Radiosensitivity of normal human epidermal cells in culture
International Nuclear Information System (INIS)
Dover, R.; Potten, C.S.
1983-01-01
Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)
Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes
Laporta, Robert F.; Taichman, Lorne B.
1982-06-01
Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.
Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.
Bolívar-Flores, Y J; Kuri-Harcuch, W
1999-08-01
Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
International Nuclear Information System (INIS)
Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo
2011-01-01
Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.
Insulin binding properties of normal and transformed human epidermal cultured keratinocytes
International Nuclear Information System (INIS)
Verrando, P.; Ortonne, J.P.
1985-01-01
Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders
Kappus, H; Reinhold, C
1994-04-01
Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.
Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.
Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J
1990-12-01
We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.
Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells
International Nuclear Information System (INIS)
Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui
2008-01-01
Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis
Kinetics of growth and differentiation of cultured human epidermal keratinocytes
International Nuclear Information System (INIS)
Albers, K.M.
1985-01-01
A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle
International Nuclear Information System (INIS)
Taichman, L.B.; Setlow, R.B.
1979-01-01
Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts
Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.
Li, Jingting; Sen, George L
2015-12-14
Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.
DEFF Research Database (Denmark)
Kuntsche, Judith; Herre, Angela; Fahr, Alfred
2013-01-01
barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...
Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong
2016-12-01
: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.
International Nuclear Information System (INIS)
Yoshito, Daniele
2011-01-01
For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)
Autodegradation of 125I-labeled human epidermal cell surface proteins
International Nuclear Information System (INIS)
Hashimoto, K.; Singer, K.H.; Lazarus, G.S.
1982-01-01
Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)
International Nuclear Information System (INIS)
Hanson, D.; DeLeo, V.
1990-01-01
Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase
Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst
2013-02-01
Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.
Culture technique of rabbit primary epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Marini M
2012-10-01
Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.
Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics
International Nuclear Information System (INIS)
Ayyagari, R.R.; Khan-Dawood, F.S.
1987-01-01
Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function
Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.
Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De
2016-10-01
In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lakshmana K Yerneni
2007-01-01
quicker healing proving the importance and usefulness of the method. With this new approach a large number of moderate to severely burned patients could be saved in several burn centers across our country with reduced hospitalization period. However, the cell based therapeutic option in burn-wound healing by the application of in vitro - cultivated sheets of epidermis from autologous epidermal keratinocyte stem cells uses no matrix. This technque is sufficient for burn wounds of 2nd & 3rd mixed degree. The burn wounds predominantly of 3rd?and 4th?mixed degree can not be healed by the thin cultured epidermis, thus requiring a cellular or cellular scaffold that more or less mimic for graft take in deeper burns. With this aim, we are presently attempting to create such a scaffold using Mebiol gel, which could support the cultured epidermis for better transfer to the wound bed. Additionally, the usefulness of Mebiol gel in growing epidermal sheets without the necessity of FBS and/or animal origin feeder cells but using human feeder cells will also be tested.
Directory of Open Access Journals (Sweden)
Xia Li
2018-03-01
Full Text Available Background: Even though epidermal growth factor-like domain 7 is known to be overexpressed in osteosarcoma and is associated with poor clinical outcome, few reports are available regarding its mechanism. Aims: The objective of this study was to explore the effect and mechanism of downregulating epidermal growth factor-like domain 7 expression in a human osteosarcoma cell line on the biological function of co-cultured human umbilical vein endothelial cells. Study Design: Cell study. Methods: In the present study, human osteosarcoma cell lines U2OS, Saos-2, HOS, and MG63, and normal human osteoblasts were cultured in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum and 1x antibiotics at 37 °C and 5% CO2 in an incubator. Of the four osteosarcoma cell lines, U2OS expresses the highest level of epidermal growth factor-like domain 7 mRNA as determined using quantitative reverse transcription polymerase chain reaction. With the knockdown of epidermal growth factor-like domain 7 in U2OS and human umbilical vein endothelial cells by lentivirus, the proliferation and apoptosis of U2OS and human umbilical vein endothelial cells were investigated using MTT and flow cytometry assays. After the co-culture of human umbilical vein endothelial cells and epidermal growth factor-like domain 7-knockdown U2OS, the in vitro effects on cell proliferation, apoptosis, adhesion, migration, and the angiogenic ability of human umbilical vein endothelial cells were detected using MTT, flow cytometry, Transwell, and tube formation assays, respectively. The expressions of phosphoinositide 3-kinase, phospho-Akt, total Akt, and vascular endothelial growth factor in human umbilical vein endothelial cells were detected using western blot assay. Results: Lentivirus with epidermal growth factor-like domain 7 shRNA could not significantly affect the proliferation and apoptosis of both U2OS and human umbilical vein endothelial cells, whereas the knockdown of
Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques
2015-06-01
Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.
Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost
2003-01-01
Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis
Differentiation of human scalp hair follicle keratinocytes in culture.
Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J
1984-01-01
The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.
Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan
2010-01-01
This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed
The organization of human epidermis: functional epidermal units and phi proportionality.
Hoath, Steven B; Leahy, D G
2003-12-01
The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.
Sequential cancer mutations in cultured human intestinal stem cells
Drost, Jarno; van Jaarsveld, Richard H.; Ponsioen, Bas; Zimberlin, Cheryl; van Boxtel, Ruben; Buijs, Arjan; Sachs, Norman; Overmeer, René M.; Offerhaus, G. Johan; Begthel, Harry; Korving, Jeroen; van de Wetering, Marc; Schwank, Gerald; Logtenberg, Meike; Cuppen, Edwin; Snippert, Hugo J.; Medema, Jan Paul; Kops, Geert J. P. L.; Clevers, Hans
2015-01-01
Crypt stem cells represent the cells of origin for intestinal neoplasia. Both mouse and human intestinal stem cells can be cultured in medium containing the stem-cell-niche factors WNT, R-spondin, epidermal growth factor (EGF) and noggin over long time periods as epithelial organoids that remain
Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes
Directory of Open Access Journals (Sweden)
Yoshinori Sugiyama
2014-01-01
Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.
Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I
1982-12-01
Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.
Hayase, N; Ishiyama, A; Niwano, M
1994-01-01
We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...
Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age
Directory of Open Access Journals (Sweden)
Zobiri O
2012-02-01
Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test
Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei
2016-02-01
Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor
DEFF Research Database (Denmark)
Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole
2009-01-01
To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...
Epidermal growth factor and its receptors in human pancreatic carcinoma
International Nuclear Information System (INIS)
Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.
1990-01-01
The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells
Energy Technology Data Exchange (ETDEWEB)
Yoshito, Daniele
2011-07-01
For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)
Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro
International Nuclear Information System (INIS)
Kondo, S.; Hozumi, Y.; Aso, K.
1990-01-01
A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
International Nuclear Information System (INIS)
Ananthaswamy, H.N.; Kripke, M.L.
1981-01-01
Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
Energy Technology Data Exchange (ETDEWEB)
Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)
2017-02-01
Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.
International Nuclear Information System (INIS)
Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.
2005-01-01
The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides
1990-04-16
18. SUB3ECT TERMS (oont’d) epidermal injury organ culture •ranuaear vacuoles C-leucine incorpora’tion by full-thickness human akin explants hi stamine ...mast- cell degranulation prostaglandin E2 lysobomal enzymes: acid phosphatase, B-glucuronidase, 0-galactcsidase, lysozyme and lactic dehydrogenase...that histamline (from local mast cells ), and PA and POgk (probably from mast cells and epidermal cells ) are s3e of the early mediators of the inflmma
Pattern of hormone receptors and human epidermal growth factor ...
African Journals Online (AJOL)
Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...
Jacobs, J. J. L.; Lehé, C.; Cammans, K. D. A.; Das, P. K.; Elliott, G. R.
2002-01-01
We evaluated the potential of human organotypic skin explant cultures (hOSECs) for screening skin irritants. Test chemicals were applied to the epidermis of the skin explants which were incubated for 4, 24 or 48 h in tissue culture medium. A decrease in epidermal RNA staining, visualised in frozen
International Nuclear Information System (INIS)
Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.
1987-01-01
Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure
Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei
2017-10-01
Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Hirata, Y.; Orth, D.N.
1981-01-01
Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
Directory of Open Access Journals (Sweden)
Daniela GUZMÁN-URIBE
Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.
Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar
2016-01-01
The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.
Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation
M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)
1997-01-01
textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were
Possible role of epidermal keratinocytes in the construction of acupuncture meridians.
Denda, Mitsuhiro; Tsutsumi, Moe
2014-04-01
Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.
Benny, Paula; Badowski, Cedric; Lane, E Birgitte; Raghunath, Michael
2015-01-01
Skin is one of the most accessible tissues for experimental biomedical sciences, and cultured skin cells represent one of the longest-running clinical applications of stem cell therapy. However, culture-generated skin mimetic multicellular structures are still limited in their application by the time taken to develop these constructs in vitro and by their incomplete differentiation. The development of a functional dermal-epidermal junction (DEJ) is one of the most sought after aspects of cultured skin, and one of the hardest to recreate in vitro. At the DEJ, dermal fibroblasts and epidermal keratinocytes interact to form an interlinked basement membrane of extracellular matrix (ECM), which forms as a concerted action of both keratinocytes and fibroblasts. Successful formation of this basement membrane is essential for take and stability of cultured skin autografts. We studied interactive matrix production by monocultures and cocultures of primary human keratinocytes and fibroblasts in an attempt to improve the efficiency of basement membrane production in culture using mixed macromolecular crowding (mMMC); resulting ECM were enriched with the deposition of collagens I, IV, fibronectin, and laminin 332 (laminin 5) and also in collagen VII, the anchoring fibril component. Our in vitro data point to fibroblasts, rather than keratinocytes, as the major cellular contributors of the DEJ. Not only did we find more collagen VII production and deposition by fibroblasts in comparison to keratinocytes, but also observed that decellularized fibroblast ECM stimulated the production and deposition of collagen VII by keratinocytes, over and above that of keratinocyte monocultures. In confrontation cultures, keratinocytes and fibroblasts showed spontaneous segregation and demarcation of cell boundaries by DEJ protein deposition. Finally, mMMC was used in a classical organotypic coculture protocol with keratinocytes seeded over fibroblast-containing collagen gels. Applied during
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Epidermal growth factor in the rat prostate
DEFF Research Database (Denmark)
Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier
1998-01-01
Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....
Matsumoto, Reiko; Sugimoto, Masazumi
2007-02-01
We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.
Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M
1999-09-27
Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost
Effects of epidermal growth factor on neural crest cells in tissue culture
International Nuclear Information System (INIS)
Erickson, C.A.; Turley, E.A.
1987-01-01
Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Vinter-Jensen, L
2000-01-01
BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...
Response of human epidermal keratinocytes to UV light
International Nuclear Information System (INIS)
Kartasova, A.A.
1987-01-01
This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs
Influence of epidermal hydration on the friction of human skin against textiles
Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.
Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung
2013-01-01
Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...
Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid
2002-09-01
To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.
Influence of epidermal hydration on the friction of human skin against textile
Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between
DEFF Research Database (Denmark)
Green, M R; Couchman, J R
1985-01-01
, the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...
Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal
Directory of Open Access Journals (Sweden)
Kynan T. Lawlor
2015-11-01
Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.
Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)
International Nuclear Information System (INIS)
Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.
1997-01-01
This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist
Directory of Open Access Journals (Sweden)
Yung-Yi Lee
2013-06-01
Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.
Human nature, human culture: the case of cultural evolution.
Lewens, Tim
2017-10-06
In recent years, far from arguing that evolutionary approaches to our own species permit us to describe the fundamental character of human nature, a prominent group of cultural evolutionary theorists has instead argued that the very idea of 'human nature' is one we should reject. It makes no sense, they argue, to speak of human nature in opposition to human culture. The very same sceptical arguments have also led some thinkers-usually from social anthropology-to dismiss the intimately related idea that we can talk of human culture in opposition to human nature. How, then, are we supposed to understand the cultural evolutionary project itself, whose proponents seem to deny the distinction between human nature and human culture, while simultaneously relying on a closely allied distinction between 'genetic' (or sometimes 'organic') evolution and 'cultural' evolution? This paper defends the cultural evolutionary project against the charge that, in refusing to endorse the concept of human nature, it has inadvertently sabotaged itself.
Dagnino, Lina; Crawford, Melissa
2018-03-27
In this article, we provide a method to isolate primary epidermal melanocytes from reporter mice, which also allow targeted gene inactivation. The mice from which these cells are isolated are bred into a Rosa26 mT/mG reporter background, which results in GFP expression in the targeted melanocytic cell population. These cells are isolated and cultured to >95% purity. The cells can be used for gene expression studies, clonogenic experiments, and biological assays, such as capacity for migration. Melanocytes are slow moving cells, and we also provide a method to measure motility using individual cell tracking and data analysis.
Immune sensitization against epidermal antigens in polymorphous light eruption
International Nuclear Information System (INIS)
Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.
1991-01-01
To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption
Expression of epidermal growth factor receptors in human endometrial carcinoma
DEFF Research Database (Denmark)
Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B
1993-01-01
Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...
Tanaka, Yohei; Nakayama, Jun
2016-01-01
Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.
Flow cytometry of human primary epidermal and follicular keratinocytes.
Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako
2008-02-19
The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.
International Nuclear Information System (INIS)
Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.
1984-01-01
Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)
Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors
International Nuclear Information System (INIS)
Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili
2013-01-01
High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors
Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.
Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo
2018-05-01
The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.
Directory of Open Access Journals (Sweden)
Victor Paromov
2011-01-01
Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.
Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes
International Nuclear Information System (INIS)
Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira
1997-01-01
Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding
International Nuclear Information System (INIS)
Graem, N.
1986-01-01
Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue
Epidermal CYP2 family cytochromes P450
International Nuclear Information System (INIS)
Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.
2004-01-01
Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier
Directory of Open Access Journals (Sweden)
H. Jang
2013-01-01
Full Text Available Lyophilized Cultured Epidermal Sheets (L-CES have been reported to be as effective as the cryopreserved CES (F-CES in treating skin ulcers. However, unlike F-CES, no preclinical study assessing wound-healing effects has been conducted for L-CES. The present study was set out to investigate the microstructure, cytokine profile, and wound-healing effects of L-CES in comparison to those of F-CES. Keratinocytes were cultured to prepare CES, followed by cryopreservation at −70°C and lyophilization. Under microscopic observation, intact cells with apparent intracellular junctions were observed in L-CES. The L-CES, like fresh CES, consisted of three to four well-maintained epidermal layers, as shown by the expression of keratins, involucrin, and p63. There were no differences in the epidermal layer or protein expression between L-CES and F-CES, and both CES were comparable to fresh CES. TGF-α, EGF, VEGF, IL-1α, and MMPs were detected in L-CES at levels similar to those in F-CES. In a mouse study, wounds treated with L-CES or F-CES completely healed at least 4 days faster than untreated wounds. CES-treated wounds completely healed by day 10, while the untreated wounds did not heal by day 14. Masson’s trichrome staining showed that collagen deposition in the CES-treated wounds was highly increased in the dermis of the wound center compared to that in the control wounds. Thus, this study demonstrates that L-CES is as clinically effective as F-CES for wound treatment.
A co-cultured skin model based on cell support membranes
International Nuclear Information System (INIS)
Dai, N.-T.; Yeh, M.-K.; Liu, Demeral David; Adams, E.F.; Chiang, C.-H.; Yen, C.-Y.; Shih, C.-M.; Sytwu, H.-K.; Chen, Tim-Mo; Wang, H.-J.; Williamson, M.R.; Coombes, A.G.A.
2005-01-01
Tissue engineering of skin based on collagen: PCL biocomposites using a designed co-culture system is reported. The collagen: PCL biocomposites having collagen: PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen: PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen: PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen: PCL biocomposite
Epidermal growth factor receptor in primary human lung cancer
International Nuclear Information System (INIS)
Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun
1996-01-01
Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion
Energy Technology Data Exchange (ETDEWEB)
Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)
2016-07-08
Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.
Toxic epidermal necrolysis successfully treated with etanercept.
Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio
2009-03-01
Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.
Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo
2015-03-01
Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.
Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen
2012-05-01
The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.
Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Philpott Michael P
2010-02-01
Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant
Directory of Open Access Journals (Sweden)
Dilip Kachhawa
2017-01-01
Full Text Available Background and Aims: Stable vitiligo can be treated by various surgical procedures. Non-cultured melanocyte grafting techniques were developed to overcome the time-consuming process of culture while at the same time providing acceptable results. All the techniques using non-cultured melanocyte transfer involve trypsinisation as an integral step. Jodhpur technique used by the author is autologous, non-cultured, non-trypsinised, epidermal cell grafting. Settings and Design: The study was conducted on patients visiting the dermatology outpatient department of a tertiary health centre in Western Rajasthan. Materials and Methods: At the donor site, mupirocin ointment was applied and dermabrasion was done with the help of micromotor dermabrader till pinpoint bleeding was seen. The paste-like material obtained by this procedure containing melanocytes and keratinocytes admixed with the ointment base was harvested with spatula and was subsequently spread over the recipient area. Recipient site was prepared in the same manner by dermabrasion. After 10 days, dressing at both sites was removed taking utmost care at the recipient site as there was a theoretical risk of dislodging epidermal cells. Results: In a study of 437 vitiligo patches, more than 75% re-pigmentation (excellent improvement was seen in 41% of the patches. Lesions on thigh (100%, face (75% and trunk (50% showed maximal excellent improvement, whereas patches on joints and acral areas did not show much improvement. Conclusions: This technique is a simplified, cost effective, less time-consuming alternative to other techniques which involve tryspsinisation of melanocytes and at the same time provides satisfactory uniform pigmentation.
Energy Technology Data Exchange (ETDEWEB)
Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando
2000-02-01
The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.
International Nuclear Information System (INIS)
Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando
2000-01-01
The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy
Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour
International Nuclear Information System (INIS)
Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.
1996-01-01
Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)
DEFF Research Database (Denmark)
Fismen, S; Hedberg, A; Fenton, K A
2009-01-01
Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...
Energy Technology Data Exchange (ETDEWEB)
Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)
2015-03-01
Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human
International Nuclear Information System (INIS)
Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo
2015-01-01
Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human
Directory of Open Access Journals (Sweden)
Francis Finot
2012-01-01
Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.
Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba
1996-01-01
Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...
Directory of Open Access Journals (Sweden)
Tanaka Y
2016-08-01
Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the
Epidermal stem cells: location, potential and contribution to cancer.
Ambler, C A; Määttä, A
2009-01-01
Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.
Hybrid Enhanced Epidermal SpaceSuit Design Approaches
Jessup, Joseph M.
A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Homologous radioimmunoassay for human epidermal growth factor (urogastrone)
International Nuclear Information System (INIS)
Dailey, G.E.; Kraus, J.W.; Orth, D.N.
1978-01-01
Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion
Tight junction regulates epidermal calcium ion gradient and differentiation
International Nuclear Information System (INIS)
Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki
2011-01-01
Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.
Reconstruction of living bilayer human skin equivalent utilizing human fibrin as a scaffold.
Mazlyzam, A L; Aminuddin, B S; Fuzina, N H; Norhayati, M M; Fauziah, O; Isa, M R; Saim, L; Ruszymah, B H I
2007-05-01
Our aim of this study was to develop a new methodology for constructing a bilayer human skin equivalent to create a more clinical compliance skin graft composite for the treatment of various skin defects. We utilized human plasma derived fibrin as the scaffold for the development of a living bilayer human skin equivalent: fibrin-fibroblast and fibrin-keratinocyte (B-FF/FK SE). Skin cells from six consented patients were culture-expanded to passage 1. For B-FF/FK SE formation, human fibroblasts were embedded in human fibrin matrix and subsequently another layer of human keratinocytes in human fibrin matrix was stacked on top. The B-FF/FK SE was then transplanted to athymic mice model for 4 weeks to evaluate its regeneration and clinical performance. The in vivo B-FF/FK SE has similar properties as native human skin by histological analysis and expression of basal Keratin 14 gene in the epidermal layer and Collagen type I gene in the dermal layer. Electron microscopy analysis of in vivo B-FF/FK SE showed well-formed and continuous epidermal-dermal junction. We have successfully developed a technique to engineer living bilayer human skin equivalent using human fibrin matrix. The utilization of culture-expanded human skin cells and fibrin matrix from human blood will allow a fully autologous human skin equivalent construction.
Predicting human epidermal melanin concentrations for different skin tones
CSIR Research Space (South Africa)
Smit, Jacoba E
2011-07-01
Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...
DEFF Research Database (Denmark)
Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten
2011-01-01
To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....
Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming
2015-09-01
Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Energy Technology Data Exchange (ETDEWEB)
Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)
2013-10-15
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
International Nuclear Information System (INIS)
Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical
Energy Technology Data Exchange (ETDEWEB)
Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)
2015-09-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human
International Nuclear Information System (INIS)
Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten
2015-01-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and
Directory of Open Access Journals (Sweden)
Takamitsu Sasaki
2007-12-01
Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.
Human dental pulp stem cells cultured in serum-free supplemented medium
Directory of Open Access Journals (Sweden)
Virginie eBonnamain
2013-12-01
Full Text Available Growing evidence show that human dental pulp stem cells (DPSCs could provide a source of adult stem cells for the treatment of neurodegenerative pathologies. In this study, DPSCs were expanded and cultured with a protocol generally used for the culture of neural stem/progenitor cells.Methodology: DPSC cultures were established from third molars. The pulp tissue was enzymatically digested and cultured in serum-supplemented basal medium for 12 hours. Adherent (ADH and non-adherent (non-ADH cell populations were separated according to their differential adhesion to plastic and then cultured in serum-free defined N2 medium with epidermal growth factor (EGF and basic fibroblast growth factor (bFGF. Both ADH and non-ADH populations were analyzed by FACS and/or PCR.Results: FACS analysis of ADH-DPSCs revealed the expression of the mesenchymal cell marker CD90, the neuronal marker CD56, the transferrin receptor CD71, and the chemokine receptor CXCR3, whereas hematopoietic stem cells markers CD45, CD133 and CD34 were not expressed. ADH-DPSCs expressed transcripts coding for the Nestin gene, whereas expression levels of genes coding for the neuronal markers β-III tubulin and NF-M, and the oligodendrocyte marker PLP-1 were donor dependent. ADH-DPSCs did not express the transcripts for GFAP, an astrocyte marker. Cells of the non-ADH population that grew as spheroids expressed Nestin, β-III tubulin, NF-M and PLP-1 transcripts. DPSCs migrated out of the spheroids exhibited an odontoblast-like morphology and expressed a higher level of DSPP and osteocalcin transcripts than ADH-DPSCs. Conclusion: Collectively, these data indicate that human DPSCs can be expended and cultured in serum-free supplemented medium with EGF and bFGF. ADH-DPSCs and non-ADH populations contained neuronal and/or oligodendrocyte precursors at different stages of commitment and interestingly, cells from spheroid structures seem to be more engaged into the odontoblastic lineage than the
Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz
2018-02-01
Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.
"Cut-and-paste" manufacture of multiparametric epidermal electronic systems
Lu, Nanshu; Yang, Shixuan; Wang, Pulin
2016-05-01
Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Effects of soap-water wash on human epidermal penetration.
Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard
2016-08-01
Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the
van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.
2014-01-01
Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of
van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.
Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of
Human Rights and Cultural Identity
Directory of Open Access Journals (Sweden)
John-Stewart Gordon
2015-12-01
Full Text Available Universal human rights and particular cultural identities, which are relativistic by nature, seem to stand in conflict with each other. It is commonly suggested that the relativistic natures of cultural identities undermine universal human rights and that human rights might compromise particular cultural identities in a globalised world. This article examines this supposed clash and suggests that it is possible to frame a human rights approach in such a way that it becomes the starting point and constraining framework for all non-deficient cultural identities. In other words, it is possible to depict human rights in a culturally sensitive way so that universal human rights can meet the demands of a moderate version of meta-ethical relativism which acknowledges a small universal core of objectively true or false moral statements and avers that, beyond that small core, all other moral statements are neither objectively true nor false.
Culture Representation in Human Reliability Analysis
Energy Technology Data Exchange (ETDEWEB)
David Gertman; Julie Marble; Steven Novack
2006-12-01
Understanding human-system response is critical to being able to plan and predict mission success in the modern battlespace. Commonly, human reliability analysis has been used to predict failures of human performance in complex, critical systems. However, most human reliability methods fail to take culture into account. This paper takes an easily understood state of the art human reliability analysis method and extends that method to account for the influence of culture, including acceptance of new technology, upon performance. The cultural parameters used to modify the human reliability analysis were determined from two standard industry approaches to cultural assessment: Hofstede’s (1991) cultural factors and Davis’ (1989) technology acceptance model (TAM). The result is called the Culture Adjustment Method (CAM). An example is presented that (1) reviews human reliability assessment with and without cultural attributes for a Supervisory Control and Data Acquisition (SCADA) system attack, (2) demonstrates how country specific information can be used to increase the realism of HRA modeling, and (3) discusses the differences in human error probability estimates arising from cultural differences.
Grafting of human epidermal cells, presence and perspectives
Czech Academy of Sciences Publication Activity Database
Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.
2001-01-01
Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry
Kremer, M; Lang, E; Berger, A C
2000-09-01
Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human
Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun
2016-02-01
Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.
Collard, J-F; Hinsenkamp, M
2015-05-01
We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes
International Nuclear Information System (INIS)
Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.
1996-01-01
UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)
Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B
2013-08-20
At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.
Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique
2014-10-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment
Expression of the epidermal growth factor system in human endometrium during the menstrual cycle
DEFF Research Database (Denmark)
Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier
2005-01-01
The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...
An evaluation of the choice of feeder cell growth arrest for the production of cultured epidermis.
Chugh, Rishi Man; Chaturvedi, Madhusudan; Yerneni, Lakshmana Kumar
2015-12-01
Growth arrested 3T3 cells have been used as feeder cells in human epidermal keratinocyte cultures to produce cultured epidermal autografts for the treatment of burns. The feeder cells were ideally growth-arrested by gamma-irradiation. Alternatively, growth arrest by mitomycin C treatment is a cost effective option. We compared the functional efficacy of these two approaches in keratinocyte cultures by colony forming efficiency, the net growth area of colonies, BrdU labeling and histological features of cultured epidermal sheets. The growth area estimation involved a semi-automated digital technique using the Adobe Photoshop and comprised of isolation and enumeration of red pixels in Rhodamine B-stained keratinocyte colonies. A further refinement of the technique led to the identification of critical steps to increasing the degree of accuracy and enabling its application as an extension of colony formation assay. The results on feeder cell functionality revealed that the gamma irradiated feeders influenced significantly higher colony forming efficiency and larger growth area than the mitomycin C treated feeders. The BrdU labeling study indicated significant stimulation of the overall keratinocyte proliferation by the gamma irradiated feeders. The cultured epidermal sheets produced by gamma feeders were relatively thicker than those produced by mitomycin C feeders. We discussed the clinical utility of mitomycin C feeders from the viewpoint of cost-effective burn care in developing countries. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.
Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis
2015-07-01
IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.
Isolation and In Vitro Characterization of Epidermal Stem Cells
DEFF Research Database (Denmark)
Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak
2017-01-01
flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...
Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis
2008-12-01
Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.
Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin
DEFF Research Database (Denmark)
Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith
2008-01-01
study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...
[Progress in epidermal stem cells].
Wang, Li-Juan; Wang, You-Liang; Yang, Xiao
2010-03-01
Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.
An ex vivo human skin model for studying skin barrier repair.
Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A
2015-01-01
In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.
2007-01-01
PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,
Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne
2017-01-01
Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Recycling of epidermal growth factor in a human pancreatic carcinoma cell line
International Nuclear Information System (INIS)
Korc, M.; Magun, B.E.
1985-01-01
PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell
McKnight, Braden; Seidel, Rachel; Moy, Ron
2015-10-01
Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.
Rastogi, Anshu; Pospísil, Pavel
2010-08-01
All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
International Nuclear Information System (INIS)
Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.
1991-01-01
Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
International Nuclear Information System (INIS)
Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-01-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
Energy Technology Data Exchange (ETDEWEB)
Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-07-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.
Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme
2017-01-01
Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.
Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang
2018-01-01
Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.
Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.
2014-01-01
We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416
Energy Technology Data Exchange (ETDEWEB)
Buck, P.A.
1986-01-01
Ovarian follicular development is dependent upon the coordinated growth and differentiation of the granulosa cells which line the follicle. Follicle stimulating hormone (FSH) induces granulosa cell differentiation both in vivo and in vitro. Epidermal growth factor (EGF) stimulates granulosa cell proliferation in vitro. The interaction of these two effectors upon selected parameters of growth and differentiation was examined in monolayer cultures of porcine granulose cells. Analysis of the EGF receptor by /sup 125/I-EGF binding revealed that the receptor was of high affinity with an apparent dissociation constant of 4-6 x 10/sup -10/ M. The average number of receptors per cell varied with the state of differentiation both in vivo and in vitro; highly differentiated cells bound two-fold less /sup 125/I-EGF and this effect was at least partially induced by FSH in vitro. EGF receptor function was examined by assessing EGF effects on cell number and /sup 3/H-thymidine incorporation. EGF stimulated thymidine incorporation in both serum-free and serum-supplemented culture, but only in serum-supplemented conditions was cell number increased. EGF receptor function was inversely related to the state of differentiation and was attenuated by FSH. The FSH receptor was examined by /sup 125/I-FSH binding. EGF increased FSH receptor number, and lowered the affinity of the receptor. The function of these receptors was assessed by /sup 125/I-hCG binding and progesterone radioimmunoassay. If EGF was present continuously in the cultures. FSH receptor function was attenuated regardless of FSH receptor number. A preliminary effort to examine the mechanism of this interaction was performed by analyzing hormonally controlled protein synthesis with /sup 35/S-methionine labeling, SDS polyacrylamide gel electrophoresis and fluorography. FSH promoted the expression of a 27,000 dalton protein. This effect was attenuated by EGF.
Enhancement of human neural stem cell self-renewal in 3D hypoxic culture.
Ghourichaee, Sasan Sharee; Powell, Elizabeth M; Leach, Jennie B
2017-05-01
The pathology of neurological disorders is associated with the loss of neuronal and glial cells that results in functional impairments. Human neural stem cells (hNSCs), due to their self-renewing and multipotent characteristics, possess enormous tissue-specific regenerative potential. However, the efficacy of clinical applications is restricted due to the lack of standardized in vitro cell production methods with the capability of generating hNSC populations with well-defined cellular compositions. At any point, a population of hNSCs may include undifferentiated stem cells, intermediate and terminally differentiated progenies, and dead cells. Due to the plasticity of hNSCs, environmental cues play crucial roles in determining the cellular composition of hNSC cultures over time. Here, we investigated the independent and synergistic effect of three important environmental factors (i.e., culture dimensionality, oxygen concentration, and growth factors) on the survival, renewal potential, and differentiation of hNSCs. Our experimental design included two dimensional (2D) versus three dimensional (3D) cultures and normoxic (21% O 2 ) versus hypoxic (3% O 2 ) conditions in the presence and absence of epidermal growth factor (EGF) and fibroblast growth factor-2 (FGF-2). Additionally, we discuss the feasibility of mathematical models that predict hNSC growth and differentiation under these culture conditions by adopting a negative feedback regulatory term. Our results indicate that the synergistic effect of culture dimensionality and hypoxic oxygen concentration in the presence of growth factors enhances the proliferation of viable, undifferentiated hNSCs. Moreover, the same synergistic effect in the absence of growth factors promotes the differentiation of hNSCs. Biotechnol. Bioeng. 2017;114: 1096-1106. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G
1989-10-15
The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.
Kempe, Marius; Lycett, Stephen J; Mesoudi, Alex
2014-10-21
Diverse species exhibit cultural traditions, i.e. population-specific profiles of socially learned traits, from songbird dialects to primate tool-use behaviours. However, only humans appear to possess cumulative culture, in which cultural traits increase in complexity over successive generations. Theoretically, it is currently unclear what factors give rise to these phenomena, and consequently why cultural traditions are found in several species but cumulative culture in only one. Here, we address this by constructing and analysing cultural evolutionary models of both phenomena that replicate empirically attestable levels of cultural variation and complexity in chimpanzees and humans. In our model of cultural traditions (Model 1), we find that realistic cultural variation between populations can be maintained even when individuals in different populations invent the same traits and migration between populations is frequent, and under a range of levels of social learning accuracy. This lends support to claims that putative cultural traditions are indeed cultural (rather than genetic) in origin, and suggests that cultural traditions should be widespread in species capable of social learning. Our model of cumulative culture (Model 2) indicates that both the accuracy of social learning and the number of cultural demonstrators interact to determine the complexity of a trait that can be maintained in a population. Combining these models (Model 3) creates two qualitatively distinct regimes in which there are either a few, simple traits, or many, complex traits. We suggest that these regimes correspond to nonhuman and human cultures, respectively. The rarity of cumulative culture in nature may result from this interaction between social learning accuracy and number of demonstrators. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hesperetin induces melanin production in adult human epidermal melanocytes.
Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban
2015-06-01
One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.
Radiosensitivity in cultured human fibroblasts
International Nuclear Information System (INIS)
Cox, R.; Masson, W.K.
1980-01-01
Caution is urged in the use of freshly isolated cultures of human diploid fibroblasts for quantitative studies of radiosensitivity. The distribution of x ray sensitivities of 'normal' human fibroblast cultures of foetal origin (10 subjects, skin or lung biopsy) and post-foetal origin (34 subjects, skin biopsy) are compared with the distribution in 12 patients with ataxia telangiectasia (probability of including any one of these in a normal post-foetal distribution is 0.01%). Cultures from nominally normal subjects showed a broad distribution of D 0 range of 98 +- 160 rad and assuming normal distribution, a mean +- one standard deviation of 122 +- 17 rad. Mean D 0 values for foetal origin cultures were 117 +- 12; values for post-foetal cultures D 0 were 124 +- 18. No systematic variation in D 0 was observed for age of donor, number of cell divisions in culture or for cloning efficiency. For ataxia telangiectasia D 0 values were 46 +- 7 rad. (U.K.)
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wakshull, E.; Kraemer, P.M.; Wharton, W.
1985-01-01
Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells
Culture, Urbanism and Changing Human Biology.
Schell, L M
2014-04-03
Anthropologists have long known that human activity driven by culture changes the environment. This is apparent in the archaeological record and through the study of the modern environment. Perhaps the largest change since the paleolithic era is the organization of human populations in cities. New environments can reshape human biology through evolution as shown by the evolution of the hominid lineage. Evolution is not the only process capable of reshaping our biology. Some changes in our human biology are adaptive and evolutionary while others are pathological. What changes in human biology may be wrought by the modern urban environment? One significant new change in the environment is the introduction of pollutants largely through urbanization. Pollutants can affect human biology in myriad ways. Evidence shows that human growth, reproduction, and cognitive functioning can be altered by some pollutants, and altered in different ways depending on the pollutant. Thus, pollutants have significance for human biologists and anthropologists generally. Further, they illustrate the bio-cultural interaction characterizing human change. Humans adapt by changing the environment, a cultural process, and then change biologically to adjust to that new environment. This ongoing, interactive process is a fundamental characteristic of human change over the millennia.
Wild Cultures: A Comparison between Chimpanzee and Human Cultures
Directory of Open Access Journals (Sweden)
Diana Rocío Carvajal Contreras
2013-07-01
Full Text Available Review of Wild Cultures: A Comparison between Chimpanzee and Human Cultures. Christophe Boesch. 2012. Cambridge University Press. Pp. 276, 68 b & w illustrations, 11 tables. £60 (hardback. ISBN 9781109025370.
Epidermal Inclusion Cysts of The Breast
Directory of Open Access Journals (Sweden)
Amir R. Motabar
2009-02-01
Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.
Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi
2011-09-01
Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.
Epidermal growth factor receptor expression in urinary bladder cancer
Directory of Open Access Journals (Sweden)
Dayalu S.L. Naik
2011-01-01
Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.
The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.
Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina
2004-12-03
The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.
Staiano-Coico, L; Steinberg, M; Higgins, P J
1990-10-15
Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.
Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou
2018-05-01
Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.
International Nuclear Information System (INIS)
Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos
2010-01-01
Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.
Stampfer, Martha R; Garbe, James C
2015-02-24
Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.
Do cultural diversity and human rights make a good match?
Donders, Yvonne
2010-01-01
The link between cultural diversity and human rights was clearly established by the Universal Declaration on Cultural Diversity, adopted by the member states of UNESCO in 2001, which holds that "the defence of cultural diversity is … inseparable from respect for human dignity" and that it "implies a commitment to human rights and fundamental freedoms." The UNESCO Convention on the Protection and Promotion of the Diversity of Cultural Expressions, adopted in 2005, states that "cultural diversity can be protected and promoted only if human rights and fundamental freedoms … are guaranteed" (Article 2[1]). The precise relationship between cultural diversity and human rights, however, is not clarified and thus leaves room for further exploration. This contribution analyses the issues surrounding the relationship between cultural diversity and human rights, in particular cultural rights. Firstly, it addresses general human rights issues such as universality and cultural relativism and the principles of equality and non-discrimination. Secondly, it explores the scope of cultural rights, as well as the cultural dimension of human rights. Thirdly, several cases are discussed in which human rights were invoked to protect cultural interests, confirming the value of cultural diversity. Finally, some concluding remarks are presented, indicating which areas require attention in order to further improve the promotion and protection of human rights in relation to cultural diversity.
Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A
2013-09-07
Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.
Immunohistochemical localization of epidermal growth factor in rat and man
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Nexø, Ebba
1986-01-01
Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...
International Nuclear Information System (INIS)
Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong
2016-01-01
The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users
International Nuclear Information System (INIS)
Olsen, W.M.; Elgjo, K.
1990-01-01
A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system
TECHNICAL CULTURE AND HUMAN AXJOSPHERE
Krystyna Chałas
2014-01-01
Technical culture is the value of each historical period. It is the subject of the ongoing development. While it is a value which is associated with different categories of values, mainly material, cognitive, social. Between culture and these three categories of values there is a cognitive effect. Technical culture determines the quality of human axjosphere. The aim of this study is to show the relationships and dependencies between technical culture and the structures in which a person liv...
Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil
2016-06-21
Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European
Europium-labeled epidermal growth factor and neurotensin: novel probes for receptor-binding studies.
Mazor, Ohad; Hillairet de Boisferon, Marc; Lombet, Alain; Gruaz-Guyon, Anne; Gayer, Batya; Skrzydelsky, Delphine; Kohen, Fortune; Forgez, Patricia; Scherz, Avigdor; Rostene, William; Salomon, Yoram
2002-02-01
We investigated the possibility of labeling two biologically active peptides, epidermal growth factor (EGF) and neurotensin (NT), with europium (Eu)-diethylenetriaminepentaacetic acid. More specifically, we tested them as probes in studying receptor binding using time-resolved fluorescence of Eu3+. The relatively simple synthesis yields ligands with acceptable binding characteristics similar to isotopically labeled derivatives. The binding affinity (Kd) of labeled Eu-EGF to human A431 epidermal carcinoid cells was 3.6 +/- 1.2 nM, similar to the reported Kd values of EGF, whereas the Kd of Eu-NT to human HT29 colon cancer cells (7.4 +/- 0.5 nM) or to Chinese hamster ovary (CHO) cells transfected with the high-affinity NT receptor (CHO-NT1) were about 10-fold higher than the Kd values of NT. The bioactivity of the Eu-labeled EGF as determined by stimulation of cultured murine D1 hematopoietic cell proliferation was nearly the same as that obtained with native EGF. The maximal stimulation of Ca2+ influx with NT and Eu-NT in CHO-NT1 cells was similar, but the respective K0.5 values were 20 pM and 1 nM, corresponding to differences in the binding affinities previously described. The results of these studies indicate that Eu labeling of peptide hormones and growth factor molecules ranging from 10(3) to 10(5) Da can be conveniently accomplished. Importantly, the Eu-labeled products are stable for approximately 2 years and are completely safe for laboratory use compared to the biohazardous radioligands. Thus, Eu-labeled peptides present an attractive alternative for commonly used radiolabeled ligands in biological studies in general and in receptor assays in particular.
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D
1993-09-01
[sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).
Directory of Open Access Journals (Sweden)
Rebecca Lamb
Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.
21 CFR 864.2280 - Cultured animal and human cells.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...
Yanagihara, K; Cheng, H; Cheng, P W
2000-01-01
Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.
Medical humanities as expressive of Western culture.
Hooker, Claire; Noonan, Estelle
2011-12-01
In this paper we articulate a growing awareness within the field of the ways in which medical humanities could be deemed expressive of Western cultural values. The authors suggest that medical humanities is culturally limited by a pedagogical and scholarly emphasis on Western cultural artefacts, as well as a tendency to enact an uncritical reliance upon foundational concepts (such as 'patient' and 'experience') within Western medicine. Both these tendencies within the field, we suggest, are underpinned by a humanistic emphasis on appreciative or receptive encounters with 'difference' among patients that may unwittingly contribute to the marginalisation of some patients and healthcare workers. While cultural difference should be acknowledged as a central preoccupation of medical humanities, we argue that the discipline must continue to expand its scholarly and critical engagements with processes of Othering in biomedicine. We suggest that such improvements are necessary in order to reflect the cultural diversification of medical humanities students, and the geographical expansion of the discipline within non-Western and/or non-Anglophone locations.
Huber, Birgit; Czaja, Alina Maria; Kluger, Petra Juliane
2016-05-01
The composition of vascularized adipose tissue is still an ongoing challenge as no culture medium is available to supply adipocytes and endothelial cells appropriately. Endothelial cell medium is typically supplemented with epidermal growth factor (EGF) as well as hydrocortisone (HC). The effect of EGF on adipocytes is discussed controversially. Some studies say it inhibits adipocyte differentiation while others reported of improved adipocyte lipogenesis. HC is known to have lipolytic activities, which might result in mature adipocyte dedifferentiation. In this study, we evaluated the influence of EGF and HC on the co-culture of endothelial cells and mature adipocytes regarding their cell morphology and functionality. We showed in mono-culture that high levels of HC promoted dedifferentiation and proliferation of mature adipocytes, whereas EGF seemed to have no negative influence. Endothelial cells kept their typical cobblestone morphology and showed a proliferation rate comparable to the control independent of EGF and HC concentration. In co-culture, HC promoted dedifferentiation of mature adipocytes, which was shown by a higher glycerol release. EGF had no negative impact on adipocyte morphology. No negative impact on endothelial cell morphology and functionality could be seen with reduced EGF and HC supplementation in co-culture with mature adipocytes. Taken together, our results demonstrate that reduced levels of HC are needed for co-culturing mature adipocytes and endothelial cells. In co-culture, EGF had no influence on mature adipocytes. Therefore, for the composition of vascularized adipose tissue constructs, the media with low levels of HC and high or low levels of EGF can be used. © 2016 International Federation for Cell Biology.
DEFF Research Database (Denmark)
Celis, J E; Madsen, Peder; Rasmussen, H H
1991-01-01
A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...
Directory of Open Access Journals (Sweden)
Santosh Kumar
2015-01-01
Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.
Medrano, Jose V; Rombaut, Charlotte; Simon, Carlos; Pellicer, Antonio; Goossens, Ellen
2016-11-01
To study the ability of human spermatogonial stem cells (hSSCs) to proliferate in vitro under mouse spermatogonial stem cell (mSSC) culture conditions. Experimental basic science study. Reproductive biology laboratory. Cryopreserved testicular tissue with normal spermatogenesis obtained from three donors subjected to orchiectomy due to a prostate cancer treatment. Testicular cells used to create in vitro cell cultures corresponding to the following groups: [1] unsorted human testicular cells, [2] differentially plated human testicular cells, and [3] cells enriched with major histocompatibility complex class 1 (HLA - )/epithelial cell surface antigen (EPCAM + ) in coculture with inactivated testicular feeders from the same patient. Analyses and characterization including immunocytochemistry and quantitative reverse-transcription polymerase chain reaction for somatic and germ cell markers, testosterone and inhibin B quantification, and TUNEL assay. Putative hSSCs appeared in singlets, doublets, or small groups of up to four cells in vitro only when testicular cells were cultured in StemPro-34 medium supplemented with glial cell line-derived neurotrophic factor (GDNF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF). Fluorescence-activated cell sorting with HLA - /EPCAM + resulted in an enrichment of 27% VASA + /UTF1 + hSSCs, compared to 13% in unsorted controls. Coculture of sorted cells with inactivated testicular feeders gave rise to an average density of 112 hSSCs/cm 2 after 2 weeks in vitro compared with unsorted cells (61 hSSCs/cm 2 ) and differentially plated cells (49 hSSCS/cm 2 ). However, putative hSSCs rarely stained positive for the proliferation marker Ki67, and their presence was reduced to the point of almost disappearing after 4 weeks in vitro. We found that hSSCs show limited proliferation in vitro under mSSC culture conditions. Coculture of HLA - /EPCAM + sorted cells with testicular
Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori
2017-08-01
To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.
Ozbun, Michelle A; Patterson, Nicole A
2014-08-01
Papillomaviruses have a strict tropism for epithelial cells, and they are fully reliant on cellular differentiation for completion of their life cycles, resulting in the production of progeny virions. Thus, a permissive environment for full viral replication in vitro-wherein virion morphogenesis occurs under cooperative viral and cellular cues-requires the cultivation of epithelium. Presented in the first section of this unit is a protocol to grow differentiating epithelial tissues that mimic many important morphological and biochemical aspects of normal skin. The technique involves growing epidermal cells atop a dermal equivalent consisting of live fibroblasts and a collagen lattice. Epithelial stratification and differentiation ensues when the keratinocyte-dermal equivalent is placed at the air-liquid interface. The apparent floating nature of the cell-matrix in this method led to the nickname "raft" cultures. The general technique can be applied to normal low passage keratinocytes, to cells stably transfected with papillomavirus genes or genomes, or keratinocytes established from neoplastic lesions. However, infectious papillomavirus particles have only been isolated from organotypic epithelial cultures initiated with cells that maintain oncogenic human papillomavirus genomes in an extrachomosomal replicative form. The second section of this unit is dedicated to a virion isolation method that minimizes aerosol and skin exposure to these human carcinogens. Although the focus of the protocols is on the growth of tissues that yields infectious papillomavirus progeny, this culture system facilitates the investigation of these fastidious viruses during their complex replicative cycles, and raft tissues can be manipulated and harvested at any point during the process. Importantly, a single-step virus growth cycle is achieved in this process, as it is unlikely that progeny virions are released to initiate subsequent rounds of infection. Copyright © 2014 John Wiley
Studies in human skin epithelial cell carcinogenesis
International Nuclear Information System (INIS)
Lehman, T.A.
