WorldWideScience

Sample records for culture generated cytotoxicity

  1. Role of IL-2 and interferon in the generation of natural cytotoxic activity in influenza virus-stimulated PBL cultures: analysis with the use of prednisolone

    NARCIS (Netherlands)

    Braakman, E.; Treep-van Leeuwen, P.; ten Berge, R. J.; Schellekens, P. T.; Lucas, C. J.

    1988-01-01

    We have examined the role of interleukin 2, interferon-gamma and interferon-alpha in the generation of natural cytotoxic (NC) activity and cytotoxic T-lymphocyte (CTL) activity in peripheral blood lymphocyte cultures stimulated with influenza virus, using the immunosuppressive effects of

  2. Bicarbonate Plays a Critical Role in the Generation of Cytotoxicity during SIN-1 Decomposition in Culture Medium

    Directory of Open Access Journals (Sweden)

    Kyo Shirai

    2012-01-01

    Full Text Available 3-Morpholinosydnonimine (SIN-1 is used as a donor of peroxynitrite (ONOO− in various studies. We demonstrated, however, that, the cell-culture medium remains cytotoxic to PC12 cells even after almost complete SIN-1 decomposition, suggesting that reaction product(s in the medium, rather than ONOO−, exert cytotoxic effects. Here, we clarified that significant cytotoxicity persists after SIN-1 decomposes in bicarbonate, a component of the culture medium, but not in NaOH. Cytotoxic SIN-1-decomposed bicarbonate, which lacks both oxidizing and nitrosating activities, degrades to innocuous state over time. The extent of SIN-1 cytotoxicity, irrespective of its fresh or decomposed state, appears to depend on the total number of initial SIN-1 molecules per cell, rather than its concentration, and involves oxidative/nitrosative stress-related cell damage. These results suggest that, despite its low abundance, the bicarbonate-dependent cytotoxic substance that accumulates in the medium during SIN-1 breakdown is the cytotoxic entity of SIN-1.

  3. GENERATION OF CYTOTOXIC LYMPHOCYTES IN MIXED LYMPHOCYTE REACTIONS

    Science.gov (United States)

    Forman, James; Möller, Göran

    1973-01-01

    Generation of cytotoxic effector cells by a unidirectional mixed lymphocyte reaction (MLR) in the mouse H-2 system was studied using labeled YAC (H-2a) leukemia cells as targets. The responding effector cell displayed a specific cytotoxic effect against target cells of the same H-2 genotype as the stimulating cell population. Killing of syngeneic H-2 cells was not observed, even when the labeled target cells were "innocent bystanders" in cultures where specific target cells were reintroduced. Similar results were found with spleen cells taken from mice sensitized in vivo 7 days earlier. The effector cell was not an adherent cell and was not activated by supernatants from MLR. The supernatants were not cytotoxic by themselves. When concanavalin A or phytohemagglutinin was added to the cytotoxic test system, target and effector cells were agglutinated. Under these conditions, killing of H-2a target cells was observed in mixed cultures where H-2a lymphocytes were also the effector cells. These findings indicate that specifically activated, probably thymus-derived lymphocytes, can kill nonspecifically once they have been activated and providing there is close contact between effector and target cells. Thus, specificity of T cell killing appears to be restricted to recognition and subsequent binding to the targets, the actual effector phase being nonspecific. PMID:4269560

  4. Cytotoxicity of extracts of spices to cultured cells.

    Science.gov (United States)

    Unnikrishnan, M C; Kuttan, R

    1988-01-01

    The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

  5. Proteolytically modified human beta 2-microglobulin augments the specific cytotoxic activity in murine mixed lymphocyte culture

    DEFF Research Database (Denmark)

    Nissen, Mogens Holst; Claësson, M H

    1987-01-01

    the endogenous production of interleukin 2 in the MLC culture; monoclonal antibody which reacts with both the native beta 2-m and M-beta 2-m molecule blocks the augmentation of cytotoxic T lymphocyte production induced by M-beta 2-m; murine as well as human MLC responder cells can proteolytically modify native......A proteolytically modified form of beta 2-microglobulin (beta 2-m) present in the serum of patients suffering from autoimmune, immunodeficient diseases and cancer has been reported in the literature. In the present study we show that human beta 2-m as well as the proteolytically modified human form...... (M-beta 2-m) bind to murine lymphocytes expressing H-2 class I antigens; M-beta 2-m, when added at day 0 and 1 of culture in nanomolar concentrations to a one-way murine allogeneic mixed lymphocyte culture (MLC) augments the generation of specific cytotoxic T lymphocytes; M-beta 2-m increases...

  6. Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.

    Directory of Open Access Journals (Sweden)

    Song-I Chun

    Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.

  7. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  8. Oxcarbazepine-induced cytotoxicity and genotoxicity in human lymphocyte cultures with or without metabolic activation.

    Science.gov (United States)

    Atlı Şekeroğlu, Zülal; Kefelioğlu, Haluk; Kontaş Yedier, Seval; Şekeroğlu, Vedat; Delmecioğlu, Berrin

    2017-03-01

    There has been considerable debate about the relationship between epilepsy and cancer. Oxcarbazepine (OXC) is used for treating certain types of seizures in patients with epilepsy. There have been no detailed investigations about genotoxicity of OXC and its metabolites. Therefore, the aim of this study is to investigate the cytotoxic and genotoxic effects of OXC and its metabolites on cultured human lymphocytes. The cytotoxicity and genotoxicity of OXC on human peripheral blood lymphocytes were examined in vitro by sister chromatid exchange (SCE), chromosomal aberration (CA) and micronucleus (MN) tests. Cultures were treated with 125, 250 and 500 μg/ml of OXC in the presence (3 h treatment) and absence (24 h and 48 h treatment) of a metabolic activator (S9 mix). Dimethyl sulfoxide (DMSO) was used as a solvent control. OXC showed cytotoxic activities due to significant decreases in mitotic index (MI), proliferation index (PI) and nuclear division index (NDI) in the absence of S9 mix when compared with solvent control. Metabolites of OXC also significantly reduced MI and PI in cultures with S9 mix. OXC significantly increased the CAs, aberrant cells, SCE and MN values in the presence and absence of S9 mix. Our results indicated that both OXC and its metabolites have cytotoxic, cytostatic and genotoxic potential on human peripheral blood lymphocyte cultures under the experimental conditions. Further studies are necessary to elucidate the relationship between cytotoxic, cytostatic and genotoxic effects, and to make a possible risk assessment in patients receiving therapy with this drug.

  9. Generation of specific antitumor cytotoxic T-lymphocytes in the monoculture

    International Nuclear Information System (INIS)

    Lupatov, A.Yu.; Brondz, B.D.

    1992-01-01

    A new model for the generation of specific antitumor cytotoxic T-lymphocytes (CTL) was proposed. In contrast to other models, it allows to generate effector CTL without immunization in vitro. For estimation of cytotoxic activity, chromium-51 release assay was used. It has been shown that effector CTL were absent in the lymph nodes in 1-fold as well as 2-fold immunization. Specific CTL were detected only after secondary immunization and subsequent cultivation in vitro. Effector cells had Thy1.2 + , Lyt2 + , L3T4 - phenotypes. Presence in vitro of exogenous IL-2 was needed for the generation of CTL against MX-11 sarcoma but not against EL4 lymphoma. The release of IL-2 from lymphomas cells could stimulate generation of the effector cells through activation of the endogenous production of IL-2, or due to some other factors

  10. Regulation of primary cytotoxic T lymphocyte responses generated during mixed leukocyte culture with H-2d identical Qa-1-disparate cells

    International Nuclear Information System (INIS)

    Huston, D.P.; Tavana, G.; Rich, R.R.; Gressens, S.E.

    1986-01-01

    Cytotoxic lymphocyte (CTL) responses are not usually generated during primary mixed leukocyte culture (MLC) with H-2 identical cells. Thus NZB mice are unusual in that their spleen cells do mount CTL responses during primary MLC with H-2d identical stimulator cells; the predominant target antigen for these NZB responses is Qa-1b. Considering the numerous immunoregulatory defects in NZB mice, we postulated that these NZB anti-Qa-1 primary CTL responses were due to an abnormality in T suppressor cell activity. Cellular interactions capable of suppressing NZB anti-Qa-1 primary CTL responses were investigated by using one-way and two-way MLC with spleen cells from NZB mice and other H-2d strains. Although H-2d identical one-way MLC with the use of NZB responders resulted in substantial CTL responses, only minimal CTL responses were detected from two-way MLC with the use of NZB spleen cells plus nonirradiated spleen cells from other H-2d mice. Thus the presence of non-NZB spleen cells in the two-way H-2d identical MLC prevented the generation of NZB CTL. Noncytotoxic mechanisms were implicated in the suppression of the NZB CTL responses during two-way MLC, because only minimal CTL activity was generated when NZB spleen cells were cultured with semiallogeneic, H-2d identical (e.g., NZB X BALB) F1 spleen cells. The observed suppression could be abrogated with as little as 100 rad gamma-irradiation to the non-NZB spleen cells. The phenotype of these highly radiosensitive spleen cells was Thy-1+, Lyt-1+, Lyt-2-, L3T4+. The functional presence of these cells in the spleens of semiallogeneic, H-2d identical F1 mice indicated that their deficiency in NZB mice was a recessive trait. These data suggest that NZB mice lack an L3T4+ cell present in the spleens of normal mice that is capable of suppressing primary anti-Qa-1 CTL responses

  11. Cytotoxic, genotoxic and cell-cycle disruptive effects of thio-dimethylarsinate in cultured human cells and the role of glutathione

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Takafumi [Laboratory of Toxicology, Faculty of Pharmaceutical Sciences, Teikyo University, Sagamiko, Kanagawa 229-0195 (Japan); Kita, Kayoko; Suzuki, Toshihide [Laboratory of Toxicology, Faculty of Pharmaceutical Sciences, Teikyo University, Sagamiko, Kanagawa 229-0195 (Japan); Rumpler, Alice; Goessler, Walter; Francesconi, Kevin A [Karl-Franzens University Graz, Institute of Chemistry-Analytical Chemistry, Universitaetsplatz 1, 8010 Graz (Austria)

    2008-04-01

    Thio-dimethylarsinate (thio-DMA), a recently discovered urine metabolite in humans, was investigated for its cytotoxic, genotoxic and cell-cycle disruptive effects in the cultured human hepatocarcinoma cell line, HepG2, and Syrian hamster embryo cells. In addition, the role of glutathione (GSH) on the cytotoxic effects of thio-DMA was investigated in terms of the effects of GSH depletion and the effects of exogenously added GSH. LC{sub 50} values of arsenicals for cells incubated for 48 h were 0.026 mM for thio-DMA, 0.343 mM for DMA and 3.66 mM for dithio-DMA. Depletion of cell GSH reduced the cytotoxic effects of thio-DMA. The cytotoxic effects of 0.02 mM and 0.05 mM thio-DMA were enhanced markedly when used in combination with 1 to 3 mM GSH, but decreased again when combined with 5 mM GSH. These results suggested that cytotoxic intermediates were generated by the interaction of thio-DMA with GSH, while an excessive amount of GSH suppressed the generation of these intermediates. Flow-cytometry showed that thio-DMA was an inducer of cells with 4N DNA and hypo 2N DNA. The results also demonstrated that cells arrested in the mitotic phase had abnormalities in their spindle organization and centrosome integrity. In addition, cells arrested in mitosis by thio-DMA had chromosome structural aberrations, such as chromatid gaps, chromatid breaks and chromatid exchanges. Moreover, the cytotoxic effects of thio-DMA may in part be associated with an apoptotic mode of cell death that was evaluated by the appearance of nucleosome level DNA fragmentations and an 85-kDa cleavage fragment of poly (ADP-ribose) polymerase. These findings suggest that the presence of thio-DMA in human urine has implications for human health in terms of arsenic metabolism and toxicity.

  12. Suppression of in vitro primary immune response by L1210 cells and their culture supernatant: evidence for cytotoxic effects

    International Nuclear Information System (INIS)

    Huget, R.P.; Flad, H.D.; Opitz, H.G.

    1977-01-01

    L1210 cells and their culture supernatants were found to inhibit the generation of PFC in the in vitro primary immune response of spleen cells to SRBC. As few as 1 percent of L1210 cells and 1 percent of culture fluid were inhibitory. Inhibition of DNA or protein synthesis of L1210 cells did not abolish their immunosuppressive activity, excluding exhaustion of culture medium as a possible mechanism of inhibition of PFC. Heating of the supernatant completely abrogated the suppressive effect and resulted in a marked increase of PFC. Daily evaluation of cell viability in the cultures revealed that, in the presence of L1210 and supernatants, the fraction of surviving cells is markedly reduced. We conclude that a direct cytotoxic effect on splenic lymphocytes and macrophages is the predominant immunosuppressive mechanism of L1210 cells and their culture supernatants

  13. Cytotoxic effect of ciprofloxacin in primary culture of rat astrocytes and protection by Vitamin E

    International Nuclear Information System (INIS)

    Guerbay, Aylin; Gonthier, Brigitte; Barret, Luc; Favier, Alain; Hincal, Filiz

    2007-01-01

    The aim of this study was to investigate the possible cytotoxic and oxidative stress inducing effects of ciprofloxacin (CPFX) on primary cultures of rat astrocytes. The cultured cells were incubated with various concentrations of CPFX (0.5-300 mg/l), and cytotoxicity was determined by neutral red (NR) and MTT assays. Survival profile of cells was biphasic in NR assay: CPFX did not cause any alteration at any concentration for 7 h, whereas ≤50 mg/l concentrations induced significant cell proliferation in incubation periods of 24, 48, 72, and 96 h. However, cell proliferation gradually decreased at higher concentrations, and 200 and 300 mg/l of CPFX exposure was found to be significantly (p < 0.05) cytotoxic at all time periods. With MTT assay, no alteration was noted for incubation period of 7 h, as observed with NR assay. But, cell viability decreased with ∼≥50 mg/l CPFX exposure in all other time periods. Cell proliferation was only seen in 24 h of incubation with 0.5 and 5 mg/l CPFX. Vitamin E pretreatment of cell cultures were found to be providing complete protection against cytotoxicity of 300 mg/l CPFX in 96 h incubation when measured with both NR and MTT assays. The SOD pretreatment was partially protective with NR assay, but no protection was noted when measured with MTT. A significant enhancement of lipid peroxidation was observed with the cytotoxic concentration of the drug, but total glutathione content and catalase activity of cells did not change. The data obtained in this study suggest that, in accordance with our previous results with fibroblast cells, CPFX-induced cytotoxicity is related to oxidative stress. And the biphasic effect of CPFX possibly resulted from the complex dose-dependent relationships between reactive oxygen species, cell proliferation, and cell viability

  14. Generation of reactive oxygen species from porous silicon microparticles in cell culture medium.

    Science.gov (United States)

    Low, Suet Peng; Williams, Keryn A; Canham, Leigh T; Voelcker, Nicolas H

    2010-06-01

    Nanostructured (porous) silicon is a promising biodegradable biomaterial, which is being intensively researched as a tissue engineering scaffold and drug-delivery vehicle. Here, we tested the biocompatibility of non-treated and thermally-oxidized porous silicon particles using an indirect cell viability assay. Initial direct cell culture on porous silicon determined that human lens epithelial cells only poorly adhered to non-treated porous silicon. Using an indirect cell culture assay, we found that non-treated microparticles caused complete cell death, indicating that these particles generated a toxic product in cell culture medium. In contrast, thermally-oxidized microparticles did not reduce cell viability significantly. We found evidence for the generation of reactive oxygen species (ROS) by means of the fluorescent probe 2',7'-dichlorofluorescin. Our results suggest that non-treated porous silicon microparticles produced ROS, which interacted with the components of the cell culture medium, leading to the formation of cytotoxic species. Oxidation of porous silicon microparticles not only mitigated, but also abolished the toxic effects.

  15. The biotransformation of tetrahydroaminoacridine (THA) in cultured hepatocytes as the cause for relative cytotoxicity in 3 species

    International Nuclear Information System (INIS)

    Smolarek, T.A.; Higgins, C.V.; Amacher, D.E.

    1990-01-01

    THA, a centrally acting anticholinesterase, shows promise for the treatment of Alzheimer's disease. However, its use has been associated with suspected human hepatotoxicity through an unknown mechanism. In this study, the cytotoxicity and biotransformation of THA was studied in rat, canine, and monkey primary hepatocyte cultures. Cytotoxicity was indicated by the release of ALT, AST, or LDH into culture medium over 24 hours. THA biotransformation was studied by exposing cells to 100 nM [ 3 H]-THA and then analyzing culture medium for labelled moieties by reversed-phase HPLC after 1,2, and 24 hrs in culture. THA was toxic to rat and canine cells at 200 μg/ml and to monkey cells at 100 μg/ml. About 98% of the THA was transformed by canine and rat cells to 3 metabolites in 2 hrs, but in monkey cell cultures, only 55% of THA was transformed to 2 metabolites in 2 hrs and 95% to 3 metabolites in 24 hrs. Quantitative differences were also noted in metabolite profiles between monkey and rat or canine cell cultures. The predominant metabolite at 2 hours, tentatively identified as 1-OH-THA, was greatly diminished or absent in canine and rat but not monkey cell cultures after 18 hours. Thus, unchanged THA or this 1-OH-THA metabolite may be responsible for the greater cytotoxicity in the monkey hepatocyte cultures

  16. Cytotoxicity But No Mutagenicity In Bacteria With Externally Generated Singlet Oxygen

    Science.gov (United States)

    Midden, W. Robert; Dahl, Thomas A.; Hartman, Philip E.

    1988-02-01

    Singlet oxygen is believed to be an important intermediate responsible for the cytotoxicity of HpD phototherapy. It has been recognized as a possible intermediate in photosensitization for more than 20 years. However, it has been difficult to obtain conclusive evidence of its biological characteristics in the past because most of the methods available for its generation that are compatible with biological systems also generate other reactive intermediates whose effects are difficult to distinguish from singlet oxygen. We have used a recently devised separated-surface-sensi-tizer (S-S-S) system for singlet oxygen generation' to measure the cytotoxicity and mutagenicity of singlet oxygen in bacteria. The S-S-S system employs rose bengal as a sensitizer immobilized on one surface of a glass plate. The glass plate is placed sensitizer-side down a small distance (plate is illuminated from above to generate singlet oxygen at the surface of the sensitizer. The singlet oxygen thus generated can diffuse the short dis-tance to the surface of the membrane to react with the bacteria. Because of the short lifetime of singlet oxygen in air, increasing the distance between the sensitizer and the membrane causes a decline in the amount of singlet oxygen reaching the membrane according to a function derived from the Einstein-Smoluchowski equation for net displacement by diffusion. Plotting the log of the effect measured (e.g., cytotoxicity) vs. the square of the distance gives a straight line. The slope of this line can be used to calculate the gas phase half life of the intermediate responsible for the observed effects. We have found that bacteria are rapidly killed in the illuminated S-S-S system and that the gas phase half life of the agent responsible for cell killing is the same as that of singlet oxygen. This observation and other simple chemical tests have conclusively estab-lished that singlet oxygen is responsible for the cytotoxicity observed with bacteria. Dosimetry

  17. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    International Nuclear Information System (INIS)

    Waalkes, M.P.; Wilson, M.J.; Poirier, L.A.

    1985-01-01

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure

  18. CD34+ cells cultured in stem cell factor and interleukin-2 generate CD56+ cells with antiproliferative effects on tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hensel Nancy

    2005-04-01

    Full Text Available Abstract In vitro stimulation of CD34+ cells with IL-2 induces NK cell differentiation. In order to define the stages of NK cell development, which influence their generation from CD34 cells, we cultured G-CSF mobilized peripheral blood CD34+ cells in the presence of stem cell factor and IL-2. After three weeks culture we found a diversity of CD56+ subsets which possessed granzyme A, but lacked the cytotoxic apparatus required for classical NK-like cytotoxicity. However, these CD56+ cells had the unusual property of inhibiting proliferation of K562 and P815 cell lines in a cell-contact dependent fashion.

  19. Genotoxic and cytotoxic effects of different types of dental cement on normal cultured human lymphocytes.

    Science.gov (United States)

    Bakopoulou, A; Mourelatos, D; Tsiftsoglou, A S; Giassin, N P; Mioglou, E; Garefis, P

    2009-01-31

    In this study we have investigated the genotoxic and cytotoxic effects of eluates derived from different types of commercially available dental cements, including glass ionomer cements (GICs) (Ketac Cem/3M ESPE and GC Fuji I/GC Corp), resin-modified glass ionomer cements (RM-GICs) (RelyX Luting/3M ESPE and Vitrebond/3M ESPE) and dual-cure resin cements (RCs) (Variolink II/ Ivoclar-Vivadent and Panavia F 2.0/Kuraray) on normal cultured human lymphocytes. Lymphocyte primary cultures obtained from blood samples of three healthy donors were exposed to serial dilutions of eluates derived from specimens of each material tested. Metaphases were induced with phytohaemagglutinin, collected after 72h treatment by use of colchicine and stained according to the fluorescence plus giemsa (FPG) procedure. Preparations were scored for sister chromatid exchange (SCE) and chromosomal aberrations (CAs), while the proliferation rate index (PRI) was also calculated. Our results show that eluates derived from the RM-GICs and RCs caused severe genotoxic effects by significantly increasing the frequencies of SCEs and CAs in cultures of peripheral blood lymphocytes and by decreasing the relevant PRI values in a dose-dependent manner, whereas the two GICs caused only minor cytogenetic effects. Eluates of the two RM-GICs (Vitrebond and RelyX) were also very cytotoxic, as the first serial dilutions of both materials caused a complete mitotic arrest in lymphocyte cultures. Overall, the degree of genotoxicity and cytotoxicity caused by dental cements decreased as follows: Viterbond>Rely X>Panavia F 2.0>Variolink II>Ketac Cem=GC Fuji I. These results indicate that different types of dental cement differ extensively in their genotoxic and cytotoxic potential and their ability to affect chromosomal integrity, cell-cycle progression, DNA replication and repair. Although these results cannot be directly extrapolated to the clinical situation, the potential occurrence of adverse effects caused by the

  20. Three-dimensional culture conditions lead to decreased radiation induced cytotoxicity in human mammary epithelial cells

    International Nuclear Information System (INIS)

    Sowa, Marianne B.; Chrisler, William B.; Zens, Kyra D.; Ashjian, Emily J.; Opresko, Lee K.

    2010-01-01

    For both targeted and non-targeted exposures, the cellular responses to ionizing radiation have predominantly been measured in two-dimensional monolayer cultures. Although convenient for biochemical analysis, the true interactions in vivo depend upon complex interactions between cells themselves and the surrounding extracellular matrix. This study directly compares the influence of culture conditions on radiation induced cytotoxicity following exposure to low-LET ionizing radiation. Using a three-dimensional (3D) human mammary epithelial tissue model, we have found a protective effect of 3D cell culture on cell survival after irradiation. The initial state of the cells (i.e., 2D versus 3D culture) at the time of irradiation does not alter survival, nor does the presence of extracellular matrix during and after exposure to dose, but long term culture in 3D which offers significant reduction in cytotoxicity at a given dose (e.g. ∼4-fold increased survival at 5 Gy). The cell cycle delay induced following exposure to 2 and 5 Gy was almost identical between 2D and 3D culture conditions and cannot account for the observed differences in radiation responses. However the amount of apoptosis following radiation exposure is significantly decreased in 3D culture relative to the 2D monolayer after the same dose. A likely mechanism of the cytoprotective effect afforded by 3D culture conditions is the down regulation of radiation induced apoptosis in 3D structures.

  1. Assessment of in vitro genotoxic and cytotoxic effects of flurbiprofen on human cultured lymphocytes.

    Science.gov (United States)

    Timocin, Taygun; Ila, Hasan Basri; Dordu, Tuba; Husunet, Mehmet Tahir; Tazehkand, Mostafa Norizadeh; Valipour, Ebrahim; Topaktas, Mehmet

    2016-01-01

    Flurbiprofen is non-steroidal anti-inflammatory drug which is commonly used for its analgesic, antipyretic, and anti-inflammatory effects. The purpose of the study was to explore the genotoxic and cytotoxic effects of flurbiprofen in human cultured lymphocytes by sister chromatid exchange, chromosome aberration, and cytokinesis-blocked micronucleus tests. 10, 20, 30, and 40 μg/mL concentrations of flurbiprofen (solvent is DMSO) were used to treatment of human cultured lymphocytes at two different treatment periods (24 and 48 h). Flurbiprofen had no significant genotoxic effect in any of these tests. But exposing to flurbiprofen for 24 and 48 h led to significant decrease on proliferation index, mitotic index, and nuclear division index (NDI). Also, all decreases were concentration-dependent (except NDI at 24 h treatment period). Consequently, the findings of this research showed that flurbiprofen had cytotoxic effects in human blood lymphocytes.

  2. Comparison of the Cytotoxic Potential of Cigarette Smoke and Electronic Cigarette Vapour Extract on Cultured Myocardial Cells

    Directory of Open Access Journals (Sweden)

    Dimitris Tsiapras

    2013-10-01

    Full Text Available Background: Electronic cigarettes (ECs have been marketed as an alternative-to-smoking habit. Besides chemical studies of the content of EC liquids or vapour, little research has been conducted on their in vitro effects. Smoking is an important risk factor for cardiovascular disease and cigarette smoke (CS has well-established cytotoxic effects on myocardial cells. The purpose of this study was to evaluate the cytotoxic potential of the vapour of 20 EC liquid samples and a “base” liquid sample (50% glycerol and 50% propylene glycol, with no nicotine or flavourings on cultured myocardial cells. Included were 4 samples produced by using cured tobacco leaves in order to extract the tobacco flavour. Methods: Cytotoxicity was tested according to the ISO 10993-5 standard. By activating an EC device at 3.7 volts (6.2 watts—all samples, including the “base” liquid and at 4.5 volts (9.2 watts—four randomly selected samples, 200 mg of liquid evaporated and was extracted in 20 mL of culture medium. Cigarette smoke (CS extract from three tobacco cigarettes was produced according to ISO 3308 method (2 s puffs of 35 mL volume, one puff every 60 s. The extracts, undiluted (100% and in four dilutions (50%, 25%, 12.5%, and 6.25%, were applied to myocardial cells (H9c2; percent-viability was measured after 24 h incubation. According to ISO 10993-5, viability of 6.25% (viability: 76.9 ± 2.0% at 6.25%, 38.2 ± 0.5% at 12.5%, 3.1 ± 0.2% at 25%, 5.2 ± 0.8% at 50%, and 3.9 ± 0.2% at 100% extract concentration. Three EC extracts (produced by tobacco leaves were cytotoxic at 100% and 50% extract concentrations (viability range: 2.2%–39.1% and 7.4%–66.9% respectively and one (“Cinnamon-Cookies” flavour was cytotoxic at 100% concentration only (viability: 64.8 ± 2.5%. Inhibitory concentration 50 was >3 times lower in CS extract compared to the worst-performing EC vapour extract. For EC extracts produced by high-voltage and energy, viability was

  3. Suppression of cytotoxic T lymphocytes by carrageenan-activated macrophage-like cells

    International Nuclear Information System (INIS)

    Yung, Y.P.; Cudkowicz, G.

    1978-01-01

    In the presence of 100 μg/ml of carrageenans (CAR), B6D2F 1 responder spleen cells failed to generate antiparent or anti-allogeneic cytotoxic T lymphocytes in vitro, but instead generated suppressor cells. Cultured CAR-treated cells added to mixtures of B6D2F 1 anti-B6 or B6D2F 1 anti-C3H cytotoxic effectors (induced in vitro) and the appropriate 51 Cr-labeled lymphoma targets reduced or abolished cytolysis (measured as 51 Cr release) depending on the ratio of suppressor to effector cells. Cultured spleen cells not exposed to CAR failed to inhibit both types of cytotoxicity. Presuppressor cells were associated with a splenic subpopulation independent of the thymus (i.e., present in spleens of athymic nude mice), were moderately adherent to Sephadex G-10 columns, but were not phagocytic or ''sticky'' to carbonyl iron particles. Activation of such cells by CAR was not prevented by in vitro exposure to 2000 rads of γ-rays before culture, nor facilitated by antigenic stimulation. The matured suppressor cells remained radioresistant and became strongly adherent to Sephadex G-10. The suppressors lacked surface Thy-1 alloantigen detectable by antibody and rabbit complement. Suppressor cell activity was not restricted by the immunologic specificity and major histocompatibility type of effectors

  4. Microglia in Glia-Neuron Co-cultures Exhibit Robust Phagocytic Activity Without Concomitant Inflammation or Cytotoxicity.

    Science.gov (United States)

    Adams, Alexandra C; Kyle, Michele; Beaman-Hall, Carol M; Monaco, Edward A; Cullen, Matthew; Vallano, Mary Lou

    2015-10-01

    A simple method to co-culture granule neurons and glia from a single brain region is described, and microglia activation profiles are assessed in response to naturally occurring neuronal apoptosis, excitotoxin-induced neuronal death, and lipopolysaccharide (LPS) addition. Using neonatal rat cerebellar cortex as a tissue source, glial proliferation is regulated by omission or addition of the mitotic inhibitor cytosine arabinoside (AraC). After 7-8 days in vitro, microglia in AraC(-) cultures are abundant and activated based on their amoeboid morphology, expressions of ED1 and Iba1, and ability to phagocytose polystyrene beads and the majority of neurons undergoing spontaneous apoptosis. Microglia and phagocytic activities are sparse in AraC(+) cultures. Following exposure to excitotoxic kainate concentrations, microglia in AraC(-) cultures phagocytose most dead neurons within 24 h without exacerbating neuronal loss or mounting a strong or sustained inflammatory response. LPS addition induces a robust inflammatory response, based on microglial expressions of TNF-α, COX-2 and iNOS proteins, and mRNAs, whereas these markers are essentially undetectable in control cultures. Thus, the functional effector state of microglia is primed for phagocytosis but not inflammation or cytotoxicity even after kainate exposure that triggers death in the majority of neurons. This model should prove useful in studying the progressive activation states of microglia and factors that promote their conversion to inflammatory and cytotoxic phenotypes.

  5. A cell-based biosensor for nanomaterials cytotoxicity assessment in three dimensional cell culture

    International Nuclear Information System (INIS)

    Dubiak-Szepietowska, Monika; Karczmarczyk, Aleksandra; Winckler, Thomas; Feller, Karl-Heinz

    2016-01-01

    Nanoparticles (NPs) are widely used in consumer and medicinal products. The high prevalence of nanoparticles in the environment raises concerns regarding their effects on human health, but there is limited knowledge about how NPs interact with cells or tissues. Because the European Union has called for a substantial reduction of animal experiments for scientific purposes (Directive 2010/63), increased efforts are required to develop in vitro models to evaluate potentially hazardous agents. Here, we describe a new cell-based biosensor for the evaluation of NPs cytotoxicity. The new biosensor is based on transgenic human hepatoblastoma cells (HepG2) that express a secreted form of alkaline phosphatase (SEAP) as a reporter protein whose expression is induced upon activation of a stress response pathway controlled by the transcription regulator nuclear factor-κB (NF-κB). The NF-κB-HepG2 sensor cells were cultured in a Matrigel-based three dimensional environment to simulate the in vivo situation. The new biosensor cells offer the advantage of generating fast and reproducible readout at lower concentrations and shorter incubation time than conventional viability assays, avoid possible interaction between nanomaterials and assay compounds, therefore, minimize generation of false positive or negative results and indicate mechanism of toxicity through NF-κB signaling.

  6. Cytotoxic effects of S-(dimethylarsino)-glutathione: A putative intermediate metabolite of inorganic arsenicals

    International Nuclear Information System (INIS)

    Hirano, Seishiro; Kobayashi, Yayoi

    2006-01-01

    Glutathione (GSH) plays an important role in the metabolism of arsenite and arsenate by generating arsenic-glutathione complexes. Although dimethylarsinic acid (DMA V ) is the major metabolite of inorganic arsenicals (iAs) in urine, it is not clear how DMA V is produced from iAs. In the present study we report that S-(dimethylarsino)-glutathione (DMA III (SG)), a putative precursor of dimethylarsinic acid DMA V , was unstable in the culture medium without excess GSH and generated volatile substances which were highly cytotoxic for both rat heart microvascular endothelial cells and HL60, a human leukemia cell line. Cytotoxicity of DMA III (SG) was higher than that of iAs and its LC 5 value was calculated to be 7.8 μM in the endothelial cells. To our surprise DMA III (SG) effectively killed cells in the neighbor wells of the same multi-well dish, indicating that volatile toxic compounds generated from DMA III (SG) in the culture medium. High performance lipid chromatography-inductively coupled plasma mass spectrometry (HPLC-ICPMS) analyses suggested that the freshly generated volatile compounds dissolved into aqueous solution and formed an unstable arsenic compound and the unstable compound was further converted to DMA V . These results suggested that DMA III (SG) exerts its cytotoxicity by generating volatile arsenicals and is implicated in the metabolic conversion of inorganic arsenicals into DMA V , a major final metabolite of inorganic arsenicals in most mammals

  7. Interactive cytotoxicity of etoposide and radiation on cultured Chinese hamster V-79 cells

    International Nuclear Information System (INIS)

    Saito, Tsutomu; Shimada, Yuji; Kamata, Rikisaburo

    1989-01-01

    Etoposide is a semisynthetic derivative of podophyllotoxin and is an active antitumor agent. The interactive cytotoxic effect of Etoposide and radiation was investigated using cultured Chinese hamster V-79 cells. The surviving fraction of the cells was reduced by only 20%, when the cells were exposed to 5μg/ml of Etoposide for 30 min. Etoposide at this concentration reduced the width of the shoulder of the radiation survival curve. The change became more significant with increase in the concentration of Etoposide. The Dqs (quasithreshold doses) of the radiation survival curves were 5.39, 3.28, 2.13 and 0.54Gy, although the Dos (37% dose slopes) of the radiation survival curves were 2.55, 2.49, 2.39 and 2.18 Gy, when combination treatment with radiaiton and 0, 5, 10 and 20 μg/ml of Etoposide, respectively, was carried out. The cytotoxic effect became increased when fractional treatments with Etoposide and radiation were performed. The results obtained suggest that the mechanism of the interactive cytotoxic effect of this combination treatment involves a reciprocal action of Etoposide and sublethal damage by the radiation to the cells. (author)

  8. Cellular distribution of inorganic mercury and its relation to cytotoxicity in bovine kidney cell cultures

    International Nuclear Information System (INIS)

    Bracken, W.M.; Sharma, R.P.; Bourcier, D.R.

    1984-01-01

    A bovine kidney cell culture system was used to assess what relationship mercuric chloride (HgCl 2 ) uptake and subcellular distribution had to cytotoxicity. Twenty-four-hour incubations with 0.05-50 μM HgCl 2 elicited a concentration-related cytotoxicity. Cellular accumulation of 203 Hg was also concentration-related, with 1.0 nmol/10 6 cells at the IC50. Measurement of Hg uptake over the 24-h exposure period revealed a multiphasic process. Peak accumulation was attained by 1 h and was followed by extrusion and plateauing of intracellular Hg levels. Least-squares regression analysis of the cytotoxicity and cellular uptake data indicated a potential relationship between the Hg uptake and cytotoxicity. However, the subcellular distribution of Hg was not concentration-related. Mitochondria and soluble protein fractions accounted for greater than 65% of the cell-associated Hg at all concentrations. The remaining Hg was distributed between the microsomal (6-10%) and nuclear and cell debris (11-22%) fractions at all concentrations tested. Less than 20% of the total cell-associated Hg was bound with metallothionein-like protein. 31 references, 4 figures, 3 tables

  9. Artifacts by marker enzyme adsorption on nanomaterials in cytotoxicity assays with tissue cultures

    International Nuclear Information System (INIS)

    Wohlleben, Wendel; Kolle, Susanne N; Hasenkamp, Laura-Carolin; Boeser, Alexander; Vogel, Sandra; Vacano, Bernhard von; Ravenzwaay, Ben van; Landsiedel, Robert

    2011-01-01

    We used precision cut lung slices (PCLS) to study the cytotoxicity of cobalt ferrite nanomaterials with and without bovine serum albumin (BSA) stabilization. Using mitochondrial activity as an indicator of cytotoxicity (WST-1 assay) increasing concentrations of cobalt ferrite nanomaterial caused increasing levels of cytotoxicity in PCLS irrespective of BSA stabilization. However, there was no increase in released lactate dehydrogenase (LDH) levels caused by BSA stabilized nanomaterial indicating concentration depended cytotoxictiy. Moreover, non-stabilized nanomaterial caused a decrease of background LDH levels in the PCLS culture supernatant confirmed by complementary methods. Direct characterization of the protein corona of extracted nanomaterial shows that the LDH decrease is due to adsorption of LDH onto the surface of the non-stabilized nanomaterial, correlated with strong agglomeration. Preincubation with serum protein blocks the adsorption of LDH and stabilizes the nanomaterial at low agglomeration. We have thus demonstrated the cytotoxicity of nanomaterials in PCLS does not correlate with disrupted membrane integrity followed by LDH release. Furthermore, we found that intracellular enzymes such as the marker enzyme LDH are able to bind onto surfaces of nanomaterial and thereby adulterate the detection of toxic effects. A replacement of BSA by LDH or a secondary LDH-on-BSA-corona were not observed, confirming earlier indications that the protein corona exchange rate are slow or vanishing on inorganic nanomaterial. Thus, the method(s) to assess nanomaterial-mediated effects have to be carefully chosen based on the cellular effect and possible nano-specific artifacts.

  10. The effect of glycosylation on cytotoxicity of Ibaraki virus nonstructural protein NS3

    Science.gov (United States)

    URATA, Maho; WATANABE, Rie; IWATA, Hiroyuki

    2015-01-01

    The cytotoxicity of Ibaraki virus nonstructural protein NS3 was confirmed, and the contribution of glycosylation to this activity was examined by using glycosylation mutants of NS3 generated by site-directed mutagenesis. The expression of NS3 resulted in leakage of lactate dehydrogenase to the culture supernatant, suggesting the cytotoxicity of this protein. The lack of glycosylation impaired the transport of NS3 to the plasma membrane and resulted in reduced cytotoxicity. Combined with the previous observation that NS3 glycosylation was specifically observed in mammalian cells (Urata et al., Virus Research 2014), it was suggested that the alteration of NS3 cytotoxicity through modulating glycosylation is one of the strategies to achieve host specific pathogenisity of Ibaraki virus between mammals and vector arthropods. PMID:26178820

  11. Comparison between xCELLigence biosensor technology and conventional cell culture system for real-time monitoring human tenocytes proliferation and drugs cytotoxicity screening.

    Science.gov (United States)

    Chiu, Chih-Hao; Lei, Kin Fong; Yeh, Wen-Ling; Chen, Poyu; Chan, Yi-Sheng; Hsu, Kuo-Yao; Chen, Alvin Chao-Yu

    2017-10-16

    Local injections of anesthetics, NSAIDs, and corticosteroids for tendinopathies are empirically used. They are believed to have some cytotoxicity toward tenocytes. The maximal efficacy dosages of local injections should be determined. A commercial 2D microfluidic xCELLigence system had been developed to detect real-time cellular proliferation and their responses to different stimuli and had been used in several biomedical applications. The purpose of this study is to determine if human tenocytes can successfully proliferate inside xCELLigence system and the result has high correlation with conventional cell culture methods in the same condition. First passage of human tenocytes was seeded in xCELLigence and conventional 24-well plates. Ketorolac tromethamine, bupivacaine, methylprednisolone, and betamethasone with different concentrations (100, 50, and 10% diluted of clinical usage) were exposed in both systems. Gene expression of type I collagen, type III collagen, tenascin-C, decorin, and scleraxis were compared between two systems. Human tenocytes could proliferate both in xCELLigence and conventional cell culture systems. Cytotoxicity of each drug revealed dose-dependency when exposed to tenocytes in both systems. Significance was found between groups. All the four drugs had comparable cytotoxicity in their 100% concentration. When 50% concentration was used, betamethasone had a relatively decreased cytotoxicity among them in xCELLigence but not in conventional culture. When 10% concentration was used, betamethasone had the least cytotoxicity. Strong and positive correlation was found between cell index of xCELLigence and result of WST-1 assay (Pearson's correlation [r] = 0.914). Positive correlation of gene expression between tenocytes in xCELLigence and conventional culture was also observed. Type I collagen: [r] = 0.823; type III collagen: [r] = 0.899; tenascin-C: [r] = 0.917; decorin: [r] = 0.874; and scleraxis: [r] = 0.965. Human

  12. pH and the cytotoxicity of fluoride in an animal cell culture system

    International Nuclear Information System (INIS)

    Helgeland, K.; Leirskar, J.

    1976-01-01

    To investigate the mechanism for the toxicity of silicate cement as observed in a cell culture system, the effects of pH and fluoride were tested on human epithelial cells (NCTC 2544). At pH 7.3, fluoride concentrations from 15 to 25 μg/ml (0.79 to 1.3 mM) had a growth inhibitory effect. When the pH of the incubation medium was lowered to the range 7.0 to 6.4, an enhanced cytotoxic effect of fluoride was found, and even at 5 to 10 μg/ml growth inhibition occurred. Concomitant with the enhanced cytotoxicity of fluoride at low pH, there was an increased utilization of glucose and formation of lactate. Upon lowering the pH of the incubation medium from 7.4 to 6.7, a twofold increase in the intracellular concentration of fluoride was found. (author)

  13. Cytotoxic effects of gold nanoparticles exposure employing in vitro animal cell culture system as part of nanobiosafety

    Science.gov (United States)

    Ambwani, Sonu; Kakade Datta, P.; Kandpal, Deepika; Arora, Sandeep; Ambwani, Tanuj Kumar

    2016-04-01

    Metal Nanoparticles are exploited in different fields that include biomedical sector where they are utilized in drug and gene delivery, biosensors, cancer treatment and diagnostic tools. Despite of their benefits, there has been serious concerns about possible side effects of several nanoparticles. Gold nanoparticles (AuNPs) are exploited for bio-imaging, biosensing, drug delivery, transfection and diagnosis. These nanoparticles may get released into the environment in high amounts at all stages of production, recycling and disposal. Since the manufacture and use of nanoparticles are increasing, humans/ animals are more likely to be exposed occupationally or via consumer products and the environment. The emergence of the new field of nanotoxicity has spurred great interest in a wide variety of materials and their possible effects on living systems. Animal cell culture system is considered as a sensitive indicator against exposure of such materials. Keeping in view the above scenario, present study was carried out to evaluate effect of AuNPs exposure in primary and cell line culture system employing chicken embryo fibroblast (CEF) culture and HeLa cell line culture through MTT assay. Minimum cytotoxic dose was found to be 60 µg/ml and 50 µg/ml in CEF and HeLa cells, respectively. Thus, it could be inferred that even a very low concentration of AuNPs could lead to cytotoxic effects in cell culture based studies.

  14. Cytotoxicity of superoxide dismutase 1 in cultured cells is linked to Zn2+ chelation.

    Directory of Open Access Journals (Sweden)

    Ann-Sofi Johansson

    Full Text Available Neurodegeneration in protein-misfolding disease is generally assigned to toxic function of small, soluble protein aggregates. Largely, these assignments are based on observations of cultured neural cells where the suspect protein material is titrated directly into the growth medium. In the present study, we use this approach to shed light on the cytotoxic action of the metalloenzyme Cu/Zn superoxide dismutase 1 (SOD1, associated with misfolding and aggregation in amyotrophic lateral sclerosis (ALS. The results show, somewhat unexpectedly, that the toxic species of SOD1 in this type of experimental setting is not an aggregate, as typically observed for proteins implicated in other neuro-degenerative diseases, but the folded and fully soluble apo protein. Moreover, we demonstrate that the toxic action of apoSOD1 relies on the protein's ability to chelate Zn(2+ ions from the growth medium. The decreased cell viability that accompanies this extraction is presumably based on disturbed Zn(2+ homeostasis. Consistently, mutations that cause global unfolding of the apoSOD1 molecule or otherwise reduce its Zn(2+ affinity abolish completely the cytotoxic response. So does the addition of surplus Zn(2+. Taken together, these observations point at a case where the toxic response of cultured cells might not be related to human pathology but stems from the intrinsic limitations of a simplified cell model. There are several ways proteins can kill cultured neural cells but all of these need not to be relevant for neurodegenerative disease.

  15. Cell-type-specific and differentiation-status-dependent variations in cytotoxicity of tributyltin in cultured rat cerebral neurons and astrocytes.

    Science.gov (United States)

    Oyanagi, Koshi; Tashiro, Tomoko; Negishi, Takayuki

    2015-08-01

    Tributyltin (TBT) is an organotin used as an anti-fouling agent for fishing nets and ships and it is a widespread environmental contaminant at present. There is an increasing concern about imperceptible but serious adverse effect(s) of exposure to chemicals existing in the environment on various organs and their physiological functions, e.g. brain and mental function. Here, so as to contribute to improvement of and/or advances in in vitro cell-based assay systems for evaluating brain-targeted adverse effect of chemicals, we tried to evaluate cell-type-specific and differentiation-status-dependent variations in the cytotoxicity of TBT towards neurons and astrocytes using the four culture systems differing in the relative abundance of these two types of cells; primary neuron culture (> 95% neurons), primary neuron-astrocyte (2 : 1) mix culture, primary astrocyte culture (> 95% astrocytes), and passaged astrocyte culture (100% proliferative astrocytes). Cell viability was measured at 48 hr after exposure to TBT in serum-free medium. IC50's of TBT were 198 nM in primary neuron culture, 288 nM in primary neuron-astrocyte mix culture, 2001 nM in primary astrocyte culture, and 1989 nM in passaged astrocyte culture. Furthermore, in primary neuron-astrocyte mix culture, vulnerability of neurons cultured along with astrocytes to TBT toxicity was lower than that of neurons cultured purely in primary neuron culture. On the other hand, astrocytes in primary neuron-astrocyte mix culture were considered to be more vulnerable to TBT than those in primary or passaged astrocyte culture. The present study demonstrated variable cytotoxicity of TBT in neural cells depending on the culture condition.

  16. Cytotoxicity of zinc oxide (ZnO) nanoparticles is influenced by cell density and culture format.

    Science.gov (United States)

    Heng, Boon Chin; Zhao, Xinxin; Xiong, Sijing; Ng, Kee Woei; Boey, Freddy Yin-Chiang; Loo, Joachim Say-Chye

    2011-06-01

    A parameter that has often been overlooked in cytotoxicity assays is the density and confluency of mammalian cell monolayers utilized for toxicology screening. Hence, this study investigated how different cell seeding densities influenced their response to cytotoxic challenge with ZnO nanoparticles. Utilizing the same volume (1 ml per well) and concentration range (5-40 μg/ml) of ZnO nanoparticles, contradictory results were observed with higher-density cell monolayers (BEAS-2B cells) obtained either by increasing the number of seeded cells per well (50,000 vs. 200,000 cells per well of 12-well plate) or by seeding the same numbers of cells (50,000) within a smaller surface area (12-well vs. 48-well plate, 4.8 vs. 1.2 cm(2), respectively). Further experiments demonstrated that the data may be skewed by inconsistency in the mass/number of nanoparticles per unit area of culture surface, as well as by inconsistent nanoparticle to cell ratio. To keep these parameters constant, the same number of cells (50,000 per well) were seeded on 12-well plates, but with the cells being seeded at the edge of the well for the experimental group (by tilting the plate) to form a dense confluent monolayer, as opposed to a sparse monolayer for the control group seeded in the conventional manner. Utilizing such an experimental set-up for the comparative evaluation of four different cell lines (BEAS-2B, L-929, CRL-2922 and C2C12), it was observed that the high cell density monolayer was consistently more resistant to the cytotoxic effects of ZnO nanoparticles compared to the sparse monolayer for all four different cell types, with the greatest differences being observed above a ZnO concentration of 10 μg/ml. Hence, the results of this study demonstrate the need for the standardization of cell culture protocols utilized for toxicology screening of nanoparticles, with respect to cell density and mass/number of nanoparticles per unit area of culture surface.

  17. Resveratrol exhibits a strong cytotoxic activity in cultured cells and has an antiviral action against polyomavirus: potential clinical use

    Directory of Open Access Journals (Sweden)

    Galati Gaspare

    2009-07-01

    Full Text Available Abstract Background Resveratrol is a non flavonoid polyphenol compound present in many plants and fruits and, at especially high concentrations, in the grape berries of Vitis vinifera. This compound has a strong bioactivity and its cytoprotective action has been demonstrated, however at high concentrations the drug exhibits also an effective anti-proliferative action. We recently showed its ability to abolish the effects of oxidative stress in cultured cells. In this work we assayed the bioactivity of resveratrol as antiproliferative and antiviral drug in cultured fibroblasts. Studies by other Authors showed that this natural compound inhibits the proliferation of different viruses such as herpes simplex, varicella-zoster and influenza A. The results presented here show an evident toxic activity of the drug at high concentrations, on the other hand at sub-cytotoxic concentrations, resveratrol can effectively inhibit the synthesis of polyomavirus DNA. A possible interpretation is that, due to the damage caused by resveratrol to the plasma membrane, the transfer of the virus from the endoplasmic reticulum to the nucleus, may be hindered thus inhibiting the production of viral DNA. Methods The mouse fibroblast line 3T6 and the human tumor line HL60 were used throughout the work. Cell viability and vital cell count were assessed respectively, by the MTT assay and Trypan Blue staining. Cytotoxic properties and evaluation of viral DNA production by agarose gel electrophoresis were performed according to standard protocols. Results Our results show a clear dose dependent both cytotoxic and antiviral effect of resveratrol respectively at high and low concentrations. The cytotoxic action is exerted towards a stabilized cell-line (3T6 as well as a tumor-line (HL60. Furthermore the antiviral action is evident after the phase of virion entry, therefore data suggest that the drug acts during the synthesis of the viral progeny DNA. Conclusion Resveratrol is

  18. Cytotoxic drug sensitivity testing of tumor cells from patients with ovarian carcinoma using the fluorometric microculture cytotoxicity assay (FMCA).

    Science.gov (United States)

    Csoka, K; Larsson, R; Tholander, B; Gerdin, E; de la Torre, M; Nygren, P

    1994-08-01

    The automated fluorometric microculture cytotoxicity assay (FMCA) is based on the measurement of fluorescence generated from cellular hydrolysis of fluorescein diacetate (FDA) to fluorescein by viable cells after a 72-hr culture period in microtiter plates. The FMCA was adopted for chemosensitivity testing of tumor cells from patients with ovarian carcinoma. Thirty-seven samples of solid tumors and malignant effusions were obtained from 35 patients at diagnosis or relapse. Tumor cells from solid samples and effusions were prepared by enzymatic digestion and centrifugation, respectively, followed by Percoll or Ficoll purification. The fluorescence was proportional to the number of cells/well and considerably higher in tumor cells than in contaminating normal cells. The effect of up to 19 cytotoxic drugs was successfully assessed in 70% of the samples and there was a good correlation between drug sensitivity data reported by the FMCA and the DiSC assay performed in parallel. The overall drug sensitivity pattern in vitro corresponded well to the clinical experience. The effect of cisplatin varied considerably between patients and resistance was found also in cases not previously exposed to cytotoxic drugs. The FMCA is a rapid and simple method that seems to report clinically relevant cytotoxic drug sensitivity data in ovarian carcinomas. In the future, this method may contribute to optimizing chemotherapy by assisting in individualized drug selection and new drug development.

  19. Cytotoxicity evaluation of sodium alendronate on cultured human periodontal ligament fibroblasts.

    Science.gov (United States)

    Correia, Vera de Fátima Padrão; Caldeira, Celso L; Marques, Márcia Martins

    2006-12-01

    External root resorption processes are usually associated with dental trauma, mainly avulsion and intrusion. In such cases endodontic therapy aims to prevent this process by using medications that can inhibit osteoclastic activity, such as bisphosphonates. However, these drugs must be biocompatible to the periapical tissues. The aim of this study was to analyze the cytotoxicity of a bisphosphonate (sodium alendronate) on human periodontal ligament fibroblasts (PDL cells). Cells were plated in a density of 1 x 10(3) cells per dish. The experimental groups were GI (control) no sodium alendronate, and GII, GIII, and GIV with sodium alendronate at the concentrations of 10(-5), 10(-6), and 10(-7) M, respectively. The experimental times were 1, 6, 12, and 24 h (short-term) for viability and 2, 4, 6, and 8 days (long-term) for cell survival. Data in triplicate were statistically analyzed. Cultures treated with the highest alendronate concentration (GII) showed cell viability percentages significantly lower (P < 0.01) than those of the other groups (GI, GIII, and GIV), at 12 and 24 h. Cell growth on GII and GIII groups was similar. GII presented smaller growth than the other groups (P < 0.05). We concluded that sodium alendronate, on direct contact with human periodontal ligament fibroblasts, is cytotoxic in concentrations higher than of 10(-6) M.

  20. The effect of tobacco smoke exposure on the generation of reactive oxygen species and cellular membrane damage using co-culture model of blood brain barrier with astrocytes.

    Science.gov (United States)

    Seo, Seung-Beom; Choe, Eun Sang; Kim, Kwang-Sik; Shim, Soon-Mi

    2017-06-01

    Brain tissue is known to be vulnerable to the exposure by tobacco smoke. Tobacco smoke can induce generation of reactive oxygen species (ROS), causing inflammatory activity and blood-brain barrier (BBB) impairment. The aim of the present study was to investigate the effect of tobacco smoke on cell cytotoxicity, generation of ROS, and cellular membrane damage in astrocytes and BBB using a co-culture system. Cell viability of U373MG cells was reduced in a dose-dependent manner, ranging from 96.7% to 40.3% by tobacco smoke condensate (TSC). Cell viability of U373MG co-cultured with human brain microvascular endothelial cells (HBMECs) was 104.9% at the IC 50 value of TSC. Trans-epithelial electric resistance values drastically decreased 80% following 12-h incubation. The value was maintained until 48 h and then increased at 72-h incubation (85%). It then decreased to 75% at 120 h. Generation of ROS increased in a dose-dependent manner, ranging from 102.7% to 107.9%, when various concentrations of TSC (4-16 mg/mL) were administered to the U373MG monoculture. When TSC was added into U373MG co-cultured with HBMECs, production of ROS ranged from 101.7% to 102.6%, slightly increasing over 12 h. Maximum exposure-generated ROS of 104.8% was reached at 24 h. Cell cytotoxicity and oxidative stress levels in the U373MG co-culture model system with HBMECs were lower than U373MG monoculture. HBMECs effectively acted as a barrier to protect the astrocytes (U373MG) from toxicity of TSC.

  1. Cytotoxic effects of chemotherapeutic drugs and heterocyclic compounds at application on the cells of primary culture of neuroepithelium tumors.

    Science.gov (United States)

    Kulchitsky, Vladimir A; Potkin, Vladimir I; Zubenko, Yuri S; Chernov, Alexander N; Talabaev, Michael V; Demidchik, Yuri E; Petkevich, Sergei K; Kazbanov, Vladimir V; Gurinovich, Tatiana A; Roeva, Margarita O; Grigoriev, Dmitry G; Kletskov, Alexei V; Kalunov, Vladimir N

    2012-01-01

    Neuroepithelial tumor cells were cultured in vitro. The biopsy material was taken from 93 children at removal of the brain tumors during neurosurgical operations. The individual features of the cells sensitivity of primary cultures in respect to protocol-approved chemotherapy drugs and changes in the Interleukin-6 (Il-6) level in the culture medium after the application of chemotherapy were established. The initial level of Il-6 exceeded 600.0 pg/ml in the cultural medium with histologically verified pilomyxoid astrocytoma cells, and ranged from 100.0 to 200.0 pg/ml in the medium at cultivation of ganglioneuroblastoma and pilocytic astrocytoma. A decrease in the Il-6 level in the medium culture of primary tumors cells was observed after the application of chemotherapeutic agents on the cells of pilomyxoid astrocytoma, astrocytomas, and pilocytic desmoplastic/nodular medulloblastoma. The production of Il-6 increased after application of cytostatic drugs on the cells of oligoastrocytomas. A decrease in Il-6 level after application of Cisplatin and Methotrexate and a 5-10 fold increase in the level of Il-6 after application of Etoposide, Carboplatin, Cytarabine, and Gemcitabine were registered in the medium with ganglioneuroblastoma. To improve the cytotoxic action of chemotherapeutic agents, the combined application of cytostatics with heterocyclic compounds was carried out. A computer modeling of ligand-protein complexes of carbamide using the Dock 6.4 and USF Chimera program packages was performed with molecular mechanics method. Special attention was drawn to the ability of several isoxazole heterocycles and isothiazolyl to inhibit the tyrosine kinase. It was proved in vitro that the joint application of chemotherapeutic agents and heterocyclic compounds could reduce the concentration of the cytostatic factor by 10 or more times, having maintained the maximum cytotoxic effect. It was assumed that the target amplification of cytotoxic action of chemotherapeutic

  2. Generative inference for cultural evolution.

    Science.gov (United States)

    Kandler, Anne; Powell, Adam

    2018-04-05

    One of the major challenges in cultural evolution is to understand why and how various forms of social learning are used in human populations, both now and in the past. To date, much of the theoretical work on social learning has been done in isolation of data, and consequently many insights focus on revealing the learning processes or the distributions of cultural variants that are expected to have evolved in human populations. In population genetics, recent methodological advances have allowed a greater understanding of the explicit demographic and/or selection mechanisms that underlie observed allele frequency distributions across the globe, and their change through time. In particular, generative frameworks-often using coalescent-based simulation coupled with approximate Bayesian computation (ABC)-have provided robust inferences on the human past, with no reliance on a priori assumptions of equilibrium. Here, we demonstrate the applicability and utility of generative inference approaches to the field of cultural evolution. The framework advocated here uses observed population-level frequency data directly to establish the likely presence or absence of particular hypothesized learning strategies. In this context, we discuss the problem of equifinality and argue that, in the light of sparse cultural data and the multiplicity of possible social learning processes, the exclusion of those processes inconsistent with the observed data might be the most instructive outcome. Finally, we summarize the findings of generative inference approaches applied to a number of case studies.This article is part of the theme issue 'Bridging cultural gaps: interdisciplinary studies in human cultural evolution'. © 2018 The Author(s).

  3. Macrolide Antibiotics Exhibit Cytotoxic Effect under Amino Acid-Depleted Culture Condition by Blocking Autophagy Flux in Head and Neck Squamous Cell Carcinoma Cell Lines

    Science.gov (United States)

    Hirasawa, Kazuhiro; Moriya, Shota; Miyahara, Kana; Kazama, Hiromi; Hirota, Ayako; Takemura, Jun; Abe, Akihisa; Inazu, Masato; Hiramoto, Masaki; Tsukahara, Kiyoaki

    2016-01-01

    Autophagy, a self-digestive system for cytoplasmic components, is required to maintain the amino acid pool for cellular homeostasis. We previously reported that the macrolide antibiotics azithromycin (AZM) and clarithromycin (CAM) have an inhibitory effect on autophagy flux, and they potently enhance the cytocidal effect of various anticancer reagents in vitro. This suggests that macrolide antibiotics can be used as an adjuvant for cancer chemotherapy. Since cancer cells require a larger metabolic demand than normal cells because of their exuberant growth, upregulated autophagy in tumor cells has now become the target for cancer therapy. In the present study, we examined whether macrolides exhibit cytotoxic effect under an amino acid-starving condition in head and neck squamous cancer cell lines such as CAL 27 and Detroit 562 as models of solid tumors with an upregulated autophagy in the central region owing to hypovascularity. AZM and CAM induced cell death under the amino acid-depleted (AAD) culture condition in these cell lines along with CHOP upregulation, although they showed no cytotoxicity under the complete culture medium. CHOP knockdown by siRNA in the CAL 27 cells significantly suppressed macrolide-induced cell death under the AAD culture condition. CHOP-/- murine embryonic fibroblast (MEF) cell lines also attenuated AZM-induced cell death compared with CHOP+/+ MEF cell lines. Using a tet-off atg5 MEF cell line, knockout of atg5, an essential gene for autophagy, also induced cell death and CHOP in the AAD culture medium but not in the complete culture medium. This suggest that macrolide-induced cell death via CHOP induction is dependent on autophagy inhibition. The cytotoxicity of macrolide with CHOP induction was completely cancelled by the addition of amino acids in the culture medium, indicating that the cytotoxicity is due to the insufficient amino acid pool. These data suggest the possibility of using macrolides for “tumor-starving therapy”. PMID

  4. Detection of tumor-specific cytotoxic drug activity in vitro using the fluorometric microculture cytotoxicity assay and primary cultures of tumor cells from patients.

    Science.gov (United States)

    Nygren, P; Fridborg, H; Csoka, K; Sundström, C; de la Torre, M; Kristensen, J; Bergh, J; Hagberg, H; Glimelius, B; Rastad, J

    1994-03-01

    The semi-automated fluorometric microculture cytotoxicity assay (FMCA), based on the measurement of fluorescence generated from cellular hydrolysis of fluorescein diacetate (FDA) by viable cells, was employed for cytotoxic drug sensitivity testing of tumor cells from patients with hematological or solid tumors. In total, 390 samples from 20 diagnoses were tested with up to 12 standard cytotoxic drugs. The technical success rate for different tumor types ranged from 67 to 95%. Fluorescence was linearly related to cell number but variably steep depending on tumor type. Samples from most solid tumors thus showed higher signal-to-noise ratios than hematological samples. A wide spectrum of in vitro drug activity was obtained, with acute leukemias and non-Hodgkin's lymphomas being sensitive to almost all tested drugs, whereas renal and adrenocortical carcinomas were essentially totally resistant. Between these extremes were samples of breast and ovarian carcinomas and sarcomas. When in vitro response was compared with known clinical response patterns, a good correspondence was observed. The results indicate that the FMCA is a rapid and efficient method for in vitro measurement of tumor-specific drug activity both in hematological and in solid tumors. The assay may be suitable for new drug development and direction of phase-2 trials to suitable patients.

  5. Identification of stable cytotoxic factors in the gas phase extract of cigarette smoke and pharmacological characterization of their cytotoxicity.

    Science.gov (United States)

    Noya, Yoichi; Seki, Koh-Ichi; Asano, Hiroshi; Mai, Yosuke; Horinouchi, Takahiro; Higashi, Tsunehito; Terada, Koji; Hatate, Chizuru; Hoshi, Akimasa; Nepal, Prabha; Horiguchi, Mika; Kuge, Yuji; Miwa, Soichi

    2013-12-06

    Smoking is a major risk factor for atherosclerotic vascular diseases, but the mechanism for its genesis is unknown. We have recently shown that the gas phase of cigarette smoke (nicotine- and tar-free cigarette smoke extract; CSE) likely to reach the systemic circulation contains stable substances which cause cytotoxicity like plasma membrane damage and cell death in cultured cells, and also that the plasma membrane damage is caused through sequential activation of protein kinase C (PKC) and NADPH oxidase (NOX) and the resulting generation of reactive oxygen species (PKC/NOX-dependent mechanism), whereas cell death is caused through PKC/NOX-dependent and -independent mechanisms. To identify these stable substances, the CSE was prepared by passing the main-stream smoke of 10 cigarettes through a Cambridge glass fiber filter, trapping of the smoke in a vessel cooled at -80°C, and subsequent dissolution in 10ml of water. The CSE was fractionated into nine fractions using reversed-phase HPLC, and each fraction was screened for cytotoxicity in cultured cells, using propidium iodide uptake assay for cell membrane damage and MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] reduction assay for cell viability. The cytotoxicity was positive in two of the nine fractions (Fr2 and Fr5). After extraction of the active fractions into dichloromethane, GC/MS analysis identified 2-cyclopenten-1-one (CPO) in Fr5 but none in Fr2. After derivatization of the active fractions with O-(2,3,4,5,6-pentafluorobenzyl) hydroxylamine hydrochloride, GC/MS analysis identified acrolein, acetone and propionaldehyde in Fr2, and methyl vinyl ketone (MVK) in Fr5. After 4-h incubation, authentic acrolein and MVK induced concentration-dependent cytotoxicity with EC50 values of 75.9±8.2 and 47.0±8.0μM (mean±SEM; n=3), respectively, whereas acetone, propionaldehyde and CPO were without effect. However, after 24-h incubation, CPO induced concentration

  6. Generativity does not necessarily satisfy all your needs: Associations among cultural demand for generativity, generative concern, generative action, and need satisfaction in the elderly in four cultures

    Czech Academy of Sciences Publication Activity Database

    Hofer, J.; Busch, H.; Au, A.; Poláčková Šolcová, Iva; Tavel, P.; Wong, T.T.

    2016-01-01

    Roč. 52, č. 3 (2016), s. 509-519 ISSN 0012-1649 R&D Projects: GA ČR(CZ) GP14-02889P Institutional support: RVO:68081740 Keywords : generative concern * internalized cultural demands * value orientations * generative behavior * basic need satisfaction * culture Subject RIV: AN - Psychology Impact factor: 3.228, year: 2016

  7. In Vitro Production of Echioidinin, 7-O-Methywogonin from Callus Cultures of Andrographis lineata and Their Cytotoxicity on Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Arifullah Mohammed

    Full Text Available Andrographis lineata is an herbal medicinal plant used in traditional medicine as a substitute for Andrographis paniculata. Here, using mature leaf explants of A. lineata we demonstrate for the first time the callus induction established on MS medium containing 1.0 mg l-1 IAA. Dried callus was subjected to solvent extraction with acetone. Further the acetone residue was separated by silica gel column chromatography, crystallized and characterized on the basis of nuclear magnetic resonance (proton and c13 and liquid chromatographic mass spectroscopy. This analysis revealed the occurrence of two known flavones namely, 7-O-methylwogonin (MW and Echioidinin (ED. Furthermore, these compounds were tested for their cytotoxicity against leukemic cell line, CEM. We identify that ED and MW induced cytotoxicity in a time- and concentration-dependent manner. Further increase in the LDH release upon treatment with ED and MW further confirmed our cytotoxicity results against leukemic cell line. Strikingly, MW was more potent than ED when compared by trypan blue and MTT assays. Our results recapitulate the utility of callus cultures for the production of plant specific bioactive secondary metabolites instead of using wild plants. Together, our in vitro studies provide new insights of A. lineata callus cultures serving as a source for cancer chemotherapeutic agents.

  8. In Vitro Production of Echioidinin, 7-O-Methywogonin from Callus Cultures of Andrographis lineata and Their Cytotoxicity on Cancer Cells

    Science.gov (United States)

    Mohammed, Arifullah; Chiruvella, Kishore K.; Rao, Yerra Koteswara; Geethangili, Madamanchi; Raghavan, Sathees C.; Ghanta, Rama Gopal

    2015-01-01

    Andrographis lineata is an herbal medicinal plant used in traditional medicine as a substitute for Andrographis paniculata. Here, using mature leaf explants of A. lineata we demonstrate for the first time the callus induction established on MS medium containing 1.0 mg l–1 IAA. Dried callus was subjected to solvent extraction with acetone. Further the acetone residue was separated by silica gel column chromatography, crystallized and characterized on the basis of nuclear magnetic resonance (proton and c13) and liquid chromatographic mass spectroscopy. This analysis revealed the occurrence of two known flavones namely, 7-O-methylwogonin (MW) and Echioidinin (ED). Furthermore, these compounds were tested for their cytotoxicity against leukemic cell line, CEM. We identify that ED and MW induced cytotoxicity in a time- and concentration-dependent manner. Further increase in the LDH release upon treatment with ED and MW further confirmed our cytotoxicity results against leukemic cell line. Strikingly, MW was more potent than ED when compared by trypan blue and MTT assays. Our results recapitulate the utility of callus cultures for the production of plant specific bioactive secondary metabolites instead of using wild plants. Together, our in vitro studies provide new insights of A. lineata callus cultures serving as a source for cancer chemotherapeutic agents. PMID:26488879

  9. Cytotoxicity of InP/ZnS quantum dots related to reactive oxygen species generation

    Science.gov (United States)

    Chibli, Hicham; Carlini, Lina; Park, Soonhyang; Dimitrijevic, Nada M.; Nadeau, Jay L.

    2011-06-01

    Indium phosphide (InP) quantum dots (QDs) have emerged as a presumably less hazardous alternative to cadmium-based particles, but their cytotoxicity has not been well examined. Although their constituent elements are of very low toxicity to cells in culture, they nonetheless exhibit phototoxicity related to generation of reactive oxygen species by excited electrons and/or holes interacting with water and molecular oxygen. Using spin-trap electron paramagnetic resonance (EPR) spectroscopy and reporter assays, we find a considerable amount of superoxide and a small amount of hydroxyl radical formed under visible illumination of biocompatible InP QDs with a single ZnS shell, comparable to what is seen with CdTe. A double thickness shell reduces the reactive oxygen species concentration approximately two-fold. Survival assays in five cell lines correspondingly indicate a distinct reduction in toxicity with the double-shell InP QDs. Toxicity varies significantly across cell lines according to the efficiency of uptake, being overall significantly less than what is seen with CdTe or CdSe/ZnS. This indicates that InP QDs are a useful alternative to cadmium-containing QDs, while remaining capable of electron-transfer processes that may be undesirable or which may be exploited for photosensitization applications.

  10. Cytotoxicity of InP/ZnS quantum dots related to reactive oxygen species generation.

    Energy Technology Data Exchange (ETDEWEB)

    Chibli, H.; Carlini, L.; Park, S.; Dimitrijevic, N. M.; Nadeau, J. L. (Center for Nanoscale Materials); ( CSE); (McGill Univ.)

    2011-01-01

    Indium phosphide (InP) quantum dots (QDs) have emerged as a presumably less hazardous alternative to cadmium-based particles, but their cytotoxicity has not been well examined. Although their constituent elements are of very low toxicity to cells in culture, they nonetheless exhibit phototoxicity related to generation of reactive oxygen species by excited electrons and/or holes interacting with water and molecular oxygen. Using spin-trap electron paramagnetic resonance (EPR) spectroscopy and reporter assays, we find a considerable amount of superoxide and a small amount of hydroxyl radical formed under visible illumination of biocompatible InP QDs with a single ZnS shell, comparable to what is seen with CdTe. A double thickness shell reduces the reactive oxygen species concentration approximately two-fold. Survival assays in five cell lines correspondingly indicate a distinct reduction in toxicity with the double-shell InP QDs. Toxicity varies significantly across cell lines according to the efficiency of uptake, being overall significantly less than what is seen with CdTe or CdSe/ZnS. This indicates that InP QDs are a useful alternative to cadmium-containing QDs, while remaining capable of electron-transfer processes that may be undesirable or which may be exploited for photosensitization applications.

  11. Identification of Alternaria alternata Mycotoxins by LC-SPE-NMR and Their Cytotoxic Effects to Soybean (Glycine max Cell Suspension Culture

    Directory of Open Access Journals (Sweden)

    Edson Rodrigues-Filho

    2013-02-01

    Full Text Available This present work describes the application of liquid chromatograpy-solid phase extraction-nuclear magnetic resonance spectroscopy to analyse Alternaria alternata crude extracts. Altenusin (1, alternariol (2, 3'-hydroxyalternariol monomethyl ether (3, and alternariol monomethyl ether (4, were separated and identified. High-resolution mass spectrometry confirmed the proposed structures. The cytotoxic effects of these compounds towards plants were determined using soybean (Glycine max cell cultures as a model. EC50 values which range from 0.11 (±0.02 to 4.69 (±0.47 μM showed the high cytotoxicity of these compounds.

  12. Size-dependent cytotoxicity of yttrium oxide nanoparticles on primary osteoblasts in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Guoqiang, E-mail: zhougq1982@163.com; Li, Yunfei; Ma, Yanyan; Liu, Zhu; Cao, Lili; Wang, Da; Liu, Sudan; Xu, Wenshi; Wang, Wenying [Hebei University, Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of Ministry of Education, Key Laboratory of Chemical Biology of Hebei Province, College of Chemistry and Environmental Science (China)

    2016-05-15

    Yttrium oxide nanoparticles are an excellent host material for the rare earth metals and have high luminescence efficiency providing a potential application in photodynamic therapy and biological imaging. In this study, the effects of yttrium oxide nanoparticles with four different sizes were investigated using primary osteoblasts in vitro. The results demonstrated that the cytotoxicity generated by yttrium oxide nanoparticles depended on the particle size, and smaller particles possessed higher toxicological effects. For the purpose to elucidate the relationship between reactive oxygen species generation and cell damage, cytomembrane integrity, intracellular reactive oxygen species level, mitochondrial membrane potential, cell apoptosis rate, and activity of caspase-3 in cells were then measured. Increased reactive oxygen species level was also observed in a size-dependent way. Thus, our data demonstrated that exposure to yttrium oxide nanoparticles resulted in a size-dependent cytotoxicity in cultured primary osteoblasts, and reactive oxygen species generation should be one possible damage pathway for the toxicological effects produced by yttrium oxide particles. The results may provide useful information for more rational applications of yttrium oxide nanoparticles in the future.

  13. Cytotoxic effects of nanosilver are highly dependent on the chloride concentration and the presence of organic compounds in the cell culture media.

    Science.gov (United States)

    Kaiser, Jean-Pierre; Roesslein, Matthias; Diener, Liliane; Wichser, Adrian; Nowack, Bernd; Wick, Peter

    2017-01-06

    Nanosilver shows great promise for use in industrial, consumer or medical products because of its antimicrobial properties. However, the underlying mechanisms of the effects of silver nanoparticles on human cells are still controversial. Therefore, in the present study the influence of the chloride concentration and different serum content of culture media on the cytotoxic effects of nanosilver was systematically evaluated. Our results show that nanosilver toxicity was strongly affected by the composition of the culture media. The chloride concentration, as well as the carbon content affected the silver agglomeration and the complex formation. But also the dissolution of nanosilver and the availability of free silver ions (Ag + ) were severely affected by the compositions of the culture media. Cells, only exposed to silver particles in suspension and dissolved silver complexes, did not show any effects under all conditions. Nanosilver agglomerates and silver complexes were not very soluble. Thus, cells growing on the bottom of the culture dishes were exposed to sedimented nanosilver agglomerates and precipitated silver complexes. Locally, the concentration of silver on the cell surface was very high, much higher compared the silver concentration in the bulk solution. The cytotoxic effects of nanosilver are therefore a combination of precipitated silver complexes and organic silver compounds rather than free silver ions. Silver coatings are used in health care products due to their bacteriostatic or antibacterial properties. The assessment of the toxicity of a certain compound is mostly done using in vitro assays. Therefore, cytotoxicity studies of nanosilver using human cell cultures have to be undertaken under well controlled and understood cultivations conditions in order to improve the compatibility of different studies. Especially when eukaryotic versus prokaryotic systems are compared for the evaluation of the use of nanosilver as antibacterial coatings for

  14. Generativity Does Not Necessarily Satisfy All Your Needs: Associations among Cultural Demand for Generativity, Generative Concern, Generative Action, and Need Satisfaction in the Elderly in Four Cultures

    Science.gov (United States)

    Hofer, Jan; Busch, Holger; Au, Alma; Polácková Šolcová, Iva; Tavel, Peter; Tsien Wong, Teresa

    2016-01-01

    The present study examines the association between various facets of generativity, that is, cultural demand for generativity, generative concern, and generative action, with the satisfaction of the needs for relatedness, competence, and autonomy in samples of elderly from Cameroon, China (Hong Kong), the Czech Republic, and Germany. Participants…

  15. Cerebrospinal fluid cytotoxicity does not affect survival in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Galán, L; Matías-Guiu, J; Matias-Guiu, J A; Yáñez, M; Pytel, V; Guerrero-Sola, A; Vela-Souto, A; Arranz-Tagarro, J A; Gómez-Pinedo, U; García, A G

    2017-09-01

    Cerebrospinal fluid (CSF) from some patients with amyotrophic lateral sclerosis (ALS) has been demonstrated to significantly reduce the neuronal viability of primary cell cultures of motor neurons. We aimed to study the potential clinical consequences associated with the cytotoxicity of CSF in a cohort of patients with ALS. We collected CSF from thirty-one patients with ALS. We analysed cytotoxicity by incubating it into the primary cultures of motor cortex neurons. Neural viability was quantified after 24 hours using the colorimetric MTT reduction assay. All patients were followed up from the moment of diagnosis to death, and a complete evaluation during disease progression and survival was performed, including gastrostomy and respiratory assistance. Twenty-one patients (67.7%) presented a cytotoxic CSF. There were no significant differences between patients with and without cytotoxicity regarding mean time from symptom onset to the diagnosis, from the diagnosis to death, from the diagnosis to respiratory assistance with BIPAP, from diagnosis to gastrostomy and from the onset of symptoms to death. In Cox regression analysis, bulbar onset, but not cytotoxicity, gender or age at onset, was associated with a lower risk of survival. Cerebrospinal fluid cytotoxicity was not associated with differential survival rates. This suggests that the presence of cytotoxicity in CSF, measured through neuronal viability in primary cultures of motor cortex neurons, could reflect different mechanisms of the disease, but it does not predict disease outcome. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Activity-guided isolation of cytotoxic bis-bibenzyl constituents from Dumortiera hirsuta.

    Science.gov (United States)

    Toyota, Masao; Ikeda, Risa; Kenmoku, Hiromichi; Asakawa, Yoshinori

    2013-01-01

    Activity-guided fractionation of the ether extract of Dumortiera hirsute (Japanese liverwort), using cytotoxicity testing with cultured HL 60 and KB cells, resulted in the isolation of a new cytotoxic bis-bibenzyl compound, along with the two known bis-bibenzyls: isomarchantin C and isoriccardin C. The structural determination of the new bis-bibenzyl through extensive NMR spectral data indicated a derivative of marchantin A, which has been isolated from the liverwort Marchantia polymorpha. The cytotoxicity of the bis-bibenzyls was evaluated by the MTT (3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay using cultured HL 60 and KB cells.

  17. Effect of radiation on the induction of anti-hapten cytotoxic T-lymphocytes

    International Nuclear Information System (INIS)

    Ito, Shinichi; Hachisu, Reiko.

