous pilot investigations of the uses of primary cell cultures to study late damage in stem cells of the skin of the New Zealand white (NZW) rabbit and the rhesus monkey /1-3/, have been extended to individual monkeys exposed to 55 MeV protons. Protons of this energy have a larger range in tissue of (~2.6 cm) than the 32 MeV protons (~0.9 cm) to which the animals in our earlier studies had been exposed. Although the primary emphases in the current studies were improvement and simplification in the techniques and logistics of transportation of biopsies to a central analytical facility, comparison of the quantitative measurements obtained thus far for survival of stem cells in the skins from animals irradiated 21 years ago reveals that the effects of both proton energies are similar.

  6. Malassezia furfur induces the expression of beta-defensin-2 in human keratinocytes in a protein kinase C-dependent manner.

    Science.gov (United States)

    Donnarumma, Giovanna; Paoletti, Iole; Buommino, Elisabetta; Orlando, Manuela; Tufano, Maria Antonietta; Baroni, Adone

    2004-04-01

    Antimicrobial peptides of the beta-defensin family are expressed in all human epithelial tissues tested to date and have recently been the subject of vigorous investigation. Their localization and characteristics support the hypothesis that these peptides play a role in mucosal and skin defense. The lipophilic yeast Malassezia furfur is a saprophyte found in normal human cutaneous flora. Malassezia furfur is not only a saprophyte, but is also associated with several diseases such as Malassezia folliculitis, seborrheic dermatitis and some forms of atopic dermatitis, psoriasis and confluent and reticulate papillomatosis. Little is known about the mechanism by which M. furfur overcomes the natural barrier of the skin. To further define the role of the beta-defensins in the innate human skin immune response, we analyzed the mRNA expression of two human beta-defensins HBD-1 and HBD-2 in human keratinocytes treated with M. furfur. In addition, we looked into how M. furfur of TGF-beta1 and IL-10, cytokines that interfere with the development of protective cell immunity, regulate their expression. Finally, we examined the signal transduction mechanisms involved during M. furfur uptake. Cultured human keratinocytes were treated with M. furfur. The mRNA and protein expression were analyzed, respectively, by reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. Our data demonstrate that M. furfur does not modify HBD-1 expression, whereas it up-regulates, via protein kinase C (PKC), the expression of HBD-2, TGFbeta-1 and IL-10 48 h after treatment. Our results suggest that beta-defensins are integral components of innate host defenses. They play an essential part in the resistance of the human skin surfaces against M. furfur uptake and other microbial invasion.

  7. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  8. High molecular weight plant heteropolysaccharides stimulate fibroblasts but inhibit keratinocytes.

    Science.gov (United States)

    Shahbuddin, Munira; Shahbuddin, Dahlia; Bullock, Anthony J; Ibrahim, Halijah; Rimmer, Stephen; MacNeil, Sheila

    2013-06-28

    Konjac glucomannan (KGM) is a natural polysaccharide of β(1-4)-D-glucomannopyranosyl backbone of D-mannose and D-glucose derived from the tuber of Amorphophallus konjac C. Koch. KGM has been reported to have a wide range of activities including wound healing. In this study we examined KGM extracts prepared from five plant species, (Amorphophallus konjac Koch, Amorphophallus oncophyllus, Amorphophallus prainii, Amorphophallus paeoniifolius and Amorphophallus elegans) for their effects on cultured human keratinocytes and fibroblasts. Extracts from A. konjac Koch, A. oncophyllus and A. prainii (but not from A. paeoniifolius or A. elegans) stimulated fibroblast proliferation both in the absence and presence of serum. However, these materials inhibited keratinocyte proliferation. The fibroblast stimulatory activity was associated with high molecular weight fractions of KGM and was lost following ethanol extraction or enzyme digestion with β-mannanase. It was also reduced by the addition of concanavalin A but not mannose suggesting that these heteropolysaccharides are acting on lectins but not via receptors specific to mannose. The most dramatic effect of KGM was seen in its ability to support fibroblasts for 3weeks under conditions of deliberate media starvation. This effect did not extend to supporting keratinocytes under conditions of media starvation but KGM did significantly help support adipose derived stem cells under media starvation conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Up-modulation of the expression of functional keratinocyte growth factor receptors induced by high cell density in the human keratinocyte HaCaT cell line.

    Science.gov (United States)

    Capone, A; Visco, V; Belleudi, F; Marchese, C; Cardinali, G; Bellocci, M; Picardo, M; Frati, L; Torrisi, M R

    2000-11-01

    Keratinocyte growth factor (KGF) is involved in the control of proliferation and differentiation of human keratinocytes. It binds to, and activates, the tyrosine kinase KGF receptor (KGFR), a splicing transcript variant of the fibroblast growth factor receptor 2. We have previously shown (C. Marchese et al., Cell Growth Differ., 8: 989-997, 1997) that differentiation of primary cultured keratinocytes triggered by high Ca2+ concentrations in the growing medium induced up-regulation of KGFR expression, which suggested that KGFR may play a crucial role in the control of the proliferative/differentiative program during transition from basal to suprabasal cells. Here we analyzed the process of modulation of the expression of KGFRs in the human keratinocyte cell line HaCaT, widely used as a model to study keratinocyte differentiation. Western blot and double immunofluorescence for KGFR and the K1 differentiation marker showed that cell differentiation and stratification induced by confluence and high cell density correlated with an increase in KGFR expression. KGFRs, present on suprabasal differentiated cells, appeared to be efficiently tyrosine-phosphorylated by KGF, which indicated that the receptors up-regulated by differentiation can be functionally activated by ligand binding. Bromodeoxyuridine incorporation assay revealed that a significant portion of suprabasal differentiated cells expressing KGFR seemed to be still able to synthesize DNA and to proliferate in response to KGF, which suggested that increased KGFR expression may be required for retention of the proliferative activity.

  10. Grading keratinocyte atypia in actinic keratosis: a correlation of reflectance confocal microscopy and histopathology.

    Science.gov (United States)

    Pellacani, G; Ulrich, M; Casari, A; Prow, T W; Cannillo, F; Benati, E; Losi, A; Cesinaro, A M; Longo, C; Argenziano, G; Soyer, H P

    2015-11-01

    Actinic Keratosis (AK) is the clinical manifestation of cutaneous dysplasia of epidermal keratinocytes, with progressive trend towards squamous cell carcinoma. To evaluate the strength of the correlation between keratinocyte atypia, as detected by Reflectance Confocal Microscopy (RCM) and histopathology, and to develop a more objective atypia grading scale for RCM quantification, through a discrete ranking. A total of 48 AKs and two control areas (photodamaged and non-photodamaged skin) were selected for this study. All these areas were documented by RCM and biopsied for histopathology. One representative image of the epidermis was selected for RCM and for histopathology and used for side-by-side comparison with purpose written software. The assessor chose which of two images displayed more keratinocyte atypia, and an ordered list from the image showing the least to the most keratinocyte atypia was generated. Three evaluations were obtained for RCM and two for histopathology. Good interobserver correlation was obtained for RCM and histopathology grading, with high concordance between RCM and histopathology grading. Expert rater scan consistently distinguish different grades of cytological atypia. Non-invasive RCM data from in vivo imaging can be graded for keratinocyte atypia, comparable to histopathological grading. © 2015 European Academy of Dermatology and Venereology.

  11. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  12. Activation of caspase-9 is required for UV-induced apoptosis of human keratinocytes.

    Science.gov (United States)

    Sitailo, Leonid A; Tibudan, Shalini S; Denning, Mitchell F

    2002-05-31

    UV radiation from the sun activates both the membrane death receptor and the intrinsic or mitochondrial apoptotic signaling pathways in epidermal keratinocytes, triggering apoptosis and affording protection against skin cancer formation. We have investigated the involvement of caspase-9 in the UV death effector pathway in human keratinocytes, since this is the initiating caspase in the mitochondrial pathway required for UV-induced apoptosis in some, but not all, cell types. UV radiation triggered activation of caspase-3, caspase-9, and caspase-8 with similar kinetics, although the rank order of activation was caspase-3 > caspase-9 > caspase-8. Inhibition of caspase-9 with either the peptide inhibitor benzyloxycarbonyl-Leu-Glu(OCH(3))-His-Asp(OCH(3))-fluoromethyl ketone, or expression of a catalytically inactive caspase-9 by retroviral transduction, protected normal keratinocytes from UV-induced apoptosis. HaCaT keratinocytes harboring mutant p53 alleles were also protected from UV-induced apoptosis by the dominant negative caspase-9. The dominant negative caspase-9 blocked UV-induced activation of caspase-3, caspase-9, and caspase-8, and also protected cells from the loss of mitochondrial membrane potential. In contrast, the dominant negative caspase-9 did not protect from anti-Fas-induced apoptosis or caspase activation. These results identify caspase-9 as the critical upstream caspase initiating apoptosis by UV radiation in human keratinocytes, the relevant cell type for this important environmental carcinogen.