1987-01-01
Metabolism and DNA adduct formation of benzo[a]pyrene (BP) by human epidermal keratinocytes pretreated with inhibitors or inducer of cytochrame P450 was studied. To study DNA adduct analysis, cultures were pretreated as described above, and then treated with non-radiolabeled BP. DNA was prepared from these cultures, digested to the nucleotide level, and 32 P-postlabeled for adduct analysis. Cultures pretreated with BHA, 7,8-BF or disulfiralm formed significantly fewer BPDE I-dB adducts than non-pretreated cultures, while cultures pretreated with MeBHA formed more BPDE-I-dG adducts. MeBHA increased BP activation and adduct formation inhuman keratinocyte in cultures by inducing a specific isoenzyme of cytochrome P450 which preferentially increases the oxidative metabolism of BP to 7,8 diol BP and 7,8 diol BP to BPDE I. To approximate an in vivo human system, metabolism of BPDE I by human skin xenografts treated with cell cycles modulators was studied. When treated with BPDE I, specific carcinogen-DNA adducts were formed. Separation and identification of these adducts by the 32 P-postlabeling technique indicated that the 7R- and 7S-BPDE I-dG adducts were the major adducts
DEFF Research Database (Denmark)
Boone, Marc; Draye, Jean Pierre; Verween, Gunther
2014-01-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...
Visual Culture, Art History and the Humanities
Castaneda, Ivan
2009-01-01
This essay will discuss the need for the humanities to address visual culture studies as part of its interdisciplinary mission in today's university. Although mostly unnoticed in recent debates in the humanities over historical and theoretical frameworks, the relatively new field of visual culture has emerged as a corrective to a growing…
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat
Directory of Open Access Journals (Sweden)
Roberta Sartori
2016-06-01
Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.
Directory of Open Access Journals (Sweden)
Nitin Nitin
2009-06-01
Full Text Available Background: The development of noninvasive molecular imaging approaches has the potential to improve management of cancer. Methods: In this study, we demonstrate the potential of noninvasive topical delivery of an epidermal growth factor-Alexa 647 (EGF-Alexa 647 conjugate to image changes in epidermal growth factor receptor expression associated with oral neoplasia. We report a series of preclinical analyses to evaluate the optical contrast achieved after topical delivery of EGF-Alexa 647 in a variety of model systems, including cells, three-dimensional tissue cultures, and intact human tissue specimens using wide-field and high-resolution fluorescence imaging. Data were collected from 17 different oral cancer patients: eight pairs of normal and abnormal biopsies and nine resected tumors were examined. Results: The EGF-dye conjugate can be uniformly delivered throughout the oral epithelium with a penetration depth exceeding 500 µm and incubation time of less than 30 minutes. After EGF-Alexa 647 incubation, the presence of oral neoplasia is associated with a 1.5- to 6.9-fold increase in fluorescence contrast compared with grossly normal mucosa from the same patient with both wide-field and high-resolution fluorescence imaging. Conclusions: Results illustrate the potential of EGF-targeted fluorescent agents for in vivo molecular imaging, a technique that may aid in the diagnosis and characterization of oral neoplasia and allow real-time detection of tumor margins.
The cultural dimension of economic activities in international human right jurisprudence
Donders, Y.; Vadi, V.; de Witte, B.
2015-01-01
Cultural diversity and human rights are mutually linked: human rights protect and promote cultural diversity while cultural diversity also forms an important aspect of the enjoyment of human rights. Cultural diversity and the economy are also increasingly connected, for example through cultural
Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B
2000-01-01
Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.
TECHNICAL CULTURE AND HUMAN AXJOSPHERE
Directory of Open Access Journals (Sweden)
Krystyna Chałas
2014-11-01
Full Text Available Technical culture is the value of each historical period. It is the subject of the ongoing development. While it is a value which is associated with different categories of values, mainly material, cognitive, social. Between culture and these three categories of values there is a cognitive effect. Technical culture determines the quality of human axjosphere. The aim of this study is to show the relationships and dependencies between technical culture and the structures in which a person lives and works. It is mainly about the answer to the question of which values of technical culture are closely related to and what are the inter dependencies? The primary task is to define the concept of the technical culture and to show its teaching essence. The second task boils down to indicate the range of values inherent in the culture of technology, determining the value of the technological culture and values, which are developed by the technical culture. Indication of the interaction between the technical culture and values is the third task.
DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi
Directory of Open Access Journals (Sweden)
Lila Gardenia
2014-06-01
Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.
A review of toxic epidermal necrolysis management in Japan
Directory of Open Access Journals (Sweden)
Yuri Kinoshita
2017-01-01
Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.
Epidermal stem cells response to radiative genotoxic stress
International Nuclear Information System (INIS)
Marie, Melanie
2013-01-01
Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global
AbstractDermal exposure to metals may res·ult in irritant contact dermatitis. This study examined the potential of metal nanoparticles to elicit irritant contact dermatitis in a human skin equivalent model (HSEM) derived from epidermal keratinocytes. These cultured cells form a m...
Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai
2018-03-15
Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related
Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.
Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo
2014-01-01
To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.
[Characterization of epithelial primary culture from human conjunctiva].
Rivas, L; Blázquez, A; Muñoz-Negrete, F J; López, S; Rebolleda, G; Domínguez, F; Pérez-Esteban, A
2014-01-01
To evaluate primary cultures from human conjunctiva supplemented with fetal bovine serum, autologous serum, and platelet-rich autologous serum, over human amniotic membrane and lens anterior capsules. One-hundred and forty-eight human conjunctiva explants were cultured in CnT50(®) supplemented with 1, 2.5, 5 and 10% fetal bovine serum, autologous serum and platelet-rich autologous serum. Conjunctival samples were incubated at 37°C, 5% CO2 and 95% HR, for 3 weeks. The typical phenotype corresponding to conjunctival epithelial cells was present in all primary cultures. Conjunctival cultures had MUC5AC-positive secretory cells, K19-positive conjunctival cells, and MUC4-positive non-secretory conjunctival cells, but were not corneal phenotype (cytokeratin K3-negative) and fibroblasts (CD90-negative). Conjunctiva epithelial progenitor cells were preserved in all cultures; thus, a cell culture in CnT50(®) supplemented with 1 to 5% autologous serum over human amniotic membrane can provide better information of epithelial cell differentiation for the conjunctival surface reconstruction. Copyright © 2013 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Directory of Open Access Journals (Sweden)
Kai Kretzschmar
2014-10-01
Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.
Time to take human embryo culture seriously.
Sunde, Arne; Brison, Daniel; Dumoulin, John; Harper, Joyce; Lundin, Kersti; Magli, M Cristina; Van den Abbeel, Etienne; Veiga, Anna
2016-10-01
Is it important that end-users know the composition of human embryo culture media? We argue that there is as strong case for full transparency concerning the composition of embryo culture media intended for human use. Published data suggest that the composition of embryo culture media may influence the phenotype of the offspring. A review of the literature was carried out. Data concerning the potential effects on embryo development of culture media were assessed and recommendations for users made. The safety of ART procedures, especially with respect to the health of the offspring, is of major importance. There are reports from the literature indicating a possible effect of culture conditions, including culture media, on embryo and fetal development. Since the introduction of commercially available culture media, there has been a rapid development of different formulations, often not fully documented, disclosed or justified. There is now evidence that the environment the early embryo is exposed to can cause reprogramming of embryonic growth leading to alterations in fetal growth trajectory, birthweight, childhood growth and long-term disease including Type II diabetes and cardiovascular problems. The mechanism for this is likely to be epigenetic changes during the preimplantation period of development. In the present paper the ESHRE working group on culture media summarizes the present knowledge of potential effects on embryo development related to culture media, and makes recommendations. There is still a need for large prospective randomized trials to further elucidate the link between the composition of embryo culture media used and the phenotype of the offspring. We do not presently know if the phenotypic changes induced by in vitro embryo culture represent a problem for long-term health of the offspring. Published data indicate that there is a strong case for demanding full transparency concerning the compositions of and the scientific rationale behind the
International Nuclear Information System (INIS)
Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.
1998-01-01
The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported
International Nuclear Information System (INIS)
Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.
2003-01-01
A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)
International Nuclear Information System (INIS)
Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.
1986-01-01
We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients
Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.
2013-01-01
Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445
STRATEGIC HUMAN RESOURCE MANAGEMENT : A Cross-Cultural Managerial Approach
Anyangwe, Xavier
2017-01-01
The goal of the thesis was to examine the impact of the concepts of culture, human resource management and strategic human resource management. A man without a culture is like a man with no identity, so the identity of people needs to be identified for effective unity in diversity. The findings of the thesis show that cultural diversity is an inclusive aspect of almost all communities and countries in the world. The richness of these cultures in terms of cultural values, languages, intera...
Decorin gene expression and its regulation in human keratinocytes
Energy Technology Data Exchange (ETDEWEB)
Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)
2011-07-22
Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen
2017-06-16
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen
2017-01-01
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Human Possibilities: The Interaction of Biology and Culture
Directory of Open Access Journals (Sweden)
Riane Eisler
2015-06-01
Full Text Available This article briefly describes the two main strands of a new unified theory about human nature and human possibilities: cultural transformation theory and bio-culturalism. Bio-culturalism combines findings from neuroscience about how our brains develop in interaction with our environments with findings from the study of relational dynamics, a new method of social analysis focusing on what kinds of relations—from intimate to international—a particular culture or subculture supports. Bio-culturalism recognizes that our species has a vast spectrum of genetic capacities, ranging from consciousness, caring, empathy, cooperation, and creativity to insensitivity, cruelty, exploitation, and destructiveness, and proposes that which of these capacities are expressed or inhibited largely hinges on the nature of our cultural environments. Cultural transformation theory looks at the whole span of human cultural evolution from the perspective of the tension between the contrasting configurations of the partnership system and the domination system as two underlying possibilities for structuring beliefs, institutions, and relationships. The article describes the core components of partnership- and domination-oriented societies, provides examples of each, and proposes that our future hinges on accelerating the cultural transformation from domination to partnership in our time of nuclear and biological weapons and the ever more efficient despoliation of nature, when high technology guided by an ethos of domination and conquest could take us to an evolutionary dead end.
Ponec, Maria; El Ghalbzouri, Abdoelwaheb; Dijkman, Remco; Kempenaar, Johanna; van der Pluijm, Gabri; Koolwijk, Pieter
2004-01-01
A human skin equivalent from a single skin biopsy harboring keratinocytes and melanocytes in the epidermal compartment, and fibroblasts and microvascular dermal endothelial cells in the dermal compartment was developed. The results of the study revealed that the nature of the extracellular matrix of the dermal compartments plays an important role in establishment of endothelial network in vitro. With rat-tail type I collagen matrices only lateral but not vertical expansion of endothelial networks was observed. In contrast, the presence of extracellular matrix of entirely human origin facilitated proper spatial organization of the endothelial network. Namely, when human dermal fibroblasts and microvascular endothelial cells were seeded on the bottom of an inert filter and subsequently epidermal cells were seeded on top of it, fibroblasts produced extracellular matrix throughout which numerous branched tubes were spreading three-dimensionally. Fibroblasts also facilitated the formation of basement membrane at the epidermal/matrix interface. Under all culture conditions, fully differentiated epidermis was formed with numerous melanocytes present in the basal epidermal cell layer. The results of the competitive RT-PCR revealed that both keratinocytes and fibroblasts expressed VEGF-A, -B, -C, aFGF and bFGF mRNA, whereas fibroblasts also expressed VEGF-D mRNA. At protein level, keratinocytes produced 10 times higher amounts of VEGF-A than fibroblasts did. The generation of multicellular skin equivalent from a single human skin biopsy will stimulate further developments for its application in the treatment of full-thickness skin defects. The potential development of biodegradable, biocompatible material suitable for these purposes is a great challenge for future research.
Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J; Baker, Timothy R; Troutman, John A; Hewitt, Nicola J; Goebel, Carsten
2015-09-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis-Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte Km and Vmax values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and Cmax was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. Copyright © 2015. Published by Elsevier Inc.
Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.
2016-01-01
Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...
Toxic epidermal necrolysis and Stevens-Johnson syndrome
Directory of Open Access Journals (Sweden)
French Lars E
2010-12-01
Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis
Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.
Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo
2014-01-01
Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.
Energy Technology Data Exchange (ETDEWEB)
Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))
1988-03-01
The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.
Energy Technology Data Exchange (ETDEWEB)
De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)
2014-05-01
The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures
Human environment and cultural influence on the development of international business
Directory of Open Access Journals (Sweden)
Nicolae ȚÂU
2017-12-01
Full Text Available Peoples always seek to improve their life conditions. This sought had significantly contributed to the improvement of human life. Urbanization was a major turning point in the history of human development. It contributed to a change of lifestyle and a progress of business. The establishment of urban areas led to a transformation in the human and cultural environments. Furthermore, globalization processes contributed considerably to the alteration of human and cultural environments. In this work, we are going to explore the components of the human and cultural environment. The main aim of this work is reveal how can human environment and cultural influence the development of international business. This work is similarly meant to exhibit how cultural differences can and cultural transformation caused by globalization processes, affect communication, negotiation and management processes, thus influencing the development of international business.
Amano, Satoshi; Ogura, Yuki; Akutsu, Nobuko; Nishiyama, Toshio
2007-02-01
Type VII collagen is the major component of anchoring fibrils in the epidermal basement membrane. Its expression has been analyzed by immunostaining or Northern blotting, but rarely at the protein level. In this study, we have quantitatively examined the effects of ascorbic acid and various cytokines/growth factors on the protein synthesis and secretion of type VII collagen by human dermal fibroblasts in culture, using a developed, highly sensitive sandwich enzyme-linked immunoassay with two kinds of specific monoclonal antibodies against the non-collagenous domain-1. Ascorbic acid and its derivative induced a twofold increase in type VII collagen synthesis, and markedly increased the secretion of type VII collagen into the medium when compared with the control culture. This effect was not influenced by the presence of transforming growth factor-beta1 (TGF-beta1). The synthesis of type VII collagen was elevated by TGF-beta1, platelet-derived growth factor, tumor necrosis factor-alpha, and interleukin-1beta, but not by TGF-alpha. Thus, our data indicate that the synthesis and secretion of type VII collagen in human dermal fibroblasts are regulated by ascorbate and the enhancement of type VII collagen gene expression by cytokines/growth factors is accompanied with elevated production of type VII collagen at the protein level.
Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor
International Nuclear Information System (INIS)
Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.
1991-01-01
Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes
99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.
Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad
2017-04-01
Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.
CULTURAL DIVERSITY AND HUMAN RESOURCE MANAGEMENT IN MULTINATIONAL COMPANIES
Flavian Clipa; Raluca Irina Clipa
2009-01-01
When the multinational firms employ human resources from different countries they have to submit to the restrictions concerning cultural differences. The paper is an attempt to show how the human resource management administrates these cultural differences.
Directory of Open Access Journals (Sweden)
Jung-Hwan Lee
Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.
Lee, Jung-Hwan; Om, Ji-Yeon; Kim, Yong-Hee; Kim, Kwang-Mahn; Choi, Eun-Ha; Kim, Kyoung-Nam
2016-01-01
The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP)-induced radicals on the epidermal growth factor receptor (EGFR), which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...
Culture of human cell lines by a pathogen-inactivated human platelet lysate.
Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L
2016-08-01
Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety.
International Nuclear Information System (INIS)
Lyng, F.M.; Ni Shuilleabhain, S.; Davoren, M.
2004-01-01
Mechanisms of toxicant action on biological systems are difficult to identify when more than one contaminant is involved due to potential synergistic and antagonistic effects. There is a general paucity of research into the effect of radiation exposure in tandem with common environmental contaminants due to the inherent difficulties involved. In vitro cell cultures are particularly suited to the study of toxic mechanisms due to their proximity to toxic modes of action and the absence of the multiple defence mechanisms present in intact organisms. Primary cell cultures are particularly beneficial in this area of research as they still maintain many of their tissue specific functions. The objective of this study was to distinguish different mechanisms of cell death (growth arrest, apoptosis, primary and secondary necrosis and proliferation), following combination exposure to ionising radiation and a heavy metal (ZnCl 2 ). The model system employed was a primary cell culture of rainbow trout (Oncorhynchus mykiss) epidermal tissue which has been previously used to study the effects of various environmental agents in this laboratory. Apoptosis and necrosis were quantified morphologically while proliferation was assessed immuno-cyto-chemically using an anti PCNA (proliferating cell nuclear antigen) antibody. While radiation doses up to and including 10 Gy had no effect on growth, exposure to ZnCl 2 produced a significant dose dependent reduction in growth (10, 50, 75, 100 and 200 ppm ZnCl 2 ). Preliminary results indicate no significant effect on growth following a combined exposure of 5 Gy + 50 ppm ZnCl 2 . These results may have important implications for understanding the mechanisms underlying cellular responses to multiple contaminant exposures. (author)
Discarded human fetal tissue and cell cultures for transplantation research
International Nuclear Information System (INIS)
Hay, R.J.; Phillips, T.; Thompson, A.; Vilner, L.; Cleland, M.; Tchaw-ren Chen; Zabrenetzky, V.
1999-01-01
A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial
International Nuclear Information System (INIS)
Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando
1999-01-01
The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued
CULTURAL DIVERSITY AND HUMAN RESOURCE MANAGEMENT IN MULTINATIONAL COMPANIES
Directory of Open Access Journals (Sweden)
Flavian Clipa
2009-09-01
Full Text Available When the multinational firms employ human resources from different countries they have to submit to the restrictions concerning cultural differences. The paper is an attempt to show how the human resource management administrates these cultural differences.
Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.
2015-01-01
Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis
International Nuclear Information System (INIS)
Treina, G.; Scaletta, C.; Frenk, E.; Applegate, L.A.; Fourtanier, A.; Seite, S.
1996-01-01
Ultraviolet A (UVA) radiation represents an important oxidative stress to human skin and certain forms of oxidative stress have been shown to modulate intercellular adhesion molecule-1 (ICAM-1) expression. ICAM-1 has been shown to play an important part in many immune reactions and the perturbations of this molecule by ultraviolet radiation could have implications in many inflammatory responses. An enhancement immunohistochemical method with avidin/biotin was used for analysing the early effects of UVA radiation on human cell cultures and human skin (340-400 nm). Both in vitro and in vivo data show that ICAM-1 staining in epidermal keratinocytes, which was expressed constitutively, decreased in a UVA dose-dependent manner. The decrease was most noted at 3-6 h following UVA radiation with some ICAM-1 staining returning by 48 h post-UVA. ICAM-1 positive staining in the dermis was specific for vascular structures and was increased 24 h after UVA radiation. Cultured dermal fibroblasts exhibited ICAM-1 staining which increased slightly within 6-48 h post-UVA radiation. As epidermal ICAM-1 expression is depleted following UVA radiation and dermal expression increases due to an increase in the vascular structures, ICAM-1 provides a valuable marker following UVA radiation in human skin that can be readily measured in situ. (author)
Mechanisms of Formation of Human Culture in Education
Directory of Open Access Journals (Sweden)
Baboshina Helen B.
2017-12-01
Full Text Available The relevance of the research problem lies in the necessity of an axiological approach to the formation of the personality in education and the task of strengthening the ideal image of the function. The aim of this article is studying and understanding the culture of personality formation mechanisms in relation to future specialists. The leading method of research was the theoretical analysis of philosophical and cultural approaches to the cultural formation of the personality and to the content of human culture. Content analysis was based on the philosophical and cultural concepts of V. S. Bibler, M. Buber, J. G. Herder, I. Kant, L. N. Kogan, D. S. Likhachev, A. Schweitzer, M. Scheler, and others. The experiment method was the experimental realization of formation stages of the future specialist as a person of culture, which allowed revealing the positive role of cultural mechanisms in this process. The result is the stages of human culture formation as well as mechanisms for their implementation. The article may be useful for specialists of the educational sphere, social philosophers, and culturologists.
Workshop on cultural usability and human work interaction design
DEFF Research Database (Denmark)
Clemmensen, Torkil; Ørngreen, Rikke; Roese, Kerstin
2008-01-01
it into interaction design. The workshop will present current research into cultural usability and human work interaction design. Cultural usability is a comprehensive concept, which adheres to all kinds of contexts in which humans are involved (private family, work, public and private organizations, nature......, Workplace observation, Think-Aloud Usability Test, etc. These techniques often give - seemingly - similar results when applied in diverse cultural settings, but experience shows that we need a deep understanding of the cultural, social and organizational context to interpret the results, and to transform...
Spatiotemporal Expression of p63 in Mouse Epidermal Commitment
Directory of Open Access Journals (Sweden)
Qian Zhao
2015-12-01
Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.
Do cultural diversity and human rights make a good match?
Donders, Y.
2010-01-01
The link between cultural diversity and human rights was clearly established by the Universal Declaration on Cultural Diversity, adopted by the member states of UNESCO in 2001, which holds that "the defence of cultural diversity is … inseparable from respect for human dignity" and that it " implies
Kleijkers, Sander H M; Eijssen, Lars M T; Coonen, Edith; Derhaag, Josien G; Mantikou, Eleni; Jonker, Martijs J; Mastenbroek, Sebastiaan; Repping, Sjoerd; Evers, Johannes L H; Dumoulin, John C M; van Montfoort, Aafke P A
2015-10-01
Is gene expression in human preimplantation embryos affected by the medium used for embryo culture in vitro during an IVF treatment? Six days of in vitro culture of human preimplantation embryos resulted in medium-dependent differences in expression level of genes involved in apoptosis, protein degradation, metabolism and cell-cycle regulation. Several human studies have shown an effect of culture medium on embryo development, pregnancy outcome and birthweight. However, the underlying mechanisms in human embryos are still unknown. In animal models of human development, it has been demonstrated that culture of preimplantation embryos in vitro affects gene expression. In humans, it has been found that culture medium affects gene expression of cryopreserved embryos that, after thawing, were cultured in two different media for 2 more days. In a multicenter trial, women were randomly assigned to two culture medium groups [G5 and human tubal fluid (HTF)]. Data on embryonic development were collected for all embryos. In one center, embryos originating from two pronuclei (2PN) zygotes that were not selected for transfer or cryopreservation on Day 2 or 3 because of lower morphological quality, were cultured until Day 6 and used in this study, if couples consented. Ten blastocysts each from the G5 and HTF study groups, matched for fertilization method, maternal age and blastocyst quality, were selected and their mRNA was isolated and amplified. Embryos were examined individually for genome-wide gene expression using Agilent microarrays and PathVisio was used to identify the pathways that showed a culture medium-dependent activity. Expression of 951 genes differed significantly (P differences observed between the study groups are caused by factors that we did not investigate. Extrapolation of these results to embryos used for transfer demands caution as in the present study embryos that were not selected for either embryo transfer or cryopreservation have been used for the
International Nuclear Information System (INIS)
Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook
2006-01-01
Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level
Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat
International Nuclear Information System (INIS)
Tanaka, S.; Sakai, A.
1979-01-01
The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude
A Culture-Behavior-Brain Loop Model of Human Development.
Han, Shihui; Ma, Yina
2015-11-01
Increasing evidence suggests that cultural influences on brain activity are associated with multiple cognitive and affective processes. These findings prompt an integrative framework to account for dynamic interactions between culture, behavior, and the brain. We put forward a culture-behavior-brain (CBB) loop model of human development that proposes that culture shapes the brain by contextualizing behavior, and the brain fits and modifies culture via behavioral influences. Genes provide a fundamental basis for, and interact with, the CBB loop at both individual and population levels. The CBB loop model advances our understanding of the dynamic relationships between culture, behavior, and the brain, which are crucial for human phylogeny and ontogeny. Future brain changes due to cultural influences are discussed based on the CBB loop model. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A
1998-01-01
The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.