    1987-01-01

    Effect of ionizing radiation on the induction process of cytotoxic T lymphocytes was studied. We used trinitrophenyl (TNP) as hapten to modify the syngeneic spleen cells. Anti-TNP cytotoxic T lymphocytes (TNP-CTL) were induced from normal spleen cells of C3H mice. The spleen cells were stimulated with TNP-modified spleen cells and cultured for five days in CO 2 incubator (37 deg C, 5 % CO 2 ). Then, the activity of TNP-CTL was measured with 51 Cr release assay. Syngeneic tumor cells, X5563 cells, were labeled with 51 Cr and used as target cells in the assay. The spleen cells were irradiated with 0, 0.5, or 2Gy in course of five days culture. The activity of TNP-CTL was greatly reduced when the spleen cells were irradiated by two days after the initiation of the culture. On the other hand, irradiation was less effective to reduce the TNP-CTL activity on the spleen cells which were cultured longer than three days. Therefore efficacy of the irradiation to suppress the generation of TNP-CTL was gradually reduced with the passing of the culture day. This suggests that the radiosensitivity of the spleen cells which probably include precursor cells of CTL and helper T cells were decreased with the matuation of these cells. The results supported that matured TNP-CTL was radioresistant, for it's activity did not decrease after the irradiation up to 42Gy. (author)

  18. Real-time monitoring of cisplatin cytotoxicity on three-dimensional spheroid tumor cells

    Directory of Open Access Journals (Sweden)

    Baek NH

    2016-07-01

    Full Text Available NamHuk Baek,1,* Ok Won Seo,1,* Jaehwa Lee,1 John Hulme,2 Seong Soo A An2 1Department of Research and Development, NanoEntek Inc., Seoul, 2Department of BioNano Technology, Gachon University, Gyeonggi-do, Korea *These authors contributed equally to this work Abstract: Three-dimensional (3D cell cultivation is a powerful technique for monitoring and understanding diverse cellular mechanisms in developmental cancer and neuronal biology, tissue engineering, and drug development. 3D systems could relate better to in vivo models than two-dimensional (2D cultures. Several factors, such as cell type, survival rate, proliferation rate, and gene and protein expression patterns, determine whether a particular cell line can be adapted to a 3D system. The 3D system may overcome some of the limitations of 2D cultures in terms of cell–cell communication and cell networks, which are essential for understanding differentiation, structural organization, shape, and extended connections with other cells or organs. Here, the effect of the anticancer drug cisplatin, also known as cis-diamminedichloroplatinum (II or CDDP, on adenosine triphosphate (ATP generation was investigated using 3D spheroid-forming cells and real-time monitoring for 7 days. First, 12 cell lines were screened for their ability to form 3D spheroids: prostate (DU145, testis (F9, embryonic fibroblast (NIH-3T3, muscle (C2C12, embryonic kidney (293T, neuroblastoma (SH-SY5Y, adenocarcinomic alveolar basal epithelial cell (A549, cervical cancer (HeLa, HeLa contaminant (HEp2, pituitary epithelial-like cell (GH3, embryonic cell (PA317, and osteosarcoma (U-2OS cells. Of these, eight cell lines were selected: NIH-3T3, C2C12, 293T, SH-SY5Y, A549, HeLa, PA317, and U-2OS; and five underwent real-time monitoring of CDDP cytotoxicity: HeLa, A549, 293T, SH-SY5Y, and U-2OS. ATP generation was blocked 1 day after addition of 50 µM CDDP, but cytotoxicity in HeLa, A549, SH-SY5Y, and U-2OS cells could be

  19. RELATIONS BETWEEN INVITRO CYTOTOXICITY AND CROSS-LINKED DERMAL SHEEP COLLAGENS

    NARCIS (Netherlands)

    VANLUYN, MJA; VANWACHEM, PB; DAMINK, LO; DIJKSTRA, PJ; FEIJEN, J; NIEUWENHUIS, P

    Collagen-based biomaterials have found various applications in the biomedical field. However, collagen-based biomaterials may induce cytotoxic effects. This study evaluated possible cytotoxic effects of (crosslinked) dermal sheep collagen (DSC) using a 7-d-methylcellulose cell culture with human

  20. sigma receptor ligands attenuate N-methyl-D-aspartate cytotoxicity in dopaminergic neurons of mesencephalic slice cultures.

    Science.gov (United States)

    Shimazu, S; Katsuki, H; Takenaka, C; Tomita, M; Kume, T; Kaneko, S; Akaike, A

    2000-01-28

    We investigated the potential neuroprotective effects of several sigma receptor ligands in organotypic midbrain slice cultures as an excitotoxicity model system. When challenged with 100-microM N-methyl-D-aspartate (NMDA) for 24 h, dopaminergic neurons in midbrain slice cultures degenerated, and this was prevented by (5R, 10S)-(+)-5-methyl-10,11-dihydro-5H-dibenzo[a,b]-cyclohepten-5, 10-imine (MK-801; 1-10 microM). Concomitant application of ifenprodil (1-10 microM) or haloperidol (1-10 microM), both of which are high-affinity sigma receptor ligands, significantly attenuated the neurotoxicity of 100 microM NMDA. The sigma(1) receptor-selective ligand (+)-N-allylnormetazocine ((+)-SKF 10047; 1-10 microM) was also effective in attenuating the toxicity of NMDA. The effect of R(-)-N-(3-phenyl-1-propyl)-1-phenyl-2-aminopropane hydrochloride ((-)-PPAP), a sigma receptor ligand with negligible affinity for the phencyclidine site of NMDA receptors, was also examined. (-)-PPAP (3-100 microM) caused a concentration-dependent reduction of NMDA cytotoxicity, with significant protection at concentrations of 30 and 100 microM. In contrast, (+)-SKF 10047 (10 microM) and (-)-PPAP (100 microM) showed no protective effects against cell death induced by the Ca(2+) ionophore ionomycin (1-3 microM). These results indicate that sigma receptor ligands attenuate the cytotoxic effects of NMDA on midbrain dopaminergic neurons, possibly via inhibition of NMDA receptor functions.

  1. Comparison of generation 3 polyamidoamine dendrimer and generation 4 polypropylenimine dendrimer on drug loading, complex structure, release behavior, and cytotoxicity

    Science.gov (United States)

    Shao, Naimin; Su, Yunzhang; Hu, Jingjing; Zhang, Jiahai; Zhang, Hongfeng; Cheng, Yiyun

    2011-01-01

    Background Polyamidoamine (PAMAM) and polypropylenimine (PPI) dendrimers are the commercially available and most widely used dendrimers in pharmaceutical sciences and biomedical engineering. In the present study, the loading and release behaviors of generation 3 PAMAM and generation 4 PPI dendrimers with the same amount of surface amine groups (32 per dendrimer) were compared using phenylbutazone as a model drug. Methods The dendrimer-phenylbutazone complexes were characterized by 1H nuclear magnetic resonance and nuclear Overhauser effect techniques, and the cytotoxicity of each dendrimer was evaluated. Results Aqueous solubility results suggest that the generation 3 PAMAM dendrimer has a much higher loading ability towards phenylbutazone in comparison with the generation 4 PPI dendrimer at high phenylbutazone-dendrimer feeding ratios. Drug release was much slower from the generation 3 PAMAM matrix than from the generation 4 PPI dendrimer. In addition, the generation 3 PAMAM dendrimer is at least 50-fold less toxic than generation 4 PPI dendrimer on MCF-7 and A549 cell lines. Conclusion Although the nuclear Overhauser effect nuclear magnetic resonance results reveal that the generation 4 PPI dendrimer with a more hydrophobic interior encapsulates more phenylbutazone, the PPI dendrimer-phenylbutazone inclusion is not stable in aqueous solution, which poses a great challenge during drug development. PMID:22267921

  2. Use of a mixed culture strategy to isolate halophilic bacteria with antibacterial and cytotoxic activity from the Manaure solar saltern in Colombia.

    Science.gov (United States)

    Conde-Martínez, Natalia; Acosta-González, Alejandro; Díaz, Luis E; Tello, Edisson

    2017-12-08

    Water evaporation in solar salterns creates salinity gradients that promote the adaptation of microbial species to different salinities. This competitive habitat challenges the metabolic capabilities of microorganisms and promotes alterations in their production of secondary metabolites. Thus, solar salterns are a potentially important source of new natural products. In Colombia, the most important and representative solar saltern is located in Manaure (La Guajira) in the north of Colombia. The aim of this study was to develop an alternative screening strategy to select halophilic bacteria as producers of bioactive compounds from mixed microbial cultures rather than individual environmental isolates. Brine and sediment samples from different ponds (across a salinity gradient) were inoculated in seven different culture media to grow bacteria and archaea, allowing for a total of 40 different mixed cultures. An organic extract from each mixed culture was obtained and tested against multidrug resistant pathogens, including Klebsiella pneumoniae, vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus and Bacillus subtilis. In addition, the extracts were tested against two human cancer cell lines, cervical adenocarcinoma (SiHa) and lung carcinoma (A-549). Twenty-four of the forty extracts from mixed cultures obtained from brine and sediment samples from the Manaure solar saltern showed antibacterial activity against Bacillus subtilis. Two extracts, referred to as A1SM3-29 and A1SM3-36, were also active against a methicillin-resistant Staphylococcus aureus, with the latter extract also showing slight cytotoxic activity against the assayed human lung cancer cell line. From this mixed culture, nine isolates were cultivated, and their extracts were tested against the same pathogens, resulting in the identification of a Vibrio sp. strain (A1SM3-36-8) with antimicrobial activity that was similar to that observed for the mixed culture extract

  3. Sunitinib indirectly enhanced anti-tumor cytotoxicity of cytokine-induced killer cells and CD3⁺CD56⁺ subset through the co-culturing dendritic cells.

    Directory of Open Access Journals (Sweden)

    Adisak Wongkajornsilp

    Full Text Available Cytokine-induced killer (CIK cells have reached clinical trials for leukemia and solid tumors. Their anti-tumor cytotoxicity had earlier been shown to be intensified after the co-culture with dendritic cells (DCs. We observed markedly enhanced anti-tumor cytotoxicity activity of CIK cells after the co-culture with sunitinib-pretreated DCs over that of untreated DCs. This cytotoxicity was reliant upon DC modulation by sunitinib because the direct exposure of CIK cells to sunitinib had no significant effect. Sunitinib promoted Th1-inducing and pro-inflammatory phenotypes (IL-12, IFN-γ and IL-6 in DCs at the expense of Th2 inducing phenotype (IL-13 and regulatory phenotype (PD-L1, IDO. Sunitinib-treated DCs subsequently induced the upregulation of Th1 phenotypic markers (IFN-γ and T-bet and the downregulation of the Th2 signature (GATA-3 and the Th17 marker (RORC on the CD3⁺CD56⁺ subset of CIK cells. It concluded that sunitinib-pretreated DCs drove the CD3⁺CD56⁺ subset toward Th1 phenotype with increased anti-tumor cytotoxicity.

  4. Application of hanging drop technique for stem cell differentiation and cytotoxicity studies.

    Science.gov (United States)

    Banerjee, Meenal; Bhonde, Ramesh R

    2006-05-01

    The aim of our study is to explore the possibility of using an ancient method of culture technique- the hanging drop technique for stem cell differentiation and cytotoxicity testing. We demonstrate here a variety of novel applications of this age old technique not only to harness the differentiation potential of stem cells into specific lineages but also for cytotoxicity studies. Here we have prepared hanging drop cultures by placing 20 microl micro-drops of nutrient media and 10% Fetal Calf Serum (FCS) containing cells of interest on the lids of 60 mm dishes. Bottom plates of the dishes were filled with sterile Phosphate Buffer Saline (PBS) to avoid desiccation of samples. Lids were then placed on the bottom plates to achieve hanging drop cultures. We utilized this technique for cultivation of ciliated epithelia to study cytotoxicity and differentiation of bone marrow stromal cells. Most importantly the modified culture technique presented here is simple, economical and cost effective in terms of the time taken and the reagents required and are amenable to goal specific modification such as cytotoxicity testing. It is advantageous over the existing system in terms of retention of viability and functionality for longer duration and for providing three dimensional growth micro-environment making it useful for organotypic cultures and in vivo simulation.

  5. Comparative cytotoxicity of periodontal bacteria

    International Nuclear Information System (INIS)

    Stevens, R.H.; Hammond, B.F.

    1988-01-01

    The direct cytotoxicity of sonic extracts (SE) from nine periodontal bacteria for human gingival fibroblasts (HGF) was compared. Equivalent dosages (in terms of protein concentration) of SE were used to challenge HGF cultures. The cytotoxic potential of each SE was assessed by its ability to (1) inhibit HGF proliferation, as measured by direct cell counts; (2) inhibit 3H-thymidine incorporation in HGF cultures; or (3) cause morphological alterations of the cells in challenged cultures. The highest concentration (500 micrograms SE protein/ml) of any of the SEs used to challenge the cells was found to be markedly inhibitory to the HGFs by all three of the criteria of cytotoxicity. At the lowest dosage tested (50 micrograms SE protein/ml); only SE from Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, and Fusobacterium nucleatum caused a significant effect (greater than 90% inhibition or overt morphological abnormalities) in the HGFs as determined by any of the criteria employed. SE from Capnocytophaga sputigena, Eikenella corrodens, or Wolinella recta also inhibited cell proliferation and thymidine incorporation at this dosage; however, the degree of inhibition (5-50%) was consistently, clearly less than that of the first group of three organisms named above. The SE of the three other organisms tested (Actinomyces odontolyticus, Bacteroides intermedius, and Streptococcus sanguis) had little or no effect (0-10% inhibition) at this concentration. The data suggest that the outcome of the interaction between bacterial components and normal resident cells of the periodontium is, at least in part, a function of the bacterial species

  6. KHYG-1, a model for the study of enhanced natural killer cell cytotoxicity.

    Science.gov (United States)

    Suck, Garnet; Branch, Donald R; Smyth, Mark J; Miller, Richard G; Vergidis, Joanna; Fahim, Soad; Keating, Armand

    2005-10-01

    To compare the cytotoxicity of KHYG-1 with other natural killer (NK)/NK T-cell lines and identify molecules that may be associated with enhanced cytotoxicity, thereby eventually leading to improved NK cell-mediated cancer immunotherapy. NK/NK T-cell lines KHYG-1, NK-92, YT, and SNT-8 were compared with a novel flow cytometric cytotoxicity assay under different culture conditions. Transcription, expression, and phosphorylation studies were performed using polymerase chain reaction sequence-specific primers, reverse transcription polymerase chain reaction, immunoblotting, and flow cytometry. KHYG-1 is a highly cytotoxic cell line, exceeding the cytolytic capacity of the other cell lines against K562. KHYG-1 is also highly cytotoxic against the leukemia cell lines EM2, EM3, and HL60. The novel activation receptor NKp44 and its adaptor, DAP12, NKG2D, and constitutively phosphorylated ERK2 may be associated with the enhanced cytotoxicity of KHYG-1. This cell line most likely mediates cytolysis by granzyme M (but not granzymes A and B) together with perforin, which is constitutively fully cleaved to the 60-kD form, in contrast to the other cell lines. KHYG-1 is a valuable model for the study of enhanced cytotoxicity by NK cells. In addition to the activation of NKp44, KHYG-1 may induce apoptosis of tumor cells by the newly described granzyme M/perforin pathway. Targeted modifications of effector molecules demonstrated in this model could generate NK cells with even greater killing ability that may be particularly attractive for clinical application. Moreover, our demonstration of greater cytotoxicity of KHYG-1 versus NK-92 cells, already in clinical trials, suggests a direct therapeutic role for KHYG-1.

  7. Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

    Directory of Open Access Journals (Sweden)

    DA Ribeiro

    2011-01-01

    Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

  8. Oxidative Mechanisms of Monocyte-Mediated Cytotoxicity

    Science.gov (United States)

    Weiss, Stephen J.; Lobuglio, Albert F.; Kessler, Howard B.

    1980-01-01

    Human monocytes stimulated with phorbol myristate acetate were able to rapidly destroy autologous erythrocyte targets. Monocyte-mediated cytotoxicity was related to phorbol myristate acetate concentration and monocyte number. Purified preparations of lymphocytes were incapable of mediating erythrocyte lysis in this system. The ability of phorbol myristate acetate-stimulated monocytes to lyse erythrocyte targets was markedly impaired by catalase or superoxide dismutase but not by heat-inactivated enzymes or albumin. Despite a simultaneous requirement for superoxide anion and hydrogen peroxide in the cytotoxic event, a variety of hydroxyl radical and singlet oxygen scavengers did not effect cytolysis. However, tryptophan significantly inhibited cytotoxicity. The myeloperoxidase inhibitor cyanide enhanced erythrocyte destruction, whereas azide reduced it modestly. The inability of cyanide to reduce cytotoxicity coupled with the protective effect of superoxide dismutase suggests that cytotoxicity is independent of the classic myeloperoxidase system. We conclude that monocytes, stimulated with phorbol myristate acetate, generate superoxide anion and hydrogen peroxide, which together play an integral role in this cytotoxic mechanism.

  9. DNA damage and cytotoxicity in type II lung epithelial (A549) cell cultures after exposure to diesel exhaust and urban street particles

    DEFF Research Database (Denmark)

    Danielsen, Pernille Høgh; Loft, Steffen; Møller, Peter

    2008-01-01

    ABSTRACT: BACKGROUND: Exposure to air pollution particles has been acknowledged to be associated with excess generation of oxidative damage to DNA in experimental model systems and humans. The use of standard reference material (SRM), such as SRM1650 and SRM2975, is advantageous because experiments...... collected at a traffic intensive road in Copenhagen, Denmark. RESULTS: All of the particles generated strand breaks and oxidized purines in A549 lung epithelial cells in a dose-dependent manner and there were no overt differences in their potency. The exposures also yielded dose-dependent increase...... of cytotoxicity (as lactate dehydrogenase release) and reduced colony forming ability with slightly stronger cytotoxicity of SRM1650 than of the other particles. In contrast, only the authentic street particles were able to generate 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in calf thymus DNA, which might...

  10. Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

    Science.gov (United States)

    Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

    2009-01-01

    Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

  11. Cytotoxic and genotoxic effect of the [166Dy]Dy/166Ho-EDTMP in vivo generator system in mice

    International Nuclear Information System (INIS)

    Pedraza-Lopez, Martha; Ferro-Flores, Guillermina; Arteaga de Murphy, Consuelo; Morales-Ramirez, Pedro; Piedras-Ross, Josefa; Murphy-Stack, Eduardo; Hernandez-Oviedo, Omar

    2004-01-01

    Multiple myeloma and other hematological malignancies have been treated by myeloablative radiotherapy/chemotherapy and subsequent stem cell transplantation. [ 166 Dy]Dy/ 166 Ho-ethylenediaminetetramethylene phosphonate (EDTMP) forms a stable in vivo generator system with selective skeletal uptake in mice; therefore, it could work as a potential and improved agent for marrow ablation. Induced bone marrow cytotoxicity and genotoxicity are determined by the reduction of reticulocytes (RET) and elevation of micronucleated reticulocyte (MN-RET) in peripheral blood and ablation by bone marrow histological studies. The aim of this study was to determine the bone marrow cytotoxic and genotoxic effect of the [ 166 Dy]Dy/ 166 Ho-EDTMP in vivo generator system in mice and to evaluate by histopathology its myeloablative potential. Enriched 166 Dy 2 O 3 was irradiated and [ 166 Dy]DyCl 3 was added to EDTMP in phosphate buffer (pH 8.0) in a molar ratio of 1:1.75. QC was determined by TLC. Dy-EDTMP complex was prepared the same way with nonirradiated dysprosium oxide. A group of BALB/c mice were intraperitoneally injected with the radiopharmaceutical and two groups of control animals were injected with the cold complex and with 0.9% sodium chloride, respectively. A blood sample was taken at the beginning of the experiments and every 48 h for 12 days postinjection. The animals were sacrificed, organs of interest taken out and the radioactivity determined. The femur was used for histological studies. Flow cytometry analysis was used to quantify the frequency of RET and MN-RET in the blood samples. The MCNP4B Monte Carlo computer code was used for dosimetry calculations. Radiochemical purity was 99% and the mean specific activity was 1.3 MBq/mg. The RET and MN-RET frequency were statistically different in the treatment at the end of the 12-day period demonstrating cytotoxicity and genotoxicity induced by the in vivo generator system. The histology studies show that there was

  12. In vitro cytotoxity of silver: implication for clinical wound care.

    Science.gov (United States)

    Poon, Vincent K M; Burd, Andrew

    2004-03-01

    In this study, we look at the cytotoxic effects of silver on keratinocytes and fibroblasts. We have assessed the viability of monolayer cultures using the MTT and BrdU assays. The composition of the culture medium and also the culture technique were modified to assess the effects of culture 'environment' on the susceptibility of the cells to the toxic action of silver. Further in vitro, experiments were performed using tissue culture models to allow cellular behavior in three dimensional planes which more closely simulated in vivo behavior. The silver source was both silver released from silver nitrate solution but also nanocrystalline silver released from a commercially available dressing. The results show that silver is highly toxic to both keratinocytes and fibroblasts in monolayer culture. When using optimized and individualized culture the fibroblasts appear to be more sensitive to silver than keratinocytes. However, when both cell types were grown in the same medium their viability was the same. Using tissue culture models again indicated an 'environmental effect' with decreased sensitivity of the cells to the cytotoxic effects of the silver. Nevertheless in these studies the toxic dose of skin cells ranging from 7 x 10(-4) to 55 x 10(-4)% was similar to that of bacteria. These results suggest that consideration of the cytotoxic effects of silver and silver-based products should be taken when deciding on dressings for specific wound care strategies. This is important when using keratinocyte culture, in situ, which is playing an increasing role in contemporary wound and burn care.

  13. Cytotoxicity and cellular uptake of ZnS:Mn nanocrystals biofunctionalized with chitosan and aminoacids

    Digital Repository Service at National Institute of Oceanography (India)

    Augustine, M.S.; Anas, A.; Das, A.V.; Sreekanth, S.; Jayalekshmi, S.

    into solution and by generating free radical species. In animal experiments, QDs preferentially enter the liver and spleen follow-ing intravascular injection which undergo minimal excretion if lar-ger than 6 nm, and appear to be safe to the animal. The present... recently on toxicity studies of quantum dots (QDs) in cells and animals [49,50]. Cell culture experiments have shown that QDs undergo design- dependent intracellular localiza-tion which can cause cytotoxicity by releasing free toxic materials...

  14. Control of microorganisms of oral health interest with Arctium lappa L. (burdock) extract non-cytotoxic to cell culture of macrophages (RAW 264.7).

    Science.gov (United States)

    de Oliveira, Jonatas Rafael; de Aguiar Almeida, Rosilene Batista; das Graças Figueiredo Vilela, Polyana; de Oliveira, Felipe Eduardo; da Rocha, Rosilene Fernandes; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

    2014-08-01

    To evaluate the antimicrobial activity of Arctium lappa L. extract on Staphylococcus aureus, S. epidermidis, Streptococcus mutans, Candida albicans, C. tropicalis and C. glabrata. In addition, the cytotoxicity of this extract was analyzed on macrophages (RAW 264.7). By broth microdilution method, different concentrations of the extract (250-0.4 mg/mL) were used in order to determine the minimum microbicidal concentration (MMC) in planktonic cultures and the most effective concentration was used on biofilms on discs made of acrylic resin. The cytotoxicity A. lappa L. extract MMC was evaluated on RAW 264.7 by MTT assay and the quantification of IL-1β and TNF-α by ELISA. The most effective concentration was 250 mg/mL and also promoted significant reduction (log₁₀) in the biofilms of S. aureus (0.438 ± 0.269), S. epidermidis (0.377 ± 0.298), S. mutans (0.244 ± 0.161) and C. albicans (0.746 ± 0.209). Cell viability was similar to 100%. The production of IL-1β was similar to the control group (p>0.05) and there was inhibition of TNF-α (plappa L. extract was microbicidal for all the evaluated strains in planktonic cultures, microbiostatic for biofilms and not cytotoxic to the macrophages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. DETECTION OF BACTERIAL CYTOTOXIC ACTIVITIES FROM WATER-DAMAGED CEILING TILE MATERIAL FOLLOWING INCUBATION ON BLOOD AGAR

    Science.gov (United States)

    Samples of ceiling tiles with high levels of bacteria exhibited cytotoxic activities on a HEP-2 tissue culture assay. Ceiling tiles containing low levels of bacterial colonization did not show cytotoxic activities on the HEP-2 tissue culture assay. Using a spread plate procedure ...

  16. Does cross-generational epigenetic inheritance contribute to cultural continuity?

    Science.gov (United States)

    Pembrey, Marcus E

    2018-04-01

    Human studies of cross-generational epigenetic inheritance have to consider confounding by social patterning down the generations, often referred to as 'cultural inheritance'. This raises the question to what extent is 'cultural inheritance' itself epigenetically mediated rather than just learnt. Human studies of non-genetic inheritance have demonstrated that, beyond foetal life, experiences occurring in mid-childhood before puberty are the most likely to be associated with cross-generational responses in the next generation(s). It is proposed that cultural continuity is played out along the axis, or 'payoff', between responsiveness and stability. During the formative years of childhood a stable family and/or home permits small children to explore and thereby learn. To counter disruptions to this family home ideal, cultural institutions such as local schools, religious centres and market places emerged to provide ongoing stability, holding the received wisdom of the past in an accessible state. This cultural support allows the growing child to freely indulge their responsiveness. Some of these prepubertal experiences induce epigenetic responses that also transfer molecular signals to the gametes through which they contribute to the conception of future offspring. In parallel co-evolution with growing cultural support for increasing responsiveness, 'runaway' responsiveness is countered by the positive selection of genetic variants that dampen responsiveness. Testing these ideas within longitudinal multigenerational cohorts will need information on ancestors/parents' own communities and experiences (Exposome scans) linked to ongoing Phenome scans on grandchildren; coupled with epigenome analysis, metastable epialleles and DNA methylation age. Interactions with genetic variants affecting responsiveness should help inform the broad hypothesis.

  17. 3-Dimensional culture systems for anti-cancer compound profiling and high-throughput screening reveal increases in EGFR inhibitor-mediated cytotoxicity compared to monolayer culture systems.

    Science.gov (United States)

    Howes, Amy L; Richardson, Robyn D; Finlay, Darren; Vuori, Kristiina

    2014-01-01

    3-dimensional (3D) culture models have the potential to bridge the gap between monolayer cell culture and in vivo studies. To benefit anti-cancer drug discovery from 3D models, new techniques are needed that enable their use in high-throughput (HT) screening amenable formats. We have established miniaturized 3D culture methods robust enough for automated HT screens. We have applied these methods to evaluate the sensitivity of normal and tumorigenic breast epithelial cell lines against a panel of oncology drugs when cultured as monolayers (2D) and spheroids (3D). We have identified two classes of compounds that exhibit preferential cytotoxicity against cancer cells over normal cells when cultured as 3D spheroids: microtubule-targeting agents and epidermal growth factor receptor (EGFR) inhibitors. Further improving upon our 3D model, superior differentiation of EC50 values in the proof-of-concept screens was obtained by co-culturing the breast cancer cells with normal human fibroblasts and endothelial cells. Further, the selective sensitivity of the cancer cells towards chemotherapeutics was observed in 3D co-culture conditions, rather than as 2D co-culture monolayers, highlighting the importance of 3D cultures. Finally, we examined the putative mechanisms that drive the differing potency displayed by EGFR inhibitors. In summary, our studies establish robust 3D culture models of human cells for HT assessment of tumor cell-selective agents. This methodology is anticipated to provide a useful tool for the study of biological differences within 2D and 3D culture conditions in HT format, and an important platform for novel anti-cancer drug discovery.

  18. Generation of cytotoxic T lymphocytes in vitro. VII. Suppressive effect of irradiated MLC cells on CTL response

    International Nuclear Information System (INIS)

    Fitch, F.W.; Engers, H.D.; Cerottini, J.C.; Bruner, K.T.

    1976-01-01

    Irradiated cells obtained from MLC at the peak of the CTL response caused profound suppression of generation of CTL when added in small numbers at the initiation of primary MLC prepared with normal spleen cells. The inhibitory activity of the MLC cells was not affected by irradiation (1000 rads) but was abolished by treatment with anti-theta serum and complement. The suppression was immunologically specific. The response of A (H-2/sup a/) spleen cells toward C3H (H-2/sup k/) alloantigens was suppressed by irradiated MLC cells obtained from MLC prepared with A spleen cells and irradiated C3H-stimulating cells, whereas the response of A spleen cells toward DBA/2 (H-2/sup d/) alloantigens was affected relatively little. However, if irradiated C3H x DBA/2F1 hybrid spleen cells were used to stimulate A spleen cells in MLC, addition of irradiated MLC cells having cytotoxic activity toward C3H antigens abolished the response to both C3H and DBA/2 antigens. The response to DBA/2 antigens was much less affected when a mixture of irradiated C3H and DBA/2 spleen cells was used as stimulating cells. Thus, the presence of MLC cells having cytotoxic activity toward one alloantigen abolished the response to another non-cross-reacting antigen only when both antigens were present on the same F1 hybrid-stimulating cells. This suppression of generation of CTL by irradiated MLC cells apparently involves inactivation of alloantigen-bearing stimulating cells as a result of residual cytotoxic activity of the irradiated MLC cells. This mechanism may be active during the decline in CTL activity noted in the normal immune response in vivo and in vitro

  19. Dendritic cells transduced with Rsf-1/HBXAP gene generate specific cytotoxic T lymphocytes against ovarian cancer in vitro

    International Nuclear Information System (INIS)

    Sun, Li; Kong, Beihua; Sheng, Xiugui; Sheu, Jim Jinn-Chyuan; Shih, Ie-Ming

    2010-01-01

    Recently, some studies have indicated that Rsf-1/HBXAP plays a role in chromatin remodeling and transcriptional regulation that may contribute to tumorigenesis in ovarian cancer. The present study demonstrates that using dendritic cells (DCs) from human cord blood CD34 + cells transduced with Rsf-1/HBXAP DNA plasmids by nucleofection generate specific cytotoxic T lymphocytes (CTL) against ovarian cancer in vitro. After transfection, DCs were analyzed for Rsf-1/HBXAP mRNA expression by RT-PCR and protein expression by Western blot. Then the DC phenotypes, T-cell stimulatory capacity, endocytic activity and migration capacity were explored by flow cytometry analysis, allogeneic mixed lymphocyte reaction, endocytosis and transwell chemotaxis assay, respectively. After transfection, Rsf-1/HBXAP expression was detected at mRNA and protein levels. Allogeneic T-cell proliferation induced by transfected DCs was obviously higher than non-transfected DCs, but the endocytosis capacity and migratory ability were not different. Rsf-1/HBXAP gene-transduced DCs could induce antigen-specific CTL and generate a very potent cytotoxicity to OVCAR3 cells. These data suggest that Rsf-1/HBXAP gene-transduced DCs may be a potential adjuvant immunotherapy for ovarian cancer in clinical applications.

  20. Generational Affiliation as a Component of Culture: Focus Group Perspectives of Three Generational Cohorts

    Science.gov (United States)

    Nesbit, Elisabeth Anne

    2010-01-01

    The purpose of this study was to explore the multicultural elements related to generational affiliation. Much of current generational literature is anecdotal and does not empirically explore the culture of each generation. A constructivist ground theory approach was applied to the study of three generational cohorts (Baby Boomers, Generation Xers,…

  1. Simulating the Effects of Cross-Generational Cultural Transmission on Language Change

    Science.gov (United States)

    Gong, Tao; Shuai, Lan

    Language evolves in a socio-cultural environment. Apart from biological evolution and individual learning, cultural transmission also casts important influence on many aspects of language evolution. In this paper, based on the lexicon-syntax coevolution model, we extend the acquisition framework in our previous work to examine the roles of three forms of cultural transmission spanning the offspring, parent, and grandparent generations in language change. These transmissions are: those between the parent and offspring generations (PO), those within the offspring generation (OO), and those between the grandparent and offspring generations (GO). The simulation results of the considered model and relevant analyses illustrate not only the necessity of PO and OO transmissions for language change, thus echoing our previous findings, but also the importance of GO transmission, a form of cross-generational cultural transmission, on preserving the mutual understandability of the communal language across generations of individuals.

  2. Cytotoxicity Testing: Cell Experiments

    Science.gov (United States)

    Grünert, Renate; Westendorf, Aron; Buczkowska, Magdalena; Hänsch, Mareike; Grüunert, Sybil; Bednarski, Patrick J.

    Screening for new anticancer agents has traditionally been done with in vitro cell culture methods. Even in the genomic era of target-driven drug design, screening for cytotoxic activity is still a standard tool in the search for new anticancer agents, especially if the mode of action of a substance is not yet known. A wide variety of cell culture methods with unique end-points are available for testing the anticancer potential of a substance. Each has its advantages and disadvantages, which must be weighed in the decision to use a particular method. Often several complementary methods are used to gain information on the mode of action of a substance.

  3. Cytotoxicity of Cerastes cerastes snake venom: Involvement of imbalanced redox status.

    Science.gov (United States)

    Kebir-Chelghoum, Hayet; Laraba-Djebari, Fatima

    2017-09-01

    Envenomation caused by Cerastes cerastes snake venom is characterized by a local and a systemic tissue damage due to myonecrosis, hemorrhage, edema and acute muscle damage. The present study aimed to evaluate the relationship between the pro/anti-oxidants status and the cytotoxicity of C. cerastes snake venom. The in vivo cytotoxicity analysis was undertaken by the injection of C. cerastes venom (48μg/20g body weight) by i.p. route, mice were then sacrificed at 3, 24 and 48h post injection, organs were collected for further analysis. In vitro cytotoxicity analysis was investigated on cultured PBMC, hepatocytes and isolated liver. The obtained results showed a significant cell infiltration characterized by a significant increase of myeloperoxidase (MPO) and eosinoperoxidase (EPO) activities. These results showed also a potent oxidative activity of C. cerastes venom characterized by increased levels of residual nitrites and lipid peroxidation associated with a significant decrease of glutathione and catalase activity in sera and tissues (heart, lungs, liver and kidneys). The in vitro cytotoxicity of C. cerastes venom on PBMC seems to be dose-dependent (IC50 of 21μg/ml/10 6 cells) and correlated with an imbalanced redox status at high doses of venom. However, in the case of cultured hepatocytes, the LDH release and oxidative stress were observed only at high doses of the venom. The obtained results of in vivo study were confirmed by the culture of isolated liver. Therefore, these results suggest that the venom induces a direct cytotoxic effect which alters the membrane integrity causing a leakage of the cellular contents. This cytotoxic effect can lead indirectly to inflammatory response and oxidative stress. These data suggest that an early anti-inflammatory and antioxidant treatment could be useful in the management of envenomed victims. Copyright © 2017. Published by Elsevier B.V.

  4. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding...

  5. Cytotoxicity evaluation of polymer-derived ceramics for pacemaker electrode applications.

    Science.gov (United States)

    Grossenbacher, Jonas; Gullo, Maurizio R; Dalcanale, Federico; Blugan, Gurdial; Kuebler, Jakob; Lecaudé, Stéphanie; Tevaearai Stahel, Hendrik; Brugger, Juergen

    2015-11-01

    Ceramics are known to be chemically stable, and the possibility to electrically dope polymer-derived ceramics makes it a material of interest for implantable electrode applications. We investigated cytotoxic characteristics of four polymer-derived ceramic candidates with either electrically conductive or insulating properties. Cytotoxicity was assessed by culturing C2C12 myoblast cells under two conditions: by exposing them to material extracts and by putting them directly in contact with material samples. Cell spreading was optically evaluated by comparing microscope observations immediately after the materials insertion and after 24 h culturing. Cell viability (MTT) and mortality (LDH) were quantified after 24-h incubation in contact with the materials. Comparison was made with biocompatible positive references (alumina, platinum, biocompatible stainless steel 1.4435), negative references (latex, stainless steel 1.4301) and controls (no material present in the culture wells). We found that the cytotoxic properties of tested ceramics are comparable to established reference materials. These ceramics, which are reported to be very stable, can be microstructured and electrically doped to a wide range of conductivity and are thus excellent candidates for implantable electrode applications including pacemakers. © 2015 Wiley Periodicals, Inc.

  6. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  7. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  8. Cytotoxicity and genotoxicity of clothianidin in human lymphocytes with or without metabolic activation system.

    Science.gov (United States)

    Atlı Şekeroğlu, Zülal; Şekeroğlu, Vedat; Uçgun, Ebru; Kontaş Yedier, Seval; Aydın, Birsen

    2018-02-26

    Clothianidin (CHN) is a broad-spectrum neonicotinoid insecticide. Limited studies have been carried out on the cytotoxic and genotoxic effects of both CHN using different genotoxicity tests in human cells with or without human metabolic activation system (S9 mix). Therefore, the aim of this study is to investigate the cytotoxic and genotoxic effects of CHN and its metabolites on human lymphocyte cultures with or without S9 mix using chromosomal aberration (CA) and micronucleus (MN) tests. The cultures were treated with 25, 50, and 100 µg/ml of CHN in the presence (3 h treatment) and absence (48 h treatment) of S9 mix. Dimethyl sulfoxide (DMSO) was used as a solvent control. CHN showed cytotoxic and genotoxic effects due to significant decreases in mitotic index (MI) and nuclear division index (NDI), and significant increases in the CAs, aberrant cells, and MN formation in the absence of S9 mix when compared with solvent control. However, CHN did not significantly induce cytotoxicity and genotoxicity in the presence of S9 mix. Our results indicated that CHN has cytotoxic, cytostatic, and genotoxic potential on human peripheral blood lymphocyte cultures, but not its metabolites under the experimental conditions.

  9. Metabolic and physiologic studies of nonimmune lymphoid cells cytotoxic for fibroblastic cells in vitro

    International Nuclear Information System (INIS)

    Mayhew, E.; Bennett, M.

    1974-01-01

    An in vitro reaction between mouse lymphoid cells and target fibroblastic cells in wells of microtest plates, which appears to simulate the in vivo rejection of hemopoietic allografts, has been analyzed for metabolic and physiologic requirements. Protein synthesis was required for only the first few hours of culture. Inhibition of RNA synthesis and alteration of cell surface charge with various agents were without obvious effects. Metabolic slowing at 4 0 C or deviation of the pH of the culture medium suppressed the reaction. Thymus cells, which are not cytotoxic in this system, significantly but not completely inhibited the cytotoxicity of lymph node cells. Antiserum directed against target cells specifically protected them from the cytotoxic lymphoid cells in the absence of complement. Precursors of cytotoxic lymphoid cells were radiosensitive, unlike the cytotoxic cells themselves. BALB/c anti-C57BL/6 spleen cell serum and 89 Sr both are able to prevent rejection of marrow allografts in vivo. Lymphoid cells incubated with this antiserum plus complement lost much of their cytotoxicity but were still effective at high ratios of aggressor to target cells. Lymphoid cells of mice treated with 89 Sr were effectively cytotoxic but lost practically all of their cytotoxicity after incubation with the antiserum plus complement. Thus, it appears that this reaction detects two different cytotoxic lymphoid cells, either of which can function in vitro. Both cell types may need to cooperate in vivo during marrow allograft rejections

  10. Light-triggered liposomal cargo delivery platform incorporating photosensitizers and gold nanoparticles for enhanced singlet oxygen generation and increased cytotoxicity

    Science.gov (United States)

    Kautzka, Zofia; Clement, Sandhya; Goldys, Ewa M.; Deng, Wei

    2018-02-01

    We developed light-triggered liposomes incorporating gold nanoparticles and Rose Bengal (RB), a well-known photosensitizer used for photodynamic therapy. Singlet oxygen generated by these liposomes with 532 nm light illumination was characterized by adjusting the molar ratio of lipids and gold nanoparticles while keeping the amount of RB constant. Gold nanoparticles were found to enhance the singlet oxygen generation rate, with a maximum enhancement factor of 1.75 obtained for the molar ratio of HSPC: PE-NH2: gold of 57:5:17 compared with liposomes loaded with RB alone. The experimental results could be explained by the local electric field enhancement caused by gold nanoparticles. We further assessed cellular cytotoxicity of these liposomes by encapsulating an antitumor drug, doxorubicin (Dox); such Dox loaded liposomes were applied to human colorectal cancer cells, HCT116, and exposed to light. Gold-loaded liposomes containing RB and Dox where Dox release was triggered by light were found to exhibit higher cytotoxicity, compared to the liposomes loaded with RB and Dox alone. Our results indicate that gold-loaded liposomes incorporating photosensitizers may have improved therapeutic efficacy in photodynamic therapy and chemotherapy.

  11. Cellular changes in motor neuron cell culture produced by cytotoxic cerebrospinal fluid from patients with amyotrophic lateral sclerosis.

    Science.gov (United States)

    Gomez-Pinedo, U; Yáñez, M; Matías-Guiu, J; Galán, L; Guerrero-Sola, A; Benito-Martin, M S; Vela, A; Arranz-Tagarro, J A; García, A G

    2014-01-01

    The neurotoxic effects of cerebrospinal fluid (CSF) from patients with amyotrophic lateral sclerosis (ALS) have been reported by various authors who have attributed this neurotoxicity to the glutamate in CSF-ALS. Cultures of rat embryonic cortical neurons were exposed to CSF from ALS patients during an incubation period of 24 hours. Optical microscopy was used to compare cellular changes to those elicited by exposure to 100μm glutamate, and confocal microscopy was used to evaluate immunohistochemistry for caspase-3, TNFα, and peripherin. In the culture exposed to CSF-ALS, we observed cells with nuclear fragmentation and scarce or null structural modifications to the cytoplasmic organelles or to plasma membrane maintenance. This did not occur in the culture exposed to glutamate. The culture exposed to CSF-ALS also demonstrated increases in caspase-3, TNFα, and in peripherin co-locating with caspase-3, but not with TNFα, suggesting that TNFα may play an early role in the process of apoptosis. CFS-ALS cytotoxicity is not related to glutamate. It initially affects the nucleus without altering the cytoplasmic membrane. It causes cytoplasmic apoptosis that involves an increase in caspase-3 co-located with peripherin, which is also overexpressed. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  12. Cytotoxicity and apoptotic inducibility of Vitex agnus-castus fruit extract in cultured human normal and cancer cells and effect on growth.

    Science.gov (United States)

    Ohyama, Kunio; Akaike, Takenori; Hirobe, Chieko; Yamakawa, Toshio

    2003-01-01

    A crude extract was prepared with ethanol from dried ripened Vitex agnus-castus fruits growing in Israel (Vitex extract). Cytotoxicity of the extract against human uterine cervical canal fibroblast (HCF), human embryo fibroblast (HE-21), ovarian cancer (MCF-7), cervical carcinoma (SKG-3a), breast carcinoma (SKOV-3), gastric signet ring carcinoma (KATO-III), colon carcinoma (COLO 201), and small cell lung carcinoma (Lu-134-A-H) cells was examined. After culture for 24 h (logarithmic growth phase) or 72 h (stationary growth phase), the cells were treated with various concentrations of Vitex extract. In both growth phases, higher growth activity of cells and more cytotoxic activity of Vitex extract were seen. The cytotoxic activity against stationary growth-phase cells was less than that against logarithmic growth-phase cells. DNA fragmentation of Vitex extract-treated cells was seen in SKOV-3, KATO-III, COLO 201, and Lu-134-A-H cells. The DNA fragmentation in Vitex extract-treated KATO-III cells was inhibited by the presence of the antioxidative reagent pyrrolidine dithiocarbamate or N-acetyl-L-cysteine (NAC). Western blotting analysis showed that in Vitex extract-treated KATO-III cells, the presence of NAC also inhibited the expression of heme oxygenase-1 and the active forms of caspases-3, -8 and -9. It is concluded that the cytotoxic activity of Vitex extract may be attributed to the effect on cell growth, that cell death occurs through apoptosis, and that this apoptotic cell death may be attributed to increased intracellular oxidation by Vitex extract treatment.

  13. In vitro generation of Epstein-Barr virus-specific cytotoxic T cells in patients receiving haplo-identical allogeneic stem cell transplantation.

    Science.gov (United States)

    Musk, P; Szmania, S; Galloway, A T; Johnson, K; Scott, A; Guttman, S; Bridges, K; Bruorton, M; Gatlin, J; Garcia, J V; Lamb, L; Chiang, K Y; Spencer, T; Henslee-Downey, J; van Rhee, F

    2001-01-01

    Use of a partially mismatched related donor (PMRD) is an option for patients who require allogeneic transplantation but do not have a matched sibling or unrelated donor. Epstein-Barr virus (EBV)-induced lymphoma is a major cause of mortality after PMRD transplantation. In this study, we present a clinical grade culture system for donor-derived EBV-specific cytotoxic T cells (CTLs) that do not recognize haplo-identical recipient cells. The EBV-specific CTLs were tested for cytolytic specificity and other functional properties, including ability to transgress into tissues, propensity for apoptosis, degree of clonality, stability of dominant T-cell clones, and Tc and Th phenotypes. The EBV-specific CTLs were routinely expanded to greater than 80 x 10(6) over a period of 5 weeks, which is sufficient for clinical application. A CD8+ phenotype predominated, and the CTLs were highly specific for donor lymphoblastoid cell lines (LCLs) without killing of recipient targets or K562. Vbeta spectratyping showed an oligoclonal population that was stable on prolonged culture. The EBV-specific CTLs were activated (D-related human leukocyte antigen [HLA-DR+], L-selectin+/-) and of memory phenotype (CD45RO+). Expression of the integrin VLA-4 suggested that these CTLs could adhere to endothelium and migrate into tissues. The Bcl-2 message was upregulated, which may protect the CTLs from the apoptosis. The first demonstration of overexpression of bcl-2 in human memory CTLs. In addition, we show that lymphoblastoid cell lines used to generate CTLs are readily genetically modified with recombinant lentivirus, indicating that genetically engineered antigen presentation is feasible.

  14. Cytotoxic and genotoxic effect of the [{sup 166}Dy]Dy/{sup 166}Ho-EDTMP in vivo generator system in mice

    Energy Technology Data Exchange (ETDEWEB)

    Pedraza-Lopez, Martha [Departamento de Medicina Nuclear, Instituto Nacional de Ciencias Medicas y Nutricion, Salvador Zubiran, Delegacion Tlalpan, Mexico DF 14000 (Mexico); Ferro-Flores, Guillermina [Instituto Nacional de Investigaciones Nucleares, Carretera Mexico-Toluca, Ocoyoacac, Estado de Mexico, CP 52045 (Mexico); Arteaga de Murphy, Consuelo [Departamento de Medicina Nuclear, Instituto Nacional de Ciencias Medicas y Nutricion, Salvador Zubiran, Delegacion Tlalpan, Mexico DF 14000 (Mexico)]. E-mail: consuelo_murphy@yahoo.com.mx; Morales-Ramirez, Pedro [Instituto Nacional de Investigaciones Nucleares, Carretera Mexico-Toluca, Ocoyoacac, Estado de Mexico, CP 52045 (Mexico); Piedras-Ross, Josefa [Departamento de Medicina Nuclear, Instituto Nacional de Ciencias Medicas y Nutricion, Salvador Zubiran, Delegacion Tlalpan, Mexico DF 14000 (Mexico); Murphy-Stack, Eduardo [Hospital Santaelena, Mexico DF (Mexico); Hernandez-Oviedo, Omar [Escuela Superior de Fisica y Matematicas, IPN, Mexico DF (Mexico)

    2004-11-01

    Multiple myeloma and other hematological malignancies have been treated by myeloablative radiotherapy/chemotherapy and subsequent stem cell transplantation. [{sup 166}Dy]Dy/{sup 166}Ho-ethylenediaminetetramethylene phosphonate (EDTMP) forms a stable in vivo generator system with selective skeletal uptake in mice; therefore, it could work as a potential and improved agent for marrow ablation. Induced bone marrow cytotoxicity and genotoxicity are determined by the reduction of reticulocytes (RET) and elevation of micronucleated reticulocyte (MN-RET) in peripheral blood and ablation by bone marrow histological studies. The aim of this study was to determine the bone marrow cytotoxic and genotoxic effect of the [{sup 166}Dy]Dy/{sup 166}Ho-EDTMP in vivo generator system in mice and to evaluate by histopathology its myeloablative potential. Enriched {sup 166}Dy{sub 2}O{sub 3} was irradiated and [{sup 166}Dy]DyCl{sub 3} was added to EDTMP in phosphate buffer (pH 8.0) in a molar ratio of 1:1.75. QC was determined by TLC. Dy-EDTMP complex was prepared the same way with nonirradiated dysprosium oxide. A group of BALB/c mice were intraperitoneally injected with the radiopharmaceutical and two groups of control animals were injected with the cold complex and with 0.9% sodium chloride, respectively. A blood sample was taken at the beginning of the experiments and every 48 h for 12 days postinjection. The animals were sacrificed, organs of interest taken out and the radioactivity determined. The femur was used for histological studies. Flow cytometry analysis was used to quantify the frequency of RET and MN-RET in the blood samples. The MCNP4B Monte Carlo computer code was used for dosimetry calculations. Radiochemical purity was 99% and the mean specific activity was 1.3 MBq/mg. The RET and MN-RET frequency were statistically different in the treatment at the end of the 12-day period demonstrating cytotoxicity and genotoxicity induced by the in vivo generator system. The

  15. Formation of zinc-containing nanoparticles from Zn²⁺ ions in cell culture media: implications for the nanotoxicology of ZnO.

    Science.gov (United States)

    Turney, Terence W; Duriska, Martin B; Jayaratne, Vidura; Elbaz, Abdulkareem; O'Keefe, Sean J; Hastings, Andrew S; Piva, Terrence J; Wright, Paul F A; Feltis, Bryce N

    2012-10-15

    Zinc ions generate a range of poorly soluble Zn-containing nanoparticles when added to commonly used mammalian cell culture media. The formation of these nanoparticles confounds the use of soluble Zn salts as positive controls during cytotoxicity testing of other Zn-containing nanoparticles, such as ZnO. These nanoprecipitates can either be crystalline or amorphous and vary in composition depending upon the concentration of Zn(II) within the medium. The cytotoxicity and immune system response of these nanoparticles in situ are similar to those of 30 nm ZnO nanoparticles. The low residual level of truly soluble Zn species (taken as species passing through a 2 kDa membrane) in cell culture media with serum is insufficient to elicit any appreciable cytotoxicity. These observations highlight the importance of employing appropriate controls when studying ZnO nanoparticle toxicity and suggest a re-evaluation of the conclusions drawn in some previous cytotoxicity studies.

  16. Cultural Differences in Perceiving Sounds Generated by Others: Self Matters

    Directory of Open Access Journals (Sweden)

    Liyu eCao

    2015-12-01

    Full Text Available Sensory consequences resulting from own movements receive different neural processing compared to externally generated sensory consequences (e.g., by a computer, leading to sensory attenuation, i.e., a reduction in perceived loudness or brain evoked responses. However, discrepant findings exist from different cultural regions about whether sensory attenuation is also present for sensory consequences generated by others. In this study, we performed a cross culture (between Chinese and British comparison on the processing of sensory consequences (perceived loudness from self and others compared to an external source in the auditory domain. We found a cultural difference in processing sensory consequences generated by others, with only Chinese and not British showing the sensory attenuation effect. Sensory attenuation in this case was correlated with independent self-construal scores. The sensory attenuation effect for self-generated sensory consequences was not replicated. However, a correlation with delusional ideation was observed for British. These findings are discussed with respects to mechanisms of sensory attenuation.

  17. Mycotoxin production by Fusarium avenaceum strains isolated from Norwegian grain and the cytotoxicity of rice culture extracts to porcine kidney epithelial cells.

    Science.gov (United States)

    Morrison, Ellen; Kosiak, Barbara; Ritieni, Alberto; Aastveit, Are H; Uhlig, Silvio; Bernhoft, Aksel

    2002-05-08

    The secondary metabolites of 24 isolates of Fusarium avenaceum from Norwegian cereals and grown on rice have been characterized. Moniliformin (MON), enniatins (ENNs), and beauvericin (BEA) were analyzed by high-performance liquid chromatography. Porcine kidney epithelial cells (PK15, American Type Culture Collection) were used to study the cytotoxicity of MON in the extracts. The following metabolites were produced by all isolates, ranked by concentration in rice cultures: ENN-B, MON, ENN-B1, and ENN-A. BEA was produced by eight isolates. The productions of BEA and ENN-A were significantly correlated, as was the case with ENN-B and ENN-B1. MON production was correlated neither to any of the other toxins nor to toxicity.

  18. Cytotoxicity of cancer HeLa cells sensitivity to normal MCF10A cells in cultivations with cell culture medium treated by microwave-excited atmospheric pressure plasmas

    Science.gov (United States)

    Takahashi, Yohei; Taki, Yusuke; Takeda, Keigo; Hashizume, Hiroshi; Tanaka, Hiromasa; Ishikawa, Kenji; Hori, Masaru

    2018-03-01

    Cytotoxic effects of human epithelial carcinoma HeLa cells sensitivity to human mammary epithelial MCF10A cells appeared in incubation with the plasma-activated medium (PAM), where the cell culture media were irradiated with the hollow-shaped contact of a continuously discharged plasma that was sustained by application of a microwave power under Ar gas flow at atmospheric pressure. The discharged plasma had an electron density of 7  ×  1014 cm-3. As the nozzle exit to the plasma source was a distance of 5 mm to the medium, concentrations of 180 µM for H2O2 and 77 µM for NO2- were generated in the PAM for 30 s irradiation, resulting in the control of irradiation periods for aqueous H2O2 with a generation rate of 6.0 µM s-1, and nitrite ion (NO2- ) with a rate of 2.2 µM s-1. Effective concentrations of H2O2 and NO2- for the antitumor effects were revealed in the microwave-excited PAM, with consideration of the complicated reactions at the plasma-liquid interfaces.

  19. Mouse embryonic stem cell culture for generation of three-dimensional retinal and cortical tissues.

    Science.gov (United States)

    Eiraku, Mototsugu; Sasai, Yoshiki

    2011-12-15

    Generation of compound tissues with complex structures is a major challenge in cell biology. In this article, we describe a protocol for mouse embryonic stem cell (ESC) culture for in vitro generation of three-dimensional retinal tissue, comparing it with the culture protocol for cortical tissue generation. Dissociated ESCs are reaggregated in a 96-well plate with reduced cell-plate adhesion and cultured as floating aggregates. Retinal epithelium is efficiently generated when ESC aggregates are cultured in serum-free medium containing extracellular matrix proteins, spontaneously forming hemispherical vesicles and then progressively transforming into a shape reminiscent of the embryonic optic cup in 9-10 d. In long-term culture, the ESC-derived optic cup generates a fully stratified retinal tissue consisting of all major neural retinal components. In contrast, the cortical differentiation culture can be started without exogenous extracellular matrix proteins, and it generates stratified cortical epithelia consisting of four distinct layers in 13 d.

  20. Study on the cytotoxicity of natural killer cells induced by endothelial cells in vitro in the model of xenotransplantation

    International Nuclear Information System (INIS)

    Huang Haoyue; Shen Zhenya; Liu Hongcheng; Meng Zili; Teng Xiaomei

    2004-01-01

    Objective: To explore the change of the cytotoxicity of natural killer cells induced by vascular endothelial cells in vitro and the relationship between this change and the variety of cytokine level. Methods: After fixed by paraformaldehyde, vascular endothelial cells from pigs were co-cultured in vitro with natural killer cells from Chinese monkeys at different ratios. The change of the cytotoxicity of natural killer cells occurring after this contact and the content of IFN-γ and TNF-α in the supernatants were detected. Results: The cytotoxicity of natural killer cells improved gradually in accordance with the co-culture ratio after co-cultured with fixed vascular endothelial cells. The secretion of INF-γ and TNF-α also improved gradually. Conclusion: After contact with xeno-target cells, the cytotoxicity of natural killer cells and the secretion of cytokines are related to the ratio of effective cells and target cells

  1. Generational Differences in the Perception of Corporate Culture in European Transport Enterprises

    Directory of Open Access Journals (Sweden)

    Rudolf Kampf

    2017-09-01

    Full Text Available The workforce of an enterprise consists of employees of various ages with different personality types. Members of each generation differ not only in their behaviour, but also in their attitudes and opinions. A manager should identify generational differences. Subsequently, the management style, leadership and employee motivation should be adapted forasmuch as well-motivated employees are able to affect the efficiency of enterprise processes in right way. The objective of the paper is to identify differences in perception of the preferred level of corporate culture in terms of various generations. Preferred level of corporate culture in six areas is evaluated using a questionnaire consisting of 24 questions. Sixty-four European transport enterprises are engaged in the survey. Following the outcomes, we find that all generations of respondents working in the European transport enterprises prefer clan corporate culture in the course of five years. This culture puts emphasis on employees, customers and traditions. Loyalty and teamwork are considered to be the essential tools for business success. Following the statistical verification using the ANOVA test, we can state that the hypothesis regarding the existence of generational differences in the perception of corporate culture was not confirmed.

  2. Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures

    Science.gov (United States)

    Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi

    2013-01-01

    The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

  3. The uptake of tritium-labelled carnitine by monolayer cultures of human fetal muscle and its potential as a label in cytotoxicity studies

    International Nuclear Information System (INIS)

    Cambridge, G.; Stern, C.M.M.

    1981-01-01

    As a novel approach to the investigation of immune responses directed against muscle antigens in inflammatory muscle disease, the use of tritium-labelled carnitine as a selective marker for myotubes in monolayer cultures was investigated. Tritium-labelled carnitine was incubated either with monolayer cultures of human fetal muscle or with syngeneic monolayer cultures of human fetal fibroblasts. The rate of uptake and loss of tritium-labelled carnitine by muscle cultures was compared with that shown by fibroblast cultures; values for the ratio Ksub(m)/Vsub(max) were 3.1 for muscle cultures and 0.46 for fibroblast cultures. Freeze-dried radioautographs of muscle monolayers, previously incubated with tritium-labelled carnitine confirmed the specific intra-tubular localization of the label. Fetal muscle monolayers, previously incubated with tritium-labelled carnitine, were used as targets in long-term cytotoxicity experiments into lymphocyte-mediated myotoxicity. Peripheral blood lymphocytes from patients with inflammatory muscle disease were shown to be myotoxic, but lymphocytes from normal individuals or those with non-inflammatory muscle disease were not. Carnitine-based measures of myotoxicity closely followed the clinical activity of the disease in one patient and the test shows considerable potential as a means of assessing myotube killing by lymphocytes on a per-cell basis. (author)

  4. Suppression of natural killer cell cytotoxicity in postpartum women: time course and potential mechanisms.

    Science.gov (United States)

    Groer, Maureen W; El-Badri, Nagwa; Djeu, Julie; Williams, S Nicole; Kane, Bradley; Szekeres, Karoly

    2014-07-01

    Little is known about the recovery of the immune system from normal pregnancy and whether the postpartum period is a uniquely adapted immune state. This report extends previous observations from our group of decreased natural killer (NK) cell cytotoxicity in the postpartum period. NK cytotoxicity was measured from 1 week through 9 months postpartum. In addition, NK cytotoxicity was assayed in the presence or absence of pooled plasmas collected from either postpartum or nonpostpartum women. Samples of cells were stained for inhibitory receptors and analyzed by flow cytometry. NK cytotoxicity remained decreased in postpartum women compared to controls through the first 6 postpartum months, returned to normal levels by 9 months, and remained normal at 12 months. NK cytotoxicity during the first 6 months was further inhibited by the addition of pooled plasma to NK cultures from postpartum women, but the addition of pooled plasma from the control group did not affect that group's NK cultures. There were differences in inhibitory receptor staining between the two groups, with decreased CD158a and CD158b and increased NKG2A expression on postpartum NK cells during the first 3 postpartum months. These data suggest that NK cytotoxicity postpartum inhibition lasts 6 months and is influenced by unidentified postpartum plasma components. The effect may also involve receptors on NK cells. © The Author(s) 2013.

  5. Comparative study of eco- and cytotoxicity during biotransformation of anthraquinone dye Alizarin Blue Black B in optimized cultures of microscopic fungi.

    Science.gov (United States)

    Rybczyńska-Tkaczyk, Kamila; Święciło, Agata; Szychowski, Konrad A; Korniłłowicz-Kowalska, Teresa

    2018-01-01

    The aim of this study was to select optimal conditions (C and N sources, initial pH and temperature) for biodecolorization of 0.03% anthraquinone dye Alizarin Blue Black B (ABBB) by microscopic fungi: Haematonectria haematococca BwIII43, K37 and Trichoderma harzianum BsIII33. The phenolic compounds, phytotoxicity (Lepidium sativum L.), biotoxicity (Microtox), cytotoxicity and yeast viability assay were performed to determine the extent of ABBB detoxification. Biodecolorization and detoxification of 0.03% ABBB in H. haematococca BwIII43 and T. harzianum BsIII33 cultures was correlated with extracellular oxidoreductases activity. In turn, secondary products, toxic to human fibroblasts and respiring sod1 Saccharomyces cerevisiae cells, were formed in H. haematococca K37 strain cultures, despite efficient decolorization. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Cytotoxicity of synthetic cannabinoids on primary neuronal cells of the forebrain: the involvement of cannabinoid CB1 receptors and apoptotic cell death

    International Nuclear Information System (INIS)

    Tomiyama, Ken-ichi; Funada, Masahiko

    2014-01-01

    The abuse of herbal products containing synthetic cannabinoids has become an issue of public concern. The purpose of this paper was to evaluate the acute cytotoxicity of synthetic cannabinoids on mouse brain neuronal cells. Cytotoxicity induced by synthetic cannabinoid (CP-55,940, CP-47,497, CP-47,497-C8, HU-210, JWH-018, JWH-210, AM-2201, and MAM-2201) was examined using forebrain neuronal cultures. These synthetic cannabinoids induced cytotoxicity in the forebrain cultures in a concentration-dependent manner. The cytotoxicity was suppressed by preincubation with the selective CB 1 receptor antagonist AM251, but not with the selective CB 2 receptor antagonist AM630. Furthermore, annexin-V-positive cells were found among the treated forebrain cells. Synthetic cannabinoid treatment induced the activation of caspase-3, and preincubation with a caspase-3 inhibitor significantly suppressed the cytotoxicity. These synthetic cannabinoids induced apoptosis through a caspase-3-dependent mechanism in the forebrain cultures. Our results indicate that the cytotoxicity of synthetic cannabinoids towards primary neuronal cells is mediated by the CB 1 receptor, but not by the CB 2 receptor, and further suggest that caspase cascades may play an important role in the apoptosis induced by these synthetic cannabinoids. In conclusion, excessive synthetic cannabinoid abuse may present a serious acute health concern due to neuronal damage or deficits in the brain. - Highlights: • Synthetic cannabinoids (classical cannabinoids, non-classical cannabinoids, and aminoalkylindole derivatives) induce cytotoxicity in mouse forebrain cultures. • Synthetic cannabinoid-induced cytotoxicity towards forebrain cultures is mediated by the CB 1 receptor, but not by the CB 2 receptor, and involves caspase-dependent apoptosis. • A high concentration of synthetic cannabinoids may be toxic to neuronal cells that express CB 1 receptors

  7. Antigen entrapped in the escheriosomes leads to the generation of CD4(+) helper and CD8(+) cytotoxic T cell response.

    Science.gov (United States)

    Syed, Faisal M; Khan, Masood A; Nasti, Tahseen H; Ahmad, Nadeem; Mohammad, Owais

    2003-06-02

    In previous study, we demonstrated the potential of Escherichia coli (E. coli) lipid liposomes (escheriosomes) to undergo membrane-membrane fusion with cytoplasmic membrane of the target cells including professional antigen presenting cells. Our present study demonstrates that antigen encapsulated in escheriosomes could be successfully delivered simultaneously to the cytosolic as well as endosomal processing pathways of antigen presenting cells, leading to the generation of both CD4(+) T-helper and CD8(+) cytotoxic T cell response. In contrast, encapsulation of same antigen in egg phosphatidyl-choline (egg PC) liposomes, just like antigen-incomplete Freund's adjuvant (IFA) complex, has inefficient access to the cytosolic pathway of MHC I-dependent antigen presentation and failed to generate antigen-specific CD8(+) cytotoxic T cell response. However, both egg PC liposomes as well as escheriosomes-encapsulated antigen elicited strong humoral immune response in immunized animals but antibody titre was significantly higher in the group of animals immunized with escheriosomes-encapsulated antigen. These results imply usage of liposome-based adjuvant as potential candidate vaccine capable of eliciting both cell-mediated as well as humoral immune responses. Furthermore, antigen entrapped in escheriosomes stimulates antigen-specific CD4(+) T cell proliferation and also enhances the level of IL-2, IFN-gamma and IL-4 in the immunized animals.

  8. Semi-automated limit-dilution assay and clonal expansion of all T-cell precursors of cytotoxic lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, A.; Chen, W.F.; Scollay, R.; Shortman, K. (Walter and Eliza Hall Inst. of Medical Research, Parkville (Australia))

    1982-08-13

    A limit-dilution microculture system is described, where almost all precursor T cells of the cytotoxic lineage (CTL-p) develop into extended clones of cytotoxic T cells (CTL), which are then detected with a new radio-autographic /sup 111/In-release assay. The principle is to polyclonally activate all T cells with concanavalin A, to expand the resultant clones over an 8-9 day period in cultures saturated with growth factors, then to detect all clones with cytotoxic function by phytohaemagglutinin mediated lysis of P815 tumour cells. The key variables for obtaining high cloning efficiency are the use of flat-bottomed 96-well culture trays, the use of appropriately irradiated spleen filler cells, and the inclusion of a T-cell growth factor supplement. Cultures are set up at input levels of around one T cell per well. Forty percent of T cells then form CTL clones readily detected by the cytotoxic assay. The lytic activity of the average clone is equivalent to 3000 CTL, but clone size appears to be much larger. The precursor cells are predominantly if not entirely from the Lyt 2/sup +/ T-cell subclass and almost all cells of this subclass form cytolytic clones. Analysis of the frequency of positive cultures shows a good fit to the expected Poisson distribution, with no evidence of the CTL-p frequency estimates being distorted by helper or suppressor effects.

  9. Semi-automated limit-dilution assay and clonal expansion of all T-cell precursors of cytotoxic lymphocytes

    International Nuclear Information System (INIS)

    Wilson, A.; Chen, W.-F.; Scollay, R.; Shortman, K.

    1982-01-01

    A limit-dilution microculture system is described, where almost all precursor T cells of the cytotoxic lineage (CTL-p) develop into extended clones of cytotoxic T cells (CTL), which are then detected with a new radio-autographic 111 In-release assay. The principle is to polyclonally activate all T cells with concanavalin A, to expand the resultant clones over an 8-9 day period in cultures saturated with growth factors, then to detect all clones with cytotoxic function by phytohaemagglutinin mediated lysis of P815 tumour cells. The key variables for obtaining high cloning efficiency are the use of flat-bottomed 96-well culture trays, the use of appropriately irradiated spleen filler cells, and the inclusion of a T-cell growth factor supplement. Cultures are set up at input levels of around one T cell per well. Forty percent of T cells then form CTL clones readily detected by the cytotoxic assay. The lytic activity of the average clone is equivalent to 3000 CTL, but clone size appears to be much larger. The precursor cells are predominantly if not entirely from the Lyt 2 + T-cell subclass and almost all cells of this subclass form cytolytic clones. Analysis of the frequency of positive cultures shows a good fit to the expected Poisson distribution, with no evidence of the CTL-p frequency estimates being distorted by helper or suppressor effects. (Auth.)

  10. A fluorescence-based rapid screening assay for cytotoxic compounds

    International Nuclear Information System (INIS)

    Montoya, Jessica; Varela-Ramirez, Armando; Estrada, Abril; Martinez, Luis E.; Garza, Kristine; Aguilera, Renato J.

    2004-01-01

    A simple fluorescence-based assay was developed for the rapid screening of potential cytotoxic compounds generated by combinatorial chemistry. The assay is based on detection of nuclear green fluorescent protein (GFP) staining of a human cervical cancer cell line (HeLa) carrying an integrated histone H2B-GFP fusion gene. Addition of a cytotoxic compound to the HeLa-GFP cells results in the eventual degradation of DNA and loss of the GFP nuclear fluorescence. Using this assay, we screened 11 distinct quinone derivatives and found that several of these compounds were cytotoxic. These compounds are structurally related to plumbagin an apoptosis-inducing naphthoquinone isolated from Black Walnut. In order to determine the mechanism by which cell death was induced, we performed additional experiments with the most cytotoxic quinones. These compounds were found to induce morphological changes (blebbing and nuclear condensation) consistent with induction of apoptosis. Additional tests revealed that the cytotoxic compounds induce both necrotic and apoptotic modes of death

  11. Cytotoxicity of Phenol Red in Toxicity Assays for Carbon Nanoparticles

    Directory of Open Access Journals (Sweden)

    Chunhai Fan

    2012-09-01

    Full Text Available To explore the novel properties of carbon nanoparticles (CNPs in nanotoxicity assays, the adsorption of phenol red (a pH indicator for culture medium by multi-walled carbon nanotubes (MWNTs and three kinds of carbon blacks (CBs with nanosize, and its effects on cytotoxicity were studied. Results indicated that the phenol red adsorbed and delivered into cells by CBs was responsible for the toxicity to Hela cells in the medium without serum. The cellular uptake of phenol red was verified using 125I-labeling techniques. The size-dependent cytotoxicity of CBs was found to closely correlate to adsorption of phenol red, cellular uptake of phenol red-CB complexes and the amount of phenol red delivered into the cells by CBs. Although the CBs were either nontoxic or slightly toxic, as vehicles of phenol red, they played an essential role in the cytotoxicity induced by phenol red. However, MWNTs showed an intrinsic cytotoxicity independent of phenol red. The implications associated with these findings are discussed.

  12. In vitro cytotoxic, genotoxic and antioxidant/oxidant effects of guaiazulene on human lymphocytes

    Directory of Open Access Journals (Sweden)

    Başak Toğar

    2015-02-01

    Full Text Available The aim of this study was to evaluate for the cytotoxicity, genotoxicity and antioxidant/oxidant activity of GYZ on human peripheral blood lymphocytes (PBLs. Guaiazulene (GYZ was added into culture tubes at various concentrations (0-400 µg/mL-1. Cytotoxicity against the human lymphocytes cultures was examined by lactate dehydrogenase (LDH release assay. The proliferative response was estimated by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay. Antioxidant/oxidant activity was evaluated by measuring the total oxidant status (TOS and total antioxidant capacity (TAC levels. Micronucleus (MN and chromosomal aberration (CA tests were used in genotoxicity studies. The results showed that GYZ caused cytotoxicity in the PBLs at high concentrations, but TOS level were not affected, while the level of TAC was significantly increased. GYZ also did not induce chromosomal aberrations when compared to that of the control group. Results this study clearly revealed that GYZ was not genotoxic and also increased the capacity of the antioxidant in the culture of human PBL cells. This report is first report on the impact of GYZ on human PBL cells.

  13. Clonal differences in generation times of GPK epithelial cells in monolayer culture.

    Science.gov (United States)

    Riley, P A; Hola, M

    1980-01-01

    Pedigrees of cells in eight clones of guinea pig keratocyte (GPK) cells in monolayer culture were analyzed from a time-lapse film. The generation times and the position in the field of observation were recorded up to the sixth generation when the cultures were still subconfluent. Statistical analysis of the results indicates that the position in the culture has less significance than the clonal origin of the cell in determining the interval between successive mitoses.

  14. Microbial Fuel Cells using Mixed Cultures of Wastewater for Electricity Generation

    International Nuclear Information System (INIS)

    Zain, S.M; Roslani, N.S.; Hashim, R.; Anuar, N.; Suja, F.; Basi, N.E.A.; Anuar, N.; Daud, W.R.W.

    2011-01-01

    Fossil fuels (petroleum, natural gas and coal) are the main resources for generating electricity. However, they have been major contributors to environmental problems. One potential alternative to explore is the use of microbial fuel cells (MFCs), which generate electricity using microorganisms. MFCs uses catalytic reactions activated by microorganisms to convert energy preserved in the chemical bonds between organic molecules into electrical energy. MFC has the ability to generate electricity during the wastewater treatment process while simultaneously treating the pollutants. This study investigated the potential of using different types of mixed cultures (raw sewage, mixed liquor from the aeration tank and return waste activated sludge) from an activated sludge treatment plant in MFCs for electricity generation and pollutant removals (COD and total kjeldahl nitrogen, TKN). The MFC in this study was designed as a dual-chambered system, in which the chambers were separated by a Nafion TM membrane using a mixed culture of wastewater as a bio catalyst. The maximum power density generated using activated sludge was 9.053 mW/ cm 2 , with 26.8 % COD removal and 40 % TKN removal. It is demonstrated that MFC offers great potential to optimize power generation using mixed cultures of wastewater. (author)

  15. Cytotoxicity and apoptotic effects of nickel oxide nanoparticles in cultured HeLa cells

    Directory of Open Access Journals (Sweden)

    Kezban Ada

    2010-04-01

    Full Text Available The aim of this study was to observe the cytotoxicity and apoptotic effects of nickel oxide nanoparticles on humancervix epithelioid carcinoma cell line (HeLa. Nickel oxide precursors were synthesized by an nickel sulphate-excess ureareaction in boiling aqueous solution. The synthesized NiO nanoparticles (<200 nm were investigated by X-ray diffractionanalysis and transmission electron microscopy techniques. For cytotoxicity experiments, HeLa cells were incubated in50-500 μg/mL NiO for 2, 6, 12 and 16 hours. The viable cells were counted with a haemacytometer using light microscopy.The cytotoxicity was observed low in 50-200 μg/mL concentration for 16 h, but high in 400-500 μg/mL concentration for2-6 h. HeLa cells' cytoplasm membrane was lysed and detached from the well surface in 400 μg/mL concentration NiOnanoparticles. Double staining and M30 immunostaining were performed to quantify the number of apoptotic cells in cultureon the basis of apoptotic cell nuclei scores. The apoptotic effect was observed 20% for 16 h incubation.

  16. In vitro cytotoxicity of maxillofacial silicone elastomers: effect of accelerated aging.

    Science.gov (United States)

    Bal, Bilge Turhan; Yilmaz, Handan; Aydin, Cemal; Karakoca, Seçil; Yilmaz, Sükran

    2009-04-01

    The purpose of this in vitro study was to evaluate the cytotoxicity of three maxillofacial silicone elastomers at 24, 48, and 72 h on L-929 cells and to determine the effect of accelerated aging on the cytotoxicity of these silicone elastomers. Disc-shaped test samples of maxillofacial silicone elastomers (Cosmesil, Episil, Multisil) were fabricated according to manufacturers' instructions under aseptic conditions. Samples were then divided into three groups: (1) not aged; (2) aged for 150 h with an accelerated weathering tester; and (3) aged for 300 h. Then the samples were placed in Dulbecco's Modified Eagle Medium/Ham's F12 (DMEM/F12) for 24, 48, and 72 h. After the incubation periods, cytotoxicity of the extracts to cultured fibroblasts (L-929) was measured by MTT assay. The degree of cytotoxicity of each sample was determined according to the reference value represented by the cells with a control (culture without sample). Statistical significance was determined by repeated measurement ANOVA (p test (p test materials in each group demonstrated high survival rates in MTT assay (Episil; 93.84%, Multisil; 88.30%, Cosmesil; 87.50%, respectively); however, in all groups, Episil material demonstrated significantly higher cell survival rate after each of the experimental incubation periods (p Accelerated aging for 150 and 300 h had no significant effect on the biocompatibility of maxillofacial silicone elastomers tested (p > 0.05).

  17. Cytotoxicity of synthetic cannabinoids on primary neuronal cells of the forebrain: the involvement of cannabinoid CB{sub 1} receptors and apoptotic cell death

    Energy Technology Data Exchange (ETDEWEB)

    Tomiyama, Ken-ichi; Funada, Masahiko, E-mail: mfunada@ncnp.go.jp

    2014-01-01

    The abuse of herbal products containing synthetic cannabinoids has become an issue of public concern. The purpose of this paper was to evaluate the acute cytotoxicity of synthetic cannabinoids on mouse brain neuronal cells. Cytotoxicity induced by synthetic cannabinoid (CP-55,940, CP-47,497, CP-47,497-C8, HU-210, JWH-018, JWH-210, AM-2201, and MAM-2201) was examined using forebrain neuronal cultures. These synthetic cannabinoids induced cytotoxicity in the forebrain cultures in a concentration-dependent manner. The cytotoxicity was suppressed by preincubation with the selective CB{sub 1} receptor antagonist AM251, but not with the selective CB{sub 2} receptor antagonist AM630. Furthermore, annexin-V-positive cells were found among the treated forebrain cells. Synthetic cannabinoid treatment induced the activation of caspase-3, and preincubation with a caspase-3 inhibitor significantly suppressed the cytotoxicity. These synthetic cannabinoids induced apoptosis through a caspase-3-dependent mechanism in the forebrain cultures. Our results indicate that the cytotoxicity of synthetic cannabinoids towards primary neuronal cells is mediated by the CB{sub 1} receptor, but not by the CB{sub 2} receptor, and further suggest that caspase cascades may play an important role in the apoptosis induced by these synthetic cannabinoids. In conclusion, excessive synthetic cannabinoid abuse may present a serious acute health concern due to neuronal damage or deficits in the brain. - Highlights: • Synthetic cannabinoids (classical cannabinoids, non-classical cannabinoids, and aminoalkylindole derivatives) induce cytotoxicity in mouse forebrain cultures. • Synthetic cannabinoid-induced cytotoxicity towards forebrain cultures is mediated by the CB{sub 1} receptor, but not by the CB{sub 2} receptor, and involves caspase-dependent apoptosis. • A high concentration of synthetic cannabinoids may be toxic to neuronal cells that express CB{sub 1} receptors.

  18. Impression Generation of Indonesian Cultural Paintings for Mobile Application with Culture Dependent Color-Impression Metric Creation Contents

    Directory of Open Access Journals (Sweden)

    Devira Nanda Kuswhara

    2014-06-01

    Full Text Available Painting is one of complex image reflecting observations and feelings of the artist to the environment. This condition extends the need of painting impression generation system since common people with lack of art experience would have difficulties to interpret the painting. From this point of view we presents a new model to provide representative impressions of paintings by providing a color-impression metric taken from public survey and implement it for mobile application. The new model provides analytical functions to generate the representative impression of the image query. The functions consist of two main section: (1 The cultural-dependent color-impression metric creation which consist of conducting survey, applying normalized 3D color vector quantization to image dataset, generating image-impression metric, and generating color- impression metric; and (2 Impression generation of image query which consist of applying normalized 3D color vector quantization to image query and measuring the similarity between image query andcolor-impression metric. To perform our proposed impression generation system, we examine our system with Indonesian cultural image dataset and 5 different mobile devices. Our proposed system performs main color impression precision result with average precision of more than 60%. Brightness intensity and zooming affects the retrieved impressions. Rotating captures of an image generate the same retrieved impressions. The system also performs average response time vary in range 41263 to 117434 milliseconds from all devices. Keywords: impression generation system, color based impression, cultural computing, mobile application.

  19. Surface modification of amorphous nanosilica particles suppresses nanosilica-induced cytotoxicity, ROS generation, and DNA damage in various mammalian cells

    International Nuclear Information System (INIS)

    Yoshida, Tokuyuki; Yoshioka, Yasuo; Matsuyama, Keigo; Nakazato, Yasutaro; Tochigi, Saeko; Hirai, Toshiro; Kondoh, Sayuri; Nagano, Kazuya; Abe, Yasuhiro; Kamada, Haruhiko; Tsunoda, Shin-ichi; Nabeshi, Hiromi; Yoshikawa, Tomoaki; Tsutsumi, Yasuo

    2012-01-01

    Highlights: ► There is increasing concern regarding the potential health risks of nanomaterials. ► We evaluated the effect of surface properties of nanomaterials on cellular responses. ► We showed that the surface properties play an important in determining its safety. ► These data provide useful information for producing safer nanomaterials. -- Abstract: Recently, nanomaterials have been utilized in various fields. In particular, amorphous nanosilica particles are increasingly being used in a range of applications, including cosmetics, food technology, and medical diagnostics. However, there is concern that the unique characteristics of nanomaterials might induce undesirable effects. The roles played by the physical characteristics of nanomaterials in cellular responses have not yet been elucidated precisely. Here, by using nanosilica particles (nSPs) with a diameter of 70 nm whose surface was either unmodified (nSP70) or modified with amine (nSP70-N) or carboxyl groups (nSP70-C), we examined the relationship between the surface properties of nSPs and cellular responses such as cytotoxicity, reactive oxygen species (ROS) generation, and DNA damage. To compare the cytotoxicity of nSP70, nSP70-N, or nSP70-C, we examined in vitro cell viability after nSP treatment. Although the susceptibility of each cell line to the nSPs was different, nSP70-C and nSP70-N showed lower cytotoxicity than nSP70 in all cell lines. Furthermore, the generation of ROS and induction of DNA damage in nSP70-C- and nSP70-N-treated cells were lower than those in nSP70-treated cells. These results suggest that the surface properties of nSP70 play an important role in determining its safety, and surface modification of nSP70 with amine or carboxyl groups may be useful for the development of safer nSPs. We hope that our results will contribute to the development of safer nanomaterials.