  13. Tissue-Engineered Skin Substitute Enhances Wound Healing after Radiation Therapy.

    Science.gov (United States)

    Busra, Mohd Fauzi bin Mh; Chowdhury, Shiplu Roy; bin Ismail, Fuad; bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2016-03-01

    When given in conjunction with surgery for treating cancer, radiation therapy may result in impaired wound healing, which, in turn, could cause skin ulcers. In this study, bilayer and monolayer autologous skin substitutes were used to treat an irradiated wound. A single dose of 30 Gy of linear electron beam radiation was applied to the hind limb of nude mice before creating the skin lesion (area of 78.6 mm). Monolayer tissue-engineered skin substitutes (MTESSs) were prepared by entrapping cultured keratinocytes in fibrin matrix, and bilayer tissue-engineered skin substitutes (BTESSs) were prepared by entrapping keratinocytes and fibroblasts in separate layers. Bilayer tissue-engineered skin substitute and MTESS were implanted to the wound area. Gross appearance and wound area were analyzed to evaluate wound healing efficiency. Skin regeneration and morphological appearance were observed via histological and electron microscopy. Protein expressions of transforming growth factor β1 (TGF-β1), platelet-derived growth factor BB (PDGF-BB), and vascular endothelial growth factor (VEGF) in skin regeneration were evaluated by immunohistochemistry (IHC). Macroscopic observation revealed that at day 13, treatments with BTESS completely healed the irradiated wound, whereas wound sizes of 1.1 ± 0.05 and 6.8 ± 0.14 mm were measured in the MTESS-treated and untreated control groups, respectively. Hematoxylin-eosin (H&E) analysis showed formation of compact and organized epidermal and dermal layers in the BTESS-treated group, as compared with MTESS-treated and untreated control groups. Ultrastructural analysis indicates maturation of skin in BTESS-treated wound evidenced by formation of intermediate filament bundles in the dermal layer and low intercellular space in the epidermal layer. Expressions of TGF-β1, PDGF-BB, and VEGF were also higher in BTESS-treated wounds, compared with MTESS-treated wounds. These results indicate that BTESS is the preferred treatment for

  14. Thyrotropin-releasing hormone (TRH promotes wound re-epithelialisation in frog and human skin.

    Directory of Open Access Journals (Sweden)

    Natalia T Meier

    Full Text Available There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression. Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters.

  15. Nanodiamonds protect skin from ultraviolet B-induced damage in mice.

    Science.gov (United States)

    Wu, Meng-Si; Sun, Der-Shan; Lin, Yu-Chung; Cheng, Chia-Liang; Hung, Shih-Che; Chen, Po-Kong; Yang, Jen-Hung; Chang, Hsin-Hou

    2015-05-07

    Solar ultraviolet (UV) radiation causes various deleterious effects, and UV blockage is recommended for avoiding sunburn. Nanosized titanium dioxide and zinc oxide offer effective protection and enhance cosmetic appearance but entail health concerns regarding their photocatalytic activity, which generates reactive oxygen species. These concerns are absent in nanodiamonds (NDs). Among the UV wavelengths in sunlight, UVB irradiation primarily threatens human health. The efficacy and safety of NDs in UVB protection were evaluated using cell cultures and mouse models. We determined that 2 mg/cm(2) of NDs efficiently reduced over 95% of UVB radiation. Direct UVB exposure caused cell death of cultured keratinocyte, fibroblasts and skin damage in mice. By contrast, ND-shielding significantly protected the aforementioned pathogenic alterations in both cell cultures and mouse models. NDs are feasible and safe materials for preventing UVB-induced skin damage.

  16. Identification of novel keratinocyte-secreted peptides dermokine-alpha/-beta and a new stratified epithelium-secreted protein gene complex on human chromosome 19q13.1.

    Science.gov (United States)

    Matsui, Takeshi; Hayashi-Kisumi, Fumie; Kinoshita, Yoko; Katahira, Sayaka; Morita, Kazumasa; Miyachi, Yoshiki; Ono, Yuichi; Imai, Toshio; Tanigawa, Yoko; Komiya, Tohru; Tsukita, Shoichiro

    2004-08-01

    We performed high-throughput in situ hybridization screening of sections of mouse epidermis using an equalized skin cDNA library as probes and identified a novel gene giving rise to two splicing variants, both of which are expressed in the spinous layer. This gene was mapped between two genes encoding keratinocyte-related peptides, suprabasin and keratinocyte differentiation-associated protein (Kdap), on human chromosome 19q13.1. These gene products appeared to carry functional signal sequences. We then designated these two splicing variants as dermokine-alpha and -beta. Northern blotting and quantitative RT-PCR revealed that dermokine-alpha/-beta, suprabasin, and Kdap were highly expressed in stratified epithelia. In mouse embryonic development, dermokine-alpha/-beta began to be expressed during the period of stratification. Also, in differentiating primary cultured human keratinocytes, transcription of dermokine-alpha/-beta, suprabasin, and Kdap was induced. These findings indicated that dermokine-alpha/-beta, suprabasin, and Kdap are secreted from the spinous layer of the stratified epithelia and that these genes form a novel gene complex on the chromosome.

  17. Topical stabilized retinol treatment induces the expression of HAS genes and HA production in human skin in vitro and in vivo.

    Science.gov (United States)

    Li, Wen-Hwa; Wong, Heng-Kuan; Serrano, José; Randhawa, Manpreet; Kaur, Simarna; Southall, Michael D; Parsa, Ramine

    2017-05-01

    Skin Aging manifests primarily with wrinkles, dyspigmentations, texture changes, and loss of elasticity. During the skin aging process, there is a loss of moisture and elasticity in skin resulting in loss of firmness finally leading to skin sagging. The key molecule involved in skin moisture is hyaluronic acid (HA), which has a significant water-binding capacity. HA levels in skin decline with age resulting in decrease in skin moisture, which may contribute to loss of firmness. Clinical trials have shown that topically applied ROL effectively reduces wrinkles and helps retain youthful appearance. In the current study, ROL was shown to induce HA production and stimulates the gene expression of all three forms of hyaluronic acid synthases (HAS) in normal human epidermal keratinocytes monolayer cultures. Moreover, in human skin equivalent tissues and in human skin explants, topical treatment of tissues with a stabilized-ROL formulation significantly induced the gene expression of HAS mRNA concomitant with an increased HA production. Finally, in a vehicle-controlled human clinical study, histochemical analysis confirmed increased HA accumulation in the epidermis in ROL-treated human skin as compared to vehicle. These results show that ROL increases skin expression of HA, a significant contributing factor responsible for wrinkle formation and skin moisture, which decrease during aging. Taken together with the activity to increase collagen, elastin, and cell proliferation, these studies establish that retinol provides multi-functional activity for photodamaged skin.

  18. Low doses of UVB or UVA induce chromosomal aberrations in cultured human skin cells

    NARCIS (Netherlands)

    Emri, G.; Wenczl, E.; Erp, P. van; Jans, J.; Roza, L.; Horkay, I.; Schothorst, A.A.

    2000-01-01

    Chromosomal defects are frequently present in malignant and premalignant skin disorders; however, it is not known whether ultraviolet radiation from sunlight plays a role in their induction. To obtain information on the ability of ultraviolet A and ultraviolet B to induce chromosomal aberrations,

  19. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  20. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  1. Air-Stimulated ATP Release from Keratinocytes Occurs through Connexin Hemichannels

    Science.gov (United States)

    Barr, Travis P.; Albrecht, Phillip J.; Hou, Quanzhi; Mongin, Alexander A.; Strichartz, Gary R.; Rice, Frank L.

    2013-01-01

    Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil). These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease. PMID:23457608

  2. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  3. Analysis of the response of human keratinocytes to Malassezia globosa and restricta strains.

    Science.gov (United States)

    Donnarumma, Giovanna; Perfetto, Brunella; Paoletti, Iole; Oliviero, Giovanni; Clavaud, Cécile; Del Bufalo, Aurelia; Guéniche, Audrey; Jourdain, Roland; Tufano, Maria Antonietta; Breton, Lionel

    2014-10-01

    Malassezia spp. are saprophyte yeasts involved in skin diseases with different degrees of severity. The aim of our study was to analyze the response of human epidermal keratinocytes to Malassezia globosa and restricta strains evaluating the host defence mechanisms induced by Malassezia spp. colonization. Our results showed a different modulation of the inflammatory and immunomodulatory cytokine pathways obtained with the different strains of Malassezia tested. In addition, this expression is altered by blocking the TLR2 receptor. In comparison with M. furfur, M. globosa and restricta displayed an unexpected and striking cytotoxicity on keratinocytes. The differences observed could be related to the different modalities of interaction between keratinocytes and Malassezia strains, but also to their growth condition. Taken together, these results indicate that M. globosa or M. restricta colonization exert a different control on the cytokine inflammatory response activated in the human keratinocyte in which TLR2 might be involved. M. globosa and M. restricta may play a synergistic role in the exacerbation of skin diseases in which both are found.

  4. Long-term Genoprotection Effect of Sechium edule Fruit Extract Against UVA Irradiation in Keratinocytes.

    Science.gov (United States)

    Metral, Elodie; Rachidi, Walid; Damour, Odile; Demarne, Frédéric; Bechetoille, Nicolas

    2018-03-01

    Photoprotection is essential to prevent the long-term deleterious effects of ultraviolet (UV), including skin cancer and photoaging. So far, there has been an increase in the use of natural bioactive phytochemicals for the development of more effective skin photoprotective agents. However, the molecular mechanisms underlying the photochemoprotection activity of such compounds remain largely unknown. The objective of this study was to investigate the effects of a Sechium edule fruit extract (SEE) in terms of photoprotection against UVA in primary human keratinocytes. We found that SEE protected keratinocytes against UVA-induced cytotoxicity, decreased the intracellular amounts of reactive oxygen species, and reduced oxidatively induced DNA lesions after UVA exposure. Furthermore, SEE decreased the induction of CPD lesions in UVA-irradiated keratinocytes and exhibited increased DNA repair of such photoproducts at 24 h postexposure. Finally, using DNA repair biochips, we demonstrated that SEE-treated keratinocytes had DNA enzymatic repair activities more efficient for abasic sites, CPD and thymine glycols. Therefore, the benefits of SEE against UVA could be explained by a combination of antioxidant activity, the reduction in DNA damage, and the enhancement of DNA repair capacities. © 2017 The American Society of Photobiology.

  5. A novel transcript for DNA repair gene Ercc1 in mouse skin.

    Science.gov (United States)

    Song, L; Winter, A G; Selfridge, J; Melton, D W

    2011-02-01

    The nucleotide excision repair pathway deals with UV-induced DNA damage. The tissue that receives by far the greatest exposure to UV is the skin and we have investigated the possibility that expression of the nucleotide excision repair gene, Ercc1, may display different properties in the skin to deal with a more demanding role in that tissue. ERCC1, in a complex with XPF, is the structure--specific endonuclease responsible for incising 5' to the UV-induced lesion. We identified a novel Ercc1 mRNA in mouse skin that originates from an alternative upstream promoter. Levels of this skin-specific transcript were low in embryonic skin and increased rapidly after birth, but there was no induction by UV, either in adult skin, or in a cultured keratinocyte model. Levels of the skin-specific Ercc1 transcript were higher in albino than pigmented mouse strains, but there was no difference in ERCC1 protein levels and the expression of the skin-specific transcript was found to be determined by the Ercc1 gene sequence rather than by coat pigmentation. Using an Ercc1 transgene the promoter for the skin-specific transcript was mapped to a region around 400 bp upstream of the normal promoter, where a transposable element with known promoter activity was found in albino but not in pigmented strains.