Energy Technology Data Exchange (ETDEWEB)
Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)
2016-03-15
Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.
Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure
2013-12-01
The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International human rights and cultural diversity: a balancing act
Donders, Y.
2013-01-01
It is broadly agreed that international human rights law and cultural diversity have a mutually interdependent and beneficial relationship. Many human rights, such as the rights to freedom of expression, freedom of religion, freedom of assembly, as well as the rights to take part in cultural life
Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland
2014-01-01
The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.
Vaccine-induced toxic epidermal necrolysis: A case and systematic review
Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott
2018-01-01
Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...
Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J
2003-12-01
Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.
Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi
2013-02-01
We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.
Radiation transformation in differentiated human cells in culture
International Nuclear Information System (INIS)
Mothersill, C.; Seymour, C.; Moriarty, M.; Malone, J.; Byrne, P.; Hennessy, T.
1986-01-01
A tissue culture technique is described for human thyroid tissue as an approach to studying mechanisms of human radiation carcinogenesis. Normal human tissue obtained from surgery is treated in one of two ways, depending upon size of specimen. Large pieces are completely digested in trypsin/ collagenase solution to a single cell suspension. Small pieces of tissue are plated as explants following partial digestion in trypsin/collagenase solution. Following irradiation of the primary differentiated monolayers (normally 10 days after plating), the development of transformed characteristics is monitored in the subsequent subcultures. A very high level of morphological and functional differentiation is apparent in the primary cultures. Over a period of approx. 6 months, the irradiated surviving cells continue to grow in culture, unlike the unirradiated controls which senesce after 2-3 subcultures. (UK)
Human cultural diversity in prehistoric Fiji
Directory of Open Access Journals (Sweden)
Ethan E. Cochrane
2005-08-01
Full Text Available Remote islands and their human, animal and plant populations have long fascinated archaeologists, biologists and geographers. In this article, the chronology, diversity and interactions of human cultures in some small islands of the Fiji archipelago are explored, particularly through the application of sophisticated chemical analyses of the composition of prehistoric pottery.
Energy Technology Data Exchange (ETDEWEB)
Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu
1999-04-01
The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.
Culture-sensitive neural substrates of human cognition: a transcultural neuroimaging approach.
Han, Shihui; Northoff, Georg
2008-08-01
Our brains and minds are shaped by our experiences, which mainly occur in the context of the culture in which we develop and live. Although psychologists have provided abundant evidence for diversity of human cognition and behaviour across cultures, the question of whether the neural correlates of human cognition are also culture-dependent is often not considered by neuroscientists. However, recent transcultural neuroimaging studies have demonstrated that one's cultural background can influence the neural activity that underlies both high- and low-level cognitive functions. The findings provide a novel approach by which to distinguish culture-sensitive from culture-invariant neural mechanisms of human cognition.
Cultural assemblages show nested structure in humans and chimpanzees but not orangutans.
Kamilar, Jason M; Atkinson, Quentin D
2014-01-07
The evolution of hominin culture is well-documented in the archeological and fossil record, but such a record is largely absent for nonhuman primates. An alternative approach to studying cultural evolution is to examine patterns of modern cultural variation. In this article we measure nestedness across human and great ape "cultural repertoires" to gain insight into the accumulation and maintenance of putative cultural diversity in these species. Cultural assemblages are nested if cultures with a small repertoire of traits tend to comprise a proper subset of those traits present in more complex cultures. This nesting will occur if some traits are sequentially gained or lost, which may be because of the differential dispersal or extinction of traits. Here we apply statistical tools from ecology to examine the degree of nestedness in four datasets documenting the presence or absence of specific cultural traits across indigenous human populations in North America and New Guinea. We then compare the human data to patterns observed for putative cultural traits in chimpanzee and orangutan populations. In both humans and chimpanzees, cultural diversity is highly nonrandom, showing significant nested structure for all of the datasets examined. We find no evidence for nestedness in the orangutan cultural data. These findings are consistent with a sequential "layering" of cultural diversity in humans and chimpanzees, but not orangutans. Such an interpretation implies that the traits required for sequential cultural evolution first appeared in the last common ancestor of chimpanzees and humans.
Dong, Jia; Mandenius, Carl-Fredrik; Lübberstedt, Marc; Urbaniak, Thomas; Nüssler, Andreas K N; Knobeloch, Daniel; Gerlach, Jörg C; Zeilinger, Katrin
2008-07-01
Optimization of cell culture media based on statistical experimental design methodology is a widely used approach for improving cultivation conditions. We applied this methodology to refine the composition of an established culture medium for growth of a human hepatoma cell line, C3A. A selection of growth factors and nutrient supplements were systematically screened according to standard design of experiments (DoE) procedures. The results of the screening indicated that the medium additives hepatocyte growth factor, oncostatin M, and fibroblast growth factor 4 significantly influenced the metabolic activities of the C3A cell line. Surface response methodology revealed that the optimum levels for these factors were 30 ng/ml for hepatocyte growth factor and 35 ng/ml for oncostatin M. Additional experiments on primary human hepatocyte cultures showed high variance in metabolic activities between cells from different individuals, making determination of optimal levels of factors more difficult. Still, it was possible to conclude that hepatocyte growth factor, epidermal growth factor, and oncostatin M had decisive effects on the metabolic functions of primary human hepatocytes.
del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia
2013-01-01
Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.
In vitro culture of mouse embryos amniotic fluid ID human
African Journals Online (AJOL)
1989-07-15
Jul 15, 1989 ... Because human amniotic fluid is a physiological, balanced ultrafiltrate, it has been considered as an inexpensive alternative culture medium in. IVF. A study of the development of mouse embryos in human amniotic fluid was undertaken to assess the suitability of this as an optional culture medium in human ...
Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats
DEFF Research Database (Denmark)
Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.
2013-01-01
The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...
Epidermal growth factor in alkali-burned corneal epithelial wound healing.
Singh, G; Foster, C S
1987-06-15
We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.
Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.
Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J
2014-01-01
Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel
2006-08-01
Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer
A method for culturing human hair follicle cells.
Weterings, P J; Vermorken, A J; Bloemendal, H
1981-01-01
For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.
An Empirical Analysis of Human Performance and Nuclear Safety Culture
International Nuclear Information System (INIS)
Jeffrey Joe; Larry G. Blackwood
2006-01-01
The purpose of this analysis, which was conducted for the US Nuclear Regulatory Commission (NRC), was to test whether an empirical connection exists between human performance and nuclear power plant safety culture. This was accomplished through analyzing the relationship between a measure of human performance and a plant's Safety Conscious Work Environment (SCWE). SCWE is an important component of safety culture the NRC has developed, but it is not synonymous with it. SCWE is an environment in which employees are encouraged to raise safety concerns both to their own management and to the NRC without fear of harassment, intimidation, retaliation, or discrimination. Because the relationship between human performance and allegations is intuitively reciprocal and both relationship directions need exploration, two series of analyses were performed. First, human performance data could be indicative of safety culture, so regression analyses were performed using human performance data to predict SCWE. It also is likely that safety culture contributes to human performance issues at a plant, so a second set of regressions were performed using allegations to predict HFIS results
Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing
2018-03-01
Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.
Epidermal growth factor-mediated effects on equine vascular smooth muscle cells
International Nuclear Information System (INIS)
Grosenbaugh, D.A.; Amoss, M.S.; Hood, D.M.; Morgan, S.J.; Williams, J.D.
1988-01-01
Epidermal growth factor (EGF) receptor binding kinetics and EGF-mediated stimulation of DNA synthesis and cellular proliferation were studied in cultured vascular smooth muscle cells (VSMC) from the equine thoracic aorta. Binding studies, using murine 125 I-labeled EGF, indicate the presence of a single class of high-affinity binding sites, with an estimated maximal binding capacity of 5,800 sites/cells. EGF stimulated [ 3 H]thymidine uptake in confluent quiescent monolayers in a dose-dependent fashion, half-maximal stimulation occurring at 7.5 x 10 -11 M. Likewise, EGF-mediated cellular proliferation was dose dependent under reduced serum concentrations. Equine VSMC contain specific receptors for EGF, and EGF can stimulate DNA synthesis and proliferation in these cultured cells, which suggests that EGF may participate in the proliferative changes observed in equine distal digital peripheral vascular disease
Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo
2012-01-01
HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291
DEFF Research Database (Denmark)
Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H
2011-01-01
PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...
TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.
Directory of Open Access Journals (Sweden)
Aurélie Hayez
Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.
Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells
International Nuclear Information System (INIS)
Ronald Sluyter; Kylie S Yuen; Gary M Halliday
2001-01-01
There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc
On culture and human development: Interview with Barbara Rogoff
DEFF Research Database (Denmark)
Glaveanu, Vlad Petre
2011-01-01
In this interview Professor Barbara Rogoff explores the many ways in which culture shapes the course of human development, and illustrates this with several findings from her past as well as most recent work. These reveal the vital importance of growing up in a family and a community for the human...... child and participating, from early on, in their various rituals and practices. Building on and enriching cultural psychological sources, Professor Rogoff offers us a comprehensive framework with which to understand both cultural and developmental phenomena and, above all, their multiple intersections...
Genetic analysis of Ras genes in epidermal development and tumorigenesis
Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano
2013-01-01
Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175
Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report
International Nuclear Information System (INIS)
Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub
2006-01-01
Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess
Pyrc, Krzysztof; Sims, Amy C.; Dijkman, Ronald; Jebbink, Maarten; Long, Casey; Deming, Damon; Donaldson, Eric; Vabret, Astrid; Baric, Ralph; van der Hoek, Lia; Pickles, Raymond
2010-01-01
Culturing newly identified human lung pathogens from clinical sample isolates can represent a daunting task, with problems ranging from low levels of pathogens to the presence of growth suppressive factors in the specimens, compounded by the lack of a suitable tissue culture system. However, it is
Development and validation of a simple method for the extraction of human skin melanocytes.
Wang, Yinjuan; Tissot, Marion; Rolin, Gwenaël; Muret, Patrice; Robin, Sophie; Berthon, Jean-Yves; He, Li; Humbert, Philippe; Viennet, Céline
2018-03-21
Primary melanocytes in culture are useful models for studying epidermal pigmentation and efficacy of melanogenic compounds, or developing advanced therapy medicinal products. Cell extraction is an inevitable and critical step in the establishment of cell cultures. Many enzymatic methods for extracting and growing cells derived from human skin, such as melanocytes, are described in literature. They are usually based on two enzymatic steps, Trypsin in combination with Dispase, in order to separate dermis from epidermis and subsequently to provide a suspension of epidermal cells. The objective of this work was to develop and validate an extraction method of human skin melanocytes being simple, effective and applicable to smaller skin samples, and avoiding animal reagents. TrypLE™ product was tested on very limited size of human skin, equivalent of multiple 3-mm punch biopsies, and was compared to Trypsin/Dispase enzymes. Functionality of extracted cells was evaluated by analysis of viability, morphology and melanin production. In comparison with Trypsin/Dispase incubation method, the main advantages of TrypLE™ incubation method were the easier of separation between dermis and epidermis and the higher population of melanocytes after extraction. Both protocols preserved morphological and biological characteristics of melanocytes. The minimum size of skin sample that allowed the extraction of functional cells was 6 × 3-mm punch biopsies (e.g., 42 mm 2 ) whatever the method used. In conclusion, this new procedure based on TrypLE™ incubation would be suitable for establishment of optimal primary melanocytes cultures for clinical applications and research.
Díez, José M; Bauman, Ewa; Gajardo, Rodrigo; Jorquera, Juan I
2015-03-13
Fetal bovine serum (FBS) is an animal product used as a medium supplement. The animal origin of FBS is a concern if cultured stem cells are to be utilized for human cell therapy. Therefore, a substitute for FBS is desirable. In this study, an industrial, xeno-free, pharmaceutical-grade supplement for cell culture (SCC) under development at Grifols was tested for growth of human mesenchymal stem cells (hMSCs), cell characterization, and differentiation capacity. SCC is a freeze-dried product obtained through cold-ethanol fractionation of industrial human plasma pools from healthy donors. Bone marrow-derived hMSC cell lines were obtained from two commercial suppliers. Cell growth was evaluated by culturing hMSCs with commercial media or media supplemented with SCC or FBS. Cell viability and cell yield were assessed with an automated cell counter. Cell surface markers were studied by indirect immunofluorescence assay. Cells were cultured then differentiated into adipocytes, chondrocytes, osteoblasts, and neurons, as assessed by specific staining and microscopy observation. SCC supported the growth of commercial hMSCs. Starting from the same number of seeded cells in two consecutive passages of culture with medium supplemented with SCC, hMSC yield and cell population doubling time were equivalent to the values obtained with the commercial medium and was consistent among lots. The viability of hMSCs was higher than 90%, while maintaining the characteristic phenotype of undifferentiated hMSCs (positive for CD29, CD44, CD90, CD105, CD146, CD166 and Stro-1; negative for CD14 and CD19). Cultured hMSCs maintained the potential for differentiation into adipocytes, chondrocytes, osteoblasts, and neurons. The tested human plasma-derived SCC sustains the adequate growth of hMSCs, while preserving their differentiation capacity. SCC can be a potential candidate for cell culture supplement in advanced cell therapies.
Bravo, Susana B; Garcia-Rendueles, Maria E R; Garcia-Rendueles, Angela R; Rodrigues, Joana S; Perez-Romero, Sihara; Garcia-Lavandeira, Montserrat; Suarez-Fariña, Maria; Barreiro, Francisco; Czarnocka, Barbara; Senra, Ana; Lareu, Maria V; Rodriguez-Garcia, Javier; Cameselle-Teijeiro, Jose; Alvarez, Clara V
2013-06-01
Mechanisms of thyroid physiology and cancer are principally studied in follicular cell lines. However, human thyroid cancer lines were found to be heavily contaminated by other sources, and only one supposedly normal-thyroid cell line, immortalized with SV40 antigen, is available. In primary culture, human follicular cultures lose their phenotype after passage. We hypothesized that the loss of the thyroid phenotype could be related to culture conditions in which human cells are grown in medium optimized for rodent culture, including hormones with marked differences in its affinity for the relevant rodent/human receptor. The objective of the study was to define conditions that allow the proliferation of primary human follicular thyrocytes for many passages without losing phenotype. Concentrations of hormones, transferrin, iodine, oligoelements, antioxidants, metabolites, and ethanol were adjusted within normal homeostatic human serum ranges. Single cultures were identified by short tandem repeats. Human-rodent interspecies contamination was assessed. We defined an humanized 7 homeostatic additives medium enabling growth of human thyroid cultures for more than 20 passages maintaining thyrocyte phenotype. Thyrocytes proliferated and were grouped as follicle-like structures; expressed Na+/I- symporter, pendrin, cytokeratins, thyroglobulin, and thyroperoxidase showed iodine-uptake and secreted thyroglobulin and free T3. Using these conditions, we generated a bank of thyroid tumors in culture from normal thyroids, Grave's hyperplasias, benign neoplasms (goiter, adenomas), and carcinomas. Using appropriate culture conditions is essential for phenotype maintenance in human thyrocytes. The bank of thyroid tumors in culture generated under humanized humanized 7 homeostatic additives culture conditions will provide a much-needed tool to compare similarly growing cells from normal vs pathological origins and thus to elucidate the molecular basis of thyroid disease.
International Nuclear Information System (INIS)
Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.
1988-01-01
Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)
The Digital Future of Humanities through the Lens of DIY Culture
DEFF Research Database (Denmark)
Roued-Cunliffe, Henriette
2017-01-01
This paper asks the question: Do the humanities by necessity have a digital future? It argues that the answer to this question is both yes and no. The argument looks through the lens of DIY culture as an attempt to try and understand the future for the humanities in terms of both cultural material...... and processes. The argument is made first by examining the case of information sharing within DIY culture as an expression of current day cultural material. Secondly, it illustrated how traditional humanities scholarship, such as reading ancient documents, compares to it’s DIY equivalent within family history...
Human Behavioral Representations with Realistic Personality and Cultural Characteristics
National Research Council Canada - National Science Library
Zachary, Wayne; Le Mentec, Jean-Christopher; Miller, Lynn; Read, Stephen; Thomas-Meyers, Gina
2005-01-01
...) with pre-defined and specific personality traits and cultural characteristics. This capability meets a current and growing need for human models that exhibit personality and cultural variability...
Establishing human lacrimal gland cultures with secretory function.
Directory of Open Access Journals (Sweden)
Shubha Tiwari
Full Text Available PURPOSE: Dry eye syndrome is a multifactorial chronic disabling disease mainly caused by the functional disruptions in the lacrimal gland. The treatment involves palliation like ocular surface lubrication and rehydration. Cell therapy involving replacement of the gland is a promising alternative for providing long-term relief to patients. This study aimed to establish functionally competent lacrimal gland cultures in-vitro and explore the presence of stem cells in the native gland and the established in-vitro cultures. METHODS: Fresh human lacrimal gland from patients undergoing exenteration was harvested for cultures after IRB approval. The freshly isolated cells were evaluated by flow cytometry for expression of stem cell markers ABCG2, high ALDH1 levels and c-kit. Cultures were established on Matrigel, collagen and HAM and the cultured cells evaluated for the presence of stem cell markers and differentiating markers of epithelial (E-cadherin, EpCAM, mesenchymal (Vimentin, CD90 and myofibroblastic (α-SMA, S-100 origin by flow cytometry and immunocytochemistry. The conditioned media was tested for secretory proteins (scIgA, lactoferrin, lysozyme post carbachol (100 µM stimulation by ELISA. RESULTS: Native human lacrimal gland expressed ABCG2 (mean±SEM: 3.1±0.61%, high ALDH1 (3.8±1.26% and c-kit (6.7±2.0%. Lacrimal gland cultures formed a monolayer, in order of preference on Matrigel, collagen and HAM within 15-20 days, containing a heterogeneous population of stem-like and differentiated cells. The epithelial cells formed 'spherules' with duct like connections, suggestive of ductal origin. The levels of scIgA (47.43 to 61.56 ng/ml, lysozyme (24.36 to 144.74 ng/ml and lactoferrin (32.45 to 40.31 ng/ml in the conditioned media were significantly higher than the negative controls (p<0.05 for all comparisons. CONCLUSION: The study reports the novel finding of establishing functionally competent human lacrimal gland cultures in-vitro. It also
Protein biosynthesis in cultured human hair follicle cells.
Weterings, P J; Vermorken, A J; Bloemendal, H
1980-10-31
A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.
Human-Computer Interaction, Tourism and Cultural Heritage
Cipolla Ficarra, Francisco V.
We present a state of the art of the human-computer interaction aimed at tourism and cultural heritage in some cities of the European Mediterranean. In the work an analysis is made of the main problems deriving from training understood as business and which can derail the continuous growth of the HCI, the new technologies and tourism industry. Through a semiotic and epistemological study the current mistakes in the context of the interrelations of the formal and factual sciences will be detected and also the human factors that have an influence on the professionals devoted to the development of interactive systems in order to safeguard and boost cultural heritage.
Free-energy carriers in human cultured muscle cells
Bolhuis, P. A.; de Zwart, H. J.; Ponne, N. J.; de Jong, J. M.
1985-01-01
Creatine phosphate (CrP), adenosine triphosphate (ATP), creatine kinase (CK), adenylate kinase (AK), protein, and DNA were quantified in human muscle cell cultures undergoing transition from dividing myoblasts to multinucleate myotubes. CrP is negligible in cultures grown in commonly applied media
Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.
2000-01-01
Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal
Modeling human disease using organotypic cultures
DEFF Research Database (Denmark)
Schweiger, Pawel J; Jensen, Kim B
2016-01-01
animal models and in vitro cell culture systems. However, it has been exceedingly difficult to model disease at the tissue level. Since recently, the gap between cell line studies and in vivo modeling has been narrowing thanks to progress in biomaterials and stem cell research. Development of reliable 3D...... culture systems has enabled a rapid expansion of sophisticated in vitro models. Here we focus on some of the latest advances and future perspectives in 3D organoids for human disease modeling....
Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E
2017-01-01
Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.
International Nuclear Information System (INIS)
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-01-01
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Energy Technology Data Exchange (ETDEWEB)
Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Post-female-circumcision clitoral epidermal inclusion cyst: a case ...
African Journals Online (AJOL)
Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.
CULTURAL DIMENSIONS IN GLOBAL HUMAN RESOURCE MANAGEMENT: IMPLICATIONS FOR NIGERIA
Directory of Open Access Journals (Sweden)
John N. N. Ugoani
2016-09-01
Full Text Available As enterprise operations continue to be globalized through overseas expansions, joint ventures, mergers and acquisitions as well as strategic relationships and partnerships transnational organizations need to give attention to issues of culture in human resource management practices as a panacea for prosperity. The global organization is competent if only it is able to bridge the gap between management and culture so that personal relationships with other peoples in the organization and society become in harmony. This is critical because cultural relativity and reality in organizations influence operations. The study was designed to explore possible relationships between cultural dimensions and global human resource management. The survey research design was employed and data generated through primary and secondary sources. The participants comprised of 385 respondents from a cross-section of the population in Nigeria. By Chi-Square test, it was found that culture has a significant positive relationship with global human resource management.
Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei
2017-05-01
Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.
Graphene foam as a biocompatible scaffold for culturing human neurons
Mattei, Cristiana; Nasr, Babak; Hudson, Emma J.; Alshawaf, Abdullah J.; Chana, Gursharan; Everall, Ian P.; Dottori, Mirella; Skafidas, Efstratios
2018-01-01
In this study, we explore the use of electrically active graphene foam as a scaffold for the culture of human-derived neurons. Human embryonic stem cell (hESC)-derived cortical neurons fated as either glutamatergic or GABAergic neuronal phenotypes were cultured on graphene foam. We show that graphene foam is biocompatible for the culture of human neurons, capable of supporting cell viability and differentiation of hESC-derived cortical neurons. Based on the findings, we propose that graphene foam represents a suitable scaffold for engineering neuronal tissue and warrants further investigation as a model for understanding neuronal maturation, function and circuit formation. PMID:29657752
Ito, Akira; Nagai, Momoko; Tajino, Junichi; Yamaguchi, Shoki; Iijima, Hirotaka; Zhang, Xiangkai; Aoyama, Tomoki; Kuroki, Hiroshi
2015-01-01
Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C) for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and citrate synthase (CS), which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1) and aggrecan (ACAN), was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y)-box 9 (SOX9), which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and chondrogenesis.