  20. In vitro cytotoxicity of white MTA, MTA Fillapex® and Portland cement on human periodontal ligament fibroblasts.

    Science.gov (United States)

    Yoshino, Patrícia; Nishiyama, Celso Kenji; Modena, Karin Cristina da Silva; Santos, Carlos Ferreira; Sipert, Carla Renata

    2013-01-01

    The aim of this study was to compare the in vitro cytotoxicity of white mineral trioxide aggregate (MTA), MTA Fillapex® and Portland cement (PC) on human cultured periodontal ligament fibroblasts. Periodontal ligament fibroblast culture was established and the cells were used for cytotoxic tests after the fourth passage. Cell density was set at 1.25 X10 4 cells/well in 96-well plates. Endodontic material extracts were prepared by placing sealer/cement specimens (5x3mm) in 1mL of culture medium for 72 h. The extracts were then serially two-fold diluted and inserted into the cell-seeded wells for 24, 48 and 72 h. MTT assay was employed for analysis of cell viability. Cell supernatants were tested for nitric oxide using the Griess reagent system. MTA presented cytotoxic effect in undiluted extracts at 24 and 72 h. MTA Fillapex® presented the highest cytotoxic levels with important cell viability reduction for pure extracts and at ½ and ¼ dilutions. In this study, PC did not induce alterations in fibroblast viability. Nitric oxide was detected in extract-treated cell supernatants and also in the extracts only, suggesting presence of nitrite in the soluble content of the tested materials. In the present study, MTA Fillapex displayed the highest cytotoxic effect on periodontal ligament fibroblasts followed by white MTA and PC.

  1. Cytotoxic CD4 T Cells—Friend or Foe during Viral Infection?

    Science.gov (United States)

    Juno, Jennifer A.; van Bockel, David; Kent, Stephen J.; Kelleher, Anthony D.; Zaunders, John J.; Munier, C. Mee Ling

    2017-01-01

    CD4 T cells with cytotoxic function were once thought to be an artifact due to long-term in vitro cultures but have in more recent years become accepted and reported in the literature in response to a number of viral infections. In this review, we focus on cytotoxic CD4 T cells in the context of human viral infections and in some infections that affect mice and non-human primates. We examine the effector mechanisms used by cytotoxic CD4 cells, the phenotypes that describe this population, and the transcription factors and pathways that lead to their induction following infection. We further consider the cells that are the predominant targets of this effector subset and describe the viral infections in which CD4 cytotoxic T lymphocytes have been shown to play a protective or pathologic role. Cytotoxic CD4 T cells are detected in the circulation at much higher levels than previously realized and are now recognized to have an important role in the immune response to viral infections. PMID:28167943

  2. Enhancement of human natural cytotoxicity by Plasmodium falciparum antigen activated lymphocytes

    DEFF Research Database (Denmark)

    Theander, T G; Pedersen, B K; Bygbjerg, I C

    1987-01-01

    Mononuclear cells (MNC) isolated from malaria immune donors and from donors never exposed to malaria were stimulated in vitro with soluble purified Plasmodium falciparum antigens (SPag) or PPD. After 7 days of culture the proliferative response and the cytotoxic activity against the natural killer...... were preincubated with interleukin 2 (IL-2) for one hour before the start of the cytotoxic assay. SPag activation did not enhance the cytotoxic activity of MNC which did not respond to the antigen in the proliferation assay, and preincubation of these cells with IL-2 did not increase the activity. PPD...

  3. Hemolysis and cytotoxicity mechanisms of biodegradable magnesium and its alloys

    International Nuclear Information System (INIS)

    Zhen, Zhen; Liu, Xiaoli; Huang, Tao; Xi, TingFei; Zheng, Yufeng

    2015-01-01

    Good hemocompatibility and cell compatibility are essential requirements for coronary stents, especially for biodegradable magnesium alloy stents, which could change the in situ environment after implanted. In this work, the effects of magnesium ion concentration and pH value on the hemolysis and cytotoxicity have been evaluated. Solution with different Mg 2+ concentration gradients and pH values of normal saline and cell culture media DMEM adjusted by MgCl 2 and NaOH respectively were tested for the hemolysis and cell viability. Results show that even when the concentration of Mg 2+ reaches 1000 μg/mL, it has little destructive effect on erythrocyte, and the high pH value over 11 caused by the degradation is the real reason for the high hemolysis ratio. Low concentrations of Mg 2+ (< 100 μg/mL) cause no cytotoxicity to L929 cells, of which the cell viability is above 80%, while high concentrations of Mg 2+ (> 300 μg/mL) could induce obvious death of the L929 cells. The pH of the extract plays a synergetic effect on cytotoxicity, due to the buffer action of the cell culture medium. To validate this conclusion, commercial pure Mg using normal saline and PBS as extract was tested with the measurement of pH and Mg 2+ concentration. Pure Mg leads to a higher hemolysis ratio in normal saline (47.76%) than in buffered solution (4.38%) with different pH values and low concentration of Mg 2+ . The Mg extract culture media caused no cytotoxicity, with pH = 8.44 and 47.80 μg/mL Mg 2+ . It is suggested that buffered solution and dynamic condition should be adopted in the hemolysis evaluation. - Highlights: • Mg 2+ and pH have been tested for hemolysis and cytotoxicity of biomedical Mg. • Even 1000 μg/ml Mg 2+ cannot cause hemolysis, but hemolysis reaches 53.8% when pH > 11. • Mg 2+ > 300 μg/mL induces death of L929 and slight alkaline improves the proliferation. • Pure Mg in normal saline induces high hemolysis, but in PBS causes no hemolysis. • True reason

  4. Cytotoxicity evaluation of a copaiba oil-based root canal sealer compared to three commonly used sealers in endodontics

    Directory of Open Access Journals (Sweden)

    Angela Delfina Bittencourt Garrido

    2015-01-01

    Full Text Available Background: The constant development of new root canal sealers has allowed the solution of a large number of clinical cases in endodontics, however, cytotoxicity of such sealers must be tested before their validation as filling materials. The aim of this study was to evaluate the cytotoxic effect of a new Copaiba oil-based root canal sealer (Biosealer [BS] on osteoblast-like Osteo-1 cells. Materials and Methods: The experimental groups were formed according to the culture medium conditioned with the tested sealers, as follows: Control group (CG (culture medium without conditioning; Sealer 26 (S26 - culture medium + S26; Endofill (EF - culture medium + EF; AH Plus (AHP - culture medium + AHP; and BS - culture medium + BS (Copaiba oil-based sealer. The conditioned culture medium was placed in contact with 2 × 10 4 cells cultivated on 60 mm diameter Petri dishes for 24 h. Then, hemocytometer count was performed to evaluate cellular viability, using Trypan Blue assay. The normal distribution of data was tested by the Kolmogorov-Smirnov test and the values obtained for cellular viability were statistically analyzed (1-way ANOVA, Tukey′s test - P 0.05. Conclusion: The Copaiba oil-based root canal sealer presented promising results in terms of cytotoxicity which indicated its usefulness as a root canal sealer.

  5. Cytotoxicity evaluation of a copaiba oil-based root canal sealer compared to three commonly used sealers in endodontics

    Science.gov (United States)

    Garrido, Angela Delfina Bittencourt; de Cara, Sueli Patricia Harumi Miyagi; Marques, Marcia Martins; Sponchiado, Emílio Carlos; Garcia, Lucas da Fonseca Roberti; de Sousa-Neto, Manoel Damião

    2015-01-01

    Background: The constant development of new root canal sealers has allowed the solution of a large number of clinical cases in endodontics, however, cytotoxicity of such sealers must be tested before their validation as filling materials. The aim of this study was to evaluate the cytotoxic effect of a new Copaiba oil-based root canal sealer (Biosealer [BS]) on osteoblast-like Osteo-1 cells. Materials and Methods: The experimental groups were formed according to the culture medium conditioned with the tested sealers, as follows: Control group (CG) (culture medium without conditioning); Sealer 26 (S26) - culture medium + S26; Endofill (EF) - culture medium + EF; AH Plus (AHP) - culture medium + AHP; and BS - culture medium + BS (Copaiba oil-based sealer). The conditioned culture medium was placed in contact with 2 × 104 cells cultivated on 60 mm diameter Petri dishes for 24 h. Then, hemocytometer count was performed to evaluate cellular viability, using Trypan Blue assay. The normal distribution of data was tested by the Kolmogorov-Smirnov test and the values obtained for cellular viability were statistically analyzed (1-way ANOVA, Tukey's test - P 0.05). Conclusion: The Copaiba oil-based root canal sealer presented promising results in terms of cytotoxicity which indicated its usefulness as a root canal sealer. PMID:25878676

  6. Dextran and Polymer Polyethylene Glycol (PEG Coating Reduce Both 5 and 30 nm Iron Oxide Nanoparticle Cytotoxicity in 2D and 3D Cell Culture

    Directory of Open Access Journals (Sweden)

    Alisa Morss Clyne

    2012-05-01

    Full Text Available Superparamagnetic iron oxide nanoparticles are widely used in biomedical applications, yet questions remain regarding the effect of nanoparticle size and coating on nanoparticle cytotoxicity. In this study, porcine aortic endothelial cells were exposed to 5 and 30 nm diameter iron oxide nanoparticles coated with either the polysaccharide, dextran, or the polymer polyethylene glycol (PEG. Nanoparticle uptake, cytotoxicity, reactive oxygen species (ROS formation, and cell morphology changes were measured. Endothelial cells took up nanoparticles of all sizes and coatings in a dose dependent manner, and intracellular nanoparticles remained clustered in cytoplasmic vacuoles. Bare nanoparticles in both sizes induced a more than 6 fold increase in cell death at the highest concentration (0.5 mg/mL and led to significant cell elongation, whereas cell viability and morphology remained constant with coated nanoparticles. While bare 30 nm nanoparticles induced significant ROS formation, neither 5 nm nanoparticles (bare or coated nor 30 nm coated nanoparticles changed ROS levels. Furthermore, nanoparticles were more toxic at lower concentrations when cells were cultured within 3D gels. These results indicate that both dextran and PEG coatings reduce nanoparticle cytotoxicity, however different mechanisms may be important for different size nanoparticles.

  7. Differential role of base excision repair proteins in mediating cisplatin cytotoxicity.

    Science.gov (United States)

    Sawant, Akshada; Floyd, Ashley M; Dangeti, Mohan; Lei, Wen; Sobol, Robert W; Patrick, Steve M

    2017-03-01

    Interstrand crosslinks (ICLs) are covalent lesions formed by cisplatin. The mechanism for the processing and removal of ICLs by DNA repair proteins involves nucleotide excision repair (NER), homologous recombination (HR) and fanconi anemia (FA) pathways. In this report, we monitored the processing of a flanking uracil adjacent to a cisplatin ICL by the proteins involved in the base excision repair (BER) pathway. Using a combination of extracts, purified proteins, inhibitors, functional assays and cell culture studies, we determined the specific BER proteins required for processing a DNA substrate with a uracil adjacent to a cisplatin ICL. Uracil DNA glycosylase (UNG) is the primary glycosylase responsible for the removal of uracils adjacent to cisplatin ICLs, whereas other uracil glycosylases can process uracils in the context of undamaged DNA. Repair of the uracil adjacent to cisplatin ICLs proceeds through the classical BER pathway, highlighting the importance of specific proteins in this redundant pathway. Removal of uracil is followed by the generation of an abasic site and subsequent cleavage by AP endonuclease 1 (APE1). Inhibition of either the repair or redox domain of APE1 gives rise to cisplatin resistance. Inhibition of the lyase domain of Polymerase β (Polβ) does not influence cisplatin cytotoxicity. In addition, lack of XRCC1 leads to increased DNA damage and results in increased cisplatin cytotoxicity. Our results indicate that BER activation at cisplatin ICLs influences crosslink repair and modulates cisplatin cytotoxicity via specific UNG, APE1 and Polβ polymerase functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Italian Family Business Cultures Involved in the Generational Change

    Directory of Open Access Journals (Sweden)

    Ruggero Ruggieri

    2014-02-01

    Full Text Available In family firms, the business and the family are two arenas in which processes significantly overlap and influence management. The present paper investigates the overlap of the family system and the business through the use of culture. Adopting an idiographic approach and recognising the unique psychodynamic process of family business (FB, this study aims to identify the cultural patterns within the FB, starting from what families define as a family, b business and, c the generational change. Twenty-five family firms were considered during the generational change. The results show how and when this overlap takes shape pointing out how the role of family tradition can became a critical or success factor for the business.

  9. Influence of HLA-D/DR antigen disparity in CTL generation in vitro

    International Nuclear Information System (INIS)

    Johnsen, H.E.; Madsen, M.; Mossin, J.; Kristensen, T.

    1983-01-01

    This report describes the influence of HLA-D/-DR antigen disparity upon the level of cytotoxicity in allogeneic in vitro cultures. Allogeneic cultures, between unrelated HLA-D/-DR full house donors, tested in CML gave three different levels of cytotoxicity, termed weak, intermediate and strong cytotoxicity. HLA-D/-DR compatibility predicts weak cytotoxicity and two HLA-B antigen incompatibility predicts strong cytotoxicity. On the contrary, HLA-A antigens have no major influence upon the strength of cytotoxicity. Accepting that the MLC/CML reaction is an in vitro parallel to the in vivo transplantation of allogeneic tissue, the observations are in accordance with the results of HLA-D/-DR matching for graft survival in human renal transplantation. (author)

  10. Cytotoxicity of titanium dioxide nanoparticles in mouse fibroblast cells.

    Science.gov (United States)

    Jin, Cheng-Yu; Zhu, Bang-Shang; Wang, Xue-Feng; Lu, Qing-Hua

    2008-09-01

    Nanotitanium dioxide (TiO2) is an important industrial material that is widely used as an additive in cosmetics, pharmaceuticals, and food colorants. Although the small size of the TiO2 nanoparticle is useful in various applications, the biosafety of this material needs to be evaluated. In this study, mouse fibroblast (L929) cells were used to evaluate the cytotoxicity of different concentrations (3-600 microg/mL) of homogeneous and weakly aggregated TiO2 nanoparticles in aqueous solution. The L929 cells became round and even shrank as the concentration of TiO2 nanoparticles increased. Moreover, TiO2 nanoparticle-treated cells had condensed fragmented chromatin or were directly necrosed, as observed by acridine orange (AO) staining. The transmission electron microscopy (TEM) analysis showed that in cells cultured in a medium containing 300 microg/mL TiO2, the number of lysosomes increased, and some cytoplasmic organelles were damaged. In addition, there was a significant increase in oxidative stress at higher TiO2 nanoparticle concentrations (>60 microg/mL). As the concentration of TiO2 nanoparticles increased in the culture medium, the levels of reactive oxygen species (ROS) and lactate dehydrogenase (LDH) increased, while those of methyl tetrazolium cytotoxicity (MTT), glutathione (GSH), and superoxide dismutase (SOD) decreased. A possible mechanism for the cytotoxicity of TiO2 nanoparticles is also discussed.

  11. Interferon-β gene transfer induces a strong cytotoxic bystander effect on melanoma cells.

    Science.gov (United States)

    Rossi, Úrsula A; Gil-Cardeza, María L; Villaverde, Marcela S; Finocchiaro, Liliana M E; Glikin, Gerardo C

    2015-05-01

    A local gene therapy scheme for the delivery of type I interferons could be an alternative for the treatment of melanoma. We evaluated the cytotoxic effects of interferon-β (IFNβ) gene lipofection on tumor cell lines derived from three human cutaneous and four canine mucosal melanomas. The cytotoxicity of human IFNβ gene lipofection resulted higher or equivalent to that of the corresponding addition of the recombinant protein (rhIFNβ) to human cells. IFNβ gene lipofection was not cytotoxic for only one canine melanoma cell line. When cultured as monolayers, three human and three canine IFNβ-lipofected melanoma cell lines displayed a remarkable bystander effect. As spheroids, the same six cell lines were sensitive to IFNβ gene transfer, two displaying a significant multicell resistance phenotype. The effects of conditioned IFNβ-lipofected canine melanoma cell culture media suggested the release of at least one soluble thermolabile cytotoxic factor that could not be detected in human melanoma cells. By using a secretion signal-free truncated human IFNβ, we showed that its intracellular expression was enough to induce cytotoxicity in two human melanoma cell lines. The lower cytoplasmatic levels of reactive oxygen species detected after intracellular IFNβ expression could be related to the resistance displayed by one human melanoma cell line. As IFNβ gene transfer was effective against most of the assayed melanomas in a way not limited by relatively low lipofection efficiencies, the clinical potential of this approach is strongly supported. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Calcein AM release-based cytotoxic cell assay for fish leucocytes.

    Science.gov (United States)

    Iwanowicz, Luke R; Densmore, Christine L; Ottinger, Christopher A

    2004-02-01

    A non-specific cytotoxic cell assay for fish is presented that is based on the release of the activated fluorochrome calcein AM from lysed carp epithelioma papulosum cyprini (EPC) cells. To establish the suitability of treating EPC cells with calcein AM the uptake and spontaneous release of the calcein AM by the EPC cells was evaluated. Incubation of 5 microM calcein AM in culture medium with 1x10(5)EPC cells well(-1)for a minimum of 3 h provided sufficient labelling. Spontaneous release of fluorescence from the labelled EPC cells during 10 h of post labelling incubation ranged from 30 to 39% of the total observed fluorescence. Cytotoxic activity of trout leucocytes was evaluated at three leucocyte to target cell ratios (10:1, 2:1 and 1:1) following incubation (4, 6, 8, and 10 h) with calcein AM-labelled EPC cells at 15 degrees C. In some instances, the monoclonal antibody specific for the NCC surface receptor NCCRP-1 (MAb5C.6) was included in the cultures. The activity of NCC cells was significantly inhibited in the presence of 0.25 microg well(-1)of MAb5C.6 relative to no antibody (Pcytotoxic cell activity of approximately 18% was observed following 8 h of incubation at the 2:1 and 1:1 leucocyte to target cell ratios. Percent cytotoxic cell activity using calcein AM was similar to values reported for rainbow trout leucocytes using the 51Cr-release assay.

  13. In vitro generation of polysialylated cervical mucins by bacterial polysialyltransferases to counteract cytotoxicity of extracellular histones.

    Science.gov (United States)

    Galuska, Sebastian P; Galuska, Christina E; Tharmalingam, Tharmala; Zlatina, Kristina; Prem, Gerlinde; Husejnov, Farzali C O; Rudd, Pauline M; Vann, Willie F; Reid, Colm; Vionnet, Justine; Gallagher, Mary E; Carrington, Faye A; Hassett, Sarah-Louise; Carrington, Stephen D

    2017-06-01

    Neutrophil extracellular traps (NET) are formed against pathogens. However, various diseases are directly linked to this meshwork of DNA. The cytotoxic properties of extracellular histones especially seem to be an important trigger during these diseases. Furthermore, NET accumulation on implants is discussed to result in an impaired efficiency or failure, depending on the category of implant. Interestingly, mucins have been investigated as surface coatings potentially capable of reducing neutrophil adhesion. Similarly, polysialic acid was shown to inactivate the cytotoxic properties of extracellular histones. We wanted to combine the probability to decrease the adhesion of neutrophils using mucins with the capability of sialic acid polymers to counteract histone-mediated cytotoxicity. To this end, we elongate cervical mucins using bacterial polysialyltransferases. Subsequent cell-based experiments demonstrated the activity of elongated mucins against histone-mediated cytotoxicity. Thus, polysialylated mucins may represent a novel component to coat implants or to combat diseases with exaggerated NET formation. © 2017 Federation of European Biochemical Societies.

  14. Generating Culture-Specific Gestures for Virtual Agent Dialogs

    DEFF Research Database (Denmark)

    Endrass, Birgit; Damian, Ionut; Huber, Peter

    2010-01-01

    Integrating culture into the behavioral model of virtual agents has come into focus lately. When investigating verbal aspects of behavior, nonverbal behaviors are desirably added automatically, driven by the speech-act. In this paper, we present a corpus driven approach of generating gestures...

  15. The influence of cross-cultural interviewing on the generation of data ...

    African Journals Online (AJOL)

    cultural interviews and problematised data generation as a vital contributor in cross-cultural data collection. An Interview Process Model was adapted from the Response Process Model of Miller and Cannell, and used to understand how responses ...

  16. Looking across three generations of Alaska Natives to explore how culture fosters indigenous resilience.

    Science.gov (United States)

    Wexler, Lisa

    2014-02-01

    Research has established connection between indigenous culture--often described in terms of cultural identity, enculturation, and participation in traditional activities--and resilience, the process by which people overcome acute and ongoing challenges. Despite correlations between culture and resilience, research has seldom described the ways these concepts are linked in indigenous people's narratives. Furthermore, little attention has been paid to the affect of historical trauma on different generations' understanding and deployment of "culture" in the context of hardship. This project, conducted in the summer of 2008 in an indigenous Arctic community, focuses on narratives from three generations who have experienced different degrees of cultural suppression in their lifetimes. From this starting point, the study explores how individuals make meaning and take strength from particular notions of culture, and illuminates the ways each generation accesses and deploys their cultural understandings in the face of hardship. By identifying the similarities and differences in both the challenges and sources of strength for each generation, the paper highlights how understandings of culture are shaped by historical experiences and modified through time. The differing ways that culture fosters strength, purpose, and fortitude (or does not) in indigenous young people's, adults' and Elders' life stories provide clues for enhancing indigenous youth resilience. Findings suggest that "culture" can galvanize Inupiaq people's sense of identity, feeling of commitment, and purpose, all of which are protective. However, young people need support in developing particular ideas around cultural identity and group membership that can contribute to resilience.

  17. Cytotoxicity of topical antimicrobial agents used in burn wounds in Australasia.

    Science.gov (United States)

    Fraser, John F; Cuttle, Leila; Kempf, Margit; Kimble, Roy M

    2004-03-01

    Burn sepsis is a leading cause of mortality and morbidity in patients with major burns. The use of topical antimicrobial agents has helped improve the survival of these patients. Silvazine (Sigma Pharmaceuticals, Melbourne, Australia) (1% silver sulphadiazine and 0.2% chlorhexidine digluconate) is used exclusively in Australasia, and there is no published study on its cytotoxicity. This study compared the relative cytotoxicity of Silvazine with 1% silver sulphadiazine (Flamazine (Smith & Nephew Healthcare, Hull, UK)) and a silver-based dressing (Acticoat (Smith & Nephew Healthcare, Hull, UK)). Dressings were applied to the centre of culture plates that were then seeded with keratinocytes at an estimated 25% confluence. The plates were incubated for 72 h and culture medium and dressings then removed. Toluidine blue was added to stain the remaining keratinocytes. Following removal of the dye, the plates were photographed under standard conditions and these digital images were analysed using image analysis software. Data was analysed using Student's t-test. In the present study, Silvazine is the most cytotoxic agent. Seventy-two hour exposure to Silvazine in the present study results in almost no keratinocyte survival at all and a highly statistically significant reduction in cell survival relative to control, Acticoat and Flamazine (Pstudy comparing Acticoat, Silvazine and Flamazine, Silvazine shows an increased cytotoxic effect, relative to control, Flamazine and Acticoat. An in-vivo study is required to determine whether this effect is carried into the clinical setting.

  18. Hydrolyzable Tannins of Tamaricaceous Plants. 7.1 Structures and Cytotoxic Properties of Oligomeric Ellagitannins from Leaves of Tamarix nilotica and Cultured Tissues of Tamarix tetrandra.

    Science.gov (United States)

    Orabi, Mohamed A A; Taniguchi, Shoko; Sakagami, Hiroshi; Yoshimura, Morio; Amakura, Yoshiaki; Hatano, Tsutomu

    2016-04-22

    Partially unacylated new oligomeric hydrolyzable tannins, nilotinin T2 (1, trimer) and nilotinin Q1 (2, tetramer), together with four known trimers, nilotinin T1 (3) and hirtellins T1-T3 (4-6), and a dimer, tamarixinin B (7), were isolated from the aqueous acetone extracts of leaves of Tamarix nilotica. Among them, the new trimer 1 and the known trimers 4 and 6, in addition to the partially unacylated new trimer nilotinin T3 (8), the known dimers nilotinin D3 (9) and tamarixinin C (10), and the monomer tellimagrandin I (11), were isolated from the cultured shoots of Tamarix tetrandra. The structures of the new hydrolyzable tannins were established by chromatographic analyses and extensive 1D and 2D NMR, HRESI-TOFMS, and ECD spectroscopic experiments. Among the new oligomeric tannins, the particular unacylated position of a glucose core is attributed to a possible biosynthetic route. Isolation of the same oligomeric tannins from cultured shoots of T. tetrandra emphasizes the unique biogenetic ability of the obtained cultures on production of the structurally and biologically characteristic tamaricaceous tannins commonly produced by the intact Tamarix plants. Additionally, tannins obtained in the present study together with gemin D (12) and 1,3-di-O-galloyl-4,6-O-(aS)-hexahydroxydiphenoyl-β-d-glucose (13), from our previous investigation of the leaves of T. nilotica, exhibited variable tumor-specific cytotoxic effects. The ellagitannin trimers 4, 6, and 8 and the dimer 9 exerted predominant tumor-selective cytotoxic effects with high specificity toward human promyelocytic leukemia cells.

  19. Cytogenetic, cytotoxic and GC-MS studies on concrete and absolute oils from Taif rose, Saudi Arabia.

    Science.gov (United States)

    Hagag, Heba A; Bazaid, Salih A; Abdel-Hameed, El-Sayed S; Salman, Mahmood

    2014-12-01

    Taif rose (Rosa damascena trigintipetala Dieck) is a sort of damask rose, which is considered as one of the most important economic products of Taif. In this study, the authors investigated the possible cytotoxic, genotoxic, antimutagenic and anticancer effect of concrete and absolute rose oils. The results showed that both concrete and absolute rose oils were cytotoxically and genotoxically safe at a dose of 10 μg/ml when tested on cultures of normal human blood lymphocytes. Also, the results showed significant antimutagenic activity at p oil at the same dose level when tested on cultures of normal human blood lymphocytes supplemented with 300 ng/ml mitomycin C (MMC). On the other hand, concrete and absolute oils exerted a cytotoxic activity against two kinds of human cancer cell lines: HepG2 and MCF7. Concrete oil showed cytotoxic activity against HepG2 and MCF7 with a half maximal inhibitory concentration (IC50) of 16.28 and 18.09 μg/ml, respectively, whereas absolute rose oil showed its cytotoxic activity against HepG2 and MCF7 with an IC50 of 24.94 and 19.69, respectively. From this study, it is concluded that concrete and absolute rose oils are cytotoxically and genotoxically safe at a dose of 10 μg/ml when tested on cultures of normal human blood lymphocytes. In addition, absolute oil has an antimutagenic activity at the same dose. Further investigations are needed to study the activity of higher doses of both oils in vitro and in vivo in experimental animals in order to evaluate the capability of using these oils as therapeutic for treatment of some kinds of cancers.

  20. Interleukin-2 activation of cytotoxic cells in postmastectomy seroma.

    Science.gov (United States)

    Gercel-Taylor, C; Hoffman, J P; Taylor, D D; Owens, K J; Eisenberg, B L

    1996-02-15

    Lymphocytes were isolated from breast seroma fluids and used to study the mechanism of activation of cytotoxic lymphocytes and possible role of immunological potentiation following surgery in breast cancer patients. Single or serial samples were obtained from patients who had undergone mastectomy or lumpectomy with axillary node dissection. Lymphocytes were activated with rIL-2 (interleukin-2) and their cytotoxic activity was studied against Daudi and K562 cells and against a breast tumor line (SKBr-3). All of the patients (21/21) responded to IL-2 stimulation by significant activation of cytotoxic activity. The unstimulated cytotoxic activity of these cells against NK targets was low with less than 10% specific release in cytotoxicity assays. In simultaneous experiments, autologous seroma fluid was included during activation of lymphocytes to study possible regulatory molecules that may be present. In 17/21 patients, the presence of their seroma fluid, during the activation period, enhanced or did not effect the cytotoxic potential of their lymphocytes; inhibition was observed when seroma fluids from 4/21 patients were included. Analysis of the cytotoxic population derived from combined IL-2 and seroma treatments indicates the presence of cells with increased expression of CD56, and CD2, as well as in some cases CD16 expression. Cytotoxic lymphocytes derived from IL-2 and seroma treatments appeared to be more effective killers. Modulation of CD2 expression with seroma alone appeared to result in the generation of this highly cytotoxic population. This study demonstrates the role of CD2 expression in the effectiveness of LAK cell killing and also potential benefit of an immunotherapeutic approach to the postoperative treatment of carcinoma of the breast.

  1. GoldiRunx and Remembering Cytotoxic Memory.

    Science.gov (United States)

    Mikami, Yohei; Kanno, Yuka

    2018-04-17

    The molecular basis for T cell memory differentiation remains elusive. Wang et al. (2018) identify Runx3 as an initiating transcription factor that specifies regulatory regions required for cytotoxic T cell (CTL) memory differentiation early after TCR signaling and constrains the ability of T-bet to drive terminal effector generation. Published by Elsevier Inc.

  2. In vitro cytotoxicity of the ternary PAMAM G3–pyridoxal–biotin bioconjugate

    Directory of Open Access Journals (Sweden)

    Uram Ł

    2013-12-01

    Full Text Available Łukasz Uram, Magdalena Szuster, Krzysztof Gargasz, Aleksandra Filipowicz, Elżbieta Wałajtys-Rode, Stanisław Wołowiec Cosmetology Department, University of Information Technology and Management in Rzeszów, Rzeszów, Poland Abstract: A third-generation polyamidoamine dendrimer (PAMAM G3 was used as a macromolecular carrier for pyridoxal and biotin. The binary covalent bioconjugate of G3, with nine molecules of biotin per one molecule of G3 (G39B, and the ternary covalent bioconjugate of G3, with nine biotin and ten pyridoxal molecules (G39B10P, were synthesized. The biotin and pyridoxal residues of the bioconjugate were available for carboxylase and transaminase enzymes, as demonstrated in the conversion of pyruvate to oxaloacetate and alanine to pyruvate, respectively, by in vitro monitoring of the reactions, using 1H nuclear magnetic resonance spectroscopy. The toxicity of the ternary bioconjugate (BC-PAMAM was studied in vitro on BJ human normal skin fibroblasts and human squamous cell carcinoma (SCC-15 cell cultures in comparison with PAMAM G3, using three cytotoxicity assays (XTT, neutral red, and crystal violet and an estimation of apoptosis by confocal microscopy detection. The tests have shown that BC-PAMAM has significantly lower cytotoxicity compared with PAMAM. Nonconjugated PAMAM was not cytotoxic at concentrations up to 5 µM (NR and 10 µM (XTT, and BC-PAMAM was not cytotoxic up to 50 µM (both assays for both cell lines. It has been also found that normal fibroblasts were more sensitive than SCC to both PAMAM and BC-PAMAM. The effect of PAMAM and BC-PAMAM on the initiation of apoptosis (PAMAM in fibroblasts at 5 µM and BC-PAMAM at 10 µM in both cell lines corresponded with cytotoxicity assays for both cell lines. We concluded that normal fibroblasts are more sensitive to the cytotoxic effects of the PAMAM G3 dendrimer and that modification of its surface cationic groups by substitution with biologically active molecules

  3. Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.

    Science.gov (United States)

    Li, Jingting; Sen, George L

    2015-12-14

    Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.

  4. Application of cultural algorithm to generation scheduling of hydrothermal systems

    International Nuclear Information System (INIS)

    Yuan Xiaohui; Yuan Yanbin

    2006-01-01

    The daily generation scheduling of hydrothermal power systems plays an important role in the operation of electric power systems for economics and security, which is a large scale dynamic non-linear constrained optimization problem. It is difficult to solve using traditional optimization methods. This paper proposes a new cultural algorithm to solve the optimal daily generation scheduling of hydrothermal power systems. The approach takes the water transport delay time between connected reservoirs into consideration and can conveniently deal with the complicated hydraulic coupling simultaneously. An example is used to verify the correctness and effectiveness of the proposed cultural algorithm, comparing with both the Lagrange method and the genetic algorithm method. The simulation results demonstrate that the proposed algorithm has rapid convergence speed and higher solution precision. Thus, an effective method is provided to solve the optimal daily generation scheduling of hydrothermal systems

  5. Hemolysis and cytotoxicity mechanisms of biodegradable magnesium and its alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zhen, Zhen [Center for Biomedical Materials and Tissue Engineering, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Liu, Xiaoli [School of Material Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Huang, Tao [Department of Materials Science and Engineering, State Key Laboratory for Turbulence and Complex System, College of Engineering, Peking University, Beijing 100871 (China); Xi, TingFei, E-mail: xitingfei@pku.edu.cn [Center for Biomedical Materials and Tissue Engineering, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Biomedical Engineering Research Center, Shenzhen Institute, Peking University, Shenzhen 518057 (China); Shenzhen Key Laboratory of Human Tissue Regeneration and Repair, Shenzhen Institute, Peking University, Shenzhen 518057 (China); Zheng, Yufeng [Center for Biomedical Materials and Tissue Engineering, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Department of Materials Science and Engineering, State Key Laboratory for Turbulence and Complex System, College of Engineering, Peking University, Beijing 100871 (China); Shenzhen Key Laboratory of Human Tissue Regeneration and Repair, Shenzhen Institute, Peking University, Shenzhen 518057 (China)

    2015-01-01

    Good hemocompatibility and cell compatibility are essential requirements for coronary stents, especially for biodegradable magnesium alloy stents, which could change the in situ environment after implanted. In this work, the effects of magnesium ion concentration and pH value on the hemolysis and cytotoxicity have been evaluated. Solution with different Mg{sup 2+} concentration gradients and pH values of normal saline and cell culture media DMEM adjusted by MgCl{sub 2} and NaOH respectively were tested for the hemolysis and cell viability. Results show that even when the concentration of Mg{sup 2+} reaches 1000 μg/mL, it has little destructive effect on erythrocyte, and the high pH value over 11 caused by the degradation is the real reason for the high hemolysis ratio. Low concentrations of Mg{sup 2+} (< 100 μg/mL) cause no cytotoxicity to L929 cells, of which the cell viability is above 80%, while high concentrations of Mg{sup 2+} (> 300 μg/mL) could induce obvious death of the L929 cells. The pH of the extract plays a synergetic effect on cytotoxicity, due to the buffer action of the cell culture medium. To validate this conclusion, commercial pure Mg using normal saline and PBS as extract was tested with the measurement of pH and Mg{sup 2+} concentration. Pure Mg leads to a higher hemolysis ratio in normal saline (47.76%) than in buffered solution (4.38%) with different pH values and low concentration of Mg{sup 2+}. The Mg extract culture media caused no cytotoxicity, with pH = 8.44 and 47.80 μg/mL Mg{sup 2+}. It is suggested that buffered solution and dynamic condition should be adopted in the hemolysis evaluation. - Highlights: • Mg{sup 2+} and pH have been tested for hemolysis and cytotoxicity of biomedical Mg. • Even 1000 μg/ml Mg{sup 2+} cannot cause hemolysis, but hemolysis reaches 53.8% when pH > 11. • Mg{sup 2+} > 300 μg/mL induces death of L929 and slight alkaline improves the proliferation. • Pure Mg in normal saline induces high

  6. Hemolysis and cytotoxicity mechanisms of biodegradable magnesium and its alloys.

    Science.gov (United States)

    Zhen, Zhen; Liu, Xiaoli; Huang, Tao; Xi, TingFei; Zheng, Yufeng

    2015-01-01

    Good hemocompatibility and cell compatibility are essential requirements for coronary stents, especially for biodegradable magnesium alloy stents, which could change the in situ environment after implanted. In this work, the effects of magnesium ion concentration and pH value on the hemolysis and cytotoxicity have been evaluated. Solution with different Mg(2+) concentration gradients and pH values of normal saline and cell culture media DMEM adjusted by MgCl2 and NaOH respectively were tested for the hemolysis and cell viability. Results show that even when the concentration of Mg(2+) reaches 1000 μg/mL, it has little destructive effect on erythrocyte, and the high pH value over 11 caused by the degradation is the real reason for the high hemolysis ratio. Low concentrations of Mg(2+) (300 μg/mL) could induce obvious death of the L929 cells. The pH of the extract plays a synergetic effect on cytotoxicity, due to the buffer action of the cell culture medium. To validate this conclusion, commercial pure Mg using normal saline and PBS as extract was tested with the measurement of pH and Mg(2+) concentration. Pure Mg leads to a higher hemolysis ratio in normal saline (47.76%) than in buffered solution (4.38%) with different pH values and low concentration of Mg(2+). The Mg extract culture media caused no cytotoxicity, with pH=8.44 and 47.80 μg/mL Mg(2+). It is suggested that buffered solution and dynamic condition should be adopted in the hemolysis evaluation. Copyright © 2014. Published by Elsevier B.V.

  7. Cytotoxic and radioprotective effects of Podophyllum hexandrum.

    Science.gov (United States)

    Shukla, Sandeep Kumar; Chaudhary, Pankaj; Prem Kumar, Indracanti; Afrin, Farhat; Puri, Satish Chandra; Qazi, Ghulam Nabi; Sharma, Rakesh Kumar

    2006-07-01

    Podophyllum hexandrum, a herb thriving in Himalayas has already been reported to exhibit antitumor and radioprotective properties. Present study was undertaken to unravel the possible mechanism responsible for the cytotoxic and radioprotective properties of REC-2001, a fraction isolated from the rhizome of P. hexandrum using murine peritoneal macrophages and plasmid DNA as model systems. Cell death, levels of intracellular reactive oxygen species (ROS) and apoptosis were studied employing trypan blue exclusion assay, dichlorofluorescein diacetate and DNA fragmentation assay, respectively. Superoxide anions, hydroxyl radicals and DNA damage were estimated following nitroblue tetrazolium, 2-deoxyribose degradation and plasmid DNA relaxation assays, respectively. Pre-irradiation administration of REC-2001 to peritoneal macrophages in the concentration range of 25-200μg/ml significantly reduced radiation induced ROS generation, DNA damage, apoptosis and cell killing in comparison to radiation control group indicating radioprotective potential. Studies with plasmid DNA indicated the ability of REC-2001 to inhibit 20Gy induced single and double strand breaks further supporting the antioxidative potential. However, REC-2001 in a dose-dependent fashion induced cell death, ROS and DNA fragmentation indicating the cytotoxic nature. REC-2001, in presence of 100μM copper sulfate, generated significant amount of hydroxyl radicals and superoxide anions indicating ability to act as a pro-oxidant in presence of metal ions. The superoxide anion generation was found to be sensitive to metal chelators like EDTA and deferoxamine mesylate (DFR). These results suggest that the ability of REC-2001 to act as a pro-oxidant in presence of metal ions and antioxidant in presence of free radicals might be responsible for cytotoxic and radioprotective properties.

  8. Influence of copper ions on the viability and cytotoxicity of Pseudomonas aeruginosa under conditions relevant to drinking water environments.

    Science.gov (United States)

    Dwidjosiswojo, Zenyta; Richard, Jessica; Moritz, Miriam M; Dopp, Elke; Flemming, Hans-Curt; Wingender, Jost

    2011-11-01

    Copper plumbing materials can be the source of copper ions in drinking water supplies. The aim of the current study was to investigate the influence of copper ions on the viability and cytotoxicity of the potential pathogen Pseudomonas aeruginosa that presents a health hazard when occurring in building plumbing systems. In batch experiments, exposure of P. aeruginosa (10(6)cells/mL) for 24h at 20°C to copper-containing drinking water from domestic plumbing systems resulted in a loss of culturability, while total cell numbers determined microscopically did not decrease. Addition of the chelator diethyldithiocarbamate (DDTC) to copper-containing water prevented the loss of culturability. When suspended in deionized water with added copper sulfate (10 μM), the culturability of P. aeruginosa decreased by more than 6 log units, while total cell counts, the concentration of cells with intact cytoplasmic membranes, determined with the LIVE/DEAD BacLight kit, and the number of cells with intact 16S ribosomal RNA, determined by fluorescent in situ hybridization, remained unchanged. When the chelator DDTC was added to copper-stressed bacteria, complete restoration of culturability was observed to occur within 14 d. Copper-stressed bacteria were not cytotoxic towards Chinese hamster ovary (CHO-9) cells, while untreated and resuscitated bacteria caused an almost complete decrease of the concentration of viable CHO-9 cells within 24 h. Thus, copper ions in concentrations relevant to drinking water in plumbing systems seem to induce a viable but non-culturable (VBNC) state in P. aeruginosa accompanied by a loss of culturability and cytotoxicity, and VBNC cells can regain both culturability and cytotoxicity, when copper stress is abolished. Copyright © 2011 Elsevier GmbH. All rights reserved.

  9. Cytotoxicity and Genotoxicity of Cypermethrin in Hepatocarcinoma Cells: A Dose- and Time-Dependent Study.

    Science.gov (United States)

    AlKahtane, Abdullah A; Alarifi, Saud; Al-Qahtani, Ahmed A; Ali, Daoud; Alomar, Suliman Y; Aleissia, Mohammed S; Alkahtani, Saad

    2018-01-01

    Most of the agricultural workers are potentially exposed to pesticides through different routes. Inhalation exposures may result in numerous diseases that can adversely affect an individual's health and capacity to perform at work. The aim of this study was to determine the cytotoxic potential of cypermethrin pesticide on cultured human hepatocarcinoma (HepG2) cells. The HepG2 cells were exposed to cypermethrin (0, 5, 15, 40 ng/mL) for 24 and 48 hours. We observed that cypermethrin caused cell death of HepG2 cells using 3-(4, 5-dimethylthiozolyl-2)-2,5-diphenyl tetrazolium bromide (MTT) and lactate dehydrogenase tests. Furthermore, cypermethrin reduced HepG2 cells viability in a time and dose dependent basis, that was probably mediated through the induction of reactive oxygen species (ROS) and apoptosis. An increase in ROS generation with a concomitant increase in expression of the proapoptotic protein Bcl-2 and cytochrome c and decrease in the antiapoptosis protein Bax suggested that a mitochondria-mediated pathway was involved in cypermethrin-induced apoptosis. These findings provide insights into the underlying mechanisms involved in cytotoxicity of cypermethrin in HepG2 cells.

  10. Will generation experience a culture clash in hotels : An exploratory study

    NARCIS (Netherlands)

    Groen, B.; Lub, X.D.; Nije Bijvank, M.

    2009-01-01

    This research explores how Baby Boomers (1945 -1964), Generation X (1965-1980), and Generation Y (1981-1995) perceive organisational culture in an international hotel chain, using Quinn's competing values model. The sample consisted of 181 employees (response 72%). The four orientations that

  11. A new assay for cytotoxic lymphocytes, based on a radioautographic readout of 111In release, suitable for rapid, semi-automated assessment of limit-dilution cultures

    International Nuclear Information System (INIS)

    Shortman, K.; Wilson, A.

    1981-01-01

    A new assay for cytotoxic T lymphocytes is described, of general application, but particularly suitable for rapid, semi-automated assessment of multiple microculture tests. Target cells are labelled with high efficiency and to high specific activity with the oxine chelate of 111 indium. After a 3-4 h incubation of test cells with 5 X 10 3 labelled target cells in V wells of microtitre trays, samples of the supernatant are spotted on paper (5 μl) or transferred to soft-plastic U wells (25-50 μl) and the 111 In release assessed by radioautography. Overnight exposure of X-ray film with intensifying screens at -70 0 C gives an image which is an intense dark spot for maximum release, a barely visible darkening with the low spontaneous release, and a definite positive with 10% specific lysis. The degree of film darkening, which can be quantitated by microdensitometry, shows a linear relationship with cytotoxic T lymphocyte dose up to the 40% lysis level. The labelling intensity and sensitivity can be adjusted over a wide range, allowing a single batch of the short half-life isotope to serve for 2 weeks. The 96 assays from a single tray are developed simultaneously on a single small sheet of film. Many trays can be processed together, and handling is rapid if 96-channel automatic pipettors are used. The method allows rapid visual scanning for positive and negative limit dilution cultures in cytotoxic T cell precursor frequency and specificity studies. In addition, in conjunction with an automated densitometer designed to scan microtitre trays, the method provides an efficient alternative to isotope counting in routine cytotoxic assays. (Auth.)

  12. Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines

    Science.gov (United States)

    Hamilton, Gerhard

    2014-01-01

    Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4) inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC) cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS) and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose)-Polymerase 1 (PARP1) inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS. PMID:24608973

  13. Sustainable Tourism Destinations: Cultural Sites Generated by Romanian People of Genius as a Potential Resource for Cultural Tourism

    Directory of Open Access Journals (Sweden)

    Daniela NICOLAIE

    2015-10-01

    Full Text Available The progress of humankind brought forth the world nations’ assets. People of genius from different parts of the world, who showed interest in various areas of knowledge, increased over the centuries the cultural heritage of the people they came from. Thus, cultural tourism can put forward those works of science and art, architecture, sculpture and painting, literature and history, which became part of the world heritage through their unique features and role. Part of these works emerged from Romanian men of genius cluster. Public attitude towards cultural awareness is essential, both for the prestige of those working in this sector and for the whole system of values of Romanian cultural heritage. The aim of this article is to identify those places generated by the Romanian people of genius life activity as well as their areas of interest as potential resources for cultural tourism. The research is grounded on secondary data such as biographic method of inquiry. The results show that cultural sites generated by Romanian people of genius’s life and works represent a wide range of resources that can be integrated into a cultural tourism package for those interested in this type of journeys. Local authorities can get fully involved in rehabilitation, maintenance and protection of all these national assets as distinctive national elements that can support for an attractive tourism market.

  14. Concanavalin A-induced activation of lymphocytic choriomeningitis virus memory lymphocytes into specifically cytotoxic T cells

    DEFF Research Database (Denmark)

    Marker, O; Thomsen, Allan Randrup; Andersen, G T

    1977-01-01

    When spleen cells, which have been primed to Lymphocytic Choriomeningitis (LCM) virus during a primary infection several months previously, are stimulated in vitro with Con A. highly specific secondary cytotoxic effector cells are generated. The degree of cytotoxicity revealed by such Con A...

  15. Cytotoxic activity of vitamins K1, K2 and K3 against human oral tumor cell lines.

    Science.gov (United States)

    Okayasu, H; Ishihara, M; Satoh, K; Sakagami, H

    2001-01-01

    Vitamin K1, K2 and K3 were compared for their cytotoxic activity, radical generation and O2- scavenging activity. Among these compounds, vitamin K3 showed the highest cytotoxic activity against human oral tumor cell lines (HSC-2, HSG), human promyelocytic leukemic cell line (HL-60) and human gingival fibroblast (HGF). Vitamin K3 induced internucleosomal DNA fragmentation in HL-60 cells, but not in HSC-2 or HSG cells. The cytotoxic activity of vitamins K2 and K1 was one and two orders lower, respectively, than K3. Vitamin K2, but not vitamin K3, showed tumor-specific cytotoxic action. ESR spectroscopy showed that only vitamin K3 produced radical(s) under alkaline condition and most potently enhanced the radical intensity of sodium ascorbate and scavenged O2- (generated by hypoxanthine-xanthine oxidase reaction system); vitamin K2 was much less active whereas vitamin K1 was inactive. These data suggest that the cytotoxic activity of vitamin K3 is generated by radical-mediated oxidation mechanism and that this vitamin has two opposing actions (that is, antioxidant and prooxidant), depending on the experimental conditions.

  16. Cytotoxicity of semiconductor nanoparticles in A549 cells is attributable to their intrinsic oxidant activity

    Energy Technology Data Exchange (ETDEWEB)

    Escamilla-Rivera, Vicente; Uribe-Ramirez, Marisela [Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV-IPN), Departamento de Toxicología (Mexico); Gonzalez-Pozos, Sirenia [CINVESTAV-IPN, Unidad de Microscopia Electrónica (LaNSE) (Mexico); Velumani, Subramaniam [CINVESTAV-IPN, Departamento de Ingeniería Eléctrica (Mexico); Arreola-Mendoza, Laura [Centro Interdisciplinario de Investigaciones y Estudios sobre Medio Ambiente y Desarrollo del Instituto Politécnico Nacional (CIIEMAD-IPN), Departamento de Biociencias e Ingeniería (Mexico); Vizcaya-Ruiz, Andrea De, E-mail: avizcaya@cinvestav.mx [Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV-IPN), Departamento de Toxicología (Mexico)

    2016-04-15

    Copper indium gallium diselenide (CIGS) and cadmium sulfide (CdS) nanoparticles (NP) are next generation semiconductors used in photovoltaic cells (PV). They possess high quantum efficiency, absorption coefficient, and cheaper manufacturing costs compared to silicon. Due to their potential for an industrial development and the lack of information about the risk associated in their use, we investigated the influence of the physicochemical characteristics of CIGS (9 nm) and CdS (20 nm) in relation to the induction of cytotoxicity in human alveolar A549 cells through ROS generation and mitochondrial dysfunction. CIGS induced cytotoxicity in a dose dependent manner in lower concentrations than CdS; both NP were able to induce ROS in A549. Moreover, CIGS interact directly with mitochondria inducing depolarization that leads to the induction of apoptosis compared to CdS. Antioxidant pretreatment significantly prevented the loss of mitochondrial membrane potential and cytotoxicity, suggesting ROS generation as the main cytotoxic mechanism. These results demonstrate that semiconductor characteristics of NP are crucial for the type and intensity of the cytotoxic effects. Our work provides relevant information that may help guide the production of a safer NP-based PV technologies, and would be a valuable resource on future risk assessment for a safer use of nanotechnology in the development of clean sources of renewable energy.

  17. Emotion at Work: A Contribution to Third-Generation Cultural-Historical Activity Theory

    Science.gov (United States)

    Roth, Wolff-Michael

    2007-01-01

    Second-generation cultural-historical activity theory, which drew its inspiration from Leont'ev's work, constituted an advance over Vygotsky's first-generation theory by explicitly articulating the dialectical relation between individual and collective. As part of an effort to develop third-generation-historical activity theory, I propose in this…

  18. Effect of radiation and other cytotoxic agents on the growth of cells cultured from normal and tumor tissues from the female genital tract

    International Nuclear Information System (INIS)

    Mothersill, C.; Seymour, C.B.; Bonnar, J.

    1990-01-01

    A technique is presented which allows the response of human gynecological tissue to radiation and cytotoxic drugs to be assessed using a tissue culture explant system. The technique is simple to use and gives results in line with those obtained for human tissues by more complex culture methods. Data are presented showing how the explant technique developed by the group for other tissues can be adapted to yield acceptable results for normal tissue response to radiation. The potential of the technique for use in predictive testing of individual tumor response is then assessed in five cases of gynecological malignancy. It is clear that variations in sensitivity to different radio- and chemotherapy agents and combinations can be detected. The results obtained require clinical validation and it is hoped that this will come over the next few years from evaluation of patient response to treatment using individually optimized, rather than empirical therapy

  19. Conventional and whitening toothpastes: cytotoxicity, genotoxicity and effect on the enamel surface.

    Science.gov (United States)

    Camargo, Samira Esteves Afonso; Jóias, Renata Pilli; Santana-Melo, Gabriela Fátima; Ferreira, Lara Tolentino; El Achkar, Vivian Narana Ribeiro; Rode, Sigmar de Mello

    2014-12-01

    To evaluate the cytotoxicity and genotoxicity of whitening and common toothpastes, and the surface roughness of tooth enamel submitted to brushing with both toothpastes. Samples of whitening toothpastes [Colgate Whitening (CW) and Oral-B Whitening (OBW)] and regular (non-whitening) toothpastes (Colgate and Oral-B) were extracted in culture medium. Gingival human fibroblasts (FMM-1) were placed in contact with different dilutions of culture media that had been previously exposed to such materials, and the cytotoxicity was evaluated using the MTT assay. The genotoxicity was assessed by the micronucleus formation assay in Chinese hamster fibroblasts (V79). The cell survival rate and micronuclei number were assessed before and after exposure to the toothpaste extracts. For the surface roughness evaluation, 20 bovine tooth specimens, divided into four groups according to toothpastes, were submitted to 10,000 brushing cycles. The results were analyzed using the Mann-Whitney U and two-way ANOVA tests (P whitening toothpastes showed the highest numbers of micronuclei compared to the untreated control (UC) (P enamel surface (P whitening toothpastes and Oral-B were cytotoxic to the cells. The whitening toothpastes were more genotoxic to cells in vitro than the common toothpastes, and genotoxicity was more pronounced in the OBW toothpaste.

  20. Differential cytotoxic effects of 7-dehydrocholesterol-derived oxysterols on cultured retina-derived cells: Dependence on sterol structure, cell type, and density.

    Science.gov (United States)

    Pfeffer, Bruce A; Xu, Libin; Porter, Ned A; Rao, Sriganesh Ramachandra; Fliesler, Steven J

    2016-04-01

    Tissue accumulation of 7-dehydrocholesterol (7DHC) is a hallmark of Smith-Lemli-Opitz Syndrome (SLOS), a human inborn error of the cholesterol (CHOL) synthesis pathway. Retinal 7DHC-derived oxysterol formation occurs in the AY9944-induced rat model of SLOS, which exhibits a retinal degeneration characterized by selective loss of photoreceptors and associated functional deficits, Müller cell hypertrophy, and engorgement of the retinal pigment epithelium (RPE) with phagocytic inclusions. We evaluated the relative effects of four 7DHC-derived oxysterols on three retina-derived cell types in culture, with respect to changes in cellular morphology and viability. 661W (photoreceptor-derived) cells, rMC-1 (Müller glia-derived) cells, and normal diploid monkey RPE (mRPE) cells were incubated for 24 h with dose ranges of either 7-ketocholesterol (7kCHOL), 5,9-endoperoxy-cholest-7-en-3β,6α-diol (EPCD), 3β,5α-dihydroxycholest-7-en-6-one (DHCEO), or 4β-hydroxy-7-dehydrocholesterol (4HDHC); CHOL served as a negative control (same dose range), along with appropriate vehicle controls, while staurosporine (Stsp) was used as a positive cytotoxic control. For 661W cells, the rank order of oxysterol potency was: EPCD > 7kCHOL > DHCEO > 4HDHC ≈ CHOL. EC50 values were higher for confluent vs. subconfluent cultures. 661W cells exhibited much higher sensitivity to EPCD and 7kCHOL than either rMC-1 or mRPE cells, with the latter being the most robust when challenged, either at confluence or in sub-confluent cultures. When tested on rMC-1 and mRPE cells, EPCD was again an order of magnitude more potent than 7kCHOL in compromising cellular viability. Hence, 7DHC-derived oxysterols elicit differential cytotoxicity that is dose-, cell type-, and cell density-dependent. These results are consistent with the observed progressive, photoreceptor-specific retinal degeneration in the rat SLOS model, and support the hypothesis that 7DHC-derived oxysterols are causally linked to that

  1. Cytotoxicity of four denture adhesives on human gingival fibroblast cells.

    Science.gov (United States)

    Lee, Yoon; Ahn, Jin-Soo; Yi, Young-Ah; Chung, Shin-Hye; Yoo, Yeon-Jee; Ju, Sung-Won; Hwang, Ji-Yun; Seo, Deog-Gyu

    2015-02-01

    The purpose of this study was to compare the cytotoxicity of four denture adhesives on human gingival fibroblast cells. Immortalized human gingival fibroblasts were cultured with one of four different denture adhesives, Polident, Protefix, Staydent or Denfix-A, which was placed in insert dishes (10% w/v concentration) for 48 h. The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and flow cytometric apoptosis assay were used to evaluate cell viability and apoptosis rates. The fibroblasts were also examined under a scanning electron microscope. The MTT assay showed that all denture adhesives resulted in a significantly lower cell viability compared to the control cells propagated in normal culture medium (p 0.05). Staydent showed the highest apoptosis rate. Scanning electron microscopy showed that the cells of the Staydent group underwent cytoplasmic membrane shrinkage, with cell free areas containing residual fragments of the membrane of dead cells. The four denture adhesives evaluated in this study imparted cytotoxic effects on human gingival fibroblast cells. Staydent showed the highest toxicity.

  2. Cytotoxicity study of plant Aloe vera (Linn

    Directory of Open Access Journals (Sweden)

    Atul N Chandu

    2012-01-01

    Full Text Available Background: The objective of this study has been to evaluate the in-vitro antitumor activity of Aloe vera extract of in cultured B16F10 melanoma cell line by measuring cell viability using "Trypan blue exclusion assay" method. Aim: To find out such kind of anticancer drug which is a cheap, safe, less toxic, and more potent drug compared to chemotherapy drug. Materials and Methods: In-vitro antitumor activity cell culture1, drug treatment (standard and test extract and Trypan blue exclusion assay growth and viability test 1 were used. Treatment of Aloe vera extract against B16F10 melanoma cell line, in all concentration range, showed decrease in percent cell viability, as compared to that of negative when examined by "Trypan blue exclusion assay". Results: In overall variation of test samples, Aloe vera extract showed its best activity in the concentration of 300 μg/ml, which was approximately equal to the activity of standard drug doxorubicin. Evaluation of in-vitro antitumor activity revealed that Aloe vera extract exhibits good cytotoxic activity. The best cytotoxic activity by Aloe vera was shown at 200 μg/ml concentration. Conclusion: The study of cytoprotection against normal cells by micronucleus assay has shown that the herbal extracts have less toxic effects to the normal blood lymphocytes, as compared to that of standard anticancer drug.

  3. Cytotoxicity of the Ascidian Cystodytes dellechiajei Against Tumor Cells and Study of the Involvement of Associated Microbiota in the Production of Cytotoxic Compounds

    Directory of Open Access Journals (Sweden)

    Josefa Antón

    2007-07-01

    Full Text Available Many cytotoxic compounds of therapeutic interest have been isolated from marine invertebrates, and some of them have been reported to be of microbial origin. Pyridoacridine alkaloids are the main compounds extracted from the ascidian Cystodytes dellechiajei. Here we describe the in vitro antiproliferative activity against different tumor cell lines of the ascidian extracts and provide some insights on the role of the microbial community associated with the tunicate in the production of these compounds. C. dellechiajei extracts showed remarkably high antiproliferative activity (IC50 ≤5 μg/mL in human lung carcinoma A-549, colon adenocarcinoma H-116, pancreatic adenocarcinoma PSN-1 and breast carcinoma SKBR3 cell lines. Moreover, we found that the maximum activity was located in the tunic tissue of the colony, which harbours a microbial community. In order to ascertain the involvement of this community in the synthesis of the bioactive compounds different approachs that included culture and culture independent methods were carried out. We undertook a screening for antiproliferative activities of the bacterial isolates from the ascidian, as well as a comprative analysis of the cytotoxic activities and the microbial communities from two color morphs of the ascidian, green and blue. In addition, the changes of the antiproliferative activities and the composition of the microbial communities were studied from ascidians kept in aquaria and treated with antibiotics for one month. Our data obtained from the different experiments did not point out to bacteria as the source of the cytotoxic compounds, suggesting thus an ascidian origin.

  4. Cytotoxic and antimicrobial activities of endophytic fungi isolated from Bacopa monnieri (L.) Pennell (Scrophulariaceae).

    Science.gov (United States)

    Katoch, Meenu; Singh, Gurpreet; Sharma, Sadhna; Gupta, Nidhi; Sangwan, Payare Lal; Saxena, Ajit Kumar

    2014-02-11

    Endophytes, which reside in plant tissues, have the potential to produce novel metabolites with immense benefits for health industry. Cytotoxic and antimicrobial activities of endophytic fungi isolated from Bacopa monnieri (L.) Pennell were investigated. Endophytic fungi were isolated from the Bacopa monnieri. Extracts from liquid cultures were tested for cytotoxicity against a number of cancer cell lines using the MTT assay. Antimicrobial activity was determined using the micro dilution method. 22% of the examined extracts showed potent (IC50 of <20 μg/ml) cytotoxic activity against HCT-116 cell line. 5.5%, 11%, 11% of the extracts were found to be cytotoxic for MCF-7, PC-3, and A-549 cell lines respectively. 33% extracts displayed antimicrobial activity against at least one test organism with MIC value 10-100 μg/ml. The isolate B9_Pink showed the most potent cytotoxic activity for all the cell lines examined and maximum antimicrobial activity against the four pathogens examined which was followed by B19. Results indicated the potential for production of bioactive agents from endophytes of Bacopa monnieri.

  5. Analogues of luteinizing hormone-releasing hormone containing cytotoxic groups.

    Science.gov (United States)

    Janáky, T; Juhász, A; Bajusz, S; Csernus, V; Srkalovic, G; Bokser, L; Milovanovic, S; Redding, T W; Rékási, Z; Nagy, A

    1992-02-01

    In an attempt to produce better cytotoxic analogues, chemotherapeutic antineoplastic radicals including an alkylating nitrogen mustard derivative of D-phenylalanine (D-melphalan), reactive cyclopropane, anthraquinone derivatives [2-(hydroxymethyl)anthraquinone and the anticancer antibiotic doxorubicin], and an antimetabolite (methotrexate) were coupled to suitably modified agonists and antagonists of luteinizing hormone-releasing hormone (LH-RH). Analogues with D-lysine6 and D-ornithine6 or N epsilon-(2,3-diaminopropionyl)-D-lysine and N delta-(2,3-diaminopropionyl)-D-ornithine were used as carriers for one or two cytotoxic moieties. The enhanced biological activities produced by the incorporation of D amino acids into position 6 of the agonistic analogues were further increased by the attachment of hydrophobic cytotoxic groups, resulting in compounds with 10-50 times higher activity than LH-RH. Most of the monosubstituted agonistic analogues showed high affinities for the membrane receptors of human breast cancer cells, while the receptor binding affinities of peptides containing two cytotoxic side chains were lower. Antagonistic carriers [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,D-Lys6,D-Ala10] LH-RH [where Nal(2) is 3-(2-naphthyl)alanine], [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,N epsilon-(2,3-diaminopropionyl)-D-Lys6,D-Ala10]LH-RH, and their D-Pal(3)3 homologs [Pal(3) is 3-(3-pyridyl)alanine] as well as [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Pal(3)3,Tyr5,N epsilon-(2,3-diamino-propionyl)-D-Lys6,D-Ala10]LH-RH were linked to cytotoxic compounds. The hybrid molecules inhibited ovulation in rats at doses of 10 micrograms and suppressed LH release in vitro. The receptor binding of cytotoxic analogues was decreased compared to the precursor peptides, although analogues with 2-(hydroxymethyl)anthraquinone hemiglutarate had high affinities. All of the cytotoxic analogues tested inhibited [3H]thymidine incorporation into DNA in cultures of human breast and prostate cancer cell lines

  6. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  7. Cell-mediated immune response to syngeneic uv induced tumors. I. The presence of tumor associated macrophages and their possible role in the in vitro generation of cytotoxic lymphocytes

    International Nuclear Information System (INIS)

    Woodward, J.G.; Daynes, R.A.

    1978-01-01

    A primary in vitro sensitization system employing a chromium release assay was utilized to investigate reactivity of murine spleen cells toward syngeneic ultraviolet (uv) light induced fibrosarcomas. These tumors are immunologically rejected in vivo when implanted into normal syngeneic mice but grow progressively when implanted into syngeneic mice that had previously been irradiated with subcarcinogenic levels of uv light. Following appropriate sensitization, spleen cells from both normal and uv irradiated mice are capable of developing cytotoxic lymphocytes in vitro against the uv induced tumors. It was subsequently discovered that in situ uv induced tumors all contained macrophages of host origin that became demonstrable only after enzymatic dissociation of the tumor tissue. These macrophages were immunologically active in vitro as their presence in the stimulator cell population was necessary to achieve an optimum anti-tumor cytotoxic response following in vitro sensitization. Anti-tumor reactivity generated by mixing spleen cells and tumor cells in the absence of tumor derived macrophages could be greatly enhanced by the addition of normal syngeneic peritoneal macrophages. When in vitro anti-tumor reactivity of spleen cells from normal and uv treated mice was compared under these conditions we again found no significant difference in the magnitude of the responses. In addition, the cytotoxic cells generated in response to uv induced tumors appeared to be highly cross reactive with respect to their killing potential

  8. Microchip screening platform for single cell assessment of NK cell cytotoxicity

    Directory of Open Access Journals (Sweden)

    Karolin eGuldevall

    2016-04-01

    Full Text Available Here we report a screening platform for assessment of the cytotoxic potential of individual natural killer (NK cells within larger populations. Human primary NK cells were distributed across a silicon-glass microchip containing 32 400 individual microwells loaded with target cells. Through fluorescence screening and automated image analysis the numbers of NK and live or dead target cells in each well could be assessed at different time points after initial mixing. Cytotoxicity was also studied by time-lapse live-cell imaging in microwells quantifying the killing potential of individual NK cells. Although most resting NK cells (≈75% were non-cytotoxic against the leukemia cell line K562, some NK cells were able to kill several (≥3 target cells within the 12 hours long experiment. In addition, the screening approach was adapted to increase the chance to find and evaluate serial killing NK cells. Even if the cytotoxic potential varied between donors it was evident that a small fraction of highly cytotoxic NK cells were responsible for a substantial portion of the killing. We demonstrate multiple assays where our platform can be used to enumerate and characterize cytotoxic cells, such as NK or T cells. This approach could find use in clinical applications, e.g. in the selection of donors for stem cell transplantation or generation of highly specific and cytotoxic cells for adoptive immunotherapy.

  9. Microchip Screening Platform for Single Cell Assessment of NK Cell Cytotoxicity

    Science.gov (United States)

    Guldevall, Karolin; Brandt, Ludwig; Forslund, Elin; Olofsson, Karl; Frisk, Thomas W.; Olofsson, Per E.; Gustafsson, Karin; Manneberg, Otto; Vanherberghen, Bruno; Brismar, Hjalmar; Kärre, Klas; Uhlin, Michael; Önfelt, Björn

    2016-01-01

    Here, we report a screening platform for assessment of the cytotoxic potential of individual natural killer (NK) cells within larger populations. Human primary NK cells were distributed across a silicon–glass microchip containing 32,400 individual microwells loaded with target cells. Through fluorescence screening and automated image analysis, the numbers of NK and live or dead target cells in each well could be assessed at different time points after initial mixing. Cytotoxicity was also studied by time-lapse live-cell imaging in microwells quantifying the killing potential of individual NK cells. Although most resting NK cells (≈75%) were non-cytotoxic against the leukemia cell line K562, some NK cells were able to kill several (≥3) target cells within the 12-h long experiment. In addition, the screening approach was adapted to increase the chance to find and evaluate serial killing NK cells. Even if the cytotoxic potential varied between donors, it was evident that a small fraction of highly cytotoxic NK cells were responsible for a substantial portion of the killing. We demonstrate multiple assays where our platform can be used to enumerate and characterize cytotoxic cells, such as NK or T cells. This approach could find use in clinical applications, e.g., in the selection of donors for stem cell transplantation or generation of highly specific and cytotoxic cells for adoptive immunotherapy. PMID:27092139

  10. Genotoxic and cytotoxic damage by the therapeutic radiopharmaceutical [166Dy]Dy/166Ho-EDTMP as in vivo generator system

    International Nuclear Information System (INIS)

    Pedraza L, M.; Piedras R, J.; Ferro F, G.; Morales R, P.; Murphy S, E.; Hernandez O, O.

    2005-01-01

    In patients with leukemias and multiple myeloma, the cure can be obtained to inclination of a bone marrow transplant (m.o.), for that which one is used a combination of external radiotherapy and chemotherapy with the consequent toxicity to healthy organs. The complex [ 166 Dy]Dy/ 166 Ho-ethylenediaminetetramethylenephosphonate ([ 166 Dy]Dy/ 166 Ho-EDTMP) it forms a generator system in vivo stable with bony selective likeness in mice therefore, this it could work as a therapeutic radiopharmaceutical for bone marrow ablation. The objective of this original work was to determine the genotoxic and cytotoxic damage produced by the [ 166 Dy]Dy/ 166 Ho-EDTMP like a generator system in vivo by means of the reticulocytes reduction (RET) and micronucleus elevation in reticulocytes (RET-MN) in peripheral blood and to evaluate its myeloablative potential for histopathologic studies. It was irradiated 166 Dy 2 O 3 enriched and it was add in form 166 DyCI 3 to the EDTMP in a softening media of phosphates (pH 8), the optimal molar relationship 166 Dy: EDTMP was 1.7:1 and the radiochemical purity was evaluated by ITLC. The Dy:EDTMP complexes, non radioactive, its were prepared in the same way with non irradiated dysprosium oxide. A group of BALB/c mice was injected intraperitoneally with the radiopharmaceutical and two groups of control mice were injected with the non radioactive complex and with sodium chloride 0.9% respectively. Before injecting each one of the solutions it was take a basal sample of peripheral blood of the mouse tail and each 48 h post-injection during 12 d. The animals were sacrificed to obtain the organs of interest and to determine the radioactivity in each one. The femur was used for the histopathologic studies. The quantification of the frequency of RET and RET-MN was carried out by flow cytometry of the sanguine samples and the Monte Carlo code MCNP4B for the dosimetry calculations was used. The radiochemical purity was 99% and in average the specific

  11. Islet cytotoxicity of interleukin 1. Influence of culture conditions and islet donor characteristics

    DEFF Research Database (Denmark)

    Mandrup-Poulsen, T; Spinas, G A; Prowse, S J

    1987-01-01

    We recently demonstrated that the macrophage product interleukin 1 (IL-1) is cytotoxic to isolated pancreatic islets and hypothesized that IL-1 is responsible for beta-cell destruction in insulin-dependent diabetes mellitus (IDDM). We studied whether the variation in IDDM preponderance with age, ...

  12. The Mediating Roles of Generative Cognition and Organizational Culture between Personality Traits and Student Imagination

    Science.gov (United States)

    Liu, Yi-Lin; Liang, Chaoyun

    2014-01-01

    Using science majors as an example, we analyzed how generative cognition, organizational culture, and personality traits affect student imagination, and examined the mediating effects of generative cognition and organizational culture. A total of 473 undergraduates enrolled in physical, chemical, mathematical, and biological science programs…

  13. Dendritic cells decreased the concomitant expanded Tregs and Tregs related IL-35 in cytokine-induced killer cells and increased their cytotoxicity against leukemia cells.

    Directory of Open Access Journals (Sweden)

    Ying Pan

    Full Text Available Regulatory T cells (Tregs are potent immunosuppressive cells and essential for inducing immune tolerance. Recent studies have reported that Tregs and Tregs related cytokines can inhibit the antitumor activity of cytokine-induced killer (CIK cells, but dendritic cells co-cultured CIK (DC-CIK cells can be used for induction of a specific immune response by blocking of Tregs and TGF-β, IL-10. As a novel identified cytokine, IL-35 is specially produced by Tregs and plays an essential role in immune regulation. However, it remains unknown whether IL-35 roles in tumor immunotherapy mediated by CIK and DC-CIK cells. In this study, we cultured CIK and DC-CIK cells from the same healthy adult samples, and investigated their phenotype, proliferation, cytotoxic activity against leukemia cell lines K562 and NB4 by FCM and CCK-8, measured IL-35, TGF-β and IL-10 protein by ELISA, detected Foxp3, IL-35 and IL-35 receptor mRNA by Real-time PCR, respectively. We found Tregs and IL-35 concomitantly expanded by a time-dependent way during the generation of CIK cells, but DC significantly down-regulated the expression of them and simultaneously up-regulated the proliferation ability as well as cytotoxic activity of CIK cells against leukemia cell lines. Therefore, our data suggested that DC decreased concomitant expanded Tregs and Tregs related IL-35 in CIK cells and might contribute to improve their cytotoxicity against leukemia cells in vitro.

  14. [Cytotoxic effect of physalis peruviana in cell culture of colorectal and prostate cancer and chronic myeloid leukemia].

    Science.gov (United States)

    Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham

    2009-01-01

    The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.

  15. In vitro antibacterial and cytotoxicity assessments of an orthodontic bonding agent containing benzalkonium chloride.

    Science.gov (United States)

    Saito, Kayo; Hayakawa, Tohru; Kawabata, Rihito; Meguro, Daijiro; Kasai, Kazutaka

    2009-03-01

    To assess the antibacterial activity and cytotoxicity of an orthodontic bonding material containing an antibacterial agent. Superbond C&B (4-methacryloxyethyl trimellitate anhydride/methyl methacrylate-tri-n-butyl borane [4-META/MMA-TBB]) resin was mixed with benzalkonium chloride (BAC) to obtain final BAC concentrations of 0.25%, 0.75%, 1.25%, 1.75%, 2.5%, and 5.0% (wt/ wt). Antibacterial activity against Streptococcus mutans and Streptococcus sobrinus was evaluated by soaking the BAC-resin in distilled water at 37 degrees C for periods of 30, 90, and 180 days. Antibacterial activity of the BAC-resin was measured by the disk diffusion method, and the inhibition zone around each sample was measured and recorded. For evaluation of cytotoxicity, BAC-resin samples were put into cell culture inserts placed above human gingival cells and were incubated at 37 degrees C for 1, 3, and 6 days. Cytotoxicity was assessed with a tetrazolium bromide reduction assay. The antibacterial activity of BAC-incorporated resin samples decreased significantly after immersion in water for 180 days, regardless of BAC concentration. The antibacterial activity of nonimmersed resin containing 0.25% or 1.75% BAC was comparable with that of 5.0% BAC-resin immersed for 180 days. In cytotoxicity tests, most cells died when exposed to resins containing 1.75%, 2.5%, and 5% BAC. No difference was observed between resins containing 0.25% and 0.75% BAC at 1, 3, and 6 days of culture. The addition of BAC to 4-META/MMA-TBB resin confers an antibacterial effect even after immersion in water, and 4-META/MMA-TBB resin containing 0.25% to 0.75% BAC has no significant cytotoxic effect.

  16. Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Gerhard Hamilton

    2014-03-01

    Full Text Available Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4 inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose-Polymerase 1 (PARP1 inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS.

  17. In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Cordero Camacho

    2002-01-01

    Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.

  18. In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Cordero Camacho

    2011-12-01

    Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.

  19. Comparative cytotoxicity assessments of some manufactured and anthropogenic nanoparticulate materials

    Science.gov (United States)

    Soto, Karla Fabiola

    toxicity evaluation, cytokine production, mitochondrial function (MTT assay), reactive oxygen species generation (ROS), were assessed after 48 and 336 hours under control and exposed conditions. A simple, direct-contact assay was developed to evaluate the toxicity of anthropogenic particulate matter (PM), without removing it from high volume filter collections and exposing collected PM by direct contact with the human epithelial (A549) cells in culture. The cell viability data revealed that the manufactured nanomaterials exhibit cytotoxic response for the murine alveolar and human macrophage cell line, but in particular to the human epithelial cell line. Assay results for the direct-contact of filter-collected carbonaceous nanoparticulate, showed toxicity for all PM, but with various natural gas combustion PM being the most toxic. Light optical microscopy examination of affected human epithelial cells confirmed quantitative results. These nanoparticulate soots also produced the most reactive oxygen species (ROS) on the A549 cell culture as well as along with the Fe2O3, MWCNT-N, and black carbon (BC). Comparison of polycyclic aromatic hydrocarbon (PAH) content and concentration for the carbonaceous PM showed no PAH correlation with relative cell viability after 48 h. In addition, there was no correlation of cytotoxic response with specific surface area in the manufactured nanoparticulate materials. In conclusion, the manufactured as well as the anthropogenic nanomaterials were observed to generate large amounts of ROS and cytokines. This study suggests that the mechanism of toxicity is likely due to the generation of reactive oxygen species (ROS). Also, the comparative assessments presented, should be viewed as a precaution when considering the inhalation of the corresponding nanoparticulate materials in concentrations approaching those identified to be dangerous for recognized pathogens such as silica, black carbon, and asbestos. Humans should avoid breathing these

  20. Radiation prevulcanized natural rubber latex: Cytotoxicity and safety evaluation on animal

    Energy Technology Data Exchange (ETDEWEB)

    Keong, C C; Zin, W M Wan; Ibrahim, P; Ibrahim, S, E-mail: chai@nuclearmalaysia.gov.my [Malaysian Nuclear Agency, Bangi, 43000 Kajang, Selangor (Malaysia)

    2010-05-15

    Radiation prevulcanized natural rubber latex (RVNRL) was claimed to be more user friendly than natural rubber latex prevulcanized by sulphur curing system. The absence of Type IV allergy inducing chemicals in RVNRL make it a suitable material for manufacturing of many kinds of latex products, especially those come into direct contact with users. This paper reveals and discusses the findings of cytotoxicity test and safety evaluation on animal for RVNRL. The test was done on RVNRL films prepared by coagulant dipping method and RVNRL dipped products produced by latex dipped product manufacturers. Cytotocixity test was carried out on mammalian cell culture American Type Culture Collection CCL 81, Vero. Results indicated that no cytotoxic effect from RVNRL films and products was found on the cell culture. Two animal studies, namely dermal sensitization study and primary skin irritation study, were done on gloves made from RVNRL. Albino white guinea pigs were used as test subjects in dermal sensitization study and results showed no sensitization induced by the application of test material in the guinea pigs. Primary skin irritation study was done on New Zealand white rabbits and results showed that the product tested was not corrosive and was not a primary irritant

  1. Radiation prevulcanized natural rubber latex: Cytotoxicity and safety evaluation on animal

    International Nuclear Information System (INIS)

    Keong, C C; Zin, W M Wan; Ibrahim, P; Ibrahim, S

    2010-01-01

    Radiation prevulcanized natural rubber latex (RVNRL) was claimed to be more user friendly than natural rubber latex prevulcanized by sulphur curing system. The absence of Type IV allergy inducing chemicals in RVNRL make it a suitable material for manufacturing of many kinds of latex products, especially those come into direct contact with users. This paper reveals and discusses the findings of cytotoxicity test and safety evaluation on animal for RVNRL. The test was done on RVNRL films prepared by coagulant dipping method and RVNRL dipped products produced by latex dipped product manufacturers. Cytotocixity test was carried out on mammalian cell culture American Type Culture Collection CCL 81, Vero. Results indicated that no cytotoxic effect from RVNRL films and products was found on the cell culture. Two animal studies, namely dermal sensitization study and primary skin irritation study, were done on gloves made from RVNRL. Albino white guinea pigs were used as test subjects in dermal sensitization study and results showed no sensitization induced by the application of test material in the guinea pigs. Primary skin irritation study was done on New Zealand white rabbits and results showed that the product tested was not corrosive and was not a primary irritant

  2. Cytotoxicity and antiviral activity of electrochemical - synthesized silver nanoparticles against poliovirus.

    Science.gov (United States)

    Huy, Tran Quang; Hien Thanh, Nguyen Thi; Thuy, Nguyen Thanh; Chung, Pham Van; Hung, Pham Ngoc; Le, Anh-Tuan; Hong Hanh, Nguyen Thi

    2017-03-01

    Silver nanoparticles (AgNPs) have been proven to have noticeable cytotoxicity in vitro and antiviral activity against some types of enveloped viruses. This paper presents the cytotoxicity and antiviral activity of pure AgNPs synthesized by the electrochemical method, towards cell culture and poliovirus (a non-enveloped virus). Prepared AgNPs were characterized by ultraviolet-visible spectroscopy, energy-dispersive X-ray spectroscopy and transmission electron microscopy. Before incubation with poliovirus, different concentrations of AgNPs were added to human rhabdomyosarcoma (RD) cell monolayers seeded in 96 well plates for testing their cytotoxicity. The in vitro cytotoxicity and anti-poliovirus activity of AgNPs were daily assessed for cytopathic effect (CPE) through inverted light microscopy. CPE in the tested wells was determined in comparison with those in wells of negative and positive control. Structure analysis showed that AgNPs were formed with a quasi-spherical shape with mean size about 7.1nm and high purity. No CPE of RD cells was seen in wells at the time point of 48h post-incubation with AgNPs at concentration up to 100ppm. The anti-poliovirus activity of AgNPs was determined at 3.13ppm corresponding to the viral concentration of 1TCID 50 (Tissue Culture Infective Dose) after 30min, and 10TCID 50 after 60min, the cell viability was found up to 98% at 48h post-infection, with no CPE found. Whereas, a strong CPE of RD cells was found at 48h post-infection with the mixture of AgNPs and poliovirus at concentration of 100TCID 50 , and in wells of positive controls. With mentioned advantages, electrochemical-synthesized AgNPs are promising candidate for advanced biomedical and disinfection applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Cytotoxic effects and apoptosis induction of enrofloxacin in hepatic cell line of grass carp (Ctenopharyngodon idellus).