  6. Beneficial Effects of the Genus Aloe on Wound Healing, Cell Proliferation, and Differentiation of Epidermal Keratinocytes.

    Science.gov (United States)

    Moriyama, Mariko; Moriyama, Hiroyuki; Uda, Junki; Kubo, Hirokazu; Nakajima, Yuka; Goto, Arisa; Akaki, Junji; Yoshida, Ikuyo; Matsuoka, Nobuya; Hayakawa, Takao

    2016-01-01

    Aloe has been used as a folk medicine because it has several important therapeutic properties. These include wound and burn healing, and Aloe is now used in a variety of commercially available topical medications for wound healing and skin care. However, its effects on epidermal keratinocytes remain largely unclear. Our data indicated that both Aloe vera gel (AVG) and Cape aloe extract (CAE) significantly improved wound healing in human primary epidermal keratinocytes (HPEKs) and a human skin equivalent model. In addition, flow cytometry analysis revealed that cell surface expressions of β1-, α6-, β4-integrin, and E-cadherin increased in HPEKs treated with AVG and CAE. These increases may contribute to cell migration and wound healing. Treatment with Aloe also resulted in significant changes in cell-cycle progression and in increases in cell number. Aloe increased gene expression of differentiation markers in HPEKs, suggesting roles for AVG and CAE in the improvement of keratinocyte function. Furthermore, human skin epidermal equivalents developed from HPEKs with medium containing Aloe were thicker than control equivalents, indicating the effectiveness of Aloe on enhancing epidermal development. Based on these results, both AVG and CAE have benefits in wound healing and in treatment of rough skin.

  7. Derivation and characterization of cell cultures from the skin of the Indo-Pacific humpback dolphin Sousa chinensis.

    Science.gov (United States)

    Jin, Wei; Jia, Kuntong; Yang, Lili; Chen, Jialin; Wu, Yuping; Yi, Meisheng

    2013-06-01

    The marine mammalian Indo-Pacific humpback dolphin, once widely lived in waters of the Indian to western Pacific oceans, has become an endangered species. The individual number of this dolphin has significantly declined in recent decades, which raises the concern of extinction. Direct concentration on laboratorial conservation of the genetic and cell resources should be paid to this marine species. Here, we report the successful derivation of cell lines form the skin of Indo-Pacific humpback dolphin. The cell cultures displayed the characteristics of fibroblast in morphology and grew rapidly at early passages, but showed obvious growth arrest at higher passages. The karyotype of the cells consisted of 42 autosomes and sex chromosomes X and Y. The immortalized cell lines obtained by forced expression of the SV40 large T-antigen were capable of proliferation at high rate in long-term culture. Immortalization and long-term culture did not cause cytogenetically observable abnormality in the karyotype. The cell type of the primary cultures and immortalized cell lines were further characterized as fibroblasts by the specific expression of vimentin. Gene transfer experiments showed that exogenetic genes could be efficiently delivered into the cells by both plasmid transfection and lentivirus infection. The cells derived from the skin of the Indo-Pacific humpback dolphin may serve as a useful in vitro system for studies on the effects of environmental pollutants and pathogens in habitats on the dolphin animals. More importantly, because of their high proliferation rate and susceptibility to lentivirus, these cells are potential ideal materials for generation of induced pluripotent stem cells.

  8. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  9. Aneuploidy and proliferation in keratinocytic intraepidermal neoplasias.

    NARCIS (Netherlands)

    Smits, T.; Olthuis, D.; Blokx, W.A.M.; Kleinpenning, M.M.; Kerkhof, P.C.M. van de; Erp, P.E.J. van; Gerritsen, M.J.P.

    2007-01-01

    Cutaneous squamous (pre)malignancies can be classified according to the keratinocytic intraepidermal neoplasia (KIN) classification. Aneuploidy can be seen as the result of chromosomal aberrations leading to altered DNA content and has been strongly associated with malignancy. Hyperproliferation is

  10. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  11. Imaging sulfur mustard lesions in human epidermal tissues and keratinocytes by confocal and multiphoton microscopy

    Science.gov (United States)

    Werrlein, Robert; Madren-Whalley, Janna S.

    2002-06-01

    Topical exposure to sulfur mustard (HD), a known theat agent, produces persistent and debilitating cutaneous blisters. The blisters occur at the dermal-epidermal junction following a dose-dependent latent period of 8-24 h, however, the primary lesions causing vesication remain uncertain. Immunofluorescent images reveal that a 5-min exposure to 400 (mu) M HD disrupts molecules that are also disrupted by epidermolysis bullosa-type blistering diseases of the skin. Using keratinocyte cultures and fluorochomes conjugated to two different keratin-14 (K14) antibodies (clones CKB1 and LL002), results have shown a statistically significant (p<0.1) 1-h decrease of 29.2% in expression of the CKB1 epitope, a nearly complete loss of CKB1 expression within 2 h, and progressive cytoskeletal (K14) collapse without loss in expression of the LL002 epitope. With human epidermal tissues, multi-photon images of (alpha) 6 integrin and laminin 5 showed disruptive changes in the cell-surface organization and integrity of these adhesion molecules. At 1 H postexposure, analyses showed a statistically significant (p<0.1) decrease of 27.3% in (alpha) 6 integrin emissions, and a 32% decrease in laminin 5 volume. Multi-photon imaging indicates that molecules essential for epidermal-dermal attachment are early targets in the alkylating events leading to HD-induced vesication.

  12. The effect of amphiphilic siloxane oligomers on fibroblast and keratinocyte proliferation and apoptosis.

    Science.gov (United States)

    Lynam, Emily C; Xie, Yan; Loli, Bree; Dargaville, Tim R; Leavesley, David I; George, Graeme A; Upton, Zee

    2010-11-01

    The formation of hypertrophic scars (HSF) is a frequent medical outcome of wound repair and often requires further therapy with treatments such as silicone gel sheets (SGS) or apoptosis-inducing agents, including bleomycin. Although widely used, knowledge regarding SGS and their mode of action is limited. Preliminary research has shown that small amounts of amphiphilic silicone present in SGS have the ability to move into skin during treatment. We demonstrate herein that a commercially available analogue of these amphiphilic siloxane species, the rake copolymer GP226, decreases collagen synthesis on exposure to cultures of fibroblasts derived from HSF. By size exclusion chromatography, GP226 was found to be a mixture of siloxane species, containing five fractions of different molecular weight. By studies of collagen production, cell viability and proliferation, it was revealed that a low molecular weight fraction (fraction IV) was the most active, reducing the number of viable cells present after treatment and thereby reducing collagen production as a result. On exposure of fraction IV to human keratinocytes, viability and proliferation were also significantly affected. HSF undergoing apoptosis after application of fraction IV were also detected via real-time microscopy and by using the TUNEL assay. Taken together, these data suggests that these amphiphilic siloxanes could be potential non-invasive substitutes to apoptotic-inducing chemical agents that are currently used as scar treatments.

  13. Harnessing cellular differentiation to improve ALA-based photodynamic therapy in an artificial skin model

    Science.gov (United States)

    Maytin, Edward; Anand, Sanjay; Sato, Nobuyuki; Mack, Judith; Ortel, Bernhard

    2005-04-01

    During ALA-based photodynamic therapy (PDT), a pro-drug (aminolevulinic acid; ALA) is taken up by tumor cells and metabolically converted to a photosensitizing intermediate (protoporphyrin IX; PpIX). ALA-based PDT, while an emerging treatment modality, remains suboptimal for most cancers (e.g. squamous cell carcinoma of the skin). Many treatment failures may be largely due to insufficient conversion of ALA to PpIX within cells. We discovered a novel way to increase the conversion of ALA to PpIX, by administering agents that can drive terminal differentiation (i.e., accelerate cellular maturation). Terminally-differentiated epithelial cells show higher levels of intracellular PpIX, apparently via increased levels of a rate-limiting enzyme, coproporphyrinogen oxidase (CPO). To study these mechanisms in a three-dimensional tissue, we developed an organotypic model that mimics true epidermal physiology in a majority of respects. A line of rat epidermal keratinocytes (REKs), when grown in raft cultures, displays all the features of a fully-differentiated epidermis. Addition of ALA to the culture medium results in ALA uptake and PpIX synthesis, with subsequent death of keratinocytes upon exposure to blue light. Using this model, we can manipulate cellular differentiation via three different approaches. (1) Vitamin D, a hormone that enhances keratinocyte differentiation; (2) Hoxb13, a nuclear transcription factor that affects the genetically-controlled differentiation program of stratifying cells (3) Hyaluronan, an abundant extracellular matrix molecule that regulates epidermal differentiation. Because the raft cultures contain only a single cell type (no blood, fibroblasts, etc.) the effects of terminal differentiation upon CPO, PpIX, and keratinocyte cell death can be specifically defined.

  14. 1,25-dihydroxyvitamin D3 induces LL-37 and HBD-2 production in keratinocytes from diabetic foot ulcers promoting wound healing: an in vitro model.