Directory of Open Access Journals (Sweden)
Akira Ito
Full Text Available Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH and citrate synthase (CS, which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1 and aggrecan (ACAN, was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y-box 9 (SOX9, which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and
Human factors in safety assessment. Safety culture assessment
International Nuclear Information System (INIS)
Zhang Li; Deng Zhiliang; Wang Yiqun; Huang Weigang
1996-01-01
This paper analyses the present conditions and problems in enterprises safety assessment, and introduces the characteristics and effects of safety culture. The authors think that safety culture must be used as a 'soul' to form the pattern of modern safety management. Furthermore, they propose that the human safety and synthetic safety management assessment in a system should be changed into safety culture assessment. Finally, the assessment indicators are discussed
Howes, Amy L; Richardson, Robyn D; Finlay, Darren; Vuori, Kristiina
2014-01-01
3-dimensional (3D) culture models have the potential to bridge the gap between monolayer cell culture and in vivo studies. To benefit anti-cancer drug discovery from 3D models, new techniques are needed that enable their use in high-throughput (HT) screening amenable formats. We have established miniaturized 3D culture methods robust enough for automated HT screens. We have applied these methods to evaluate the sensitivity of normal and tumorigenic breast epithelial cell lines against a panel of oncology drugs when cultured as monolayers (2D) and spheroids (3D). We have identified two classes of compounds that exhibit preferential cytotoxicity against cancer cells over normal cells when cultured as 3D spheroids: microtubule-targeting agents and epidermal growth factor receptor (EGFR) inhibitors. Further improving upon our 3D model, superior differentiation of EC50 values in the proof-of-concept screens was obtained by co-culturing the breast cancer cells with normal human fibroblasts and endothelial cells. Further, the selective sensitivity of the cancer cells towards chemotherapeutics was observed in 3D co-culture conditions, rather than as 2D co-culture monolayers, highlighting the importance of 3D cultures. Finally, we examined the putative mechanisms that drive the differing potency displayed by EGFR inhibitors. In summary, our studies establish robust 3D culture models of human cells for HT assessment of tumor cell-selective agents. This methodology is anticipated to provide a useful tool for the study of biological differences within 2D and 3D culture conditions in HT format, and an important platform for novel anti-cancer drug discovery.
Reconciling international human rights and cultural relativism: the case of female circumcision.
James, Stephen A
1994-01-01
How can we reconcile, in a non-ethnocentric fashion, the enforcement of international, universal human rights standards with the protection of cultural diversity? Examining this question, taking the controversy over female circumcision as a case study, this article will try to bridge the gap between the traditional anthropological view that human rights are non-existent -- or completely relativised to particular cultures -- and the view of Western naturalistic philosophers (including Lockeian philosophers in the natural rights tradition, and Aquinas and neo-Thomists in the natural law tradition) that they are universal -- simply derived from a basic human nature we all share. After briefly defending a universalist conception of human rights, the article will provide a critique of female circumcision as a human rights violation by three principal means: by an internal critique of the practice using the condoning cultures' own functionalist criteria; by identifying supra-national norms the cultures subscribe to which conflict with the practice; and by the identification of traditional and novel values in the cultures, conducive to those norms. Through this analysis, it will be seen that cultural survival, diversity and flourishing need not be incompatible with upholding international, universal human rights standards.
Mary Jane Hogue (1883-1962): A pioneer in human brain tissue culture.
Zottoli, Steven J; Seyfarth, Ernst-August
2018-05-16
The ability to maintain human brain explants in tissue culture was a critical step in the use of these cells for the study of central nervous system disorders. Ross G. Harrison (1870-1959) was the first to successfully maintain frog medullary tissue in culture in 1907, but it took another 38 years before successful culture of human brain tissue was accomplished. One of the pioneers in this achievement was Mary Jane Hogue (1883-1962). Hogue was born into a Quaker family in 1883 in West Chester, Pennsylvania, and received her undergraduate degree from Goucher College in Baltimore, Maryland. Research with the developmental biologist Theodor Boveri (1862-1915) in Würzburg, Germany, resulted in her Ph.D. (1909). Hogue transitioned from studying protozoa to the culture of human brain tissue in the 1940s and 1950s, when she was one of the first to culture cells from human fetal, infant, and adult brain explants. We review Hogue's pioneering contributions to the study of human brain cells in culture, her putative identification of progenitor neuroblast and/or glioblast cells, and her use of the cultures to study the cytopathogenic effects of poliovirus. We also put Hogue's work in perspective by discussing how other women pioneers in tissue culture influenced Hogue and her research.
International Nuclear Information System (INIS)
Tyrrell, R.M.; Pidoux, M.
1988-01-01
Glutathione depletion of cultured human skin fibroblasts by treatment with buthionine-S.R.-sulfoximine (BSO) sensitises them to solar UV radiation. We now show that there is a close quantitative correlation between cellular glutathione content and sensitivity to radiation at 365 nm. A weaker correlation is observed when cells are depleted of glutathione using diethylmaleimide. Both fibroblasts and epidermal keratinocytes derived from the same foreskin biopsy are sensitised to radiation at 313 nm by glutathione depletion. At low to intermediate fluence levels, 10 mM cysteamine present during irradiation at 302 nm is able to almost completely reverse the sensitising effects of glutathione depletion suggesting that the endogenous thiol protects against radiation at this wavelength by a free radical scavenging mechanism. At 313 nm, the sensitisation is not reversed by cysteamine suggesting that glutathione plays a more specific role in protection against radiation at longer wavelengths. Xeroderma pigmentosum group A fibroblasts (excision deficient) are also sensitised to radiation at 313 and 365 nm by depletion of glutathione. The results provide further evidence that endogenous glutathione is involved in protecting human skin cells against a wide range of solar radiation damage. (author)
Cell Culture Assay for Human Noroviruses [response
Energy Technology Data Exchange (ETDEWEB)
Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.
2007-07-01
We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools
Thyrotropin-releasing hormone controls mitochondrial biology in human epidermis.
Knuever, Jana; Poeggeler, Burkhard; Gáspár, Erzsébet; Klinger, Matthias; Hellwig-Burgel, Thomas; Hardenbicker, Celine; Tóth, Balázs I; Bíró, Tamás; Paus, Ralf
2012-03-01
Mitochondrial capacity and metabolic potential are under the control of hormones, such as thyroid hormones. The most proximal regulator of the hypothalamic-pituitary-thyroid (HPT) axis, TRH, is the key hypothalamic integrator of energy metabolism via its impact on thyroid hormone secretion. Here, we asked whether TRH directly modulates mitochondrial functions in normal, TRH-receptor-positive human epidermis. Organ-cultured human skin was treated with TRH (5-100 ng/ml) for 12-48 h. TRH significantly increased epidermal immunoreactivity for the mitochondria-selective subunit I of respiratory chain complex IV (MTCO1). This resulted from an increased MTCO1 transcription and protein synthesis and a stimulation of mitochondrial biogenesis as demonstrated by transmission electron microscopy and TRH-enhanced mitochondrial DNA synthesis. TRH also significantly stimulated the transcription of several other mitochondrial key genes (TFAM, HSP60, and BMAL1), including the master regulator of mitochondrial biogenesis (PGC-1α). TRH significantly enhanced mitochondrial complex I and IV enzyme activity and enhanced the oxygen consumption of human skin samples, which shows that the stimulated mitochondria are fully vital because the main source for cellular oxygen consumption is mitochondrial endoxidation. These findings identify TRH as a potent, novel neuroendocrine stimulator of mitochondrial activity and biogenesis in human epidermal keratinocytes in situ. Thus, human epidermis offers an excellent model for dissecting neuroendocrine controls of human mitochondrial biology under physiologically relevant conditions and for exploring corresponding clinical applications.
Human dignity in religion-embedded cross-cultural nursing.
Cheraghi, Mohammad A; Manookian, Arpi; Nasrabadi, Alireza N
2014-12-01
Although human dignity is an unconditional value of every human being, it can be shattered by extrinsic factors. It is necessary to discover the authentic meaning of patients' dignity preservation from different religious perspectives to provide professional cross-cultural care in a diverse setting. This article identifies common experiences of Iranian Muslim and Armenian Christian patients regarding dignified care at the bedside. This is a qualitative study of participants' experiences of dignified care elicited by individual in-depth semi-structured interviews. A purposeful sample of 10 participants (five Iranian Muslims and five Iranian Armenians) from various private and governmental hospital settings was chosen. This study was approved by the ethics committee of Tehran University of Medical Sciences. All the participants were provided with information about the purpose and the nature of the study, the voluntary condition of their participation in this study, and the anonymous reporting of recorded interviews. The common experiences of Christian and Muslim patients regarding dignity preservation emerged as "exigency of respecting human nobility" and "providing person-centered care." It is essential to recognize the humanness and individuality of each patient to preserve and promote human dignity in diverse cross-cultural settings. The findings support and expand current understanding about the objective and subjective nature of dignity preservation in cross-cultural nursing. © The Author(s) 2014.
Foliar Epidermal Studies of Plants in Euphorbiaceae
Directory of Open Access Journals (Sweden)
H. A. Thakur
2014-03-01
Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.
Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed
2015-04-01
Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.
Cultural crossings of care: An appeal to the medical humanities.
Kristeva, Julia; Moro, Marie Rose; Ødemark, John; Engebretsen, Eivind
2018-03-01
Modern medicine is confronted with cultural crossings in various forms. In facing these challenges, it is not enough to simply increase our insight into the cultural dimensions of health and well-being. We must, more radically, question the conventional distinction between the 'objectivity of science' and the 'subjectivity of culture'. This obligation creates an urgent call for the medical humanities but also for a fundamental rethinking of their grounding assumptions.Julia Kristeva (JK) has problematised the biomedical concept of health through her reading of the anthropogony of Cura (Care), who according to the Roman myth created man out of a piece of clay. JK uses this fable as an allegory for the cultural distinction between health construed as a 'definitive state', which belongs to biological life ( bios ), and healing as a durative 'process with twists and turns in time' that characterises human living ( zoe ). A consequence of this demarcation is that biomedicine is in constant need of 'repairing' and bridging the gap between bios and zoe, nature and culture. Even in radical versions, the medical humanities are mostly reduced to such an instrument of repairment, seeing them as what we refer to as a soft, 'subjective' and cultural supplement to a stable body of 'objective', biomedical and scientific knowledge. In this article, we present a prolegomenon to a more radical programme for the medical humanities, which calls the conventional distinctions between the humanities and the natural sciences into question, acknowledges the pathological and healing powers of culture, and sees the body as a complex biocultural fact. A key element in such a project is the rethinking of the concept of 'evidence' in healthcare. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.
Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina
2018-03-27
Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.
Astrocyte cultures derived from human brain tissue express angiotensinogen mRNA
International Nuclear Information System (INIS)
Milsted, A.; Barna, B.P.; Ransohoff, R.M.; Brosnihan, K.B.; Ferrario, C.M.
1990-01-01
The authors have identified human cultured cell lines that are useful for studying angiotensinogen gene expression and its regulation in the central nervous system. A model cell system of human central nervous system origin expressing angiotensinogen has not previously been available. Expression of angiotensinogen mRNA appears to be a basal property of noninduced human astrocytes, since astrocytic cell lines derived from human glioblastomas or nonneoplastic human brain tissue invariably produced angiotensinogen mRNA. In situ hybridization histochemistry revealed that angiotensinogen mRNA production was not limited to a subpopulation of astrocytes because >99% of cells in these cultures contained angiotensinogen mRNA. These cell lines will be useful in studies of the molecular mechanisms controlling angiotensin synthesis and the role of biologically active angiotensin in the human brain by allowing the authors to examine regulation of expression of the renin-angiotensin system in human astrocyte cultures
Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.
van Pelt, F N; Haring, R M; Weterings, P J
1991-01-01
Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.
Investigation of cytogenetic activity of radioprotectors in human lymphocyte culture
International Nuclear Information System (INIS)
Egiazaryan, S.V.; Arutyunyan, R.M.
1977-01-01
Studied are the effects of the F-11 and F-37 indene preparations on chromosome aberrations induced in lymphocyte culture of peripheral human blood by thioTEP. Investigation into the action of the substance in euqimolar concentrations has not shown their protective effect. Indene preparations did not change the spectrum of chromosome aberrations induced by thioTEP as well as did not increase the level of chromosome aberrations in lumphocyte culture of human peripheral human blood
Ali, F; Khan, A Q; Khan, R; Sultana, S
2016-02-01
Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Evan L. Carpenter
2018-05-01
Full Text Available Exposure to ultraviolet B (UVB irradiation of the skin leads to numerous dermatological concerns including skin cancer and accelerated aging. Natural product glucosinolate derivatives, like sulforaphane, have been shown to exhibit chemopreventive and photoprotective properties. In this study, we examined meadowfoam (Limnanthes alba glucosinolate derivatives, 3-methoxybenzyl isothiocyanate (MBITC and 3-methoxyphenyl acetonitrile (MPACN, for their activity in protecting against the consequences of UV exposure. To that end, we have exposed human primary epidermal keratinocytes (HPEKs and 3D human skin reconstructed in vitro (EpiDermTM FT-400 to UVB insult and investigated whether MBITC and MPACN treatment ameliorated the harmful effects of UVB damage. Activity was determined by the compounds’ efficacy in counteracting UVB-induced DNA damage, matrix-metalloproteinase (MMP expression, and proliferation. We found that in monolayer cultures of HPEK, MBITC and MPACN did not protect against a UVB-induced loss in proliferation and MBITC itself inhibited cell proliferation. However, in human reconstructed skin-equivalents, MBITC and MPACN decrease epidermal cyclobutane pyrimidine dimers (CPDs and significantly reduce total phosphorylated γH2A.X levels. Both MBITC and MPACN inhibit UVB-induced MMP-1 and MMP-3 expression indicating their role to prevent photoaging. Both compounds, and MPACN in particular, showed activity against UVB-induced proliferation as indicated by fewer epidermal PCNA+ cells and prevented UVB-induced hyperplasia as determined by a reduction in reconstructed skin epidermal thickness (ET. These data demonstrate that MBITC and MPACN exhibit promising anti-photocarcinogenic and anti-photoaging properties in the skin microenvironment and could be used for therapeutic interventions.
Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien
2015-01-01
Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381
Directory of Open Access Journals (Sweden)
Rong-Dih Lin
2015-12-01
Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.
Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.
Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K
2016-03-01
Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.
The impact of culture on human and space development—New millennial challenge
Harris, Philip R.
The Space Age is causing new applications to the concept of culture, a human coping tool. The exploration and exploitation of outer space resources are altering human culture both on Earth and in orbit. For the first time in history, our species need not merely react and adapt to environment, but plan for a space culture appropriate for extraterrestrial migration. The impact of culture can be analyzed in terms of how space developments alter human perceptions and behavior on this planet; the emergence of a new culture to suit the orbital environment; the organizations that build spacecraft and deploy people aloft; and the technological systems created for spacefaring. This article presents a paradigm for analyzing some of the non-technical human factors involved in space undertakings. It also offers a method for classifying a culture according to ten categories which may be applied both to a macroculture, such as a lunar base; or a microculture, such as a space agency or crew. Human enterprise in space is viewed as both altering the species, and providing a challenge for expanded behavioral and biological scientific research on living and working in space.
Human rights: eye for cultural diversity
Donders, Y.M.
2012-01-01
The relationship and interaction between international human rights law and cultural diversity is a current topic, as is shown by the recent debates in The Netherlands on, for instance, the proposed ban on wearing facial coverage, or burqas, and the proposed ban on ritual slaughter without
Hairy-root organ cultures for the production of human acetylcholinesterase
Directory of Open Access Journals (Sweden)
Mor Tsafrir S
2008-12-01
Full Text Available Abstract Background Human cholinesterases can be used as a bioscavenger of organophosphate toxins used as pesticides and chemical warfare nerve agents. The practicality of this approach depends on the availability of the human enzymes, but because of inherent supply and regulatory constraints, a suitable production system is yet to be identified. Results As a promising alternative, we report the creation of "hairy root" organ cultures derived via Agrobacterium rhizogenes-mediated transformation from human acetylcholinesterase-expressing transgenic Nicotiana benthamiana plants. Acetylcholinesterase-expressing hairy root cultures had a slower growth rate, reached to the stationary phase faster and grew to lower maximal densities as compared to wild type control cultures. Acetylcholinesterase accumulated to levels of up to 3.3% of total soluble protein, ~3 fold higher than the expression level observed in the parental plant. The enzyme was purified to electrophoretic homogeneity. Enzymatic properties were nearly identical to those of the transgenic plant-derived enzyme as well as to those of mammalian cell culture derived enzyme. Pharmacokinetic properties of the hairy-root culture derived enzyme demonstrated a biphasic clearing profile. We demonstrate that master banking of plant material is possible by storage at 4°C for up to 5 months. Conclusion Our results support the feasibility of using plant organ cultures as a successful alternative to traditional transgenic plant and mammalian cell culture technologies.
Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.
Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei
2015-07-28
To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.
Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J
2017-08-01
Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Gillman, Aaron N; Breshears, Laura M; Kistler, Charles K; Finnegan, Patrick M; Torres, Victor J; Schlievert, Patrick M; Peterson, Marnie L
2017-06-28
Staphylococcus aureus ( S. aureus ) produces many different exotoxins including the gamma-toxins, HlgAB and HlgCB. Gamma-toxins form pores in both leukocyte and erythrocyte membranes, resulting in cell lysis. The genes encoding gamma-toxins are present in most strains of S. aureus, and are commonly expressed in clinical isolates recovered from menstrual Toxic Shock Syndrome (mTSS) patients. This study set out to investigate the cytotoxic and proinflammatory effects of gamma-toxins on vaginal epithelial surfaces. We found that both HlgAB and HlgCB were cytotoxic to cultured human vaginal epithelial cells (HVECs) and induced cytokine production at sub-cytotoxic doses. Cytokine production induced by gamma-toxin treatment of HVECs was found to involve epidermal growth factor receptor (EGFR) signaling and mediated by shedding of EGFR ligands from the cell surface. The gamma-toxin subunits displayed differential binding to HVECs (HlgA 93%, HlgB 97% and HlgC 28%) with both components (HlgAB or HlgCB) required for maximum detectable binding and significant stimulation of cytokine production. In studies using full thickness ex vivo porcine vaginal mucosa, HlgAB or HlgCB stimulated a dose-dependent cytokine response, which was reduced significantly by inhibition of EGFR signaling. The effects of gamma-toxins on porcine vaginal tissue and cultured HVECs were validated using ex vivo human ectocervical tissue. Collectively, these studies have identified the EGFR-signaling pathway as a key component in gamma-toxin-induced proinflammatory changes at epithelial surfaces and highlight a potential therapeutic target to diminish toxigenic effects of S. aureus infections.
Cultural selection drives the evolution of human communication systems.
Tamariz, Monica; Ellison, T Mark; Barr, Dale J; Fay, Nicolas
2014-08-07
Human communication systems evolve culturally, but the evolutionary mechanisms that drive this evolution are not well understood. Against a baseline that communication variants spread in a population following neutral evolutionary dynamics (also known as drift models), we tested the role of two cultural selection models: coordination- and content-biased. We constructed a parametrized mixed probabilistic model of the spread of communicative variants in four 8-person laboratory micro-societies engaged in a simple communication game. We found that selectionist models, working in combination, explain the majority of the empirical data. The best-fitting parameter setting includes an egocentric bias and a content bias, suggesting that participants retained their own previously used communicative variants unless they encountered a superior (content-biased) variant, in which case it was adopted. This novel pattern of results suggests that (i) a theory of the cultural evolution of human communication systems must integrate selectionist models and (ii) human communication systems are functionally adaptive complex systems.
Human Factors and Safety Culture in Maritime Safety (revised
Directory of Open Access Journals (Sweden)
Heinz Peter Berg
2013-09-01
Full Text Available As in every industry at risk, the human and organizational factors constitute the main stakes for maritime safety. Furthermore, several events at sea have been used to develop appropriate risk models. The investigation on maritime accidents is, nowadays, a very important tool to identify the problems related to human factor and can support accident prevention and the improvement of maritime safety. Part of this investigation should in future also be near misses. Operation of ships is full of regulations, instructions and guidelines also addressing human factors and safety culture to enhance safety. However, even though the roots of a safety culture have been established, there are still serious barriers to the breakthrough of the safety management. One of the most common deficiencies in the case of maritime transport is the respective monitoring and documentation usually lacking of adequacy and excellence. Nonetheless, the maritime area can be exemplified from other industries where activities are ongoing to foster and enhance safety culture.
Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism.
Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark
2008-06-07
Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We suggest that specific behavioural manifestations of collectivism (e.g. ethnocentrism, conformity) can inhibit the transmission of pathogens; and so we hypothesize that collectivism (compared with individualism) will more often characterize cultures in regions that have historically had higher prevalence of pathogens. Drawing on epidemiological data and the findings of worldwide cross-national surveys of individualism/collectivism, our results support this hypothesis: the regional prevalence of pathogens has a strong positive correlation with cultural indicators of collectivism and a strong negative correlation with individualism. The correlations remain significant even when controlling for potential confounding variables. These results help to explain the origin of a paradigmatic cross-cultural difference, and reveal previously undocumented consequences of pathogenic diseases on the variable nature of human societies.
Duran, Anyelo; Valero, Nereida; Mosquera, Jesús; Fuenmayor, Edgard; Alvarez-Mon, Melchor
2017-12-15
The epidermal growth factor receptor (EGFR) and nucleotide-binding and oligomerization-domain containing 2 (NOD2) are important in cancer and in microbial recognition, respectively. These molecules trigger intracellular signaling pathways inducing the expression of inflammatory genes by NF-kB translocation. Gefitinib (GBTC) and pyrrolidine dithiocarbamate (PDTC) are capable of inhibiting EGFR/NOD2 and NF-kB, respectively. In earlier stages of dengue virus (DENV) infection, monocytes are capable of sustaining viral replication and increasing cytokine production, suggesting that monocyte/macrophages play an important role in early DENV replication. GBTC and PDTC have not been used to modify the pathogenesis of DENV in infected cells. This study was aimed to determine the effect of GBTC and PDTC on viral replication and cytokine production in DENV serotype 2 (DENV2)-infected human monocyte cultures. GBTC and PDTC were used to inhibit EGFR/NOD2 and NF-kB, respectively. Cytokine production was measured by ELISA and viral replication by plaque forming unit assay. Increased DENV2 replication and anti-viral cytokine production (IFN-α/β, TNF-α, IL-12 and IL-18) in infected cultures were found. These parameters were decreased after EGFR/NOD2 or NF-kB inhibitions. The inhibitory effects of GBTC and PDTC on viral replication and cytokine production can be beneficial in the treatment of patients infected by dengue and suggest a possible role of EGFR/NOD2 receptors and NF-kB in dengue pathogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Biochemistry of epidermal stem cells.
Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace
2013-02-01
The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Biochemistry of epidermal stem cells☆
Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace
2014-01-01
Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.
Evolution of dinosaur epidermal structures.
Barrett, Paul M; Evans, David C; Campione, Nicolás E
2015-06-01
Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Long-term Culture of Human iPS Cell-derived Telencephalic Neuron Aggregates on Collagen Gel.
Oyama, Hiroshi; Takahashi, Koji; Tanaka, Yoshikazu; Takemoto, Hiroshi; Haga, Hisashi
2018-01-01
It takes several months to form the 3-dimensional morphology of the human embryonic brain. Therefore, establishing a long-term culture method for neuronal tissues derived from human induced pluripotent stem (iPS) cells is very important for studying human brain development. However, it is difficult to keep primary neurons alive for more than 3 weeks in culture. Moreover, long-term adherent culture to maintain the morphology of telencephalic neuron aggregates induced from human iPS cells is also difficult. Although collagen gel has been widely used to support long-term culture of cells, it is not clear whether human iPS cell-derived neuron aggregates can be cultured for long periods on this substrate. In the present study, we differentiated human iPS cells to telencephalic neuron aggregates and examined long-term culture of these aggregates on collagen gel. The results indicated that these aggregates could be cultured for over 3 months by adhering tightly onto collagen gel. Furthermore, telencephalic neuronal precursors within these aggregates matured over time and formed layered structures. Thus, long-term culture of telencephalic neuron aggregates derived from human iPS cells on collagen gel would be useful for studying human cerebral cortex development.Key words: Induced pluripotent stem cell, forebrain neuron, collagen gel, long-term culture.