    Science.gov (United States)

    Liu, Bo; Cui, Yanting; Brown, Paul B; Ge, Xianping; Xie, Jun; Xu, Pao

    2015-12-01

    We determined the effect of enrofloxacin on the lactate dehydrogenase (LDH) release, reactive oxygen species (ROS), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), mitochondria membrane potential (ΔΨm) and apoptosis in the hepatic cell line of grass carp (Ctenopharyngodon idellus). Cultured cells were treated with different concentrations of enrofloxacin (12.5-200 ug/mL) for 24 h. We found that the cytotoxic effect of enrofloxacin was mediated by apoptosis, and that this apoptosis occurred in a dose-dependent manner. The doses of 50,100 and 200 μg/mL enrofloxacin increased the LDH release and MDA concentration, induced cell apoptosis and reduced the ΔΨm compared to the control. The highest dose of 200 ug/mL enrofloxacin also significantly induced apoptosis accompanied by ΔΨm disruption and ROS generation and significantly reduced T-AOC and increased MDA concentration compared to the control. Our results suggest that the dose of 200 ug/mL enrofloxacin exerts its cytotoxic effect and produced ROS via apoptosis by affecting the mitochondria of the hepatic cells of grass carp. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Parental autonomy support and ethnic culture identification among second-generation immigrants.

    Science.gov (United States)

    Abad, Neetu S; Sheldon, Kennon M

    2008-08-01

    Born and raised in the United States, children of immigrants often face conflict over whether to endorse the norms and traditions of the family's country of origin (the natal culture) or those of mainstream U.S. society (the host culture). The authors hypothesized that when immigrant parents allow children to make their own choices concerning their cultural identity, their children will be more likely to internalize the natal culture and will experience greater well-being. Ninety-nine college-aged 2nd-generation immigrants rated their well-being, perceptions of their mother's and father's autonomy support, and their endorsement of both natal and U.S. cultures. Results demonstrated that paternal, but not maternal, autonomy support predicted greater well-being and greater endorsement of the natal culture and that immersion in the natal culture predicted some indices of well-being. Several explanations for the possibly greater significance of paternal versus maternal autonomy support in the context of immigrant families are considered.

  5. Dose-dependent cytotoxicity of clinically relevant cobalt nanoparticles and ions on macrophages in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Young-Min; Xia Zhidao; Glyn-Jones, Sion; Beard, David; Gill, Harinderjit S; Murray, David W, E-mail: young-min.kwon@ndos.ox.ac.u [Nuffield Department of Orthopaedic Surgery, University of Oxford, Oxford OX3 7LD (United Kingdom)

    2009-04-15

    Despite the satisfactory short-term implant survivorship of metal-on-metal hip resurfacing arthroplasty, periprosthetic soft-tissue masses such as pseudotumours are being increasingly reported. Cytotoxic effects of cobalt or chromium have been suggested to play a role in its aetiology. The aim of this study was to investigate the effects of clinically relevant metal nanoparticles and ions on the viability of macrophages in vitro. A RAW 264.7 murine macrophage cell line was cultured in the presence of either: (1) cobalt, chromium and titanium nanoparticles sized 30-35 nm; or (2) cobalt sulphate and chromium chloride. Two methods were used to quantify cell viability: Alamar Blue assay and Live/Dead assay. The cytotoxicity was observed only with cobalt. Cobalt nanoparticles and ions demonstrated dose-dependent cytotoxic effects on macrophages in vitro: the cytotoxic concentrations of nanoparticles and ions were 1 x 10{sup 12} particles ml{sup -1} and 1000 {mu}M, respectively. The high concentration of cobalt nanoparticles required for cytotoxicity of macrophages in vitro suggests that increased production of cobalt nanoparticles in vivo, due to excessive MoM implant wear, may lead to local adverse biological effects. Therefore, cytotoxicity of high concentrations of metal nanoparticles phagocytosed by macrophages located in the periprosthetic tissues may be an important factor in pathogenesis of pseudotumours.

  6. Identification of a cytotoxic molecule in heat-modified citrus pectin.

    Science.gov (United States)

    Leclere, Lionel; Fransolet, Maude; Cambier, Pierre; El Bkassiny, Sandy; Tikad, Abdellatif; Dieu, Marc; Vincent, Stéphane P; Van Cutsem, Pierre; Michiels, Carine

    2016-02-10

    Modified forms of citrus pectin possess anticancer properties. However, their mechanism of action and the structural features involved remain unclear. Here, we showed that citrus pectin modified by heat treatment displayed cytotoxic effects in cancer cells. A fractionation approach was used aiming to identify active molecules. Dialysis and ethanol precipitation followed by HPLC analysis evidenced that most of the activity was related to molecules with molecular weight corresponding to low degree of polymerization oligogalacturonic acid. Heat-treatment of galacturonic acid also generated cytotoxic molecules. Furthermore, heat-modified galacturonic acid and heat-fragmented pectin contained the same molecule that induced cell death when isolated by HPLC separation. Mass spectrometry analyses revealed that 4,5-dihydroxy-2-cyclopenten-1-one was one cytotoxic molecule present in heat-treated pectin. Finally, we synthesized the enantiopure (4R,5R)-4,5-dihydroxy-2-cyclopenten-1-one and demonstrated that this molecule was cytotoxic and induced a similar pattern of apoptotic-like features than heat-modified pectin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Generational Politics: Narratives of Power in Central Asia's Visual Culture

    OpenAIRE

    Khudonazar, Anaita

    2011-01-01

    This dissertation focuses on the visual representation of generational politics as it changed during Imperial, Soviet and Post Soviet periods. It argues that the most important shift in visual representation of power relations between generations in Central Asia took place in the late 1920s when a group of cultural producers, which this dissertation introduces as Transsoveticus, entered the Soviet art and film industries. This dissertation demonstrates ways in which these artists and filmmak...

  8. Cytotoxic and Antimicrobial Compounds from the Marine-Derived Fungus, Penicillium Species

    Directory of Open Access Journals (Sweden)

    Diaa T. A. Youssef

    2018-02-01

    Full Text Available The organic extract of liquid cultures of the marine-derived Penicillium sp. was investigated. Fractionation of the extracts of the fungus led to the purification and identification of two new compounds, penicillatides A (1 and B (2, together with the previously reported cyclo(R-Pro–S-Phe (3 and cyclo(R-Pro–R-Phe (4. The structures of compounds 1–4 were assigned by extensive interpretation of their NMR and high-resolution mass spectrometry (HRMS. The antiproliferative and cytotoxic activities of the compounds against three human cancer cell lines as well as their antimicrobial activity against several pathogens were evaluated. Compounds 2–4 displayed variable cytotoxic and antimicrobial activities.

  9. HeLa cell variants that differ in sensitivity to monofunctional alkylating agents, with independence of cytotoxic and mutagenic responses

    Science.gov (United States)

    Baker, R. M.; Voorhis, W. C. Van; Spencer, L. A.

    1979-01-01

    Different strains of the established human cell line HeLa differ substantially in sensitivity to ethyl methanesulfonate (EtMes). The EtMes doses effective for either cytotoxicity or mutation induction in a line of HeLa S3 cells are about 1/10th those required in the CCL2 HeLa line of the American Type Culture Collection. By plating the sensitive HeLa S3 line in the presence of highly cytotoxic doses of EtMes, we obtained a clone (designated A6) that displays about 7-fold greater resistance to EtMes toxicity. This A6 isolate is also cross resistant to other simple monofunctional alkylating agents—exhibiting about 4-fold increased resistance to methyl methanesulfonate and 10- to 15-fold increased resistance to N-methyl-N′-nitro-N-nitrosoguanidine but is similar to the S3 parent in sensitivity to mitomycin C, UV radiation, and γ-rays. In contrast to the results for cytotoxicity, the A6 variant and the S3 parent showed the same high susceptibility to EtMes induction of ouabain-resistant mutations. This is direct biological evidence that different alkylation lesions are normally responsible for mutagenic and cytotoxic effects. The S3 and A6 cell lines may differ in DNA repair capability specific to certain potentially lethal alkylation products. The comparative sensitivity of the A6 cells to alkylation mutagenesis may also prove useful in cell genetic studies by facilitating the generation of multiple mutants for recessive alleles and permitting exceptionally sensitive detection of specific mutagenic effects. PMID:291942

  10. Development of a microfluidic perfusion 3D cell culture system

    Science.gov (United States)

    Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

    2018-04-01

    Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

  11. Cell-mediated immunity to Plasmodium falciparum infection: evidence against the involvement of cytotoxic lymphocytes

    DEFF Research Database (Denmark)

    Theander, T G; Andersen, B J; Pedersen, B K

    1988-01-01

    stimulated PBMC from malaria-immune donors by SPag and purified protein derivative (PPD) in culture for 7 days. The PBMC were then co-incubated with P. falciparum for 48 h, and parasitaemia was determined by microscopy. Parasite growth was only significantly impaired after incubation with PBMC stimulated...... by either SPag or PPD in the presence of immune serum. Studies on subpopulations of PBMC indicated that the inhibitory cells resided among the adherent cell fraction. Furthermore we tested PBMC for cytotoxic activity against P. falciparum-infected autologous or heterologous erythrocytes. Experiments were...... done both in the absence and the presence of immune serum. Neither fresh PBMC nor PBMC activated by SPag or PPD for 7 days prior to assay were cytotoxic, indicating that cytotoxic T cells, natural killer (NK) cells, and K cells did not possess cytotoxic activity directed against parasitized...

  12. Urtica dioica Induces Cytotoxicity in Human Prostate Carcinoma ...

    African Journals Online (AJOL)

    Purpose: To evaluate the cytotoxic mechanisms of an extract from the leaves of the Urtica dioica (UD) plant in LNCaP prostate cancer cells. Methods: LNCaP cells were exposed to the UD extract for 24hrs and cell viability assessed using the MTT assay. Reactive oxygen species generation was assessed using the NBT ...

  13. Klebsiella pneumoniae triggers a cytotoxic effect on airway epithelial cells

    Directory of Open Access Journals (Sweden)

    Llobet-Brossa Enrique

    2009-08-01

    Full Text Available Abstract Background Klebsiella pneumoniae is a capsulated Gram negative bacterial pathogen and a frequent cause of nosocomial infections. Despite its clinical relevance, little is known about the features of the interaction between K. pneumoniae and lung epithelial cells on a cellular level, neither about the role of capsule polysaccharide, one of its best characterised virulence factors, in this interaction. Results The interaction between Klebsiella pneumoniae and cultured airway epithelial cells was analysed. K. pneumoniae infection triggered cytotoxicity, evident by cell rounding and detachment from the substrate. This effect required the presence of live bacteria and of capsule polysaccharide, since it was observed with isolates expressing different amounts of capsule and/or different serotypes but not with non-capsulated bacteria. Cytotoxicity was analysed by lactate dehydrogenase and formazan measurements, ethidium bromide uptake and analysis of DNA integrity, obtaining consistent and complementary results. Moreover, cytotoxicity of non-capsulated strains was restored by addition of purified capsule during infection. While a non-capsulated strain was avirulent in a mouse infection model, capsulated K. pneumoniae isolates displayed different degrees of virulence. Conclusion Our observations allocate a novel role to K. pneumoniae capsule in promotion of cytotoxicity. Although this effect is likely to be associated with virulence, strains expressing different capsule levels were not equally virulent. This fact suggests the existence of other bacterial requirements for virulence, together with capsule polysaccharide.

  14. Cytotoxicity assessment of adipose-derived mesenchymal stem cells on synthesized biodegradable Mg-Zn-Ca alloys

    Energy Technology Data Exchange (ETDEWEB)

    Fazel Anvari-Yazdi, Abbas [Department of Biomedical Engineering, Materials and Biomaterials Research Center (MBMRC), Tehran, IR (Iran, Islamic Republic of); Tahermanesh, Kobra, E-mail: tahermanesh.k@iums.ac.ir [Endometriosis and Gynecologic Disorders Research Center, Department of Ob. & Gyn., Rasoul-e Akram Hospital, Iran University of Medical Sciences (IUMS), Tehran, IR (Iran, Islamic Republic of); Hadavi, Seyed Mohammad Mehdi [Materials and Energy Research Center (MERC), Karaj, IR (Iran, Islamic Republic of); Talaei-Khozani, Tahereh [Tissue Engineering Lab, Anatomy Department, School of Medicine, Shiraz University of Medical Sciences (SUMS), Shiraz, IR (Iran, Islamic Republic of); Razmkhah, Mahboobeh [Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences (SUMS), Shiraz, IR (Iran, Islamic Republic of); Abed, Seyedeh Mehr [School of Medicine, Yasuj University of Medical Sciences (YUMS), Yasuj, IR (Iran, Islamic Republic of); Mohtasebi, Maryam Sadat [Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences (SUMS), Shiraz, IR (Iran, Islamic Republic of)

    2016-12-01

    Magnesium (Mg)-based alloys have been extensively considered as biodegradable implant materials for orthopedic surgery. Mg and its alloys are metallic biomaterials that can degrade in the body and promote new bone formation. In this study, the corrosion behavior and cytotoxicity of Mg-Zn-Ca alloys are evaluated with adipose-derived mesenchymal stem cells (ASCs). Mg-2Zn and Mg-2Zn-xCa (x = 1, 2 and 3 wt.%) alloys were designated. Mg alloys were analyzed with scanning electron microscopy and potentiodynamic polarization. To understand the in-vitro biocompatibility and cytotoxicity of Mg-2Zn and Mg-2Zn-xCa alloys, ASCs were cultured for 24 and 72 h in contact with 10%, 50% and 100% extraction of all alloys prepared in DMEM. Cell cytotoxicity and viability of ASCs were examined by MTT assay. Alloying elements including Zn and Ca improved the corrosion resistance of alloys were compared with pure Mg. The cytotoxicity results showed that all alloys had no significant adverse effects on cell viability in 24 h. After 72 h, cell viability and proliferation increased in the cells exposed to pure Mg and Mg-2Zn-1Ca extracts. The release of Mg, Zn and Ca ions in culture media had no toxic impacts on ASCs viability and proliferation. Mg-2Zn-1Ca alloy can be suggested as a good candidate to be used in biomedical applications. - Highlights: • Short and long term corrosion behavior of Mg-Zn-Ca alloys studied • Viability and toxicity of Adipose-derived Stem cells studied with Mg-Zn-Ca alloys • Understanding the morphology of cultured adipose stem cells on Mg alloys • Stem cells on Mg-Zn-Ca alloys could proliferate and expand.

  15. Cytotoxicity assessment of adipose-derived mesenchymal stem cells on synthesized biodegradable Mg-Zn-Ca alloys

    International Nuclear Information System (INIS)

    Fazel Anvari-Yazdi, Abbas; Tahermanesh, Kobra; Hadavi, Seyed Mohammad Mehdi; Talaei-Khozani, Tahereh; Razmkhah, Mahboobeh; Abed, Seyedeh Mehr; Mohtasebi, Maryam Sadat

    2016-01-01

    Magnesium (Mg)-based alloys have been extensively considered as biodegradable implant materials for orthopedic surgery. Mg and its alloys are metallic biomaterials that can degrade in the body and promote new bone formation. In this study, the corrosion behavior and cytotoxicity of Mg-Zn-Ca alloys are evaluated with adipose-derived mesenchymal stem cells (ASCs). Mg-2Zn and Mg-2Zn-xCa (x = 1, 2 and 3 wt.%) alloys were designated. Mg alloys were analyzed with scanning electron microscopy and potentiodynamic polarization. To understand the in-vitro biocompatibility and cytotoxicity of Mg-2Zn and Mg-2Zn-xCa alloys, ASCs were cultured for 24 and 72 h in contact with 10%, 50% and 100% extraction of all alloys prepared in DMEM. Cell cytotoxicity and viability of ASCs were examined by MTT assay. Alloying elements including Zn and Ca improved the corrosion resistance of alloys were compared with pure Mg. The cytotoxicity results showed that all alloys had no significant adverse effects on cell viability in 24 h. After 72 h, cell viability and proliferation increased in the cells exposed to pure Mg and Mg-2Zn-1Ca extracts. The release of Mg, Zn and Ca ions in culture media had no toxic impacts on ASCs viability and proliferation. Mg-2Zn-1Ca alloy can be suggested as a good candidate to be used in biomedical applications. - Highlights: • Short and long term corrosion behavior of Mg-Zn-Ca alloys studied • Viability and toxicity of Adipose-derived Stem cells studied with Mg-Zn-Ca alloys • Understanding the morphology of cultured adipose stem cells on Mg alloys • Stem cells on Mg-Zn-Ca alloys could proliferate and expand

  16. A cytotoxic study of eugenol and its ortho dimer (bis-eugenol)

    Energy Technology Data Exchange (ETDEWEB)

    Kashiwagi, Yasushi [Meikai Univ., Sakado, Saitama (Japan). School of Dentistry

    2000-07-01

    Eugenol is widely used not only as a dental material such as pulp capping material, provisional cement, root canal sealer, and impression paste, but also as a perfume ingredients. Eugenol has antioxidant, bactericidal, and sedative activities, inhibits and non-enzymatic peroxidation. It was previously reported that eugenol exhibited the cytotoxic activity toward pulp cells and gingial fibroblasts and also that the cytotoxic activity was predominantly performed by radicals derived from the oxidation of eugenol. This study was based on the hypothesis that the toxicity of eugenol may be greately reduced if the radicalization of eugenol was diminished by the dimerization of eugenol. Thus, bis-eugenol, the dimer of eugenol, was synthesized to characterize the effect of this eugenol-related compound. The cytotoxic activity of bis-eugenol against human gingival fibroblasts (HGF cell) or human submandibular gland cancer cells (HSG cell) was studied in the presence or absence of light irradiation (visible or ultraviolet light), and compared with that of eugenol. The cytotoxic activity of eugenol was significantly greater than that of bis-eugenol. The cytotoxic activity of irradiated eugenol, but not that of irradiated bis-eugenol, was significantly higher than that of the non-irradiated counterpart. Bis-eugenol at a relatively low concentration declined the phototoxic activity of irradiation on living cells. Also, the generation of reactive oxygen in HSG cells in the ab-sence or the presence of irradiated bis-eugenol or eugenol was evaluated by an ACAS laser cytometry, and the results indicated that eugenol, but not bis-eugenol, generated reactive oxygen in the cells. The DPPH-radical scavenging activity of bis-eugenol was larger than that of eugenol. Furthermore, eugenol had a positive apoptosis-inducing effect on HSG cells. The structure-activity relationships of eugenol-related compounds showed that the nature of the substituent at the ortho or para-position of eugenol

  17. A cytotoxic study of eugenol and its ortho dimer (bis-eugenol)

    International Nuclear Information System (INIS)

    Kashiwagi, Yasushi

    2000-01-01

    Eugenol is widely used not only as a dental material such as pulp capping material, provisional cement, root canal sealer, and impression paste, but also as a perfume ingredients. Eugenol has antioxidant, bactericidal, and sedative activities, inhibits and non-enzymatic peroxidation. It was previously reported that eugenol exhibited the cytotoxic activity toward pulp cells and gingial fibroblasts and also that the cytotoxic activity was predominantly performed by radicals derived from the oxidation of eugenol. This study was based on the hypothesis that the toxicity of eugenol may be greately reduced if the radicalization of eugenol was diminished by the dimerization of eugenol. Thus, bis-eugenol, the dimer of eugenol, was synthesized to characterize the effect of this eugenol-related compound. The cytotoxic activity of bis-eugenol against human gingival fibroblasts (HGF cell) or human submandibular gland cancer cells (HSG cell) was studied in the presence or absence of light irradiation (visible or ultraviolet light), and compared with that of eugenol. The cytotoxic activity of eugenol was significantly greater than that of bis-eugenol. The cytotoxic activity of irradiated eugenol, but not that of irradiated bis-eugenol, was significantly higher than that of the non-irradiated counterpart. Bis-eugenol at a relatively low concentration declined the phototoxic activity of irradiation on living cells. Also, the generation of reactive oxygen in HSG cells in the ab-sence or the presence of irradiated bis-eugenol or eugenol was evaluated by an ACAS laser cytometry, and the results indicated that eugenol, but not bis-eugenol, generated reactive oxygen in the cells. The DPPH-radical scavenging activity of bis-eugenol was larger than that of eugenol. Furthermore, eugenol had a positive apoptosis-inducing effect on HSG cells. The structure-activity relationships of eugenol-related compounds showed that the nature of the substituent at the ortho or para-position of eugenol

  18. Reducing the cytotoxicity of inhalable engineered nanoparticles via in situ passivation with biocompatible materials

    International Nuclear Information System (INIS)

    Byeon, Jeong Hoon; Park, Jae Hong; Peters, Thomas M.; Roberts, Jeffrey T.

    2015-01-01

    Highlights: • The cytotoxicity of model welding particles was modulated through in situ passivation. • Model welding particles were incorporated with chitosan nanoparticles for passivation. • In vitro assay revealed that the passivated particles had a lower cytotoxicity. • Passivation with chitosan adhesive or graphite paste could also reduce cytotoxicity. • This method would be suitable for efficient reduction of inhalable toxic components. - Abstract: The cytotoxicity of model welding nanoparticles was modulated through in situ passivation with soluble biocompatible materials. A passivation process consisting of a spark discharge particle generator coupled to a collison atomizer as a co-flow or counter-flow configuration was used to incorporate the model nanoparticles with chitosan. The tested model welding nanoparticles are inhaled and that A549 cells are a human lung epithelial cell line. Measurements of in vitro cytotoxicity in A549 cells revealed that the passivated nanoparticles had a lower cytotoxicity (>65% in average cell viability, counter-flow) than the untreated model nanoparticles. Moreover, the co-flow incorporation between the nanoparticles and chitosan induced passivation of the nanoparticles, and the average cell viability increased by >80% compared to the model welding nanoparticles. As a more convenient way (additional chitosan generation and incorporation devices may not be required), other passivation strategies through a modification of the welding rod with chitosan adhesive and graphite paste did also enhance average cell viability (>58%). The approach outlined in this work is potentially generalizable as a new platform, using only biocompatible materials in situ, to treat nanoparticles before they are inhaled

  19. Reducing the cytotoxicity of inhalable engineered nanoparticles via in situ passivation with biocompatible materials

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Jeong Hoon, E-mail: postjb@yu.ac.kr [School of Mechanical Engineering, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Park, Jae Hong; Peters, Thomas M. [Department of Occupational and Environmental Health, University of Iowa, IA 52242 (United States); Roberts, Jeffrey T., E-mail: jtrob@purdue.edu [Department of Chemistry, Purdue University, IN 47907 (United States)

    2015-07-15

    Highlights: • The cytotoxicity of model welding particles was modulated through in situ passivation. • Model welding particles were incorporated with chitosan nanoparticles for passivation. • In vitro assay revealed that the passivated particles had a lower cytotoxicity. • Passivation with chitosan adhesive or graphite paste could also reduce cytotoxicity. • This method would be suitable for efficient reduction of inhalable toxic components. - Abstract: The cytotoxicity of model welding nanoparticles was modulated through in situ passivation with soluble biocompatible materials. A passivation process consisting of a spark discharge particle generator coupled to a collison atomizer as a co-flow or counter-flow configuration was used to incorporate the model nanoparticles with chitosan. The tested model welding nanoparticles are inhaled and that A549 cells are a human lung epithelial cell line. Measurements of in vitro cytotoxicity in A549 cells revealed that the passivated nanoparticles had a lower cytotoxicity (>65% in average cell viability, counter-flow) than the untreated model nanoparticles. Moreover, the co-flow incorporation between the nanoparticles and chitosan induced passivation of the nanoparticles, and the average cell viability increased by >80% compared to the model welding nanoparticles. As a more convenient way (additional chitosan generation and incorporation devices may not be required), other passivation strategies through a modification of the welding rod with chitosan adhesive and graphite paste did also enhance average cell viability (>58%). The approach outlined in this work is potentially generalizable as a new platform, using only biocompatible materials in situ, to treat nanoparticles before they are inhaled.

  20. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. A role of ZnO nanoparticle electrostatic properties in cancer cell cytotoxicity

    Directory of Open Access Journals (Sweden)

    Wingett D

    2016-07-01

    Full Text Available Denise Wingett,1–3 Panagiota Louka,1 Catherine B Anders,2 Jianhui Zhang,4 Alex Punnoose2,41Department of Biological Sciences, 2Biomolecular Sciences PhD Program, Boise State University, Boise, ID, 3Department of Medicine, Division of Gerontology and Geriatric Medicine, University of Washington, Seattle, WA, 4Department of Physics, Boise State University, Boise, ID, USA Abstract: ZnO nanoparticles (NPs have previously been shown to exhibit selective cytotoxicity against certain types of cancerous cells suggesting their potential use in biomedical applications. In this study, we investigate the effect of surface modification of ZnO NPs on their cytotoxicity to both cancerous and primary T cells. Our results show that polyacrylic acid capping produces negatively charged ZnO NPs that are significantly more toxic compared to uncapped positively charged NPs of identical size and composition. In contrast, the greatest selectivity against cancerous cells relative to normal cells is observed with cationic NPs. In addition, differences in NP cytotoxicity inversely correlate with NP hydrodynamic size, propensity for aggregation, and dissolution profiles. The generation of reactive oxygen species (ROS was also observed in the toxicity mechanism with anionic NPs generating higher levels of mitochondrial superoxide without appreciably affecting glutathione levels. Additional experiments evaluated the combined effects of charged ZnO NPs and nontoxic cationic or anionic CeO2 NPs. Results show that the CeO2 NPs offer protective effects against cytotoxicity from anionic ZnO NPs via antioxidant properties. Altogether, study data indicate that surface modification of NPs and resulting changes in their surface charge affect the level of intracellular ROS production, which can be ameliorated by the CeO2 ROS scavenger, suggesting that ROS generation is a dominant mechanism of ZnO NP cytotoxicity. These findings demonstrate the importance of surface electrostatic

  2. Suppression of autophagy enhances the cytotoxicity of the DNA-damaging aromatic amine p-anilinoaniline

    International Nuclear Information System (INIS)

    Elliott, Althea; Reiners, John J.

    2008-01-01

    p-Anilinoaniline (pAA) is an aromatic amine that is widely used in hair dying applications. It is also a metabolite of metanil yellow, an azo dye that is commonly used as a food coloring agent. Concentrations of pAA between 10 and 25 μM were cytostatic to cultures of the normal human mammary epithelia cell line MCF10A. Concentrations ≥ 50 μM were cytotoxic. Cytostatic concentrations induced transient G 1 and S cell cycle phase arrests; whereas cytotoxic concentrations induced protracted arrests. Cytotoxic concentrations of pAA caused DNA damage, as monitored by the alkaline single-cell gel electrophoresis (Comet) assay, and morphological changes consistent with cells undergoing apoptosis and/or autophagy. Enzymatic and western blot analyses, and binding analyses of fluorescent labeled VAD-FMK, suggested that caspase family members were activated by pAA. Western blot analyses documented the conversion of LC3-I to LC3-II, a post-translational modification involved in the development of the autophagosome. Suppression of autophagosome formation, via knockdown of ATG7 with shRNA, prevented pAA-induced vacuolization, enhanced the activation of pro-caspase-3, and increased susceptibility of ATG7-deficient cells to the cytostatic and cytotoxic activities of markedly lower concentrations of pAA. Cells stably transfected with a nonsense shRNA behaved like parental MCF10A cells. Collectively, these data suggest that MCF10A cultures undergo autophagy as a pro-survival response to concentrations of pAA sufficient to induce DNA damage

  3. A cytotoxicity study of silicon oxycarbide nanowires as cell scaffold for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Lagonegro, P.; Rossi, F. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Galli, C., E-mail: carlo.galli@unipr.it [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Smerieri, A. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Alinovi, R.; Pinelli, S. [Department of Clinical and Experimental Medicine, Parma University, via Gramsci 14, 43126 Parma (Italy); Rimoldi, T. [Physics and Earth Science Department, Parma University, Parco Area delle Scienze 7/A, 43124 Parma (Italy); Attolini, G. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Macaluso, G.; Macaluso, C. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy); Department of Biomedical, Biotechnological, and Translational Sciences, Parma University, via Gramsci 14, 43126 Parma (Italy); Saddow, S.E. [Electrical Engineering Department, University of South Florida, 4202 East Fowler Avenue, ENB118 Tampa, Florida (United States); Salviati, G. [IMEM-CNR Institute, Parco Area delle Scienze 37/A, 43124 Parma (Italy)

    2017-04-01

    Goal: Nanowires are promising biomaterials in multiple clinical applications. The goal of this study was to investigate the cytotoxicity of carbon-doped silica nanowires (SiO{sub x}C{sub y} NWs) on a fibroblastic cell line in vitro. Materials and methods: SiO{sub x}C{sub y} NWs were grown on Si substrates by CVD process. Murine L929 fibroblasts were cultured in complete DMEM and indirect and direct cytotoxicity tests were performed in agreement with ISO 19003-5, by quantitating cell viability at MTT and chemiluminescent assay. Cell cultures were investigated at Scanning Electron Microscope (SEM) and immunocytochemistry to observe their morphology and investigate cell-NWs interactions. Furthermore, hemocompatibility with Platelet-rich Plasma was assayed at SEM and by ELISA assay. Results: SiOxCy NWs proved biocompatible and did not impair cell proliferation at contact assays. L929 were able to attach on NWs and proliferate. Most interestingly, L929 reorganised the NW scaffold by displacing the nanostructure and creating tunnels within the NW network. NWs moreover did not impair platelet activation and behaved similarly to flat SiO{sub 2}. Conclusions: Our data show that SiOxCy NWs did not release cytotoxic species and acted as a viable and adaptable scaffold for fibroblastic cells, thus representing a promising platform for implantable devices. - Highlights: • NWs did not release cytotoxic species. • Fibroblasts reorganised the NWs network, adapting it to their needs. • Blood tests with platelet-rich plasma and dynamic blood coagulation tests showed oxycarbide NWs induced platelet activation. • Carbon-doped SiO{sub x}C{sub y} NWs network are a promising biomaterial for implantable scaffolds for tissue regeneration.

  4. Cytotoxicity of Brazilian plant extracts against oral microorganisms of interest to dentistry.

    Science.gov (United States)

    de Oliveira, Jonatas Rafael; de Castro, Vinicius Carlos; das Graças Figueiredo Vilela, Polyana; Camargo, Samira Esteves Afonso; Carvalho, Cláudio Antonio Talge; Jorge, Antonio Olavo Cardoso; de Oliveira, Luciane Dias

    2013-08-15

    With the emergence of strains resistant to conventional antibiotics, it is important to carry studies using alternative methods to control these microorganisms causing important infections, such as the use of products of plant origin that has demonstrated effective antimicrobial activity besides biocompatibility. Therefore, this study aimed to evaluate the antimicrobial activity of plant extracts of Equisetum arvense L., Glycyrrhiza glabra L., Punica granatum L. and Stryphnodendron barbatimam Mart. against Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus mutans, Candida albicans, Candida tropicalis, and Candida glabrata, and to analyze the cytotoxicity of these extracts in cultured murine macrophages (RAW 264.7). Antimicrobial activity of plant extracts was evaluated by microdilution method based on Clinical and Laboratory Standards Institute (CLSI), M7-A6 and M27-A2 standards. The cytotoxicity of concentrations that eliminated the microorganisms was evaluated by MTT colorimetric method and by quantification of proinflammatory cytokines (IL-1β and TNF-α) using ELISA. In determining the minimum microbicidal concentration, E. arvense L., P. granatum L., and S. barbatimam Mart. extracts at a concentration of 50 mg/mL and G. glabra L. extract at a concentration of 100 mg/mL, were effective against all microorganisms tested. Regarding cell viability, values were 48% for E. arvense L., 76% for P. granatum L, 86% for S. barbatimam Mart. and 79% for G. glabra L. at the same concentrations. About cytokine production after stimulation with the most effective concentrations of the extracts, there was a significant increase of IL-1β in macrophage cultures treated with S. barbatimam Mart. (3.98 pg/mL) and P. granatum L. (7.72 pg/mL) compared to control (2.20 pg/mL) and a significant decrease of TNF-α was observed in cultures treated with G. glabra L. (4.92 pg/mL), S. barbatimam Mart. (0.85 pg/mL), E. arvense L. (0.83 pg/mL), and P. granatum L. (0.00 pg

  5. Cultural Transmission and Evolution of Melodic Structures in Multi-generational Signaling Games.

    Science.gov (United States)

    Lumaca, Massimo; Baggio, Giosuè

    2017-01-01

    It has been proposed that languages evolve by adapting to the perceptual and cognitive constraints of the human brain, developing, in the course of cultural transmission, structural regularities that maximize or optimize learnability and ease of processing. To what extent would perceptual and cognitive constraints similarly affect the evolution of musical systems? We conducted an experiment on the cultural evolution of artificial melodic systems, using multi-generational signaling games as a laboratory model of cultural transmission. Signaling systems, using five-tone sequences as signals, and basic and compound emotions as meanings, were transmitted from senders to receivers along diffusion chains in which the receiver in each game became the sender in the next game. During transmission, structural regularities accumulated in the signaling systems, following principles of proximity, symmetry, and good continuation. Although the compositionality of signaling systems did not increase significantly across generations, we did observe a significant increase in similarity among signals from the same set. We suggest that our experiment tapped into the cognitive and perceptual constraints operative in the cultural evolution of musical systems, which may differ from the mechanisms at play in language evolution and change.

  6. Developing a Plant Culture Medium Composed of Vinasse Originating from Haematococcus Pluvialis Culture

    International Nuclear Information System (INIS)

    Gollo, A. L.; Silva, A. L. L. D.; Lima, K. K. D. D.; Camara, M. C.; Rodrigues, C.; Vandenberghe, L. P. D. S.; Soccol, V. T.; Soccol, C. R.; Biasi, L. A.

    2016-01-01

    The mineral nutrients in vinasse provide support for algal and plant growth. Algal culture releases organic compounds into its liquid culture medium. These organic and inorganic substances can be useful for formulating a plant tissue culture medium, because tissue culture medium is composed of organic and inorganic components. Therefore, the aims of this study were to develop a plant culture medium by using the vinasse that is employed for Haematococcus pluvialis culture (algal filtrate); to investigate the possible beneficial effects of the biocompounds in the micropropagation of Nidularium procerum (Bromeliaceae), to evaluate quercetin content, total phenolics content in vinasse and to evaluate the cytotoxicity of the media by performing a bioassay with Artemia salina. The vinasse that originated from H. pluvialis culture can be used to formulate plant tissue culture at a 3% dilution, and its mineral nutrients can support In vitro plant growth, but some nutrients must be supplemented to enhance its efficiency. An efficient micropropagation protocol was developed for N. procerum. The micropropagated plants were suitable for transfer to the field (they were acclimatized). This culture medium provides a way to reuse wastewater, gives a rational alternative to vinasse disposal and adds value to what is currently considered to be an undesirable residue. Moreover, this process can reduce the production costs of clonal seedlings and/or bioactive compounds in biofactories. There was no apparent biostimulatory effect by the algal filtrate on morphogenesis; however, it did increase quercetin production. The H. pluvialis culture that was grown in the vinasse decreased the cytotoxicity and phenolic compound contents, which prevented explant tissue necrosis and represented a treatment for this residue for safer disposal in the environment. (author)

  7. Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants

    Science.gov (United States)

    Alves, Celha Borges Costa; Segurado, Márcio Nunes; Dorta, Miriam Cristina Leandro; Dias, Fátima Ribeiro; Lenza, Maurício Guilherme; Lenza, Marcos Augusto

    2016-01-01

    ABSTRACT Objective: To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Methods: Six mini-implants (Conexão(tm), Neodent(tm) and SIN(tm)) were separately immersed in artificial saliva (pH 6.76) for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM). The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Conclusion: Orthodontic mini-implants manufactured by Conexão(tm), Neodent(tm) and SIN(tm) present high corrosion resistance and are not cytotoxic. PMID:27901227

  8. Impact of bioavailability on the correlation between in vitro cytotoxic and in vivo acute fish toxic concentrations of chemicals

    International Nuclear Information System (INIS)

    Guelden, Michael; Seibert, Hasso

    2005-01-01

    The lower sensitivity of in vitro cytotoxicity assays currently restricts their use as alternative to the fish acute toxicity assays for hazard assessment of chemicals in the aquatic environment. In vitro cytotoxic potencies mostly refer to nominal concentrations. The main objective of the present study was to investigate, whether a reduced availability of chemicals in vitro can account for the lower sensitivity of in vitro toxicity test systems. For this purpose, the bioavailable free fractions of the nominal cytotoxic concentrations (EC 50 ) of chemicals determined with a cytotoxicity test system using Balb/c 3T3 cells and the corresponding free cytotoxic concentrations (ECu 50 ) were calculated. The algorithm applied is based on a previously developed simple equilibrium distribution model for chemicals in cell cultures with serum-supplemented culture media. This model considers the distribution of chemicals between water, lipids and serum albumin. The algorithm requires the relative lipid volume of the test system, the octanol-water partition coefficient (K ow ) and the in vitro albumin-bound fraction of the chemicals. The latter was determined from EC 50 -measurements in the presence of different albumin concentrations with the Balb/c 3T3 test system. Organic chemicals covering a wide range of cytotoxic potency (EC 50 : 0.16-527000 μM) and lipophilicity (log K ow : -5.0-6.96) were selected, for which fish acute toxicity data (LC 50 -values) from at least one of the three fish species, medaka, rainbow trout and fathead minnow, respectively, were available. The availability of several chemicals was shown to be extensively reduced either by partitioning into lipids or by serum albumin binding, or due to both mechanisms. Reduction of bioavailability became more important with increasing cytotoxic potency. The sensitivity of the Balb/c 3T3 cytotoxicity assay and the correspondence between in vivo and in vitro toxic potencies were increased when the free cytotoxic

  9. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  10. Digital Literacies and Generational Micro-Cultures: Email Feedback in Lebanon

    Science.gov (United States)

    De Coursey, Christina; Dandashly, Nadine

    2015-01-01

    This study reports on the introduction of email feedback, in a private university in Lebanon with marked generational differences and a traditional instructor culture focused on grammar correction. The instructor profile showed insufficient ELT training and a disjuncture between those with low and those with long service. Instructors were trained,…

  11. East Indian Families Raising ABCD Adolescents: Cultural and Generational Challenges

    Science.gov (United States)

    Poulsen, Shruti S.

    2009-01-01

    Immigration is a process fraught with both challenges and opportunities for families. In particular, East Indian families with U.S.-born adolescents experience the challenges of bridging cultures across generational divides; they are perceived by others as confused, identity less, and conflicted or as American-Born, Confused Desis (ABCDs). This…

  12. Cytotoxic and antibacterial activity of the mixture of olive oil and lime cream in vitro conditions.

    Science.gov (United States)

    Sumer, Zeynep; Yildirim, Gulay; Sumer, Haldun; Yildirim, Sahin

    2013-01-01

    The mixture of olive oil and lime cream has been traditionally used to treat external burns in the region of Hatay/Antakya and middle Anatolia. Olive oil and lime cream have been employed by many physicians to treat many ailments in the past. A limited number of studies have shown the antibacterial effect of olive oil and that it does not have any toxic effect on the skin. But we did not find any reported studies on the mixture of olive oil and lime cream. The aim of this paper is to investigate the cytotoxic and antibacterial activity of olive oil and lime cream individually or/and in combination in vitro conditions, by using disk-diffusion method and in cell culture. The main purpose in using this mixture is usually to clear burns without a trace. Agar overlay, MTT (Cytotoxicity assay) and antibacterial susceptibility tests were used to investigate the cytotoxic and antibacterial activity of olive oil and lime cream. We found that lime cream has an antibacterial activity but also cytotoxic on the fibroblasts. On the other hand olive oil has limited or no antibacterial effect and it has little or no cytotoxic on the fibroblasts. When we combined lime cream and olive oil, olive oil reduced its cytotoxic impact. These results suggest that mixture of olive oil and lime cream is not cytotoxic and has antimicrobial activity.

  13. Development of a serum-free medium for in vitro expansion of human cytotoxic T lymphocytes using a statistical design

    Directory of Open Access Journals (Sweden)

    Lee Gyun

    2010-09-01

    Full Text Available Abstract Background Serum-containing medium (SCM, which has a number of poorly defined components with varying concentrations, hampers standardization of lymphocyte cultures. In order to develop a serum-free medium (SFM for the expansion of human lymphocytes from peripheral blood mononuclear cells (PBMCs, a statistical optimization approach based on a fractional factorial method and a response surface method was adopted. A basal medium was prepared by supplementing RPMI1640 medium with insulin, albumin, ferric citrate, ethanolamine, fatty acids, glutamine, sodium pyruvate, 2-mercaptoethanol, 1-thioglycerol, nonessential amino acids, and vitamins. We identified additional positive determinants and their optimal concentrations for cell growth through a statistical analysis. Results From a statistical analysis using the fractional factorial method, cholesterol and polyamine supplement were identified as positive determinants for cell growth. Their optimal concentrations were determined by the response surface method. The maximum viable cell concentration in the developed SFM was enhanced by more than 1.5-fold when compared to that in RPMI1640 supplemented with 10% fetal bovine serum (FBS. Furthermore, a cytotoxicity assay and an enzyme-linked immunospot assay revealed that the effector function of cytotoxic T lymphocytes generated from PBMCs grown in SFM, by stimulation of peptide-presenting dendritic cells, was retained or even better than that in SCM. Conclusions The use of a developed SFM with cholesterol and polyamine supplement for human lymphocyte culture resulted in better growth without loss of cellular function when compared to SCM.

  14. Development of a serum-free medium for in vitro expansion of human cytotoxic T lymphocytes using a statistical design.

    Science.gov (United States)

    Jeon, Min Kyoung; Lim, Jong-Baeck; Lee, Gyun Min

    2010-09-21

    Serum-containing medium (SCM), which has a number of poorly defined components with varying concentrations, hampers standardization of lymphocyte cultures. In order to develop a serum-free medium (SFM) for the expansion of human lymphocytes from peripheral blood mononuclear cells (PBMCs), a statistical optimization approach based on a fractional factorial method and a response surface method was adopted. A basal medium was prepared by supplementing RPMI1640 medium with insulin, albumin, ferric citrate, ethanolamine, fatty acids, glutamine, sodium pyruvate, 2-mercaptoethanol, 1-thioglycerol, nonessential amino acids, and vitamins. We identified additional positive determinants and their optimal concentrations for cell growth through a statistical analysis. From a statistical analysis using the fractional factorial method, cholesterol and polyamine supplement were identified as positive determinants for cell growth. Their optimal concentrations were determined by the response surface method. The maximum viable cell concentration in the developed SFM was enhanced by more than 1.5-fold when compared to that in RPMI1640 supplemented with 10% fetal bovine serum (FBS). Furthermore, a cytotoxicity assay and an enzyme-linked immunospot assay revealed that the effector function of cytotoxic T lymphocytes generated from PBMCs grown in SFM, by stimulation of peptide-presenting dendritic cells, was retained or even better than that in SCM. The use of a developed SFM with cholesterol and polyamine supplement for human lymphocyte culture resulted in better growth without loss of cellular function when compared to SCM.

  15. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  16. Mechanism of Cisplatin-Induced Cytotoxicity Is Correlated to Impaired Metabolism Due to Mitochondrial ROS Generation.

    Science.gov (United States)

    Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun

    2015-01-01

    The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.

  17. Bioluminescence-based cytotoxicity assay for simultaneous evaluation of cell viability and membrane damage in human hepatoma HepG2 cells.

    Science.gov (United States)

    Uno, Katsuhiro; Murotomi, Kazutoshi; Kazuki, Yasuhiro; Oshimura, Mitsuo; Nakajima, Yoshihiro

    2018-05-01

    We have developed a bioluminescence-based non-destructive cytotoxicity assay in which cell viability and membrane damage are simultaneously evaluated using Emerald luciferase (ELuc) and endoplasmic reticulum (ER)-targeted copepod luciferase (GLuc-KDEL), respectively, by using multi-integrase mouse artificial chromosome (MI-MAC) vector. We have demonstrated that the time-dependent concentration response curves of ELuc luminescence intensity and WST-1 assay, and GLuc-KDEL luminescence intensity and lactate dehydrogenase (LDH) activity in the culture medium accompanied by cytotoxicity show good agreement in toxicant-treated ELuc- and GLuc-KDEL-expressing HepG2 stable cell lines. We have clarified that the increase of GLuc-KDEL luminescence intensity in the culture medium reflects the type of cell death, including necrosis and late apoptosis, but not early apoptosis. We have also uncovered a strong correlation between GLuc-KDEL luminescence intensity in the culture medium and the extracellular release of high mobility group box 1 (HMGB1), a representative damage-associated molecular pattern (DAMP) molecule. The bioluminescence measurement assay using ELuc and GLuc-KDEL developed in this study can simultaneously monitor cell viability and membrane damage, respectively, and the increase of GLuc-KDEL luminescence intensity in the culture medium accompanied by the increase of cytotoxicity is an index of necrosis and late apoptosis associated with the extracellular release of DAMP molecules. Copyright © 2018 John Wiley & Sons, Ltd.

  18. Atomic structures of fibrillar segments of hIAPP suggest tightly mated β-sheets are important for cytotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Krotee, Pascal [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; Molecular Biology Institute, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States; Rodriguez, Jose A. [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States; Sawaya, Michael R. [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States; Cascio, Duilio [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States; Reyes, Francis E. [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States; Shi, Dan [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States; Hattne, Johan [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States; Nannenga, Brent L. [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States; Oskarsson, Marie E. [Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden; Philipp, Stephan [Department of Molecular Biology and Biochemistry, University of California, Irvine, Irvine, United States; Griner, Sarah [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States; Jiang, Lin [Molecular Biology Institute, University of California, Los Angeles, Los Angeles, United States; Department of Neurology, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, United States; Brain Research Institute (BRI), University of California, Los Angeles, Los Angeles, United States; Glabe, Charles G. [Department of Molecular Biology and Biochemistry, University of California, Irvine, Irvine, United States; Biochemistry Department, Faculty of Science and Experimental Biochemistry Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia; Westermark, Gunilla T. [Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden; Gonen, Tamir [Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States; Eisenberg, David S. [Department of Biological Chemistry, Howard Hughes Medical Institute, University of California, Los Angeles, Los Angeles, United States; Department of Chemistry and Biochemistry, University of California, Los Angeles, Los Angeles, United States; Molecular Biology Institute, University of California, Los Angeles, Los Angeles, United States; UCLA-DOE Institute, University of California, Los Angeles, Los Angeles, United States

    2017-01-03

    hIAPP fibrils are associated with Type-II Diabetes, but the link of hIAPP structure to islet cell death remains elusive. Here we observe that hIAPP fibrils are cytotoxic to cultured pancreatic β-cells, leading us to determine the structure and cytotoxicity of protein segments composing the amyloid spine of hIAPP. Using the cryoEM method MicroED, we discover that one segment, 19–29 S20G, forms pairs of β-sheets mated by a dry interface that share structural features with and are similarly cytotoxic to full-length hIAPP fibrils. In contrast, a second segment, 15–25 WT, forms non-toxic labile β-sheets. These segments possess different structures and cytotoxic effects, however, both can seed full-length hIAPP, and cause hIAPP to take on the cytotoxic and structural features of that segment. These results suggest that protein segment structures represent polymorphs of their parent protein and that segment 19–29 S20G may serve as a model for the toxic spine of hIAPP.

  19. In vitro evaluation of antiproliferative and cytotoxic properties of pterostilbene against human colon cancer cells.

    Science.gov (United States)

    Wawszczyk, Joanna; Kapral, Małgorzata; Hollek, Andrzej; Węglarz, Ludmiła

    2014-01-01

    Colon cancer has been remaining the second leading cause of cancer mortality in Poland in the last years. Epidemiological, preclinical and clinical studies reveal that dietary phytochemicals may exert chemopreventive and therapeutic effect against colorectal cancer. There is a growing interest in identifying new biologically active agents from dietary sources in this respect. Pterostilbene (trans-3,5-dimethoxy-4-hydroxystilbene) is a naturally occurring stilbene, that has been found to have antioxidative, anti-inflammatory and antipro- liferative properties. Compared to other stilbenes, pterostilbene has greater bioavailability, and so, a greater potential for clinical applications. Recent studies showed that pterostilbene exhibits the hallmark characteristics of an anticancer agent. The aim of this study was to analyze antiproliferative and cytotoxic effects of pterostilbene on human colon cancer Caco-2 cells. They were cultured using standard techniques and exposed to increasing doses of pterostilbene (5-100 μM) for 48 and 72 h. Cell proliferation was determined by sulforhodamine B assay. The growth of treated cells was expressed as a percentage of that of untreated control cells. Pterostilbene decreased proliferation rate of Caco-2 cells in a dose- and time-dependent manner. Its concentrations = 25 μM did not affect cell growth after 48 h treatment period. Significant growth inhibition was observed in cultures incubated with higher concentrations of pterostilbene (40-100 μM). Pterostilbene at all concentrations used (5-100 μM) caused significant inhibition of cell proliferation when the experimental time period was elongated to 72 h. The maximum growth reduction was observed at 100 mM pterostilbene. The cytotoxicity of pterostilbene was evaluated in 48 h cultures based on lactate dehydrogenase (LDH) leakage into the culture medium and showed dose-related pattern. The findings of this study showed significant dose-dependent antiproliferative and cytotoxic

  20. Structure-cytotoxicity relationships for dietary flavonoids

    DEFF Research Database (Denmark)

    Breinholt, V.; Dragsted, L.O.

    1998-01-01

    The cytotoxicity of a large series of dietary flavonoids was tested in a non-tumorigenic mouse and two human cancer cell lines, using the neutral red dye exclusion assay. All compounds tested exhibited a concentration-dependent cytotoxic action in the employed cell lines. The relative cytotoxicity...... of the flavonoids, however, Tvas found to vary greatly among the different cell Lines. With a few exceptions, the investigated flavonoids were more cytotoxic to the human cancer cell lines, than the mouse cell line. The differences in cytotoxicity were accounted for in part by differences in cellular uptake...... and metabolic capacity among the different cell types. In 3T3 cells fairly consistent structure-cytotoxicity relationships were found. The most cytotoxic structures tested in 3T3 cells were flavonoids with adjacent 3',4' hydroxy groups on the B-ring, such as luteolin, quercetin, myricetin, fisetin, eriodictyol...

  1. Cytotoxicity Comparison of Harvard Zinc Phosphate Cement Versus Panavia F2 and Rely X Plus Resin Cements on Rat L929-fibroblasts.

    Science.gov (United States)

    Mahasti, Sahabi; Sattari, Mandana; Romoozi, Elham; Akbar-Zadeh Baghban, Alireza

    2011-01-01

    Resin cements, regardless of their biocompatibility, have been widely used in restorative dentistry during the recent years. These cements contain hydroxy ethyl methacrylate (HEMA) molecules which are claimed to penetrate into dentinal tubules and may affect dental pulp. Since tooth preparation for metal ceramic restorations involves a large surface of the tooth, cytotoxicity of these cements would be more important in fixed prosthodontic treatments. The purpose of this study was to compare the cytotoxicity of two resin cements (Panavia F2 and Rely X Plus) versus zinc phosphate cement (Harvard) using rat L929-fibroblasts in vitro. In this experimental study, ninety hollow glass cylinders (internal diameter 5-mm, height 2-mm) were made and divided into three groups. Each group was filled with one of three experimental cements; Harvard Zinc Phosphate cement, Panavia F2 resin cement and Rely X Plus resin cement. L929- Fibroblast were passaged and subsequently cultured in 6-well plates of 5×10(5) cells each. The culture medium was RPMI_ 1640. All samples were incubated in CO2. Using enzyme-linked immune-sorbent assay (ELISA) and (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) (MTT) assay, the cytotoxicity of the cements was investigated at 1 hour, 24 hours and one week post exposure. Statistical analyses were performed via two-way ANOVA and honestly significant difference (HSD) Tukey tests. This study revealed significant differences between the three cements at the different time intervals. Harvard cement displayed the greatest cytotoxicity at all three intervals. After 1 hour Panavia F2 showed the next greatest cytotoxicity, but after 24-hours and oneweek intervals Rely X Plus showed the next greatest cytotoxicity. The results further showed that cytotoxicity decreased significantly in the Panavia F2 group with time (pHarvard cement group failed to showed no noticeable change in cytotoxicity with time. Although this study has limitations, it provides

  2. The potential of mycelium and culture broth of Lignosus rhinocerotis as substitutes for the naturally occurring sclerotium with regard to antioxidant capacity, cytotoxic effect, and low-molecular-weight chemical constituents.

    Directory of Open Access Journals (Sweden)

    Beng Fye Lau

    Full Text Available Previous studies on the nutritional and nutraceutical properties of Lignosus rhinocerotis focused mainly on the sclerotium; however, the supply of wild sclerotium is limited. In this investigation, the antioxidant capacity and cytotoxic effect of L. rhinocerotis cultured under different conditions of liquid fermentation (shaken and static were compared to the sclerotium produced by solid-substrate fermentation. Aqueous methanol extracts of the mycelium (LR-MH, LR-MT and culture broth (LR-BH, LR-BT demonstrated either higher or comparable antioxidant capacities to the sclerotium extract (LR-SC based on their radical scavenging abilities, reducing properties, metal chelating activities, and inhibitory effects on lipid peroxidation. All extracts exerted low cytotoxicity (IC50>200 µg/ml, 72 h against selected mammalian cell lines. Several low-molecular-weight compounds, including sugars, fatty acids, methyl esters, sterols, amides, amino acids, phenolics, and triterpenoids, were identified using GC-MS and UHPLC-ESI-MS/MS. The presence of proteins (<40 kDa in the extracts was confirmed by SDS-PAGE and SELDI-TOF-MS. Principal component analysis revealed that the chemical profiles of the mycelial extracts under shaken and static conditions were distinct from those of the sclerotium. Results from bioactivity evaluation and chemical profiling showed that L. rhinocerotis from liquid fermentation merits consideration as an alternative source of functional ingredients and potential substitute for the sclerotium.

  3. Reaction between nitracrine and glutathione: implications for hypoxic cell radiosensitization and cytotoxicity

    International Nuclear Information System (INIS)

    Wilson, W.R.; Anderson, R.F.

    1989-01-01

    Nitracrine (NC) is an electron affinic DNA intercalating agent and a potent hypoxia-selective cytotoxin and radiosensitizer in cell culture. Although NC is too cytotoxic and too rapidly metabolized to provide hypoxic cell radiosensitization in tumors, it is of mechanistic interest as an example of a DNA affinic radiosensitizer. We have observed a rapid chemical reaction between NC and reduced glutathione (GSH), which suggests that the observed potent in vitro cytotoxicity and radiosensitization might be dependent on thiol depletion by the large extracellular reservoir of drug. However, no GSH depletion was observed under conditions providing radiosensitization or rapid cell killing, and prior depletion of GSH by buthionine sulphoximine had no effect on cytotoxicity or formation of macromolecular adducts. Further, the intracellular reaction of NC with GSH is slower than predicted on the basis of the measured second order rate constant and the total intracellular concentrations of both species. The results are consistent with a role for DNA binding in protecting NC from reaction with GSH, and in improving the efficiency with which reduced electrophilic metabolites react with DNA in preference to GSH

  4. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  5. Cytotoxicity of lambda-cyhalothrin on the macrophage cell line RAW 264.7.

    Science.gov (United States)

    Zhang, Quan; Wang, Cui; Sun, Liwei; Li, Ling; Zhao, Meirong

    2010-01-01

    The wide use and wide-spectrum toxicity of synthetic pyrethroids (SPs) insecticides make them an emerging ecotoxicological concern. Some previous studies showed that SPs possessed cytotoxicity in some immune cells such as human lymphocytes and rat bone marrow. However, the cytotoxicity of SPs to macrophages, which are crucial to innate immunity, has not been explored. In the present report, we investigated a new pyrethroid insecticide, lambda-cyhalothrin (LCT), which may increase the generation of reactive oxygen species (ROS) and DNA damage levels and cause cytotoxicity in RAW 264.7 cells in dose- and time-dependent manners. The results for the first time implicated increased endogenous ROS and DNA damage as co-mediators of LCT-induced cytotoxicity in macrophages. Our results also suggested that macrophages were involved in synthetic pyrethroid-induced adverse immune effects. Considering the ubiquitous environmental presence of SPs, this study provided new information relative to the potential long-term physiological and immunological effects associated with chronic exposure to SPs. Hence, the potential immunotoxicity of SPs should be considered in assessing the safety of these compounds in sensitive environmental compartments.

  6. Rhodium metalloinsertor binding generates a lesion with selective cytotoxicity for mismatch repair-deficient cells.

    Science.gov (United States)

    Bailis, Julie M; Weidmann, Alyson G; Mariano, Natalie F; Barton, Jacqueline K

    2017-07-03

    The DNA mismatch repair (MMR) pathway recognizes and repairs errors in base pairing and acts to maintain genome stability. Cancers that have lost MMR function are common and comprise an important clinical subtype that is resistant to many standard of care chemotherapeutics such as cisplatin. We have identified a family of rhodium metalloinsertors that bind DNA mismatches with high specificity and are preferentially cytotoxic to MMR-deficient cells. Here, we characterize the cellular mechanism of action of the most potent and selective complex in this family, [Rh(chrysi)(phen)(PPO)] 2+ (Rh-PPO). We find that Rh-PPO binding induces a lesion that triggers the DNA damage response (DDR). DDR activation results in cell-cycle blockade and inhibition of DNA replication and transcription. Significantly, the lesion induced by Rh-PPO is not repaired in MMR-deficient cells, resulting in selective cytotoxicity. The Rh-PPO mechanism is reminiscent of DNA repair enzymes that displace mismatched bases, and is differentiated from other DNA-targeted chemotherapeutics such as cisplatin by its potency, cellular mechanism, and selectivity for MMR-deficient cells.

  7. Impact of commercial cigarette smoke condensate on brain tissue co-cultured with astrocytes and blood-brain barrier endothelial cells.

    Science.gov (United States)

    Lee, Seon-Bong; Kim, Ju-Hyeong; Cho, Myung-Haing; Choe, Eun-Sang; Kim, Kwang-Sik; Shim, Soon-Mi

    2017-01-01

    The purpose of the current study was to investigate the effect of two commercial cigarette smoke condensates (CCSC) on oxidative stress and cell cytotoxicity in human brain (T98G) or astrocytes (U-373 MG) in the presence of human brain microvascular endothelial cells (HBMEC). Cell viability of mono-culture of T98G or U-373 MG was markedly decreased in a concentration-dependent manner, and T98G was more susceptible than U-373 MG to CCSC exposure. Cytotoxicity was less prominent when T98G was co-cultured with HBMEC than when T98G was co-cultured with U-373 MG. Significant reduction in trans-epithelial electric resistance (TEER), a biomarker of cellular integrity was noted in HBMEC co-cultured with T98G (HBMEC-T98G co-culture) and U-373 MG co-cultured with T98G (U-373 MG-T98G co-culture) after 24 or 48 hr CCSC exposure, respectively. TEER value of U-373 MG co-cultured with T98G (79-84%) was higher than HBMEC co-cultured with T98G (62-63%) within 120-hr incubation with CCSC. Reactive oxygen species (ROS) generated by CCSC in mono-culture of T98G and U-373 MG reached highest levels at 4 and 16 mg/ml, respectively. ROS production by T98G fell when co-cultured with HBMEC or U-373MG. These findings suggest that adverse consequences of CCSC treatment on brain cells may be protected by blood-brain barrier or astrocytes, but with chronic exposure toxicity may be worsened due to destruction of cellular integrity.

  8. Cultural Behavior Generation

    National Research Council Canada - National Science Library

    Reece, Douglas A; Taylor, Glenn

    2008-01-01

    .... We considered different training applications and identified a "knock-and-talk" house visitation scenario as representative of scenarios that require cultural awareness on the part of a trainee, yet...

  9. Evaluation of the cytotoxic effects of ophthalmic solutions containing benzalkonium chloride on corneal epithelium using an organotypic 3-D model.

    Science.gov (United States)

    Khoh-Reiter, Su; Jessen, Bart A

    2009-07-28

    Benzalkonium chloride (BAC) is a common preservative used in ophthalmic solutions. The aim of this study was to compare the cytotoxic effects of BAC-containing ophthalmic solutions with a BAC-free ophthalmic solution using an organotypic 3-dimensional (3-D) corneal epithelial model and to determine the effects of latanoprost ophthalmic solution and its BAC-containing vehicle on corneal thickness in a monkey model. The cytotoxicity of commercially available BAC-containing ophthalmic formulations of latanoprost (0.02% BAC) and olopatadine (0.01% BAC) was compared to that of BAC-free travoprost and saline in a corneal organotypic 3-D model using incubation times of 10 and 25 minutes. To compare the extent of differentiation of 3-D corneal cultures to monolayer transformed human corneal epithelial (HCE-T) cell cultures, expression levels (mRNA and protein) of the corneal markers epidermal growth factor receptor, transglutaminase 1 and involucrin were quantified. Finally, latanoprost ophthalmic solution or its vehicle was administered at suprapharmacologic doses (two 30 microL drops twice daily in 1 eye for 1 year) in monkey eyes, and corneal pachymetry was performed at baseline and at weeks 4, 13, 26 and 52. In the 3-D corneal epithelial culture assays, there were no significant differences in cytotoxicity between the BAC-containing latanoprost and olopatadine ophthalmic solutions and BAC-free travoprost ophthalmic solution at either the 10- or 25-minute time points. The 3-D cultures expressed higher levels of corneal epithelial markers than the HCE-T monolayers, indicating a greater degree of differentiation. There were no significant differences between the corneal thickness of monkey eyes treated with latanoprost ophthalmic solution or its vehicle (both containing 0.02% BAC) and untreated eyes. The lack of cytotoxicity demonstrated in 3-D corneal cultures and in monkey studies suggests that the levels of BAC contained in ophthalmic solutions are not likely to cause

  10. Evaluation of the cytotoxic effects of ophthalmic solutions containing benzalkonium chloride on corneal epithelium using an organotypic 3-D model

    Directory of Open Access Journals (Sweden)

    Jessen Bart A

    2009-07-01

    Full Text Available Abstract Background Benzalkonium chloride (BAC is a common preservative used in ophthalmic solutions. The aim of this study was to compare the cytotoxic effects of BAC-containing ophthalmic solutions with a BAC-free ophthalmic solution using an organotypic 3-dimensional (3-D corneal epithelial model and to determine the effects of latanoprost ophthalmic solution and its BAC-containing vehicle on corneal thickness in a monkey model. Methods The cytotoxicity of commercially available BAC-containing ophthalmic formulations of latanoprost (0.02% BAC and olopatadine (0.01% BAC was compared to that of BAC-free travoprost and saline in a corneal organotypic 3-D model using incubation times of 10 and 25 minutes. To compare the extent of differentiation of 3-D corneal cultures to monolayer transformed human corneal epithelial (HCE-T cell cultures, expression levels (mRNA and protein of the corneal markers epidermal growth factor receptor, transglutaminase 1 and involucrin were quantified. Finally, latanoprost ophthalmic solution or its vehicle was administered at suprapharmacologic doses (two 30 μL drops twice daily in 1 eye for 1 year in monkey eyes, and corneal pachymetry was performed at baseline and at weeks 4, 13, 26 and 52. Results In the 3-D corneal epithelial culture assays, there were no significant differences in cytotoxicity between the BAC-containing latanoprost and olopatadine ophthalmic solutions and BAC-free travoprost ophthalmic solution at either the 10- or 25-minute time points. The 3-D cultures expressed higher levels of corneal epithelial markers than the HCE-T monolayers, indicating a greater degree of differentiation. There were no significant differences between the corneal thickness of monkey eyes treated with latanoprost ophthalmic solution or its vehicle (both containing 0.02% BAC and untreated eyes. Conclusion The lack of cytotoxicity demonstrated in 3-D corneal cultures and in monkey studies suggests that the levels of BAC

  11. Lactobacillus delbrueckii ssp. bulgaricus B-30892 can inhibit cytotoxic effects and adhesion of pathogenic Clostridium difficile to Caco-2 cells

    Directory of Open Access Journals (Sweden)

    Banerjee Pratik

    2009-04-01

    Full Text Available Abstract Background Probiotic microorganisms are receiving increasing interest for use in the prevention, treatment, or dietary management of certain diseases, including antibiotic-associated diarrhea (AAD. Clostridium difficile is the most common cause of AAD and the resulting C. difficile – mediated infection (CDI, is potentially deadly. C. difficile associated diarrhea (CDAD is manifested by severe inflammation and colitis, mostly due to the release of two exotoxins by C. difficile causing destruction of epithelial cells in the intestine. The aim of this study was to determine the effect of probiotic bacteria Lactobacillus delbrueckii ssp. bulgaricus B-30892 (LDB B-30892 on C. difficile-mediated cytotoxicity using Caco-2 cells as a model. Methods Experiments were carried out to test if the cytotoxicity induced by C. difficile-conditioned-medium on Caco-2 cells can be altered by cell-free supernatant (CFS from LDB B-30892 in different dilutions (1:2 to 1:2048. In a similar experimental setup, comparative evaluations of other probiotic strains were made by contrasting the results from these strains with the results from LDB B-30892, specifically the ability to affect C. difficile induced cytotoxicity on Caco-2 monolayers. Adhesion assays followed by quantitative analysis by Giemsa staining were conducted to test if the CFSs from LDB B-30892 and other probiotic test strains have the capability to alter the adhesion of C. difficile to the Caco-2 monolayer. Experiments were also performed to evaluate if LDB B-30892 or its released components have any bactericidal effect on C. difficile. Results and discussion Co-culturing of LDB B-30892 with C. difficile inhibited the C. difficile-mediated cytotoxicity on Caco-2 cells. When CFS from LDB B-30892-C. difficile co-culture was administered (up to a dilution of 1:16 on Caco-2 monolayer, there were no signs of cytotoxicity. When CFS from separately grown LDB B-30892 was mixed with the cell-free toxin

  12. Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer

    Directory of Open Access Journals (Sweden)

    Choi Moon-Jeong

    2011-01-01

    Full Text Available Abstract Cytotoxicity is a severe problem for cadmium sulfide nanoparticles (CSNPs in biological systems. In this study, mercaptoacetic acid-coated CSNPs, typical semiconductor Q-dots, were synthesized in aqueous medium by the arrested precipitation method. Then, amino-terminated polyethylene glycol (PEG was conjugated to the surface of CSNPs (PCSNPs in order to introduce amino groups to the surface. Finally, insulin was immobilized on the surface of PCSNPs (ICSNPs to reduce cytotoxicity as well as to enhance cell compatibility. The presence of insulin on the surface of ICSNPs was confirmed by observing infrared absorptions of amide I and II. The mean diameter of ICSNPs as determined by dynamic light scattering was about 38 nm. Human fibroblasts were cultured in the absence and presence of cadmium sulfide nanoparticles to evaluate cytotoxicity and cell compatibility. The results showed that the cytotoxicity of insulin-immobilized cadmium sulfide nanoparticles was significantly suppressed by usage of PEG as a spacer. In addition, cell proliferation was highly facilitated by the addition of ICSNPs. The ICSNPs used in this study will be potentials to be used in bio-imaging applications.

  13. Discovery of potent and selective cytotoxic activity of new quinazoline-ureas against TMZ-resistant glioblastoma multiforme (GBM).

    Science.gov (United States)

    Elkamhawy, Ahmed; Viswanath, Ambily Nath Indu; Pae, Ae Nim; Kim, Hyeon Young; Heo, Jin-Chul; Park, Woo-Kyu; Lee, Chong-Ock; Yang, Heekyoung; Kim, Kang Ho; Nam, Do-Hyun; Seol, Ho Jun; Cho, Heeyeong; Roh, Eun Joo

    2015-10-20

    Herein, we report new quinazoline-urea based compounds with potent cytotoxic activities against TMZ-resistant glioblastoma multiforme (GBM) cells. Low micromolar IC₅₀ values were exhibited over a panel of three primary GBM patient-derived cell cultures belonging to proneural (GBM-1), mesenchymal (GBM-2), and classical (GBM-3) subtypes. Eight compounds showed excellent selectivity indices for GBM cells comparing to a normal astrocyte cell line. In JC-1 assay, analogues 11, 12, 20, 22, and 24 exerted promising rates of mPTP opening induction towards proneural GBM subtype. Compounds 11, 20, and 24 bound to the translocator protein 18 kDa (TSPO) in submicromolar range using [(3)H] PK-11195 binding affinity assay. A homology model was built and docked models of 11, 12, 20, 22 and 24 were generated for describing their plausible binding modes in TSPO. In 3D clonogenic assay, compound 20 manifested potent tumoricidal effects on TMZ-resistant GBM cells even at submicromolar concentrations. In addition, CYP450 and hERG assays presented a safe toxicity profile of 20. Taken as a whole, this report presents compound 20 as a potent, selective and safe GBM cytotoxic agent which constitutes a promising direction against TMZ-resistant GBM. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Wu Xiayu; Liang Ziqing; Zou Tianning; Wang Xu

    2009-01-01

    Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicity was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.

  15. Cytotoxicity of cadmium-containing quantum dots based on a study using a microfluidic chip

    International Nuclear Information System (INIS)

    Zheng Xiannuo; Weng Lixing; Tian Jing; Wang Lianhui; Wu Lei; Jin Qinghui; Zhao Jianlong

    2012-01-01

    There is a lack of reliable nanotoxicity assays available for monitoring and quantifying multiple cellular events in cultured cells. In this study, we used a microfluidic chip to systematically investigate the cytotoxicity of three kinds of well-characterized cadmium-containing quantum dots (QDs) with the same core but different shell structures, including CdTe core QDs, CdTe/CdS core–shell QDs, and CdTe/CdS/ZnS core–shell–shell QDs, in HEK293 cells. Using the microfluidic chip combined with fluorescence microscopy, multiple QD-induced cellular events including cell morphology, viability, proliferation, and QD uptake were simultaneously analysed. The three kinds of QDs showed significantly different cytotoxicities. The CdTe QDs, which are highly toxic to HEK293 cells, resulted in remarkable cellular and nuclear morphological changes, a dose-dependent decrease in cell viability, and strong inhibition of cell proliferation; the CdTe/CdS QDs were moderately toxic but did not significantly affect the proliferation of HEK293 cells; while the CdTe/CdS/ZnS QDs had no detectable influence on cytotoxicity with respect to cell morphology, viability, and proliferation. Our data indicated that QD cytotoxicity was closely related to their surface structures and specific physicochemical properties. This study also demonstrated that the microfluidic chip could serve as a powerful tool to systematically evaluate the cytotoxicity of nanoparticles in multiple cellular events. (paper)

  16. Cytotoxicity of cadmium-containing quantum dots based on a study using a microfluidic chip

    Science.gov (United States)

    Zheng, Xiannuo; Tian, Jing; Weng, Lixing; Wu, Lei; Jin, Qinghui; Zhao, Jianlong; Wang, Lianhui

    2012-02-01

    There is a lack of reliable nanotoxicity assays available for monitoring and quantifying multiple cellular events in cultured cells. In this study, we used a microfluidic chip to systematically investigate the cytotoxicity of three kinds of well-characterized cadmium-containing quantum dots (QDs) with the same core but different shell structures, including CdTe core QDs, CdTe/CdS core-shell QDs, and CdTe/CdS/ZnS core-shell-shell QDs, in HEK293 cells. Using the microfluidic chip combined with fluorescence microscopy, multiple QD-induced cellular events including cell morphology, viability, proliferation, and QD uptake were simultaneously analysed. The three kinds of QDs showed significantly different cytotoxicities. The CdTe QDs, which are highly toxic to HEK293 cells, resulted in remarkable cellular and nuclear morphological changes, a dose-dependent decrease in cell viability, and strong inhibition of cell proliferation; the CdTe/CdS QDs were moderately toxic but did not significantly affect the proliferation of HEK293 cells; while the CdTe/CdS/ZnS QDs had no detectable influence on cytotoxicity with respect to cell morphology, viability, and proliferation. Our data indicated that QD cytotoxicity was closely related to their surface structures and specific physicochemical properties. This study also demonstrated that the microfluidic chip could serve as a powerful tool to systematically evaluate the cytotoxicity of nanoparticles in multiple cellular events.

  17. Evaluation of the cytotoxicity of selected conventional glass ionomer cements on human gingival fibroblasts.

    Science.gov (United States)

    Marczuk-Kolada, Grażyna; Łuczaj-Cepowicz, Elżbieta; Pawińska, Małgorzata; Hołownia, Adam

    2017-10-01

    Dentistry materials are the most frequently used substitutes of human tissues. Therefore, an assessment of dental filling materials should cover not only their chemical, physical, and mechanical characteristics, but also their cytotoxicity. To compare the cytotoxic effects of 13 conventional glass ionomer cements on human gingival fibroblasts. The assessment was conducted using the MTT test. Six samples were prepared for each material. Culture plates with cells and inserts with the materials were incubated at 37°C, 5% CO2, and 95% humidity for 24 h. Then the inserts were removed, 1 mL of MTT was added in the amount of 0.5 mg/1 mL of the medium, and the samples were incubated in the described conditions without light for 2 h. The optical density was measured with an absorption spectrophotometer at a wavelength of 560 nm. The cytotoxic effects of the Argion Molar was significantly stronger than the Fuji Triage (p = 0.007), Chemfil Molar (p cements from the low cytotoxicity group were significantly more toxic vs materials whose presence resulted in fibroblast growth (p < 0.001). The research conducted indicates that, although the materials studied may belong to the same group, they are characterized by low, yet not uniform, cytotoxicity on human gingival fibroblasts. The toxic effects should not be assigned to a relevant group of materials, but each dentistry product should be evaluated individually.

  18. Application of cytotoxicity test for toxic micropollutants. Saibo dokusei shiken ni yoru yugai kagaku busshitsu osen no hyoka

    Energy Technology Data Exchange (ETDEWEB)

    Utsumi, H; Hamada, A [Showa University, Tokyo (Japan). School of Pharmaceutical Science; Ono, Y [National Institute of Hygienic Sciences, Tokyo (Japan)

    1992-10-01

    Considerations were given from a viewpoint of assessing toxicity to human bodies on methods of assessing water pollutants and organisms, and applicability of cytotoxity test using cultured cells to water quality assessment. Biological assessment systems used for water environment may use tests using multicellular organisms, cells, or organelles in cells. The organism assessment method is intended mainly for assessing ecological effects, and a suitable method must be selected upon extrapolating it to human bodies. A toxicity parameter used most frequently in a cytotoxity test is the cell revival rate, and life and death are determined from liberation of enzymes in cells, or with color rejection tests and incorporation tests. There are a number of test specimens of raw tap water and its chlorine treatment condensate that show no mutagenicity but cytotoxity. Efficiencies of removal by means of mild chlorine treatment, fast filtration, and activated carbon adsorption vary greatly with cytotoxity and mutagenicity. Introducing the cytotoxity test is expected of further contributing to improving safety in water quality. 24 refs., 1 fig., 7 tabs.

  19. Initial cytotoxicity assays of media for sulfate-reducing bacteria: An endodontic biopharmaceutical product under development.

    Science.gov (United States)

    Heggendorn, Fabiano Luiz; Silva, Gabriela Cristina de Carvalho; Cardoso, Elisama Azevedo; Castro, Helena Carla; Gonçalves, Lúcio Souza; Dias, Eliane Pedra; Lione, Viviane de Oliveira Freitas; Lutterbach, Márcia Teresa Soares

    2016-01-01

    This study assessed the cell viability of the inoculation vehicle of BACCOR (a combination of sulfate-reducing bacteria plus a culture media for bacteria), a biopharmaceutical product under development for dental use as aid in fractured endodontic file removal from the root canal. Different culture media for bacteria were evaluated: modified Postgate E (MCP-E mod), Modified Postgate E without Agar-agar (MCP-E w/Ag), Postgate C with Agar-agar (MCP-C Ag) and Postgate C without Agar-agar (MCP-C w/Ag). Cytotoxicity was quantified by the MTT test, exposing L929 and Vero cell lines to the vehicles over 24 h. The exposure of L929 cell line to MCP-E w/Ag resulted in biocompatibility (52% cell viability), while the exposure of the Vero kidney line revealed only MCP-E mod as cytotoxic. When diluted, all the vehicles showed biocompatibility with both cell lines. MCP-E w/Ag was the vehicle chosen for BACCOR, because of its biocompatibility with the cells used.

  20. Correlating cytotoxicity to elution behaviors of composite resins in term of curing kinetic.

    Science.gov (United States)

    Meng, Junquan; Yang, Huichuan; Cao, Man; Li, Lei; Cai, Qing

    2017-09-01

    Cytotoxicity of photocurable composite resins is a key issue for their safe use in dental restoration. Curing kinetic and elution behaviors of the composite resin would have decisive effects on its cytotoxicity. In this study, composite resins composed of bisphenol-glycidyl dimethacrylate (Bis-GMA), triethyleneglycol dimethacrylate (TEGDMA), camphorquinone (CQ), N,N-dimethylaminoethyl methacrylate (DMAEMA) and barium glass powders were prepared by setting the photoinitiators CQ/DMAEMA at 0.5wt%, 1wt% or 3wt% of the total weight of Bis-GMA/TEGDMA. The ratio of Bis-GMA/TEGDMA was 6:4, the ratio of CQ/DMAEMA was 1:1, and the incorporated inorganic powder was 75wt%. Then, curing kinetics were studied by using real-time Fourier transform infrared spectroscopy (FTIR) and photo-DSC (differential scanning calorimeter). Elution behaviors in both ethanol solution and deionized water were monitored by using liquid chromatogram/mass spectrometry (LC/MS). Cytotoxicity was evaluated by in vitro culture of L929 fibroblasts. Finally, they were all analyzed and correlated in terms of initiator contents. It was found that the commonly used 0.5wt% of photoinitiators was somewhat insufficient in obtaining composite resin with low cytotoxicity. Copyright © 2017. Published by Elsevier B.V.

  1. Cytotoxic mechanisms of hydrosulfide anion and cyanide anion in primary rat hepatocyte cultures

    International Nuclear Information System (INIS)

    Thompson, Rodney W.; Valentine, Holly L.; Valentine, William M.

    2003-01-01

    Hydrogen sulfide and hydrogen cyanide are known to compromise mitochondrial respiration through inhibition of cytochrome c oxidase and this is generally considered to be their primary mechanism of toxicity. Experimental studies and the efficiency of current treatment protocols suggest that H 2 S may exert adverse physiological effects through additional mechanisms. To evaluate the role of alternative mechanisms in H 2 S toxicity, the relative contributions of electron transport inhibition, uncoupling of mitochondrial respiration, and opening of the mitochondrial permeability transition pore (MPTP) to hydrosulfide and cyanide anion cytotoxicity in primary hepatocyte cultures were examined. Supplementation of hepatocytes with the glycolytic substrate, fructose, rescued hepatocytes from cyanide anion induced toxicity, whereas fructose supplementation increased hydrosulfide anion toxicity suggesting that hydrosulfide anion may compromise glycolysis in hepatocytes. Although inhibitors of the MPTP opening were protective for hydrosulfide anion, they had no effect on cyanide anion toxicity, consistent with an involvement of the permeability transition pore in hydrosulfide anion toxicity but not cyanide anion toxicity. Exposure of isolated rat liver mitochondria to hydrosulfide did not result in large amplitude swelling suggesting that if H 2 S induces the permeability transition it does so indirectly through a mechanism requiring other cellular components. Hydrosulfide anion did not appear to be an uncoupler of mitochondrial respiration in hepatocytes based upon the inability of oligomycin and fructose to protect hepatocytes from hydrosulfide anion toxicity. These findings support mechanisms additional to inhibition of cytochrome c oxidase in hydrogen sulfide toxicity. Further investigations are required to assess the role of the permeability transition in H 2 S toxicity, determine whether similar affects occur in other cell types or in vivo and evaluate whether this may

  2. Gender, Culture, and the Educational Choices of Second Generation Hmong American Girls

    OpenAIRE

    Lo, Bao

    2017-01-01

    Research on the educational achievement of racialized minorities and immigrants have largely discussed culture as either a deficit or an advantage for academic success. This paper explores gender differences in educational achievement and how the educational choices of second-generation Hmong American girls are impacted by racially constructed gender norms. In response to hegemonic and subordinated femininities, second-generation Hmong American girls pursue education to enter mainstream Ameri...