    Directory of Open Access Journals (Sweden)

    Irma Gonzalez-Curiel

    Full Text Available Diabetic foot ulcers (DFU are one of the most common diabetes-related cause of hospitalization and often lead to severe infections and poor healing. It has been recently reported that patients with DFU have lower levels of antimicrobial peptides (AMPs at the lesion area, which contributes with the impairment of wound healing. The aim of this study was to determine whether 1,25-dihydroxyvitamin D3 (1,25 (OH2 D3 and L-isoleucine induced HBD-2 and LL-37 in primary cultures from DFU. We developed primary cell cultures from skin biopsies from 15 patients with DFU and 15 from healthy donors. Cultures were treated with 1,25 (OH2D3 or L-isoleucine for 18 h. Keratinocytes phenotype was identified by western blot and flow cytometry. Real time qPCR for DEFB4, CAMP and VDR gene expression was performed as well as an ELISA to measure HBD-2 and LL-37 in supernatant. Antimicrobial activity, in vitro, wound healing and proliferation assays were performed with conditioned supernatant. The results show that primary culture from DFU treated with 1,25(OH2D3, increased DEFB4 and CAMP gene expression and increased the production of HBD-2 and LL-37 in the culture supernatant. These supernatants had antimicrobial activity over E. coli and induced remarkable keratinocyte migration. In conclusion the 1,25(OH2D3 restored the production of AMPs in primary cell from DFU which were capable to improve the in vitro wound healing assays, suggesting their potential therapeutic use on the treatment of DFU.

  15. Anti-ageing effects of a new synthetic sphingolipid (K6EAA-L12) on aged murine skin.

    Science.gov (United States)

    Jung, Minyoung; Lee, Sanghoon; Park, Hwa-young; Youm, Jong-Kyung; Jeong, Sekyoo; Bae, Jonghwan; Kwon, Mi Jung; Park, Byeong Deog; Lee, Seung Hun; Choi, Eung Ho

    2011-04-01

    Recently, we reported on the anti-ageing effects of K6PC-5. This compound induced keratinocyte differentiation and fibroblast proliferation by increasing sphingosine-1 phosphate synthesis. We performed this study to confirm the anti-ageing effects of new synthetic products (the K6EAA series) derived from K6PC-5 through an amino group induction. Cellular responses such as differentiation, proliferation and calcium mobilization were investigated using cultured human keratinocytes and fibroblasts. Also, we measured the expressions of collagen mRNA and protein using real time RT-PCR and ELISA, respectively. The K6EAA-L12 product, selected by in vitro screening, was evaluated for anti-ageing effects on intrinsically and extrinsically (photo) aged models of hairless mice. In the intrinsically aged murine skin, K6EAA-L12 showed anti-ageing effects by activating collagen synthesis, eventually causing dermal thickening. Also, in the photo-aged skin, the dermal collagen density and dermal thickness were increased. In photo-aged murine skin, K6EAA-L12 increased stratum corneum integrity by increasing corneodesmosome density and improved the barrier recovery rate. However, there were no changes in the expressions of epidermal differentiation maker proteins. In conclusion, topical K6EAA-L12, a new synthetic K6PC-5 derivative, improves intrinsically and extrinsically (photo) aged skin by increasing the collagen density and improving the skin barrier function. © 2011 John Wiley & Sons A/S.

  16. Assessment of phototoxicity, skin irritation, and sensitization potential of polystyrene and TiO2 nanoparticles

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Choi, Byeong Hyeok; Son, Sang Wook; Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon

    2011-01-01

    The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO 2 nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO 2 nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.

  17. Assessment of phototoxicity, skin irritation, and sensitization potential of polystyrene and TiO2 nanoparticles

    Science.gov (United States)

    Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Hyeok Choi, Byeong; Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon; Son, Sang Wook

    2011-07-01

    The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO2 nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO2 nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.

  18. Changes in dermal matrix in the absence of Rac1 in keratinocytes

    DEFF Research Database (Denmark)

    Stanley, Alanna; Pedersen, Esben Ditlev Kølle; Brakebusch, Cord

    2016-01-01

    that the deletion of Rac1 in keratinocytes causes heightened inflammation due to aberrant crosstalk with immune cells. Indeed, the skin of these mice shows a higher inflammatory response to the induction of irritant contact dermatitis (ICD), and also even to treatment with a vehicle alone, compared with controls....... As inflammation is intimately linked with fibrotic disease in the skin, this raised the question as to whether this deletion may also affect the deposition and arrangement of the dermal ECM. This study assessed the effects of Rac1 deletion in keratinocytes and of the heightened inflammatory status by induction...... of ICD on the tissue localisation and arrangements of dermal collagen. Qualitative analysis did not reveal evidence for the formation of pathologies in the dermis. However, quantitative analysis did reveal some perturbations in the dermal matrix, namely that only the combination of the lack of Rac1...

  19. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  20. In vitro evaluation of the effects of human umbilical cord extracts on human fibroblasts, keratinocytes, and melanocytes.

    Science.gov (United States)

    Van Pham, Phuc; Dang, Loan Thi-Tung; Dinh, Uyen Thanh; Truong, Huyen Thi-Thu; Huynh, Ba Ngoc; Van Le, Dong; Phan, Ngoc Kim

    2014-04-01

    Skin aging is the result of internal and external factors. So-called photoaging has been identified as the major factor in skin aging. Effects of photoaging include inhibition of fibroblast and keratinocyte proliferation as well as collagen and fibronectin expression, while activating expression of collagenases such as matrix metalloproteinase-1. Previous studies have shown that extracts or products from human placenta significantly improve skin aging and chronic wound healing. However, there are few studies of umbilical cord extracts. Therefore, this study aimed to evaluate the effects of umbilical cord extract-derived formulae on three kinds of skin cells including fibroblasts, keratinocytes, and melanocytes. We prepared 20 formulae from intracellular umbilical cord extracts, extracellular umbilical cord extracts, and umbilical cord-derived stem cell extracts, as well as five control formulae. We evaluated the effects of the 25 formulae on fibroblast and keratinocyte proliferation, and expression of collagen I, fibronectin, and matrix metalloproteinase-1 in fibroblasts and tyrosinase in melanocytes. The results showed that 7.5% formula 35 was the most effective formula for promotion of fibroblast and keratinocyte proliferation. At this concentration, formula 35 also induced collagen expression and inhibited matrix metalloproteinase-1 expression at the transcriptional level. However, this formula had no effect on tyrosinase expression in melanocytes. These results demonstrate that umbilical cord extracts can serve as an attractive source of proteins for skincare and chronic wound healing products.

  1. Immortalized keratinocytes derived from patients with epidermolytic ichthyosis reproduce the disease phenotype: a useful in vitro model for testing new treatments.

    Science.gov (United States)

    Chamcheu, J C; Pihl-Lundin, I; Mouyobo, C E; Gester, T; Virtanen, M; Moustakas, A; Navsaria, H; Vahlquist, A; Törmä, H

    2011-02-01

    Epidermolytic ichthyosis (EI) is a skin fragility disorder caused by mutations in genes encoding suprabasal keratins 1 and 10. While the aetiology of EI is known, model systems are needed for pathophysiological studies and development of novel therapies. To generate immortalized keratinocyte lines from patients with EI for studies of EI cell pathology and the effects of chemical chaperones as putative therapies. We derived keratinocytes from three patients with EI and one healthy control and established immortalized keratinocytes using human papillomavirus 16-E6/E7. Growth and differentiation characteristics, ability to regenerate organotypic epidermis, keratin expression, formation of cytoskeletal aggregates, and responses to heat shock and chemical chaperones were assessed. The cell lines EH11 (K1_p.Val176_Lys197del), EH21 (K10_p.156Arg>Gly), EH31 (K10_p.Leu161_Asp162del) and NKc21 (wild-type) currently exceed 160 population doublings and differentiate when exposed to calcium. At resting state, keratin aggregates were detected in 9% of calcium-differentiated EH31 cells, but not in any other cell line. Heat stress further increased this proportion to 30% and also induced aggregates in 3% of EH11 cultures. Treatment with trimethylamine N-oxide and 4-phenylbutyrate (4-PBA) reduced the fraction of aggregate-containing cells and affected the mRNA expression of keratins 1 and 10 while 4-PBA also modified heat shock protein 70 (HSP70) expression. Furthermore, in situ proximity ligation assay suggested a colocalization between HSP70 and keratins 1 and 10. Reconstituted epidermis from EI cells cornified but EH21 and EH31 cells produced suprabasal cytolysis, closely resembling the in vivo phenotype. These immortalized cell lines represent a useful model for studying EI biology and novel therapies. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  2. Antimycotics suppress the Malassezia extract-induced production of CXC chemokine ligand 10 in human keratinocytes.

    Science.gov (United States)

    Hau, Carren S; Kanda, Naoko; Makimura, Koichi; Watanabe, Shinichi

    2014-02-01

    Malassezia, a lipophilic yeast, exacerbates atopic dermatitis. Malassezia products can penetrate the disintegrated stratum corneum and encounter subcorneal keratinocytes in the skin of atopic dermatitis patients. Type 1 helper T (Th1) cells infiltrate chronic lesions with atopic dermatitis, and antimycotic agents improve its symptoms. We aimed to identify Malassezia-induced chemokines in keratinocytes and examine whether antimycotics suppressed this induction. Normal human keratinocytes were incubated with a Malassezia restricta extract and antimycotics. Chemokine expression was analyzed by enzyme-linked immunosorbent assays and real-time polymerase chain reaction. Signal transducer and activator of transcription (STAT)1 activity was examined by luciferase assays. The tyrosine-phosphorylation of STAT1 was analyzed by western blotting. The M. restricta extract increased the mRNA and protein expression of Th1-attracting CXC chemokine ligand (CXCL)10 and STAT1 activity and phosphorylation in keratinocytes, which was suppressed by a Janus kinase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine suppressed M. restricta extract-induced CXCL10 mRNA and protein expression and STAT1 activity and phosphorylation. These effects were similarly induced by 15-deoxy-Δ-(12,14) -prostaglandin J2 (15d-PGJ2 ), a prostaglandin D2 metabolite. Antimycotics increased the release of 15d-PGJ2 from keratinocytes. The antimycotic-induced suppression of CXCL10 production and STAT1 activity was counteracted by a lipocalin-type prostaglandin D synthase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine may suppress the M. restricta-induced production of CXCL10 by inhibiting STAT1 through an increase in 15d-PGJ2 production in keratinocytes. These antimycotics may block the Th1-mediated inflammation triggered by Malassezia in the chronic phase of atopic dermatitis. © 2014