DEFF Research Database (Denmark)
Jensen, T; Aliouat, E M; Lundgren, B
1998-01-01
The production of free radicals in human neutrophils was studied in both Pneumocystis carinii derived from cultures of L2 rat lung epithelial-like cells and Pneumocystis carinii purified from human lung. Using the cytochrome C technique, which selectively measured extracellular superoxide...... generation, hardly any free radical production was observed after stimulation with cultured rat-derived P. carinii. A chemiluminescence technique, which separately measured intra- and extracellular free radical production, was subsequently employed to differentiate the free radical generation....... It was established that 1) P. carinii stimulated intra- but not extracellular free radical production in human neutrophils, 2) opsonized cultured rat-derived P. carinii stimulated human neutrophils to a strong intracellular response of superoxide production, and 3) opsonized P. carinii, purified from human lung also...
Cultural diversity and human resources management in Europe
Cristian MARINAS; Monica CONDRUZ- BACESCU
2009-01-01
The increase in the international dimensions of human resources management and the extension of European Union represents important premises regarding the harmonization of human resources practices at the level of the European countries. Despite this, the main characteristic of the European model of management is diversity. During the last decade, the human resource function registered profound changes, determined especially by the economic, social, cultural and political context registered a...
Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism
Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark
2008-01-01
Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We sug...
Cultural Implications of Human Resource Development.
Hiranpruk, Chaiskran
A discussion of the cultural effects of economic and, by extension, human resource development in Southeast Asia looks at short- and long-term implications. It is suggested that in the short term, increased competition will affect distribution of wealth, which can promote materialism and corruption. The introduction of labor-saving technology may…
Hanging drop cultures of human testis and testis cancer samples
DEFF Research Database (Denmark)
Jørgensen, Anne; Young, J; Nielsen, J E
2014-01-01
cultured in 'hanging drops' and effects of activin A and follistatin treatment were investigated in seminoma cultures. RESULTS: Testis fragments with normal spermatogenesis or CIS cells were cultured for 14 days with sustained proliferation of germ cells and CIS cells and without increased apoptosis....... Seminoma cultures survived 7 days, with proliferating cells detectable during the first 5 days. Activin A treatment significantly reduced KIT transcript and protein levels in seminoma cultures, thereby demonstrating a specific treatment response. CONCLUSIONS: Hanging drop cultures of human testis...
Viability of human corneal keratocytes during organ culture
DEFF Research Database (Denmark)
Møller-Pedersen, T; Møller, H J
1996-01-01
The viability of human corneal keratocytes was assessed during four weeks of 'closed system' organ culture at 31 degrees C. After 28 days of culturing, the entire keratocyte population was still alive and viable because all cells incorporated uridine; a parameter for RNA-synthesis. During the first...... of keratan sulphate proteoglycan suggested that approximately 1% of the total content was lost during the period. In conclusion, our current organ culture technique can maintain a viable keratocyte population for four weeks; a viable stroma can be grafted within this period....
INPO Perspectives and Activities to Enhance Supplier Human Performance and Safety Culture
International Nuclear Information System (INIS)
Duncan, R. J.
2016-01-01
Within their own organizations, utilities have made significant improvements in human performance and safety culture, supported by a strong community of practice through INPO and WANO. In recent years, utilities have been making increasing use of suppliers for design, construction, inspection and maintenance services in support of their NPPs. Many of these suppliers do not have the benefit of being members of a community of practice when it comes to human performance and safety culture. To help the supplier community make improvements similar to what the utilities have achieved, INPO has recently expanded its Supplier Participant program to address the issue of human performance and safety culture in the supplier community. The intent of this paper will be to share the INPO’s perspectives and activities in helping suppliers of services and products to NPPs enhance their human performance and safety culture. (author)
Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells
International Nuclear Information System (INIS)
Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook
2011-01-01
Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.
Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina
2005-01-01
The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Supplements in human islet culture: human serum albumin is inferior to fetal bovine serum.
Avgoustiniatos, Efstathios S; Scott, William E; Suszynski, Thomas M; Schuurman, Henk-Jan; Nelson, Rebecca A; Rozak, Phillip R; Mueller, Kate R; Balamurugan, A N; Ansite, Jeffrey D; Fraga, Daniel W; Friberg, Andrew S; Wildey, Gina M; Tanaka, Tomohiro; Lyons, Connor A; Sutherland, David E R; Hering, Bernhard J; Papas, Klearchos K
2012-01-01
Culture of human islets before clinical transplantation or distribution for research purposes is standard practice. At the time the Edmonton protocol was introduced, clinical islet manufacturing did not include culture, and human serum albumin (HSA), instead of fetal bovine serum (FBS), was used during other steps of the process to avoid the introduction of xenogeneic material. When culture was subsequently introduced, HSA was also used for medium supplementation instead of FBS, which was typically used for research islet culture. The use of HSA as culture supplement was not evaluated before this implementation. We performed a retrospective analysis of 103 high-purity islet preparations (76 research preparations, all with FBS culture supplementation, and 27 clinical preparations, all with HSA supplementation) for oxygen consumption rate per DNA content (OCR/DNA; a measure of viability) and diabetes reversal rate in diabetic nude mice (a measure of potency). After 2-day culture, research preparations exhibited an average OCR/DNA 51% higher (p < 0.001) and an average diabetes reversal rate 54% higher (p < 0.05) than clinical preparations, despite 87% of the research islet preparations having been derived from research-grade pancreata that are considered of lower quality. In a prospective paired study on islets from eight research preparations, OCR/DNA was, on average, 27% higher with FBS supplementation than that with HSA supplementation (p < 0.05). We conclude that the quality of clinical islet preparations can be improved when culture is performed in media supplemented with serum instead of albumin.
Human meniscal proteoglycan metabolism in long-term tissue culture
Verbruggen, G.; Verdonk, R.; Veys, E. M.; van Daele, P.; de Smet, P.; van den Abbeele, K.; Claus, B.; Baeten, D.
1996-01-01
For the purpose of human meniscal allografting, menisci have been maintained viable in in vitro culture. The influence of long-term tissue culture on the extracellular matrix metabolism of the meniscus has been studied. Fetal calf serum (FCS) was used as a supplement for the growth factors necessary
The Human-Computer Interaction of Cross-Cultural Gaming Strategy
Chakraborty, Joyram; Norcio, Anthony F.; Van Der Veer, Jacob J.; Andre, Charles F.; Miller, Zachary; Regelsberger, Alexander
2015-01-01
This article explores the cultural dimensions of the human-computer interaction that underlies gaming strategies. The article is a desktop study of existing literature and is organized into five sections. The first examines the cultural aspects of knowledge processing. The social constructs technology interaction is discussed. Following this, the…
Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari
2017-12-01
Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.
Directory of Open Access Journals (Sweden)
Yu-Ping Hsiao
2015-01-01
Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.
International Nuclear Information System (INIS)
Bell, C.W.
1987-01-01
Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B
Cultural Difference and Human Rights : A Philosophical-Anthropological Approach
J. Kloeg (Julien)
2014-01-01
textabstractIn ‘Cultural Difference and Human Rights’, Julien Kloeg claims, with Pablo Gilabert, that theoretical attempts to justify human rights should move beyond the dichotomy of providing either a humanist or a political justification. Kloeg demonstrates how philosophical anthropology could
Humane Orientation as a New Cultural Dimension of the GLOBE Project
DEFF Research Database (Denmark)
Schlösser, Oliver; Frese, Michael; Heintze, Anna-Maria
2013-01-01
We validate, extend, and empirically and theoretically criticize the cultural dimension of humane orientation of the project GLOBE (Global Leadership and Organizational Behavior Effectiveness Research Program). Theoretically, humane orientation is not just a one-dimensionally positive concept about...... study used student samples from 25 countries that were either high or low in humane orientation (N = 876) and studied their relation to the traditional GLOBE scale and other cultural-level measures (agreeableness, religiosity, authoritarianism, and welfare state score). Findings revealed a strong...... correlation between humane orientation and agreeableness, welfare state score, and religiosity. Out-group humane orientation proved to be the more relevant subfacet of the original humane orientation construct, suggesting that future research on humane orientation should make use of this measure instead...
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.
Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un
2008-09-01
Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.
Epidermal growth factor and lung development in the offspring of the diabetic rat
DEFF Research Database (Denmark)
Thulesen, J; Poulsen, Steen Seier; Nexø, Ebba
2000-01-01
Fetuses of diabetic mothers who were exposed to excessive glucose show delayed maturation. Under these conditions, altered growth factor expression or signaling may have important regulatory influences. We examined the role of epidermal growth factor (EGF) in lung development and maternal diabetes...... in the rat. In order to evaluate the possible role of glucose for the expression of EGF and the growth of lung tissue, we performed in vitro studies with organotypic cultures of fetal alveolar cells obtained from control rats. Compared to pups of normal rats, the newborn rats of untreated diabetic rats had...... and was associated with a reduced intensity of surfactant protein A-IR. The only difference observed between pups of treated diabetic rats and controls was a decrease in the lung weight:body weight ratio. In organotypic cultures, the presence of 13 mmol/L glucose in the cell media increased immunoreactive staining...
Directory of Open Access Journals (Sweden)
Gift T. Baloyi
2017-01-01
Full Text Available This article discusses the nature of human beings (men and women as an egalitarian one even beyond cultural expectations. It argues against some cultural practices on women, especially widows, which claim supremacy and bind the widows to its ritual processes among the Tsonga people. It stresses the importance of human individual that overtakes everything from God�s creation, including cultural rituals which are created by human beings. It claims that the existence of culture depends solely on the existence or presence of human beings and their communities. Therefore, culture cannot use humans to shape itself and to transform the community. It is humans themselves who use culture to identify themselves and ultimately change their communities. Although the paper is theological in its approach, it argues for individual human rights to be respected and weighed above all cultural practices. It further concludes that such cultural practices are not static and that they can be removed from the rest of culture.Intradisciplinary and/or interdisciplinary implications: This article, from a practical theological view, challenges the African cultural rituals that claim authority over women�s rights and dignity. The interdisciplinary nature of this article indicates the sanctity of human individuals especially widows and thereby calls for paradigm shift to deconstruct certain oppressive teachings and practices against widows among African women. This article concludes thus, cultural deconstruction is possible.
International Nuclear Information System (INIS)
Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.
1986-01-01
Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor
Corporate Culture in Developing Professionalism of Human Resources in LEMHANNAS RI
Directory of Open Access Journals (Sweden)
Paula Theresia Ekowati Purwaning Utami
2012-08-01
Full Text Available Based on a case study by Lemhannas RI, this work attempts to discuss the relation of professionalism of human resources and corporate culture. The change and growth of corporate culture in an organization requires strong commitment from those involved in it. Corporate culture should be continually developed through a persistent socialization, partnership and supervision programs. The right management of human resources, which follows the basis of management, will give a great contribution when applied well. In addition, policy evaluation on corporate culture should include structural and cultural aspects and be conducted in several steps, including identification of goals and ways of completing them, measurement of relevant information activities, analysis of data for a conclusion and recommendation. The recommendation is a crucial step that needs a special attention for the restructurization of culture for better results. This study concludes that interaction between structure and culture is a key and pre-condition for the growth of a better and conducive corporate culture for accomplishing the goals of organization.
A novel role of RASSF9 in maintaining epidermal homeostasis.
Directory of Open Access Journals (Sweden)
Chiou-Mei Lee
Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.
Energy Technology Data Exchange (ETDEWEB)
Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)
2017-09-15
To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.
International Nuclear Information System (INIS)
Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo
2017-01-01
To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers
International Nuclear Information System (INIS)
Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana
2008-01-01
Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure
Kant and the development of the human and cultural sciences.
Makkreel, Rudolf A
2008-12-01
Starting with Kant's doubts about psychology as a natural science capable of explaining human behavior, several alternative attempts to conceive of human life, culture and history are examined. Kant proposes an anthropology that will be a commonly useful human science rather than a universally valid natural science. This anthropology relates to philosophy as a mode of world-cognition. Special attention is given to how Kant's theory of right can help define our appropriate place in a communal world. The different ways in which Wilhelm Dilthey and Hermann Cohen respond to Kant's idea of legitimate appropriation are also considered. The various tasks that descriptive elucidation, explanation, reflective understanding, characterization and interpretation can perform for the human and cultural sciences are examined throughout the essay.
Toward "harder" medical humanities: moving beyond the "two cultures" dichotomy.
Polianski, Igor J; Fangerau, Heiner
2012-01-01
Using the current international debate surrounding the incorporation of medical humanities into medical curricula as a starting point, the authors address both the legitimacy and didactics of teaching medical humanities to medical students. They highlight the paradox of the increasing prevalence of medical humanities in medical curricula and the often critical reception humanities courses receive. The alleged lack of empirical evidence linking such courses with improved patient care cannot alone explain the criticism they engender. After a short overview of the debate surrounding medical humanities and their inclusion in outcomes-based education, the authors outline the medical humanities block, "The History, Theory, and Ethics of Medicine," which is part of the German medical curriculum. A model developed at Ulm University exemplifies the integrated inclusion of the heterogeneous aspects of medical culture into medical education. This model emphasizes a reflexive approach (i.e., understanding how the humanities are manifested in medicine) as an alternative to the currently dominant narrative approach (i.e., liberal arts, moral development, and/or mental retreat), which has gradually been limited to a quasi-"secular religion" for doctors. This model uses established concepts from science and cultural studies as the "instruments" for seminars and courses; paradigms, discourses, social systems, and cosmologies constitute the tools for teaching and learning about the historical, theoretical, and ethical dimensions of medicine. The authors argue that this approach both precludes the need to justify the medical humanities and overcomes the dichotomy that has heretofore existed between the two cultures of science and the humanities in medicine.
Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin
DEFF Research Database (Denmark)
Li, Hongbing; Panina, Svetlana; Kaur, Amandeep
2012-01-01
Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...
Stimulation of DNA synthesis in cultured rat alveolar type II cells
International Nuclear Information System (INIS)
Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.
1985-01-01
Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture
Primary culture of human Schwann and schwannoma cells: improved and simplified protocol.
Dilwali, Sonam; Patel, Pratik B; Roberts, Daniel S; Basinsky, Gina M; Harris, Gordon J; Emerick, Kevin S; Stankovic, Konstantina M
2014-09-01
Primary culture of human Schwann cells (SCs) and vestibular schwannoma (VS) cells are invaluable tools to investigate SC physiology and VS pathobiology, and to devise effective pharmacotherapies against VS, which are sorely needed. However, existing culture protocols, in aiming to create robust, pure cultures, employ methods that can lead to loss of biological characteristics of the original cells, potentially resulting in misleading biological findings. We have developed a minimally manipulative method to culture primary human SC and VS cells, without the use of selective mitogens, toxins, or time-consuming and potentially transformative laboratory techniques. Schwann cell purity was quantified longitudinally using S100 staining in SC cultures derived from the great auricular nerve and VS cultures followed for 7 and 12 weeks, respectively. SC cultures retained approximately ≥85% purity for 2 weeks. VS cultures retained approximately ≥80% purity for the majority of the span of 12 weeks, with maximal purity of 87% at 2 weeks. The VS cultures showed high level of biological similarity (68% on average) to their respective parent tumors, as assessed using a protein array featuring 41 growth factors and receptors. Apoptosis rate in vitro negatively correlated with tumor volume. Our results, obtained using a faster, simplified culturing method than previously utilized, indicate that highly pure, primary human SC and VS cultures can be established with minimal manipulation, reaching maximal purity at 2 weeks of culture. The VS cultures recapitulate the parent tumors' biology to a great degree, making them relevant models to investigate VS pathobiology. Copyright © 2014 Elsevier B.V. All rights reserved.
Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis
Directory of Open Access Journals (Sweden)
Kazuhiko Arima
2015-01-01
Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.
Explaining human uniqueness: genome interactions with environment, behaviour and culture.
Varki, Ajit; Geschwind, Daniel H; Eichler, Evan E
2008-10-01
What makes us human? Specialists in each discipline respond through the lens of their own expertise. In fact, 'anthropogeny' (explaining the origin of humans) requires a transdisciplinary approach that eschews such barriers. Here we take a genomic and genetic perspective towards molecular variation, explore systems analysis of gene expression and discuss an organ-systems approach. Rejecting any 'genes versus environment' dichotomy, we then consider genome interactions with environment, behaviour and culture, finally speculating that aspects of human uniqueness arose because of a primate evolutionary trend towards increasing and irreversible dependence on learned behaviours and culture - perhaps relaxing allowable thresholds for large-scale genomic diversity.
Differences in the characteristics of cell cultures established from seven human osteosarcomas
International Nuclear Information System (INIS)
Lloyd, E.L.; Henning, C.B.; Mackevicius, F.
1975-01-01
Cell cultures derived from seven human osteosarcomas have been characterized with respect to their pattern of growth and cell morphology using light microscopy, transmission electron microscopy, and scanning electron microscopy. Other characteristics studied included growth rates, chromosomal abnormalities, and ability to grow in low serum concentrations and on a semisolid substrate. Normal human fibroblasts in culture have also been examined by the same methods. The results show many differences both between individual osteosarcoma cultures and normal fibroblasts. Two of the osteosarcoma cultures were epithelium-like, and five had a more fibroblastic appearance when viewed by the light microscope. Examination by electron microscopy showed a wide variety of cells in each culture. Many of the features exhibited in the fibroblast-like tumor cells were different from those seen with the normal fibroblast cultures. Growth rates differed widely with characteristic doubling times varying between 1 and 7 days from the osteosarcoma cultures, compared to 3 to 4 days for normal fibroblasts. Unlike normal mouse fibroblasts, which grow poorly or not at all in low serum concentrations, the normal human fibroblasts tested grew almost as well in media with 1 percent serum as with 15 percent serum
Directory of Open Access Journals (Sweden)
Yanase Toshihiko
2010-06-01
Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.
3D bioprinting of functional human skin: production and in vivo analysis.
Cubo, Nieves; Garcia, Marta; Del Cañizo, Juan F; Velasco, Diego; Jorcano, Jose L
2016-12-05
Significant progress has been made over the past 25 years in the development of in vitro-engineered substitutes that mimic human skin, either to be used as grafts for the replacement of lost skin, or for the establishment of in vitro human skin models. In this sense, laboratory-grown skin substitutes containing dermal and epidermal components offer a promising approach to skin engineering. In particular, a human plasma-based bilayered skin generated by our group, has been applied successfully to treat burns as well as traumatic and surgical wounds in a large number of patients in Spain. There are some aspects requiring improvements in the production process of this skin; for example, the relatively long time (three weeks) needed to produce the surface required to cover an extensive burn or a large wound, and the necessity to automatize and standardize a process currently performed manually. 3D bioprinting has emerged as a flexible tool in regenerative medicine and it provides a platform to address these challenges. In the present study, we have used this technique to print a human bilayered skin using bioinks containing human plasma as well as primary human fibroblasts and keratinocytes that were obtained from skin biopsies. We were able to generate 100 cm 2 , a standard P100 tissue culture plate, of printed skin in less than 35 min (including the 30 min required for fibrin gelation). We have analysed the structure and function of the printed skin using histological and immunohistochemical methods, both in 3D in vitro cultures and after long-term transplantation to immunodeficient mice. In both cases, the generated skin was very similar to human skin and, furthermore, it was indistinguishable from bilayered dermo-epidermal equivalents, handmade in our laboratories. These results demonstrate that 3D bioprinting is a suitable technology to generate bioengineered skin for therapeutical and industrial applications in an automatized manner.
International Nuclear Information System (INIS)
Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook
2006-01-01
To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing
Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation
Energy Technology Data Exchange (ETDEWEB)
Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.
1990-11-01
For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs.
Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation
International Nuclear Information System (INIS)
Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.
1990-11-01
For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs
A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli
Directory of Open Access Journals (Sweden)
Jihene Elloumi-Mseddi
2014-01-01
Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2001-01-01
...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Immunocytochemical characterization of explant cultures of human prostatic stromal cells
A. Kooistra (Anko); A.M.J. Elissen (Arianne ); J.J. Konig (Josee); M. Vermey; Th.H. van der Kwast (Theo); J.C. Romijn (Johannes); F.H. Schröder (Fritz)
1995-01-01
textabstractThe study of stromal-epithelial interactions greatly depends on the ability to culture both cell types separately, in order to permit analysis of their interactions under defined conditions in reconstitution experiments. Here we report the establishment of explant cultures of human
Paul, Michelle; Kaur, Pritinder; Herson, Marisa; Cheshire, Perdita; Cleland, Heather; Akbarzadeh, Shiva
2015-10-01
Tissue-engineered composite skin is a promising therapy for the treatment of chronic and acute wounds, including burns. Providing the wound bed with a dermal scaffold populated by autologous dermal and epidermal cellular components can further entice host cell infiltration and vascularization to achieve permanent wound closure in a single stage. However, the high porosity and the lack of a supportive basement membrane in most commercially available dermal scaffolds hinders organized keratinocyte proliferation and stratification in vitro and may delay re-epithelization in vivo. The objective of this study was to develop a method to enable the in vitro production of a human skin equivalent (HSE) that included a porous scaffold and dermal and epidermal cells expanded ex vivo, with the potential to be used for definitive treatment of skin defects in a single procedure. A collagen-glycosaminoglycan dermal scaffold (Integra(®)) was populated with adult fibroblasts. A near-normal skin architecture was achieved by the addition of coagulated human plasma to the fibroblast-populated scaffold before seeding cultured keratinocytes. This resulted in reducing scaffold pore size and improving contact surfaces. Skin architecture and basement membrane formation was further improved by the addition of aprotinin (a serine protease inhibitor) to the culture media to inhibit premature clot digestion. Histological assessment of the novel HSE revealed expression of keratin 14 and keratin 10 similar to native skin, with a multilayered neoepidermis morphologically comparable to human skin. Furthermore, deposition of collagen IV and laminin-511 were detected by immunofluorescence, indicating the formation of a continuous basement membrane at the dermal-epidermal junction. The proposed method was efficient in producing an in vitro near native HSE using the chosen off-the-shelf porous scaffold (Integra). The same principles and promising outcomes should be applicable to other biodegradable
Evolution of social learning does not explain the origin of human cumulative culture.
Enquist, Magnus; Ghirlanda, Stefano
2007-05-07
Because culture requires transmission of information between individuals, thinking about the origin of culture has mainly focused on the genetic evolution of abilities for social learning. Current theory considers how social learning affects the adaptiveness of a single cultural trait, yet human culture consists of the accumulation of very many traits. Here we introduce a new modeling strategy that tracks the adaptive value of many cultural traits, showing that genetic evolution favors only limited social learning owing to the accumulation of maladaptive as well as adaptive culture. We further show that culture can be adaptive, and refined social learning can evolve, if individuals can identify and discard maladaptive culture. This suggests that the evolution of such "adaptive filtering" mechanisms may have been crucial for the birth of human culture.
Culture and Human Rights: The Wroclaw Commentaries
Wiesand, A.J.; Chainoglou, K.; Śledzińska-Simon, A.; Donders, Y.