  3. Uptake and cytotoxic effects of multi-walled carbon nanotubes in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Hirano, Seishiro; Fujitani, Yuji; Furuyama, Akiko; Kanno, Sanae

    2010-01-01

    Carbon nanotubes (CNT) are cytotoxic to several cell types. However, the mechanism of CNT toxicity has not been fully studied, and dosimetric analyses of CNT in the cell culture system are lacking. Here, we describe a novel, high throughput method to measure cellular uptake of CNT using turbimetry. BEAS-2B, a human bronchial epithelial cell line, was used to investigate cellular uptake, cytotoxicity, and inflammatory effects of multi-walled CNT (MWCNT). The cytotoxicity of MWCNT was higher than that of crocidolite asbestos in BEAS-2B cells. The IC 50 of MWCNT was 12 μg/ml, whereas that of asbestos (crocidolite) was 678 μg/ml. Over the course of 5 to 8 h, BEAS-2B cells took up 17-18% of the MWCNT when they were added to the culture medium at a concentration of 10 μg/ml. BEAS-2B cells were exposed to 2, 5, or 10 μg/ml of MWCNT, and total RNA was extracted for cytokine cDNA primer array assays. The culture supernatant was collected for cytokine antibody array assays. Cytokines IL-6 and IL-8 increased in a dose dependent manner at both the mRNA and protein levels. Migration inhibitory factor (MIF) also increased in the culture supernatant in response to MWCNT. A phosphokinase array study using lysates from BEAS-2B cells exposed to MWCNT indicated that phosphorylation of p38, ERK1, and HSP27 increased significantly in response to MWCNT. Results from a reporter gene assays using the NF-κB or AP-1 promoter linked to the luciferase gene in transiently transfected CHO-KI cells revealed that NF-κB was activated following MWCNT exposure, while AP-1 was not changed. Collectively, MWCNT activated NF-κB, enhanced phosphorylation of MAP kinase pathway components, and increased production of proinflammatory cytokines in human bronchial epithelial cells.

  4. TRX-ASK1-JNK signaling regulation of cell density-dependent cytotoxicity in cigarette smoke-exposed human bronchial epithelial cells.

    Science.gov (United States)

    Lee, Yong Chan; Chuang, Chun-Yu; Lee, Pak-Kei; Lee, Jin-Soo; Harper, Richart W; Buckpitt, Alan B; Wu, Reen; Oslund, Karen

    2008-05-01

    Cigarette smoke is a major environmental air pollutant that injures airway epithelium and incites subsequent diseases including chronic obstructive pulmonary disease. The lesion that smoke induces in airway epithelium is still incompletely understood. Using a LIVE/DEAD cytotoxicity assay, we observed that subconfluent cultures of bronchial epithelial cells derived from both human and monkey airway tissues and an immortalized normal human bronchial epithelial cell line (HBE1) were more susceptible to injury by cigarette smoke extract (CSE) and by direct cigarette smoke exposure than cells in confluent cultures. Scraping confluent cultures also caused an enhanced cell injury predominately in the leading edge of the scraped confluent cultures by CSE. Cellular ATP levels in both subconfluent and confluent cultures were drastically reduced after CSE exposure. In contrast, GSH levels were significantly reduced only in subconfluent cultures exposed to smoke and not in confluent cultures. Western blot analysis demonstrated ERK activation in both confluent and subconfluent cultures after CSE. However, activation of apoptosis signal-regulating kinase 1 (ASK1), JNK, and p38 were demonstrated only in subconfluent cultures and not in confluent cultures after CSE. Using short interfering RNA (siRNA) to JNK1 and JNK2 and a JNK inhibitor, we attenuated CSE-mediated cell death in subconfluent cultures but not with an inhibitor of the p38 pathway. Using the tetracycline (Tet)-on inducible approach, overexpression of thioredoxin (TRX) attenuated CSE-mediated cell death and JNK activation in subconfluent cultures. These results suggest that the TRX-ASK1-JNK pathway may play a critical role in mediating cell density-dependent CSE cytotoxicity.

  5. Pronounced radiosensitization of cultured human cancer cells by COX inhibitor under acidic microenvironment

    International Nuclear Information System (INIS)

    Shah, Tushar; Ryu, Samuel; Lee, Ho Jun; Brown, Stephen; Kim, Jae Ho

    2002-01-01

    Purpose: To demonstrate the influence of pH on the cytotoxicity and radiosensitization by COX (cyclooxygenase) -1 and -2 inhibitors using established human cancer cells in culture. Methods and Materials: Nonselective COX inhibitor, ibuprofen (IB), and selective COX-2 inhibitor, SC-236, were used to determine the cytotoxicity and radiosensitization at varying pH of culture media. Human colon carcinoma cell line (HT-29) was exposed to the drug alone and in combination with radiation at different pH of the cell culture media. The end point was clonogenic ability of the single-plated cells after the treatment. Results: Cytotoxicity and radiosensitization of IB increased with higher drug concentration and longer exposure time. The most significant radiosensitization was seen with IB (1.5 mM) for 2-h treatment at pH 6.7 before irradiation. The dose-modifying factor as defined by the ratio of radiation doses required to achieve the same effect on cell survival was 1.8 at 10% survival level. In contrast, SC-236 (50 μM for 2-8 h) showed no pH-dependent cytotoxicity. There was modest increase in the cell killing at lower doses of radiation. Conclusion: An acidic pH was an important factor affecting the increased cytotoxicity and radiosensitization by ibuprofen. Radiation response was enhanced at shoulder portion of the cell survival curve by selective COX-2 inhibitor

  6. The evolution of chicken stem cell culture methods.

    Science.gov (United States)

    Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

    2017-12-01

    1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

  7. Source of cytotoxicity in a colloidal silver nanoparticle suspension.

    Science.gov (United States)

    Hatipoglu, Manolya Kukut; Keleştemur, Seda; Altunbek, Mine; Culha, Mustafa

    2015-05-15

    Silver nanoparticles (AgNPs) are increasingly used in a variety of applications because of their potential antimicrobial activity and their plasmonic and conductivity properties. In this study, we investigated the source of cytotoxicity, genotoxicity, and reactive oxygen species (ROS) production on human dermal fibroblast and human lung cancer (A549) cell lines upon exposure to AgNP colloidal suspensions prepared with the simplest and most commonly used Lee–Meisel method with a variety of reaction times and the concentrations of the reducing agent. The AgNPs synthesized with shorter reaction times were more cytotoxic and genotoxic due to the presence of a few nanometer-sized AgNP seeds. The suspensions prepared with an increased citrate concentration were not cytotoxic, but they induced more ROS generation on A549 cells due to the high citrate concentration. The genotoxicity of the suspension decreased significantly at the higher citrate concentrations. The analysis of both transmission electron microscopy images from the dried droplet areas of the colloidal suspensions and toxicity data indicated that the AgNP seeds were the major source of toxicity. The completion of the nucleation step and the formation of larger AgNPs effectively decreased the toxicity.

  8. Quantifying oxygen in paper-based cell cultures with luminescent thin film sensors.

    Science.gov (United States)

    Boyce, Matthew W; Kenney, Rachael M; Truong, Andrew S; Lockett, Matthew R

    2016-04-01

    Paper-based scaffolds are an attractive material for generating 3D tissue-like cultures because paper is readily available and does not require specialized equipment to pattern, cut, or use. By controlling the exchange of fresh culture medium with the paper-based scaffolds, we can engineer diffusion-dominated environments similar to those found in spheroids or solid tumors. Oxygen tension directly regulates cellular phenotype and invasiveness through hypoxia-inducible transcription factors and also has chemotactic properties. To date, gradients of oxygen generated in the paper-based cultures have relied on cellular response-based readouts. In this work, we prepared a luminescent thin film capable of quantifying oxygen tensions in apposed cell-containing paper-based scaffolds. The oxygen sensors, which are polystyrene films containing a Pd(II) tetrakis(pentafluorophenyl)porphyrin dye, are photostable, stable in culture conditions, and not cytotoxic. They have a linear response for oxygen tensions ranging from 0 to 160 mmHg O2, and a Stern-Volmer constant (K sv) of 0.239 ± 0.003 mmHg O2 (-1). We used these oxygen-sensing films to measure the spatial and temporal changes in oxygen tension for paper-based cultures containing a breast cancer line that was engineered to constitutively express a fluorescent protein. By acquiring images of the oxygen-sensing film and the fluorescently labeled cells, we were able to approximate the oxygen consumption rates of the cells in our cultures.

  9. The Generation of Human γδT Cell-Derived Induced Pluripotent Stem Cells from Whole Peripheral Blood Mononuclear Cell Culture.

    Science.gov (United States)

    Watanabe, Daisuke; Koyanagi-Aoi, Michiyo; Taniguchi-Ikeda, Mariko; Yoshida, Yukiko; Azuma, Takeshi; Aoi, Takashi

    2018-01-01

    γδT cells constitute a small proportion of lymphocytes in peripheral blood. Unlike αβT cells, the anti-tumor activities are exerted through several different pathways in a MHC-unrestricted manner. Thus, immunotherapy using γδT cells is considered to be effective for various types of cancer. Occasionally, however, ex vivo expanded cells are not as effective as expected due to cell exhaustion. To overcome the issue of T-cell exhaustion, researchers have generated induced pluripotent stem cells (iPSCs) that harbor the same T-cell receptor (TCR) genes as their original T-cells, which provide nearly limitless sources for antigen-specific cytotoxic T lymphocytes (CTLs). However, these technologies have focused on αβT cells and require a population of antigen-specific CTLs, which are purified by cell sorting with HLA-peptide multimer, as the origin of iPS cells. In the present study, we aimed to develop an efficient and convenient system for generating iPSCs that harbor rearrangements of the TCRG and TCRD gene regions (γδT-iPSCs) without cell-sorting. We stimulated human whole peripheral blood mononuclear cell (PBMC) culture using Interleukin-2 and Zoledronate to activate γδT cells. Gene transfer into those cells with the Sendai virus vector resulted in γδT cell-dominant expression of exogenous genes. The introduction of reprogramming factors into the stimulated PBMC culture allowed us to establish iPSC lines. Around 70% of the established lines carried rearrangements at the TCRG and TCRD gene locus. The γδT-iPSCs could differentiate into hematopoietic progenitors. Our technology will pave the way for new avenues toward novel immunotherapy that can be applied for various types of cancer. Stem Cells Translational Medicine 2018;7:34-44. © 2017 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  10. Cytotoxic effects of air freshener biocides in lung epithelial cells.

    Science.gov (United States)

    Kwon, Jung-Taek; Lee, Mimi; Seo, Gun-Baek; Kim, Hyun-Mi; Shim, Ilseob; Lee, Doo-Hee; Kim, Taksoo; Seo, Jung Kwan; Kim, Pilje; Choi, Kyunghee

    2013-09-01

    This study evaluated the cytotoxicity of mixtures of citral (CTR) and either benzisothiazolinone (BIT, Mix-CTR-BIT) or triclosan (TCS, Mix-CTR-TCS) in human A549 lung epithelial cells. We investigated the effects of various mix ratios of these common air freshener ingredients on cell viability, cell proliferation, reactive oxygen species (ROS) generation, and DNA damage. Mix-CTR-BIT and Mix-CTR-TCS significantly decreased the viability of lung epithelial cells and inhibited cell growth in a dose-dependent manner. In addition, both mixtures increased ROS generation, compared to that observed in control cells. In particular, cell viability, growth, and morphology were affected upon increase in the proportion of BIT or TCS in the mixture. However, comet analysis showed that treatment of cells with Mix-CTR-BIT or Mix-CTR-TCS did not increase DNA damage. Taken together, these data suggested that increasing the content of biocides in air fresheners might induce cytotoxicity, and that screening these compounds using lung epithelial cells may contribute to hazard assessment.

  11. Effect of irradiation on human T-cell proliferation: low dose irradiation stimulates mitogen-induced proliferation and function of the suppressor/cytotoxic T-cell subset

    International Nuclear Information System (INIS)

    Gualde, N.; Goodwin, J.S.

    1984-01-01

    Unfractionated human T cells exposed to 10-50 rad of X irradiation incorporated less [ 3 H]thymidine than nonirradiated T cells when subsequently cultured with PHA or Con A. The cytotoxic/suppressor T-cell subset, isolated as either OKT8(+) or OKT4(-) cells, demonstrated significantly enhanced [ 3 H]thymidine incorporation in PHA- or Con A-stimulated cultures after exposure to 10-50 rad, compared to unirradiated cells, while the proliferation of the OKT4(+) helper/inducer subset was inhibited by low dose irradiation. It has been previously reported that approximately 30% of the cytotoxic/suppressor subset also stains with OKM1. When the cytotoxic/suppressor subset was further subdivided into OKT4(-), OKM1(+), and OKT4(-), OKM1(-) cells, proliferation of the OKT4(-), OKM1(+) population was inhibited by exposure to 25 rad while proliferation of the OKT4(-), OKM1(-) population was stimulated. The increase in proliferation of the cytotoxic/suppressor T-cell subset after low dose irradiation is paralleled by an increase in suppressor activity of these cells. T cells exposed to 25 rad and then cultured with Con A for 48 hr caused greater inhibition of IgG production when added to fresh autologous lymphocytes stimulated by pokeweed mitogen than did unirradiated cells. Thus, low dose irradiation enhances both the proliferation and function of the human suppressor T-cell subset

  12. Synthesis of curcumin-functionalized gold nanoparticles and cytotoxicity studies in human prostate cancer cell line

    Science.gov (United States)

    Nambiar, Shruti; Osei, Ernest; Fleck, Andre; Darko, Johnson; Mutsaers, Anthony J.; Wettig, Shawn

    2018-03-01

    Gold nanoparticles synthesized using plant extracts with medicinal properties have gained traction in recent years, especially for their use in various biomedical applications. Colloidal stability of these nanoparticles in different environments is critical to retain the expected therapeutic/diagnostic efficacy and toxicological outcome. Any change in the colloidal stability leads to dramatic changes in the physico-chemical properties of the nanoparticles such as size and surface charge, which in turn may alter the biological activity of the particles. Such changes are imminent in physiologically-relevant environment wherein interactions with different biomolecules, such as serum proteins, may modify the overall properties of the nanoparticles. In this regard, we synthesized 15 nm sized gold nanoparticles using curcumin, a plant extract from turmeric root, to evaluate cytotoxicity, uptake, and localization in human prostate cancer cells using cell-culture medium supplemented with or without fetal bovine serum (FBS). The results indicate a dramatic difference in the cytotoxicity and uptake between cells treated with curcumin-functionalized gold nanoparticles (cur-AuNPs) in cell-culture medium with and without serum. The addition of FBS to the medium not only increased the stability of the nanoparticles but also enhanced the biocompatibility (i.e. minimal cytotoxicity for a wide range of cur-AuNP concentrations). We conclude that the presence of serum proteins significantly impact the therapeutic potential of cur-AuNPs.

  13. Cell viability score as an integrated indicator for cytotoxicity of benzalkonium chloride-containing antiglaucoma eyedrops.

    Science.gov (United States)

    Ayaki, Masahiko; Iwasawa, Atsuo; Niwano, Yoshimi

    2012-01-01

    We evaluated the in vitro cytotoxicity of benzalkonium chloride (BAK)-containing antiglaucoma eyedrops. We prepared cell cultures of SIRC, BCE C/D-1b, RC-1, and Chang conjunctiva. The viability of cell cultures was determined using the MTT and neutral red assays. The cell viability score (CVS) was used to compare the toxicity of test solutions. %CVS50 and %CVS40/80 of each eyedrop solution were 71 and 26 for Lumigan(®) (0.002% bimatoprost with 0.005% BAK), 100 and 99 for Tapros(®) (0.0015% tafluprost, a new formula from 2010 with 0.001% BAK), 39 and -29 for 2% Trusopt(®) (2% dorzolamide with 0.0075% BAK), 28 and -43 for Xalacom(®) (latanoprost/0.5% timolol with 0.02% BAK), 88 and 66 for DuoTrav(®) (travoprost/0.5% timolol with no BAK), 36 and -35 for Cosopt(®) (2% dorzolamide/0.5% timolol with 0.0075% BAK) and 53 and -1 for Combigan(®) (0.15% brimonidin/0.5% timolol with 0.005% BAK). Only Xalacom(®) and Tapros(®) did not show an apparent decrease in %CVS as compared to the corresponding concentration of BAK. In conclusion, the cytotoxicity of tested eyedrops was dependent on BAK. Only the eyedrops containing latanoprost or tafluprost showed a reduction in the cytotoxicity of BAK.

  14. Efficacy and cytotoxicity of a bleaching gel after short application times on dental enamel.

    Science.gov (United States)

    Soares, Diana Gabriela; Ribeiro, Ana Paula Dias; da Silveira Vargas, Fernanda; Hebling, Josimeri; de Souza Costa, Carlos Alberto

    2013-11-01

    This study aimed to evaluate and correlate the efficacy and cytotoxicity of a 35 % hydrogen peroxide (HP) bleaching gel after different application times on dental enamel. Enamel/dentin disks in artificial pulp chambers were placed in wells containing culture medium. The following groups were formed: G1, control (no bleaching); G2 and G3, three or one 15-min bleaching applications, respectively; and G4 and G5, three or one 5-min bleaching applications, respectively. Extracts (culture medium with bleaching gel components) were applied for 60 min on cultured odontoblast-like MDPC-23 cells. Cell metabolism (methyl tetrazolium assay) (Kruskal-Wallis/Mann-Whitney; α = 5 %) and cell morphology (scanning electron microscopy) were analyzed immediately after the bleaching procedures and the trans-enamel and trans-dentinal HP diffusion quantified (one-way analysis of variance/Tukey's test; α = 5 %). The alkaline phosphatase (ALP) activity was evaluated 24 h after the contact time of the extracts with the cells (Kruskal-Wallis/Mann-Whitney; α = 5 %). Tooth color was analyzed before and 24 h after bleaching using a spectrophotometer according to the Commission Internationale de l'Eclairage L*a*b* system (Kruskal-Wallis/Mann-Whitney; α = 0.05). Significant difference (p 0.05). The lowest amount of HP diffusion was observed in G5 (p 0.05). HP diffusion through dental tissues and its cytotoxic effects were proportional to the contact time of the bleaching gel with enamel. However, shorter bleaching times reduced bleaching efficacy. Shortening the in-office tooth bleaching time could be an alternative to minimize the cytotoxic effects of this clinical procedure to pulp tissue. However, the reduced time of bleaching agent application on enamel may not provide adequate esthetic outcome.

  15. Cytotoxicity difference of 316L stainless steel and titanium reconstruction plate

    OpenAIRE

    Ni Putu Mira Sumarta; Coen Pramono Danudiningrat; Ester Arijani Rachmat; Pratiwi Soesilawati

    2011-01-01

    Background: Pure titanium is the most biocompatible material today and used as a gold standard for metallic implants. However, stainless steel is still being used as implants because of its strength, ductility, lower price, corrosion resistant and biocompatibility. Purpose: This study was done to revealed the cytotoxicity difference between reconstruction plate made of 316L stainless steel and of commercially pure (CP) titanium in baby hamster kidney-21 (BHK-21) fibroblast culture through MTT...

  16. Arsenite and monomethylarsonous acid generate oxidative stress response in human bladder cell culture

    International Nuclear Information System (INIS)

    Eblin, K.E.; Bowen, M.E.; Cromey, D.W.; Bredfeldt, T.G.; Mash, E.A.; Lau, S.S.; Gandolfi, A.J.

    2006-01-01

    Arsenicals have commonly been seen to induce reactive oxygen species (ROS) which can lead to DNA damage and oxidative stress. At low levels, arsenicals still induce the formation of ROS, leading to DNA damage and protein alterations. UROtsa cells, an immortalized human urothelial cell line, were used to study the effects of arsenicals on the human bladder, a site of arsenical bioconcentration and carcinogenesis. Biotransformation of As(III) by UROtsa cells has been shown to produce methylated species, namely monomethylarsonous acid [MMA(III)], which has been shown to be 20 times more cytotoxic. Confocal fluorescence images of UROtsa cells treated with arsenicals and the ROS sensing probe, DCFDA, showed an increase of intracellular ROS within five min after 1 μM and 10 μM As(III) treatments. In contrast, 50 and 500 nM MMA(III) required pretreatment for 30 min before inducing ROS. The increase in ROS was ameliorated by preincubation with either SOD or catalase. An interesting aspect of these ROS detection studies is the noticeable difference between concentrations of As(III) and MMA(III) used, further supporting the increased cytotoxicity of MMA(III), as well as the increased amount of time required for MMA(III) to cause oxidative stress. These arsenical-induced ROS produced oxidative DNA damage as evidenced by an increase in 8-hydroxyl-2'-deoxyguanosine (8-oxo-dG) with either 50 nM or 5 μM MMA(III) exposure. These findings provide support that MMA(III) cause a genotoxic response upon generation of ROS. Both As(III) and MMA(III) were also able to induce Hsp70 and MT protein levels above control, showing that the cells recognize the ROS and respond. As(III) rapidly induces the formation of ROS, possibly through it oxidation to As(V) and further metabolism to MMA(III)/(V). These studies provide evidence for a different mechanism of MMA(III) toxicity, one that MMA(III) first interacts with cellular components before an ROS response is generated, taking longer to

  17. Concanavalin A-mediated in vitro activation of a secondary cytotoxic T-cell response in virus-primed splenocytes

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Jensen, B L

    1980-01-01

    In a recent report it was shown that what appeared to be secondary cytotoxic T cells could be obtained from lymphocytic choriomeningitis virus (LCMV)-primed splenocytes after stimulation in vitro with the non-specific T cell mitogen concanavalin A (Con A). The present experiments attempt to chara......In a recent report it was shown that what appeared to be secondary cytotoxic T cells could be obtained from lymphocytic choriomeningitis virus (LCMV)-primed splenocytes after stimulation in vitro with the non-specific T cell mitogen concanavalin A (Con A). The present experiments attempt...... to characterize further these effector cells and, in particular, to establish whether the Con A-activated cytotoxic effectors are qualitatively different from the secondary cytotoxic T cells induced by restimulation with the homologous antigen. It was found that: (1) in vitro activation with Con A could......, since no evidence was found to indicate a role for other cell types or soluble (cytotoxic or arming) factors; (4) cytotoxicity was specific with regard to both virus and 'self'. By comparison with previous data on LCMV-induced cytotoxic T cells, it is concluded that Con A induces the generation...

  18. Biocompatibility index of antiseptic agents by parallel assessment of antimicrobial activity and cellular cytotoxicity.

    Science.gov (United States)

    Müller, Gerald; Kramer, Axel

    2008-06-01

    To assess the suitability of an antiseptic agent, both the microbicidal activity and the cytotoxic effect must be taken into consideration to derive biocompatible antibacterial agents. We defined the biocompatibility index (BI) by measuring the antibacterial activity against the test organisms Escherichia coli and Staphylococcus aureus and, in parallel, the cytotoxicity on cultured murine fibroblasts. The antiseptic agents tested were benzalkonium chloride (BAC), cetylpyridinium chloride (CPC), chlorhexidine digluconate (CHX), mild silver protein (MSP), octenidine dihydrochloride (OCT), polyhexamethylene biguanide (PHMB), povidone iodine in solution [PVP-I(s)], povidone iodine in ointment [PVP-I(o)], silver nitrate (AgNO(3)), silver (I) sulfadiazine (SSD) and triclosan (TRI). Assays were carried out for 30 min of exposure at 37 degrees C in the presence of cell culture medium containing 10% fetal bovine serum. The resulting dimensionless BI was defined as the ratio of the concentration at which 50% of the murine fibroblasts are damaged and the microbicidal effect producing at least 3 log(10) (99.9%) reduction. The resulting rank ordering of BI for the ratio of fibroblast cytotoxicity to E. coli toxicity was OCT > PHMB > CHX > PVP-I(o) > PVP-I(s) > BAC > CPC > TRI > MSP and that to S. aureus was OCT > PHMB > CHX > CPC > PVP-I(o) > BAC > PVP(s) > TRI > MSP. OCT and PHMB were the most suitable agents with a BI greater than 1. The BI presented may be a useful tool to evaluate antiseptic agents for use in clinical practice.

  19. Cultural Transmission and Evolution of Melodic Structures in Multi-generational Signaling Games

    DEFF Research Database (Denmark)

    Lumaca, Massimo; Baggio, G.

    2017-01-01

    , and basic and compound emotions as meanings, were transmitted from senders to receivers along diffusion chains in which the receiver in each game became the sender in the next game. During transmission, structural regularities accumulated in the signaling systems, following principles of proximity, symmetry...... and cognitive constraints similarly affect the evolution of musical systems? We conducted an experiment on the cultural evolution of artificial melodic systems, using multi-generational signaling games as a laboratory model of cultural transmission. Signaling systems, using five-tone sequences as signals...

  20. T-cell activation. VI. Inhibitory and stimulatory effects of anti-major histocompatibility complex class I antibodies in allogeneic mixed lymphocyte culture

    DEFF Research Database (Denmark)

    Röpke, M; Röpke, C; Claesson, Mogens Helweg

    1993-01-01

    Murine T splenocytes stimulated in primary allogeneic mixed lymphocyte culture (MLC) were incubated with soluble anti-major histocompatibility complex (MHC) class I monoclonal antibodies. These antibodies induced inhibition in the cytotoxicity of the responding population and this inhibition...... was not dependent on the domain on class I molecules recognized by the antibodies. Cross-reactivity of the antibodies between the responder and stimulating cell population caused a marked reduction in the inhibitory effect compared to systems where no such cross-reactivity was present. Saturating levels...... of the antibodies caused a reduction in generation of T-cell cytotoxicity, whereas low concentrations stimulated the same response. These results demonstrate that the MHC class I molecules of T cells are of significant importance in antigen-induced signal transduction....

  1. Effect of Digestion and Storage of Human Milk on Free Fatty Acid Concentration and Cytotoxicity

    Science.gov (United States)

    Penn, Alexander H.; Altshuler, Angelina E.; Small, James W.; Taylor, Sharon F.; Dobkins, Karen R.; Schmid-Schönbein, Geert W.

    2014-01-01

    Objectives Fat is digested in the intestine into free fatty acids (FFAs), which are detergents and therefore toxic to cells at micromolar concentration. The mucosal barrier protects cells in the adult intestine, but this barrier may not be fully developed in premature infants. Lipase-digested infant formula, but not fresh human milk, has elevated FFAs and is cytotoxic to intestinal cells, and therefore could contribute to intestinal injury in necrotizing enterocolitis (NEC). But even infants exclusively fed breast milk may develop NEC. Our objective was to determine if stored milk and milk from donor milk banks (DM) could also become cytotoxic, especially after digestion. Methods We exposed cultured rat intestinal epithelial cells or human neutrophils to DM and milk collected fresh and stored at 4 or −20 °C for up to 12 weeks and then treated for 2 hours (37°C) with 0.1 or 1 mg/ml pancreatic lipase and/or trypsin and chymotrypsin. Results DM and milk stored 3 days (at 4 or −20 °C) and then digested were cytotoxic. Storage at −20 °C for 8 and 12 weeks resulted in an additional increase in cytotoxicity. Protease digestion decreased, but did not eliminate cell death. Conclusions Current storage practices may allow milk to become cytotoxic and contribute to intestinal damage in NEC. PMID:24840512

  2. Lactobacillus delbrueckii ssp. bulgaricus B-30892 can inhibit cytotoxic effects and adhesion of pathogenic Clostridium difficile to Caco-2 cells

    Science.gov (United States)

    Banerjee, Pratik; Merkel, Glenn J; Bhunia, Arun K

    2009-01-01

    Background Probiotic microorganisms are receiving increasing interest for use in the prevention, treatment, or dietary management of certain diseases, including antibiotic-associated diarrhea (AAD). Clostridium difficile is the most common cause of AAD and the resulting C. difficile – mediated infection (CDI), is potentially deadly. C. difficile associated diarrhea (CDAD) is manifested by severe inflammation and colitis, mostly due to the release of two exotoxins by C. difficile causing destruction of epithelial cells in the intestine. The aim of this study was to determine the effect of probiotic bacteria Lactobacillus delbrueckii ssp. bulgaricus B-30892 (LDB B-30892) on C. difficile-mediated cytotoxicity using Caco-2 cells as a model. Methods Experiments were carried out to test if the cytotoxicity induced by C. difficile-conditioned-medium on Caco-2 cells can be altered by cell-free supernatant (CFS) from LDB B-30892 in different dilutions (1:2 to 1:2048). In a similar experimental setup, comparative evaluations of other probiotic strains were made by contrasting the results from these strains with the results from LDB B-30892, specifically the ability to affect C. difficile induced cytotoxicity on Caco-2 monolayers. Adhesion assays followed by quantitative analysis by Giemsa staining were conducted to test if the CFSs from LDB B-30892 and other probiotic test strains have the capability to alter the adhesion of C. difficile to the Caco-2 monolayer. Experiments were also performed to evaluate if LDB B-30892 or its released components have any bactericidal effect on C. difficile. Results and discussion Co-culturing of LDB B-30892 with C. difficile inhibited the C. difficile-mediated cytotoxicity on Caco-2 cells. When CFS from LDB B-30892-C. difficile co-culture was administered (up to a dilution of 1:16) on Caco-2 monolayer, there were no signs of cytotoxicity. When CFS from separately grown LDB B-30892 was mixed with the cell-free toxin preparation (CFT) of

  3. Alkaloids from Prosopis juliflora leaves induce glial activation, cytotoxicity and stimulate NO production.

    Science.gov (United States)

    Silva, A M M; Silva, A R; Pinheiro, A M; Freitas, S R V B; Silva, V D A; Souza, C S; Hughes, J B; El-Bachá, R S; Costa, M F D; Velozo, E S; Tardy, M; Costa, S L

    2007-04-01

    Prosopis juliflora is used for feeding cattle and humans. Intoxication with the plant has been reported, and is characterized by neuromuscular alterations and gliosis. Total alkaloidal extract (TAE) was obtained using acid/basic-modified extraction and was fractionated. TAE and seven alkaloidal fractions, at concentrations ranging 0.03-30 microg/ml, were tested for 24h on astrocyte primary cultures derived from the cortex of newborn Wistar rats. The MTT test and the measure of LDH activity on the culture medium, revealed that TAE and fractions F29/30, F31/33, F32 and F34/35 were cytotoxic to astrocytes. The EC(50) values for the most toxic compounds, TAE, F31/33 and F32 were 2.87 2.82 and 3.01 microg/ml, respectively. Morphological changes and glial cells activation were investigated through Rosenfeld's staining, by immunocytochemistry for the protein OX-42, specific of activated microglia, by immunocytochemistry and western immunoblot for GFAP, the marker of reactive and mature astrocytes, and by the production of nitric oxide (NO). We observed that astrocytes exposed to 3 microg/ml TAE, F29/30 or F31/33 developed compact cell body with many processes overexpressing GFAP. Treatment with 30 microg/ml TAE and fractions, induced cytotoxicity characterized by a strong cell body contraction, very thin and long processes and condensed chromatin. We also observed that when compared with the control (+/-1.34%), the proportion of OX-42 positive cells was increased in cultures treated with 30 microg/ml TAE or F29/30, F31/33, F32 and F34/35, with values raging from 7.27% to 28.74%. Moreover, incubation with 3 microg/ml F32, 30 microg/ml TAE, F29/30, F31/33 or F34/35 induced accumulation of nitrite in culture medium indicating induction of NO production. Taken together these results show that TAE and fractionated alkaloids from P. juliflora act directly on glial cells, inducing activation and/or cytotoxicity, stimulating NO production, and may have an impact on neuronal

  4. Inhibition of clone formation as an assay for T cell-mediated cytotoxicity: short-term kinetics and comparison with 51Cr release

    International Nuclear Information System (INIS)

    Lees, R.K.; MacDonald, H.R.; Sinclair, N.R.; University of Western Ontario London

    1977-01-01

    The short-term kinetics of T cell-mediated cytotoxicity was investigated using a cloning inhibition assay. Murine cytotoxic thymus-derived lymphocytes generated in vitro in mixed leukocyte cultures were incubated for various periods of time at 37degC with allogeneic mastocytoma target cells. The mixtures were then plated in soft agar, and mastocytoma clone formation was assessed after 5-7 days incubation. Using this technique, it was demonstrated that events leading to the loss of cloning ability could be detected after 1-3 min incubation at 37degC, and after 20-30 min, 95% of the clone forming cells had been inactivated. When these results were compared directly with those obtained using the conventional 51 Cr-release assay, it was found that the events leading to loss of cloning ability occurred more rapidly than indicated by the isotope assay. However, a modification of the 51 Cr-release assay involving EDTA addition gave comparable result to the cloning inhibition assay. These results raise the possibility that the events leading to 51 Cr-release of tumor target cells may be related in time to those leading to the loss of cloning ability

  5. Cytocompatibility, cytotoxicity and genotoxicity analysis of dental implants

    Science.gov (United States)

    Reigosa, M.; Labarta, V.; Molinari, G.; Bernales, D.

    2007-11-01

    Several types of materials are frequently used for dental prostheses in dental medicine. Different treatments with titanium are the most used. The aim of the present study was to analyze by means of cytotoxicity and cytocompatibility techniques the capacity of dental implants to integrate to the bone tissue. Cultures of UMR 106 cell line derived from an osteosarcoma were used for bioassays mainly because they show many of the properties of osteoblasts. Dental implant samples provided by B&W company were compared with others of recognized trademarks. The first ones contain ASTM titanium (8348 GR2) with acid printing. Cytotoxicity was analyzed by means of lysosome activity, using the neutral red technique and alkaline phosphatase enzyme activity. Cell variability was determined by means of the acridine ethidium-orange bromide technique. One-way ANOVA and Bonferroni and Duncan post-ANOVA tests were used for the statistical analysis. The assays did not show significant differences among the dental implants analyzed. Our findings show that the dental prostheses studied present high biocompatibility, quantified by the bioassays performed. The techniques employed revealed that they can be a useful tool for the analysis of other materials for dental medicine use.

  6. Cytocompatibility, cytotoxicity and genotoxicity analysis of dental implants

    International Nuclear Information System (INIS)

    M, Reigosa; V, Labarta; G, Molinari; D, Bernales

    2007-01-01

    Several types of materials are frequently used for dental prostheses in dental medicine. Different treatments with titanium are the most used. The aim of the present study was to analyze by means of cytotoxicity and cytocompatibility techniques the capacity of dental implants to integrate to the bone tissue. Cultures of UMR 106 cell line derived from an osteosarcoma were used for bioassays mainly because they show many of the properties of osteoblasts. Dental implant samples provided by B and W company were compared with others of recognized trademarks. The first ones contain ASTM titanium (8348 GR2) with acid printing. Cytotoxicity was analyzed by means of lysosome activity, using the neutral red technique and alkaline phosphatase enzyme activity. Cell variability was determined by means of the acridine ethidium-orange bromide technique. One-way ANOVA and Bonferroni and Duncan post-ANOVA tests were used for the statistical analysis. The assays did not show significant differences among the dental implants analyzed. Our findings show that the dental prostheses studied present high biocompatibility, quantified by the bioassays performed. The techniques employed revealed that they can be a useful tool for the analysis of other materials for dental medicine use

  7. Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.

    Science.gov (United States)

    Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M

    2013-09-01

    Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Reducing the cytotoxicity of inhalable engineered nanoparticles via in situ passivation with biocompatible materials.

    Science.gov (United States)

    Byeon, Jeong Hoon; Park, Jae Hong; Peters, Thomas M; Roberts, Jeffrey T

    2015-07-15

    The cytotoxicity of model welding nanoparticles was modulated through in situ passivation with soluble biocompatible materials. A passivation process consisting of a spark discharge particle generator coupled to a collison atomizer as a co-flow or counter-flow configuration was used to incorporate the model nanoparticles with chitosan. The tested model welding nanoparticles are inhaled and that A549 cells are a human lung epithelial cell line. Measurements of in vitro cytotoxicity in A549 cells revealed that the passivated nanoparticles had a lower cytotoxicity (>65% in average cell viability, counter-flow) than the untreated model nanoparticles. Moreover, the co-flow incorporation between the nanoparticles and chitosan induced passivation of the nanoparticles, and the average cell viability increased by >80% compared to the model welding nanoparticles. As a more convenient way (additional chitosan generation and incorporation devices may not be required), other passivation strategies through a modification of the welding rod with chitosan adhesive and graphite paste did also enhance average cell viability (>58%). The approach outlined in this work is potentially generalizable as a new platform, using only biocompatible materials in situ, to treat nanoparticles before they are inhaled. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants.

    Science.gov (United States)

    Alves, Celha Borges Costa; Segurado, Márcio Nunes; Dorta, Miriam Cristina Leandro; Dias, Fátima Ribeiro; Lenza, Maurício Guilherme; Lenza, Marcos Augusto

    2016-01-01

    To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Six mini-implants (Conexão(tm), Neodent(tm) and SIN(tm)) were separately immersed in artificial saliva (pH 6.76) for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM). The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p < 0.05 considered significant. Statistical analysis was carried out with Graph Pad PRISM software Version 4.0. No changes in cell viability or morphology were observed. Mini-implants SEM images revealed smooth surfaces with no obvious traces of corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Orthodontic mini-implants manufactured by Conexão(tm), Neodent(tm) and SIN(tm) present high corrosion resistance and are not cytotoxic.

  10. Effect of Light Irradiation and Sex Hormones on Jurkat T Cells: 17β-Estradiol but Not Testosterone Enhances UVA-Induced Cytotoxicity in Jurkat Lymphocytes

    Directory of Open Access Journals (Sweden)

    Michael F. Angel

    2005-04-01

    Full Text Available In Eastern cultures, such as India, it is traditionally recommended that women but not men cover their heads while working in the scorching sun. The purpose of this pilot study was to determine whether there was any scientific basis for this cultural tradition. We examined the differential cytotoxic effects of ultraviolet A light (UVA on an established T cell line treated with female and male sex hormones. CD4+ Jurkat T cells were plated in 96 well plates at 2 x 106 cells/ml and treated with 17β-estradiol (EST or testosterone (TE. These cells were irradiated by UVA light with an irradiance of 170 J/cm2 for 15min at a distance of 6 cm from the surface of the 96-well plate. Controls included cells not treated with hormones or UVA. The effects of EST and TE were investigated between 1 and 20 ng/mL. Cytotoxicity by fluorescein-diacetate staining and COMET assay generating single strand DNA cleavage, tail length and tail moment measurements were examined. The effect of estrogen (5ng/mL on apoptosis and its mediators was further studied using DNA laddering and western blotting for bcl-2 and p53. We found that EST alone, without UVA, enhanced Jurkat T cell survival. However, EST exhibited a dose-related cytotoxicity in the presence of UVA; up to 28% at 20 ng/ml. TE did not alter UVA-induced cytotoxicity. Since TE did not alter cell viability in the presence of UVA further damaging studies were not performed. COMET assay demonstrated the harmful effects of EST in the presence of UVA while EST without UVA had no significant effect on the nuclear damage. Apoptosis was not present as indicated by the absence of DNA laddering on agarose gel electrophoresis at 5ng/ml EST or TE ± UVA. Western blot showed that estrogen down regulated bcl-2 independently of UVA radiation while p53 was down regulated in the presence of UVA treatment. EST and TE have differential effects on UVA-induced cytotoxicity in Jurkat T-lymphocyte which suggested that women

  11. Engineering of dendrimer surfaces to enhance transepithelial transport and reduce cytotoxicity.

    Science.gov (United States)

    Jevprasesphant, Rachaneekorn; Penny, Jeffrey; Attwood, David; McKeown, Neil B; D'Emanuele, Antony

    2003-10-01

    To evaluate the cytotoxicity, permeation, and transport mechanisms of PAMAM dendrimers and surface-modified cationic PAMAM dendrimers using monolayers of the human colon adenocarcinoma cell line, Caco-2. Cytotoxicity was determined using the MTT assay. The effect of dendrimers on monolayer integrity was determined from measurements of transepithelial electrical resistance (TEER) and [14C]mannitol apparent permeability coefficient (Papp). The Papp of dendrimers through monolayers was measured in both the apical (A)-to-basolateral (B) and B --> A directions at 4 degrees C and 37 degrees C and also in the presence and absence of ethylenediamine tetraacetic acid (EDTA) and colchicine. The cytotoxicity and permeation of dendrimers increased with both concentration and generation. The cytotoxicity of cationic dendrimers (G2, G3, G4) was greater than that of anionic dendrimers (G2.5, G3.5) but was reduced by conjugation with lauroyl chloride: the least cytotoxic conjugates were those with six attached lauroyl chains. At 37 degrees C the Papp of cationic dendrimers was higher than that of anionic dendrimers and, in general, increased with the number of attached lipid chains. Cationic dendrimers decreased TEER and significantly increased the Papp of mannitol. Modified dendrimers also reduced TEER and caused a more marked increase in the Papp of mannitol. The Papp values of dendrimers and modified dendrimers were higher in the presence of EDTA, lower in the presence of colchicine, and lower at 4 degrees C than at 37 degrees C. The properties of dendrimers may be significantly modified by surface engineering. Conjugation of cationic PAMAM dendrimers with lauroyl chloride decreased their cytotoxicity and increased their permeation through Caco-2 cell monolayers. Both PAMAM dendrimers and lauroyl-PAMAM dendrimer conjugates can cross epithelial monolayers by paracellular and transcellular pathways.

  12. Comparative microstructures and cytotoxicity assays for ballistic aerosols composed of micrometals and nanometals: respiratory health implications

    Science.gov (United States)

    Machado, Brenda I; Suro, Raquel M; Garza, Kristine M; Murr, Lawrence E

    2011-01-01

    Aerosol particulates collected on filters from ballistic penetration and erosion events for W–Ni–Co and W–Ni–Fe kinetic energy rod projectiles penetrating steel target plates were observed to be highly cytotoxic to human epithelial A549 lung cells in culture after 48 hours of exposure. The aerosol consisted of micron-sized Fe particulates and nanoparticulate aggregates consisting of W, Ni or W, Co, and some Fe, characterized by scanning electron microscopy and transmission electron microscopy, and using energy-dispersive (X-ray) spectrometry for elemental analysis and mapping. Cytotoxic assays of manufactured micron-sized and nanosized metal particulates of W, Ni, Fe, and Co demonstrated that, consistent with many studies in the literature, only the nanoparticulate elements demonstrated measurable cytotoxicity. These results suggest the potential for very severe, short-term, human toxicity, in particular to the respiratory system on inhaling ballistic aerosols. PMID:21499416

  13. Cisplatin Induces a Mitochondrial-ROS Response That Contributes to Cytotoxicity Depending on Mitochondrial Redox Status and Bioenergetic Functions

    Science.gov (United States)

    Marullo, Rossella; Werner, Erica; Degtyareva, Natalya; Moore, Bryn; Altavilla, Giuseppe; Ramalingam, Suresh S.; Doetsch, Paul W.

    2013-01-01

    Cisplatin is one of the most effective and widely used anticancer agents for the treatment of several types of tumors. The cytotoxic effect of cisplatin is thought to be mediated primarily by the generation of nuclear DNA adducts, which, if not repaired, cause cell death as a consequence of DNA replication and transcription blockage. However, the ability of cisplatin to induce nuclear DNA (nDNA) damage per se is not sufficient to explain its high degree of effectiveness nor the toxic effects exerted on normal, post-mitotic tissues. Oxidative damage has been observed in vivo following exposure to cisplatin in several tissues, suggesting a role for oxidative stress in the pathogenesis of cisplatin-induced dose-limiting toxicities. However, the mechanism of cisplatin-induced generation of ROS and their contribution to cisplatin cytotoxicity in normal and cancer cells is still poorly understood. By employing a panel of normal and cancer cell lines and the budding yeast Saccharomyces cerevisiae as model system, we show that exposure to cisplatin induces a mitochondrial-dependent ROS response that significantly enhances the cytotoxic effect caused by nDNA damage. ROS generation is independent of the amount of cisplatin-induced nDNA damage and occurs in mitochondria as a consequence of protein synthesis impairment. The contribution of cisplatin-induced mitochondrial dysfunction in determining its cytotoxic effect varies among cells and depends on mitochondrial redox status, mitochondrial DNA integrity and bioenergetic function. Thus, by manipulating these cellular parameters, we were able to enhance cisplatin cytotoxicity in cancer cells. This study provides a new mechanistic insight into cisplatin-induced cell killing and may lead to the design of novel therapeutic strategies to improve anticancer drug efficacy. PMID:24260552

  14. Prevention of phosphine-induced cytotoxicity by nutrients in HepG2 cells

    Directory of Open Access Journals (Sweden)

    Marzieh Rashedinia

    2016-01-01

    Interpretation & conclusions: The results supported the hypothesis that phosphine-induced cytotoxicity was due to decrease of ATP levels. ATP suppliers could prevent its toxicity by generating ATP through glycolysis. α-keto compounds such as dihydroxyacetone and α-ketoglutarate may bind to phosphine and restore mitochondrial respiration.

  15. Factors influencing the cytotoxicity of zinc oxide nanoparticles: particle size and surface charge

    International Nuclear Information System (INIS)

    Baek, M; Kim, M K; Cho, H J; Lee, J A; Yu, J; Chung, H E; Choi, S J

    2011-01-01

    Zinc oxide (ZnO) nanoparticle is one of the most important materials in diverse applications, since it has UV light absorption, antimicrobial, catalytic, semi-conducting, and magnetic properties. However, there is little information about the toxicological effects of ZnO nanoparticles with respect to physicochemical properties. The aim of this study was, therefore, to evaluate the relationships between cytotoxicity and physicochemical properties of ZnO nanoparticle such as particle size and surface charge in human lung cells. Two different sizes of ZnO nanoparticles (20 and 70 nm) were prepared with positive (+) or negative (-) charge, and then, cytotoxicity of different ZnO nanoparticles was evaluated by measuring cell proliferation in short-term and long-term, membrane integrity, and generation of reactive oxygen species (ROS). The results demonstrated that smaller particles exhibited high cytotoxic effects compared to larger particles in terms of inhibition of cell proliferation, membrane damage, and ROS generation. In addition, positively charged ZnO showed greater ROS production than ZnO with negative charge. These findings suggest that the cytoxicity of ZnO nanoparticles are strongly affected by their particle size and surface charge, highlighting the role of the physicochemical properties of nanoparticles to understand and predict their potential adverse effects on human.

  16. Factors influencing the cytotoxicity of zinc oxide nanoparticles: particle size and surface charge

    Energy Technology Data Exchange (ETDEWEB)

    Baek, M; Kim, M K; Cho, H J; Lee, J A; Yu, J; Chung, H E; Choi, S J, E-mail: sjchoi@swu.ac.kr [Department of Food Science and Technology, Seoul Women' s University, 126 Gongneung 2-dong, Nowon-gu, Seoul 139-774 (Korea, Republic of)

    2011-07-06

    Zinc oxide (ZnO) nanoparticle is one of the most important materials in diverse applications, since it has UV light absorption, antimicrobial, catalytic, semi-conducting, and magnetic properties. However, there is little information about the toxicological effects of ZnO nanoparticles with respect to physicochemical properties. The aim of this study was, therefore, to evaluate the relationships between cytotoxicity and physicochemical properties of ZnO nanoparticle such as particle size and surface charge in human lung cells. Two different sizes of ZnO nanoparticles (20 and 70 nm) were prepared with positive (+) or negative (-) charge, and then, cytotoxicity of different ZnO nanoparticles was evaluated by measuring cell proliferation in short-term and long-term, membrane integrity, and generation of reactive oxygen species (ROS). The results demonstrated that smaller particles exhibited high cytotoxic effects compared to larger particles in terms of inhibition of cell proliferation, membrane damage, and ROS generation. In addition, positively charged ZnO showed greater ROS production than ZnO with negative charge. These findings suggest that the cytoxicity of ZnO nanoparticles are strongly affected by their particle size and surface charge, highlighting the role of the physicochemical properties of nanoparticles to understand and predict their potential adverse effects on human.

  17. Effective collaboration between marginal metallophilic macrophages and CD8+ dendritic cells in the generation of cytotoxic T cells

    Science.gov (United States)

    Backer, Ronald; Schwandt, Timo; Greuter, Mascha; Oosting, Marije; Jüngerkes, Frank; Tüting, Thomas; Boon, Louis; O’Toole, Tom; Kraal, Georg; Limmer, Andreas; den Haan, Joke M. M.

    2009-01-01

    The spleen is the lymphoid organ that induces immune responses toward blood-borne pathogens. Specialized macrophages in the splenic marginal zone are strategically positioned to phagocytose pathogens and cell debris, but are not known to play a role in the activation of T-cell responses. Here we demonstrate that splenic marginal metallophilic macrophages (MMM) are essential for cross-presentation of blood-borne antigens by splenic dendritic cells (DCs). Our data demonstrate that antigens targeted to MMM as well as blood-borne adenoviruses are efficiently captured by MMM and exclusively transferred to splenic CD8+ DCs for cross-presentation and for the activation of cytotoxic T lymphocytes. Depletion of macrophages in the marginal zone prevents cytotoxic T-lymphocyte activation by CD8+ DCs after antibody targeting or adenovirus infection. Moreover, we show that tumor antigen targeting to MMM is very effective as antitumor immunotherapy. Our studies point to an important role for splenic MMM in the initial steps of CD8+ T-cell immunity by capturing and concentrating blood-borne antigens and the transfer to cross-presenting DCs which can be used to design vaccination strategies to induce antitumor cytotoxic T-cell immunity. PMID:20018690

  18. The Psychological Aspect of Safety Culture: Application of the Theory of Generations for the Formation of Safety Culture Among Personnel

    International Nuclear Information System (INIS)

    Melnitckaia, T.B.

    2016-01-01

    The formation of safety culture is an attempt of constructive influence on the socio psychological atmosphere of the team and the behavior of employees. By way of creating specific settings, the value system for the organization staff as part of the organizational culture, it is possible to forecast, plan and promote the desired behavior. However, it is necessary to take into account the corporate culture spontaneously established in the organization. The leaders often try to establish a safety culture, where the progressive values, norms are declared, and the results obtained are not those expected. This is partly because the organizational norms and values implemented come into conflict with reality and, therefore, are actively rejected by many members of the organization. The theory of generations developed by the American scientists (N. Howe, W. Strauss) helps in the analysis and consideration of the staff values formed under the influence of many factors, depending on the age of employees, in the course of safety culture formation. (author)

  19. On-chip gradient generation in 256 microfluidic cell cultures: simulation and experimental validation.

    Science.gov (United States)

    Somaweera, Himali; Haputhanthri, Shehan O; Ibraguimov, Akif; Pappas, Dimitri

    2015-08-07

    A microfluidic diffusion diluter was used to create a stable concentration gradient for dose response studies. The microfluidic diffusion diluter used in this study consisted of 128 culture chambers on each side of the main fluidic channel. A calibration method was used to find unknown concentrations with 12% error. Flow rate dependent studies showed that changing the flow rates generated different gradient patterns. Mathematical simulations using COMSOL Multi-physics were performed to validate the experimental data. The experimental data obtained for the flow rate studies agreed with the simulation results. Cells could be loaded into culture chambers using vacuum actuation and cultured for long times under low shear stress. Decreasing the size of the culture chambers resulted in faster gradient formation (20 min). Mass transport into the side channels of the microfluidic diffusion diluter used in this study is an important factor in creating the gradient using diffusional mixing as a function of the distance. To demonstrate the device's utility, an H2O2 gradient was generated while culturing Ramos cells. Cell viability was assayed in the 256 culture chambers, each at a discrete H2O2 concentration. As expected, the cell viability for the high concentration side channels increased (by injecting H2O2) whereas the cell viability in the low concentration side channels decreased along the chip due to diffusional mixing as a function of distance. COMSOL simulations were used to identify the effective concentration of H2O2 for cell viability in each side chamber at 45 min. The gradient effects were confirmed using traditional H2O2 culture experiments. Viability of cells in the microfluidic device under gradient conditions showed a linear relationship with the viability of the traditional culture experiment. Development of the microfluidic device used in this study could be used to study hundreds of concentrations of a compound in a single experiment.

  20. Specific inhibition of cytotoxic memory cells produced against uv-induced tumors in uv-irradiation mice

    International Nuclear Information System (INIS)

    Thorn, R.M.

    1978-01-01

    Cytotoxic responses of uv-irradiated mice against syngeneic uv-induced tumors were measured by using a 51 Cr-release assay to determine if uv treatment induced a specific reduction of cytotoxic activity. The in vivo and in vitro primary responses against syngeneic tumors and allogeneic cells were unaffected, as was the ''memory'' response (in vivo stimulation, in vitro restimulation) against alloantigens. In contrast, the memory response of uv-treated mice against syngeneic, uv-induced tumors was consistently and significantly depressed. The cytotoxicity generated by tumor cell stimulation in vivo or in vitro was tumor-specific and T cell-dependent. Since the primary response against syngeneic uv-induced tumors produces apparently normal amounts of tumor-specific cytotoxic activity, uv-treated mice may not reject transplanted syngeneic tumors because of too few T effector memory cells. These results imply that, at least in this system, tumor rejection depends mostly on the secondary responses against tumor antigens and that at least one carcinogen can, indirectly, specifically regulate immune responses

  1. Selective cytotoxicity of an oxygen-radical-generating enzyme conjugated to a monoclonal antibody.

    Science.gov (United States)

    Battelli, M G; Abbondanza, A; Tazzari, P L; Dinota, A; Rizzi, S; Grassi, G; Gobbi, M; Stirpe, F

    1988-07-01

    The monoclonal antibody 8A, which recognizes a human plasma cell-associated antigen, was covalently linked to xanthine oxidase in a conjugate maintaining both immunological and enzymatic properties. A significant degree of target cell lysis was obtained at an enzyme concentration that was ineffective on non-target cells and on myeloid staminal cells (CFU-GM). The cytotoxic activity was abolished by an excess of antibody, by allopurinol and by superoxide dismutase and catalase. A possible use of the conjugate for bone marrow purging in multiple myeloma patients is suggested.

  2. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  3. Synthesis of geranylhydroquinone derivatives with potential cytotoxic activity

    Energy Technology Data Exchange (ETDEWEB)

    Baeza, Evelyn; Catalan, Karen; Pena-Cortes, Hugo; Espinoza, Luis, E-mail: luis.espinozac@usm.cl [Departamento de Quimica, Universidad Tecnica Federico Santa Maria, Valparaiso (Chile); Villena, Joan [Facultad de Medicina, Universidad de Valparaiso, Centro Regional de Estudios en Alimentos Saludables, Valparaiso (Chile); Carrasco, Hector [Departamento de Ciencias Quimicas, Universidad Andres Bello, Campus Vina del Mar (Chile)

    2012-07-01

    Natural geranylhydroquinone 1 and geranyl-p-methoxyphenol 2 were prepared by Electrophilic Aromatic Substitution (EAS) reactions between geraniol and 1,4-hydroquinone or p-methoxyphenol respectively, using BF{sub 3} {center_dot}Et{sub 2}O as a catalyst. Furthermore, natural geranylquinone 3, geranyl-1,4-dimethoxyquinone 4 and the new geranyl-4-methoxyphenyl acetate 5 were obtained by chemical transformations of 1 and 2. The compounds were evaluated for their in vitro cytotoxicity activities against cultured human cancer cells of PC-3 human prostate cancer, MCF-7 and MDA-MB-231 breast carcinoma, and Dermal Human ibroblasts DHF. IC{sub 50} values were in the {mu}M range. (author)

  4. Assessment of long-term effects of nanoparticles in a microcarrier cell culture system.

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    Full Text Available Nano-sized materials could find multiple applications in medical diagnosis and therapy. One main concern is that engineered nanoparticles, similar to combustion-derived nanoparticles, may cause adverse effects on human health by accumulation of entire particles or their degradation products. Chronic cytotoxicity must therefore be evaluated. In order to perform chronic cytotoxicity testing of plain polystyrene nanoparticles on the endothelial cell line EAhy 926, we established a microcarrier cell culture system for anchorage-dependent cells (BioLevitator(TM. Cells were cultured for four weeks and exposed to doses, which were not cytotoxic upon 24 hours of exposure. For comparison, these particles were also studied in regularly sub-cultured cells, a method that has traditionally been used to assess chronic cellular effects. Culturing on basal membrane coated microcarriers produced very high cell densities. Fluorescent particles were mainly localized in the lysosomes of the exposed cells. After four weeks of exposure, the number of cells exposed to 20 nm polystyrene particles decreased by 60% as compared to untreated controls. When tested in sub-cultured cells, the same particles decreased cell numbers to 80% of the untreated controls. Dose-dependent decreases in cell numbers were also noted after exposure of microcarrier cultured cells to 50 nm short multi-walled carbon nanotubes. Our findings support that necrosis, but not apoptosis, contributed to cell death of the exposed cells in the microcarrier culture system. In conclusion, the established microcarrier model appears to be more sensitive for the identification of cellular effects upon prolonged and repeated exposure to nanoparticles than traditional sub-culturing.

  5. Establishment of a Novel Lingual Organoid Culture System: Generation of Organoids Having Mature Keratinized Epithelium from Adult Epithelial Stem Cells

    Science.gov (United States)

    Hisha, Hiroko; Tanaka, Toshihiro; Kanno, Shohei; Tokuyama, Yoko; Komai, Yoshihiro; Ohe, Shuichi; Yanai, Hirotsugu; Omachi, Taichi; Ueno, Hiroo

    2013-11-01

    Despite the strong need for the establishment of a lingual epithelial cell culture system, a simple and convenient culture method has not yet been established. Here, we report the establishment of a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Histological analyses showed that the generated organoids had both a stratified squamous epithelial cell layer and a stratum corneum. Very recently, we showed via a multicolor lineage tracing method that Bmi1-positive stem cells exist at the base of the epithelial basal layer in the interpapillary pit. Using our new culture system, we found that organoids could be generated by single Bmi1-positive stem cells and that in the established organoids, multiple Bmi1-positive stem cells were generated at the outermost layer. Moreover, we observed that organoids harvested at an early point in culture could be engrafted and maturate in the tongue of recipient mice and that the organoids generated from carcinogen-treated mice had an abnormal morphology. Thus, this culture system presents valuable settings for studying not only the regulatory mechanisms of lingual epithelium but also lingual regeneration and carcinogenesis.

  6. Effects of serum on cytotoxicity of nano- and micro-sized ZnO particles

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, I-Lun; Huang, Yuh-Jeen, E-mail: yjhuang@mx.nthu.edu.tw [National Tsing Hua University, Department of Biomedical Engineering and Environmental Sciences (China)

    2013-09-15

    Although an increasing number of in vitro studies are being published regarding the cytotoxicity of nanomaterials, the components of the media for toxicity assays have often varied according to the needs of the scientists. Our aim for this study was to evaluate the influence of serum-in this case, fetal bovine serum-in a cell culture medium on the toxicity of nano-sized (50-70 nm) and micro-sized (<1 {mu}m) ZnO on human lung epithelial cells (A549). The nano- and micro-sized ZnO both exhibited their highest toxicity when exposed to serum-free media, in contrast to exposure in media containing 5 or 10 % serum. This mainly comes not only from the fact that ZnO particles in the serum-free media have a higher dosage-per-cell ratio, which results from large aggregates of particles, rapid sedimentation, absence of protein protection, and lower cell growth rate, but also that extracellular Zn{sup 2+} release contributes to cytotoxicity. Although more extracellular Zn{sup 2+} release was observed in serum-containing media, it did not contribute to nano-ZnO cytotoxicity. Furthermore, non-dissolved particles underwent size-dependent particle agglomeration, resulting in size-dependent toxicity in both serum-containing and serum-free media. A low correlation between cytotoxicity and inflammation endpoints in the serum-free medium suggested that some signaling pathways were changed or induced. Since cell growth, transcription behavior for protein production, and physicochemical properties of ZnO particles all were altered in serum-free media, we recommend the use of a serum-containing medium when evaluating the cytotoxicity of NPs.

  7. Organotypic slice cultures containing the preBötzinger complex generate respiratory-like rhythms

    DEFF Research Database (Denmark)

    Phillips, Wiktor S; Herly, Mikkel; Del Negro, Christopher A

    2016-01-01

    containing the preBötzinger complex (preBötC), the core inspiratory rhythm generator of the ventrolateral brainstem. We measured bilateral synchronous network oscillations, using calcium-sensitive fluorescent dyes, in both ventrolateral (presumably the preBötC) and dorsomedial regions of 7-43 days in vitro......Acute brainstem slice preparations in vitro have advanced understanding of the cellular and synaptic mechanisms of respiratory rhythm generation, but their inherent limitations preclude long-term manipulation and recording experiments. Here, we developed an organotypic slice culture preparation...... of the brainstem displayed up to 193% faster burst frequency (22.4 ± 8.3 bursts/min) and higher signal amplitude (340%) compared to acute slices. We conclude that preBötC-containing slice cultures retain inspiratory-like rhythmic function and therefore may facilitate lines of experimentation that involve extended...

  8. The cytotoxicity evaluation of magnetic iron oxide nanoparticles on human aortic endothelial cells

    Science.gov (United States)

    Ge, Gaoyuan; Wu, Hengfang; Xiong, Fei; Zhang, Yu; Guo, Zhirui; Bian, Zhiping; Xu, Jindan; Gu, Chunrong; Gu, Ning; Chen, Xiangjian; Yang, Di

    2013-05-01

    One major obstacle for successful application of nanoparticles in medicine is its potential nanotoxicity on the environment and human health. In this study, we evaluated the cytotoxicity effect of dimercaptosuccinic acid-coated iron oxide (DMSA-Fe2O3) using cultured human aortic endothelial cells (HAECs). Our results showed that DMSA-Fe2O3 in the culture medium could be absorbed into HAECs, and dispersed in the cytoplasm. The cytotoxicity effect of DMSA-Fe2O3 on HAECs was dose-dependent, and the concentrations no more than 0.02 mg/ml had little toxic effect which were revealed by tetrazolium dye assay. Meanwhile, the cell injury biomarker, lactate dehydrogenase, was not significantly higher than that from control cells (without DMSA-Fe2O3). However, the endocrine function for endothelin-1 and prostacyclin I-2, as well as the urea transporter function, was altered even without obvious evidence of cell injury in this context. We also showed by real-time PCR analysis that DMSA-Fe2O3 exposure resulted in differential effects on the expressions of pro- and anti-apoptosis genes of HAECs. Meanwhile, it was noted that DMSA-Fe2O3 exposure could activate the expression of genes related to oxidative stress and adhesion molecules, which suggested that inflammatory response might be evoked. Moreover, we demonstrated by in vitro endothelial tube formation that even a small amount of DMSA-Fe2O3 (0.01 and 0.02 mg/ml) could inhibit angiogenesis by the HAECs. Altogether, these results indicate that DMSA-Fe2O3 have some cytotoxicity that may cause side effects on normal endothelial cells.

  9. Flow cytometric assay detecting cytotoxicity against human endogenous retrovirus antigens expressed on cultured multiple sclerosis cells

    DEFF Research Database (Denmark)

    Møller-Larsen, A; Brudek, T; Petersen, T

    2013-01-01

    on their surface. Polyclonal antibodies against defined peptides in the Env- and Gag-regions of the HERVs were raised in rabbits and used in antibody-dependent cell-mediated cytotoxicity (ADCC) -assays. Rituximab® (Roche), a chimeric monoclonal antibody against CD20 expressed primarily on B cells, was used...

  10. Analysis of cytotoxic effects of chlorhexidine gluconate as antiseptic agent on human blood lymphocytes.

    Science.gov (United States)

    Salimi, Ahmad; Alami, Bahare; Pourahmad, Jalal

    2017-08-01

    The aim of this study was to assess the cytotoxicity of chlorhexidine gluconate (CHG) on human blood lymphocytes as a useful ex vivo model for accelerated human toxicity studies. Using biochemical and flow cytometry assessments, we demonstrated that addition of CHG at 1 μM concentration to human blood lymphocytes induced cytotoxicity following 6 h. The CHG-induced cytotoxicity on human blood lymphocytes was associated with intracellular reactive oxygen species generation, mitochondrial membrane potential collapse, lysosomal membrane injury, lipid peroxidation, and depletion of glutathione. According to our results, CHG triggers oxidative stress and organelles damages in lymphocytes which are important cells in defense against foreign agents. Finally our findings suggest that using of antioxidants and mitochondrial/lysosomal protective agents could be of benefit for the people in the exposure with CHG. © 2017 Wiley Periodicals, Inc.

  11. Cytotoxic Effects of Alcoholic Extract of Dorema Glabrum Seed on Cancerous Cells Viability

    Directory of Open Access Journals (Sweden)

    Maryam Bannazadeh Amirkhiz

    2013-08-01

    Full Text Available Purpose: In the present study cytotoxic effects of the alcoholic extract of Dorema Glabrum seed on viability of WEHI-164 cells, mouse Fibrosarcoma cell line and L929 normal cells were compared with the cytotoxic effects of Taxol (anticancer and apoptosis inducer drug. Methods: To find out the plant extract cytotoxic effects, MTT test and DNA fragmentation assay, the biochemical hallmark of apoptosis were performed on cultured and treated cells. Results: According to the findings the alcoholic extract of Dorema Glabrum seed can alter cells morphology and because of chromatin condensation and other changes they shrink and take a spherical shape, and lose their attachment too. So the plant extract inhibits cell growth albeit in a time and dose dependent manner and results in degradation of chromosomal DNA. Conclusion: Our data well established the anti-proliferative effect of methanolic extract of Dorema Glabrum seed and clearly showed that the plant extract can induce apoptosis and not necrosis in vitro, but the mechanism of its activities remained unknown. These results demonstrated that Dorema Glabrum seed might be a novel and attractive therapeutic candidate for tumor treatment in clinical practices.

  12. Relative cytotoxicity of complexes of platinum(II and palladium(II against pure cell culture Paramecium caudatum and human cell lines A431 and HaCaT

    Directory of Open Access Journals (Sweden)

    Aleksei Vladimirovich Eremin

    2018-04-01

    Full Text Available The results of cytotoxicity cisplatin-like complexes of platinum(II and palladium(II are presented. The cytotoxicity was researched by method of  biotesting with Paramecium caudatum and by MTT-assay with human cells: epidermoid carcimoma A431 and minimal transformed aneuploid keratinocytes HaCaT. Cytotoxicity of complexes toward protists is high, however, comparatively HaCaT are more sensitive than A431. Furthemore, cytotoxicity of palladium(II complexes is higher than the analogues with platinum(II.

  13. Natural lipids in nanostructured lipid carriers and its cytotoxicity

    Science.gov (United States)

    Lima, Paula A.; Rampazo, Caroline A. D.; Costa, Amanda F.; Rodrigues, Tiago; Watashi, Carolina M.; Durán, Nelson

    2017-06-01

    Nanostructured lipid carriers (NLCs) are active carrier systems which modulate the sustained release of actives and protect unstable compounds against degradation. NLCs can also protect skin from sun light, due to its particulates nature, which gives them intrinsic scattering properties. In this work, we present the preparation of NLCs using natural lipids and its cytotoxicity profile. It was used a vegetal butter with melting point (m.p.) ~32-40°C, an animal wax (m.p. 35-40°C) and a vegetal oil (boiling point ~120-150°C). NLCs were prepared by hot high pressure homogenization method and particles were characterized by average size (Zave), polydispersity index (PDI) and zeta potential (PZ) (Fig.1). The thermal behavior of the NLCs was studied using Differential Scanning Calorimetry (DSC). All the formulations were followed up for 60 days in order to evaluate their stability. NLCs exhibited a Zave around 150-200 nm, PDI less than 0.2 and PZ varying from -25 to -40 mV. The m.p. for the lyophilized NLCs was about 40-56°C. Cytotoxicity of the formulations were evaluated for human keratinocytes (HaCaT) and melanocytes (Melan-A) in the exponential growth phase. Cell viability was used as indicator of cytotoxicity and determined after 4 days of culture by MTT assay. It was found that the NLC formulations were not toxic against HaCaT and Melan-A cells. Results showed that the NLCs produced are potential carriers for nanocosmetics and sunscreen products.

  14. Neuroprotective Effect of Puerarin on Glutamate-Induced Cytotoxicity in Differentiated Y-79 Cells via Inhibition of ROS Generation and Ca(2+) Influx.

    Science.gov (United States)

    Wang, Ke; Zhu, Xue; Zhang, Kai; Wu, Zhifeng; Sun, Song; Zhou, Fanfan; Zhu, Ling

    2016-07-11

    Glutamate toxicity is estimated to be the key cause of photoreceptor degeneration in the pathogenesis of retinal degenerative diseases. Oxidative stress and Ca(2+) influx induced by glutamate are responsible for the apoptosis process of photoreceptor degeneration. Puerarin, a primary component of Kudzu root, has been widely used in the clinical treatment of retinal degenerative diseases in China for decades; however, the detailed molecular mechanism underlying this effect remains unclear. In this study, the neuroprotective effect of puerarin against glutamate-induced cytotoxicity in the differentiated Y-79 cells was first investigated through cytotoxicity assay. Then the molecular mechanism of this effect regarding anti-oxidative stress and Ca(2+) hemostasis was further explored with indirect immunofluorescence, flow cytometric analysis and western blot analysis. Our study showed that glutamate induced cell viability loss, excessive reactive oxygen species (ROS) generation, calcium overload and up-regulated cell apoptosis in differentiated Y-79 cells, which effect was significantly attenuated with the pre-treatment of puerarin in a dose-dependent manner. Furthermore, our data indicated that the neuroprotective effect of puerarin was potentially mediated through the inhibition of glutamate-induced activation of mitochondrial-dependent signaling pathway and calmodulin-dependent protein kinase II (CaMKII)-dependent apoptosis signal-regulating kinase 1(ASK-1)/c-Jun N-terminal kinase (JNK)/p38 signaling pathway. The present study supports the notion that puerarin may be a promising neuroprotective agent in the prevention of retinal degenerative diseases.

  15. Molecular cytotoxic mechanisms of anticancer hydroxychalcones.

    Science.gov (United States)

    Sabzevari, Omid; Galati, Giuseppe; Moridani, Majid Y; Siraki, Arno; O'Brien, Peter J

    2004-06-30

    Chalcones are being considered as anticancer agents as they are natural compounds that are particularly cytotoxic towards K562 leukemia or melanoma cells. In this study, we have investigated phloretin, isoliquiritigenin, and 10 other hydroxylated chalcones for their cytotoxic mechanisms towards isolated rat hepatocytes. All hydroxychalcones partly depleted hepatocyte GSH and oxidized GSH to GSSG. These chalcones also caused a collapse of mitochondrial membrane potential and increased oxygen uptake. Furthermore, glycolytic or citric acid cycle substrates prevented cytotoxicity and mitochondrial membrane potential collapse. The highest pKa chalcones were the most effective at collapsing the mitochondrial membrane potential which suggests that the cytotoxic activity of hydroxychalcones are likely because of their ability to uncouple mitochondria.

  16. Plasma generated in culture medium induces damages of HeLa cells due to flow phenomena

    Science.gov (United States)

    Sato, Yusuke; Sato, Takehiko; Yoshino, Daisuke

    2018-03-01

    Plasma in a liquid has been anticipated as an effective tool for medical applications, however, few reports have described cellular responses to plasma generated in a liquid similar to biological fluids. Herein we report the effects of plasma generated in a culture medium on HeLa cells. The plasma in the culture medium produced not only heat, shock waves, and reactive chemical species but also a jet flow with sub millimeter-sized bubbles. Cells exposed to the plasma exhibited detachment, morphological changes, and changes in the actin cytoskeletal structure. The experimental results suggest that wall shear stress over 160 Pa was generated on the surface of the cells by the plasma. It is one of the main factors that cause those cellular responses. We believe that our findings would provide valuable insight into advancements in medical applications of plasma in a liquid.

  17. Evaluation of cytotoxicity and corrosion resistance of orthodontic mini-implants

    Directory of Open Access Journals (Sweden)

    Celha Borges Costa Alves

    Full Text Available ABSTRACT Objective: To evaluate and compare in vitro cytotoxicity and corrosion resistance of mini-implants from three different commercial brands used for orthodontic anchorage. Methods: Six mini-implants (Conexão(tm, Neodent(tm and SIN(tm were separately immersed in artificial saliva (pH 6.76 for 30 and 60 days. The cytotoxicity of the corrosion extracts was assessed in L929 cell cultures using the violet crystal and MTT assays, as well as cell morphology under light microscopy. Metal surface characteristics before and after immersion in artificial saliva were assessed by means of scanning electron microscopy (SEM. The samples underwent atomic absorption spectrophotometry to determine the concentrations of aluminum and vanadium ions, constituent elements of the alloy that present potential toxicity. For statistical analysis, one-way ANOVA/Bonferroni tests were used for comparisons among groups with p < 0.05 considered significant. Statistical analysis was carried out with Graph Pad PRISM software Version 4.0. Results: No changes in cell viability or morphology were observed. Mini-implants SEM images revealed smooth surfaces with no obvious traces of corrosion. The extracts assessed by means of atomic absorption spectrophotometry presented concentrations of aluminum and vanadium ions below 1.0 µg/mL and 0.5 µg/mL, respectively. Conclusion: Orthodontic mini-implants manufactured by Conexão(tm, Neodent(tm and SIN(tm present high corrosion resistance and are not cytotoxic.

  18. Culture and postpartum mood problems: similarities and differences in the experiences of first- and second-generation Canadian women.

    Science.gov (United States)

    Mamisachvili, Lana; Ardiles, Paola; Mancewicz, Grazyna; Thompson, Sherry; Rabin, Kapri; Ross, Lori E

    2013-04-01

    Few studies have examined the role of culture in a woman's experience of postpartum mood problems (PPMP). This study explored differences and similarities in experiences of PPMP between first- and second-generation Canadian women. In this exploratory qualitative study, we interviewed nine first-generation and eight second-generation women who were clients of the Women's Health Centre at St. Joseph's Health Centre in Toronto, Canada. Using semistructured interviews, we explored how women perceived and experienced PPMP. Four themes reflected cultural issues: PPMP stigma, relationship with parents/in-laws, internalization of society's expectations of motherhood, and identity issues/relationship with self. The results of this study contribute to a limited literature on possible contributing factors to PPMP and can inform development of resources for delivering culturally appropriate mental health care for women dealing with PPMP.

  19. A pH-Sensing Optode for Mapping Spatiotemporal Gradients in 3D Paper-Based Cell Cultures.

    Science.gov (United States)

    Kenney, Rachael M; Boyce, Matthew W; Whitman, Nathan A; Kromhout, Brenden P; Lockett, Matthew R

    2018-02-06

    Paper-based cultures are an emerging platform for preparing 3D tissue-like structures. Chemical gradients can be imposed upon these cultures, generating microenvironments similar to those found in poorly vascularized tumors. There is increasing evidence that the tumor microenvironment is responsible for promoting drug resistance and increased invasiveness. Acidosis, or the acidification of the extracellular space, is particularly important in promoting these aggressive cancer phenotypes. To better understand how cells respond to acidosis there is a need for 3D culture platforms that not only model relevant disease states but also contain sensors capable of quantifying small molecules in the extracellular environment. In this work, we describe pH-sensing optodes that are capable of generating high spatial and temporal resolution maps of pH gradients in paper-based cultures. This sensor was fabricated by suspending microparticles containing pH-sensitive (fluorescein) and pH-insensitive (diphenylanthracene) dyes in a polyurethane hydrogel, which was then coated onto a transparent film. The pH-sensing films have a fast response time, are reversible, stable in long-term culture environments, have minimal photobleaching, and are not cytotoxic. These films have a pK a of 7.61 ± 0.04 and are sensitive in the pH range corresponding to normal and tumorigenic tissues. With these optodes, we measured the spatiotemporal evolution of pH gradients in paper-based tumor models.

  20. Assessing the cytotoxicity of ambient particulate matter (PM) using Chinese hamster ovary (CHO) cells and its relationship with the PM chemical composition and oxidative potential

    Science.gov (United States)

    Wang, Yixiang; Plewa, Michael J.; Mukherjee, Ujjal Kumar; Verma, Vishal

    2018-04-01

    We assessed mammalian cell cytotoxicity of ambient PM2.5 and investigated its association with the oxidative potential (OP) and chemical composition of the particles. Sixteen PM samples spanning in various seasons (fall, winter, spring and summer) were collected from an urban site in central Illinois. Cytotoxicity (LC50) in terms of the volume of air that kills 50% of the cells were calculated, which varied from 4.3 to 7.2 m3 of air. The OP was measured by two assays - the dithiothreitol (DTT) and the surrogate lung fluid (SLF) assay. In DTT assay, we measured two endpoints - hydroxyl radicals (•OH) generation and DTT consumption (the conventionally measured endpoint), while only •OH generation was measured in the SLF assay. Although, all three endpoints in the OP assays correlated significantly (P ≤ 0.05) with LC50, the correlation of reactive oxygen species (ROS) generation in DTT and SLF assays was much higher (r > 0.80 for •OH generation versus LC50) than the DTT consumption (r = 0.58). To further understand the components in PM that drive cytotoxicity and OP, concentration of water-soluble metals (Fe, Cu, Co, Cr, Mn, Ni, Pb, V, Hg, and Zn), organic carbon (OC), water soluble organic carbon (WSOC), and elemental carbon (EC) were measured. Among all the chemical components, Fe, Cu and WSOC correlated most (r > 0.70; P ≤ 0.01) with the cytotoxicity. DTT consumption correlated only with OC and WSOC (r > 0.80; P ≤ 0.01), while •OH generation in DTT and SLF assay correlated with both WSOC (r > 0.70; P ≤ 0.01) and metals (i.e. Fe and Cu; r > 0.75; P ≤ 0.01). Our results suggest a strong link between the PM2.5 OP and its cytotoxicity. Furthermore, the synergistic interactions among the organic compounds (i.e. WSOC) and metals (Fe and Cu) to enhance the ROS generation, which are more effectively captured in •OH generation endpoints in DTT and SLF assay than the DTT consumption, appear to be largely responsible for the observed mammalian cell

  1. Effect of glutathione on arecanut treated normal human buccal fibroblast culture.

    Directory of Open Access Journals (Sweden)

    Saraswathi T

    2006-01-01

    Full Text Available BACKGROUND: Experimental studies have shown arecanut to be a cytotoxic substance with mutagenic and carcinogenic potential. OBJECTIVE: The present study was undertaken to evaluate the effect of glutathione on arecanut treated human buccal fibroblast culture and its potential as a chemopreventive agent. MATERIALS AND METHODS: Fibroblast culture was done in Dulbecco′s Modified Eagle′s Medium MEM supplemented with 10% Fetal Calf Serum (FCS and antibiotic at 370C degrees in an atmosphere of 5% carbon di-oxide and 95% air. The fibroblast cells were subjected to different concentrations of aqueous extracts of raw and boiled arecanut. Fibroblasts were plated in two 24-well culture plates and in each plate, cells were dividt,ednto 2 groups; 600gg microml of reduced glutathione was added to the first group of cells; subsequently, aqueous extracts of raw and boiled arecanut at least and highest concentrations i.e., 20j. microml and 100lg microml were added to the first group of cells in the respective plates whereas the second group served as a control. The morphological alterations and cell survival were assayed at 24, 48, 72, and 96 hours. Results Morphologically, the initial (10 hours attached fibroblast cells were converted from spheroidal shape towards hexagonal and finally to a fully extended spindle shaped configuration. The three morphological types of fibroblasts at 48 hours were F-I, F-II and F-III. Aqueous extract of raw arecanut exhibited significant cytotoxicity (p < .0 001 at all time periods studied, when compared against the control values of untreated fibroblasts. Addition of reduced glutathione to cultures showed a significant (p < 0. 001 reduction in cytotoxicity, as indicated by higher optical density values and morphological reversion to the spindle-shaped configuration. CoCONCLUSION:Addition of glutathione reduced the cytotoxic and morphological alterations of the fibroblasts treated with aqueous extracts of both raw and boiled

  2. Cytotoxicity and Bioactivity of Calcium Silicate Cements Combined with Niobium Oxide in Different Cell Lines.

    Science.gov (United States)

    Mestieri, Leticia Boldrin; Gomes-Cornélio, Ana Lívia; Rodrigues, Elisandra Márcia; Faria, Gisele; Guerreiro-Tanomaru, Juliane Maria; Tanomaru-Filho, Mário

    2017-01-01

    The aim of this study was to evaluate the cytotoxicity and bioactivity of calcium silicate-based cements combined with niobium oxide (Nb2O5) micro and nanoparticles, comparing the response in different cell lines. This evaluation used four cell lines: two primary cultures (human dental pulp cells - hDPCs and human dental follicle cells - hDFCs) and two immortalized cultures (human osteoblast-like cells - Saos-2 and mouse periodontal ligament cells - mPDL). The tested materials were: White Portland Cement (PC), mineral trioxide aggregate (MTA), white Portland cement combined with microparticles (PC/Nb2O5µ) or nanoparticles (PC/Nb2O5n) of niobium oxide (Nb2O5). Cytotoxicity was evaluated by the methylthiazolyldiphenyl-tetrazolium bromide (MTT) and trypan blue exclusion assays and bioactivity by alkaline phosphatase (ALP) enzyme activity. Results were analyzed by ANOVA and Tukey test (a=0.05). PC/Nb2O5n presented similar or higher cell viability than PC/Nb2O5µ in all cell lines. Moreover, the materials presented similar or higher cell viability than MTA. Saos-2 exhibited high ALP activity, highlighting PC/Nb2O5µ material at 7 days of exposure. In conclusion, calcium silicate cements combined with micro and nanoparticles of Nb2O5 presented cytocompatibility and bioactivity, demonstrating the potential of Nb2O5 as an alternative radiopacifier agent for these cements. The different cell lines had similar response to cytotoxicity evaluation of calcium silicate cements. However, bioactivity was more accurately detected in human osteoblast-like cell line, Saos-2.