  3. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  4. Vitamin D derivatives enhance cytotoxic effects of H2O2 or cisplatin on human keratinocytes

    Science.gov (United States)

    Anna, Piotrowska; Justyna, Wierzbicka; Tomasz, Ślebioda; Michał, Woźniak; Robert, C. Tuckey; Andrzej, T. Slominski; Michał, A. Żmijewski

    2016-01-01

    Although the skin production of vitamin D is initiated by ultraviolet radiation type B (UVB), the role vitamin D plays in antioxidative or pro-oxidative responses remains to be elucidated.. We have used immortalized human HaCaT keratinocytes as a model of proliferating epidermal cells to test the influence of vitamin D on cellular response to H2O2 or the anti-cancer drug, cisplatin. Incubation of keratinocytes with 1,25(OH)2D3 or its low calcemic analogues, 20(OH)D3, 21(OH)pD or calcipotriol, sensitized cells to ROS resulting in more potent inhibition of keratinocyte proliferation by H2O2 in the presence of vitamin D compounds. These results were supported by cell cycle and apoptosis analyses, and measurement of the mitochondrial transmembrane potentials (MMP), however some unique properties of individual secosteroids were observed. Furthermore, in HaCaT keratinocytes treated with H2O2, 1,25(OH)2D3, 21(OH)pD and calcipotriol stimulated the expression of SOD1 and CAT genes, but not SOD2, indicating a possible role of mitochondria in ROS-modulated cell death. 1,25(OH)2D3 also showed a short-term, protective effect on HaCaT keratinocytes, as exemplified by the inhibition of apoptosis and the maintenance of MMP. However, with prolonged incubation with H2O2 or cisplatin, 1,25(OH)2D3 caused an acceleration in the death of the keratinocytes. Therefore, we propose that lead vitamin D derivatives can protect the epidermis against neoplastic transformation secondary to oxidative or UV-induced stress through activation of vitamin D-signaling. Furthermore, our data suggest that treatment with low calcemic vitamin D analogs or the maintenance of optimal level of vitamin D by proper supplementation, can enhance the anticancer efficacy of cisplatin PMID:27083311

  5. Nrf2 Regulates the Sensitivity of Mouse Keratinocytes to Nitrogen Mustard via Multidrug Resistance-Associated Protein 1 (Mrp1)

    Science.gov (United States)

    Udasin, Ronald G.; Wen, Xia; Bircsak, Kristin M.; Aleksunes, Lauren M.; Shakarjian, Michael P.; Kong, Ah-Ng Tony; Heck, Diane E.; Laskin, Debra L.; Laskin, Jeffrey D.

    2016-01-01

    Sulfur mustard and nitrogen mustard (mechlorethamine, HN2) are potent vesicants developed as chemical warfare agents. These electrophilic, bifunctional alkylating agents cause skin injury, including inflammation, edema, and blistering. HN2 covalently modifies macromolecules such as DNA, RNA, and proteins or is scavenged by glutathione, forming adducts that can contribute to toxicity. Multidrug resistance-associated protein 1 (Mrp1/MRP1) is a transmembrane ATPase known to efflux glutathione-conjugated electrophiles. In the present studies, we examined the effects of modulating Mrp1-mediated transport activity on the sensitivity of primary and PAM212 mouse keratinocytes to HN2. Primary keratinocytes, and to a lesser extent, PAM212 cells, express Mrp1 mRNA and protein and possess Mrp1 functional activity, as measured by calcein efflux. Sulforaphane, an activator of Nrf2, increased Mrp1 mRNA, protein, and functional activity in primary keratinocytes and PAM212 cells and decreased their sensitivity to HN2-induced growth inhibition (IC50 = 1.4 and 4.8 µM in primary keratinocytes and 1 and 13 µM in PAM212 cells, in the absence and presence of sulforaphane, respectively). The Mrp1 inhibitor, MK-571, reversed the effects of sulforaphane on HN2-induced growth inhibition in both primary keratinocytes and PAM212 cells. In primary keratinocytes from Nrf2−/− mice, sulforaphane had no impact on Mrp1 expression or activity, or on sensitivity to HN2, demonstrating that its effects depend on Nrf2. These data suggest that Mrp1-mediated efflux is important in regulating HN2-induced keratinocyte growth inhibition. Enhancing HN2 efflux from keratinocytes may represent a novel strategy for mitigating vesicant-induced cytotoxicity. PMID:26454883

  6. Superoxide anions produced by Streptococcus pyogenes group A-stimulated keratinocytes are responsible for cellular necrosis and bacterial growth inhibition.

    Science.gov (United States)

    Regnier, Elodie; Grange, Philippe A; Ollagnier, Guillaume; Crickx, Etienne; Elie, Laetitia; Chouzenoux, Sandrine; Weill, Bernard; Plainvert, Céline; Poyart, Claire; Batteux, Frédéric; Dupin, Nicolas

    2016-02-01

    Gram-positive Streptococcus pyogenes (group A Streptococcus or GAS) is a major skin pathogen and interacts with keratinocytes in cutaneous tissues. GAS can cause diverse suppurative and inflammatory infections, such as cellulitis, a common acute bacterial dermo-hypodermitis with a high morbidity. Bacterial isolation yields from the lesions are low despite the strong local inflammation observed, raising numerous questions about the pathogenesis of the infection. Using an in vitro model of GAS-infected keratinocytes, we show that the major ROS produced is the superoxide anion ([Formula: see text]), and that its production is time- and dose-dependent. Using specific modulators of ROS production, we show that [Formula: see text] is mainly synthesized by the cytoplasmic NADPH oxidase. Superoxide anion production leads to keratinocyte necrosis but incomplete inhibition of GAS growth, suggesting that GAS may be partially resistant to the oxidative burst. In conclusion, GAS-stimulated keratinocytes are able to develop an innate immune response based on the production of ROS. This local immune response limits GAS development and induces keratinocyte cell death, resulting in the skin lesions observed in patients with cellulitis. © The Author(s) 2015.

  7. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  8. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  9. Inhibition of melanosome transfer results in skin lightening.

    Science.gov (United States)

    Seiberg, M; Paine, C; Sharlow, E; Andrade-Gordon, P; Costanzo, M; Eisinger, M; Shapiro, S S

    2000-08-01

    The chemical basis of melanogenesis is well documented, but the mechanism of melanosome transfer and the regulation of pigmentation by keratinocyte-melanocyte interactions are not well understood. Therefore we examined the effects of serine protease inhibitors on skin pigmentation and found that the protease-activated receptor 2, expressed on keratinocytes, may regulate pigmentation via keratinocyte-melanocyte interactions. Here we show that modulation of protease-activated receptor 2 activation affects melanosome transfer into keratinocytes, resulting in changes in pigment production and deposition. SLIGRL, the protease-activated receptor 2 activating peptide, enhanced melanosome ingestion by keratinocytes, thus increasing pigment deposition. RWJ-50353, a serine protease inhibitor, led to reduced pigment deposition in melanocytes and depigmentation. Electron microscopy studies illustrated an accumulation of immature melanosomes inside melanocytes and abnormal dendrite dynamics in RWJ-50353-treated epidermal equivalents. RWJ-50353 induced a visible and dose-dependent skin lightening effect in the dark-skinned Yucatan swine. Examinations by electron microscopy indicated that the in vivo transfer of melanosomes from melanocytes to keratinocytes was affected. Our data suggest that modulation of keratinocyte-melanocyte interactions via the protease-activated receptor 2 pathway affects melanosome transfer. The use of RWJ-50353 to modulate protease-activated receptor 2 activation could lead to a new class of depigmenting agents.

  10. The effect of local hyperglycemia on skin cells in vitro and on wound healing in euglycemic rats

    DEFF Research Database (Denmark)

    Kruse, Carla R; Singh, Mansher; Sørensen, Jens A

    2016-01-01

    BACKGROUND: Multiple previous studies have established that high systemic blood glucose concentration impairs skin wound healing. However, the effects of local hyperglycemia on wound healing are not well defined. Comprehensive animal studies and in vitro studies using both fibroblasts and keratin......BACKGROUND: Multiple previous studies have established that high systemic blood glucose concentration impairs skin wound healing. However, the effects of local hyperglycemia on wound healing are not well defined. Comprehensive animal studies and in vitro studies using both fibroblasts...... and keratinocytes are lacking. MATERIALS AND METHODS: Primary keratinocytes and fibroblasts were isolated from discarded human tissue, cultured under different concentrations of glucose, and the effect on cell function was examined. In addition, a rat full-thickness wound model was used to topically treat...... the wounds with different glucose concentrations and the effect on wound closure and re-epithelialization was investigated over time. RESULTS: The cell viability experiments indicated that both keratinocytes and fibroblasts endure high glucose well and concentrations under 26 mM did not have a remarkable...

  11. Size is an essential parameter in governing the UVB-protective efficacy of silver nanoparticles in human keratinocytes

    OpenAIRE

    Palanki, Rohan; Arora, Sumit; Tyagi, Nikhil; Rusu, Lilia; Singh, Ajay P.; Palanki, Srinivas; Carter, James E.; Singh, Seema

    2015-01-01

    Background Ultraviolet (UV) radiation from sun, particularly its UVB component (290–320 nm), is considered the major etiological cause of skin cancer that impacts over 2 million lives in the United States alone. Recently, we reported that polydisperse colloidal suspension of silver nanoparticles (AgNPs) protected the human keratinocytes (HaCaT) against UVB-induced damage, thus indicating their potential for prevention of skin carcinogenesis. Here we sought out to investigate if size controlle...

  12. Getting under their skin: towards a cross-cultural approach for the ...

    African Journals Online (AJOL)

    Reference is made to the evolution of French didactics and methodology which has taken place in language teaching at tertiary level in this country and ... and a classwork-assessed, cross-cultural model with examples of pedagogical activities is proposed as the most appropriate form of literature teaching for French ...