2016-01-01
The City of Wroclaw, in cooperation with the National Cultural Centre (Warsaw), has asked Andreas Joh. Wiesand to prepare, together with experts from many different countries, a basic handbook which cover all relevant legal questions as well as main political consequences related to human rights and
Matsumura, Hajime; Matsushima, Asako; Ueyama, Masashi; Kumagai, Norio
2016-06-01
In the 1970s, Green et al. developed a method that involved culturing keratinocyte sheets and used for treatment of burns. Since then, the take rate of cultured epidermal autograft (CEA) onto fascia, granulation tissue, or allografts has been extensively reported, while that on an artificial dermis in a large case series is not. Moreover, the contribution of CEA to patient survival has not been analyzed in a multicenter study. We conducted a 6-year multicenter surveillance on the application of the CEA "JACE(®") for treatment of burns >30% total body surface area (TBSA) across 118 Japanese hospitals. This surveillance included 216 patients and 718 graft sites for efficacy analysis. The CEA take rate at 4 weeks after grafting was evaluated, and safety was monitored until 52 weeks. In addition, the survival curve obtained in this study and the data obtained from the Tokyo Burn Unit Association (TBUA) were compared. The mean CEA take rates at week 4 were 66% (sites) and 68% (patients), and the rate on the artificial dermis was 65% for 226 sites. CEA application combined with wide split-thickness auto or patch autograft increased the CEA take rate. On comparison with the data obtained from the TBUA, which included data on individuals with burns of the same severity, CEA application was found to contribute to patient survival until 7 weeks after burn. We reported the take rate of CEA based on a 6-year multicenter surveillance. From our results, we found that the application of CEA is a useful treatment for the patients with extensive burns. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.
The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology
DEFF Research Database (Denmark)
Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J
2017-01-01
The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....
Optimal allocation of leaf epidermal area for gas exchange
de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.
2016-01-01
Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2003-01-01
...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Gledhill, Karl; Guo, Zongyou; Umegaki-Arao, Noriko; Higgins, Claire A; Itoh, Munenari; Christiano, Angela M
2015-01-01
The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs) present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.
Directory of Open Access Journals (Sweden)
Karl Gledhill
Full Text Available The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.
Traditional Values, Socio-Cultural Factors and Human Resource ...
African Journals Online (AJOL)
... Values, Socio-Cultural Factors and Human Resource Management Practices in ... Ghanaian worker in general and the HR manager in particular is influenced ... face -to-face interview methods were used to obtain information for the study.
Yoshimitsu, Ryosuke; Hattori, Koji; Sugiura, Shinji; Kondo, Yuki; Yamada, Rotaro; Tachikawa, Saoko; Satoh, Taku; Kurisaki, Akira; Ohnuma, Kiyoshi; Asashima, Makoto; Kanamori, Toshiyuki
2014-05-01
Human induced pluripotent stem cells (hiPSCs) are a promising cell source for drug screening. For this application, self-renewal or differentiation of the cells is required, and undefined factors in the culture conditions are not desirable. Microfluidic perfusion culture allows the production of small volume cultures with precisely controlled microenvironments, and is applicable to high-throughput cellular environment screening. Here, we developed a microfluidic perfusion culture system for hiPSCs that uses a microchamber array chip under defined extracellular matrix (ECM) and culture medium conditions. By screening various ECMs we determined that fibronectin and laminin are appropriate for microfluidic devices made out of the most popular material, polydimethylsiloxane (PDMS). We found that the growth rate of hiPSCs under pressure-driven perfusion culture conditions was higher than under static culture conditions in the microchamber array. We applied our new system to self-renewal and differentiation cultures of hiPSCs, and immunocytochemical analysis showed that the state of the hiPSCs was successfully controlled. The effects of three antitumor drugs on hiPSCs were comparable between microchamber array and 96-well plates. We believe that our system will be a platform technology for future large-scale screening of fully defined conditions for differentiation cultures on integrated microfluidic devices. © 2013 Wiley Periodicals, Inc.
Bio-imaging of colorectal cancer models using near infrared labeled epidermal growth factor.
Directory of Open Access Journals (Sweden)
Gadi Cohen
Full Text Available Novel strategies that target the epidermal growth factor receptor (EGFR have led to the clinical development of monoclonal antibodies, which treat metastatic colorectal cancer (mCRC but only subgroups of patients with increased wild type KRAS and EGFR gene copy, respond to these agents. Furthermore, resistance to EGFR blockade inevitably occurred, making future therapy difficult. Novel bio-imaging (BOI methods may assist in quantization of EGFR in mCRC tissue thus complementing the immunohistochemistry methodology, in guiding the future treatment of these patients. The aim of the present study was to explore the usefulness of near infrared-labeled EGF (EGF-NIR for bio-imaging of CRC using in vitro and in vivo orthotopic tumor CRC models and ex vivo human CRC tissues. We describe the preparation and characterization of EGF-NIR and investigate binding, using BOI of a panel of CRC cell culture models resembling heterogeneity of human CRC tissues. EGF-NIR was specifically and selectively bound by EGFR expressing CRC cells, the intensity of EGF-NIR signal to background ratio (SBR reflected EGFR levels, dose-response and time course imaging experiments provided optimal conditions for quantization of EGFR levels by BOI. EGF-NIR imaging of mice with HT-29 orthotopic CRC tumor indicated that EGF-NIR is more slowly cleared from the tumor and the highest SBR between tumor and normal adjacent tissue was achieved two days post-injection. Furthermore, images of dissected tissues demonstrated accumulation of EGF-NIR in the tumor and liver. EGF-NIR specifically and strongly labeled EGFR positive human CRC tissues while adjacent CRC tissue and EGFR negative tissues expressed weak NIR signals. This study emphasizes the use of EGF-NIR for preclinical studies. Combined with other methods, EGF-NIR could provide an additional bio-imaging specific tool in the standardization of measurements of EGFR expression in CRC tissues.
Energy Technology Data Exchange (ETDEWEB)
Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R., E-mail: mundy.william@epa.gov
2011-11-15
There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural
International Nuclear Information System (INIS)
Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R.
2011-01-01
There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Papiorek, Sarah; Junker, Robert R; Lunau, Klaus
2014-01-01
Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Directory of Open Access Journals (Sweden)
Sarah Papiorek
Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of
Study on invadopodia formation for lung carcinoma invasion with a microfluidic 3D culture device.
Wang, Shanshan; Li, Encheng; Gao, Yanghui; Wang, Yan; Guo, Zhe; He, Jiarui; Zhang, Jianing; Gao, Zhancheng; Wang, Qi
2013-01-01
Invadopodia or invasive feet, which are actin-rich membrane protrusions with matrix degradation activity formed by invasive cancer cells, are a key determinant in the malignant invasive progression of tumors and represent an important target for cancer therapies. In this work, we presented a microfluidic 3D culture device with continuous supplement of fresh media via a syringe pump. The device mimicked tumor microenvironment in vivo and could be used to assay invadopodia formation and to study the mechanism of human lung cancer invasion. With this device, we investigated the effects of epidermal growth factor (EGF) and matrix metalloproteinase (MMP) inhibitor, GM6001 on invadopodia formation by human non-small cell lung cancer cell line A549 in 3D matrix model. This device was composed of three units that were capable of achieving the assays on one control group and two experimental groups' cells, which were simultaneously pretreated with EGF or GM6001 in parallel. Immunofluorescence analysis of invadopodia formation and extracellular matrix degradation was conducted using confocal imaging system. We observed that EGF promoted invadopodia formation by A549 cells in 3D matrix and that GM6001 inhibited the process. These results demonstrated that epidermal growth factor receptor (EGFR) signaling played a significant role in invadopodia formation and related ECM degradation activity. Meanwhile, it was suggested that MMP inhibitor (GM6001) might be a powerful therapeutic agent targeting invadopodia formation in tumor invasion. This work clearly demonstrated that the microfluidic-based 3D culture device provided an applicable platform for elucidating the mechanism of cancer invasion and could be used in testing other anti-invasion agents.
Humans have evolved specialized skills of social cognition: the cultural intelligence hypothesis.
Herrmann, Esther; Call, Josep; Hernàndez-Lloreda, Maráa Victoria; Hare, Brian; Tomasello, Michael
2007-09-07
Humans have many cognitive skills not possessed by their nearest primate relatives. The cultural intelligence hypothesis argues that this is mainly due to a species-specific set of social-cognitive skills, emerging early in ontogeny, for participating and exchanging knowledge in cultural groups. We tested this hypothesis by giving a comprehensive battery of cognitive tests to large numbers of two of humans' closest primate relatives, chimpanzees and orangutans, as well as to 2.5-year-old human children before literacy and schooling. Supporting the cultural intelligence hypothesis and contradicting the hypothesis that humans simply have more "general intelligence," we found that the children and chimpanzees had very similar cognitive skills for dealing with the physical world but that the children had more sophisticated cognitive skills than either of the ape species for dealing with the social world.
Oogenesis in cultures derived from adult human ovaries
Directory of Open Access Journals (Sweden)
Caudle Michael R
2005-05-01
Full Text Available Abstract Ten years ago, we reported that in adult human females the ovarian surface epithelium (OSE is a source of germ cells. Recently, we also demonstrated that new primary follicles are formed by assembly of oocytes with nests of primitive granulosa cells in the ovarian cortex. The components of the new primary follicles, primitive granulosa and germ cells, differentiated sequentially from the OSE, which arises from cytokeratin positive mesenchymal progenitor cells residing in the ovarian tunica albuginea. In the present study, we investigated the possibility that the oocytes and granulosa cells may differentiate in cultures derived from adult human ovaries. Cells were scrapped from the surface of ovaries and cultured for 5 to 6 days, in the presence or absence of estrogenic stimuli [phenol red (PhR]. The OSE cells cultured in the medium without PhR differentiated into small (15 micron cells of granulosa phenotype, and epithelial, neural, and mesenchymal type cells. In contrast, OSE cells cultured in the presence of PhR differentiated directly into large (180 micron cells of the oocyte phenotype. Such cells exhibited germinal vesicle breakdown, expulsion of the polar body, and surface expression of zona pellucida proteins, i.e. characteristics of secondary oocytes. These in vitro studies confirm our in vivo observations that in adult human ovaries, the OSE is a bipotent source of oocytes and granulosa cells. Development of numerous mature oocytes from adult ovarian stem cells in vitro offers new strategies for the egg preservation, IVF utilization, and treatment of female infertility. In addition, other clinical applications aiming to utilize stem cells, and basic stem cell research as well, may employ totipotent embryonic stem cells developing from fertilized oocytes.
International Nuclear Information System (INIS)
Gradishar, William J
2016-01-01
Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed
Directory of Open Access Journals (Sweden)
Kyounghwan Lee
2015-04-01
Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.
Culture and art: Importance of art practice, not aesthetics, to early human culture.
Zaidel, Dahlia W
2018-01-01
Art is expressed in multiple formats in today's human cultures. Physical traces of stone tools and other archaeological landmarks suggest early nonart cultural behavior and symbolic cognition in the early Homo sapiens (HS) who emerged ~300,000-200,000 years ago in Africa. Fundamental to art expression is the neural underpinning for symbolic cognition, and material art is considered its prime example. However, prior to producing material art, HS could have exploited symbolically through art-rooted biological neural pathways for social purpose, namely, those controlling interpersonal motoric coordination and sound codependence. Aesthetics would not have been the primary purpose; arguments for group dance and rhythmical musical sounds are offered here. In addition, triggers for symbolic body painting are discussed. These cultural art formats could well have preceded material art and would have enhanced unity, inclusiveness, and cooperative behavior, contributing significantly to already existing nonart cultural practices. © 2018 Elsevier B.V. All rights reserved.
Glucose metabolism in cultured trophoblasts from human placenta
International Nuclear Information System (INIS)
Moe, A.J.; Farmer, D.R.; Nelson, D.M.; Smith, C.H.
1990-01-01
The development of appropriate placental trophoblast isolation and culture techniques enables the study of pathways of glucose utilization by this important cell layer in vitro. Trophoblasts from normal term placentas were isolated and cultured 24 hours and 72 hours in uncoated polystyrene culture tubes or tubes previously coated with a fibrin matrix. Trophoblasts cultured on fibrin are morphologically distinct from those cultured on plastic or other matrices and generally resemble in vivo syncytium. Cells were incubated up to 3 hours with 14 C-labeled glucose and reactions were stopped by addition of perchloric acid. 14 CO 2 production by trophoblasts increased linearly with time however the largest accumulation of label was in organic acids. Trophoblasts cultured in absence of fibrin utilized more glucose and accumulated more 14 C in metabolic products compared to cells cultured on fibrin. Glucose oxidation to CO 2 by the phosphogluconate (PG) pathway was estimated from specific yields of 14 CO 2 from [1- 14 C]-D-glucose and [6- 14 C]-D-glucose. Approximately 6% of glucose oxidation was by the PG pathway when cells were cultured on fibrin compared to approximately 1% by cells cultured in the absence of fibrin. The presence of a fibrin growth matrix appears to modulate the metabolism of glucose by trophoblast from human placenta in vitro
Human Rights in the Context of Cultural Diversity
Directory of Open Access Journals (Sweden)
Emilian Ciongaru
2013-05-01
Full Text Available The human rights understood in the sense of fundamental inalienable rights are therefore considered as universal – they apply to everything and egalitarian exist in two ways: as natural or legal rights, both in the rights doctrine in the international practice within the international law, the global and regional institutions, in the state policies and the activities of non from all over the world regardless of peoples’ cultures. manage the ethnic-cultural communities living on the territory of a state often contributes, in fact, to the separation and not to the reunion of peoples, the ideological and political factors acting rather as division factors whereas the affective spiritual connection exists only between the states having deep similarities. For this purpose, serving justice having as a goal the pres on the social feelings of humanity.
Al-Wardi, Yousuf
2017-09-01
Rates of aviation accident differ in different regions; and national culture has been implicated as a factor. This invites a discussion about the role of national culture in aviation accidents. This study makes a cross-cultural comparison between Oman, Taiwan and the USA. A cross-cultural comparison was acquired using data from three studies, including this study, by applying the Human Factors Analysis and Classification System (HFACS) framework. The Taiwan study presented 523 mishaps with 1762 occurrences of human error obtained from the Republic of China Air Force. The study from the USA carried out for commercial aviation had 119 accidents with 245 instances of human error. This study carried out in Oman had a total of 40 aircraft accidents with 129 incidences. Variations were found between Oman, Taiwan and the USA at the levels of organisational influence and unsafe supervision. Seven HFACS categories showed significant differences between the three countries (p culture can have an impact on aviation safety. This study revealed that national culture plays a role in aircraft accidents related to human factors that cannot be disregarded.
Carroll, Molly J; Kapur, Arvinder; Felder, Mildred; Patankar, Manish S; Kreeger, Pamela K
2016-12-27
In ovarian cancer, a high ratio of anti-inflammatory M2 to pro-inflammatory M1 macrophages correlates with poor patient prognosis. The mechanisms driving poor tumor outcome as a result of the presence of M2 macrophages in the tumor microenvironment remain unclear and are challenging to study with current techniques. Therefore, in this study we utilized a micro-culture device previously developed by our lab to model concentrated paracrine signaling in order to address our hypothesis that interactions between M2 macrophages and ovarian cancer cells induce tumor cell proliferation. Using the micro-culture device, we determined that co-culture with M2-differentiated primary macrophages or THP-1 increased OVCA433 proliferation by 10-12%. This effect was eliminated with epidermal growth factor receptor (EGFR) or heparin-bound epidermal growth factor (HB-EGF) neutralizing antibodies and HBEGF expression in peripheral blood mononuclear cells from ovarian cancer patients was 9-fold higher than healthy individuals, suggesting a role for HB-EGF in tumor progression. However, addition of HB-EGF at levels secreted by macrophages or macrophage-conditioned media did not induce proliferation to the same extent, indicating a role for other factors in this process. Matrix metalloproteinase-9, MMP-9, which cleaves membrane-bound HB-EGF, was elevated in co-culture and its inhibition decreased proliferation. Utilizing inhibitors and siRNA against MMP9 in each population, we determined that macrophage-secreted MMP-9 released HB-EGF from macrophages, which increased MMP9 in OVCA433, resulting in a positive feedback loop to drive HB-EGF release and increase proliferation in co-culture. Identification of multi-cellular interactions such as this may provide insight into how to most effectively control ovarian cancer progression.
Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes
International Nuclear Information System (INIS)
Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.
2008-01-01
Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated
Energy Technology Data Exchange (ETDEWEB)
Roese, K. [Technische Univ. Kaiserslautern (Germany). AG Nutzergerechte Produktentwicklung
2006-07-01
Cross-cultural Human-Machine-Systems are one key factor for success in the global market era. Nowadays the machine producer have to offer their products worldwide. With the export to other nations they have to consider on the user behaviour in these other cultures. The analysis of cross-cultural user requirements and their integration into the product development process is a real chance to cape with these challenge. This paper describe two aspects of cross-cultural user aspects. It gives an impression of the complex and sometimes unknown cultural influencing factors and their impact on Human-Machine-System-Engineering. (orig.)
Culture in Animals: The Case of a Non-human Primate Culture of Low Aggression and High Affiliation
Sapolsky, Robert M.
2006-01-01
Philosophers often consider what it is that makes individuals human. For biologists considering the same, the answer is often framed in the context of what are the key differences between humans and other animals. One vestige of human uniqueness still often cited by anthropologists is culture. However, this notion has been challenged in recent…
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Chen, Z Y; Li, D L; Duan, X D; Peng, D Z
2016-09-20
To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each
Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M
1992-07-01
Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-01-01
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...
Physiology and culture of the human blastocyst.
Gardner, David K; Lane, Michelle; Schoolcraft, William B
2002-01-01
The human embryo undergoes many changes in physiology during the first 4 days of life as it develops and differentiates from a fertilized oocyte to the blastocyst stage. Concomitantly, the embryo is exposed to gradients of nutrients within the female reproductive tract and exhibits changes in its own nutrient requirements and utilization. Determining the nature of such nutrient gradients in the female tract and the changing requirements of the embryo has facilitated the formulation of stage-specific culture media designed to support embryo development throughout the preimplantation period. Resultant implantation rates attained with the culture and transfer of human blastocysts are higher than those associated with the transfer of cleavage stage embryos to the uterus. Such increases in implantation rates have facilitated the establishment of high pregnancy rates while reducing the number of embryos transferred. With the introduction of new scoring systems for the blastocyst and the non-invasive assessment of metabolic activity of individual embryos, it should be possible to move to single blastocyst transfer for the majority of patients.
Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi
2009-11-01
Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.
TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells
International Nuclear Information System (INIS)
Shimada, S.; Katz, S.I.
1985-01-01
A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity
International Nuclear Information System (INIS)
Ansel, J.C.; Luger, T.A.; Green, I.
1983-01-01
Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies
Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks
Directory of Open Access Journals (Sweden)
Sang Wha Kim
2014-03-01
Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.
Human rights for women: battles of culture and power.
Poulsen, K
1995-06-01
In Africa, nongovernmental organizations (NGOs) focussing on human rights have mushroomed during the past 10-15 years, and, with several of these organizations run by and for women, it is possible to find free legal aid for women in almost every capital city. The collapse of the extended family and, thus, the framework for customary law has meant that women are faced with problems of maintenance and widows with problems of inheritance. Customary law and the protection it afforded women and children has also been weakened by a poverty-driven shift in urban areas from a focus on community support to a focus on individual survival. The vacuum left by this change in legal and social structure is being filled by the human rights NGOs. Paradoxically, in the face of such change, a static, communal, and neutral concept of "culture" was held out by African state representatives at the 1993 UN Conference on Human Rights to justify their opposition to the acceptance of the crosscultural legitimacy of human rights, especially for women. While these arguments were being aired at the Conference, African NGOs were vigorously using examples of the marginalization of women to promote the opposite view. The most important aspect of these conflicting views is which group has the most power and resources to voice its interpretation of the situation. With most African countries governed by a dual system of laws, customary law and common or civil law (left over from colonialism), human rights groups are working to instill human rights principles into common law through the ratification of international conventions. Thus, persons in need could be viewed not as victims but as individuals entitled to enforceable and universal rights. Misuse of the term "culture" can marginalize women even as it is being promoted as a protective device for women. A more useful view of culture is as something which transcends traditional boundaries and locates people and institutions in the global community
Generation of organotypic raft cultures from primary human keratinocytes.
Anacker, Daniel; Moody, Cary
2012-02-22
The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as
A Culture Of Health And Human Rights.
Mariner, Wendy K; Annas, George J
2016-11-01
A culture of health can be seen as a social norm that values health as the nation's priority or as an appeal to improve the social determinants of health. Better population health will require changing social and economic policies. Effective changes are unlikely unless health advocates can leverage a framework broader than health to mobilize political action in collaboration with non-health sector advocates. We suggest that human rights-the dominant international source of norms for government responsibilities-provides this broader framework. Human rights, as expressed in the Universal Declaration of Human Rights and enforceable treaties, require governments to assure their populations nondiscriminatory access to food, water, education, work, social security, and a standard of living adequate for health and well-being. The policies needed to realize human rights also improve population health, well-being, and equity. Aspirations for human rights are strong enough to endure beyond inevitable setbacks to specific causes. Project HOPE—The People-to-People Health Foundation, Inc.
International Nuclear Information System (INIS)
Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.
2010-01-01
Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.
Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis
Directory of Open Access Journals (Sweden)
Wen-Hung Chung
2010-01-01
Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.
International Nuclear Information System (INIS)
Ji Xiaoqin; Ji Jiang; Chen Yongbing; Shan Fang; Lu Xueguan
2014-01-01
Objective: To investigate the effect of human lung cancer-associated fibroblasts (CAF) on the radiosensitivity of lung cancer cells when CAF is placed in direct contact co-culture with lung cancer cells. Methods: Human lung CAF was obtained from fresh human lung adenocarcinoma tissue specimens by primary culture and subculture and was then identified by immunofluorescence staining. The CAF was placed in direct contact co-culture with lung cancer A 549 and H 1299 cells, and the effects of CAF on the radiosensitivity of A 549 and H 1299 cells were evaluated by colony-forming assay. Results: The human lung CAF obtained by adherent culture could stably grow and proliferate, and it had specific expression of α-smooth muscle actin, vimentin, and fibroblast activation protein,but without expression of cytokeratin-18. The plating efficiency (PE, %) of A 549 cells at 0 Gy irradiation was (20.0 ± 3.9)% when cultured alone versus (32.3 ± 5.5)% when co-cultured with CAF (t=3.16, P<0.05), and the PE of H 1299 cells at 0 Gy irradiation was (20.6 ± 3.1)% when cultured alone versus (35.2 ± 2.3)% when co-cultured with CAF (t=6.55, P<0.05). The cell survival rate at 2 Gy irradiation (SF 2 ) of A 549 cells was 0.727 ±0.061 when cultured alone versus 0.782 ± 0.089 when co-cultured with CAF (t=0.88, P>0.05), and the SF 2 of H 1299 cells was 0.692 ±0.065 when cultured alone versus 0.782 ± 0.037 when co-cultured with CAF (t=2.08, P>0.05). The protection enhancement ratios of human lung CAF for A 549 cells and H 1299 cells were 1.29 and 1.25, respectively. Conclusions: Human lung CAF reduces the radiosensitivity of lung cancer cells when placed in direct contact co-culture with them, and the radioprotective effect may be attributed to CAF promoting the proliferation of lung cancer cells. (authors)
Influence of organizational culture on human error
International Nuclear Information System (INIS)
Friedlander, M.A.; Evans, S.A.