  3. Myricetin-induced apoptosis of triple-negative breast cancer cells is mediated by the iron-dependent generation of reactive oxygen species from hydrogen peroxide.

    Science.gov (United States)

    Knickle, Allison; Fernando, Wasundara; Greenshields, Anna L; Rupasinghe, H P Vasantha; Hoskin, David W

    2018-05-06

    Myricetin is a dietary phytochemical with anticancer activity; however, the effect of myricetin on breast cancer cells remains unclear. Here, we show that myricetin inhibited the growth of triple-negative breast cancer (TNBC) cells but was less inhibitory for normal cells. The effect of myricetin was comparable to epigallocatechin gallate and doxorubicin, and greater than resveratrol and cisplatin. Myricetin-treated TNBC cells showed evidence of early and late apoptosis/necrosis, which was associated with intracellular reactive oxygen species (ROS) accumulation, extracellular regulated kinase 1/2 and p38 mitogen-activated protein kinase activation, mitochondrial membrane destabilization and cytochrome c release, and double-strand DNA breaks. The antioxidant N-acetyl-cysteine protected myricetin-treated TNBC cells from cytotoxicity due to DNA damage. Myricetin also induced hydrogen peroxide (H 2 O 2 ) production in cell-free culture medium, as well as in the presence of TNBC cells and normal cells. In addition, deferriprone-mediated inhibition of intracellular ROS generation via the iron-dependent Fenton reaction and inhibition of extracellular ROS accumulation with superoxide dismutase plus catalase prevented myricetin-induced cytotoxicity in TNBC cell cultures. We conclude that the cytotoxic effect of myricetin on TNBC cells was due to oxidative stress initiated by extracellular H 2 O 2 formed by autoxidation of myricetin, leading to intracellular ROS production via the Fenton reaction. Copyright © 2018. Published by Elsevier Ltd.

  4. The effects of beryllium metal particles on the viability and function of cultured rat alveolar macrophages

    International Nuclear Information System (INIS)

    Finch, G.L.; Lowther, W.T.; Hoover, M.D.; Brooks, A.L.

    1988-01-01

    Rat pulmonary alveolar macrophages (PAM) were exposed in vitro to beryllium metal particles. The particles used were relatively large (Be-II) and small (Be-V) size fractions of beryllium metal obtained from an aerosol cyclone, and a beryllium metal aerosol generated by laser vaporization of beryllium metal in an argon atmosphere (Be-L). Glass beads (GB) were used as a negative control particle. The endpoints examined included cell killing (trypan blue dye exclusion) and phagocytic ability (sheep red blood cell uptake). Phagocytic ability was inhibited by beryllium particles at concentrations that did not cause appreciable cell killing. Results based on the mass concentration of particles in culture medium were transformed by the amount of specific surface area of the particles to permit expression of toxicity on the basis of amount of surface area of particles per unit volume of culture medium. On a mass concentration basis, the order of cytotoxicity was Be-L > Be-V ∼ Be-II > GB; for inhibition of phagacytosis, the cytotoxicity order was Be-L ∼ Be-V > Be-II > GB. On a surface area concentration basis, the order of toxicity for viability was altered to Be-II > Be-L ∼ Be-V (with GB indeterminant) and to Be-V > Be-II ∼ Be-L > GB for inhibition of phagocytosis. We conclude that there are factors in addition to specific surface area that influence the expression of toxic effects in cultured PAM. (author)

  5. Ionizing radiation affects generation of MART-1-specific cytotoxic T cell responses by dendritic cells

    International Nuclear Information System (INIS)

    Liao, Y.P.; Wang, C.-C.; McBride, W.H.

    2003-01-01

    Full text: The human MART-1/Melan-A (MART-1) melanoma tumor antigen is known to be recognized by cytotoxic T lymphocytes (CTLs) and several groups are using this target for clinical immunotherapy. Most approaches use dendritic cells (DCs) that are potent antigen presentation cells for initiating CTL responses. In order for CTL recognition to occur, DCs must display 9-residue antigenic peptides on MHC class I molecules. These peptides are generated by proteasome degradation and then transported through the endoplasmic reticulum to the cell surface where they stabilize MHC class I expression. Our previous data showed that irradiation inhibits proteasome function and, therefore, we hypothesized that irradiation may inhibit antigen processing and CTL activation, as has been shown for proteasome inhibitors. To study the importance of irradiation effects on DCs, we studied the generation MART-1-specific CTL responses. Preliminary data showed that irradiation of murine bone marrow derived DCs did not affect expression of MHC class I, II, CD80, or CD86, as assessed by flow cytometric analyses 24-hour after irradiation. The effect of irradiation on MART-1 antigen processing by DCs was evaluated using DC transduced with adenovirus MART-1 (AdVMART1). C57BL/6 mice were immunized with AdVMART1 transduced DCs, with and without prior irradiation. IFN-γ production was measured by ELISPOT assays after 10-14 days of immunization. Prior radiation treatment resulted in a significant decrease in MART-1-specific T cell responses. The ability of irradiated and non-irradiated AdVMART1/DC vaccines to protect mice against growth of murine B16 tumors, which endogenously express murine MART-1, was also examined. AdVMART1/DC vaccination protected C57BL/6 mice against challenge with viable B16 melanoma cells while DCs irradiated (10 Gy) prior to AdVMART1 transduction abrogated protection. These results suggest that proteasome inhibition in DCs by irradiation may be a possible pathway in

  6. 'Chocolate' silver nanoparticles: Synthesis, antibacterial activity and cytotoxicity.

    Science.gov (United States)

    Chowdhury, Neelika Roy; MacGregor-Ramiasa, Melanie; Zilm, Peter; Majewski, Peter; Vasilev, Krasimir

    2016-11-15

    Silver nanoparticles (AgNPs) have emerged as a powerful weapon against antibiotic resistant microorganisms. However, most conventional AgNPs syntheses require the use of hazardous chemicals and generate toxic organic waste. Hence, in recent year's, plant derived and biomolecule based synthetics have has gained much attention. Cacao has been used for years for its medicinal benefits and contains a powerful reducing agent - oxalic acid. We hypothesized that, due to the presence of oxalic acid, cacao extract is capable of reducing silver nitrate (AgNO3) to produce AgNPs. In this study, AgNPs were synthesized by using natural cacao extract as a reducing and stabilizing agent. The reaction temperature, time and reactant molarity were varied to optimize the synthesis yield. UV-visible spectroscopy (UV-vis), dynamic light scattering (DLS) and transmission electron microscopy (TEM) characterization demonstrated that the synthesized AgNPs were spherical particles ranging in size from 35 to 42.5nm. The synthesized AgNPs showed significant antibacterial activity against clinically relevant pathogens such as Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Staphylococcus epidermidis. Importantly, these green AgNPs are not cytotoxic to human dermal fibroblasts (HDFs) at concentrations below 32μg/ml. We conclude that cacao-based synthesis is a reproducible and sustainable method for the generation of stable antimicrobial silver nanoparticles with low cytotoxicity to human cells. The AgNPs synthesized in this work have promising properties for applications in the biomedical field. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Cytotoxicity and trypanocidal activity of nifurtimox encapsulated in ethylcyanoacrylate nanoparticles

    Directory of Open Access Journals (Sweden)

    GITTITH SÁNCHEZ

    2002-01-01

    Full Text Available The aim of the present study was to study the trypanocidal activity of nanoparticles loaded with nifurtimox in comparison with the free drug against Trypanosoma cruzi, responsible for Chagas' disease. Ethylcyanoacrylate nanoparticles acted as the delivery system into cells. As the obligate replicative intracellular form is amastigote, in vitro studies were performed on this form of parasite as well as on cell culture derived trypomastigotes. The fluorescence method used here was very useful as it allowed for the simultaneous study of trypanocide activity and cytotoxicity by determining living or dead parasites within living or dead host cells. According to these results, the greatest trypanocide activity on cell culture-derived trypomastigotes was recorded for nifurtimox-loaded nanoparticles with a 50% inhibitory concentration (IC50 twenty times less than that of the free drug. The cytotoxycity of unloaded nanoparticles at low concentrations was similar to that obtained by free drug when evaluated on Vero cells. Furthermore, nifurtimox-loaded nanoparticles showed increased trypanocide activity on intracellular amastigotes with an IC50 thirteen times less than that of nifurtimox. We also observed that the unloaded nanoparticles possess the previously-described trypanocide activity, similar to the standard solution of nifurtimox, although the mechanism for this has not yet been elucidated. In conclusion, it was possible to establish in vitro conditions using nifurtimox encapsulated nanoparticles in order to decrease the doses of the drug and thus to obtain high trypanocidal activity on both free trypomastigotes and intracellular amastigotes with low cytotoxicity for the host cell.

  8. The effect of radiosterilization on cytotoxicity of polyurethane film

    International Nuclear Information System (INIS)

    Sheikh, N.

    2003-01-01

    Nowadays a sequence of tests for evaluation of sterilized biomaterial includes an initial set of tests in vitro, both biological (cell culture) and non-biological (mechanical tests). In this paper the cytotoxicity of a sterilized polyurethane film, in order to use as biomaterial, has been investigated. For this purpose NCO-terminated urethane prepolymer in medical quality was synthesized without ingredients beside monomers (polyethylene glycol/castor oil and toluene diisocyanate). The cured prepolymer films were prepared under ambient conditions due to the reaction of free NCO-groups of prepolymer with air moisture. The polyurethane films were sterilized by gamma-ray (25 kGy). The surface structure of sterilized polyurethane film was observed by SEM and compared to that of the unsterilized film. Also, the in vitro interaction of fibroblast cells and sterilized polyurethane film in culture medium containing serum was evaluated in comparison with control samples. Results showed no signs of cell toxicity

  9. A Comparison between the Cytotoxicity Induced by Gossypol in Two Testicular Cell Lines

    Directory of Open Access Journals (Sweden)

    Neda MahdinezhadGorji

    2014-12-01

    Full Text Available Background: Gossypol is a yellow toxic pigment from the cottonseed that can cause acute or chronic toxicity in humans and animals by affecting the testicular tissues. Nowadays cottonseed is used as food supplement for ruminants specially the sheep. In this study, two different stem cell lines of testicular tissue including GC1-spg (mouse testis and SFTF-PI43 (sheep testis cells were used to evaluation of gossypol cytotoxicity. Methods: The GC-1spg and the SFTF_PI43 cells were cultured in RPMI-1640 supplemented with fetal bovine serum (10% and antibiotic (penicillin 105/ml, streptomycin100μg/ml, and then 5×104 cells/well were seeded in 24 well plates. Cultured cells were exposed to four different concentrations of gossypol (1.25, 2.5, 5 and 10μM. After 24 h incubation, cells viability test was performed using Trypan Blue dye exclusion and MTT assay. The Thiobarbituric Acid Reacting Substances (TBARS and Ferric Reducing Activity Potential (FRAP assays was performed on media. Result: In high concentrations (over than 2.5μM, Gossypol showed cytotoxic effects on cells. The IC50 for gossypol (using MTT assays on SFTF-PI43 and GC-1spg cell lines was 2.2 μM and 3.2 μM, respectively. While the results for FRAP assay did not show any significant differences between the test and control groups, significantly higher lipid peroxidation was observed in SFTF-PI43 cells that were treated with higher doses of gossypol (10μM. Conclusion: In this research, we found that gossypol has cytotoxic effects on both examined testicular cell lines and increased lipid peroxidation, which is a probable mechanism of its toxicity on cell lines.

  10. Use of disposable reactors to generate inoculum cultures for E. coli production fermentations.

    Science.gov (United States)

    Mahajan, Ekta; Matthews, Timothy; Hamilton, Ryan; Laird, Michael W

    2010-01-01

    Disposable technology is being used more each year in the biotechnology industry. Disposable bioreactors allow one to avoid expenses associated with cleaning, assembly and operations, as well as equipment validation. The WAVE bioreactor is well established for Chinese Hamster Ovary (CHO) production, however, it has not yet been thoroughly tested for E. coli production because of the high oxygen demand and temperature maintenance requirements of that platform. The objective of this study is to establish a robust process to generate inoculum for E. coli production fermentations in a WAVE bioreactor. We opted not to evaluate the WAVE system for production cultures because of the high cell densities required in our current E. coli production processes. Instead, the WAVE bioreactor 20/50 system was evaluated at laboratory scale (10-L) to generate inoculum with target optical densities (OD(550)) of 15 within 7-9 h (pre-established target for stainless steel fermentors). The maximum settings for rock rate (40 rpm) and angle (10.5) were used to maximize mass transfer. The gas feed was also supplemented with additional oxygen to meet the high respiratory demand of the culture. The results showed that the growth profiles for the inoculum cultures were similar to those obtained from conventional stainless steel fermentors. These inoculum cultures were subsequently inoculated into 10-L working volume stainless steel fermentors to evaluate the inocula performance of two different production systems during recombinant protein production. The results of these production cultures using WAVE inocula showed that the growth and recombinant protein production was comparable to the control data set. Furthermore, an economic analysis showed that the WAVE system would require less capital investment for installation and operating expenses would be less than traditional stainless steel systems. (c) 2010 American Institute of Chemical Engineers

  11. Organizational culture and knowledge management in the electric power generation industry

    Science.gov (United States)

    Mayfield, Robert D.

    Scarcity of knowledge and expertise is a challenge in the electric power generation industry. Today's most pervasive knowledge issues result from employee turnover and the constant movement of employees from project to project inside organizations. To address scarcity of knowledge and expertise, organizations must enable employees to capture, transfer, and use mission-critical explicit and tacit knowledge. The purpose of this qualitative grounded theory research was to examine the relationship between and among organizations within the electric power generation industry developing knowledge management processes designed to retain, share, and use the industry, institutional, and technical knowledge upon which the organizations depend. The research findings show that knowledge management is a business problem within the domain of information systems and management. The risks associated with losing mission critical-knowledge can be measured using metrics on employee retention, recruitment, productivity, training and benchmarking. Certain enablers must be in place in order to engage people, encourage cooperation, create a knowledge-sharing culture, and, ultimately change behavior. The research revealed the following change enablers that support knowledge management strategies: (a) training - blended learning, (b) communities of practice, (c) cross-functional teams, (d) rewards and recognition programs, (e) active senior management support, (f) communication and awareness, (g) succession planning, and (h) team organizational culture.

  12. A simple hanging drop cell culture protocol for generation of 3D spheroids.

    Science.gov (United States)

    Foty, Ramsey

    2011-05-06

    Studies of cell-cell cohesion and cell-substratum adhesion have historically been performed on monolayer cultures adherent to rigid substrates. Cells within a tissue, however, are typically encased within a closely packed tissue mass in which cells establish intimate connections with many near-neighbors and with extracellular matrix components. Accordingly, the chemical milieu and physical forces experienced by cells within a 3D tissue are fundamentally different than those experienced by cells grown in monolayer culture. This has been shown to markedly impact cellular morphology and signaling. Several methods have been devised to generate 3D cell cultures including encapsulation of cells in collagen gels or in biomaterial scaffolds. Such methods, while useful, do not recapitulate the intimate direct cell-cell adhesion architecture found in normal tissues. Rather, they more closely approximate culture systems in which single cells are loosely dispersed within a 3D meshwork of ECM products. Here, we describe a simple method in which cells are placed in hanging drop culture and incubated under physiological conditions until they form true 3D spheroids in which cells are in direct contact with each other and with extracellular matrix components. The method requires no specialized equipment and can be adapted to include addition of any biological agent in very small quantities that may be of interest in elucidating effects on cell-cell or cell-ECM interaction. The method can also be used to co-culture two (or more) different cell populations so as to elucidate the role of cell-cell or cell-ECM interactions in specifying spatial relationships between cells. Cell-cell cohesion and cell-ECM adhesion are the cornerstones of studies of embryonic development, tumor-stromal cell interaction in malignant invasion, wound healing, and for applications to tissue engineering. This simple method will provide a means of generating tissue-like cellular aggregates for measurement of

  13. Cytotoxic glucosphingolipid from Celtis Africana.

    Science.gov (United States)

    Perveen, Shagufta; Al-Taweel, Areej Mohammad; Fawzy, Ghada Ahmed; El-Shafae, Azza Muhammed; Khan, Afsar; Proksch, Peter

    2015-05-01

    Literature survey proved the use of the powdered sun-dried bark and roots of Celtis africana for the treatment of cancer in South Africa. The aim of this study was to do further isolation work on the ethyl acetate fraction and to investigate the cytotoxic activities of the various fractions and isolated compound. Cytotoxicity of petroleum ether, chloroform, ethyl acetate, n-butanol fractions and compound 1 were tested on mouse lymphoma cell line L5178Y using the microculture tetrazolium assay. One new glucosphingolipid 1 was isolated from the aerial parts of C. africana. The structure of the new compound was determined by extensive analysis by one-dimensional and two-dimensional nuclear magnetic resonance spectroscopy and mass spectrometry. The ethyl acetate fraction and compound 1 showed strong cytotoxic activity with an EC50 value of 8.3 μg/mL and 7.8 μg/mL, respectively, compared with Kahalalide F positive control (6.3 μg/mL). This is the first report of the occurrence of a cytotoxic glucosphingolipid in family Ulmaceae.

  14. In vitro interactions of lymphocytes and cultured cells from beagles with plutonium-induced bone tumors

    International Nuclear Information System (INIS)

    Frazier, M.E.; Lund, J.E.; Busch, R.H.

    1976-01-01

    Cell cultures have been prepared from lung and bone tumors arising in beagle dogs following exposure to inhaled plutonium. Evaluation of the cultured cells by commonly applied criteria (i.e., cell morphology, lack of contact inhibitory mechanisms, cloning efficiency, growth in soft agar, and tumor production in vivo) indicated that tumor cells were being grown in culture. Blood leukocytes and peripheral lymphocytes from beagle dogs were tested for cytotoxic effects against several cell cultures. Lymphocytes from normal dogs or dogs with unrelated tumors would not kill the bone tumor cells unless monocytes (macrophage) were present, in which case the leukocyte preparation was capable of mounting de novo cytotoxic immune reactions after 3 to 5 days in culture. In contrast, the dogs with plutonium-induced bone tumors had circulating lymphocytes that appeared to have undergone presensitization to bone-tumor-distinctive antigens in vivo. Consequently these lymphocytes interacted with cultured cells promptly after encounter in vitro

  15. Dynamized Preparations in Cell Culture

    Directory of Open Access Journals (Sweden)

    Ellanzhiyil Surendran Sunila

    2009-01-01

    Full Text Available Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929 and Chinese Hamster Ovary (CHO cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties.

  16. Development of an in vitro cytotoxicity model for aerosol exposure using 3D reconstructed human airway tissue; application for assessment of e-cigarette aerosol.

    Science.gov (United States)

    Neilson, Louise; Mankus, Courtney; Thorne, David; Jackson, George; DeBay, Jason; Meredith, Clive

    2015-10-01

    Development of physiologically relevant test methods to analyse potential irritant effects to the respiratory tract caused by e-cigarette aerosols is required. This paper reports the method development and optimisation of an acute in vitro MTT cytotoxicity assay using human 3D reconstructed airway tissues and an aerosol exposure system. The EpiAirway™ tissue is a highly differentiated in vitro human airway culture derived from primary human tracheal/bronchial epithelial cells grown at the air-liquid interface, which can be exposed to aerosols generated by the VITROCELL® smoking robot. Method development was supported by understanding the compatibility of these tissues within the VITROCELL® system, in terms of airflow (L/min), vacuum rate (mL/min) and exposure time. Dosimetry tools (QCM) were used to measure deposited mass, to confirm the provision of e-cigarette aerosol to the tissues. EpiAirway™ tissues were exposed to cigarette smoke and aerosol generated from two commercial e-cigarettes for up to 6 h. Cigarette smoke reduced cell viability in a time dependent manner to 12% at 6 h. E-cigarette aerosol showed no such decrease in cell viability and displayed similar results to that of the untreated air controls. Applicability of the EpiAirway™ model and exposure system was demonstrated, showing little cytotoxicity from e-cigarette aerosol and different aerosol formulations when compared directly with reference cigarette smoke, over the same exposure time. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Stochastic modeling of oligodendrocyte generation in cell culture: model validation with time-lapse data

    Directory of Open Access Journals (Sweden)

    Noble Mark

    2006-05-01

    Full Text Available Abstract Background The purpose of this paper is two-fold. The first objective is to validate the assumptions behind a stochastic model developed earlier by these authors to describe oligodendrocyte generation in cell culture. The second is to generate time-lapse data that may help biomathematicians to build stochastic models of cell proliferation and differentiation under other experimental scenarios. Results Using time-lapse video recording it is possible to follow the individual evolutions of different cells within each clone. This experimental technique is very laborious and cannot replace model-based quantitative inference from clonal data. However, it is unrivalled in validating the structure of a stochastic model intended to describe cell proliferation and differentiation at the clonal level. In this paper, such data are reported and analyzed for oligodendrocyte precursor cells cultured in vitro. Conclusion The results strongly support the validity of the most basic assumptions underpinning the previously proposed model of oligodendrocyte development in cell culture. However, there are some discrepancies; the most important is that the contribution of progenitor cell death to cell kinetics in this experimental system has been underestimated.

  18. Cytotoxicity and oxidative stress induced by different metallic nanoparticles on human kidney cells

    Directory of Open Access Journals (Sweden)

    Ohayon-Courtès Céline

    2011-03-01

    Full Text Available Abstract Background Some manufactured nanoparticles are metal-based and have a wide variety of applications in electronic, engineering and medicine. Until now, many studies have described the potential toxicity of NPs on pulmonary target, while little attention has been paid to kidney which is considered to be a secondary target organ. The objective of this study, on human renal culture cells, was to assess the toxicity profile of metallic nanoparticles (TiO2, ZnO and CdS usable in industrial production. Comparative studies were conducted, to identify whether particle properties impact cytotoxicity by altering the intracellular oxidative status. Results Nanoparticles were first characterized by size, surface charge, dispersion and solubility. Cytotoxicity of NPs was then evaluated in IP15 (glomerular mesangial and HK-2 (epithelial proximal cell lines. ZnO and CdS NPs significantly increased the cell mortality, in a dose-dependent manner. Cytotoxic effects were correlated with the physicochemical properties of NPs tested and the cell type used. Analysis of reactive oxygen species and intracellular levels of reduced and oxidized glutathione revealed that particles induced stress according to their composition, size and solubility. Protein involved in oxidative stress such as NF-κb was activated with ZnO and CdS nanoparticles. Such effects were not observed with TiO2 nanoparticles. Conclusion On glomerular and tubular human renal cells, ZnO and CdS nanoparticles exerted cytotoxic effects that were correlated with metal composition, particle scale and metal solubility. ROS production and oxidative stress induction clearly indicated their nephrotoxic potential.

  19. Reproducible fashion of the HSP70B' promoter-induced cytotoxic response on a live cell-based biosensor by cell cycle synchronization.

    Science.gov (United States)

    Migita, Satoshi; Wada, Ken-Ichi; Taniguchi, Akiyoshi

    2010-10-15

    Live cell-based sensors potentially provide functional information about the cytotoxic effect of reagents on various signaling cascades. Cells transfected with a reporter vector derived from a cytotoxic response promoter can be used as intelligent cytotoxicity sensors (i.e., sensor cells). We have combined sensor cells and a microfluidic cell culture system that can achieve several laminar flows, resulting in a reliable high-throughput cytotoxicity detection system. These sensor cells can also be applied to single cell arrays. However, it is difficult to detect a cellular response in a single cell array, due to the heterogeneous response of sensor cells. The objective of this study was cell homogenization with cell cycle synchronization to enhance the response of cell-based biosensors. Our previously established stable sensor cells were brought into cell cycle synchronization under serum-starved conditions and we then investigated the cadmium chloride-induced cytotoxic response at the single cell level. The GFP positive rate of synchronized cells was approximately twice as high as that of the control cells, suggesting that cell homogenization is an important step when using cell-based biosensors with microdevices, such as a single cell array. Copyright 2010 Wiley Periodicals, Inc.

  20. Comparative analysis of the in vitro cytotoxicity of the dietary biogenic amines tyramine and histamine.

    Science.gov (United States)

    Linares, Daniel M; del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; Fernandez, Maria; Ruas-Madiedo, Patricia; Alvarez, Miguel A

    2016-04-15

    Tyramine and histamine, the most toxic biogenic amines (BA), are often found in high concentrations in certain foods. Prompted by the limited knowledge of BA toxicity, and increasing awareness of the risks associated with high intakes of dietary BA, the in vitro cytotoxicity of tyramine and histamine was investigated. Tyramine and histamine were toxic for HT29 intestinal cell cultures at concentrations commonly found in BA-rich food, as determined by real-time cell analysis. Surprisingly, tyramine had a stronger and more rapid cytotoxic effect than histamine. Their mode of action was also different, while tyramine caused cell necrosis, histamine induced apoptosis. To avoid health risks, the BA content of foods should be reduced and legal limits established for tyramine. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Social and cultural factors underlying generational differences in overweight: a cross-sectional study among ethnic minorities in the Netherlands

    Directory of Open Access Journals (Sweden)

    Nierkens Vera

    2011-02-01

    Full Text Available Abstract Background The prevalence of overweight appears to vary in people of first and second generation ethnic minority groups. Insight into the factors that underlie these weight differences might help in understanding the health transition that is taking place across generations following migration. We studied the role of social and cultural factors associated with generational differences in overweight among young Turkish and Moroccan men and women in the Netherlands. Methods Cross-sectional data were derived from the LASER-study in which information on health-related behaviour and socio-demographic factors, level of education, occupational status, acculturation (cultural orientation and social contacts, religious and migration-related factors was gathered among Turkish and Moroccan men (n = 334 and women (n = 339 aged 15-30 years. Participants were interviewed during a home visit. Overweight was defined as a Body Mass Index ≥ 25 kg/m2. Using logistic regression analyses, we tested whether the measured social and cultural factors could explain differences in overweight between first and second generation ethnic groups. Results Second generation women were less often overweight than first generation women (21.8% and 45.0% respectively, but this association was no longer significant when adjusting for the socioeconomic position (i.e. higher level of education of second generation women (Odds Ratio (OR = 0.77, 95%, Confidence Interval (CI 0.40-1.46. In men, we observed a reversed pattern: second generation men were more often overweight than first generation men (32.7% and 27.8%. This association (OR = 1.89, 95% CI 1.09-3.24 could not be explained by the social and cultural factors because none of these factors were associated with overweight among men. Conclusions The higher socio-economic position of second generation Turkish and Moroccan women may partly account for the lower prevalence of overweight in this group compared to first

  2. Social and cultural factors underlying generational differences in overweight: a cross-sectional study among ethnic minorities in the Netherlands.

    Science.gov (United States)

    Hosper, Karen; Nicolaou, Mary; van Valkengoed, Irene; Nierkens, Vera; Stronks, Karien

    2011-02-16

    The prevalence of overweight appears to vary in people of first and second generation ethnic minority groups. Insight into the factors that underlie these weight differences might help in understanding the health transition that is taking place across generations following migration. We studied the role of social and cultural factors associated with generational differences in overweight among young Turkish and Moroccan men and women in the Netherlands. Cross-sectional data were derived from the LASER-study in which information on health-related behaviour and socio-demographic factors, level of education, occupational status, acculturation (cultural orientation and social contacts), religious and migration-related factors was gathered among Turkish and Moroccan men (n = 334) and women (n = 339) aged 15-30 years. Participants were interviewed during a home visit. Overweight was defined as a Body Mass Index ≥ 25 kg/m2. Using logistic regression analyses, we tested whether the measured social and cultural factors could explain differences in overweight between first and second generation ethnic groups. Second generation women were less often overweight than first generation women (21.8% and 45.0% respectively), but this association was no longer significant when adjusting for the socioeconomic position (i.e. higher level of education) of second generation women (Odds Ratio (OR) = 0.77, 95%, Confidence Interval (CI) 0.40-1.46). In men, we observed a reversed pattern: second generation men were more often overweight than first generation men (32.7% and 27.8%). This association (OR = 1.89, 95% CI 1.09-3.24) could not be explained by the social and cultural factors because none of these factors were associated with overweight among men. The higher socio-economic position of second generation Turkish and Moroccan women may partly account for the lower prevalence of overweight in this group compared to first generation women. Further research is necessary to elucidate

  3. Cytotoxic Effects of Bangladeshi Medicinal Plant Extracts

    Directory of Open Access Journals (Sweden)

    Shaikh J. Uddin

    2011-01-01

    Full Text Available To investigate the cytotoxic effect of some Bangladeshi medicinal plant extracts, 16 Bangladeshi medicinal plants were successively extracted with n-hexane, dichloromethane, methanol and water. The methanolic and aqueous extracts were screened for cytotoxic activity against healthy mouse fibroblasts (NIH3T3 and three human cancer-cell lines (gastric: AGS; colon: HT-29; and breast: MDA-MB-435S using the MTT assay. Two methanolic extracts (Hygrophila auriculata and Hibiscus tiliaceous and one aqueous extract (Limnophila indica showed no toxicity against healthy mouse fibroblasts, but selective cytotoxicity against breast cancer cells (IC50 1.1–1.6 mg mL−1. Seven methanolic extracts from L. indica, Clerodendron inerme, Cynometra ramiflora, Xylocarpus moluccensis, Argemone mexicana, Ammannia baccifera and Acrostichum aureum and four aqueous extracts from Hygrophila auriculata, Bruguiera gymnorrhiza, X. moluccensis and Aegiceras corniculatum showed low toxicity (IC50 > 2.5 mg mL−1 against mouse fibroblasts but selective cytotoxicity (IC50 0.2–2.3 mg mL−1 against different cancer cell lines. The methanolic extract of Blumea lacera showed the highest cytotoxicity (IC50 0.01–0.08 mg mL−1 against all tested cell lines among all extracts tested in this study. For some of the plants their traditional use as anticancer treatments correlates with the cytotoxic results, whereas for others so far unknown cytotoxic activities were identified.

  4. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu......We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level...

  5. Children's Everyday Learning by Assuming Responsibility for Others: Indigenous Practices as a Cultural Heritage Across Generations.

    Science.gov (United States)

    Fernández, David Lorente

    2015-01-01

    This chapter uses a comparative approach to examine the maintenance of Indigenous practices related with Learning by Observing and Pitching In in two generations--parent generation and current child generation--in a Central Mexican Nahua community. In spite of cultural changes and the increase of Western schooling experience, these practices persist, to different degrees, as a Nahua cultural heritage with close historical relations to the key value of cuidado (stewardship). The chapter explores how children learn the value of cuidado in a variety of everyday activities, which include assuming responsibility in many social situations, primarily in cultivating corn, raising and protecting domestic animals, health practices, and participating in family ceremonial life. The chapter focuses on three main points: (1) Cuidado (assuming responsibility for), in the Nahua socio-cultural context, refers to the concepts of protection and "raising" as well as fostering other beings, whether humans, plants, or animals, to reach their potential and fulfill their development. (2) Children learn cuidado by contributing to family endeavors: They develop attention and self-motivation; they are capable of responsible actions; and they are able to transform participation to achieve the status of a competent member of local society. (3) This collaborative participation allows children to continue the cultural tradition and to preserve a Nahua heritage at a deeper level in a community in which Nahuatl language and dress have disappeared, and people do not identify themselves as Indigenous. © 2015 Elsevier Inc. All rights reserved.

  6. Magnetic and cytotoxic properties of hot-filament chemical vapour deposited diamond

    Energy Technology Data Exchange (ETDEWEB)

    Zanin, Hudson, E-mail: hudsonzanin@gmail.com [Faculdade de Engenharia Eletrica e Computacao, Departamento de Semicondutores, Instrumentos e Fotonica, Universidade Estadual de Campinas, UNICAMP, Av. Albert Einstein N.400, CEP 13 083-852 Campinas, Sao Paulo (Brazil); Peterlevitz, Alfredo Carlos; Ceragioli, Helder Jose [Faculdade de Engenharia Eletrica e Computacao, Departamento de Semicondutores, Instrumentos e Fotonica, Universidade Estadual de Campinas, UNICAMP, Av. Albert Einstein N.400, CEP 13 083-852 Campinas, Sao Paulo (Brazil); Rodrigues, Ana Amelia; Belangero, William Dias [Laboratorio de Biomateriais em Ortopedia, Faculdade de Ciencias Medicas, Universidade Estadual de Campinas, Rua Cinco de Junho 350 CEP 13083970, Campinas, Sao Paulo (Brazil); Baranauskas, Vitor [Faculdade de Engenharia Eletrica e Computacao, Departamento de Semicondutores, Instrumentos e Fotonica, Universidade Estadual de Campinas, UNICAMP, Av. Albert Einstein N.400, CEP 13 083-852 Campinas, Sao Paulo (Brazil)

    2012-12-01

    Microcrystalline (MCD) and nanocrystalline (NCD) magnetic diamond samples were produced by hot-filament chemical vapour deposition (HFCVD) on AISI 316 substrates. Energy Dispersive X-ray Spectroscopy (EDS) measurements indicated the presence of Fe, Cr and Ni in the MCD and NCD samples, and all samples showed similar magnetisation properties. Cell viability tests were realised using Vero cells, a type of fibroblastic cell line. Polystyrene was used as a negative control for toxicity (NCT). The cells were cultured under standard cell culture conditions. The proliferation indicated that these magnetic diamond samples were not cytotoxic. - Highlights: Black-Right-Pointing-Pointer Polycrystalline diamonds doped with Fe, Cr and Ni acquire ferromagnetic properties. Black-Right-Pointing-Pointer CVD diamonds have been prepared with magnetic and semiconductor properties. Black-Right-Pointing-Pointer Micro/nanocrystalline diamonds show good cell viability with fibroblast proliferation.

  7. Tumor necrosis factor-alpha potentiates the cytotoxicity of amiodarone in Hepa1c1c7 cells: roles of caspase activation and oxidative stress.

    Science.gov (United States)

    Lu, Jingtao; Miyakawa, Kazuhisa; Roth, Robert A; Ganey, Patricia E

    2013-01-01

    Amiodarone (AMD), a class III antiarrhythmic drug, causes idiosyncratic hepatotoxicity in human patients. We demonstrated previously that tumor necrosis factor-alpha (TNF-α) plays an important role in a rat model of AMD-induced hepatotoxicity under inflammatory stress. In this study, we developed a model in vitro to study the roles of caspase activation and oxidative stress in TNF potentiation of AMD cytotoxicity. AMD caused cell death in Hepa1c1c7 cells, and TNF cotreatment potentiated its toxicity. Activation of caspases 9 and 3/7 was observed in AMD/TNF-cotreated cells, and caspase inhibitors provided minor protection from cytotoxicity. Intracellular reactive oxygen species (ROS) generation and lipid peroxidation were observed after treatment with AMD and were further elevated by TNF cotreatment. Adding water-soluble antioxidants (trolox, N-acetylcysteine, glutathione, or ascorbate) produced only minor attenuation of AMD/TNF-induced cytotoxicity and did not influence the effect of AMD alone. On the other hand, α-tocopherol (TOCO), which reduced lipid peroxidation and ROS generation, prevented AMD toxicity and caused pronounced reduction in cytotoxicity from AMD/TNF cotreatment. α-TOCO plus a pancaspase inhibitor completely abolished AMD/TNF-induced cytotoxicity. In summary, activation of caspases and oxidative stress were observed after AMD/TNF cotreatment, and caspase inhibitors and a lipid-soluble free-radical scavenger attenuated AMD/TNF-induced cytotoxicity.

  8. Relationship of CD86 surface marker expression and cytotoxicity on dendritic cells exposed to chemical allergen

    International Nuclear Information System (INIS)

    Hulette, Ben C.; Ryan, Cindy A.; Gildea, Lucy A.; Gerberick, G. Frank

    2005-01-01

    Human peripheral blood-derived dendritic cells (DC) respond to a variety of chemical allergens by up-regulating expression of the co-stimulatory molecule CD86. It has been postulated that this measure might provide the basis for an in vitro alternative approach for the identification of skin sensitizing chemicals. We recently reported that DC, exposed in culture to the highest non-cytotoxic concentrations of various chemical allergens, displayed marginal up-regulation of membrane CD86 expression; the interpretation being that such changes were insufficiently sensitive for the purposes of hazard identification. For the work presented here, immature DC were derived from human monocytes and treated with the chemical allergens 2,4-dinitrobenzenesulfonic acid (DNBS), nickel sulfate (NiSO 4 ), p-phenylenediamine (PPD), Bandrowski's base (BB), hydroquinone (HQ) and propyl gallate (PG) for 48 h at concentrations which induced both no to slight to moderate cytotoxicity. For comparison, DC were treated with the irritants sodium dodecyl sulfate (SDS), benzoic acid (BA), and benzalkonium chloride (BZC) at concentrations resulting in comparable levels of cytotoxicity. CD86 expression, as measured by flow cytometry, was consistently up-regulated (ranging from 162 to 386% control) on DC treated with concentrations of chemical allergens that induced approximately 10-15% cytotoxicity. The irritants BA and BZC did not induce up-regulation of CD86 expression when tested at concentrations that induced similar levels of cytotoxicity. SDS, however, up-regulated CD86 expression to 125-138% of control in 2/4 preparations when tested at concentrations which induced similar toxicity. Our results confirm that chemical allergens up-regulate CD86 expression on blood-derived DC and illustrate further that up-regulation of CD86 surface marker expression is more robust when DC are treated with concentrations of chemical allergen that induce slight to moderate cytotoxicity

  9. A novel method for producing target cells and assessing cytotoxic T lymphocyte activity in outbred hosts

    Directory of Open Access Journals (Sweden)

    Bendinelli Mauro

    2009-03-01

    Full Text Available Abstract Background Cytotoxic T lymphocytes play a crucial role in the immunological control of microbial infections and in the design of vaccines and immunotherapies. Measurement of cytotoxic T lymphocyte activity requires that the test antigen is presented by target cells having the same or compatible class I major hystocompatibility complex antigens as the effector cells. Conventional assays use target cells labeled with 51chromium and infer cytotoxic T lymphocyte activity by measuring the isotope released by the target cells lysed following incubation with antigen-specific cytotoxic T lymphocytes. This assay is sensitive but needs manipulation and disposal of hazardous radioactive reagents and provides a bulk estimate of the reporter released, which may be influenced by spontaneous release of the label and other poorly controllable variables. Here we describe a novel method for producing target in outbred hosts and assessing cytotoxic T lymphocyte activity by flow cytometry. Results The method consists of culturing skin fibroblasts, immortalizing them with a replication defective clone of simian virus 40, and finally transducing them with a bicistronic vector encoding the target antigen and the reporter green fluorescent protein. When used in a flow cytometry-based assay, the target cells obtained with this method proved valuable for assessing the viral envelope protein specific cytotoxic T lymphocyte activity in domestic cats acutely or chronically infected with feline immunodeficiency virus, a lentivirus similar to human immunodeficiency virus and used as animal model for AIDS studies. Conclusion Given the versatility of the bicistronic vector used, its ability to deliver multiple and large transgenes in target cells, and its extremely wide cell specificity when pseudotyped with the vesicular stomatitis virus envelope protein, the method is potentially exploitable in many animal species.

  10. An in vitro evaluation of cytotoxicity of curcumin against human dental pulp fibroblasts

    Directory of Open Access Journals (Sweden)

    Praveenkumar S Mandrol

    2016-01-01

    Full Text Available Objective: The objective of this study was to evaluate the cytotoxicity of curcumin to primary dental pulp fibroblasts in vitro. Materials and Methods: Dental pulp fibroblasts from primary maxillary central incisors were cultured and used for cytotoxicity tests after the fourth passage. Ninety-five percent curcumin was diluted with dimethylsulfoxide to prepare 100%, 50%, and 25% concentrations. Each concentration of curcumin was added in triplicate into 96-well microtiter plate containing the fibroblast culture at 104/well. Cells without treatment served as a control group. The number of viable cells after 48 hrs incubation at 37°C in a humidified atmosphere of 5 % CO2 and 95 % air was determined by the 3-(4, 5-dimethyl-thiazol-2-yl-2, 5-diphenyl-tetrazolium bromide (MTT assay. The relative viability of pulp cells was expressed as color intensity of the number in the experimental wells relative to that of the control group. Absorbances were read at 492 nm on a microplate reader with a background subtraction at 620 nm. Results: Cell viability of primary dental pulp fibroblasts to 25%, 50%, and 100% curcumin concentration was 174%, 310%, and 317%, respectively. Conclusions: Curcumin promotes cell viability and induces proliferation of primary dental pulp fibroblasts and has the potential to be developed into an economical and reliable medicament for vital pulp therapy.

  11. Surface-dependent cytotoxicity on bacteria as a model for environmental stress of halloysite nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hyo-Jick, E-mail: hyojickchoi@gmail.com [National Institute for Nanotechnology, Nanotechnology Accelerator and Department of Chemical and Materials Engineering, University of Alberta (Canada); Stazak, Theodore J. [School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati (United States); Montemagno, Carlo D., E-mail: montemag@ualberta.ca [National Institute for Nanotechnology, Nanotechnology Accelerator and Department of Chemical and Materials Engineering, University of Alberta (Canada)

    2013-10-15

    This study examined the cytotoxicity of halloysite nanotubes (HNTs) by investigating physiological responses of Escherichia coli, from cell growth to protein expression. Surfaces of HNTs were modified by amine functionalization (NH{sub 2}-HNTs) or bovine serum albumin (BSA) coating and their cytotoxicity levels were compared with that of non-modified HNTs (Bare-HNTs). Bare- and NH{sub 2}-HNTs exhibited accelerated cell death rates at {>=}0.5 mg/ml of HNTs. It was also found that concentration as low as 0.01 mg/ml of HNTs exerted significant toxic effects on the bacterial cells. Cellular viability, metabolic activity, and DNA replication all decreased with increasing concentrations of Bare- and NH{sub 2}-HNTs. In contrast, 0.01 mg/ml of BSA-coated HNTs (BSA-HNTs) coated showed no evidence of cytotoxicity. Even at concentrations {<=}0.1 mg/ml, the cytocompatibility of BSA-HNTs was significantly better than those of Bare- and NH{sub 2}-HNTs, which was confirmed by the observation of (i) the same or similar levels of cell proliferation and cell viability to the control, and (ii) higher levels of metabolic activity and plasmid DNA replication than those of Bare- and NH{sub 2}-HNTs. In addition, higher ranaspumin-2 protein yield was observed from bacterial culture supplemented with BSA-HNTs (100, 83, and 80 % of yield at 0.01, 0.05, and 0.1 mg/ml, respectively, relative to the control). This work showed that the increase of bacterial cytotoxicity of HNTs correlated well with elevating HNT concentration and that surface modification of HNTs with amine functional group and BSA coating was an effective strategy to reduce cytotoxicity up to 0.1 mg/ml of HNTs.

  12. The Marine Guanidine Alkaloid Crambescidin 816 Induces Calcium Influx and Cytotoxicity in Primary Cultures of Cortical Neurons through Glutamate Receptors.

    Science.gov (United States)

    Mendez, Aida G; Juncal, Andrea Boente; Silva, Siguara B L; Thomas, Olivier P; Martín Vázquez, Víctor; Alfonso, Amparo; Vieytes, Mercedes R; Vale, Carmen; Botana, Luís M

    2017-07-19

    Crambescidin 816 is a guanidine alkaloid produced by the sponge Crambe crambe with known antitumoral activity. While the information describing the effects of this alkaloid in central neurons is scarce, Cramb816 is known to block voltage dependent calcium channels being selective for L-type channels. Moreover, Cramb816 reduced neuronal viability through an unknown mechanism. Here, we aimed to describe the toxic activity of Cramb816 in cortical neurons. Since calcium influx is considered the main mechanism responsible for neuronal cell death, the effects of Cramb816 in the cytosolic calcium concentration of cortical neurons were studied. The alkaloid decreased neuronal viability and induced a dose-dependent increase in cytosolic calcium that was also related to the presence of calcium in the extracellular media. The increase in calcium influx was age dependent, being higher in younger neurons. Moreover, this effect was prevented by glutamate receptor antagonists, which did not fully block the cytotoxic effect of Cramb816 after 24 h of treatment but completely prevented Cramb816 cytotoxicity after 10 min exposure. Therefore, the findings presented herein provide new insights into the cytotoxic effect of Cramb816 in cortical neurons.

  13. Fused pyrazine mono-N-oxides as bioreductive drugs. II cytotoxicity in human cells and oncogenicity in a rodent transformation assay

    International Nuclear Information System (INIS)

    Langmuir, Virginia K.; Laderoute, Keith R.; Mendonca, Holly L.; Sutherland, Robert M.; Hei, Tom K.; Liu, S.-X.; Hall, Eric J.; Naylor, Matthew A.; Adams, Gerald E.

    1996-01-01

    Purpose: To determine what structural moieties of the fused pyrazine mono-N-oxides are determining factors in their in vitro cytotoxicity and oncogenicity. Methods and Materials: A new series of experimental bioreductive drugs, fused pyrazine mono-N-oxides, was evaluated in vitro for aerobic and hypoxic cytotoxicity in the HT29 human colon adenocarcinoma cell line by using clonogenic assays. The relative oncogenicities of these compounds were also determined in aerobic cultures of C3H 10T1/2 mouse embryo fibroblasts by using a standard transformation assay. Results: Removal of the 4-methyl piperazine side chain from the parent compound, RB 90740, reduced the potency of the hypoxic cytotoxin. Reduction of the N-oxide function increased the aerobic cytotoxicity and eliminated most of the hypoxic/aerobic cytotoxic differential. The reduced N-oxide also had significant oncogenicity, consistent with a mechanism of genotoxicity following bioreduction of RB 90740. Conclusion: This new series of bioreductive compounds may be effective in cancer therapy, particularly the lead compound RB 90740. The oncogenic potential of these compounds is similar to that for other cancer therapies. Further studies should include evaluation of these compounds in vivo and the development of analogs with reduced oncogenic potential and retention of the hypoxic/aerobic cytotoxicity differential

  14. A generative inference framework for analysing patterns of cultural change in sparse population data with evidence for fashion trends in LBK culture.

    Science.gov (United States)

    Kandler, Anne; Shennan, Stephen

    2015-12-06

    Cultural change can be quantified by temporal changes in frequency of different cultural artefacts and it is a central question to identify what underlying cultural transmission processes could have caused the observed frequency changes. Observed changes, however, often describe the dynamics in samples of the population of artefacts, whereas transmission processes act on the whole population. Here we develop a modelling framework aimed at addressing this inference problem. To do so, we firstly generate population structures from which the observed sample could have been drawn randomly and then determine theoretical samples at a later time t2 produced under the assumption that changes in frequencies are caused by a specific transmission process. Thereby we also account for the potential effect of time-averaging processes in the generation of the observed sample. Subsequent statistical comparisons (e.g. using Bayesian inference) of the theoretical and observed samples at t2 can establish which processes could have produced the observed frequency data. In this way, we infer underlying transmission processes directly from available data without any equilibrium assumption. We apply this framework to a dataset describing pottery from settlements of some of the first farmers in Europe (the LBK culture) and conclude that the observed frequency dynamic of different types of decorated pottery is consistent with age-dependent selection, a preference for 'young' pottery types which is potentially indicative of fashion trends. © 2015 The Author(s).

  15. Cytotoxic constituents of ethyl acetate fraction from Dianthus superbus.

    Science.gov (United States)

    Ding, Chengli; Zhang, Wu; Li, Jie; Lei, Jiachuan; Yu, Jianqing

    2013-01-01

    The ethyl acetate fraction (EE-DS) from Dianthus superbus was found to possess the cytotoxic activity against cancer cells in previous study. To investigate cytotoxic constituents, the bioassay-guided isolation of compounds from EE-DS was performed. Two dianthramides (1 and 2), three flavonoids (3-5), two coumarins (6 and 7) and three other compounds (8-10) were obtained. Structures of isolated compounds were identified by spectroscopic analysis. Cytotoxicity of the compounds against HepG2 cells was evaluated. Compound 1 showed the strongest cytotoxicity, compounds 10, 4, 3 and 5 had moderate cytotoxicity.

  16. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    De Siervi, Adriana; Vazquez, Elba S; Rezaval, Carolina; Rossetti, María V; Batlle, Alcira M del [Centro de Investigaciones sobre Porfirinas y Porfirias (CIPYP), Argentine National Research Council (CONICET), Department of Biological Chemistry, FCEN, University of Buenos Aires (Argentina)

    2002-01-01

    Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA) and porphobilinogen (PBG). ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations.

  17. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    Directory of Open Access Journals (Sweden)

    del Batlle Alcira M

    2002-03-01

    Full Text Available Abstract Background Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA and porphobilinogen (PBG. ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. Results We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations.

  18. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    International Nuclear Information System (INIS)

    De Siervi, Adriana; Vazquez, Elba S; Rezaval, Carolina; Rossetti, María V; Batlle, Alcira M del

    2002-01-01

    Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA) and porphobilinogen (PBG). ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations

  19. Dietary heme induces acute oxidative stress, but delayed cytotoxicity and compensatory hyperproliferation in mouse colon

    NARCIS (Netherlands)

    IJssenagger, N.; Rijnierse, A.; Wit, de N.J.W.; Boekschoten, M.V.; Dekker, J.; Schonewille, A.; Müller, M.R.; Meer, van der M.

    2013-01-01

    Red meat consumption is associated with an increased colon cancer risk. Heme, present in red meat, injures the colon surface epithelium by generating cytotoxic and oxidative stress. Recently, we found that this surface injury is compensated by hyperproliferation and hyperplasia of crypt cells, which

  20. Cytotoxicity effects of water dispersible oxidized multiwalled carbon nanotubes on marine alga, Dunaliella tertiolecta

    International Nuclear Information System (INIS)

    Wei Liping; Thakkar, Megha; Chen Yuhong; Ntim, Susana Addo; Mitra, Somenath; Zhang Xueyan

    2010-01-01

    The multiwalled carbon nanotubes (MWNTs) are novel materials with many potential applications. The ecotoxicity of these materials is not well studied, but it is essential for environmental impact assessments. In this study a commercially available MWNT material was carboxylated by microwave assisted acid oxidation. This functionalized MWNT (f-MWNT) material was examined for toxicity effects using unicellular marine green alga Dunaliella tertiolecta. D. tertiolecta was exposed to f-MWNT which had been pre-equilibrated with culture media for 24 h. Substantial growth lag phase was observed at 5 and 10 mg L -1 f-MWNT, and the resulting 50% effective concentration (EC50) on 96-h growth was 0.82 ± 0.08 mg L -1 . During mid-exponential growth phase cytotoxicity was evidenced at 10 mg L -1 f-MWNT in 36% reduction in exponential growth rate, 88 mV more positive glutathione redox potential (indicative of oxidative stress), 5% and 22% reduction in photosystem II (PSII) quantum yield and functional cross section respectively, all relative to the control cultures. However, when the large f-MWNT aggregates in the media with 10 mg L -1 f-MWNT were removed by 0.2 μm filtration, D. tertiolecta did not show significant cytotoxicity effects in any of the above parameters. This suggests that the cytotoxicity effects originated predominately from the large f-MWNT aggregates. Analysis of the f-MWNT aggregation dynamics suggests active interaction between f-MWNT and algal cells or cell metabolites that promoted f-MWNT aggregation formation. The f-MWNT particles were also found absorbed on algal cell surface. The direct contact between f-MWNT and cell surface was likely responsible for reduced PSII functional cross section and oxidative stress during exponential growth.

  1. Quantitative structure-cytotoxicity relationship of phenylpropanoid amides.

    Science.gov (United States)

    Shimada, Chiyako; Uesawa, Yoshihiro; Ishihara, Mariko; Kagaya, Hajime; Kanamoto, Taisei; Terakubo, Shigemi; Nakashima, Hideki; Takao, Koichi; Saito, Takayuki; Sugita, Yoshiaki; Sakagami, Hiroshi

    2014-07-01

    A total of 12 phenylpropanoid amides were subjected to quantitative structure-activity relationship (QSAR) analysis, based on their cytotoxicity, tumor selectivity and anti-HIV activity, in order to investigate on their biological activities. Cytotoxicity against four human oral squamous cell carcinoma (OSCC) cell lines and three human oral normal cells was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. Tumor selectivity was evaluated by the ratio of the mean CC50 (50% cytotoxic concentration) against normal oral cells to that against OSCC cell lines. Anti-HIV activity was evaluated by the ratio of CC50 to EC50 (50% cytoprotective concentration from HIV infection). Physicochemical, structural, and quantum-chemical parameters were calculated based on the conformations optimized by the LowModeMD method followed by density functional theory (DFT) method. Twelve phenylpropanoid amides showed moderate cytotoxicity against both normal and OSCC cell lines. N-Caffeoyl derivatives coupled with vanillylamine and tyramine exhibited relatively higher tumor selectivity. Cytotoxicity against normal cells was correlated with descriptors related to electrostatic interaction such as polar surface area and chemical hardness, whereas cytotoxicity against tumor cells correlated with free energy, surface area and ellipticity. The tumor-selective cytotoxicity correlated with molecular size (surface area) and electrostatic interaction (the maximum electrostatic potential). The molecular size, shape and ability for electrostatic interaction are useful parameters for estimating the tumor selectivity of phenylpropanoid amides. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  2. Microstructure and cytotoxicity evaluation of duplex-treated silver-containing antibacterial TiO2 coatings

    International Nuclear Information System (INIS)

    Zhang, Xiangyu; Wu, Haibo; Geng, Zhenhua; Huang, Xiaobo; Hang, Ruiqiang; Ma, Yong; Yao, Xiaohong; Tang, Bin

    2014-01-01

    Implant-related infection is one of the most common and serious complications associated with biomedical implantation. To prevent bacterial adhesion, a series of porous TiO 2 coatings with different concentrations of silver (designated as M0, M1, M2 and M3) were prepared on pure titanium substrates by a duplex-treatment technique combining magnetron sputtering with micro-arc oxidation. All coatings are porous with pore size less than 5 μm and the concentrations of silver in the M0, M1, M2 and M3 are 0, 0.95, 1.36 and 1.93 wt.%, respectively. Silver is found to be distributed throughout the thickness of the coatings by scanning electron microscopy. The release of silver from the TiO 2 coatings was confirmed by an inductively-coupled plasma mass spectroscopy. The antibacterial effects of these coatings were tested against Gram-positive Staphylococcus aureus (S. aureus) and Gram-negative Escherichia coli (E. coli), and the cytotoxicity was evaluated using the mouse pre-osteoblast cells. The results indicate that the antibacterial activities of TiO 2 coatings are greatly improved due to the incorporation of silver. No cytotoxic effect is found for the M1 surfaces from the observation of pre-osteoblast cell by MTT assay and fluorescence microscopy. Although the M2 and M3 coatings appeared to be toxic for pre-osteoblast cells after 1 day in culture, the cell viability on M2 and M3 surfaces was greatly raised after culturing for 2 days. Our results suggested that the TiO 2 coatings incorporated with an optimum amount of silver can possess excellent antibacterial activities without cytotoxic effect, which has promising applications in biomedical devices. - Highlights: • Porous TiO 2 coatings with various concentration of Ag on titanium were prepared. • Ag element was distributed throughout the thickness of the coatings. • The antibacterial activities were greatly improved due to the incorporation of Ag. • The release amounts of Ag were initially high and gradually

  3. Macrophage activation by a vanadyl-aspirin complex is dependent on L-type calcium channel and the generation of nitric oxide

    International Nuclear Information System (INIS)

    Molinuevo, Maria Silvina; Etcheverry, Susana Beatriz; Cortizo, Ana Maria

    2005-01-01

    Bone homeostasis is the result of a tight balance between bone resorption and bone formation where macrophage activation is believed to contribute to bone resorption. We have previously shown that a vanadyl(IV)-aspirin complex (VOAspi) regulates cell proliferation and differentiation of osteoblasts in culture. In this study, we assessed VOAspi and VO effects and their possible mechanism of action on a mouse macrophage cell line RAW 264.7. Both vanadium compounds inhibited cell proliferation in a dose-dependent manner. Nifedipine completely reversed the VOAspi-induced macrophage cytotoxicity, while it could not block the effect of VO. VOAspi also stimulated nitric oxide (NO) production, the oxidation of dihydrorhodamine 123 (DHR-123) and enhanced the expression of both constitutive and inducible isoforms of nitric oxide syntases (NOS). All these effects were abolished by nifedipine. Althogether our finding give evidence that VOAspi-induced macrophage cytotoxicity is dependent on L-type calcium channel and the generation of NO though the induction of eNOS and iNOS. Contrary, the parent compound VO exerted a cytotoxic effect by mechanisms independent of a calcium entry and the NO/NOS activation

  4. Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II peptide-pulsed DCs

    Directory of Open Access Journals (Sweden)

    Satthaporn Sukchai

    2009-03-01

    Full Text Available Abstract Background Optimal techniques for DC generation for immunotherapy in cancer are yet to be established. Study aims were to evaluate: (i DC activation/maturation milieu (TNF-α +/- IFN-α and its effects on CD8+ hTERT-specific T cell responses to class I epitopes (p540 or p865, (ii CD8+ hTERT-specific T cell responses elicited by vaccination with class I alone or both class I and II epitope (p766 and p672-pulsed DCs, prepared without IFN-α, (iii association between circulating T regulatory cells (Tregs and clinical responses. Methods Autologous DCs were generated from 10 patients (HLA-0201 with advanced cancer by culturing CD14+ blood monocytes in the presence of GM-CSF and IL-4 supplemented with TNF-α [DCT] or TNF-α and IFN-α [DCTI]. The capacity of the DCs to induce functional CD8+ T cell responses to hTERT HLA-0201 restricted nonapeptides was assessed by MHC tetramer binding and peptide-specific cytotoxicity. Each DC preparation (DCT or DCTI was pulsed with only one type of hTERT peptide (p540 or p865 and both preparations were injected into separate lymph node draining regions every 2–3 weeks. This vaccination design enabled comparison of efficacy between DCT and DCTI in generating hTERT peptide specific CD8+ T cells and comparison of class I hTERT peptide (p540 or p865-loaded DCT with or without class II cognate help (p766 and p672 in 6 patients. T regulatory cells were evaluated in 8 patients. Results (i DCTIs and DCTs, pulsed with hTERT peptides, were comparable (p = 0.45, t-test in inducing peptide-specific CD8+ T cell responses. (ii Class II cognate help, significantly enhanced (p (iii Clinical responders had significantly lower (p Conclusion Addition of IFN-α to ex vivo monocyte-derived DCs, did not significantly enhance peptide-specific T cell responses in vivo, compared with TNF-α alone. Class II cognate help significantly augments peptide-specific T cell responses. Clinically favourable responses were seen in patients

  5. Synthesis of Key Fragments of Amphidinolide Q — A Cytotoxic 12-membered Macrolide

    Directory of Open Access Journals (Sweden)

    Kohei Kawa

    2011-06-01

    Full Text Available b-Hydroxy aldehyde and alkyl ketone moieties were effectively synthesized as key intermediates of amphidinolide Q, a cytotoxic macrolide from the cultured dinoflagellate Amphidinium sp.. The asymmetric center of the former derivative was produced by Sharpless asymmetric epoxidation, followed by E-selective 1,4-addition to give the sp2 methyl group. Derivatization of the L-ascorbic acid derivative by Evans asymmetric alkylation and Peterson olefination provided the latter intermediate. The coupling reaction of the segments was examined.

  6. A Comparison between the Cytotoxicity Induced by Gossypol in Two Testicular Cell Lines

    OpenAIRE

    Neda MahdinezhadGorji; SeyedGholamAli Jorsaraei; Vida Hojati; Ebrahim Zabihi; Asieh Khalilpour; Zainab Abedian; Eisa Tahmasbpour

    2014-01-01

    Background: Gossypol is a yellow toxic pigment from the cottonseed that can cause acute or chronic toxicity in humans and animals by affecting the testicular tissues. Nowadays cottonseed is used as food supplement for ruminants specially the sheep. In this study, two different stem cell lines of testicular tissue including GC1-spg (mouse testis) and SFTF-PI43 (sheep testis) cells were used to evaluation of gossypol cytotoxicity. Methods: The GC-1spg and the SFTF_PI43 cells were cultured in...

  7. In vitro bacterial cytotoxicity of CNTs: reactive oxygen species mediate cell damage edges over direct physical puncturing.

    Science.gov (United States)

    Rajavel, Krishnamoorthy; Gomathi, Rajkumar; Manian, Sellamuthu; Rajendra Kumar, Ramasamy Thangavelu

    2014-01-21

    Understanding the bacterial cytotoxicity of CNTs is important for a wide variety of applications in the biomedical, environmental, and health sectors. A majority of the earlier reports attributed the bactericidal cytotoxicity of CNTs to bacterial cell membrane damage by direct physical puncturing. Our results reveal that bacterial cell death via bacterial cell membrane damage is induced by reactive oxygen species (ROS) produced from CNTs and is not due to direct physical puncturing by CNTs. To understand the actual mechanism of bacterial killing, we elucidated the bacterial cytotoxicity of SWCNTs and MWCNTs against Gram-negative human pathogenic bacterial species Escherichia coli, Shigella sonnei, Klebsiella pneumoniae, and Pseudomonas aeruginosa and its amelioration upon functionalizing the CNTs with antioxidant tannic acid (TA). Interestingly, the bacterial cells treated with CNTs exhibited severe cell damage under laboratory (ambient) and sunlight irradiation conditions. However, CNTs showed no cytotoxicity to the bacterial cells when incubated in the dark. The quantitative assessments carried out by us made it explicit that CNTs are effective generators of ROS such as (1)O2, O2(•-), and (•)OH in an aqueous medium under both ambient and sunlight-irradiated conditions. Both naked and TA-functionalized CNTs showed negligible ROS production in the dark. Furthermore, strong correlations were obtained between ROS produced by CNTs and the bacterial cell mortality (with the correlation coefficient varying between 0.7618 and 0.9891) for all four tested pathogens. The absence of bactericidal cytotoxicity in both naked and functionalized CNTs in the dark reveals that the presence of ROS is the major factor responsible for the bactericidal action compared to direct physical puncturing. This understanding of the bactericidal activity of the irradiated CNTs, mediated through the generation of ROS, could be interesting for novel applications such as regulated ROS delivery

  8. The enhanced cytotoxicity of misonidazole in the thiol depleted state - An oxygen dependent mechanism

    International Nuclear Information System (INIS)

    Tuttle, S.W.; Varnes, M.E.; Donahue, L.; Biaglow, J.E.

    1985-01-01

    Incubating A549 cells in the presence of L-buthionine-S, R-sulfoximine and misonidazole under aerobic conditions results in lowered rates of cell growth and greater cytotoxicity than is seen with either drug alone. The authors previously demonstrated the accumulation of hydrogen peroxide from cells treated with misonidazole following the inhibition of GSH-peroxidase with thiol depleting agents. They hypothesize that the enhancement of misonidazole toxicity by L-BSO results from the increased exposure to hydrogen peroxide, and the possible formation of the highly reactive hydroxyl radical in the presence of trace metals via Fenton chemistry. Support for this hypothesis comes from their observations that addition of radical scavengers (such as SOD and catalase) and nutritional antioxidants (vitamin E) to the culture medium will partially inhibit the cytotoxic effects. Further work is being done to measure the products of reaction of toxic oxygen species with cellular macromolecules, i.e. lipids

  9. Cytotoxicity and accumulation of ergot alkaloids in human primary cells.

    Science.gov (United States)

    Mulac, Dennis; Humpf, Hans-Ulrich

    2011-04-11

    Ergot alkaloids are secondary metabolites produced by fungi of the species Claviceps. Toxic effects after consumption of contaminated grains are described since mediaeval times. Of the more than 40 known ergot alkaloids six are found predominantly. These are ergotamine, ergocornine, ergocryptine, ergocristine, ergosine and ergometrine, along with their corresponding isomeric forms (-inine-forms). Toxic effects are known to be induced by an interaction of the ergot alkaloids as neurotransmitters, like dopamine or serotonin. Nevertheless data concerning cytotoxic effects are missing and therefore a screening of the six main ergot alkaloids was performed in human primary cells in order to evaluate the toxic potential. As it is well known that ergot alkaloids isomerize easily the stability was tested in the cell medium. Based on these results factors were calculated to correct the used concentration values to the biologically active lysergic (-ine) form. These factors range from 1.4 for the most stable compound ergometrine to 5.0 for the most unstable ergot alkaloid ergocristine. With these factors, reflecting the instability, several controverse literature data concerning the toxicity could be explained. To evaluate the cytotoxic effects of ergot alkaloids, human cells in primary culture were used. These cells remain unchanged in contrast to cell lines and the data allow a better comparison to the in vivo situation than using immortalized cell lines. To characterize the effects on primary cells, renal proximal tubule epithelial cells (RPTEC) and normal human astrocytes (NHA) were used. The parameters necrosis (LDH-release) and apoptosis (caspase-3-activation, DNA condensation and fragmentation) were distinguished. The results show that depending on the individual structure of the peptide ergot alkaloids the toxic properties change. While ergometrine as a lysergic acid amide did not show any effect, the peptide ergot alkaloids revealed a different toxic potential. Of

  10. A new cytotoxic sterol methoxymethyl ether from a deep water marine sponge Scleritoderma sp. cf. paccardi.

    Science.gov (United States)

    Gunasekera, S P; Kelly-Borges, M; Longley, R E

    1996-02-01

    24(R)-Methyl-5 alpha-cholest-7-enyl 3 beta-methoxymethyl ether (1), a new sterol ether, has been isolated from a deep-water marine sponge Scleritoderma sp. cf. paccardi. Compound 1 exhibited in vitro cytotoxicity against the cultured murine P-388 tumor cell line with an IC50 of 2.3 micrograms/mL. The isolation and structure elucidation of 1 by NMR spectroscopy is described.

  11. Sex steroids do not affect shigatoxin cytotoxicity on human renal tubular or glomerular cells

    Directory of Open Access Journals (Sweden)

    Kohan Donald E

    2002-08-01

    Full Text Available Abstract Background The greater susceptibility of children to renal injury in post-diarrheal hemolytic-uremic syndrome (HUS may be related, at least in part, to heightened renal cell sensitivity to the cytotoxic effect of Shiga toxin (Stx, the putative mediator of kidney damage in HUS. We hypothesized that sexual maturation, which coincides with a falling incidence of HUS, may induce a relatively Stx-resistant state in the renal cells. Methods Cultured human glomerular endothelial (HGEN, human glomerular visceral epithelial (HGEC and human proximal tubule (HPT cells were exposed to Stx-1 after pre-incubation with progesterone, β-estradiol or testosterone followed by determination of cytotoxicity. Results Under basal conditions, Stx-1 potently and dose-dependently killed HPT and HGEC, but had relatively little effect on HGEN. Pre-incubation for 1, 2 or 7 days with physiologic or pharmacologic concentrations of progesterone, β-estradiol or testosterone had no effect on Stx-1 cytotoxicity dose-response on any cell type. In addition, no steroid altered Gb3 expression (Stx receptor by any cell type at any time point. Conclusion These data do not support the notion that hormonal changes associated with puberty induce an Stx-resistant state within kidney cells.

  12. Cellular cytotoxic response induced by highly purified multi-wall carbon nanotube in human lung cells.

    Science.gov (United States)

    Tsukahara, Tamotsu; Haniu, Hisao

    2011-06-01

    Carbon nanotubes, a promising nanomaterial with unique characteristics, have applications in a variety of fields. The cytotoxic effects of carbon nanotubes are partially due to the induction of oxidative stress; however, the detailed mechanisms of nanotube cytotoxicity and their interaction with cells remain unclear. In this study, the authors focus on the acute toxicity of vapor-grown carbon fiber, HTT2800, which is one of the most highly purified multi-wall carbon nanotubes (MWCNT) by high-temperature thermal treatment. The authors exposed human bronchial epithelial cells (BEAS-2B) to HTT2800 and measured the cellular uptake, mitochondrial function, cellular LDH release, apoptotic signaling, reactive oxygen species (ROS) generation and pro-inflammatory cytokine release. The HTT2800-exposed cells showed cellular uptake of the carbon nanotube, increased cell death, enhanced DNA damage, and induced cytokine release. However, the exposed cells showed no obvious intracellular ROS generation. These cellular and molecular findings suggest that HTT2800 could cause a potentially adverse inflammatory response in BEAS-2B cells.

  13. Generation of Functional Thyroid Tissue Using 3D-Based Culture of Embryonic Stem Cells.

    Science.gov (United States)

    Antonica, Francesco; Kasprzyk, Dominika Figini; Schiavo, Andrea Alex; Romitti, Mírian; Costagliola, Sabine

    2017-01-01

    During the last decade three-dimensional (3D) cultures of pluripotent stem cells have been intensively used to understand morphogenesis and molecular signaling important for the embryonic development of many tissues. In addition, pluripotent stem cells have been shown to be a valid tool for the in vitro modeling of several congenital or chronic human diseases, opening new possibilities to study their physiopathology without using animal models. Even more interestingly, 3D culture has proved to be a powerful and versatile tool to successfully generate functional tissues ex vivo. Using similar approaches, we here describe a protocol for the generation of functional thyroid tissue using mouse embryonic stem cells and give all the details and references for its characterization and analysis both in vitro and in vivo. This model is a valid approach to study the expression and the function of genes involved in the correct morphogenesis of thyroid gland, to elucidate the mechanisms of production and secretion of thyroid hormones and to test anti-thyroid drugs.

  14. [3H]uridine uptake by target monolayers as a terminal label in an in vitro cell-mediated cytotoxicity assay

    International Nuclear Information System (INIS)

    Smith, G.; Nicklin, S.

    1979-01-01

    A terminal labelling method is described for measuring cell-mediated cytotoxicity based on the ability of surviving target cells to incorporate [ 3 H]uridine into their RNA precursor pools. Parameters of the system were examined using whole and damaged embryonic mouse fibroblast monolayers. This assay is less laborious than direct cell counting and gives increased sensitivity at low target to effector cell ratios. The labelling time is short and, unlike similar techniques, it allows target cell monolayers to remain intact after completion of the radioassay and available for histological examination. This is important where heterogeneous target populations are employed since it allows assessment of differential cell killing and eliminates the need for duplicate cultures. The assay was used in conjunction with a well defined mouse popliteal lymph node assay to investigate the appearance of cytotoxic cells during a localised graft versus host response. Results showed a direct correlation between proliferative index and the development of highly specific cell-mediated cytotoxicity. (Auth.)

  15. Generation of Tumor Antigen-Specific iPSC-Derived Thymic Emigrants Using a 3D Thymic Culture System

    Directory of Open Access Journals (Sweden)

    Raul Vizcardo

    2018-03-01

    Full Text Available Summary: Induced pluripotent stem cell (iPSC-derived T cells may provide future therapies for cancer patients, but those generated by current methods, such as the OP9/DLL1 system, have shown abnormalities that pose major barriers for clinical translation. Our data indicate that these iPSC-derived CD8 single-positive T cells are more like CD4+CD8+ double-positive T cells than mature naive T cells because they display phenotypic markers of developmental arrest and an innate-like phenotype after stimulation. We developed a 3D thymic culture system to avoid these aberrant developmental fates, generating a homogeneous subset of CD8αβ+ antigen-specific T cells, designated iPSC-derived thymic emigrants (iTEs. iTEs exhibit phenotypic and functional similarities to naive T cells both in vitro and in vivo, including the capacity for expansion, memory formation, and tumor suppression. These data illustrate the limitations of current methods and provide a tool to develop the next generation of iPSC-based antigen-specific immunotherapies. : A barrier for clinical application of iPSC-derived CD8 T cells using OP9/DLL1 is their abnormal biology. Vizcardo et al. show that a 3D thymic culture system enables the generation of a homogeneous antigen-specific T cell subset, named iTEs, which closely mimics naive T cells and exhibits potent anti-tumor activity. Keywords: thymopoiesis, T cell differentiation, iPSC differentiation, adoptive cell transfer, naïve T cell, recent rhymic emigrants, fetal thymus organ culture, immunotherapy, 3D culture, tumor antigen specific T cell

  16. Persea americana Glycolic Extract: In Vitro Study of Antimicrobial Activity against Candida albicans Biofilm and Cytotoxicity Evaluation

    Directory of Open Access Journals (Sweden)

    D. Jesus

    2015-01-01

    Full Text Available This study evaluated the antifungal activity of Persea americana extract on Candida albicans biofilm and its cytotoxicity in macrophage culture (RAW 264.7. To determine the minimum inhibitory concentration (MIC, microdilution in broth (CLSI M27-S4 protocol was performed. Thereafter, the concentrations of 12.5, 25, 50, 100, and 200 mg/mL (n=10 with 5 min exposure were analyzed on mature biofilm in microplate wells for 48 h. Saline was used as control (n=10. After treatment, biofilm cells were scraped off and dilutions were plated on Sabouraud dextrose agar. After incubation (37°C/48 h, the values of colony forming units per milliliter (CFU/mL were converted to log10 and analyzed (ANOVA and Tukey test, 5%. The cytotoxicity of the P. americana extract was evaluated on macrophages by MTT assay. The MIC of the extract was 6.25 mg/mL and with 12.5 mg/mL there was elimination of 100% of planktonic cultures. Regarding the biofilms, a significant reduction (P<0.001 of the biofilm at concentrations of 50 (0.580±0.209 log10, 100 (0.998±0.508 log10, and 200 mg/mL (1.093±0.462 log10 was observed. The concentrations of 200 and 100 mg/mL were cytotoxic for macrophages, while the concentrations of 50, 25, and 12.5 mg/mL showed viability higher than 55%.

  17. Protective Effect of Edaravone against Carbon Monoxide Induced Apoptosis in Rat Primary Cultured Astrocytes

    Directory of Open Access Journals (Sweden)

    Xiaodan Xu

    2017-01-01

    Full Text Available Objective. To observe the protective effect of edaravone (Eda on astrocytes after prolonged exposure to carbon monoxide (CO and further to investigate the potential mechanisms of Eda against CO-induced apoptosis. Methods. The rat primary cultured astrocytes were cultured in vitro and exposed to 1% CO for 24 h after being cultured with different concentrations of Eda. MTT assay was used to detect the cytotoxicity of CO. Flow cytometry was used to detect the apoptosis rate, membrane potential of mitochondria, and ROS level. The mRNA and protein expressions of Bcl-2, Bax, and caspase-3 were assessed by real-time PCR and Western blotting analysis, respectively. Results. Eda can significantly suppress cytotoxicity of CO, and it can significantly increase membrane potential of mitochondria and Bcl-2 expressions and significantly suppress the apoptosis rate, ROS level, Bax, and caspase-3 expressions. Conclusion. Eda protects against CO-induced apoptosis in rat primary cultured astrocytes through decreasing ROS production and subsequently inhibiting mitochondrial apoptosis pathway.

  18. The antioxidant properties, cytotoxicity and monoamine oxidase ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... and the nitroblue tetrazolium (NBT) assay. The cytotoxicity ... The antioxidant activity and cytotoxic effect of the extracts increased with increase ... supplements are concoctions of plants and/or plant .... In vitro antioxidant assay.

  19. Nickel (II)-induced cytotoxicity and apoptosis in human proximal tubule cells through a ROS- and mitochondria-mediated pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yi-Fen; Shyu, Huey-Wen [Department of Medical Laboratory Sciences and Biotechnology, Fooyin University, Kaohsiung, Taiwan (China); Chang, Yi-Chuang [Department of Nursing, Fooyin University, Kaohsiung, Taiwan (China); Tseng, Wei-Chang [Department of Medical Laboratory Sciences and Biotechnology, Fooyin University, Kaohsiung, Taiwan (China); Huang, Yeou-Lih [Department of Medical Laboratory Science and Biotechnology, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Lin, Kuan-Hua; Chou, Miao-Chen; Liu, Heng-Ling [Department of Medical Laboratory Sciences and Biotechnology, Fooyin University, Kaohsiung, Taiwan (China); Chen, Chang-Yu, E-mail: mt037@mail.fy.edu.tw [Department of Medical Laboratory Sciences and Biotechnology, Fooyin University, Kaohsiung, Taiwan (China)

    2012-03-01

    Nickel compounds are known to be toxic and carcinogenic in kidney and lung. In this present study, we investigated the roles of reactive oxygen species (ROS) and mitochondria in nickel (II) acetate-induced cytotoxicity and apoptosis in the HK-2 human renal cell line. The results showed that the cytotoxic effects of nickel (II) involved significant cell death and DNA damage. Nickel (II) increased the generation of ROS and induced a noticeable reduction of mitochondrial membrane potential (MMP). Analysis of the sub-G1 phase showed a significant increase in apoptosis in HK-2 cells after nickel (II) treatment. Pretreatment with N-acetylcysteine (NAC) not only inhibited nickel (II)-induced cell death and DNA damage, but also significantly prevented nickel (II)-induced loss of MMP and apoptosis. Cell apoptosis triggered by nickel (II) was characterized by the reduced protein expression of Bcl-2 and Bcl-xL and the induced the protein expression of Bad, Bcl-Xs, Bax, cytochrome c and caspases 9, 3 and 6. The regulation of the expression of Bcl-2-family proteins, the release of cytochrome c and the activation of caspases 9, 3 and 6 were inhibited in the presence of NAC. These results suggest that nickel (II) induces cytotoxicity and apoptosis in HK-2 cells via ROS generation and that the mitochondria-mediated apoptotic signaling pathway may be involved in the positive regulation of nickel (II)-induced renal cytotoxicity.