  13. Blood-group-related carbohydrates are expressed in organotypic cultures of human skin and oral mucosa

    DEFF Research Database (Denmark)

    Grøn, B; Andersson, A; Dabelsteen, Erik

    1999-01-01

    Cellular maturation and migration are usually associated with changes in cell-surface carbohydrates, but the relationship between these changes and cell behaviour is at present largely unknown. To investigate whether an organotypic culture system can be used as an in vitro model to study the func...

  14. A yeast glycolipid biosurfactant, mannosylerythritol lipid, shows potential moisturizing activity toward cultured human skin cells: the recovery effect of MEL-A on the SDS-damaged human skin cells.

    Science.gov (United States)

    Morita, Tomotake; Kitagawa, Masaru; Suzuki, Michiko; Yamamoto, Shuhei; Sogabe, Atsushi; Yanagidani, Shusaku; Imura, Tomohiro; Fukuoka, Tokuma; Kitamoto, Dai

    2009-01-01

    Mannosylerythritol lipids (MELs) are produced in large amounts from renewable vegetable oils by Pseudozyma antarctica, and are the most promising biosurfactants known due to its versatile interfacial and biochemical actions. In order to broaden the application in cosmetics and pharmaceuticals, the skin care property of MEL-A, the major component of MELs, was investigated using a three-dimensional cultured human skin model. The skin cells were cultured and treated with sodium dodecyl sulfate (SDS) solution of 1 wt%, and the effects of different lipids on the SDS-damaged cells were then evaluated on the basis of the cell viability. The viability of the damaged cells was markedly recovered by the addition of MEL-A in a dose-dependent manner. Compared to the control, MEL-A solutions of 5 wt% and 10 wt% gave the recovery rate of 73% and 91%, respectively, while ceramide solution of 1 wt% gave the rate of over 100%. This revealed that MEL-A shows a ceramide-like moisturizing activity toward the skin cells. Considering the drawbacks of natural ceramides, namely limited amount and high production cost, the yeast biosurfactants should have a great potential as a novel moisturizer for treating the damaged skin.

  15. Hyaluronan minimizes effects of UV irradiation on human keratinocytes.

    Science.gov (United States)

    Hašová, Martina; Crhák, Tomáš; Safránková, Barbora; Dvořáková, Jana; Muthný, Tomáš; Velebný, Vladimír; Kubala, Lukáš

    2011-05-01

    Exposure to ultraviolet (UV) irradiation has detrimental effects on skin accompanied by the increased metabolism of hyaluronan (HA), a linear polysaccharide important for the normal physiological functions of skin. In this study, the modulation of human keratinocyte response to UVB irradiation by HA (970 kDa) was investigated. Immortalized human keratinocytes (HaCaT) were irradiated by a single dose of UVB and immediately treated with HA for 6 and 24 h. The irradiation induced a significant decrease in the gene expression of CD44 and toll-like receptor 2 6 h after irradiation. The expressions of other HA receptors, including toll-like receptor 4 and the receptor for HA-mediated motility, were not detected in either the control or UVB-irradiated or HA-treated HaCaT cells. UVB irradiation induced a significant decrease in the gene expression of HA synthase-2 and hyaluronidase-2 6 h after irradiation. The expressions of HA synthase-3 and hyaluronidase-3 were not significantly modulated by UV irradiation. Interestingly, HA treatment did not significantly modulate any of these effects. In contrast, HA significantly suppressed UVB-induced pro-inflammatory cytokine release including interleukin-6 and interleukin-8. Similarly, HA treatment reduced the UVB-mediated production of transforming growth factor β1. HA treatment also significantly reduced the UV irradiation-mediated release of soluble CD44 into the media. Finally, HA partially, but significantly, suppressed the UVB-induced decrease in cell viability. Data indicate that HA had significant protective effects for HaCaT cells against UVB irradiation.

  16. Chrysin attenuates atopic dermatitis by suppressing inflammation of keratinocytes.

    Science.gov (United States)

    Choi, Jin Kyeong; Jang, Yong Hyun; Lee, Soyoung; Lee, Sang-Rae; Choi, Young-Ae; Jin, Meiling; Choi, Jung Ho; Park, Jee Hun; Park, Pil-Hoon; Choi, Hyukjae; Kwon, Taeg Kyu; Khang, Dongwoo; Kim, Sang-Hyun

    2017-12-01

    We previously reported the inhibitory effect of chrysin, a natural flavonoid plentifully contained in propolis, vegetables and fruits, on the mast cell-mediated allergic reaction. In this study, we evaluated the effect of chrysin on atopic dermatitis (AD) and defined underlying mechanisms of action. We used an AD model in BALB/c mice by the repeated local exposure of 2,4-dinitrochlorobenzene (DNCB) and house dust mite (Dermatophagoides farinae extract, DFE) to the ears. Repeated alternative treatment of DNCB/DFE caused AD-like skin lesions. Oral administration of chrysin diminished AD symptoms such as ear thickness and histopathological analysis, in addition to serum IgE and IgG2a levels. Chrysin decreased infiltration of mast cells, and reduced serum histamine level. Chrysin also suppressed AD by inhibiting the inflammatory responses of Th1, Th2, and Th17 cells in mouse lymph node and ear. Interestingly, chrysin significantly inhibited the production of cytokines, Th2 chemokines, CCL17 and CCL22 by the down-regulation of p38 MAPK, NF-κB, and STAT1 in tumor necrosis factor (TNF)-α/interferon (IFN)-γ-stimulated human keratinocytes (HaCaT). Chrysin also inhibited TNF-α/IFN-γ-stimulated IL-33 expression in HaCaT cells and mouse primary keratinocytes. Taken together, the results indicate that chrysin suppressed AD symptoms, suggesting that chrysin might be a candidate for the treatment of AD and skin allergic diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Keratinocytes drive melanoma invasion in a reconstructed skin model.

    NARCIS (Netherlands)

    Kilsdonk, J.W.J. van; Bergers, M.; Kempen, L.C.L.T. van; Schalkwijk, J.; Swart, G.W.

    2010-01-01

    Melanoma progression is a multistep progression from a common melanocytic nevus through the radial growth phase, the invasive vertical growth phase finally leading to metastatic spread into distant organs. Migration and invasion of tumor cells requires secretion of proteases to facilitate remodeling

  18. Expression of microRNA-184 in keratinocytes represses argonaute 2.

    Science.gov (United States)

    Roberts, Julian C; Warren, Richard B; Griffiths, Christopher E M; Ross, Kehinde

    2013-12-01

    Interleukin-22 (IL-22) is a proinflammatory cytokine that has been associated with the pathogenesis of inflammatory skin disorders. However, the impact of IL-22 on microRNA (miRNA) expression in epidermal keratinocytes is unknown. Here we show that IL-22 induces miR-184 in reconstituted human epidermis (RHE) and in the HaCaT keratinocyte cell line. Exposure to IL-22 increased miR-184 expression 8- and 15-fold in RHE and HaCaT cells, respectively. Oncostatin M, an unrelated proinflammatory cytokine, also raised miR-184 expression in RHE and HaCaT keratinocytes. Pharmacologic and genetic inhibition demonstrated that cytokine-induced expression of miR-184 was mediated by signal transducer and activation of transcription 3 (STAT3). Argonaute 2 (AGO2), a member of the RNA-induced silencing complex (RISC), is a predicted miR-184 target. Using protein, messenger RNA and reporter analyses, we found that miR-184 regulates the expression of AGO2. We conclude that cytokine-induced miR-184 attenuates AGO2 expression in keratinocytes. Copyright © 2013 Wiley Periodicals, Inc.

  19. Identification of extra- and intracellular alanyl aminopeptidases as new targets to modulate keratinocyte growth and differentiation

    International Nuclear Information System (INIS)

    Aminopeptidase inhibitors strongly affect proliferation, differentiation, and function of immune cells and show therapeutic potential in inflammatory disorders. In psoriatic lesions, keratinocytes display increased cellular turnover and disturbed differentiation, leading to epidermal hyperplasia accompanied by the loss of stratum granulosum. Here, we report in the HaCaT hyperproliferative keratinocyte cell line as well as in two primary keratinocyte strains in vitro a molecular and biochemical analysis of the expression of both membrane and cytosol alanyl aminopeptidase (cAAP) on the mRNA, protein, and enzymatic activity level. We found a clear dose-dependent suppression of DNA synthesis in vitro in the presence of the inhibitors actinonin, bestatin, and the cAAP-specific inhibitor PAC-22 correlating well with the simultaneous decrease in enzyme activity. In vivo, actinonin dose-dependently restored the stratum granulosum and ameliorated the impaired keratinocyte differentiation in the mouse tail model of psoriasis. Taken together, these data suggest that targeting alanyl aminopeptidases may be beneficial for psoriasis and other inflammatory skin disorders

  20. Lithospermum erythrorhizon extract protects keratinocytes and fibroblasts against oxidative stress.

    Science.gov (United States)

    Yoo, Hee Geun; Lee, Bong Han; Kim, Wooki; Lee, Jong Suk; Kim, Gun Hee; Chun, Ock K; Koo, Sung I; Kim, Dae-Ok

    2014-11-01

    Oxidative stress damages dermal and epidermal cells and degrades extracellular matrix proteins, such as collagen, ultimately leading to skin aging. The present study evaluated the potential protective effect of the aqueous methanolic extract obtained from Lithospermum erythrorhizon (LE) against oxidative stress, induced by H2O2 and ultraviolet (UV) irradiation, on human keratinocyte (HaCaT) and human dermal fibroblast-neonatal (HDF-n) cells. Exposure of cells to H2O2 or UVB irradiation markedly increased oxidative stress and reduced cell viability. However, pretreatment of cells with the LE extract not only increased cell viability (up to 84.5%), but also significantly decreased oxidative stress. Further, the LE extract downregulated the expression of matrix metalloproteinase-1, an endopeptidase that degrades extracellular matrix collagen. In contrast, treatment with the LE extract did not affect the expression of procollagen type 1 in HDF-n cells exposed to UVA irradiation. Thirteen phenolic compounds, including derivatives of shikonin and caffeic acid, were identified by ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. These results suggest that LE-derived extracts may protect oxidative-stress-induced skin aging by inhibiting degradation of skin collagen, and that this protection may derive at least in part from the antioxidant phenolics present in these extracts. Further studies are warranted to determine the potential utility of LE-derived extracts in both therapeutic and cosmetic applications.