1996-01-01
Much has been written in contemporary business literature during the last decade describing the role that corporate culture plays in virtually every aspect of a firm's success. In 1990 Kotter and Heskett wrote, open-quotes We found that firms with cultures that emphasized all of the key managerial constituencies (customers, stockholders, and employees) and leadership from managers at all levels out-performed firms that did not have those cultural traits by a huge margin. Over an eleven year period, the former increased revenues by an average of 682 percent versus 166 percent for the latter, expanded their workforce by 282 percent versus 36 percent, grew their stock prices by 901 percent versus 74 percent, and improved their net incomes by 756 percent versus 1 percent.close quotes Since the mid-1980s, several electric utilities have documented their efforts to undertake strategic culture change. In almost every case, these efforts have yielded dramatic improvements in the open-quotes bottom-lineclose quotes operational and financial results (e.g., Western Resources, Arizona Public Service, San Diego Gas ampersand Electric, and Electricity Trust of South Australia). Given the body of evidence that indicates a relationship between high-performing organizational culture and the financial and business success of a firm, Pennsylvania Power ampersand Light Company undertook a study to identify the relationship between organizational culture and the frequency, severity, and nature of human error at the Susquehanna Steam Electric Station. The underlying proposition for this asssessment is that organizational culture is an independent variable that transforms external events into organizational performance
Towards cultural materialism in the medical humanities: the case of blood rejuvenation
2018-01-01
This paper argues for an approach within the medical humanities that draws on the theoretical legacy of cultural materialism as a framework for reading cultural practices and their relationship to the social and economic order. It revisits the origins and development of cultural materialism in cultural studies and literary studies between the 1970s and 1990s and considers how, with adaptation, this methodology might facilitate ideological criticism focused on material formations of health, disease and the human body. I outline three key characteristics of a medicocultural materialist approach along these lines: (a) interdisciplinary work on a broad range of medical and cultural sources, including those drawn from ‘popular’ forms of culture; (b) the combination of historicist analysis with scrutiny of present-day contexts; (c) analyses that engage with political economy perspectives and/or the work of medical sociology in this area. The subsequent sections of the paper employ a medicocultural materialist approach to examine conjectural understandings of, and empirical investigations into, the capacity of transfused human blood to rejuvenate the ageing body. I trace textual faultlines that expose the structures of power which inform the movement of blood between bodies in ‘medical gothic’ fictions from the 19th-century fin de siècle, including Mary Elizabeth Braddon's ‘Good Lady Ducayne’ (1896) and Bram Stoker's Dracula (1897). I conclude with a critique of biomedical innovations in blood rejuvenation in the era of medical neoliberalism, before considering the potential applications of medicocultural materialism to other topics within the field of the medical humanities. PMID:28495908
Directory of Open Access Journals (Sweden)
Sabine Conrad
2014-01-01
Full Text Available This study aimed to provide a molecular signature for enriched adult human stem/progenitor spermatogonia during short-term (<2 weeks and long-term culture (up to more than 14 months in comparison to human testicular fibroblasts and human embryonic stem cells. Human spermatogonia were isolated by CD49f magnetic activated cell sorting and collagen−/laminin+ matrix binding from primary testis cultures obtained from ten adult men. For transcriptomic analysis, single spermatogonia-like cells were collected based on their morphology and dimensions using a micromanipulation system from the enriched germ cell cultures. Immunocytochemical, RT-PCR and microarray analyses revealed that the analyzed populations of cells were distinct at the molecular level. The germ- and pluripotency-associated genes and genes of differentiation/spermatogenesis pathway were highly expressed in enriched short-term cultured spermatogonia. After long-term culture, a proportion of cells retained and aggravated the “spermatogonial” gene expression profile with the expression of germ and pluripotency-associated genes, while in the majority of long-term cultured cells this molecular profile, typical for the differentiation pathway, was reduced and more genes related to the extracellular matrix production and attachment were expressed. The approach we provide here to study the molecular status of in vitro cultured spermatogonia may be important to optimize the culture conditions and to evaluate the germ cell plasticity in the future.
The peanut lectin-binding glycoproteins of human epidermal keratinocytes
International Nuclear Information System (INIS)
Morrison, A.I.; Keeble, S.; Watt, F.M.
1988-01-01
The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification
Inhibition of epidermal cell proliferation by borderline rays
Energy Technology Data Exchange (ETDEWEB)
Born, W [Freiburg Univ.; Daikeler, G
1976-08-01
Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.
Directory of Open Access Journals (Sweden)
Z. Liu
2010-05-01
Full Text Available Epithelium, a highly dynamic system, plays a key role in the homeostasis of the intestine. However, thus far a human intestinal epithelial cell line has not been established in many countries. Fetal tissue was selected to generate viable cell cultures for its sterile condition, effective generation, and differentiated character. The purpose of the present study was to culture human intestinal epithelial cells by a relatively simple method. Thermolysin was added to improve the yield of epithelial cells, while endothelin-3 was added to stimulate their growth. By adding endothelin-3, the achievement ratio (viable cell cultures/total cultures was enhanced to 60% of a total of 10 cultures (initiated from 8 distinct fetal small intestines, allowing the generation of viable epithelial cell cultures. Western blot, real-time PCR and immunofluorescent staining showed that cytokeratins 8, 18 and mouse intestinal mucosa-1/39 had high expression levels in human intestinal epithelial cells. Differentiated markers such as sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV also showed high expression levels in human intestinal epithelial cells. Differentiated human intestinal epithelial cells, with the expression of surface markers (cytokeratins 8, 18 and mouse intestinal mucosa-1/39 and secretion of cytokines (sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV, may be cultured by the thermolysin and endothelin-3 method and maintained for at least 20 passages. This is relatively simple, requiring no sophisticated techniques or instruments, and may have a number of varied applications.
Epidermal Growth Factor Receptor in Pancreatic Cancer
International Nuclear Information System (INIS)
Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.
2011-01-01
Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer
Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis
Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin
2016-01-01
Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054
Directory of Open Access Journals (Sweden)
Solange Maria Alves
2016-07-01
Full Text Available This text is fruit of studies, reflections and dialogues developed with graduate and post-graduate students inteaching and research coordinated by me, allocated in the research group: Human Development, Culture and Education, in rows : Language, Learning and Development and Imaginary Production and Creative Education. Over several years, the task of educational coordinating processes of teaching and research, allowed the construction of synthesis (always provisional, presented here. Having as a foundation the historic-cultural theory of Vygotsky and collaborators, the text reflects about human development, cognition and school education, pursuing the thesis that cognition is human development. To do this, search, in theoretical foundations of historical-cultural conception, the key elements that explain the process by which the biological becomes socio-historical, it takes up more carefully in the explicit about Vygotsky translates as plans or genetic fields of human development, increase the reflection articulating the categories: labor and language.
Directory of Open Access Journals (Sweden)
Hu Liang Cai
2016-06-01
Full Text Available Introduction: the objective of this paper is to deeply and clearly explain the internationalisation of higher education from the aspect of the integration of human being with urban cultural space. Materials and Methods: the methods used in the research are mainly analytical and descriptive ones enabling to show how the integration of human being and urban cultural space promote and influence the internationalisation of higher education. Results: the motivation for the internationalisation of higher education is closely interrelated with that of urbanisation. Besides the economic and political incentives, modern urban culture, caused by globalisation, also plays a very important role in encouraging higher education internationalisation. Discussion and Conclusions: the appearance of higher education internationalisation is mediated by the alteration of the existing environment of urban culture space against the background of city internationalisation. Human beings’ need for self-assurance in urban culture space helps to stimulate the internationalisation of higher education, and human beings promote the development of modern culture space and their separation in urban culture space accelerates the development of higher education. From the perspective of higher education internationalisation, to sort out the cultural motivation for higher education and find its suitable form for the city’s internationalisation is crucial for adjusting the orientation and guaranteeing the efficacy of higher education internationalisation. From the aspect of human beings’ development, the separation between urban space and human beings caused by the city’s ongoing internationalisation is a pressing problem to be solved. From the aspect of the construction of urban culture space, as an important means of retaining human beings’ equilibrium, urban culture promotes the internationalisation of higher education.
Peh, Gary S L; Toh, Kah-Peng; Ang, Heng-Pei; Seah, Xin-Yi; George, Benjamin L; Mehta, Jodhbir S
2013-05-03
Global shortage of donor corneas greatly restricts the numbers of corneal transplantations performed yearly. Limited ex vivo expansion of primary human corneal endothelial cells is possible, and a considerable clinical interest exists for development of tissue-engineered constructs using cultivated corneal endothelial cells. The objective of this study was to investigate the density-dependent growth of human corneal endothelial cells isolated from paired donor corneas and to elucidate an optimal seeding density for their extended expansion in vitro whilst maintaining their unique cellular morphology. Established primary human corneal endothelial cells were propagated to the second passage (P2) before they were utilized for this study. Confluent P2 cells were dissociated and seeded at four seeding densities: 2,500 cells per cm2 ('LOW'); 5,000 cells per cm2 ('MID'); 10,000 cells per cm2 ('HIGH'); and 20,000 cells per cm2 ('HIGH(×2)'), and subsequently analyzed for their propensity to proliferate. They were also subjected to morphometric analyses comparing cell sizes, coefficient of variance, as well as cell circularity when each culture became confluent. At the two lower densities, proliferation rates were higher than cells seeded at higher densities, though not statistically significant. However, corneal endothelial cells seeded at lower densities were significantly larger in size, heterogeneous in shape and less circular (fibroblastic-like), and remained hypertrophic after one month in culture. Comparatively, cells seeded at higher densities were significantly homogeneous, compact and circular at confluence. Potentially, at an optimal seeding density of 10,000 cells per cm2, it is possible to obtain between 10 million to 25 million cells at the third passage. More importantly, these expanded human corneal endothelial cells retained their unique cellular morphology. Our results demonstrated a density dependency in the culture of primary human corneal endothelial
International Nuclear Information System (INIS)
Aslanova, Afag; Takagi, Ryo; Yamato, Masayuki; Okano, Teruo; Yamamoto, Masakazu
2015-01-01
With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen
Energy Technology Data Exchange (ETDEWEB)
Aslanova, Afag [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Takagi, Ryo; Yamato, Masayuki; Okano, Teruo [Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Yamamoto, Masakazu, E-mail: yamamoto.ige@twmu.ac.jp [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan)
2015-05-01
With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen
Directory of Open Access Journals (Sweden)
Sabrina Oliveira
2012-01-01
Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.
The use of animal tissues alongside human tissue: Cultural and ethical considerations.
Kaw, Anu; Jones, D Gareth; Zhang, Ming
2016-01-01
Teaching and research facilities often use cadaveric material alongside animal tissues, although there appear to be differences in the way we handle, treat, and dispose of human cadaveric material compared to animal tissue. This study sought to analyze cultural and ethical considerations and provides policy recommendations on the use of animal tissues alongside human tissue. The status of human and animal remains and the respect because of human and animal tissues were compared and analyzed from ethical, legal, and cultural perspectives. The use of animal organs and tissues is carried out within the context of understanding human anatomy and function. Consequently, the interests of human donors are to be pre-eminent in any policies that are enunciated, so that if any donors find the presence of animal remains unacceptable, the latter should not be employed. The major differences appear to lie in differences in our perceptions of their respective intrinsic and instrumental values. Animals are considered to have lesser intrinsic value and greater instrumental value than humans. These differences stem from the role played by culture and ethical considerations, and are manifested in the resulting legal frameworks. In light of this discussion, six policy recommendations are proposed, encompassing the nature of consent, respect for animal tissues as well as human remains, and appropriate separation of both sets of tissues in preparation and display. © 2015 Wiley Periodicals, Inc.
Giant epidermal inclusion cyst in the male breast: A case report
Energy Technology Data Exchange (ETDEWEB)
KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)
2017-03-15
Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.
Napoli, Alessandro; Obeid, Iyad
2016-03-01
Electrical activity in embryonic brain tissue has typically been studied using Micro Electrode Array (MEA) technology to make dozens of simultaneous recordings from dissociated neuronal cultures, brain stem cell progenitors, or brain slices from fetal rodents. Although these rodent neuronal primary culture electrical properties are mostly investigated, it has not been yet established to what extent the electrical characteristics of rodent brain neuronal cultures can be generalized to those of humans. A direct comparison of spontaneous spiking activity between rodent and human primary neurons grown under the same in vitro conditions using MEA technology has never been carried out before and will be described in the present study. Human and rodent dissociated fetal brain neuronal cultures were established in-vitro by culturing on a glass grid of 60 planar microelectrodes neurons under identical conditions. Three different cultures of human neurons were produced from tissue sourced from a single aborted fetus (at 16-18 gestational weeks) and these were compared with seven different cultures of embryonic rat neurons (at 18 gestational days) originally isolated from a single rat. The results show that the human and rodent cultures behaved significantly differently. Whereas the rodent cultures demonstrated robust spontaneous activation and network activity after only 10 days, the human cultures required nearly 40 days to achieve a substantially weaker level of electrical function. These results suggest that rat neuron preparations may yield inferences that do not necessarily transfer to humans. © 2015 Wiley Periodicals, Inc.
Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H
2014-10-01
Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.
Sugiyama, Michelle Scalise
2003-12-01
In 1966, Laura Bohannan wrote her classic essay challenging the supposition that great literary works speak to universal human concerns and conditions and, by extension, that human nature is the same everywhere. Her evidence: the Tiv of West Africa interpret Hamlet differently from Westerners. While Bohannan's essay implies that cognitive universality and cultural variation are mutually exclusive phenomena, adaptationist theory suggests otherwise. Adaptive problems ("the human condition") and cognitive adaptations ("human nature") are constant across cultures. What differs between cultures is habitat: owing to environmental variation, the means and information relevant to solving adaptive problems differ from place to place. Thus, we find differences between cultures not because human minds differ in design but largely because human habitats differ in resources and history. On this view, we would expect world literature to express both human universals and cultural particularities. Specifically, we should expect to find literary universality at the macro level (e.g., adaptive problems, cognitive adaptations) and literary variation at the micro level (e.g., local solutions to adaptive problems).
Rasmussen, Cathy A; Allen-Hoffmann, B Lynn
2012-04-01
For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.
Cell sources for in vitro human liver cell culture models
Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny
2016-01-01
In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro. However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro. Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595
Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2016-03-01
The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Human autologous serum as a substitute for fetal bovine serum in human Schwann cell culture.
Directory of Open Access Journals (Sweden)
Parisa Goodarzi
2014-04-01
Full Text Available Nowadays, cell -based and tissue engineered products have opened new horizons in treatment of incurable nervous system disorders. The number of studies on the role of Schwann cells (SC in treating nervous disorders is higher than other cell types. Different protocols have been suggested for isolation and expansion of SC which most of them have used multiple growth factors, mitogens and fetal bovine sera (FBS in culture medium. Because of potential hazards of animal-derived reagents, this study was designed to evaluate the effect of replacing FBS with human autologous serum (HAS on SC's yield and culture parameters. Samples from 10 peripheral nerve biopsies were retrieved and processed under aseptic condition. The isolated cells cultured in FBS (1st group or autologous serum (2nd group. After primary culture the cells were seeded at 10000 cell/cm2 in a 12 wells cell culture plate for each group. At 100% confluency, the cell culture parameters (count, viability, purity and culture duration of 2 groups were compared using paired t-test. The average donors' age was 35.80 (SD=13.35 and except for 1 sample the others cultured successfully. In first group, the averages of cell purity, viability and culture duration were 97% (SD=1.32, 97/33% (SD=1.22 and 11.77 (SD=2.58 days respectively. This parameters were 97.33% (SD=1.00, 97.55% (SD=1.33 and 10.33 days (SD=1.65 in second group. The difference of cell count, purity and viability were not significant between 2 groups (P>0.05. The cells of second group reached to 100% confluency in shorter period of time (P=0.03. The results of this study showed that autologous serum can be a good substitute for FBS in human SC culture. This can reduce the costs and improve the safety of cell product for clinical application.
Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk
2010-02-01
Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.
Czech Academy of Sciences Publication Activity Database
Kunová, M.; Matulka, K.; Eiselleová, L.; Trčková, P.; Hampl, Aleš; Dvořák, Petr
2010-01-01
Roč. 21, - (2010), s. 676-686 ISSN 1472-6483 Grant - others:GA MŠk(CZ) LC06077; EC FP6(XE) LSHG-CT-2006-018739 Program:LC Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : animal protein-free culture * high-density culture * human embryonic stem cells Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.285, year: 2010
Explant culture of human peripheral lung. I. Metabolism of benzo[alpha]pyrene
DEFF Research Database (Denmark)
Stoner, G.D.; Harris, C.C.; Autrup, Herman
1978-01-01
the predominant alveolar epithelial cell type. Lamellar inclusion bodies were released from the type 2 cells and accumulated in the alveolar spaces. The metabolism of benzo[alpha]pyrene (BP) in human lung explants cultured for up to 7 days was investigated. Human lung explants had measurable aryl hydrocarbon......Human lung explants have been maintained in vitro for a period of 25 days. Autoradiographic studies indicated that the broncholar epithelial cells, type 2 alveolar epithelial cells, and stromal fibroblasts incorporated 3H-thymidine during the culture. After 7 to 10 days, type 2 cells were...... hydroxylase activity and could metabolize BP into forms that were bound to cellular DNA and protein. Peripheral lung had significantly lower aryl hydrocarbon hydroxylase activity than cultured bronchus but both tissues had similar binding levels of BP to DNA. Radioautographic studies indicated that all cell...
Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.
LENUS (Irish Health Repository)
Walsh, Marie-Therese
2011-11-01
Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
Reciprocity, culture and human cooperation: previous insights and a new cross-cultural experiment.
Gächter, Simon; Herrmann, Benedikt
2009-03-27
Understanding the proximate and ultimate sources of human cooperation is a fundamental issue in all behavioural sciences. In this paper, we review the experimental evidence on how people solve cooperation problems. Existing studies show without doubt that direct and indirect reciprocity are important determinants of successful cooperation. We also discuss the insights from a large literature on the role of peer punishment in sustaining cooperation. The experiments demonstrate that many people are 'strong reciprocators' who are willing to cooperate and punish others even if there are no gains from future cooperation or any other reputational gains. We document this in new one-shot experiments, which we conducted in four cities in Russia and Switzerland. Our cross-cultural approach allows us furthermore to investigate how the cultural background influences strong reciprocity. Our results show that culture has a strong influence on positive and in especially strong negative reciprocity. In particular, we find large cross-cultural differences in 'antisocial punishment' of pro-social cooperators. Further cross-cultural research and experiments involving different socio-demographic groups document that the antisocial punishment is much more widespread than previously assumed. Understanding antisocial punishment is an important task for future research because antisocial punishment is a strong inhibitor of cooperation.
Chronic treatment with epidermal growth factor induces growth of the rat ventral prostate
DEFF Research Database (Denmark)
Tørring, N; Jensen, L V; Wen, J G
2001-01-01
the hyperplastic growth phase of the prostate in newborn rats.MATERIAL AND METHODS: Newborn rats were treated for 8 weeks with EGF (150 microg/kg body weight per day), administered as daily subcutaneous injections. Sections of the prostate tissue were examined by a stereological technique to determine tissue......OBJECTIVE: The epidermal growth factor (EGF) system is expressed in the rat prostate, and growth factors from this system induce proliferation in prostate epithelial and stromal cell cultures. The aim of the study was to investigate the possible growth-promoting effects of the system during...... of the prostate epithelium, the stroma and the lumen following EGF treatment, in a pattern resembling physiological growth of the ventral prostate. A significant correlation (r = 0.78, p
Pijuan-Galitó, Sara; Tamm, Christoffer; Schuster, Jens; Sobol, Maria; Forsberg, Lars; Merry, Catherine L. R.; Annerén, Cecilia
2016-01-01
Reliable, scalable and time-efficient culture methods are required to fully realize the clinical and industrial applications of human pluripotent stem (hPS) cells. Here we present a completely defined, xeno-free medium that supports long-term propagation of hPS cells on uncoated tissue culture plastic. The medium consists of the Essential 8 (E8) formulation supplemented with inter-α-inhibitor (IαI), a human serum-derived protein, recently demonstrated to activate key pluripotency pathways in mouse PS cells. IαI efficiently induces attachment and long-term growth of both embryonic and induced hPS cell lines when added as a soluble protein to the medium at seeding. IαI supplementation efficiently supports adaptation of feeder-dependent hPS cells to xeno-free conditions, clonal growth as well as single-cell survival in the absence of Rho-associated kinase inhibitor (ROCKi). This time-efficient and simplified culture method paves the way for large-scale, high-throughput hPS cell culture, and will be valuable for both basic research and commercial applications. PMID:27405751
Cornelia Roux on Religion, Culture and Human Rights
African Journals Online (AJOL)
She identified human rights values as common denominators within cultural and religious spaces of fear and resistance. She also focused on interreligious and intercultural dialogue in education as a means to enhance empathetic and caring interactions with others. In recent years, Roux has initiated three projects: The first ...
Fogarty, Laurel; Wakano, Joe Yuichiro; Feldman, Marcus W; Aoki, Kenichi
2017-03-01
The forces driving cultural accumulation in human populations, both modern and ancient, are hotly debated. Did genetic, demographic, or cognitive features of behaviorally modern humans (as opposed to, say, early modern humans or Neanderthals) allow culture to accumulate to its current, unprecedented levels of complexity? Theoretical explanations for patterns of accumulation often invoke demographic factors such as population size or density, whereas statistical analyses of variation in cultural complexity often point to the importance of environmental factors such as food stability, in determining cultural complexity. Here we use both an analytical model and an agent-based simulation model to show that a full understanding of the emergence of behavioral modernity, and the cultural evolution that has followed, depends on understanding and untangling the complex relationships among culture, genetically determined cognitive ability, and demographic history. For example, we show that a small but growing population could have a different number of cultural traits from a shrinking population with the same absolute number of individuals in some circumstances.
Enhanced casein kinase II activity in human tumour cell cultures
DEFF Research Database (Denmark)
Prowald, K; Fischer, H; Issinger, O G
1984-01-01
Casein kinase II (CKII) activity is enhanced as much as 2-3 fold in established and 4-5-fold in transformed human cell lines when compared to that of fibroblasts and primary human tumour cell cultures where CKII activity never exceeded a basic level. The high activity of CKII in transformed cells...
EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...
African Journals Online (AJOL)
Administrator
stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...
Exploring cultural factors in human-robot interaction : A matter of personality?
Weiss, Astrid; Evers, Vanessa
2011-01-01
This paper proposes an experimental study to investigate task-dependence and cultural-background dependence of the personality trait attribution on humanoid robots. In Human-Robot Interaction, as well as in Human-Agent Interaction research, the attribution of personality traits towards intelligent
International Nuclear Information System (INIS)
Band, V.; Zajchowski, D.; Kulesa, V.; Sager, R.
1990-01-01
Human papilloma virus (HPV) types 16 and 18 are most commonly associated with cervical carcinoma in patients and induce immortalization of human keratinocytes in culture. HPV has not been associated with breast cancer. This report describes the immortalization of normal human mammary epithelial cells (76N) by plasmid pHPV18 or pHPV16, each containing the linearized viral genome. Transfectants were grown continuously for more than 60 passages, whereas 76N cells senesce after 18-20 passages. The transfectants also differ from 76N cells in cloning in a completely defined medium called D2 and growing a minimally supplemented defined medium (D3) containing epidermal growth factor. All transfectant tested contain integrated HPV DNA, express HPV RNA, and produce HPV E7 protein. HPV transfectants do not form tumors in a nude mouse assay. It is concluded that products of the HPV genome induce immortalization of human breast epithelial cells an