  20. Nickel (II)-induced cytotoxicity and apoptosis in human proximal tubule cells through a ROS- and mitochondria-mediated pathway

    International Nuclear Information System (INIS)

    Wang, Yi-Fen; Shyu, Huey-Wen; Chang, Yi-Chuang; Tseng, Wei-Chang; Huang, Yeou-Lih; Lin, Kuan-Hua; Chou, Miao-Chen; Liu, Heng-Ling; Chen, Chang-Yu

    2012-01-01

    Nickel compounds are known to be toxic and carcinogenic in kidney and lung. In this present study, we investigated the roles of reactive oxygen species (ROS) and mitochondria in nickel (II) acetate-induced cytotoxicity and apoptosis in the HK-2 human renal cell line. The results showed that the cytotoxic effects of nickel (II) involved significant cell death and DNA damage. Nickel (II) increased the generation of ROS and induced a noticeable reduction of mitochondrial membrane potential (MMP). Analysis of the sub-G1 phase showed a significant increase in apoptosis in HK-2 cells after nickel (II) treatment. Pretreatment with N-acetylcysteine (NAC) not only inhibited nickel (II)-induced cell death and DNA damage, but also significantly prevented nickel (II)-induced loss of MMP and apoptosis. Cell apoptosis triggered by nickel (II) was characterized by the reduced protein expression of Bcl-2 and Bcl-xL and the induced the protein expression of Bad, Bcl-Xs, Bax, cytochrome c and caspases 9, 3 and 6. The regulation of the expression of Bcl-2-family proteins, the release of cytochrome c and the activation of caspases 9, 3 and 6 were inhibited in the presence of NAC. These results suggest that nickel (II) induces cytotoxicity and apoptosis in HK-2 cells via ROS generation and that the mitochondria-mediated apoptotic signaling pathway may be involved in the positive regulation of nickel (II)-induced renal cytotoxicity.

  1. The Use of Xanthan Gum as Vaccine Adjuvant: An Evaluation of Immunostimulatory Potential in BALB/c Mice and Cytotoxicity In Vitro.

    Science.gov (United States)

    Schuch, Rodrigo Andrade; Oliveira, Thaís Larré; Collares, Thaís Farias; Monte, Leonardo Garcia; Inda, Guilherme Roig; Dellagostin, Odir Antonio; Vendruscolo, Claire Tondo; Moreira, Angelita da Silveira; Hartwig, Daiane Drawanz

    2017-01-01

    The successful production of new, safe, and effective vaccines that generate immunological memory is directly related to adjuvant feature, which is responsible for increasing and/or modulating the immune response. Several compounds display adjuvant activity, including carbohydrates. These compounds play important roles in the immune response, as well as having biocompatible properties in vaccine formulations. One such carbohydrate is xanthan gum, a polysaccharide that is produced by the plant-pathogenic bacterium Xanthomonas spp., which has adjuvant attributes. This study evaluated the immune response induced by xanthan gum associated with ovalbumin in BALB/c mice, which were subcutaneously immunized, in terms of antibody production (IgG1, IgG2a, IgG2b, and IgG3), and assessed the levels of IFN- γ in the splenocyte culture using indirect ELISA. Furthermore, we investigated in vitro cytotoxicity of xanthan in the embryo fibroblasts cell line of the NIH/3T3 mouse by MTT assay and propidium iodide uptake assay. The mice immunized with ovalbumin plus xanthan gum exhibited higher antibody IgG1 responses than control groups. Furthermore, the xanthan polysaccharide was capable of increasing the immunogenicity of antigens by producing IFN- γ and did not exhibit cytotoxicity effects in NIH/3T3 mouse fibroblast cells, considered a promising candidate for vaccine adjuvant.

  2. The Use of Xanthan Gum as Vaccine Adjuvant: An Evaluation of Immunostimulatory Potential in BALB/c Mice and Cytotoxicity In Vitro

    Directory of Open Access Journals (Sweden)

    Rodrigo Andrade Schuch

    2017-01-01

    Full Text Available The successful production of new, safe, and effective vaccines that generate immunological memory is directly related to adjuvant feature, which is responsible for increasing and/or modulating the immune response. Several compounds display adjuvant activity, including carbohydrates. These compounds play important roles in the immune response, as well as having biocompatible properties in vaccine formulations. One such carbohydrate is xanthan gum, a polysaccharide that is produced by the plant-pathogenic bacterium Xanthomonas spp., which has adjuvant attributes. This study evaluated the immune response induced by xanthan gum associated with ovalbumin in BALB/c mice, which were subcutaneously immunized, in terms of antibody production (IgG1, IgG2a, IgG2b, and IgG3, and assessed the levels of IFN-γ in the splenocyte culture using indirect ELISA. Furthermore, we investigated in vitro cytotoxicity of xanthan in the embryo fibroblasts cell line of the NIH/3T3 mouse by MTT assay and propidium iodide uptake assay. The mice immunized with ovalbumin plus xanthan gum exhibited higher antibody IgG1 responses than control groups. Furthermore, the xanthan polysaccharide was capable of increasing the immunogenicity of antigens by producing IFN-γ and did not exhibit cytotoxicity effects in NIH/3T3 mouse fibroblast cells, considered a promising candidate for vaccine adjuvant.

  3. In vitro cytotoxicity assessment of nanodiamond particles and their osteogenic potential.

    Science.gov (United States)

    Ibrahim, Mohamed; Xue, Ying; Ostermann, Melanie; Sauter, Alexander; Steinmueller-Nethl, Doris; Schweeberg, Sarah; Krueger, Anke; Cimpan, Mihaela R; Mustafa, Kamal

    2018-02-16

    Scaffolds functionalized with nanodiamond particles (nDP) hold great promise with regard to bone tissue formation in animal models. Degradation of the scaffolds over time may leave nDP within the tissues, raising concerns about possible long-term unwanted effects. Human SaOS-2 osteoblast-like cells and U937 monoblastoid cells were exposed to five different concentrations (0.002-2 mg/L) of nDP (size range: 2.36-4.42 nm) for 24 h. Cell viability was assessed by impedance-based methods. The differential expression of stress and toxicity-related genes was evaluated by polymerase chain reaction (PCR) super-array, while the expression of selected inflammatory and cell death markers was determined by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Furthermore, the expression of osteogenic genes by SaOS-2 cells, alkaline phosphatase activity and the extracellular calcium nodule deposition in response to nDP were determined in vitro. Cells responded differently to higher nDP concentrations (≥0.02 mg/L), that is, no loss of viability for SaOS-2 cells and significantly reduced viability for U937 cells. Gene expression showed significant upregulation of several cell death and inflammatory markers, among other toxicity reporter genes, indicating inflammatory and cytotoxic responses in U937 cells. Nanodiamond particles improved the osteogenicity of osteoblast-like cells with no evident cytotoxicity. However, concentration-dependent cytotoxic and inflammatory responses were seen in the U937 cells, negatively affecting osteogenicity in co-cultures. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A, 2018. © 2018 Wiley Periodicals, Inc.

  4. Involvement of ER stress and activation of apoptotic pathways in fisetin induced cytotoxicity in human melanoma.

    Science.gov (United States)

    Syed, Deeba N; Lall, Rahul K; Chamcheu, Jean Christopher; Haidar, Omar; Mukhtar, Hasan

    2014-12-01

    The prognosis of malignant melanoma remains poor in spite of recent advances in therapeutic strategies for the deadly disease. Fisetin, a dietary flavonoid is currently being investigated for its growth inhibitory properties in various cancer models. We previously showed that fisetin inhibited melanoma growth in vitro and in vivo. Here, we evaluated the molecular basis of fisetin induced cytotoxicity in metastatic human melanoma cells. Fisetin treatment induced endoplasmic reticulum (ER) stress in highly aggressive A375 and 451Lu human melanoma cells, as revealed by up-regulation of ER stress markers including IRE1α, XBP1s, ATF4 and GRP78. Time course analysis indicated that the ER stress was associated with activation of the extrinsic and intrinsic apoptotic pathways. Fisetin treated 2-D melanoma cultures displayed autophagic response concomitant with induction of apoptosis. Prolonged treatment (16days) with fisetin in a 3-D reconstituted melanoma model resulted in inhibition of melanoma progression with significant apoptosis, as evidenced by increased staining of cleaved Caspase-3 in the treated constructs. However, no difference in the expression of autophagic marker LC-3 was noted between treated and control groups. Fisetin treatment to 2-D melanoma cultures resulted in phosphorylation and activation of the multifunctional AMP-activated protein kinase (AMPK) involved in the regulation of diverse cellular processes, including autophagy and apoptosis. Silencing of AMPK failed to prevent cell death indicating that fisetin induced cytotoxicity is mediated through both AMPK-dependent and -independent mechanisms. Taken together, our studies confirm apoptosis as the primary mechanism through which fisetin inhibits melanoma cell growth and that activation of both extrinsic and intrinsic pathways contributes to fisetin induced cytotoxicity.

  5. Activation of NK Cells in Mixed Cultures of Wharton's Jelly Mesenchymal Stromal Cells and Peripheral Blood Lymphocytes.

    Science.gov (United States)

    Svirshchevskaya, E V; Poltavtsev, A M; Os'mak, G Zh; Poltavtseva, R A

    2018-01-01

    Mesenchymal stromal cells possess immunosuppressive properties that might be used for the therapy of inflammatory diseases of various geneses. The effects of mesenchymal stromal cells depend on their lifetime in the recipient tissues. During heterologous transplantation, mesenchymal stromal cells are eliminated by NK cells. We studied NK cell formation in mixed cultures of Wharton's jelly mesenchymal stromal cells and peripheral blood lymphocytes from an autologous donor. Lymphocytes were activated by a mitogen or IL-2. The lifetime of mesenchymal stromal cells was estimated by MTT test. Cytotoxic activity and phenotype of NK cells were evaluated by flow cytometry. It was found that activation of NK cells depended on IL-2 and was registered on day 2 of incubation with IL-2. In cultures with mitogen-activated lymphocytes, cytotoxicity was observed after 5-6 days. Cytotoxicity of NK correlated with significant decrease in CD16+ and increase in CD56+ NK and with reduction of mesenchymal stromal cell viability. Thus, the main mechanism of elimination of mesenchymal stromal cells is cytotoxicity of NK cells that depended on IL-2 production.

  6. Evolutionarily stable learning schedules and cumulative culture in discrete generation models.

    Science.gov (United States)

    Aoki, Kenichi; Wakano, Joe Yuichiro; Lehmann, Laurent

    2012-06-01

    Individual learning (e.g., trial-and-error) and social learning (e.g., imitation) are alternative ways of acquiring and expressing the appropriate phenotype in an environment. The optimal choice between using individual learning and/or social learning may be dictated by the life-stage or age of an organism. Of special interest is a learning schedule in which social learning precedes individual learning, because such a schedule is apparently a necessary condition for cumulative culture. Assuming two obligatory learning stages per discrete generation, we obtain the evolutionarily stable learning schedules for the three situations where the environment is constant, fluctuates between generations, or fluctuates within generations. During each learning stage, we assume that an organism may target the optimal phenotype in the current environment by individual learning, and/or the mature phenotype of the previous generation by oblique social learning. In the absence of exogenous costs to learning, the evolutionarily stable learning schedules are predicted to be either pure social learning followed by pure individual learning ("bang-bang" control) or pure individual learning at both stages ("flat" control). Moreover, we find for each situation that the evolutionarily stable learning schedule is also the one that optimizes the learned phenotype at equilibrium. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Pro-inflammatory Cytokines Are Involved in Fluoride-Induced Cytotoxic Potential in HeLa Cells.

    Science.gov (United States)

    Wang, Hong-Wei; Zhou, Bian-Hua; Cao, Jian-Wen; Zhao, Jing; Zhao, Wen-Peng; Tan, Pan-Pan

    2017-01-01

    This study was designed to investigate the pro-inflammatory cytokines and their involvement in the cytotoxic potential of fluoride (F) in HeLa cells. HeLa cells were cultured with varying F concentrations (1-50 mg/L) for 48 h, and treatment effects were analyzed. The viability of HeLa cells was determined with a colorimetric method. The concentrations of IL-1β, IL-2, IL-6, and TNF-a in culture supernatant were measured through enzyme linked immunosorbent assay (ELISA). The mRNA expression levels of IL-1β, IL-2, IL-6 and TNF-a were subjected to transcript analysis and quantified through reverse transcription real-time PCR. Results showed that 10, 20 and 50 mg/L F significantly decreased the viability of HeLa cells incubated for 24 and 48 h. With their cytotoxic effect, the concentrations of IL-1β, IL-2, IL-6, and TNF-a decreased significantly in response to F, especially at 20 and 50 mg/L for 48 h. The mRNA expression levels of IL-1β, IL-2, IL-6, and TNF-a were downregulated at 50 mg/L F for 48 h. Therefore, F inhibited HeLa cell growth; as such, F could be used to alleviate the inhibition of pro-inflammatory cytokine expression.

  8. A cytotoxic serine proteinase isolated from mouse submandibular gland.

    Science.gov (United States)

    Shimamura, T; Nagumo, N; Ikigai, H; Murakami, K; Okubo, S; Toda, M; Ohnishi, R; Tomita, M

    1989-08-01

    We have isolated a novel cytotoxic factor from the submandibular glands of male BALB/c mice by Sephadex G-50 gel filtration chromatography and reverse-phase HPLC. The cytotoxic factor is a serine proteinase, which belongs to the mouse glandular kallikrein (mGK) family, with an Mr of approximately 27,000. The purified serine proteinase showed cytotoxic activity against mouse thymocytes in a dose-dependent manner, and a serine proteinase inhibitor, diisopropyl fluorophosphate, blocked its cytotoxic activity.

  9. Structure-property relationship in cytotoxicity and cell uptake of poly(2-oxazoline) amphiphiles

    KAUST Repository

    Luxenhofer, Robert

    2011-07-01

    The family of poly(2-oxazoline)s (POx) is being increasingly investigated in the context of biomedical applications. We tested the relative cytotoxicity of POx and were able to confirm that these polymers are typically not cytotoxic even at high concentrations. Furthermore, we report structure-uptake relationships of a series of amphiphilic POx block copolymers that have different architectures, molar mass and chain termini. The rate of endocytosis can be fine-tuned over a broad range by changing the polymer structure. The cellular uptake increases with the hydrophobic character of the polymers and is observed even at nanomolar concentrations. Considering the structural versatility of this class of polymers, the relative ease of preparation and their stability underlines the potential of POx as a promising platform candidate for the preparation of next-generation polymer therapeutics.

  10. Evaluation of Iranian Snake ‘Macrovipera lebetina’ Venom Cytotoxicity in Kidney Cell Line HEK-293

    Directory of Open Access Journals (Sweden)

    Hourieh Esmaeili Jahromi

    2016-03-01

    Full Text Available Background:Envenomation by Macrovipera lebetina (M. lebetina is characterized by prominent local tissue damage, hemorrhage, abnormalities in the blood coagulation system, necrosis, and edema. However, the main cause of death after a bite by M. lebetina has been attributed to acute renal failure (ARF. It is unclear whether the venom components have a direct or indirect action in causing ARF. To investigate this point, we looked at the in vitro effect of M. lebetina crude venom, using cultured human embryonic kidney (HEK-293 mono layers as a model. Methods: The effect of M. lebetina snake venom on HEK-293 growth inhibition was determined by the MTT assay and the neutral red uptake assay. The integrity of the cell membrane through LDH release was measured with the Cytotoxicity Detection Kit. Morphological changes in HEK-293 cells were also evaluated using an inverted microscope. Results: In the MTT assay, crude venom showed a significant cytotoxic effect on HEK-293 cells at 24 hours of exposure and was confirmed by the neutral red assay. Also, at 24 hours exposure, crude venom caused a non-significant increase in LDH activity of the culture medium at concentrations above 20 μg/ml. Various morphological abnormalities were observed in cells exposed to the venom and showed loss of their common polygonal shape, appearing as several roughly rounded cells of variable size. The M. lebetina crude venom induced detachment of cells from the plate. Conclusion: Based on the results obtained in this study, it can be concluded that the Iranian snake M. lebetina venom causes a cytotoxic effect on kidney tissue not by necrotic mechanism but rather by secondary effects, including hypotension, hemolysis, hemoglobinuria, rhabdomyolysis, myoglobinuria and disseminated intravascular coagulation (DIC, which may lead to ARF.

  11. Microstructure and cytotoxicity evaluation of duplex-treated silver-containing antibacterial TiO{sub 2} coatings

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiangyu; Wu, Haibo; Geng, Zhenhua; Huang, Xiaobo; Hang, Ruiqiang; Ma, Yong; Yao, Xiaohong; Tang, Bin, E-mail: tangbin6405@sina.com

    2014-12-01

    Implant-related infection is one of the most common and serious complications associated with biomedical implantation. To prevent bacterial adhesion, a series of porous TiO{sub 2} coatings with different concentrations of silver (designated as M0, M1, M2 and M3) were prepared on pure titanium substrates by a duplex-treatment technique combining magnetron sputtering with micro-arc oxidation. All coatings are porous with pore size less than 5 μm and the concentrations of silver in the M0, M1, M2 and M3 are 0, 0.95, 1.36 and 1.93 wt.%, respectively. Silver is found to be distributed throughout the thickness of the coatings by scanning electron microscopy. The release of silver from the TiO{sub 2} coatings was confirmed by an inductively-coupled plasma mass spectroscopy. The antibacterial effects of these coatings were tested against Gram-positive Staphylococcus aureus (S. aureus) and Gram-negative Escherichia coli (E. coli), and the cytotoxicity was evaluated using the mouse pre-osteoblast cells. The results indicate that the antibacterial activities of TiO{sub 2} coatings are greatly improved due to the incorporation of silver. No cytotoxic effect is found for the M1 surfaces from the observation of pre-osteoblast cell by MTT assay and fluorescence microscopy. Although the M2 and M3 coatings appeared to be toxic for pre-osteoblast cells after 1 day in culture, the cell viability on M2 and M3 surfaces was greatly raised after culturing for 2 days. Our results suggested that the TiO{sub 2} coatings incorporated with an optimum amount of silver can possess excellent antibacterial activities without cytotoxic effect, which has promising applications in biomedical devices. - Highlights: • Porous TiO{sub 2} coatings with various concentration of Ag on titanium were prepared. • Ag element was distributed throughout the thickness of the coatings. • The antibacterial activities were greatly improved due to the incorporation of Ag. • The release amounts of Ag were

  12. Evaluation of the cytotoxicity of dihydroxytryptamines and 5-hydroxytryptamine antagonists as cytotoxic agents in dimethylhydrazine-induced adenocarcinomata.

    Science.gov (United States)

    Tutton, P J; Barkla, D H

    1978-01-01

    The cytotoxicity of 5,6-dihydroxytryptamine (5,6-DHT), 5,7-dihydroxytryptamine (5,7-DHT), bromolysergic acid diethylamide (BOL), methysergide, and cyproheptadine, and also of 5,6-DHT together with either BOL, methysergide, or cyproheptadine in dimethylhydrazine-induced (DMH) carcinomata of rat colon was evaluated by estimating the percentage of necrotic cells in histological sections of tissues taken 15 h after injection of each of the drugs. In addition, the influence of methysergide and cyproheptadine on the tumour cell mitotic rate was estimated by means of a stathmokinetic technique. Both 5,6-DHT and 5,7-DHT were cytotoxic at each dose tested and for each of these agents the percentage of necrotic cells was directly correlated with the dose of drug used. BOL was not found to be cytotoxic to the colonic carcinomata, whereas both methysergide and cyproheptadine did cause detectable tumour cell necrosis. Methysergide was also found to accelerate tumour cell proliferation, whereas cyproheptadine did not. BOL competitively inhibited the cytotoxicity of 5,6-DHT and neither methysergide nor cyproheptadine potentiated the effect of 5,6 DHT.

  13. Quantifying engineered nanomaterial toxicity: comparison of common cytotoxicity and gene expression measurements

    Directory of Open Access Journals (Sweden)

    Donald H. Atha

    2017-11-01

    Full Text Available Abstract Background When evaluating the toxicity of engineered nanomaterials (ENMS it is important to use multiple bioassays based on different mechanisms of action. In this regard we evaluated the use of gene expression and common cytotoxicity measurements using as test materials, two selected nanoparticles with known differences in toxicity, 5 nm mercaptoundecanoic acid (MUA-capped InP and CdSe quantum dots (QDs. We tested the effects of these QDs at concentrations ranging from 0.5 to 160 µg/mL on cultured normal human bronchial epithelial (NHBE cells using four common cytotoxicity assays: the dichlorofluorescein assay for reactive oxygen species (ROS, the lactate dehydrogenase assay for membrane viability (LDH, the mitochondrial dehydrogenase assay for mitochondrial function, and the Comet assay for DNA strand breaks. Results The cytotoxicity assays showed similar trends when exposed to nanoparticles for 24 h at 80 µg/mL with a threefold increase in ROS with exposure to CdSe QDs compared to an insignificant change in ROS levels after exposure to InP QDs, a twofold increase in the LDH necrosis assay in NHBE cells with exposure to CdSe QDs compared to a 50% decrease for InP QDs, a 60% decrease in the mitochondrial function assay upon exposure to CdSe QDs compared to a minimal increase in the case of InP and significant DNA strand breaks after exposure to CdSe QDs compared to no significant DNA strand breaks with InP. High-throughput quantitative real-time polymerase chain reaction (qRT-PCR data for cells exposed for 6 h at a concentration of 80 µg/mL were consistent with the cytotoxicity assays showing major differences in DNA damage, DNA repair and mitochondrial function gene regulatory responses to the CdSe and InP QDs. The BRCA2, CYP1A1, CYP1B1, CDK1, SFN and VEGFA genes were observed to be upregulated specifically from increased CdSe exposure and suggests their possible utility as biomarkers for toxicity. Conclusions This study can

  14. Influence of physicochemical properties of beryllium particles on cultured cell toxicity

    International Nuclear Information System (INIS)

    Finch, G.L.; Brooks, A.L.; Hoover, M.D.; Cuddihy, R.G.

    1988-01-01

    The toxicity of beryllium oxide (BeO)), beryllium metal, and beryllium sulfate (BeSO 4 ) was studied in two cell lines, Chinese hamster ovary cells (CHO) and lung epithelial cells (LEC). Beryllium oxide particles were prepared at either 500 or 1000 deg. C, and two different particle sizes of beryllium metal were used. Following a 20-h exposure to beryllium compounds, cells were grown in culture to quantitate cloning ability relative to controls as a measure of cell killing, The LEC cultures were more sensitive to beryllium cytotoxicity than the CHO cells. When expressed on the basis of the mass of material added to the cultures, the order of toxicity was BeSO 4 ≥ 500 deg. C -BeO > 1000 deg. C -BeO > Be metal (small) Be metal (large). When cytotoxic effects were expressed on the basis of particulate surface rather than mass, the relative differences in toxicity between compounds was decreased. The order of toxicity was Be metal (small) ∼ Be metal (large) ∼ 500 deg. C-BeO ∼ 1000 deg. C-BeO. These data indicate that solubility influences beryllium toxicity to short-term cell cultures. (author)

  15. Role of Family, Culture, and Peers in the Success of First-Generation Cambodian American College Students

    OpenAIRE

    Tang, Jennifer; Kim, Simon; Haviland, Don

    2015-01-01

    Cambodian American college students are often overlooked in academe because of the model minority myth. The stereotype overshadows the challenges and heterogeneity in the Asian American and Pacific Islander population. This exploratory study examined the experiences of 13 first-generation Cambodian American college students at a large, public institution in California. Findings revealed that, despite obstacles of being first-generation with limited cultural capital, students were transformed ...

  16. Cytotoxicity of copolymer PHEMA-g-LDPE obtained for ionizing radiation

    International Nuclear Information System (INIS)

    Lorenzetti, Solange G.; Camillo, Maria A.P.; Higa, Olga Z.; Queiroz, Alvaro A.A. de

    2005-01-01

    Polymeric biomaterials are the polymers described in the literature which are employed in medicine and biotechnology. The aim of the work was the preparation of biocompatible polymeric surface for the posterior immobilization of protein compounds using grafted copolymers obtained by ionizing radiation. The copolymers was obtained by gamma irradiation induced grafting of 2-hydroxyethyl methacrylate (HEMA) onto low density polyethylene (LDPE) in different conditions.. The grafting yield ranged from 2% to 50%. The copolymers were analysed by infrared spectroscopy (FTIR). MEV micrographs showed a smooth surface for the virgin LDPE and rough surface for the copolymers due to the grafted PHEMA. The hydrophilic property appeared with the grafting increase of PHEMA onto LDPE. The diffusion coefficient was determined. Cytotoxicity assay was performed for the evaluation of biocompatibility. The method is based on the quantitative assesment of surviving viable cells upon exposure of CHO cells to the material extract and incubation with the supravital dye MTS. The amount of MTS, taken up by the population of cells is directly proportional to the number of viable cells in culture. The grafted polymers were not cytotoxic and will be used for the chemical immobilization of the enzyme phospholipase A2, purified from the rattlesnake venom. (author)

  17. Cytotoxicity and genotoxicity of low doses of mercury chloride and methylmercury chloride on human lymphocytes in vitro

    Directory of Open Access Journals (Sweden)

    L.C. Silva-Pereira

    2005-06-01

    Full Text Available Mercury is a xenobiotic metal that is a highly deleterious environmental pollutant. The biotransformation of mercury chloride (HgCl2 into methylmercury chloride (CH3HgCl in aquatic environments is well-known and humans are exposed by consumption of contaminated fish, shellfish and algae. The objective of the present study was to determine the changes induced in vitro by two mercury compounds (HgCl2 and CH3HgCl in cultured human lymphocytes. Short-term human leukocyte cultures from 10 healthy donors (5 females and 5 males were set-up by adding drops of whole blood in complete medium. Cultures were separately and simultaneously treated with low doses (0.1 to 1000 µg/l of HgCl2 and CH3HgCl and incubated at 37ºC for 48 h. Genotoxicity was assessed by chromosome aberrations and polyploid cells. Mitotic index was used as a measure of cytotoxicity. A significant increase (P < 0.05 in the relative frequency of chromosome aberrations was observed for all concentrations of CH3HgCl when compared to control, whether alone or in an evident sinergistic combination with HgCl2. The frequency of polyploid cells was also significantly increased (P < 0.05 when compared to control after exposure to all concentrations of CH3HgCl alone or in combination with HgCl2. CH3HgCl significantly decreased (P < 0.05 the mitotic index at 100 and 1000 µg/l alone, and at 1, 10, 100, and 1000 µg/l when combined with HgCl2, showing a synergistic cytotoxic effect. Our data showed that low concentrations of CH3HgCl might be cytotoxic/genotoxic. Such effects may indicate early cellular changes with possible biological consequences and should be considered in the preliminary evaluation of the risks of populations exposed in vivo to low doses of mercury.

  18. Effect of reduced exposure times on the cytotoxicity of resin luting cements cured by high-power led

    Directory of Open Access Journals (Sweden)

    Gulfem Ergun

    2011-06-01

    Full Text Available OBJECTIVE: Applications of resin luting agents and high-power light-emitting diodes (LED light-curing units (LCUs have increased considerably over the last few years. However, it is not clear whether the effect of reduced exposure time on cytotoxicity of such products have adequate biocompatibility to meet clinical success. This study aimed at assessing the effect of reduced curing time of five resin luting cements (RLCs polymerized by high-power LED curing unit on the viability of a cell of L-929 fibroblast cells. MATERIAL AND METHODS: Disc-shaped samples were prepared in polytetrafluoroethylene moulds with cylindrical cavities. The samples were irradiated from the top through the ceramic discs and acetate strips using LED LCU for 20 s (50% of the manufacturer's recommended exposure time and 40 s (100% exposure time. After curing, the samples were transferred into a culture medium for 24 h. The eluates were obtained and pipetted onto L-929 fibroblast cultures (3x10(4 per well and incubated for evaluating after 24 h. Measurements were performed by dimethylthiazol diphenyltetrazolium assay. Statistical significance was determined by two-way ANOVA and two independent samples were compared by t-test. RESULTS: Results showed that eluates of most of the materials polymerized for 20 s (except Rely X Unicem and Illusion reduced to a higher extent cell viability compared to samples of the same materials polymerized for 40 s. Illusion exhibited the least cytotoxicity for 20 s exposure time compared to the control (culture without samples followed by Rely X Unicem and Rely X ARC (90.81%, 88.90%, and 83.11%, respectively. For Rely X ARC, Duolink and Lute-It 40 s exposure time was better (t=-1.262 p=0,276; t=-9.399 p=0.001; and t=-20.418 p<0.001, respectively. CONCLUSION: The results of this study suggest that reduction of curing time significantly enhances the cytotoxicity of the studied resin cement materials, therefore compromising their clinical

  19. Evaluation of cytotoxicity and inflammatory activity of wastewater collected from a textile factory before and after treatment by coagulation-flocculation methods.

    Science.gov (United States)

    Makene, Vedastus W; Tijani, Jimoh O; Petrik, Leslie F; Pool, Edmund J

    2016-08-01

    Effective treatment of textile effluent prior to discharge is necessary in order to avert the associated adverse health impacts on human and aquatic life. In the present investigation, coagulation/flocculation processes were evaluated for the effectiveness of the individual treatment. Effectiveness of the treatment was evaluated based on the physicochemical characteristics. The quality of the pre-treated and post-flocculation treated effluent was further evaluated by determination of cytotoxicity and inflammatory activity using RAW264.7 cell cultures. Cytotoxicity was determined using WST-1 assay. Nitric oxide (NO) and interleukin 6 (IL-6) were used as biomarkers of inflammation. NO was determined in cell culture supernatant using the Griess reaction assay. The IL-6 secretion was determined using double antibody sandwich enzyme linked immunoassay (DAS ELISA). Cytotoxicity results show that raw effluent reduced the cell viability significantly (P production than the negative control. The inflammatory results further show that the raw effluent induced significantly (P production of IL-6 than the negative control. Among the coagulants/flocculants evaluated Al2(SO4)3.14H2O at a dosage of 1.6 g/L was the most effective to remove both toxic and inflammatory pollutants. In conclusion, the inflammatory responses in RAW264.7 cells can be used as sensitive biomarkers for monitoring the effectiveness of coagulation/flocculation processes used for textile effluent treatment.

  20. Posmodernisme Dalam Novel Generation X: Tales For Accelerated Culture Dan Bilangan Fu

    OpenAIRE

    Azmi, Nurul Nayla

    2013-01-01

    This research is entitled Postmodernism in Novel Generation X: Tale of Accelerated Culture and Bilangan Fu which analyze postmodernism as the concept in both novel. As generally known, that the fast growing of recent life has effecting the human’s life that change continuity started from traditional, modern and then to the latest which postmodernism. In the changing of each stage, human life also encounters the changing which may seen from happening social phenomenon. In the stage of postmo...

  1. Evaluation of genotoxicity and cytotoxicity of water samples from the Sinos River Basin, southern Brazil

    Directory of Open Access Journals (Sweden)

    E Bianchi

    Full Text Available Some water bodies in the Sinos River Basin (SRB have been suffering the effects of pollution by residential, industrial and agroindustrial wastewater. The presence of cytotoxic and genotoxic compounds could compromise the water quality and the balance of these ecosystems. In this context, the research aimed to evaluate the genotoxicity and cytotoxicity of the water at four sites along the SRB (in the cities of Santo Antônio da Patrulha, Parobé, Campo Bom and Esteio, using bioassays in fish and cell culture. Samples of surface water were collected and evaluated in vitro using the Astyanax jacuhiensis fish species (micronucleus test and comet assay and the Vero lineage of cells (comet assay and cytotoxicity tests, neutral red - NR and tetrazolium MTT. The micronucleus test in fish showed no significant differences between the sampling sites, and neither did the comet assay and the MTT and NR tests in Vero cells. The comet assay showed an increase in genetic damage in the fish exposed to water samples collected in the middle and lower sections of the basin (Parobé, Campo Bom and Esteio when compared to the upper section of the basin (Santo Antônio da Patrulha. The results indicate contamination by genotoxic substances starting in the middle section of the SRB.

  2. Experiencing the Formation of Hybrid Cultural Identities In First- Generation Turkish Immigrants To The United States

    Directory of Open Access Journals (Sweden)

    Pelin HATTATOGLU

    2014-05-01

    Full Text Available The paper is based upon the research that explored the formation of hybrid cultural identities of five first-generation Turkish immigrants to the United States working in the high-technology sector. Postcolonial theoretical perspective was used to conceptualize the formation of hybrid cultural identities in the globalized world, and Interpretive Phenomenological Analysis was employed to analyze in depth the lived experiences of the participants. The research findings indicated four broad common experiences narrated in the interviews: Shifting Identities, Identities in Comparison, Identities against Power, and Transforming Self. These findings concurred with the postcolonial assumptions that challenged the generalizations of cultural identity in clinical psychology theory and research.

  3. Cytotoxicity and Initial Biocompatibility of Endodontic Biomaterials (MTA and Biodentine™) Used as Root-End Filling Materials.

    Science.gov (United States)

    Escobar-García, Diana María; Aguirre-López, Eva; Méndez-González, Verónica; Pozos-Guillén, Amaury

    2016-01-01

    Objective. The aim of this study was to evaluate the cytotoxicity and cellular adhesion of Mineral Trioxide Aggregate (MTA) and Biodentine (BD) on periodontal ligament fibroblasts (PDL). Methods. PDL cells were obtained from nonerupted third molars and cultured; MTS cellular profusion test was carried out in two groups: MTA and BD, with respective controls at different time periods. Also, the LIVE/DEAD assay was performed at 24 h. For evaluation of cellular adhesion, immunocytochemistry was conducted to discern the expression of Integrin β1 and Vinculin at 12 h and 24 h. Statistical analysis was performed by the Kruskal-Wallis and Mann-Whitney U tests. Results. MTA and BD exhibited living cells up to 7 days. More expressions of Integrin β1 and Vinculin were demonstrated in the control group, followed by BD and MTA, which also showed cellular loss and morphological changes. There was a significant difference in the experimental groups cultured for 5 and 7 days compared with the control, but there was no significant statistical difference between both cements. Conclusions. Neither material was cytotoxic during the time evaluated. There was an increase of cell adhesion through the expression of focal contacts observed in the case of BD, followed by MTA, but not significantly.

  4. Cytotoxicity evaluation of extracts and fractions of five marine sponges from the Persian Gulf and HPLC fingerprint analysis of cytotoxic extracts

    Institute of Scientific and Technical Information of China (English)

    Davood; Mahdian; Milad; Iranshahy; Abolfazl; Shakeri; Azar; Hoseini; Hoda; Yavari; Melika; Nazemi; Mehrdad; Iranshahi

    2015-01-01

    Objective: To screen the cytotoxic effects of some marine sponges extracts on HeLa and PC12 cells.Methods: Five marine sponges including Ircinia echinata(I. echinata), Dysidea avara,Axinella sinoxea, Haliclona tubifera and Haliclona violacea were collected from the Persian Gulf(Hengam Island). The cytotoxic effect of these sponges was evaluated by using MTT assay. The metabolic high performance liquid chromatography fingerprint of I. echinata was also carried out at two wavelengths(254 and 280 nm).Results: Among the sponges tested in this study, the extracts of I. echinata and Dysidea avara possessed the cytotoxic effect on HeLa and PC12 cells. The obtained fractions from high performance liquid chromatography were evaluated for their cytotoxic properties against the cell lines. The isolated fractions did not show significant cytotoxic properties.Conclusions: I. echinata could be considered as a potential extract for chemotherapy.Further investigation is needed to determine the accuracy of mechanism.

  5. Cytotoxicity evaluation of extracts and fractions of ifve marine sponges from the Persian Gulf and HPLC ifngerprint analysis of cytotoxic extracts

    Institute of Scientific and Technical Information of China (English)

    Davood Mahdian; Milad Iranshahy; Abolfazl Shakeri; Azar Hoseini; Hoda Yavari; Melika Nazemi; Mehrdad Iranshahi

    2015-01-01

    Objective:To screen the cytotoxic effects of some marine sponges extracts on HeLa and PC12 cells. Methods: Five marine sponges including Ircinia echinata (I. echinata), Dysidea avara, Axinella sinoxea, Haliclona tubifera and Haliclona violacea were collected from the Persian Gulf (Hengam Island). The cytotoxic effect of these sponges was evaluated by using MTT assay. The metabolic high performance liquid chromatography fingerprint of I. echinata was also carried out at two wavelengths (254 and 280 nm). Results:Among the sponges tested in this study, the extracts of I. echinata and Dysidea avara possessed the cytotoxic effect on HeLa and PC12 cells. The obtained fractions from high performance liquid chromatography were evaluated for their cytotoxic properties against the cell lines. The isolated fractions did not show significant cytotoxic properties. Conclusions:I. echinata could be considered as a potential extract for chemotherapy. Further investigation is needed to determine the accuracy of mechanism.

  6. Toxicity and oxidative stress of canine mesenchymal stromal cells from adipose tissue in different culture passages

    Directory of Open Access Journals (Sweden)

    Arícia Gomes Sprada

    2015-12-01

    Full Text Available Abstract: Stem cells in regenerative therapy have received attention from researchers in recent decades. The culture of these cells allows studies about their behavior and metabolism. Thus, cell culture is the basis for cell therapy and tissue engineering researches. A major concern regarding the use of cultivated stem cell in human or veterinary clinical routine is the risk of carcinogenesis. Cellular activities require a balanced redox state. However, when there is an imbalance in this state, oxidative stress occurs. Oxidative stress contributes to cytotoxicity, which may result in cell death or genomic alterations, favoring the development of cancer cells. The aim of this study was to determine whether there are differences in the behavior of cultured mesenchymal stem cells from canine adipose tissue according to its site of collection (omentum and subcutaneous evaluating the rate of proliferation, viability, level of oxidative stress and cytotoxicity over six passages. For this experiment, two samples of adipose tissue from subcutaneous and omentum where taken from a female dog corpse, 13 years old, Pitbull. The results showed greater levels of oxidative stress in the first and last passages of both groups, favoring cytotoxicity and cell death.

  7. Characteristics of medication errors with parenteral cytotoxic drugs

    OpenAIRE

    Fyhr, A; Akselsson, R

    2012-01-01

    Errors involving cytotoxic drugs have the potential of being fatal and should therefore be prevented. The objective of this article is to identify the characteristics of medication errors involving parenteral cytotoxic drugs in Sweden. A total of 60 cases reported to the national error reporting systems from 1996 to 2008 were reviewed. Classification was made to identify cytotoxic drugs involved, type of error, where the error occurred, error detection mechanism, and consequences for the pati...

  8. Situational variations in ethnic identity across immigration generations: Implications for acculturative change and cross-cultural adaptation.

    Science.gov (United States)

    Noels, Kimberly A; Clément, Richard

    2015-12-01

    This study examined whether the acculturation of ethnic identity is first evident in more public situations with greater opportunity for intercultural interaction and eventually penetrates more intimate situations. It also investigated whether situational variations in identity are associated with cross-cultural adaptation. First-generation (G1), second-generation (G2) and mixed-parentage second-generation (G2.5) young adult Canadians (n = 137, n = 169, and n = 91, respectively) completed a questionnaire assessing their heritage and Canadian identities across four situational domains (family, friends, university and community), global heritage identity and cross-cultural adaptation. Consistent with the acculturation penetration hypothesis, the results showed Canadian identity was stronger than heritage identity in public domains, but the converse was true in the family domain; moreover, the difference between the identities in the family domain was attenuated in later generations. Situational variability indicated better adaptation for the G1 cohort, but poorer adaptation for the G2.5 cohort. For the G2 cohort, facets of global identity moderated the relation, such that those with a weaker global identity experienced greater difficulties and hassles with greater identity variability but those with a stronger identity did not. These results are interpreted in light of potential interpersonal issues implied by situational variation for each generation cohort. © 2015 International Union of Psychological Science.

  9. Poly(ADP-ribose) polymerase-independent potentiation of nitrosourea cytotoxicity by 3-aminobenzamide in human malignant glioma cells.

    Science.gov (United States)

    Winter, S; Weller, M

    2000-06-16

    Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.

  10. Cytotoxicity and intracellular dissolution of nickel nanowires

    KAUST Repository

    Perez, Jose E.

    2015-12-22

    The assessment of cytotoxicity of nanostructures is a fundamental step for their development as biomedical tools. As widely used nanostructures, nickel nanowires (Ni NWs) seem promising candidates for such applications. In this work, Ni NWs were synthesized and then characterized using vibrating sample magnetometry, energy dispersive X-Ray analysis and electron microscopy. After exposure to the NWs, cytotoxicity was evaluated in terms of cell viability, cell membrane damage and induced apoptosis/necrosis on the model human cell line HCT 116. The influence of NW to cell ratio (10:1 to 1000:1) and exposure times up to 72 hours was analyzed for Ni NWs of 5.4 µm in length, as well as for Ni ions. The results show that cytotoxicity markedly increases past 24 hours of incubation. Cellular uptake of NWs takes place through the phagocytosis pathway, with a fraction of the dose of NWs dissolved inside the cells. Cell death results from a combination of apoptosis and necrosis, where the latter is the outcome of the secondary necrosis pathway. The cytotoxicity of Ni ions and Ni NWs dissolution studies suggest a synergistic toxicity between NW aspect ratio and dissolved Ni, with the cytotoxic effects markedly increasing after 24 hours of incubation.

  11. Cytotoxicity and intracellular dissolution of nickel nanowires.

    Science.gov (United States)

    Perez, Jose E; Contreras, Maria F; Vilanova, Enrique; Felix, Laura P; Margineanu, Michael B; Luongo, Giovanni; Porter, Alexandra E; Dunlop, Iain E; Ravasi, Timothy; Kosel, Jürgen

    2016-09-01

    The assessment of cytotoxicity of nanostructures is a fundamental step for their development as biomedical tools. As widely used nanostructures, nickel nanowires (Ni NWs) seem promising candidates for such applications. In this work, Ni NWs were synthesized and then characterized using vibrating sample magnetometry, energy dispersive X-Ray analysis, and electron microscopy. After exposure to the NWs, cytotoxicity was evaluated in terms of cell viability, cell membrane damage, and induced apoptosis/necrosis on the model human cell line HCT 116. The influence of NW to cell ratio (10:1 to 1000:1) and exposure times up to 72 hours was analyzed for Ni NWs of 5.4 μm in length, as well as for Ni ions. The results show that cytotoxicity markedly increases past 24 hours of incubation. Cellular uptake of NWs takes place through the phagocytosis pathway, with a fraction of the dose of NWs dissolved inside the cells. Cell death results from a combination of apoptosis and necrosis, where the latter is the outcome of the secondary necrosis pathway. The cytotoxicity of Ni ions and Ni NWs dissolution studies suggest a synergistic toxicity between NW aspect ratio and dissolved Ni, with the cytotoxic effects markedly increasing after 24 hours of incubation.

  12. Cytotoxicity and intracellular dissolution of nickel nanowires

    KAUST Repository

    Perez, Jose E.; Contreras, Maria F.; Vidal, Enrique Vilanova; Felix Servin, Laura P.; Margineanu, Michael B.; Luongo, Giovanni; Porter, Alexandra E.; Dunlop, Iain E.; Ravasi, Timothy; Kosel, Jü rgen

    2015-01-01

    The assessment of cytotoxicity of nanostructures is a fundamental step for their development as biomedical tools. As widely used nanostructures, nickel nanowires (Ni NWs) seem promising candidates for such applications. In this work, Ni NWs were synthesized and then characterized using vibrating sample magnetometry, energy dispersive X-Ray analysis and electron microscopy. After exposure to the NWs, cytotoxicity was evaluated in terms of cell viability, cell membrane damage and induced apoptosis/necrosis on the model human cell line HCT 116. The influence of NW to cell ratio (10:1 to 1000:1) and exposure times up to 72 hours was analyzed for Ni NWs of 5.4 µm in length, as well as for Ni ions. The results show that cytotoxicity markedly increases past 24 hours of incubation. Cellular uptake of NWs takes place through the phagocytosis pathway, with a fraction of the dose of NWs dissolved inside the cells. Cell death results from a combination of apoptosis and necrosis, where the latter is the outcome of the secondary necrosis pathway. The cytotoxicity of Ni ions and Ni NWs dissolution studies suggest a synergistic toxicity between NW aspect ratio and dissolved Ni, with the cytotoxic effects markedly increasing after 24 hours of incubation.

  13. Sponge-Associated Bacteria Produce Non-cytotoxic Melanin Which Protects Animal Cells from Photo-Toxicity.

    Science.gov (United States)

    Vijayan, Vijitha; Jasmin, Chekidhenkuzhiyil; Anas, Abdulaziz; Parakkaparambil Kuttan, Sreelakshmi; Vinothkumar, Saradavey; Perunninakulath Subrayan, Parameswaran; Nair, Shanta

    2017-09-01

    Melanin is a photo-protective polymer found in many organisms. Our research shows that the bacteria associated with darkly pigmented sponges (Haliclona pigmentifera, Sigmadocia pumila, Fasciospongia cavernosa, Spongia officinalis, and Callyspongia diffusa) secrete non-cytotoxic melanin, with antioxidant activity that protects animal cells from photo-toxicity. Out of 156 bacterial strains screened, 22 produced melanin and these melanin-producing bacteria (MPB) were identified as Vibrio spp., Providencia sp., Bacillus sp., Shewanella sp., Staphylococcus sp., Planococcus sp., Salinococcus sp., and Glutamicibacter sp. Maximum melanin production was exhibited by Vibrio alginolyticus Marine Microbial Reference Facility (MMRF) 534 (50 mg ml -1 ), followed by two isolates of Vibrio harveyi MMRF 535 (40 mg ml -1 ) and MMRF 546 (30 mg ml -1 ). Using pathway inhibition assay and FT-IR spectral analysis, we identified the melanin secreted into the culture medium of MPB as 1,8-dihydroxynaphthalene-melanin. The bacterial melanin was non-cytotoxic to mouse fibroblast L929 cells and brine shrimps up to a concentration of 200 and 500 ppm, respectively. Bacterial melanin showed antioxidant activity at very low concentration (IC 50 -9.0 ppm) and at 50 ppm, melanin protected L929 cells from UV-induced intracellular reactive oxygen stress. Our study proposes sponge-associated bacteria as a potential source of non-cytotoxic melanin with antioxidant potentials.

  14. Identification of N-acyl-fumonisin B1 as new cytotoxic metabolites of fumonisin mycotoxins.

    Science.gov (United States)

    Harrer, Henning; Laviad, Elad L; Humpf, Hans Ulrich; Futerman, Anthony H

    2013-03-01

    Fumonisins are mycotoxins produced by Fusarium species. The predominant derivative, fumonisin B1 (FB1), occurs in food and feed and is of health concern due to its hepatotoxic and carcinogenic effects. However, the role of FB1 metabolites on the mechanism of the toxicity, the inhibition of the ceramide synthesis, is unknown. The aim of this study was to identify new fumonisin metabolites and to evaluate their cytotoxic potential. MS, molecular biology, and in vitro enzyme assays were used to investigate fumonisin metabolism in mammalian cells overexpressing human ceramide synthase (CerS) genes. N-acyl-FB1 derivatives were detected as new metabolites in cultured cells at levels of up to 10 pmol/mg of protein. The N-acylation of FB1 and hydrolyzed FB1 was analyzed in several cell lines, including cells overexpressing CerS. The acyl-chain length of the N-acyl fumonisins depends on the CerS isoform acylating them. The N-acyl fumonisins are more cytotoxic than the parent fumonisin B1. The identification of N-acyl fumonisins with various acyl chain lengths together with the observed cytotoxicity of these compounds is a new aspect of fumonisin-related toxicity. Therefore, these new metabolites might play an important role in the mode of action of fumonisins. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. AlgiMatrix™ based 3D cell culture system as an in-vitro tumor model for anticancer studies.

    Directory of Open Access Journals (Sweden)

    Chandraiah Godugu

    Full Text Available Three-dimensional (3D in-vitro cultures are recognized for recapitulating the physiological microenvironment and exhibiting high concordance with in-vivo conditions. Taking the advantages of 3D culture, we have developed the in-vitro tumor model for anticancer drug screening.Cancer cells grown in 6 and 96 well AlgiMatrix™ scaffolds resulted in the formation of multicellular spheroids in the size range of 100-300 µm. Spheroids were grown in two weeks in cultures without compromising the growth characteristics. Different marketed anticancer drugs were screened by incubating them for 24 h at 7, 9 and 11 days in 3D cultures and cytotoxicity was measured by AlamarBlue® assay. Effectiveness of anticancer drug treatments were measured based on spheroid number and size distribution. Evaluation of apoptotic and anti-apoptotic markers was done by immunohistochemistry and RT-PCR. The 3D results were compared with the conventional 2D monolayer cultures. Cellular uptake studies for drug (Doxorubicin and nanoparticle (NLC were done using spheroids.IC(50 values for anticancer drugs were significantly higher in AlgiMatrix™ systems compared to 2D culture models. The cleaved caspase-3 expression was significantly decreased (2.09 and 2.47 folds respectively for 5-Fluorouracil and Camptothecin in H460 spheroid cultures compared to 2D culture system. The cytotoxicity, spheroid size distribution, immunohistochemistry, RT-PCR and nanoparticle penetration data suggested that in vitro tumor models show higher resistance to anticancer drugs and supporting the fact that 3D culture is a better model for the cytotoxic evaluation of anticancer drugs in vitro.The results from our studies are useful to develop a high throughput in vitro tumor model to study the effect of various anticancer agents and various molecular pathways affected by the anticancer drugs and formulations.

  16. Cytotoxic effects induced by interferon-ω gene lipofection through ROS generation and mitochondrial membrane potential disruption in feline mammary carcinoma cells.

    Science.gov (United States)

    Villaverde, Marcela Solange; Targovnik, Alexandra Marisa; Miranda, María Victoria; Finocchiaro, Liliana María Elena; Glikin, Gerardo Claudio

    2016-08-01

    Progress in comparative oncology promises advances in clinical cancer treatments for both companion animals and humans. In this context, feline mammary carcinoma (FMC) cells have been proposed as a suitable model to study human breast cancer. Based on our previous data about the advantages of using type I interferon gene therapy over the respective recombinant DNA derived protein, the present work explored the effects of feline interferon-ω gene (fIFNω) transfer on FMC cells. Three different cell variants derived from a single spontaneous highly aggressive FMC tumor were successfully established and characterized. Lipofection of the fIFNω gene displayed a significant cytotoxic effect on the three cell variants. The extent of the response was proportional to ROS generation, mitochondrial membrane potential disruption and calcium uptake. Moreover, a lower sensitivity to the treatment correlated with a higher malignant phenotype. Our results suggest that fIFNω lipofection could offer an alternative approach in veterinary oncology with equal or superior outcome and with less adverse effects than recombinant fIFNω therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Definition of metabolism-dependent xenobiotic toxicity with co-cultures of human hepatocytes and mouse 3T3 fibroblasts in the novel integrated discrete multiple organ co-culture (IdMOC) experimental system: results with model toxicants aflatoxin B1, cyclophosphamide and tamoxifen.

    Science.gov (United States)

    Li, Albert P; Uzgare, Aarti; LaForge, Yumiko S

    2012-07-30

    The integrated discrete multiple organ co-culture system (IdMOC) allows the co-culturing of multiple cell types as physically separated cells interconnected by a common overlying medium. We report here the application of IdMOC with two cell types: the metabolically competent primary human hepatocytes, and a metabolically incompetent cell line, mouse 3T3 fibroblasts, in the definition of the role of hepatic metabolism on the cytotoxicity of three model toxicants: cyclophosphamide (CPA), aflatoxin B1 (AFB) and tamoxifen (TMX). The presence of hepatic metabolism in IdMOC with human hepatocytes was demonstrated by the metabolism of the P450 isoform 3A4 substrate, luciferin-IPA. The three model toxicants showed three distinct patterns of cytotoxic profile: TMX was cytotoxic to 3T3 cells in the absence of hepatocytes, with slightly lower cytotoxicity towards both 3T3 cells and hepatocytes in the IdMOC. AFB was selective toxic towards the human hepatocytes and relatively noncytotoxic towards 3T3 cells both in the presence and absence of the hepatocytes. CPA cytotoxicity to the 3T3 cells was found to be significantly enhanced by the presence of the hepatocytes, with the cytotoxicity dependent of the number of hepatocytes, and with the cytotoxicity attenuated by the presence of a non-specific P450 inhibitor, 1-aminobenzotriazole. We propose here the following classification of toxicants based on the role of hepatic metabolism as defined by the human hepatocyte-3T3 cell IdMOC assay: type I: direct-acting cytotoxicants represented by TMX as indicated by cytotoxicity in 3T3 cells in the absence of hepatocytes; type II: metabolism-dependent cytotoxicity represented by AFB1 with effects localized within the site of metabolic activation (i. e. hepatocytes); and type III: metabolism-dependent cytotoxicity with metabolites that can diffuse out of the hepatocytes to cause toxicity in cells distal from the site of metabolism, as exemplified by CPA. Copyright © 2012 Elsevier Ireland

  18. Cytotoxic activity of four Mexican medicinal plants.

    Science.gov (United States)

    Vega-Avila, Elisa; Espejo-Serna, Adolfo; Alarcón-Aguilar, Francisco; Velasco-Lezama, Rodolfo

    2009-01-01

    Ibervillea sonorae Greene, Cucurbita ficifolia Bouché, Tagetes lucida Cav and Justicia spicigera Scheltdd are Mexican native plants used in the treatment of different illnesses. The ethanolic extract of J. spicigera and T. lucida as well as aqueous extracts from I. sonorae, C. ficifolia, T. lucida and J. spicigera were investigated using sulforhodamine B assay. These extracts were assessed using two cell line: T47D (Human Breast cancer) and HeLa (Human cervix cancer). Colchicine was used as the positive control. Data are presented as the dose that inhibited 50% control growth (ED50). All of the assessed extracts were cytotoxic (ED50 < 20 microg/ml) against T47D cell line, meanwhile only the aqueous extract from T. lucida and the ethanolic extract from J. spicigera were cytotoxic to HeLa cell line. Ethanolic extract from J. spicigera presented the best cytotoxic effect. The cytotoxic activity of J. spicigera correlated with one of the popular uses, the treatment of cancer.

  19. Effect of radiotherapy on lymphocyte cytotoxicity in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Wasserman, J; Melen, B [Central Microbiological Laboratory, Stockholm County Council (Sweden); Blomgren, H; Glas, U; Perlmann, P

    1975-11-01

    The cytotoxic functions of highly purified blood lymphocytes from patients with breast cancer were studied before and after radiotherapy. Addition of PHA or of rabbit antibodies to target cells (chicken erythrocytes) were chosen as two means of inducing lymphocyte cytotoxicity in vitro. The proportion of T and non-T lymphocytes was determined by means of E and EAC rosette tests. The antibody-induced cytotoxicity of lymphocytes decreased following radiotherapy while that mediated by PHA remained unchanged. There was some reduction in the percentage of EAC rosette-forming cells. These results, as well as earlier observations, suggest that the decrease in the peripheral blood of the proportion of lymphocytes with receptors for activated complement is responsible for changes in the antibody-mediated lymphocyte cytotoxicity.

  20. Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells

    International Nuclear Information System (INIS)

    Park, Eun-Jung; Choi, Jinhee; Park, Young-Kwon; Park, Kwangsik

    2008-01-01

    Cerium oxide nanoparticles of different sizes (15, 25, 30, 45 nm) were prepared by the supercritical synthesis method, and cytotoxicity was evaluated using cultured human lung epithelial cells (BEAS-2B). Exposure of the cultured cells to nanoparticles (5, 10, 20, 40 μg/ml) led to cell death, ROS increase, GSH decrease, and the inductions of oxidative stress-related genes such as heme oxygenase-1, catalase, glutathione S-transferase, and thioredoxin reductase. The increased ROS by cerium oxide nanoparticles triggered the activation of cytosolic caspase-3 and chromatin condensation, which means that cerium oxide nanoparticles exert cytotoxicity by an apoptotic process. Uptake of the nanoparticles to the cultured cells was also tested. It was observed that cerium oxide nanoparticles penetrated into the cytoplasm and located in the peri-region of the nucleus as aggregated particles, which may induce the direct interaction between nanoparticles and cellular molecules to cause adverse cellular responses

  1. Self-assembling Fmoc dipeptide hydrogel for in situ 3D cell culturing

    Directory of Open Access Journals (Sweden)

    Akpe Victor

    2007-12-01

    Full Text Available Abstract Background Conventional cell culture studies have been performed on 2D surfaces, resulting in flat, extended cell growth. More relevant studies are desired to better mimic 3D in vivo tissue growth. Such realistic environments should be the aim of any cell growth study, requiring new methods for culturing cells in vitro. Cell biology is also tending toward miniaturization for increased efficiency and specificity. This paper discusses the application of a self-assembling peptide-derived hydrogel for use as a 3D cell culture scaffold at the microscale. Results Phenylalanine derivative hydrogel formation was seen to occur in multiple dispersion media. Cells were immobilized in situ within microchambers designed for cell analysis. Use of the highly biocompatible hydrogel components and simplistic procedures significantly reduced the cytotoxic effects seen with alternate 3D culture materials and microstructure loading methods. Cells were easily immobilized, sustained and removed from microchambers. Differences in growth morphology were seen in the cultured cells, owing to the 3-dimentional character of the gel structure. Degradation improved the removal of hydrogel from the microstructures, permitting reuse of the analysis platforms. Conclusion Self-assembling diphenylalanine derivative hydrogel provided a method to dramatically reduce the typical difficulties of microculture formation. Effective generation of patterned 3D cultures will lead to improved cell study results by better modeling in vivo growth environments and increasing efficiency and specificity of cell studies. Use of simplified growth scaffolds such as peptide-derived hydrogel should be seen as highly advantageous and will likely become more commonplace in cell culture methodology.

  2. Silver nanoparticles: Antimicrobial activity, cytotoxicity, and synergism with N-acetyl cysteine.

    Science.gov (United States)

    Hamed, Selwan; Emara, Mohamed; Shawky, Riham M; El-Domany, Ramadan A; Youssef, Tareq

    2017-08-01

    The fast progression of nanotechnology has led to novel therapeutic interventions. Antimicrobial activities of silver nanoparticles (Ag NPs) were tested against standard ATCC strains of Staphylococcus aureus (ATCC 9144), Escherichia coli (O157:H7), Pseudomonas aeruginosa (ATCC 27853), and Candida albicans (ATCC 90028) in addition to 60 clinical isolates collected from cancer patients. Antimicrobial activity was tested by disk diffusion method and MIC values for Ag NPs alone and in combination with N-acetylcysteine (NAC) against tested pathogens were determined by broth microdilution method. Ag NPs showed a robust antimicrobial activity against all tested pathogens and NAC substantially enhanced the antimicrobial activity of Ag NPs against all tested pathogens. Synergism between Ag NPs and NAC has been confirmed by checkerboard assay. The effect of Ag NPs on tested pathogens was further scrutinized by Transmission Electron Microscope (TEM) which showed disruption of cell wall in both bacteria and fungi. Ag NPs abrogated the activity of respiratory chain dehydrogenase of all tested pathogens and released muramic acid content from S. aureus in culture. The cytotoxic effect of Ag NPs alone and in combination with NAC was examined using human HepG2 cells and this revealed no cytotoxicity at MIC values of Ag NPs and interestingly, NAC reduced the cytotoxic effect of Ag NPs at concentrations higher than their MIC values. Taken together, Ag NPs have robust antimicrobial activity and NAC substantially enhances their antimicrobial activities against MDR pathogens which would provide a novel safe, effective, and inexpensive therapeutic approach to control the prevalence of MDR pathogens. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Carboxylesterase-dependent cytotoxicity of dibasic esters (DBE) in rat nasal explants.

    Science.gov (United States)

    Trela, B A; Bogdanffy, M S

    1991-02-01

    Dibasic esters (DBE) are a solvent mixture of dimethyl adipate (DMA), dimethyl glutarate (DMG), and dimethyl succinate (DMS) used in the paint and coating industry. Subchronic inhalation toxicity studies have demonstrated that DBE induce a mild degeneration of the olfactory, but not the respiratory, epithelium of the rat nasal cavity. Carboxylesterase-mediated hydrolysis of the individual dibasic esters is more efficient in olfactory than in respiratory mucosal homogenates. In the present study, an in vitro system of cultured rat nasal explants was utilized to determine if DBE toxicity is dependent on a metabolic activation by nonspecific carboxylesterase. Explants from both the olfactory and the respiratory regions of the female rat nasal cavity were incubated for 2 hr in Williams' medium E containing 10-100 mM DMA, DMG, or DMS. DBE caused a dose-related increase in nasal explant acid phosphatase release, a biochemical index of cytotoxicity. HPLC analysis demonstrated parallel increases in the carboxylesterase-mediated formation of monomethyl ester metabolites. Diacid metabolite production in the nasal explant system was not entirely concentration-dependent. Metabolite concentrations and acid phosphatase release were generally greater in olfactory than respiratory tissues. DBE-induced cytotoxicity and acid metabolite production were markedly attenuated in nasal tissue excised from rats which were pretreated with bis(p-nitrophenyl)phosphate, a carboxylesterase inhibitor. This study presents a viable in vitro method for assessing organic ester cytotoxicity in the rat nasal cavity. It was shown that DBE are weak nasal toxicants under the conditions of this system. It was further demonstrated that DBE toxicity is dependent on a carboxylesterase-mediated activation. A similar mechanism was proposed for the nasal toxicity induced by other organic esters following inhalation exposure.

  4. Minocycline Has Anti-inflammatory Effects and Reduces Cytotoxicity in an Ex Vivo Spinal Cord Slice Culture Model of West Nile Virus Infection.

    Science.gov (United States)

    Quick, Eamon D; Seitz, Scott; Clarke, Penny; Tyler, Kenneth L

    2017-11-15

    West Nile virus (WNV) is a neurotropic flavivirus that can cause significant neurological disease. Mouse models of WNV infection demonstrate that a proinflammatory environment is induced within the central nervous system (CNS) after WNV infection, leading to entry of activated peripheral immune cells. We utilized ex vivo spinal cord slice cultures (SCSC) to demonstrate that anti-inflammatory mechanisms may also play a role in WNV-induced pathology and/or recovery. Microglia are a type of macrophage that function as resident CNS immune cells. Similar to mouse models, infection of SCSC with WNV induces the upregulation of proinflammatory genes and proteins that are associated with microglial activation, including the microglial activation marker Iba1 and CC motif chemokines CCL2, CCL3, and CCL5. This suggests that microglia assume a proinflammatory phenotype in response to WNV infection similar to the proinflammatory (M1) activation that can be displayed by other macrophages. We now show that the WNV-induced expression of these and other proinflammatory genes was significantly decreased in the presence of minocycline, which has antineuroinflammatory properties, including the ability to inhibit proinflammatory microglial responses. Minocycline also caused a significant increase in the expression of anti-inflammatory genes associated with alternative anti-inflammatory (M2) macrophage activation, including interleukin 4 (IL-4), IL-13, and FIZZ1. Minocycline-dependent alterations to M1/M2 gene expression were associated with a significant increase in survival of neurons, microglia, and astrocytes in WNV-infected slices and markedly decreased levels of inducible nitric oxide synthase (iNOS). These results demonstrate that an anti-inflammatory environment induced by minocycline reduces viral cytotoxicity during WNV infection in ex vivo CNS tissue. IMPORTANCE West Nile virus (WNV) causes substantial morbidity and mortality, with no specific therapeutic treatments available

  5. Phytochemical and Cytotoxic Investigations of Alpinia mutica Rhizomes

    Directory of Open Access Journals (Sweden)

    Kae Shin Sim

    2011-01-01

    Full Text Available The methanol and fractionated extracts (hexane, ethyl acetate and water of Alpinia mutica (Zingiberaceae rhizomes were investigated for their cytotoxic effect against six human carcinoma cell lines, namely KB, MCF7, A549, Caski, HCT116, HT29 and non-human fibroblast cell line (MRC 5 using an in vitro cytotoxicity assay. The ethyl acetate extract possessed high inhibitory effect against KB, MCF7 and Caski cells (IC50 values of 9.4, 19.7 and 19.8 µg/mL, respectively. Flavokawin B (1, 5,6-dehydrokawain (2, pinostrobin chalcone (3 and alpinetin (4, isolated from the active ethyl acetate extract were also evaluated for their cytotoxic activity. Of these, pinostrobin chalcone (3 and alpinetin (4 were isolated from this plant for the first time. Pinostrobin chalcone (3 displayed very remarkable cytotoxic activity against the tested human cancer cells, such as KB, MCF7 and Caski cells (IC50 values of 6.2, 7.3 and 7.7 µg/mL, respectively. This is the first report of the cytotoxic activity of Alpinia mutica.

  6. For the Benefit of Others: Generativity and Meaning in Life in the Elderly in Four Cultures

    Czech Academy of Sciences Publication Activity Database

    Hofer, J.; Holger, B.; Au, A.; Poláčková Šolcová, Iva; Tavel, P.; Wong, T.T.

    2014-01-01

    Roč. 29, č. 4 (2014), s. 764-775 ISSN 0882-7974 Institutional support: RVO:68081740 Keywords : Generativity * Belief in the species * Goals * Well-Being * Machiavellianism * Aging * Culture Subject RIV: AN - Psychology Impact factor: 2.646, year: 2014

  7. Cytotoxicity of fluorographene

    Czech Academy of Sciences Publication Activity Database

    Teo, W. Z.; Sofer, Z.; Šembera, Filip; Janoušek, Zbyněk; Pumera, M.

    2015-01-01

    Roč. 5, č. 129 (2015), s. 107158-107165 ISSN 2046-2069 R&D Projects: GA ČR(CZ) GA15-09001S Institutional support: RVO:61388963 Keywords : fluorinated graphene * viability assays * cytotoxicity Subject RIV: CC - Organic Chemistry Impact factor: 3.289, year: 2015

  8. Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

    Science.gov (United States)

    Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

    2018-06-05

    CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Silymarin attenuated paraquat-induced cytotoxicity in macrophage by regulating Trx/TXNIP complex, inhibiting NLRP3 inflammasome activation and apoptosis.

    Science.gov (United States)

    Liu, Zhenning; Sun, Mingli; Wang, Yu; Zhang, Lichun; Zhao, Hang; Zhao, Min

    2018-02-01

    Oxidative stress and inflammation are involved in paraquat-induced cytotoxicity. Silymarin can exert a potent antioxidative and anti-inflammatory effect in various pathophysiological processes. The aim of this current study is to explore the protective effect and potential mechanism of silymarin in paraquat-induced macrophage injury. Cells were pretreated with different doses of silymarin for 3h before exposure to paraquat. At 24h after exposure to paraquat, the paraquat-induced cytotoxicity to macrophage was measured via the MTT assay and LDH release. The levels of intracellular reactive oxygen species, GSH-Px, SOD, and lipid peroxidation product malondialdehyde were measured to evaluate the oxidative effect of paraquat. NLRP3 inflammasome and cytokines secretion in macrophage exposed to paraquat at 24h were measured via immunofluorescence microscopy, western blot or Elisa. Our results revealed that paraquat could dramatically cause cytotoxicity and reactive oxygen species generation, enhance TXNIP expression, and induce NLRP3 inflammasome activation and cytokines secretion. The pretreatment with silymarin could remarkably reduce the cytotoxicity, promote the expression of Trx and antioxidant enzymes, and suppress the TXNIP and NLRP3 inflammasome activation. In conclusion, silymarin attenuated paraquat-induced cytotoxicity in macrophage by inhibiting oxidative stress, NLRP3 inflammasome activation, cytokines secretion and apoptosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Endogenous glutathione protects human skin fibroblasts against the cytotoxic action of UVB, UVA and near-visible radiations

    International Nuclear Information System (INIS)

    Tyrell, R.M.; Pidoux, Mireille

    1986-01-01

    Both the UVB (290-320 nm) and UVA (320-380 nm) regions of sunlight damage human skin cells but, particularly at the longer wavelengths, information is scant concerning the mechanism(s) of damage induction and the roles of cellular defense mechanisms. Following extensive glutathione depletion of cultured human skin fibroblasts, the cells become strongly sensitized to the cytotoxic action of near-visible (405 nm), UVA (334 nm, 365 nm) and UVB (313 nm) but not UVC (254 nm) radiations. In the critical UVB region, the magnitude of the protection afforded by endogenous glutathione approaches that of the protection provided by excision repair. The results suggest that a significant fraction of even UVB damage can be mediated by free radical attack and that a major role of glutathione in human skin cells is to protect them from the cytotoxic action of sunlight. (author)

  11. Cultural dissonance among generations: a solution-focused approach with East Asian elders and their families.

    Science.gov (United States)

    Lee, Mo Yee; Mjelde-Mossey, LeeAnn

    2004-10-01

    In traditional East Asian cultures, high value is assigned to family harmony and filial piety coupled with the expectation that elders will be honored and obeyed. A lifetime of such expectations shapes how elders perceive their role and status in the family. Problems can arise when younger, less traditional, generations do not share these expectations. This article describes a solution-focused approach that facilitates the family in creating a beneficial harmony in situations of cultural dissonance. Family members are empowered to draw on personal strengths in which multiple worldviews and values of individual members are recognized, incorporated, and negotiated.

  12. The future of cytotoxic therapy: selective cytotoxicity based on biology is the key

    International Nuclear Information System (INIS)

    Bono, Johann S de; Tolcher, Anthony W; Rowinsky, Eric K

    2003-01-01

    Although mortality from breast cancer is decreasing, 15% or more of all patients ultimately develop incurable metastatic disease. It is hoped that new classes of target-based cytotoxic therapeutics will significantly improve the outcome for these patients. Many of these novel agents have displayed cytotoxic activity in preclinical and clinical evaluations, with little toxicity. Such preferential cytotoxicity against malignant tissues will remain tantamount to the Holy Grail in oncologic therapeutics because this portends improved patient tolerance and overall quality of life, and the capacity to deliver combination therapy. Combinations of such rationally designed target-based therapies are likely to be increasingly important in treating patients with breast carcinoma. The anticancer efficacy of these agents will, however, remain dependent on the involvement of the targets of these agents in the biology of the individual patient's disease. Results of DNA microarray analyses have raised high hopes that the analyses of RNA expression levels can successfully predict patient prognosis, and indicate that the ability to rapidly 'fingerprint' the oncogenic profile of a patient's tumor is now possible. It is hoped that these studies will support the identification of the molecules driving a tumor's growth, and the selection of the appropriate combination of targeted agents in the near future

  13. Cells of the J774 macrophage cell line are primed for antibody-dependent cell-mediated cytotoxicity following exposure to γ-irradiation

    International Nuclear Information System (INIS)

    Duerst, R.; Werberig, K.

    1991-01-01

    Activation of macrophages (M phi) for host defense against tumor cells follows a sequence of priming events followed by an initiating stimulus that results in production and release of cytotoxic molecules that mediate target cell killing. The authors have developed a model to study specific macrophage cytotoxicity in vitro utilizing a cultured murine M phi cell line, J774. Specific cytotoxicity of cultured human gastrointestinal tumor cells is achieved in the presence of murine IgG2a monoclonal antibody (mAb) 17-1-A. The ability of these cells to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) is greatly enhanced following gamma-irradiation. ADCC can be demonstrated at mAb 17-1-A concentrations greater than or equal to 1 microgram/ml and effector/target cell ratios greater than or equal to 2. Exposure to doses greater than or equal to 10 Gy of gamma-irradiation increases ADCC threefold. Varying the duration from J774 M phi exposure to γ-irradiation until addition of antibody-coated target cells showed that the primed state for ADCC is stable for at least 8 days but approximately 24 hr is required for complete development of the primed state. mAb-dependent target cell death begins 8 hr after addition of mAb and labeled target cells to primed effector cells and is complete by 24 hr. Incubation of unirradiated J774 M phi effector cells with recombinant murine interferon-γ (rmIFN-γ) also results in enhanced ADCC, but the extent of target cell killing achieved is less than that following priming by γ-irradiation. Concomitant priming of γ-irradiated J774 M phi with rmIFN-γ increases the extent of ADCC. Further study of irradiated J774 cells may elucidate the molecular pathways utilized by M phi for achieving and maintaining the primed state for ADCC

  14. Self-sustaining, solar-driven bioelectricity generation in micro-sized microbial fuel cell using co-culture of heterotrophic and photosynthetic bacteria

    Science.gov (United States)

    Liu, Lin; Choi, Seokheun

    2017-04-01

    Among many energy harvesting techniques with great potential, microbial fuel cell (MFC) technology is arguably the most underdeveloped. Even so, excitement is building, as microorganisms can harvest electrical power from any biodegradable organic source (e.g. wastewater) that is readily available in resource-limited settings. Nevertheless, the requirement for endless introduction of organic matter imposes a limiting factor to this technology, demanding an active feeding system and additional power. Here, we demonstrated self-sustaining bioelectricity generation from a microliter-scale microbial fuel cell (MFC) by using the syntrophic interaction between heterotrophic exoelectrogenic bacteria and phototrophs. The MFC continuously generated light-responsive electricity from the heterotrophic bacterial metabolic respiration with the organic substrates produced by photosynthetic bacteria. Without additional organic fuel, the mixed culture in a 90-μL-chamber MFC generated self-sustained current for more than 13 days, while the heterotrophic culture produced current that decreased dramatically within a few hours. The current from the mixed culture was about 70 times greater than that of the device with only photosynthetic bacteria. The miniaturization provided a short start-up time, a well-controlled environment, and small internal resistance. Those advantages will become the general design platform for micropower generation.

  15. Effect of anabolics on bovine granulosa-luteal cell primary cultures.

    Directory of Open Access Journals (Sweden)

    Bartolomeo Biolatti

    2007-10-01

    Full Text Available Granulosa cell tumours are observed with increased frequency among calves slaughtered in Northern Italy. The use of illegal anabolics in breeding was taken into account as a cause of this pathology. An in vitro approach was used to detect the possible alterations of cell proliferation induced by anabolics on primary cultures of bovine granulosa-luteal cells. Cultures were treated with different concentrations of substances illegally used in cattle (17beta-estradiol, clenbuterol and boldione. Cytotoxicity was determined by means of MTT test, to exclude toxic effects induced by anabolics and to determine the highest concentration to be tested. Morphological changes were evaluated by means of routine cytology, while PCNA expression was quantified in order to estimate cell proliferation. Cytotoxic effects were revealed at the highest concentrations. The only stimulating effect on cell proliferation was detected in boldione treated cultures: after 48 h treated cells, compared to controls, showed a doubled expression of PCNA. In clenbuterol and 17beta-estradiol treated cells PCNA expression was similar to controls or even decreased. As the data suggest an alteration in cell proliferation, boldione could have a role in the early stage of pathogenesis of granulosa cell tumour in cattle.

  16. Chaetoglobosins from Chaetomium globosum, an endophytic fungus in Ginkgo biloba, and their phytotoxic and cytotoxic activities.

    Science.gov (United States)

    Li, He; Xiao, Jian; Gao, Yu-Qi; Tang, Jiang Jiang; Zhang, An-Ling; Gao, Jin-Ming

    2014-04-30

    In preceding studies, cultivation of Chaetomium globosum, an endophytic fungus in Ginkgo biloba, produced five cytochalasan mycotoxins, chaetoglobosins A, G, V, Vb, and C (1-5), in three media. In the present work, five known chaetoglobosins, C, E, F, Fex, and 20-dihydrochaetoglobosin A (5-9), together with the four known compounds (11-14), were isolated from the MeOH extracts of the solid culture of the same endophyte. The structures of these metabolites were elucidated on the basis of spectroscopic analysis. Treatment of chaetoglobosin F (7) with (diethylamino)sulfur trifluoride (DAST) in dichloromethane afforded an unexpected fluorinated chaetoglobosin, named chaetoglobosin Fa (10), containing an oxolane ring between C-20 and C-23. The phytotoxic effects of compounds 1, 3-8, and 10 were assayed on radish seedlings; some of these compounds (1, 3, and 6-8) significantly inhibited the growth of radish (Raphanus sativus) seedlings with inhibitory rates of >60% at a concentration of 50 ppm, which was comparable or superior to the positive control, glyphosate. In addition, the cytotoxic activities against HCT116 human colon cancer cells were also tested, and compounds 1 and 8-10 showed remarkable cytotoxicity with IC50 values ranging from 3.15 to 8.44 μM, in comparison to the positive drug etoposide (IC50 = 2.13 μM). The epoxide ring between C-6 and C-7 or the double bond at C-6(12) led to a drastically increased cytotoxicity, and chaetoglobosin Fa (10) displayed a markedly increased cytotoxicity but decreased phytotoxicity.

  17. Loss of the ability to generate large burst-forming unit-like megakaryocytic colonies from thawed cord blood in semisolid cultures after short term suspension culture.

    Science.gov (United States)

    Eskola, M; Bäckman, S; Möttönen, S; Kekomäki, R

    2015-04-01

    Total colony-forming cells from thawed cord blood units (CBUs) include megakaryocytic colony-forming units (CFU-Mks), which survive the freezing process. The aim of this study was to evaluate whether different megakaryocytic progenitors from unseparated CBUs survive the freezing process and a short-term liquid culture. Thawed samples of CBUs were cultured in liquid medium. During the cultures, serial samples were drawn to assess the growth of different megakaryocytic progenitors in a semisolid collagen medium with identical cytokines as in the liquid medium. Megakaryocytic cells were detected using immunohistochemistry and flow cytometry. In suspension culture, the megakaryocytic progenitors almost completely lost the ability to generate large (burst-forming unit-like, BFU-like) megakaryocytic colonies in semisolid cultures (large colonies, median count per chamber d0: 7.25 vs. d7: 1.5; P culture in suspension resulted in the decline of small colonies as well (d7: 16.0 vs. d14: 5.75; P = 0.0088). Total CFU-Mk count declined from 23.3 (range 12.5-34.0) at d0 to 7.25 (range 1.0-13.5) at d14 (P culture after a short suspension culture. Small CFU-Mks were observed throughout the cultures. It may be that the BFU-Mk colonies matured and acquired CFU-Mk behaviour. © 2014 International Society of Blood Transfusion.

  18. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.

    Science.gov (United States)

    Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali

    2011-03-01

    Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.

  19. Potential genotoxic and cytotoxicity of emamectin benzoate in human normal liver cells.

    Science.gov (United States)

    Zhang, Zhijie; Zhao, Xinyu; Qin, Xiaosong

    2017-10-10

    Pesticide residue inducing cancer-related health problems draw people more attention recently. Emamectin benzoate (EMB) has been widely used in agriculture around the world based on its specificity targets. Although potential risk and the molecular mechanism of EMB toxicity to human liver has not been well-characterized. Unlike well-reported toxicity upon central nervous system, potential genotoxic and cytotoxicity of EMB in human liver cell was ignored and very limited. In this study, we identify genotoxicity and cytotoxicity of EMB to human normal liver cells (QSG7701 cell line) in vitro . We demonstrate that EMB inhibited the viability of QSG7701 cells and induced the DNA damage. Established assays of cytotoxicity were performed to characterize the mechanism of EMB toxicity on QSG7701 cells. Typical chromatin condensation and DNA fragmentation indicated the apoptosis of QSG7701 cells induced by EMB. And the intracellular biochemical results demonstrated that EMB-enhanced apoptosis of QSG7701 cells concurrent with generated ROS, a loss of mitochondrial membrane potential, the cytochrome-c release, up regulate the Bax/Bcl-2 and the activation of caspase-9/-3. Our results of EMB induces the death of QSG7701 cells maybe via mitochondrial-mediated intrinsic apoptotic pathways would contribute to promote the awareness of EMB as an extensive used pesticide to human being effects and reveal the underlying mechanisms of potential genotoxic.