  1. Surface modification of Polycaprolactone (PCL) microcarrier for performance improvement of human skin fibroblast cell culture

    Science.gov (United States)

    Samsudin, N.; Hashim, Y. Z. H.; Arifin, M. A.; Mel, M.; Salleh, H. Mohd; Sopyan, I.; Hamid, M. Abdul

    2018-01-01

    Polycaprolactone (PCL) has many advantages for use in biomedical engineering field. In the present work PCL microcarriers of 150-200 μm were fabricated using oil-in-water (o/w) emulsification coupled with solvent evaporation method. The surface charge of PCL microcarrier was then been improved by using ultraviolet/ozone treatment to introduce oxygen functional group. Immobilisation of gelatin onto PCL microspheres using zero-length crosslinker provides a stable protein-support complex, with no diffusional barrier which is ideal for mass processing. The optimum concentration of carboxyl group (COOH) absorbed on the surface was 1495.9 nmol/g and the amount of gelatin immobilized was 1797.3 μg/g on UV/O3 treated microcarriers as compared to the untreated (320 μg/g) microcarriers. The absorption of functional oxygen groups on the surface and the immobilized gelatin was confirmed with Fourier Transformed Infrared spectroscopy and the enhancement of hydrophilicity of the surface was confirmed using water contact angle measurement which decreased (86.93° - 49.34°) after UV/O3 treatment and subsequently after immobilisation of gelatin. The attachment and growth kinetics for human skin fibroblast cell (HSFC) showed that adhesion occurred much more rapidly for gelatin immobilised surface as compared to untreated PCL and UV/O3 PCL microcarrier.

  2. Michael Ondaatje's reinvention of social and cultural Myths: In the Skin of a Lion

    Directory of Open Access Journals (Sweden)

    Branko Gorjup

    1989-12-01

    Full Text Available From the beginning of his writing career in the early sixties until the recent publication of In the Skin of a Lian (1987, the Canada of Michael Ondaatje had represented one thing: a geographical locale which he has selected as his home but which, fundamentally, had failed to engage his imagination. The fictional worlds he created in The Collected Works of Billy the Kid, Coming Through Slaughter and Running in the Family, has been located outside of Canada, each corresponding to an actual place complete with historical and geographical references. For this very reason it has been impossible - as Sam Solecki noted in his introduction to Spider Blues, »a collection of reviews and essays on Ondaatje - to place this anomalous literary presence in Canada within »specifically Canadian tradition of writing ...«,  a tradition that would»include and see relationships among figures as different as Roberts, Pratt, F. R. Scott, Purdy and Atwood ...« Ondaatje's »characters, landscapes, stories and themes resist any taxonomies based on overtly Canadian thematics.« In fact, Solecki further suggested that Ondaatje, like »V. S. Naipaul, Derek Walcott and Salmon Rushdie ..., compels a rethinking of the notion of a national tradition«. Similarly, another critic from the same collection described Ondaatje's position in the context of Canadian writing as unique - a position according to which »language or audience or the identity and the role of the poet are indeterminate. «

  3. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  4. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  5. A new, simple assay for long-chain acyl-CoA dehydrogenase in cultured skin fibroblasts using stable isotopes and GC-MS

    NARCIS (Netherlands)

    Niezen-Koning, K. E.; Wanders, R. J.; Nagel, G. T.; IJlst, L.; Heymans, H. S.

    1992-01-01

    In this paper, we present a new method for measurement of long-chain acyl-CoA dehydrogenase (LCAD) activities in cultured skin fibroblasts. The method is based upon gas chromatographic/mass spectrometric determination of 3-OH-hexadecanoic acid formed during incubation of fibroblasts in a medium

  6. Transcriptional Analysis of Hair Follicle-Derived Keratinocytes from Donors with Atopic Dermatitis Reveals Enhanced Induction of IL32 Gene by IFN-γ

    Directory of Open Access Journals (Sweden)

    Yoshie Yoshikawa

    2013-02-01

    Full Text Available We cultured human hair follicle-derived keratinocytes (FDKs from plucked hairs. To gain insight into gene expression signatures that can distinguish atopic dermatitis from non-atopic controls without skin biopsies, we undertook a comparative study of gene expression in FDKs from adult donors with atopic dermatitis and non-atopic donors. FDK primary cultures (atopic dermatitis, n = 11; non-atopic controls, n = 7 before and after interferon gamma (IFN-γ treatment were used for microarray analysis and quantitative RT-PCR. Comparison of FDKs from atopic and non-atopic donors indicated that the former showed activated pathways with innate immunity and decreased pathways of cell growth, as indicated by increased NLRP2 expression and decreased DKK1 expression, respectively. Treatment with IFN-γ induced the enhanced expression of IL32, IL1B, IL8, and CXCL1 in the cells from atopic donors compared to that in cells from non-atopic donors at 24 h after treatment. IL1B expression in FDKs after IFN-γ treatment correlated with IL32 expression. We hypothesized that overexpression of IL32 in hair follicle keratinocytes of patients with atopic dermatitis would lead to the excessive production of pro-IL1β and that the activation of IL1β from pro-IL1β by inflammasome complex, in which NLRP2 protein might be involved, would be augmented. This is the first report to show enhanced induction of cytokine/chemokine genes by IFN-γ in atopic dermatitis using cultured FDKs.

  7. Assessment of phototoxicity, skin irritation, and sensitization potential of polystyrene and TiO{sub 2} nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Choi, Byeong Hyeok; Son, Sang Wook [Laboratory of Cell Signaling and Nanomedicine, Department of Dermatology and Division of Brain Korea 21 Project for Biomedical Science, Korea University College of Medicine, Seoul (Korea, Republic of); Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2011-07-06

    The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO{sub 2} nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO{sub 2} nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.

  8. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  9. Melanin protects melanocytes and keratinocytes against H2O2-induced DNA strand breaks through its ability to bind Ca2+.

    Science.gov (United States)

    Hoogduijn, M J; Cemeli, E; Ross, K; Anderson, D; Thody, A J; Wood, J M

    2004-03-10

    Reactive oxygen species (ROS) such as hydrogen peroxide (H(2)O(2)) are produced in the skin under the influence of UV radiation. These compounds are highly reactive and can induce DNA lesions in epidermal cells. Melanin is considered to protect human skin against DNA damage by absorbing UV radiation. We have investigated whether melanin can, in addition, offer protection against the effects of H(2)O(2) in human melanocytes and HaCaT keratinocytes. In the present study, it was shown that 40 and 100 microM H(2)O(2) increased the number of DNA strand breaks as measured using the comet assay, in melanocytes of Caucasian origin. In melanocytes of the same origin in which melanin levels were increased by culturing in presence of 10 mM NH(4)Cl and elevated l-tyrosine, H(2)O(2)-induced DNA damage was reduced compared to that in control melanocytes. Similarly, HaCaT cells that were loaded with melanin were better protected against H(2)O(2)-induced DNA strand breaks than control HaCaT cells. These protective effects of melanin were mimicked by the intracellular Ca(2+)-chelator BAPTA. Thus, BAPTA reduced the level of H(2)O(2)-induced DNA strand breaks in melanocytes. Like BAPTA, melanin is known to be a potent chelator of Ca(2+) and this was confirmed in the present study. It was shown that melanin levels in melanocytic cells correlated directly with intracellular Ca(2+) binding capacity and, in addition, correlated inversely with H(2)O(2)-induced increases in intracellular Ca(2+). Our results show that melanin may have an important role in regulating intracellular Ca(2+) homeostasis and it is suggested that melanin protects against H(2)O(2)-induced DNA strand breaks in both melanocytes and keratinocytes and through its ability to bind Ca(2+).

  10. Adiponectin Suppresses UVB-Induced Premature Senescence and hBD2 Overexpression in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    MinJeong Kim

    Full Text Available Recent studies have revealed that adiponectin can suppress cellular inflammatory signaling pathways. This study aimed to elucidate the effect of adiponectin on the unregulated production of hBD2 in UVB-induced premature senescent keratinocytes. We constructed an in vitro model of premature senescent keratinocytes through repeated exposure to low energy UVB. After repeated low energy UVB exposure, there was significant generation of reactive oxygen species (ROS and induction of senescence-associated markers, including senescence associated beta-galactosidase activity and expression of p16INK4a and histone H2AX. In addition, the present clinical study showed higher expression of hBD2 in sun-exposed skin of elderly group, and the overexpression of hBD2 was observed by c-Fos activation in vitro. Adiponectin has the ability to scavenge ROS and consequently inhibit MAPKs and SA-markers in UVB-exposed keratinocytes. An inhibitor study demonstrated that adiponectin downregulated hBD2 mRNA expression through suppression of the AP-1 transcription factor components c-Fos via inactivation of p38 MAPK. Collectively, the dysregulated production of hBD2 by the induction of oxidative stress was attenuated by adiponectin through the suppression of p38 and JNK/SAPK MAPK signaling in UVB-mediated premature senescent inducible conditions. These results suggest the feasibility of adiponectin as an anti-photoaging and anti-inflammatory agent in the skin.

  11. Staphylococcus aureus keratinocyte invasion is dependent upon multiple high-affinity fibronectin-binding repeats within FnBPA.

    Directory of Open Access Journals (Sweden)

    Andrew M Edwards

    2011-04-01

    Full Text Available Staphylococcus aureus is a commensal organism and a frequent cause of skin and soft tissue infections, which can progress to serious invasive disease. This bacterium uses its fibronectin binding proteins (FnBPs to invade host cells and it has been hypothesised that this provides a protected niche from host antimicrobial defences, allows access to deeper tissues and provides a reservoir for persistent or recurring infections. FnBPs contain multiple tandem fibronectin-binding repeats (FnBRs which bind fibronectin with varying affinity but it is unclear what selects for this configuration. Since both colonisation and skin infection are dependent upon the interaction of S. aureus with keratinocytes we hypothesised that this might select for FnBP function and thus composition of the FnBR region. Initial experiments revealed that S. aureus attachment to keratinocytes is rapid but does not require FnBRs. By contrast, invasion of keratinocytes was dependent upon the FnBR region and occurred via similar cellular processes to those described for endothelial cells. Despite this, keratinocyte invasion was relatively inefficient and appeared to include a lag phase, most likely due to very weak expression of α(5β(1 integrins. Molecular dissection of the role of the FnBR region revealed that efficient invasion of keratinocytes was dependent on the presence of at least three high-affinity (but not low-affinity FnBRs. Over-expression of a single high-affinity or three low-affinity repeats promoted invasion but not to the same levels as S. aureus expressing an FnBPA variant containing three high-affinity repeats. In summary, invasion of keratinocytes by S. aureus requires multiple high-affinity FnBRs within FnBPA, and given the importance of the interaction between these cell types and S. aureus for both colonisation and infection, may have provided the selective pressure for the multiple binding repeats within FnBPA.

  12. In Vitro Evaluation of a Biomedical-Grade Bilayer Chitosan Porous Skin Regenerating Template as a Potential Dermal Scaffold in Skin Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Chin Keong Lim

    2011-01-01

    Full Text Available Chitosan is a copolymer of N-acetylglucosamine and glucosamine. A bilayer chitosan porous skin regenerating template (CPSRT has been developed for skin tissue engineering. The pore size of the CPSRT was assessed using a scanning electron microscopy (SEM. The in vitro cytocompatibility of the CPSRT was tested on primary human epidermal keratinocyte (pHEK cultures by measuring lactate dehydrogenase (LDH levels and skin irritation by western blot analysis of the interleukin-8 (IL-8 and tumor necrosis factor-α (TNF-α secretions. The ability of the CPSRT to support cell ingrowth was evaluated by seeding primary human dermal fibroblasts (pHDFs on the scaffold, staining the cells with live/dead stain, and imaging the construct by confocal microscopy (CLSM. The CPSRT with pore sizes ranging from 50 to 150 μm was cytocompatible because it did not provoke the additional production of IL-8 and TNF-α by pHEK cultures. Cultured pHDFs were able to penetrate the CPSRT and had increased in number on day 14. In conclusion, the CPSRT serves as an ideal template for skin tissue engineering.

  13. ATP-sensitive potassium channel: a novel target for protection against UV-induced human skin cell damage.

    Science.gov (United States)

    Cao, Cong; Healey, Sarah; Amaral, Ashley; Lee-Couture, Avery; Wan, Shu; Kouttab, Nicola; Chu, Wenming; Wan, Yinsheng

    2007-07-01

    Ultraviolet radiation (UV) induces cell damages leading to skin photoaging and skin cancer. ATP-sensitive potassium (K(ATP)) channel openers (KCOs) have been shown to exert significant myocardial preservation and neuroprotection in vitro and in vivo, and yet the potential role of those KCOs in protection against UV-induced skin cell damage is unknown. We investigated the effects of pinacidil and diazoxide, two classical KCOs, on UV-induced cell death using cultured human keratinocytes (HaCat cells). Here, we demonstrated for the first time that Kir 6.1, Kir 6.2 and SUR2 subunits of K(ATP) channels are functionally expressed in HaCaT cells and both non-selective K(ATP) channel opener pinacidil and mitoK(ATP) (mitochondrial K(ATP)) channel opener diazoxide attenuated UV-induced keratinocytes cell death. The protective effects were abolished by both non-selective K(ATP) channel blocker glibenclamide and selective mitoK(ATP) channel blocker 5-hydroxydecanoate (5-HD). Also, activation of K(ATP) channel with pinacidil or diazoxide resulted in suppressive effects on UV-induced MAPK activation and reactive oxygen species (ROS) production. Unexpectedly, we found that the level of intracellular ROS was slightly elevated in HaCaT cells when treated with pinacidil or diazoxide alone. Furthermore, UV-induced mitochondrial membrane potential loss, cytochrome c release and ultimately apoptotic cell death were also inhibited by preconditioning with pinacidil and diazoxide, and their effects were reversed by glibenclamide and 5-HD. Taken together, we contend that mitoK(ATP) is likely to contribute the protection against UV-induced keratinocytes cell damage. Our findings suggest that K(ATP) openers such as pinacidil and diazoxide may be utilized to prevent from UV-induced skin aging.

  14. Endocrine-disrupting chemicals and skin manifestations.

    Science.gov (United States)

    Ju, Qiang; Zouboulis, Christos C

    2016-09-01

    Endocrine-disrupting chemicals (EDCs) are exogenous compounds that have the ability to disrupt the production and actions of hormones through direct or indirect interaction with hormone receptors, thus acting as agonists or antagonists. Human health is affected after either individual occupation or dietary and environmental exposure to EDCs. On the other hand, skin is one of the largest organs of the body and its main function is protection from noxious substances. EDCs perturb the endocrine system, and they are also carcinogenic, immunotoxic, and hepatotoxic to human skin. In addition, their effects on keratinocytes, melanocytes, sebocytes, inflammatory and immunological cells, and skin stem cells produce inflammatory and allergic skin diseases, chloracne, disorders of skin pigmentation, skin cancer, and skin aging. Mechanisms, which EDCs use to induce these skin disorders are complicated, and involve the interference of endogenous hormones and most importantly the activation of the aryl hydrocarbon receptor signal pathway. Further studies on EDCs and skin diseases are necessary to elucidate these mechanisms.

  15. Experience of ReCell in Skin Cancer Reconstruction

    Directory of Open Access Journals (Sweden)

    Onur Gilleard

    2013-09-01

    Full Text Available The ReCell system (Avita Medical is a cell culture product that allows the immediate processing of a small split-thickness skin biopsy to produce a complete population of cells including keratinocytes, melanocytes, Langerhans cells and fibroblasts. This series is the first to highlight the reconstructive applications of ReCell following ablative skin cancer surgery. The ReCell system was utilized for three patients following skin cancer excision. In two cases, the cells were applied to forehead flap donor sites following nasal reconstruction. In one case, the cells were applied to the calvarial periosteum following wide local excision of a melanoma scar. Assessment of the treated area was performed using the patient and observer scar assessment scale after 1 year. The Patient and Observer Scar Assessment Scale (POSAS scores for the 2 patients treated with ReCell following forehead flap surgery were 22 and 32. The score for the patient that underwent wide local excision of a melanoma scar was 45. The absence of a donor site, accelerated healing and the satisfactory aesthetic appearance of the mature scars in this series suggest that ReCell may play a useful role in reconstruction following skin cancer excision.

  16. Mesenchymal Stem Cells for the Treatment of Skin Diseases

    Directory of Open Access Journals (Sweden)

    Toshio Hasegawa

    2017-08-01

    Full Text Available Mesenchymal stem cell (MSC-based therapy involving both autologous and allogeneic MSCs shows great promise in treating several conditions. MSCs promote wound healing, and can differentiate into multiple cell lineages, including keratinocytes. Therefore, MSCs can be used for the treatment of congenital or acquired skin defects. Because of their immunomodulatory properties, MSCs may be useful for the treatment of inflammatory and autoimmune skin diseases. In particular, MSCs might be effective for the treatment of large vitiligo lesions as immunosuppressant or cultured grafts. MSCs can also be a novel cell source for regenerating hair in the treatment of scarring alopecia and androgenic alopecia. MSCs might also be an effective treatment for alopecia areata, which is associated with autoimmunity. Stem cell therapies with topical administration of MSCs and bone marrow transplantation were shown to alleviate recessive dystrophic epidermolysis bullosa in both animal models and human subjects. In addition to cell transplantation, the mobilization of endogenous MSCs has been attempted for skin regeneration. Overall, this review highlights the great potential of MSCs for the treatment of skin diseases in the near future.

  17. Development of a one-step approach for the reconstruction of full thickness skin defects using minced split thickness skin grafts and biodegradable synthetic scaffolds as a dermal substitute.

    Science.gov (United States)

    Sharma, Kavita; Bullock, Anthony; Ralston, David; MacNeil, Sheila

    2014-08-01

    Tissue engineering has progressed in delivering laboratory-expanded keratinocytes to the clinic; however the production of a suitable alternative to a skin graft, containing both epidermis and dermis still remains a challenge. To develop a one-step approach to wound reconstruction using finely minced split thickness skin and a biodegradable synthetic dermal substitute. This was explored in vitro using scalpel diced pieces of split thickness human skin combined with synthetic electrospun polylactide (PLA) scaffolds. To aid the spreading of tissue, 1% methylcellulose was used and platelet releasate was examined for its effect on cellular outgrowth from tissue explants. The outcome parameters included the metabolic activity of the migrating cells and their ability to produce collagen. Cell presence and migration on the scaffolds were assessed using fluorescence microscopy and SEM. Cells were identified as keratinocytes by immunostaining for pan-cytokeratin. Collagen deposition was quantified by using Sirius red. Skin cells migrated along the fibers of the scaffold and formed new collagen. 1% methylcellulose improved the tissue handling properties of the minced skin. Platelet releasate did not stimulate the migration of skin cells along scaffold fibers. Immunohistochemistry and SEM confirmed the presence of both epithelial and stromal cells in the new tissue. We describe the first key steps in the production of a skin substitute to be assembled in theatre eliminating the need for cell culture. Whilst further experiments are needed to develop this technique it can be a useful addition to armamentarium of the reconstructive surgeon. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  18. Correlation of Culture Positivity, PCR Positivity, and Burden of Borrelia burgdorferi Sensu Lato in Skin Samples of Erythema Migrans Patients with Clinical Findings.

    Science.gov (United States)

    Stupica, Daša; Lusa, Lara; Maraspin, Vera; Bogovič, Petra; Vidmar, Darja; O'Rourke, Maria; Traweger, Andreas; Livey, Ian; Strle, Franc