  20. Biological effects of a de novo designed myxoma virus peptide analogue: evaluation of cytotoxicity on tumor cells.

    Directory of Open Access Journals (Sweden)

    Taghrid S Istivan

    Full Text Available BACKGROUND: The Resonant Recognition Model (RRM is a physico-mathematical model that interprets protein sequence linear information using digital signal processing methods. In this study the RRM concept was employed for structure-function analysis of myxoma virus (MV proteins and the design of a short bioactive therapeutic peptide with MV-like antitumor/cytotoxic activity. METHODOLOGY/PRINCIPAL FINDINGS: The analogue RRM-MV was designed by RRM as a linear 18 aa 2.3 kDa peptide. The biological activity of this computationally designed peptide analogue against cancer and normal cell lines was investigated. The cellular cytotoxicity effects were confirmed by confocal immunofluorescence microscopy, by measuring the levels of cytoplasmic lactate dehydrogenase (LDH and by Prestoblue cell viability assay for up to 72 hours in peptide treated and non-treated cell cultures. Our results revealed that RRM-MV induced a significant dose and time-dependent cytotoxic effect on murine and human cancer cell lines. Yet, when normal murine cell lines were similarly treated with RRM-MV, no cytotoxic effects were observed. Furthermore, the non-bioactive RRM designed peptide RRM-C produced negligible cytotoxic effects on these cancer and normal cell lines when used at similar concentrations. The presence/absence of phosphorylated Akt activity in B16F0 mouse melanoma cells was assessed to indicate the possible apoptosis signalling pathway that could be affected by the peptide treatment. So far, Akt activity did not seem to be significantly affected by RRM-MV as is the case for the original viral protein. CONCLUSIONS/SIGNIFICANCE: Our findings indicate the successful application of the RRM concept to design a bioactive peptide analogue (RRM-MV with cytotoxic effects on tumor cells only. This 2.345 kDa peptide analogue to a 49 kDa viral protein may be suitable to be developed as a potential cancer therapeutic. These results also open a new direction to the rational

  1. In vitro analysis of cytotoxic T cell recruitment mediated by the DC-derived chemokine CCL17

    OpenAIRE

    sprotocols

    2015-01-01

    Dendritic cell (DC) licensing in cross-priming requires physical interaction of several rare immune cells, i.e. cytotoxic T cells (CTL), and cross-presenting DCs. Here we describe a novel in vitro method of analyzing chemokine effects on complex recruitment events in a multi-cellular system. To study CTL recruitment towards CCL17-producing DCs, we established a co-culture system of murine splenic DCs with polyclonal splenic CTL from donor mice, which enables visualization of cell motility and...

  2. Phenolics, Antiradical Assay and Cytotoxicity of Processed Mango ...

    African Journals Online (AJOL)

    Phenolics, Antiradical Assay and Cytotoxicity of Processed Mango ( Mangifera indica ) and Bush Mango ( Irvingia gabonensis ) Kernels. ... Nigerian Food Journal ... Phenolic constituents (total phenols, flavonoids, tannins, and anthocyanins), comparative antiradical potency and cytotoxicity of processed mango (Mangifera ...

  3. The effect of bicarbonate on menadione-induced redox cycling and cytotoxicity: potential involvement of the carbonate radical.

    Science.gov (United States)

    Aljuhani, Naif; Michail, Karim; Karapetyan, Zubeida; Siraki, Arno G

    2013-10-01

    We have investigated the effect of NaHCO3 on menadione redox cycling and cytotoxicity. A cell-free system utilized menadione and ascorbic acid to catalyze a redox cycle, and we utilized murine hepatoma (Hepa 1c1c7) cells for in vitro experiments. Experiments were performed using low (2 mmol/L) and physiological (25 mmol/L) levels of NaHCO3 in buffer equilibrated to physiological pH. Using oximetry, ascorbic acid oxidation, and ascorbyl radical detection, we found that menadione redox cycling was enhanced by NaHCO3. Furthermore, Hepa 1c1c7 cells treated with menadione demonstrated cytotoxicity that was significantly increased with physiological concentrations of NaHCO3 in the media, compared with low levels of NaHCO3. Interestingly, the inhibition of superoxide dismutase (SOD) with 2 different metal chelators was associated with a protective effect against menadione cytotoxicity. Using isolated protein, we found a significant increase in protein carbonyls with menadione-ascorbate-SOD with physiological NaHCO3 levels; low NaHCO3 or SOD-free reactions produced lower levels of protein carbonyls. In conclusion, these findings suggest that the hydrogen peroxide generated by menadione redox cycling together with NaHCO3-CO2 are potential substrates for SOD peroxidase activity that can lead to carbonate-radical-enhanced cytotoxicity. These findings demonstrate the importance of NaHCO3 in menadione redox cycling and cytotoxicity.

  4. Cytoprotective effect of tocopherols in hepatocytes cultured with polyunsaturated fatty acids

    DEFF Research Database (Denmark)

    Mikkelsen, L.; Hansen, Harald S.; Grunnet, N.

    1994-01-01

    When highly unsaturated fatty acids are added to cell cultures, it can become important to include antioxidants in the culture medium to prevent cytotoxic peroxidation. To find an optimal antioxidant for this purpose, the effect of 50 µM a-tocopherol, ¿-tocopherol, a-tocopheryl acetate, a...... of thiobarbituric acid reactive substances in the cultures was also measured. a-Tocopheryl acid succinate was found to be the most effective cytoprotective compound, followed by N,N'-diphenyl-1,4-phenylenediamine, a- tocopherol, ¿-tocopherol and a-tocopheryl acetate, and a-tocopheryl phosphate was without effect....

  5. Rapamycin Synergizes with Cisplatin in Antiendometrial Cancer Activation by Improving IL-27–Stimulated Cytotoxicity of NK Cells

    Directory of Open Access Journals (Sweden)

    Wen-Jie Zhou

    2018-01-01

    Full Text Available Natural killer (NK cell function is critical for controlling initial tumor growth and determining chemosensitivity of the tumor. A synergistic relationship between rapamycin and cisplatin in uterine endometrial cancer (UEC in vitro has been reported, but the mechanism and the combined therapeutic strategy for endometrial cancer (EC are still unknown. We found a positive correlation between the level of IL-27 and the differentiated stage of UEC. The increase of IL-27 in uterine endometrial cancer cell (UECC lines (Ishikawa, RL95-2 and KLE led to a high cytotoxic activity of NK cells to UECC in the co-culture system. Exposure with rapamycin enhanced the cytotoxicity of NK cells by upregulating the expression of IL-27 in UECC and IL-27 receptors (IL-27Rs: WSX-1 and gp130 on NK cells and further restricted the growth of UEC in Ishikawa-xenografted nude mice. In addition, treatment with rapamycin resulted in an increased autophagy level of UECC, and IL-27 enhanced this ability of rapamycin. Cisplatin-mediated NK cells' cytotoxic activity and anti-UEC activation were independent of IL-27; however, the combination of rapamycin and cisplatin led to a higher cytotoxic activity of NK cells, smaller UEC volume and longer survival rate in vivo. These results suggest that rapamycin and cisplatin synergistically activate the cytotoxicity of NK cells and inhibit the progression of UEC in both an IL-27–dependent and –independent manner. This provides a scientific basis for potential rapamycin-cisplatin combined therapeutic strategies targeted to UEC, especially for the patients with low differentiated stage or abnormally low level of IL-27.

  6. MODULATION OF THE CYTOTOXICITY AND GENOTOXICITY OF THE DRINKING WATER DBP IODOACETIC ACID BY SUPPRESSORS OF OXIDATIVE STRESS

    Science.gov (United States)

    Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose a hazard to the public health. Previously we demonstrated that iodoacetic acid was the most cytotoxic and genotoxic DBP analyzed in a mammalian cell system. Little is k...

  7. Anti-inflammatory and cytotoxic activities of five Veronica species.

    Science.gov (United States)

    Harput, U Sebnem; Saracoglu, Iclal; Inoue, Makoto; Ogihara, Yukio

    2002-04-01

    Biological activities of five Veronica species (Scrophulariaceae), V. cymbalaria, V. hederifolia, V. pectinata var. glandulosa, V. persica and V. polita were studied for their anti-inflammatory and cytotoxic activities. Their methanol extracts showed both the inhibitory activity of nitric oxide (NO) production in lipopolysaccharide (LPS)-stimulated macrophages and cytotoxic activity against KB epidermoid carcinoma and B16 melanoma. When the methanol extracts were fractionated between water and chloroform, water fractions significantly inhibited NO production without any cytotoxicity, while chloroform fractions showed cytotoxicity dose-dependently. When the radical scavenging activity was determined using 2,2-diphenyl-1-picryl-hydrazyl (DPPH), water fractions of the five Veronica species scavenged free radicals effectively, suggesting that the inhibitory effect of this species on NO production was due to their radical scavenging activity. On the other hand, chloroform fractions of Veronica species except for V. cymbalaria showed similar cytotoxic activity against KB and B16 melanoma cells.

  8. Virus-directed enzyme prodrug therapy and the assessment of the cytotoxic impact of some benzimidazole derivatives.

    Science.gov (United States)

    Szewczuk, Michał; Boguszewska, Karolina; Żebrowska, Marta; Balcerczak, Ewa; Stasiak, Marta; Świątkowska, Maria; Błaszczak-Świątkiewicz, Katarzyna

    2017-07-01

    Virus-directed enzyme prodrug therapy is one of the major strategy of increasing cytotoxicity of bioreductive agents. This research intended to examine new selected benzimidazole derivatives as a substrate for nitroreductase, the enzyme involved in nitroreduction which is responsible to the production of cytotoxic metabolites. In this way, the selectivity and strength of cytotoxicity can be raised. The effect of benzimidazoles on virus transfected cells and non-virus transfected cells A549 cell line was established by Annexin V + propidium iodide test, western blot, and polymerase chain reaction analysis of specific pro- and anti-apoptotic proteins in the corresponding gene expression and additionally nitroreductase gene expression. Our results proved the pro-apoptotic properties of all tested compounds in normoxia and hypoxia, especially according to virused A549 cells where the time of exposition was reduced from 48 to 4 h. In this shorten period of time, the strongest activity was shown by N-oxide compounds with nitro-groups. The apoptosis was confirmed by generation of BAX gene and protein and reduction of BCL2 gene and protein.

  9. Mycolactone cytotoxicity in Schwann cells could explain nerve damage in Buruli ulcer.

    Directory of Open Access Journals (Sweden)

    Junichiro En

    2017-08-01

    Full Text Available Buruli ulcer is a chronic painless skin disease caused by Mycobacterium ulcerans. The local nerve damage induced by M. ulcerans invasion is similar to the nerve damage evoked by the injection of mycolactone in a Buruli ulcer mouse model. In order to elucidate the mechanism of this nerve damage, we tested and compared the cytotoxic effect of synthetic mycolactone A/B on cultured Schwann cells, fibroblasts and macrophages. Mycolactone induced much higher cell death and apoptosis in Schwann cell line SW10 than in fibroblast line L929. These results suggest that mycolactone is a key substance in the production of nerve damage of Buruli ulcer.

  10. The Influences of Cell Type and ZnO Nanoparticle Size on Immune Cell Cytotoxicity and Cytokine Induction

    Directory of Open Access Journals (Sweden)

    Thurber Aaron

    2009-01-01

    Full Text Available Abstract Nanotechnology represents a new and enabling platform that promises to provide a range of innovative technologies for biological applications. ZnO nanoparticles of controlled size were synthesized, and their cytotoxicity toward different human immune cells evaluated. A differential cytotoxic response between human immune cell subsets was observed, with lymphocytes being the most resistant and monocytes being the most susceptible to ZnO nanoparticle-induced toxicity. Significant differences were also observed between previously activated memory lymphocytes and naive lymphocytes, indicating a relationship between cell-cycle potential and nanoparticle susceptibility. Mechanisms of toxicity involve the generation of reactive oxygen species, with monocytes displaying the highest levels, and the degree of cytotoxicity dependent on the extent of nanoparticle interactions with cellular membranes. An inverse relationship between nanoparticle size and cytotoxicity, as well as nanoparticle size and reactive oxygen species production was observed. In addition, ZnO nanoparticles induce the production of the proinflammatory cytokines, IFN-γ, TNF-α, and IL-12, at concentrations below those causing appreciable cell death. Collectively, these results underscore the need for careful evaluation of ZnO nanoparticle effects across a spectrum of relevant cell types when considering their use for potential new nanotechnology-based biological applications.

  11. Effects of Iron-Oxide Nanoparticle Surface Chemistry on Uptake Kinetics and Cytotoxicity in CHO-K1 Cells

    Directory of Open Access Journals (Sweden)

    Camille C. Hanot

    2015-12-01

    Full Text Available Superparamagnetic iron-oxide nanoparticles (SPIONs show great promise for multiple applications in biomedicine. While a number of studies have examined their safety profile, the toxicity of these particles on reproductive organs remains uncertain. The goal of this study was to evaluate the cytotoxicity of starch-coated, aminated, and PEGylated SPIONs on a cell line derived from Chinese Hamster ovaries (CHO-K1 cells. We evaluated the effect of particle diameter (50 and 100 nm and polyethylene glycol (PEG chain length (2k, 5k and 20k Da on the cytotoxicity of SPIONs by investigating cell viability using the tetrazolium dye 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT and sulforhodamine B (SRB assays. The kinetics and extent of SPION uptake by CHO-K1 cells was also studied, as well as the resulting generation of intracellular reactive oxygen species (ROS. Cell toxicity profiles of SPIONs correlated strongly with their cellular uptake kinetics, which was strongly dependent on surface properties of the particles. PEGylation caused a decrease in both uptake and cytotoxicity compared to aminated SPIONs. Interestingly, 2k Da PEG-modifed SPIONs displayed the lowest cellular uptake and cytotoxicity among all studied particles. These results emphasize the importance of surface coatings when engineering nanoparticles for biomedical applications.

  12. Cytotoxic effect of betulinic acid and betulinic acid acetate isolated ...

    African Journals Online (AJOL)

    Cytotoxic effect of betulinic acid and betulinic acid acetate isolated from Melaleuca cajuput on human myeloid leukemia (HL-60) cell line. ... The cytotoxic effect of betulinic acid (BA), isolated from Melaleuca cajuput a Malaysian plant and its four synthetic derivatives were tested for their cytotoxicity in various cell line or ...

  13. HYPOLIPIDEMIC EFFECT OF ARGLABIN IN HEPATOMA TISSUE CULTURE

    Directory of Open Access Journals (Sweden)

    A. V. Ratkin

    2015-01-01

    Full Text Available Objective. Investigation of hypolipidemic effect of sesquiterpene γ-lactone Arglabin in hepatoma tissue culture (HTC.Materials and methods. In this study we’ve evaluated the effect of sesquiterpene γ-lactone Arglabin and gemfibrozil (reference drug on the lipid content in the hepatoma tissue culture (HTC which were incubated with a fat emulsion “Lipofundin” by fluorescent method with vital dye Nile Red. The cell viability was investigated using the MTT-test and staining by Trypan blue.Results. Cultivation of cell cultures of rat’s hepatoma cell line HTC with Arglabin and gemfibrozil in concentrations from 10 to 50 μmol and from 0.25 to 0.5 mmol, respectively, had no cytotoxic effect. HTC cell viability did not change compared with the corresponding rate in the control culture. Experimental hyperlipidemia in hepatoma culture was induced by the addition in the incubation medium of fat emulsion “Lipofundin” in a final concentration of 0.05 %. The fluorescence intensity of Nile Red in the cells was increased 4-fold (p < 0.05, which indicates a significant accumulation of lipids in the cytosol of cells. In these steady-state Arglabin and gemfibrozil at concentrations 75–100 μM and 0.25–1.0 mM, respectively, reduced the content of lipid in cells. Conclusion. In the model of hyperlipidemia induced by lipofundin, sesquiterpene γ-lactone Arglabin prevents the accumulation of lipids in the HTC cell line, as evidenced by a decrease in Nile Red fluorescence. However hypolipidemic effect of Arglabin is associated with cytotoxic effects, which is typical for anticancer drugs.

  14. Human Flt3L generates dendritic cells from canine peripheral blood precursors: implications for a dog glioma clinical trial.

    Directory of Open Access Journals (Sweden)

    Weidong Xiong

    2010-06-01

    Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumor in adults and carries a dismal prognosis. We have developed a conditional cytotoxic/immunotherapeutic approach using adenoviral vectors (Ads encoding the immunostimulatory cytokine, human soluble fms-like tyrosine kinase 3 ligand (hsFlt3L and the conditional cytotoxic molecule, i.e., Herpes Simplex Type 1- thymide kinase (TK. This therapy triggers an anti-tumor immune response that leads to tumor regression and anti-tumor immunological memory in intracranial rodent cancer models. We aim to test the efficacy of this immunotherapy in dogs bearing spontaneous GBM. In view of the controversy regarding the effect of human cytokines on dog immune cells, and considering that the efficacy of this treatment depends on hsFlt3L-stimulated dendritic cells (DCs, in the present work we tested the ability of Ad-encoded hsFlt3L to generate DCs from dog peripheral blood and compared its effects with canine IL-4 and GM-CSF.Our results demonstrate that hsFlT3L expressed form an Ad vector, generated DCs from peripheral blood cultures with very similar morphological and phenotypic characteristics to canine IL-4 and GM-CSF-cultured DCs. These include phagocytic activity and expression of CD11c, MHCII, CD80 and CD14. Maturation of DCs cultured under both conditions resulted in increased secretion of IL-6, TNF-alpha and IFN-gamma. Importantly, hsFlt3L-derived antigen presenting cells showed allostimulatory potential highlighting their ability to present antigen to T cells and elicit their proliferation.These results demonstrate that hsFlt3L induces the proliferation of canine DCs and support its use in upcoming clinical trials for canine GBM. Our data further support the translation of hsFlt3L to be used for dendritic cells' vaccination and gene therapeutic approaches from rodent models to canine patients and its future implementation in human clinical trials.

  15. Cell-mediated immunity in herpes simplex virus-infected mice: functional analysis of lymph node cells during periods of acute and latent infection, with reference to cytotoxic and memory cells.

    Science.gov (United States)

    Nash, A A; Quartey-Papafio, R; Wildy, P

    1980-08-01

    The functional characteristics of lymphoid cells were investigated during acute and latent infection of mice with herpes simplex virus (HSV). Cytotoxic T cells were found in the draining lymph node (DLN) 4 days p.i. and had reached maximum activity between 6 and 9 days. After the 12th day and during the period of latent infection (> 20 days) no cytotoxic cell activity was observed. Cytotoxic activity could only be detected when the lymphoid cells had been cultured for a period of 3 days. In general, the cell killing was specific for syngeneic infected target cells, although some killing of uninfected targets was observed. In contrast to the cytotoxic response, DLN cells responding to HSV in a proliferation assay were detected towards the end of the acute phase and at lease up to 9 months thereafter. The significance of these observations for the pathogenesis of HSV is discussed.

  16. Cytotoxic effects of cyanoacrylates used as retrograde filling materials: an in vitro analysis

    Directory of Open Access Journals (Sweden)

    Azevedo Cledson Lima de

    2003-01-01

    Full Text Available Cyanoacrylate has been used in medicine and dentistry for many years. It has been used as a postextraction dressing and retrograde filling material in endodontic surgery. The aim of this study was to evaluate the cytotoxic effects of Histoacryl and other two homologue ethyl cyanoacrylates, Super Bonder and Ultrabond, on cultured fibroblasts, using the Trypan blue dye exclusion assay. The cyanoacrylates were applied to round glass coverslips, which were placed in contact with NIH 3T3 cells. After 0, 6, 12 and 24 h (short-term assay; viability and 1, 3, 5 and 7 days (long-term assay; survival, the cells were examined under phase light microscopy and counted. The data were compared by the Kruskal-Wallis test. In the short-term experiments, only the cultures of the Ultrabond group (GIV presented significant smaller percentages of cell viability than the cultures of the other groups (GI: control; GII: Super Bonder; GIII: Histoacryl. Although the cultures of the Super Bonder group (GII presented smaller percentages of cell viability than cultures of the other groups (GI, GIII, GIV at the long-term assay, this group was the only experimental group presenting a continuous and progressive cell growth. Our results have shown an in vitro biocompatibility of Histoacryl and ethyl cyanoacrylate homologues. These cyanoacrylates could therefore be of importance for endodontic purposes.

  17. Cytotoxicity of retinoic acid, menadione and aflatoxin B1 in rat liver slices using netwell inserts as a culture system

    NARCIS (Netherlands)

    Leeman, W.R.; Gevel, I.A. van de; Rutten, A.A.J.J.L.

    1995-01-01

    Precision-cut rat liver slices were used to develop a new dynamic incubation system in which histomorphology and measurement of the release of lactate dehydrogenase (LDH) and the conversion of MTT were applied to evaluate cytotoxicity. Liver slices, precision-cut using a Krumdieck tissue slicer,

  18. Legionella confirmation in cooling tower water. Comparison of culture, real-time PCR and next generation sequencing.

    Science.gov (United States)

    Farhat, Maha; Shaheed, Raja A; Al-Ali, Haider H; Al-Ghamdi, Abdullah S; Al-Hamaqi, Ghadeer M; Maan, Hawraa S; Al-Mahfoodh, Zainab A; Al-Seba, Hussain Z

    2018-02-01

    To investigate the presence of Legionella spp in cooling tower water. Legionella proliferation in cooling tower water has serious public health implications as it can be transmitted to humans via aerosols and cause Legionnaires' disease. Samples of cooling tower water were collected from King Fahd Hospital of the University (KFHU) (Imam Abdulrahman Bin Faisal University, 2015/2016). The water samples were analyzed by a standard Legionella culture method, real-time polymerase chain reaction (RT-PCR), and 16S rRNA next-generation sequencing. In addition, the bacterial community composition was evaluated. All samples were negative by conventional Legionella culture. In contrast, all water samples yielded positive results by real-time PCR (105 to 106 GU/L). The results of 16S rRNA next generation sequencing showed high similarity and reproducibility among the water samples. The majority of sequences were Alpha-, Beta-, and Gamma-proteobacteria, and Legionella was the predominant genus. The hydrogen-oxidizing gram-negative bacterium Hydrogenophaga was present at high abundance, indicating high metabolic activity. Sphingopyxis, which is known for its resistance to antimicrobials and as a pioneer in biofilm formation, was also detected. Our findings indicate that monitoring of Legionella in cooling tower water would be enhanced by use of both conventional culturing and molecular methods.

  19. Cytotoxic activity of plants from East Azarbaijan province, Iran

    Directory of Open Access Journals (Sweden)

    M. Irani

    2017-11-01

    Full Text Available Background and objectives: Due to the high cancer mortality rates and side effects of different types of cancer treatments, discovering effective treatments without or with fewer side effects is the main purpose of many researchers all around the world. Plants play an important role in the discovery of new drugs. Iran owns rich and varied vegetation but the majority of these plants have not yet undergone chemical, pharmacological and toxicological studies. In the present study, some species from East Azarbaijan province of Iran were evaluated for cytotoxicity effects. Methods: Total methanol extract of 29 plants from 18 families were screened for their cytotoxic activities. The inhibition of cell growth for these extracts was evaluated against MCF-7, A-549, Hep-G2, HT-29 and MDBK cell lines. Their 50% inhibitions of growth (IC50 were determined by MTT assay. Moreover, cytotoxic evaluation of different fractions (ether de petrol, chloroform and methanol of the most potent species was performed. Results: Total extracts and fractions of Bryonia aspera, Centaurea salicifolia, Cuscuta chinensis, Ecbalium elaterium, Gypsophila ruscifolia, Ononis spinosa exhibited potent cytotoxic activity against one or more of the cell lines. Three of the mentioned total extracts presented cytotoxicity effects exclusively against HT-29 cells. Also three fractions (one ether de petrol and two chloroform fractions demonstrated selective cytotoxicity effects against MCF-7cells. Conclusion: It was concluded that these 6 potent species were proper candidates for identification and isolation of active ingredients with cytotoxic effects  and further studies about these species are recommended.

  20. Antibacterial and Cytotoxic Activities of Acacia nilotica Lam ...

    African Journals Online (AJOL)

    Erah

    that had maximum bactericidal activity against all the tested isolates, but showed < 30 % host cell cytotoxicity. Conclusion: The lysate of Acacia nilotica ... cytotoxic effects on human cells. EXPERIMENTAL. Plant material. Acacia nilotica Lam .... a detergent that permeabilizes eukaryotic cells and results in HBMEC damage.

  1. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.

    Science.gov (United States)

    Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H

    2015-07-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Effects of viscoelastic ophthalmic solutions on cell cultures

    Directory of Open Access Journals (Sweden)

    Madhavan Hajib

    1998-01-01

    Full Text Available The development of mild but significant inflammation probably attributable to viscoelastic ophthalmic solutions in cataract surgery was recently brought to the notice of the authors, and hence a study of the effects of these solutions available in India, on cell cultures was undertaken. We studied the effects of 6 viscoelastic ophthalmic solutions (2 sodium hyaluronate designated as A and B, and 4 hydroxypropylmethylcellulose designated as C, D, E and F on HeLa, Vero and BHK-21 cell lines in tissue culture microtitre plates using undiluted, 1:10 and 1:100 dilutions of the solutions, and in cover slip cultures using undiluted solutions. Phase contrast microscopic examination of the solutions was also done to determine the presence of floating particles. The products D and F produced cytotoxic changes in HeLa cell line and these products also showed the presence of floating particles under phase contrast microscopy. Other products did not have any adverse effects on the cell lines nor did they show floating particles. The viscoelastic ophthalmic pharmaceutical products designated D and F have cytotoxic effects on HeLa cell line which appears to be a useful cell line for testing these products for their toxicity. The presence of particulate materials in products D and F indicates that the methods used for purification of the solution are not effective.

  3. Reactive oxygen species (ROS) induced cytokine production and cytotoxicity of PAMAM dendrimers in J774A.1 cells

    International Nuclear Information System (INIS)

    Naha, Pratap C.; Davoren, Maria; Lyng, Fiona M.; Byrne, Hugh J.

    2010-01-01

    The immunotoxicity of three generations of polyamidoamine (PAMAM) dendrimers (G-4, G-5 and G-6) was evaluated in mouse macrophage cells in vitro. Using the Alamar blue and MTT assays, a generation dependent cytotoxicity of the PAMAM dendrimers was found whereby G-6 > G-5 > G-4. The toxic response of the PAMAM dendrimers correlated well with the number of surface primary amino groups, with increasing number resulting in an increase in toxic response. An assessment of intracellular ROS generation by the PAMAM dendrimers was performed by measuring the increased fluorescence as a result of intracellular oxidation of Carboxy H 2 DCFDA to DCF both quantitatively using plate reader and qualitatively by confocal laser scanning microscopy. The inflammatory mediators macrophage inflammatory protein-2 (MIP-2), tumour necrosis factor-α (TNF-α) and interleukin-6, (IL-6) were measured by the enzyme linked immunosorbant assay (ELISA) following exposure of mouse macrophage cells to PAMAM dendrimers. A generation dependent ROS and cytokine production was found, which correlated well with the cytotoxicological response and therefore number of surface amino groups. A clear time sequence of increased ROS generation (maximum at ∼ 4 h), TNF-α and IL-6 secretion (maximum at ∼ 24 h), MIP-2 levels and cell death (∼ 72 h) was observed. The intracellular ROS generation and cytokine production induced cytotoxicity point towards the mechanistic pathway of cell death upon exposure to PAMAM dendrimers.

  4. A Developed NK-92MI Cell Line with Siglec-7neg Phenotype Exhibits High and Sustainable Cytotoxicity against Leukemia Cells

    Directory of Open Access Journals (Sweden)

    Chin-Han Huang

    2018-04-01

    Full Text Available Altered sialic acid processing that leads to upregulation of cell surface sialylation is recognized as a key change in malignant tissue glycosylation. This cancer-associated hypersialylation directly impacts the signaling interactions between tumor cells and their surrounding microenvironment, especially the interactions mediated by immune cell surface sialic acid-binding immunoglobulin-like lectins (Siglecs to relay inhibitory signals for cytotoxicity. First, we obtained a Siglec-7neg NK-92MI cell line, NK-92MI-S7N, by separating a group of Siglec-7neg cell population from an eight-month-long-term NK-92MI in vitro culture by fluorescence-activated cell sorting (FACS. The effect of Siglec-7 loss on NK-92MI-S7N cells was characterized by the cell morphology, proliferation, and cytotoxic activity via FACS, MTS assay, cytotoxic assay, and natural killer (NK degranulation assay. We found the expression levels of Siglec-7 in NK-92MI were negatively correlated with NK cytotoxicity against leukemia cells. This NK-92MI-S7N cell not only shared very similar phenotypes with its parental cells but also possessed a high and sustainable killing activity. Furthermore, this Siglec-7neg NK line was unexpectedly capable of eliminating a NK-92MI-resistant leukemia cell, THP-1, through enhancing the effector-target interaction. In this study, a NK cell line with high and sustainable cytotoxicity was established and this cell may provide a potential application in NK-based treatment for leukemia patients.

  5. Cytotoxic triterpenoid saponins from Clematis tangutica.

    Science.gov (United States)

    Zhao, Min; Da-Wa, Zhuo-Ma; Guo, Da-Le; Fang, Dong-Mei; Chen, Xiao-Zhen; Xu, Hong-Xi; Gu, Yu-Cheng; Xia, Bing; Chen, Lei; Ding, Li-Sheng; Zhou, Yan

    2016-10-01

    Eight previously undescribed oleanane-type triterpenoid saponins, clematangoticosides A-H, together with eight known saponins, were isolated from the whole plants of Clematis tangutica (Maxim.) Korsh. Their structures were elucidated by extensive spectroscopic analysis, in combination with chemical methods (acid hydrolysis and mild alkaline hydrolysis). Clematangoticosides D-G were found to be unusual 23, 28-bidesmosidic glycosides. The cytotoxic activities of all of the isolated saponins were evaluated against the four human cancer cell lines SGC-7901, HepG2, HL-60 and U251MG. Clematoside S, sapindoside B, kalopanax saponin A, and koelreuteria saponin A exhibited cytotoxicity against all of the test cancer cell lines with IC50 values in the range of 1.88-27.20 μM, while clematangoticoside D and F showed selective cytotoxicity against SGC-7901 with IC50 values of 24.22 and 21.35 μM, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. A Cytotoxic and Anti-inflammatory Campesterol Derivative from Genetically Transformed Hairy Roots of Lopezia racemosa Cav. (Onagraceae

    Directory of Open Access Journals (Sweden)

    Norma Elizabeth Moreno-Anzúrez

    2017-01-01

    Full Text Available The genetically transformed hairy root line LRT 7.31 obtained by infecting leaf explants of Lopezia racemosa Cav with the Agrobacterium rhizogenes strain ATCC15834/pTDT, was evaluated to identify the anti-inflammatory and cytotoxic compounds reported previously for the wild plant. After several subcultures of the LRT 7.31 line, the bio-guided fractionation of the dichloromethane–methanol (1:1 extract obtained from dry biomass afforded a fraction that showed important in vivo anti-inflammatory, and in vitro cytotoxic activities. Chemical separation of the active fraction allowed us to identify the triterpenes ursolic (1 and oleanolic (2 acids, and (23R-2α,3β,23,28-tetrahydroxy-14,15-dehydrocampesterol (3 as the anti-inflammatory principles of the active fraction. A new molecule 3 was characterized by spectroscopic analysis of its tetraacetate derivative 3a. This compound was not described in previous reports of callus cultures, in vitro germinated seedlings and wild plant extracts of whole L. racemosa plants. The anti-inflammatory and cytotoxic activities displayed by the fraction are associated to the presence of compounds 1–3. The present study reports the obtaining of the transformed hairy roots, the bioguided isolation of the new molecule 3, and its structure characterization.

  7. Zinc-Dependent Protection of Tobacco and Rice Cells From Aluminum-Induced Superoxide-Mediated Cytotoxicity

    Science.gov (United States)

    Lin, Cun; Hara, Ayaka; Comparini, Diego; Bouteau, François; Kawano, Tomonori

    2015-01-01

    Al3+ toxicity in growing plants is considered as one of the major factors limiting the production of crops on acidic soils worldwide. In the last 15 years, it has been proposed that Al3+ toxicity are mediated with distortion of the cellular signaling mechanisms such as calcium signaling pathways, and production of cytotoxic reactive oxygen species (ROS) causing oxidative damages. On the other hand, zinc is normally present in plants at high concentrations and its deficiency is one of the most widespread micronutrient deficiencies in plants. Earlier studies suggested that lack of zinc often results in ROS-mediated oxidative damage to plant cells. Previously, inhibitory action of Zn2+ against lanthanide-induced superoxide generation in tobacco cells have been reported, suggesting that Zn2+ interferes with the cation-induced ROS production via stimulation of NADPH oxidase. In the present study, the effect of Zn2+ on Al3+-induced superoxide generation in the cell suspension cultures of tobacco (Nicotiana tabacum L., cell-line, BY-2) and rice (Oryza sativa L., cv. Nipponbare), was examined. The Zn2+-dependent inhibition of the Al3+-induced oxidative burst was observed in both model cells selected from the monocots and dicots (rice and tobacco), suggesting that this phenomenon (Al3+/Zn2+ interaction) can be preserved in higher plants. Subsequently induced cell death in tobacco cells was analyzed by lethal cell staining with Evans blue. Obtained results indicated that presence of Zn2+ at physiological concentrations can protect the cells by preventing the Al3+-induced superoxide generation and cell death. Furthermore, the regulation of the Ca2+ signaling, i.e., change in the cytosolic Ca2+ ion concentration, and the cross-talks among the elements which participate in the pathway were further explored. PMID:26648960

  8. Recombinant IgG1 Fc hexamers block cytotoxicity and pathological changes in experimental in vitro and rat models of neuromyelitis optica.

    Science.gov (United States)

    Tradtrantip, Lukmanee; Felix, Christian M; Spirig, Rolf; Morelli, Adriana Baz; Verkman, A S

    2018-05-01

    Intravenous human immunoglobulin G (IVIG) may have therapeutic benefit in neuromyelitis optica spectrum disorders (herein called NMO), in part because of the anti-inflammatory properties of the IgG Fc region. Here, we evaluated recombinant Fc hexamers consisting of the IgM μ-tailpiece fused with the Fc region of human IgG1. In vitro, the Fc hexamers prevented cytotoxicity in aquaporin-4 (AQP4) expressing cells and in rat spinal cord slice cultures exposed to NMO anti-AQP4 autoantibody (AQP4-IgG) and complement, with >500-fold greater potency than IVIG or monomeric Fc fragments. Fc hexamers at low concentration also prevented antibody-dependent cellular cytotoxicity produced by AQP4-IgG and natural killer cells. Serum from rats administered a single intravenous dose of Fc hexamers at 50 mg/kg taken at 8 h did not produce complement-dependent cytotoxicity when added to AQP4-IgG-treated AQP4-expressing cell cultures. In an experimental rat model of NMO produced by intracerebral injection of AQP4-IgG, Fc hexamers at 50 mg/kg administered before and at 12 h after AQP4-IgG fully prevented astrocyte injury, complement activation, inflammation and demyelination. These results support the potential therapeutic utility of recombinant IgG1 Fc hexamers in AQP4-IgG seropositive NMO. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Nanotoxicity of cobalt induced by oxidant generation and glutathione depletion in MCF-7 cells.

    Science.gov (United States)

    Akhtar, Mohd Javed; Ahamed, Maqusood; Alhadlaq, Hisham A; Alshamsan, Aws

    2017-04-01

    There are very few studies regarding the biological activity of cobalt-based nanoparticles (NPs) and, therefore, the possible mechanism behind the biological response of cobalt NPs has not been fully explored. The present study was designed to explore the potential mechanisms of the cytotoxicity of cobalt NPs in human breast cancer (MCF-7) cells. The shape and size of cobalt NPs were characterized by scanning and transmission electron microscopy (SEM and TEM). The crystallinity of NPs was determined by X-ray diffraction (XRD). The dissolution of NPs was measured in phosphate-buffered saline (PBS) and culture media by atomic absorption spectroscopy (AAS). Cytotoxicity parameters, such as [3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (MTT), neutral red uptake (NRU), and lactate dehydrogenase (LDH) release suggested that cobalt NPs were toxic to MCF-7 cells in a dose-dependent manner (50-200μg/ml). Cobalt NPs also significantly induced reactive oxygen species (ROS) generation, lipid peroxidation (LPO), mitochondrial outer membrane potential loss (MOMP), and activity of caspase-3 enzymes in MCF-7 cells. Moreover, cobalt NPs decreased intracellular antioxidant glutathione (GSH) molecules. The exogenous supply of antioxidant N-acetyl cysteine in cobalt NP-treated cells restored the cellular GSH level and prevented cytotoxicity that was also confirmed by microscopy. Similarly, the addition of buthionine-[S, R]-sulfoximine, which interferes with GSH biosynthesis, potentiated cobalt NP-mediated toxicity. Our data suggested that low solubility cobalt NPs could exert toxicity in MCF-7 cells mainly through cobalt NP dissolution to Co 2+ . Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Culture supernatants from V. cholerae O1 El Tor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity.

    Science.gov (United States)

    Vidal, Jorge E; Enríquez-Rincón, Fernando; Giono-Cerezo, Silvia; Ribas-Aparicio, Rosa María; Figueroa-Arredondo, Paula

    2009-01-01

    To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+) and a non-toxigenic Mexican strain (CM 91-3, ctxAB-). Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.

  11. Evaluating mobile learning practice. Towards a framework for analysis of user-generated contexts with reference to the socio-cultural ecology of mobile learning

    Directory of Open Access Journals (Sweden)

    Judith Seipold

    2011-04-01

    Full Text Available Against the conceptual and theoretical background of a socio-culturally orientated approach to mobile learning (Pachler, Bachmair and Cook, 2010, this paper examines the evaluation of user-generated contexts by referring to an example from the use of mobile phones in schools. We discuss how mobile device-related, user- generated contexts around structures, agency and cultural practices might be brought into a fruitful relationship with institution-based learning. And, we provide categories for evaluating the use of mobile devices to generate meaning from and with fragmented and discontinuous media and modes at the interface of learning in formal, institutionalised and informal, self-directed settings. The evaluation criteria build on the framework of a socio-cultural ecology of mobile learning developed by the London Mobile Learning Group.

  12. Cytotoxicity evaluation of nanoclays in human epithelial cell line A549 using high content screening and real-time impedance analysis

    Energy Technology Data Exchange (ETDEWEB)

    Verma, Navin K. [Trinity College Dublin, Department of Clinical Medicine, Institute of Molecular Medicine (Ireland); Moore, Edward; Blau, Werner [Trinity College Dublin, School of Physics (Ireland); Volkov, Yuri [Trinity College Dublin, Department of Clinical Medicine, Institute of Molecular Medicine (Ireland); Ramesh Babu, P., E-mail: babup@tcd.ie [Trinity College Dublin, Centre for Research on Adaptive Nanostructures and Nanodevices (Ireland)

    2012-09-15

    Continuously expanding use of products containing nanoclays for wide range of applications have raised public concerns about health and safety. Although the products containing nanoclays may not be toxic, it is possible that nanomaterials may come in contact with humans during handling, manufacture, or disposal, and cause adverse health impact. This necessitates biocompatibility evaluation of the commonly used nanoclays. Here, we investigated the cytotoxic effects of platelet (Bentone MA, ME-100, Cloisite Na{sup +}, Nanomer PGV, and Delite LVF) and tubular (Halloysite, and Halloysite MP1) type nanoclays on cultured human lung epithelial cells A549. For the first time with this aim, we employed a cell-based automated high content screening in combination with real-time impedance sensing. We demonstrate varying degree of dose- and time-dependent cytotoxic effects of both nanoclay types. Overall, platelet structured nanoclays were more cytotoxic than tubular type. A low but significant level of cytotoxicity was observed at 25 {mu}g/mL of the platelet-type nanoclays. A549 cells exposed to high concentration (250 {mu}g/mL) of tubular structured nanoclays showed inhibited cell growth. Confocal microscopy indicated intracellular accumulation of nanoclays with perinuclear localization. Results indicate a potential hazard of nanoclay-containing products at significantly higher concentrations, which warrant their further biohazard assessment on the actual exposure in humans.

  13. Cytotoxicity evaluation of nanoclays in human epithelial cell line A549 using high content screening and real-time impedance analysis

    International Nuclear Information System (INIS)

    Verma, Navin K.; Moore, Edward; Blau, Werner; Volkov, Yuri; Ramesh Babu, P.

    2012-01-01

    Continuously expanding use of products containing nanoclays for wide range of applications have raised public concerns about health and safety. Although the products containing nanoclays may not be toxic, it is possible that nanomaterials may come in contact with humans during handling, manufacture, or disposal, and cause adverse health impact. This necessitates biocompatibility evaluation of the commonly used nanoclays. Here, we investigated the cytotoxic effects of platelet (Bentone MA, ME-100, Cloisite Na + , Nanomer PGV, and Delite LVF) and tubular (Halloysite, and Halloysite MP1) type nanoclays on cultured human lung epithelial cells A549. For the first time with this aim, we employed a cell-based automated high content screening in combination with real-time impedance sensing. We demonstrate varying degree of dose- and time-dependent cytotoxic effects of both nanoclay types. Overall, platelet structured nanoclays were more cytotoxic than tubular type. A low but significant level of cytotoxicity was observed at 25 μg/mL of the platelet-type nanoclays. A549 cells exposed to high concentration (250 μg/mL) of tubular structured nanoclays showed inhibited cell growth. Confocal microscopy indicated intracellular accumulation of nanoclays with perinuclear localization. Results indicate a potential hazard of nanoclay-containing products at significantly higher concentrations, which warrant their further biohazard assessment on the actual exposure in humans.

  14. Cell surface antigens of radiation leukemia virus-induced BALB/c leukemias defined by syngeneic cytotoxic T lymphocytes

    International Nuclear Information System (INIS)

    Kaneko, Yukio; Oettgen, H.F.; Obata, Yuichi; Nakayama, Eiichi.

    1989-01-01

    Two cell surface antigens of mouse leukemias were defined by BALB/c cytotoxic T lymphocytes (CTL) generated against syngeneic radiation leukemia virus (RadLV)-induced leukemia, BALBRV1 or BALBRVD. Hyperimmunization of BALB/c mice with irradiated leukemias followed by in vitro sensitization of primed spleen cells resulted in the generation of CTL with high killing activity. The specificity of CTL was examined by direct cytotoxicity assays and competitive inhibition assays. A shared cell surface antigen, designated as BALBRV1 antigen, was detected by BALB/c anti-BALBRV1 CTL. BALBRV1 antigen was expressed not only on RadLV-induced BALB/c leukemias except for BALBRVD, but also on spontaneous or X-ray-induced BALB/c leukemias, chemically-induced leukemias with the H-2 d haplotype and some chemically-induced BALB/c sarcomas. In contrast, a unique cell surface antigen, designated as BALBRVD antigen, was detected by BALB/c anti-BALBRVD CTL. BALBRVD antigen was expressed only on BALBRVD, but not on thirty-nine normal lymphoid or tumor cells. These two antigens could be distinguished from those previously defined on Friend, Moloney, Rauscher or Gross murine leukemia virus (MuLV) leukemias, or MuLV-related antigens. Both cytotoxic responses were blocked by antisera against H-2K d , but not H-2D d . The relationship of BALBRV1 antigen and BALBRVD antigen to endogenous MuLV is discussed with regard to the antigenic distribution on tumor cell lines. (author)

  15. Comparative cytotoxic and genotoxic potential of 13 drinking water disinfection by-products using a microplate-based cytotoxicity assay and a developed SOS/umu assay.

    Science.gov (United States)

    Zhang, Shao-Hui; Miao, Dong-Yue; Tan, Li; Liu, Ai-Lin; Lu, Wen-Qing

    2016-01-01

    The implications of disinfection by-products (DBPs) present in drinking water are of public health concern because of their potential mutagenic, carcinogenic and other toxic effects on humans. In this study, we selected 13 main DBPs found in drinking water to quantitatively analyse their cytotoxicity and genotoxicity using a microplate-based cytotoxicity assay and a developed SOS/umu assay in Salmonella typhimurium TA1535/pSK1002. With the developed SOS/umu test, eight DBPs: 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-fura3-chloro-4-(dichloromethyl)-5-hydroxy-2-[5H]-furanone (MX), dibromoacetonitrile (DBN), iodoacetic acid (IA), bromochloroacetonitrile (BCN), bromoacetic acid (BA), trichloroacetonitrile (TCN), dibromoacetic acid (DBA) and dichloroacetic acid (DCA) were significantly genotoxic to S. typhimurium. Three DBPs: chloroacetic acid (CA), trichloroacetic acid (TCA) and dichloroacetonitrile (DCN) were weakly genotoxic, whereas the remaining DBPs: chloroacetonitrile (CN) and chloral hydrate (CH) were negative. The rank order in decreasing genotoxicity was as follows: MX > DBN > IA > BCN > BA > TCN > DBA > DCA > CA, TCA, DCN > CN, CH. MX was approximately 370 000 times more genotoxic than DCA. In the microplate-based cytotoxicity assay, cytotoxic potencies of the 13 DBPs were compared and ranked in decreasing order as follows: MX > IA > DBN > BCN > BA > TCN > DCN > CA > DCA > DBA > CN > TCA > CH. MX was approximately 19 200 times more cytotoxic than CH. A statistically significant correlation was found between cytotoxicity and genotoxicity of the 13 DBPs in S. typhimurium. Results suggest that microplate-based cytotoxicity assay and the developed SOS/umu assay are feasible tools for analysing the cytotoxicity and genotoxicity of DBPs, particularly for comparing their toxic intensities quantitatively. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e

  16. Cytotoxic effects of glass ionomer cements on human dental pulp stem cells correlate with fluoride release.

    Science.gov (United States)

    Kanjevac, Tatjana; Milovanovic, Marija; Volarevic, Vladislav; Lukic, Miodrag L; Arsenijevic, Nebojsa; Markovic, Dejan; Zdravkovic, Nebojsa; Tesic, Zivoslav; Lukic, Aleksandra

    2012-01-01

    Glass ionomer cements (GICs) are commonly used as restorative materials. Responses to GICs differ among cell types and it is therefore of importance to thoroughly investigate the influence of these restorative materials on pulp stem cells that are potential source for dental tissue regeneration. Eight biomaterials were tested: Fuji I, Fuji II, Fuji VIII, Fuji IX, Fuji Plus, Fuji Triage, Vitrebond and Composit. We compared their cytotoxic activity on human dental pulp stem cells (DPSC) and correlated this activity with the content of Fluoride, Aluminium and Strontium ions in their eluates. Elution samples of biomaterials were prepared in sterile tissue culture medium and the medium was tested for toxicity by an assay of cell survival/proliferation (MTT test) and apoptosis (Annexin V FITC Detection Kit). Concentrations of Fluoride, Aluminium and Strontium ions were tested by appropriate methods in the same eluates. Cell survival ranged between 79.62% (Fuji Triage) to 1.5% (Fuji Plus) and most dead DPSCs were in the stage of late apoptosis. Fluoride release correlated with cytotoxicity of GICs, while Aluminium and Strontium ions, present in significant amount in eluates of tested GICs did not. Fuji Plus, Vitrebond and Fuji VIII, which released fluoride in higher quantities than other GICs, were highly toxic to human DPSCs. Opposite, low levels of released fluoride correlated to low cytotoxic effect of Composit, Fuji I and Fuji Triage.

  17. Monocyte chemoattractant protein-1 (MCP-1 regulates macrophage cytotoxicity in abdominal aortic aneurysm.

    Directory of Open Access Journals (Sweden)

    Qiwei Wang

    Full Text Available AIMS: In abdominal aortic aneurysm (AAA, macrophages are detected in the proximity of aortic smooth muscle cells (SMCs. We have previously demonstrated in a murine model of AAA that apoptotic SMCs attract monocytes and other leukocytes by producing MCP-1. Here we tested whether infiltrating macrophages also directly contribute to SMC apoptosis. METHODS AND RESULTS: Using a SMC/RAW264.7 macrophage co-culture system, we demonstrated that MCP-1-primed RAWs caused a significantly higher level of apoptosis in SMCs as compared to control macrophages. Next, we detected an enhanced Fas ligand (FasL mRNA level and membrane FasL protein expression in MCP-1-primed RAWs. Neutralizing FasL blocked SMC apoptosis in the co-culture. In situ proximity ligation assay showed that SMCs exposed to primed macrophages contained higher levels of receptor interacting protein-1 (RIP1/Caspase 8 containing cell death complexes. Silencing RIP1 conferred apoptosis resistance to SMCs. In the mouse elastase injury model of aneurysm, aneurysm induction increased the level of RIP1/Caspase 8 containing complexes in medial SMCs. Moreover, TUNEL-positive SMCs in aneurysmal tissues were frequently surrounded by CD68(+/FasL(+ macrophages. Conversely, elastase-treated arteries from MCP-1 knockout mice display a reduction of both macrophage infiltration and FasL expression, which was accompanied by diminished apoptosis of SMCs. CONCLUSION: Our data suggest that MCP-1-primed macrophages are more cytotoxic. MCP-1 appears to modulate macrophage cytotoxicity by increasing the level of membrane bound FasL. Thus, we showed that MCP-1-primed macrophages kill SMCs through a FasL/Fas-Caspase8-RIP1 mediated mechanism.

  18. Structure, biodegradation behavior and cytotoxicity of alkali-containing alkaline-earth phosphosilicate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kansal, Ishu; Reddy, AlluAmarnath [Department of Materials and Ceramics Engineering, University of Aveiro, CICECO, 3810-193 Aveiro (Portugal); Muñoz, Francisco [Ceramics and Glass Institute (CSIC), Kelsen 5, 28049 Madrid (Spain); Choi, Seong-Jun [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan 330714 (Korea, Republic of); Institute of Tissue Regeneration Engineering (ITREN), Dankook University, Cheonan 330714 (Korea, Republic of); Kim, Hae-Won [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan 330714 (Korea, Republic of); Institute of Tissue Regeneration Engineering (ITREN), Dankook University, Cheonan 330714 (Korea, Republic of); Department of Biomaterials Science, College of Dentistry, Dankook University, Cheonan 330714 (Korea, Republic of); Tulyaganov, Dilshat U. [Turin Polytechnic University in Tashkent, 100095 Tashkent (Uzbekistan); Ferreira, José M.F., E-mail: jmf@ua.pt [Department of Materials and Ceramics Engineering, University of Aveiro, CICECO, 3810-193 Aveiro (Portugal)

    2014-11-01

    We report on the effect of sodium on the structure, chemical degradation and bioactivity of glasses in the CaO–MgO–SiO{sub 2}–P{sub 2}O{sub 5}–CaF{sub 2} system. The {sup 29}Si and {sup 31}P magic angle spinning-nuclear magnetic resonance spectroscopy of melt-quenched glasses with varying Na{sub 2}O/MgO ratios exhibit a silicate glass network with the dominance of Q{sup 2}(Si) units and phosphorus mainly forming orthophosphate species. Sodium incorporation in the glasses did not induce a significant structural change in the silicate network, while it did influence the phosphate environment due to its lower ionic field strength in comparison with that of magnesium. The apatite forming ability of glasses has been investigated by immersion of glass powders in simulated body fluid (SBF) for time durations varying between 1 h and 7 days while their chemical degradation has been studied in Tris–HCl in accordance with ISO-10993-14. Increasing Na{sup +}/Mg{sup 2+} ratio caused a decrease in the chemical durability of glasses and in the apatite forming ability especially during initial steps of interaction between glass and SBF solution. The cellular responses were observed in vitro on bulk glass samples using mouse-derived pre-osteoblastic MC3T3-E1 cell line. The preliminary study suggested that the increasing alkali-concentration in glasses led to cytotoxicity in the cell culture medium. - Highlights: • Na{sup +} did not induce significant structural changes in chemical Si environment. • Sodium is more prone to affect the chemical environment around P. • Increasing Na{sup +}/Mg{sup 2+} ratios hinder bio-mineralization and chemical durability. • Alkali-containing glasses confer cyto-toxicity to the cell culture medium.

  19. Structure, biodegradation behavior and cytotoxicity of alkali-containing alkaline-earth phosphosilicate glasses

    International Nuclear Information System (INIS)

    Kansal, Ishu; Reddy, AlluAmarnath; Muñoz, Francisco; Choi, Seong-Jun; Kim, Hae-Won; Tulyaganov, Dilshat U.; Ferreira, José M.F.

    2014-01-01

    We report on the effect of sodium on the structure, chemical degradation and bioactivity of glasses in the CaO–MgO–SiO 2 –P 2 O 5 –CaF 2 system. The 29 Si and 31 P magic angle spinning-nuclear magnetic resonance spectroscopy of melt-quenched glasses with varying Na 2 O/MgO ratios exhibit a silicate glass network with the dominance of Q 2 (Si) units and phosphorus mainly forming orthophosphate species. Sodium incorporation in the glasses did not induce a significant structural change in the silicate network, while it did influence the phosphate environment due to its lower ionic field strength in comparison with that of magnesium. The apatite forming ability of glasses has been investigated by immersion of glass powders in simulated body fluid (SBF) for time durations varying between 1 h and 7 days while their chemical degradation has been studied in Tris–HCl in accordance with ISO-10993-14. Increasing Na + /Mg 2+ ratio caused a decrease in the chemical durability of glasses and in the apatite forming ability especially during initial steps of interaction between glass and SBF solution. The cellular responses were observed in vitro on bulk glass samples using mouse-derived pre-osteoblastic MC3T3-E1 cell line. The preliminary study suggested that the increasing alkali-concentration in glasses led to cytotoxicity in the cell culture medium. - Highlights: • Na + did not induce significant structural changes in chemical Si environment. • Sodium is more prone to affect the chemical environment around P. • Increasing Na + /Mg 2+ ratios hinder bio-mineralization and chemical durability. • Alkali-containing glasses confer cyto-toxicity to the cell culture medium

  20. Comparative studies of the mechanisms of paraquat and 1-methyl-4-phenylpyridine (MPP+) cytotoxicity

    International Nuclear Information System (INIS)

    Di Monte, D.; Sandy, M.S.; Ekstroem, G.; Smith, M.T.

    1986-01-01

    1-Methyl-4-phenylpyridine (MPP + ) is the putative toxic metabolite of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and is structurally similar to the herbicide paraquat (PQ ++ ). The authors have therefore compared the effects of MPP + and PQ ++ on isolated rat hepatocytes. PQ ++ generates reactive oxygen species within cells by redox cycling and its toxicity to hepatocytes was potentiated by pretreatment with 1,3-bis(2-chlorethyl)-1-nitrosourea (BCNU), an inhibitor of glutathione reductase. In BCNU-treated cells, PQ ++ caused GSH depletion, lipid peroxidation and cell death. These cytotoxic effects were prevented by the antioxidant N,N'-diphenyl-p-phenylenediamine (DPPD) and the iron-chelating agent desferrioxamine. MPP + also caused GSH depletion in BCNU-treated hepatocytes but its cytotoxicity was not markedly affected by BCNU, nor was it accompanied by significant lipid peroxidation. DPPD and desferrioxamine also failed to prevent MPP + -induced cell death

  1. Oxidative stress-mediated cytotoxicity of zirconia nanoparticles on PC12 and N2a cells

    Energy Technology Data Exchange (ETDEWEB)

    Asadpour, Elham [Shiraz University of Medical Sciences, Anesthesiology and Critical Care Research Center (Iran, Islamic Republic of); Sadeghnia, Hamid R. [Mashhad University of Medical Sciences, Department of Pharmacology, Faculty of Medicine (Iran, Islamic Republic of); Ghorbani, Ahmad [Mashhad University of Medical Sciences, Pharmacological Research Center of Medicinal Plants (Iran, Islamic Republic of); Sedaghat, Mehran, E-mail: m-sedaghat81@yahoo.com [Mashhad University of Medical Sciences, Department of Neurosurgery (Iran, Islamic Republic of); Boroushaki, Mohammad T., E-mail: boroushakimt@mums.ac.ir [Mashhad University of Medical Sciences, Department of Pharmacology, Faculty of Medicine (Iran, Islamic Republic of)

    2016-01-15

    In recent years, there is a growing interest in the application of nanoparticles like zirconium dioxide (zirconia <100 nm), for many purposes. Since a comprehensive study on the toxic effects of zirconia has not been done, we decided to investigate the effects of zirconia nanoparticles on cultured PC12 and N2a cells. In this study, cytotoxic effect of different concentrations of zirconia nanoparticles at three different time intervals were evaluated using MTT and ROS (reactive oxygen species) assays. Also, Lipid peroxidation, glutathione (GSH) content changes, and DNA damage were measured. Zirconia nanoparticles caused a significant reduction in cell viability and GSH content of the cells, and induce a significant increase in intracellular ROS and MDA content of PC12 and N2a cells. Moreover, it increases the percentage of DNA tail of treated cells as compared with control group. Zirconia nanoparticles have cytotoxic and genotoxic effects in PC12 and N2a cells in a time and concentration-dependent manner in concentration more than 31 µg/mL.

  2. Radiopacity and cytotoxicity of Portland cement associated with niobium oxide micro and nanoparticles.

    Science.gov (United States)

    Mestieri, Leticia Boldrin; Tanomaru-Filho, Mário; Gomes-Cornélio, Ana Livia; Salles, Loise Pedrosa; Bernardi, Maria Inês Basso; Guerreiro-Tanomaru, Juliane Maria

    2014-01-01

    Mineral Trioxide Aggregate (MTA) is composed of Portland Cement (PC) and bismuth oxide (BO). Replacing BO for niobium oxide (NbO) microparticles (Nbµ) or nanoparticles (Nbη) may improve radiopacity and bioactivity. The aim of this study was to evaluate the radiopacity and cytotoxicity of the materials: (1) PC; (2) White MTA; (3) PC+30% Nbµ; (4) PC+30% Nbη. For the radiopacity test, specimens of the different materials were radiographed along an aluminum step-wedge. For cell culture assays, Saos-2 osteoblastic-cells (ATCC HTB-85) were used. Cell viability was evaluated through MTT assay, and bioactivity was assessed by alkaline phosphatase activity assay. The results demonstrated higher radiopacity for MTA, followed by Nbµ and Nbη, which had similar values. Cell culture analysis showed that PC and PC+NbO associations promoted greater cell viability than MTA. It was concluded that the combination of PC+NbO is a potential alternative for composition of MTA.

  3. Runx1 and Runx3 are involved in the generation and function of highly suppressive IL-17-producing T regulatory cells.

    Directory of Open Access Journals (Sweden)

    Lequn Li

    Full Text Available CD4(+Foxp3(+ T regulatory cells (Tregs display phenotypic and functional plasticity that is regulated by cytokines and other immune cells. Previously, we determined that during co-culture with CD4(+CD25(- T cells and antigen presenting cells, Tregs produced IL-17. Here, we investigated the mechanisms underlying the differentiation of IL-17-producing Treg (Tr17 cells and their molecular and functional properties. We determined that during stimulation via TCR/CD3 and CD28, the combination of IL-1β and IL-2 was necessary and sufficient for the generation of Tr17 cells. Tr17 cells expressed Runx1 transcription factor, which was required for sustained expression of Foxp3 and RORγt and for production of IL-17. Surprisingly, Tr17 cells also expressed Runx3, which regulated transcription of perforin and granzyme B thereby mediating cytotoxic activity. Our studies indicate that Tr17 cells concomitantly express Foxp3, RORγt, Runx1 and Runx3 and are capable of producing IL-17 while mediating potent suppressive and cytotoxic function.

  4. Random number generation in bilingual Balinese and German students: preliminary findings from an exploratory cross-cultural study.

    Science.gov (United States)

    Strenge, Hans; Lesmana, Cokorda Bagus Jaya; Suryani, Luh Ketut

    2009-08-01

    Verbal random number generation is a procedurally simple task to assess executive function and appears ideally suited for the use under diverse settings in cross-cultural research. The objective of this study was to examine ethnic group differences between young adults in Bali (Indonesia) and Kiel (Germany): 50 bilingual healthy students, 30 Balinese and 20 Germans, attempted to generate a random sequence of the digits 1 to 9. In Balinese participants, randomization was done in Balinese (native language L1) and Indonesian (first foreign language L2), in German subjects in the German (L1) and English (L2) languages. 10 of 30 Balinese (33%), but no Germans, were unable to inhibit habitual counting in more than half of the responses. The Balinese produced significantly more nonrandom responses than the Germans with higher rates of counting and significantly less occurrence of the digits 2 and 3 in L1 compared with L2. Repetition and cycling behavior did not differ between the four languages. The findings highlight the importance of taking into account culture-bound psychosocial factors for Balinese individuals when administering and interpreting a random number generation test.

  5. Cytotoxicity potentials of eleven Bangladeshi medicinal plants.

    Science.gov (United States)

    Khatun, Amina; Rahman, Mahmudur; Haque, Tania; Rahman, Md Mahfizur; Akter, Mahfuja; Akter, Subarna; Jhumur, Afrin

    2014-01-01

    Various forms of cancer are rising all over the world, requiring newer therapy. The quest of anticancer drugs both from natural and synthetic sources is the demand of time. In this study, fourteen extracts of different parts of eleven Bangladeshi medicinal plants which have been traditionally used for the treatment of different types of carcinoma, tumor, leprosy, and diseases associated with cancer were evaluated for their cytotoxicity for the first time. Extraction was conceded using methanol. Phytochemical groups like reducing sugars, tannins, saponins, steroids, gums, flavonoids, and alkaloids were tested using standard chromogenic reagents. Plants were evaluated for cytotoxicity by brine shrimp lethality bioassay using Artemia salina comparing with standard anticancer drug vincristine sulphate. All the extracts showed potent to moderate cytotoxicity ranging from LC50 2 to 115 µg/mL. The highest toxicity was shown by Hygrophila spinosa seeds (LC50 = 2.93 µg/mL) and the lowest by Litsea glutinosa leaves (LC50 = 114.71 µg/mL) in comparison with standard vincristine sulphate (LC50 = 2.04 µg/mL). Among the plants, the plants traditionally used in different cancer and microbial treatments showed highest cytotoxicity. The results support their ethnomedicinal uses and require advanced investigation to elucidate responsible compounds as well as their mode of action.

  6. Evaluation of the Cytotoxicity of Structurally Correlated p-Menthane Derivatives

    Directory of Open Access Journals (Sweden)

    Luciana Nalone Andrade

    2015-07-01

    Full Text Available Compounds isolated from essential oils play an important role in the prevention and treatment of cancer. Monoterpenes are natural products, and the principal constituents of many essential oils. The aim of this study was to investigate the cytotoxic potential of p-menthane derivatives. Additionally, analogues of perillyl alcohol, a monoterpene with known anticancer activity, were evaluated to identify the molecular characteristics which contribute to their cytotoxicity, which was tested against OVCAR-8, HCT-116, and SF-295 human tumor cell lines, using the MTT assay. The results of this study showed that (−-perillaldehyde 8,9-epoxide exhibited the highest percentage inhibition of cell proliferation (GI = 96.32%–99.89%. Perillyl alcohol exhibited high cytotoxic activity (90.92%–95.82%, while (+-limonene 1,2-epoxide (GI = 58.48%–93.10%, (−-perillaldehyde (GI = 59.28%–83.03%, and (−-8-hydroxycarvotanacetone (GI = 61.59%–94.01% showed intermediate activity. All of the compounds tested were less cytotoxic than perillyl alcohol, except (−-perillaldehyde 8,9-epoxide (IC50 = 1.75–1.03 µL/mg. In general, replacement of C-C double bonds by epoxide groups in addition to the aldehyde group increases cytotoxicity. Furthermore, stereochemistry seems to play an important role in cytotoxicity. We have demonstrated the cytotoxic influence of chemical substituents on the p-menthane structure, and analogues of perillyl alcohol.

  7. In vitro cytotoxicity of Manville Code 100 glass fibers: Effect of fiber length on human alveolar macrophages

    Directory of Open Access Journals (Sweden)

    Jones William

    2006-03-01

    observed in fiber-exposed human macrophage cultures. In contrast, rat macrophages exhibited both incomplete phagocytosis of long fibers and length-dependent toxicity. The results of the human and rat cell studies suggest that incomplete engulfment may enhance cytotoxicity of fiber glass. However, the possibility should not be ruled out that differences between human versus rat macrophages other than cell diameter could account for differences in fiber effects.

  8. Cytotoxic activity of Agave lechuguilla Torr | Casillas | African ...

    African Journals Online (AJOL)

    The cytotoxic activity of extract and isolated saponin from leaves of Agave lechuguilla was investigated. Ethanol extract from leaves of A. lechuguilla exhibited cytotoxic activity against HeLa cells in vitro (50% inhibitory concentration (IC50) = 89 μg/ml). Bioassay-guided fractionation of this extract had led to the isolation of 5-β ...

  9. Miniaturized Antimicrobial Susceptibility Test by Combining Concentration Gradient Generation and Rapid Cell Culturing

    Directory of Open Access Journals (Sweden)

    Samuel C. Kim

    2015-10-01

    Full Text Available Effective treatment of bacterial infection relies on timely diagnosis and proper prescription of antibiotic drugs. The antimicrobial susceptibility test (AST is one of the most crucial experimental procedures, providing the baseline information for choosing effective antibiotic agents and their dosages. Conventional methods, however, require long incubation times or significant instrumentation costs to obtain test results. We propose a lab-on-a-chip approach to perform AST in a simple, economic, and rapid manner. Our assay platform miniaturizes the standard broth microdilution method on a microfluidic device (20 × 20 mm that generates an antibiotic concentration gradient and delivers antibiotic-containing culture media to eight 30-nL chambers for cell culture. When tested with 20 μL samples of a model bacterial strain (E. coli ATCC 25922 treated with ampicillin or streptomycin, our method allows for the determination of minimum inhibitory concentrations consistent with the microdilution test in three hours, which is almost a factor of ten more rapid than the standard method.

  10. Cytotoxicity of 5% Tamarindus indica extract and 3% hydrogen peroxide as root canal irrigation

    Directory of Open Access Journals (Sweden)

    Erawati Wulandari

    2008-09-01

    Full Text Available Background: Preparation of root canal is an important stage in endodontic treatment. During conducting preparation, it is always be followed with root canal irrigation that has aim to clean root canal from necrotic tissue remains, grind down dentin powder, micro organism, wet the root canal to make preparation process of root canal easier, and solute root canal content at area that can not be reached by equipment. Flesh of Tamarindus indica (pulpa tamarindorum is used as traditional medicine and it contains vitamin C (antioxidant, protein, fat, glucose, etc. Previous research shows that 5% tamarindus indica extract can clean smear layer but it is more cytotoxicity to cell line BHK–21 than sterilized aquabides. Purpose: This research is to compare cytotoxicity between 5% Tamarindus indica extract with 3% H2O2 as root canal irrigation material. Method: Four teen culture cell line BHK 21 divides into 2 groups. Group 1 is treated with 3% H2O2 and Group 2 is treated with 5% Tamarindus indica extract, for about 2.5 minutes in every group. Then, living and death cell percentage is measured. Data is analyzed with independent t test with significant level of 0.05%. Result: The research showed that death cell in group 1 was 29.3% and in group 2 was 21.1%. There was a significant different (p < 0.05 between group 1 and group 2. Conclusion: Cytotoxicity of 5% Tamarindus indica extract to the cell line BHK–21 is lower than 3% H2O2.

  11. The role of education in the culture of four pillar poverty to establish the nationalism of young generation

    Science.gov (United States)

    Sarmini; Warsono

    2018-01-01

    Globalization as an international integration process brings several positive and negative impacts due to the exchange of world views, products, thoughts, and other cultural aspects that can diminish the values of national identity. Four pillars of nationality are needed as a foundation to counteract the negative effects of globalization, therefore a culturally, educative, legal and structural approach is needed so that the younger generation can truly understand and safeguard the four pillars of our nationality. So far the government has also played little role in building the four pillars into an education. This research intends to see how the role of education can build young generation of nationalism by using research design in the form of content analysis. The population in this study is the Education Office of Sidoarjo Regency, which is the level of Junior High School Education Unit. However, given the scope and breadth of the district of Sidoarjo, a representative sample is determined using FGD (Focus Group Discussion) data collection techniques and questionnaires that will be analyzed using written policy descriptions or unwritten policies. Through a series of research stages, it can be concluded that there are still many principals who have not integrated the culture of the four pillars of nationalism into a written and unwritten document covering intracurricular, extracurricular, school culture and through community participation.

  12. Cytotoxic 1,3-Thiazole and 1,2,4-Thiadiazole Alkaloids from Penicillium oxalicum: Structural Elucidation and Total Synthesis

    Directory of Open Access Journals (Sweden)

    Zheng Yang

    2016-02-01

    Full Text Available Two new thiazole and thiadiazole alkaloids, penicilliumthiamine A and B (2 and 3, were isolated from the culture broth of Penicillium oxalicum, a fungus found in Acrida cinerea. Their structures were elucidated mainly by spectroscopic analysis, total synthesis and X-ray crystallographic analysis. Biological evaluations indicated that compound 1, 3a and 3 exhibit potent cytotoxicity against different cancer cell lines through inhibiting the phosphorylation of AKT/PKB (Ser 473, one of important cancer drugs target.

  13. Cytotoxic effects of Oosporein isolated from endophytic fungus Cochliobolus kusanoi

    Directory of Open Access Journals (Sweden)

    Rmaesha eA

    2015-09-01

    Full Text Available In the present study, oosporein, a fungal toxic secondary metabolite known to be a toxic agent causing chronic disorders in animals, was isolated from fungus Cochliobolus kusanoi of Nerium oleander L. Toxic effects of oosporein and the possible mechanisms of cytotoxicity as well as the role of oxidative stress in cytotoxicity to MDCK kidney cells and RAW 264.7 splene cells were evaluated in-vitro. Also to know the possible in-vivo toxic effects of oosporein on kidney and spleen, Balb/C mouse were treated with different concentrations of oosporein ranging from 20 uM to 200 µM. After 24 hrs of post exposure histopathological observations were made to know the effects of oosporein on target organs. Oosporein induced elevated levels of ROS generation and high levels of MDA, loss of mitochondrial membrane potential (MMP, induced glutathione hydroxylase production was observed in a dose depended manner. Effects oosporein on chromosomal DNA damage was assessed by Comet assay, and increase in DNA damage were observed in both the studied cell lines by increasing the oosprin concentration. Further, oosporein treatment to studied cell lines indicated significant suppression of oxidative stress related gene (SOD1 and CAT expression, and increased levels of mRNA expression in apoptosis or oxidative stress

  14. Electronic cigarette aerosol induces significantly less cytotoxicity than tobacco smoke

    Science.gov (United States)

    Azzopardi, David; Patel, Kharishma; Jaunky, Tomasz; Santopietro, Simone; Camacho, Oscar M.; McAughey, John; Gaça, Marianna

    2016-01-01

    Abstract Electronic cigarettes (E-cigarettes) are a potential means of addressing the harm to public health caused by tobacco smoking by offering smokers a less harmful means of receiving nicotine. As e-cigarettes are a relatively new phenomenon, there are limited scientific data on the longer-term health effects of their use. This study describes a robust in vitro method for assessing the cytotoxic response of e-cigarette aerosols that can be effectively compared with conventional cigarette smoke. This was measured using the regulatory accepted Neutral Red Uptake assay modified for air–liquid interface (ALI) exposures. An exposure system, comprising a smoking machine, traditionally used for in vitro tobacco smoke exposure assessments, was adapted for use with e-cigarettes to expose human lung epithelial cells at the ALI. Dosimetric analysis methods using real-time quartz crystal microbalances for mass, and post-exposure chemical analysis for nicotine, were employed to detect/distinguish aerosol dilutions from a reference Kentucky 3R4F cigarette and two commercially available e-cigarettes (Vype eStick and ePen). ePen aerosol induced 97%, 94% and 70% less cytotoxicity than 3R4F cigarette smoke based on matched EC50 values at different dilutions (1:5 vs. 1:153 vol:vol), mass (52.1 vs. 3.1 μg/cm2) and nicotine (0.89 vs. 0.27 μg/cm2), respectively. Test doses where cigarette smoke and e-cigarette aerosol cytotoxicity were observed are comparable with calculated daily doses in consumers. Such experiments could form the basis of a larger package of work including chemical analyses, in vitro toxicology tests and clinical studies, to help assess the safety of current and next generation nicotine and tobacco products. PMID:27690199

  15. In vitro determination of cytotoxic drug response in ovarian carcinoma using the fluorometric microculture cytotoxicity assay (FMCA).

    Science.gov (United States)

    Csóka, K; Tholander, B; Gerdin, E; de la Torre, M; Larsson, R; Nygren, P

    1997-09-17

    The fluorometric microculture cytotoxicity assay (FMCA), a short-term in vitro assay based on the concept of total tumor cell kill, was used for testing the cytotoxic drug sensitivity of tumor cells from patients with ovarian carcinoma. A total of 125 fresh specimens was obtained, 98 (78%) of which were analyzed successfully. Data from 45 patients were available for clinical correlations. The FMCA appeared to yield clinically relevant cytotoxic drug sensitivity data for ovarian carcinoma as indicated by a comparison with tumor samples obtained from patients with non-Hodgkin's lymphoma or kidney carcinoma. Considering the most active single agent in vitro actually given in vivo, and using the median drug activity among all ovarian carcinoma samples as a cut-off, the sensitivity of the assay and its specificity were 75 and 52%, respectively. Cross-resistance in vitro was frequently observed between standard drugs but not between standard drugs and Taxol. Ten percent of the specimens showed an extreme resistance for at least 4 of 6 of the drugs investigated.

  16. Culture Clash? Investigating constructions of sexual and reproductive health from the perspective of 1.5 generation migrants in Australia using Q methodology.

    Science.gov (United States)

    Dune, T; Perz, J; Mengesha, Z; Ayika, D

    2017-04-04

    In Australia, those who migrate as children or adolescents (1.5 generation migrants) may have entered a new cultural environment at a crucial time in their psychosexual development. These migrants may have to contend with constructions of sexual and reproductive health from at least two cultures which may be at conflict on the matter. This study was designed to investigate the role of culture in constructions of sexual and reproductive health and health care seeking behaviour from the perspective of 1.5 generation migrants. Forty-two adults from various ethno-cultural backgrounds took part in this Q methodological study. Online, participants rank-ordered forty-two statements about constructions of sexual and reproductive health and health seeking behaviours based on the level to which they agreed or disagreed with them. Participants then answered a series of questions about the extent to which their ethnic/cultural affiliations influenced their identity. A by-person factor analysis was then conducted, with factors extracted using the centroid technique and a varimax rotation. A seven-factor solution provided the best conceptual fit for constructions of sexual and reproductive health and help-seeking. Factor A compared progressive and traditional sexual and reproductive health values. Factor B highlighted migrants' experiences through two cultural lenses. Factor C explored migrant understandings of sexual and reproductive health in the context of culture. Factor D explained the role of culture in migrants' intimate relationships, beliefs about migrant sexual and reproductive health and engagement of health care services. Factor E described the impact of culture on sexual and reproductive health related behaviour. Factor F presented the messages migrant youth are given about sexual and reproductive health. Lastly, Factor G compared constructions of sexual and reproductive health across cultures. This study has demonstrated that when the cultural norms of migrants

  17. Next-generation sequencing and culture-based techniques offer complementary insights into fungi and prokaryotes in beach sands.

    Science.gov (United States)

    Romão, Daniela; Staley, Christopher; Ferreira, Filipa; Rodrigues, Raquel; Sabino, Raquel; Veríssimo, Cristina; Wang, Ping; Sadowsky, Michael; Brandão, João

    2017-06-15

    A next-generation sequencing (NGS) approach, in conjunction with culture-based methods, was used to examine fungal and prokaryotic communities for the presence of potential pathogens in beach sands throughout Portugal. Culture-based fungal enumeration revealed low and variable concentrations of the species targeted (yeasts and dermatophytes), which were underrepresented in the community characterized by NGS targeting the ITS1 region. Conversely, NGS indicated that the potentially pathogenic species Purpureocillium liliacinum comprised nearly the entire fungal community. Culturable fecal indicator bacterial concentrations were low throughout the study and unrelated to communities characterized by NGS. Notably, the prokaryotic communities characterized revealed a considerable abundance of archaea. Results highlight differences in communities between methods in beach sand monitoring but indicate the techniques offer complementary insights. Thus, there is a need to leverage culture-based methods with NGS methods, using a toolbox approach, to determine appropriate targets and metrics for beach sand monitoring to adequately protect public health. Copyright © 2017. Published by Elsevier Ltd.

  18. Evaluation of safety of Hammada salicornica in cell culture

    Directory of Open Access Journals (Sweden)

    F. Hosseini Hamedani

    2017-11-01

    Full Text Available Background and objectives: A pharmaceutical products that is planned to be used in clinic, should not only have beneficial effects but also be safe too. Preclinical studies in animals are costly and need considering ethical issues. Cell culture can be used before animal tests. Considering useful effects of these methods, we have evaluated safety of total methanol extract of Hammada salicornica and its aqueous and petroleum ether fractions in cell culture.Methods: Total methanol extract was prepared with the standard method of maceration. Different fractions were prepared by liquid-liquid fractionation and the extracts were then dried with rotary evaporator. After determination of bactericidal concentration of the extracts, 400 ug/mL, the cytotoxicity was tested at various concentrations regarding the minimum antibacterial concentration by MTT test. Hep-2c and VERO cell lines were used in MTT test. A range of concentrations (10-500 ug/mL of the extracts were prepared and were added to about 70% confluent 96 well plates. After exposure for 48 h, MTT solution was added to the wells, and 4 h later formazan crystals were solubilized and optical densities were read at 570 nm. Results: Cytotoxicity Index was calculated and significance test was performed using t-test comparing the Index of the test and control group at each concentration. No significant difference was observed. Conclusion: Various fractions of H. salicornica were not cytotoxic at concentrations above bactericidal concentrations (up to 500 ug/mL. The results need to be confirmed in animal studies before using in human subjects.

  19. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  20. Cytotoxic effects of oxytetracycline residues in the bones of broiler chickens following therapeutic oral administration of a water formulation.

    Science.gov (United States)

    Odore, R; De Marco, M; Gasco, L; Rotolo, L; Meucci, V; Palatucci, A T; Rubino, V; Ruggiero, G; Canello, S; Guidetti, G; Centenaro, S; Quarantelli, A; Terrazzano, G; Schiavone, A

    2015-08-01

    Tetracyclines, which represent one of the most commonly used antibiotics for poultry, are known to be deposited in bones, where they can remain, despite the observation of appropriate withdrawal times. The aim of the study was to determine the concentration of oxytretracycline (OTC) residues in the bone and muscle of chickens, following the oral administration of a commercially available liquid formulation, and to test their cytotoxic effects on an in vitro cell culture model. Seventy-two 1-day-old broiler chickens were randomly allotted into 2 groups (control and treated animals). OTC (40 mg/kg BW) was administered via drinking water during the 1 to 5 and 20 to 25 days of life periods. At the end of the trial, the birds were slaughtered and the OTC residues in the target tissues were measured by means of liquid chromatography (LC) - tandem mass spectrometry (MS/MS). Cytotoxicity was assessed by evaluating the pro-apoptotic effect of the bone residues on the K562 erythroleukemic line and on the peripheral blood mononuclear cells (PBMC). In all the animals, the OTC residues in the muscle were far below the established MRL of 100 μg/kg. The OTC levels in the bones of the treated animals were instead found in the parts per million (ppm) range. Cell cytotoxicity was assessed by evaluating the pro-apoptotic effect of OTC bone residues on the haematopoietic cell system. This in vitro system has revealed a significant pro-apoptotic effect on both the K562 cell line and PBMC cultures. This result suggests potential human and animal health risks due to the entry of tetracycline residues contained in the bones of treated livestock into the food-chain. This could be of concern, particularly for canine and feline diets, as meat, bone meal, and poultry by-products represent some of the main ingredients of pet foods, especially in the case of dry pet food. Further studies are needed to define the underlying mechanisms of cytotoxicity and to evaluate the in vivo toxicological

  1. induced acute cytotoxicity in human cervical epithelial carcinoma cells

    African Journals Online (AJOL)

    Molecular basis of arsenite (As +3 )-induced acute cytotoxicity in human cervical epithelial carcinoma cells. ... Libyan Journal of Medicine ... Methods: After performing cytotoxic assays on a human epithelial carcinoma cell line, expression analysis was done by quantitative polymerase chain reaction, western blotting, and ...

  2. Cytotoxicity and mitogenicity assays with real-time and label-free monitoring of human granulosa cells with an impedance-based signal processing technology intergrating micro-electronics and cell biology.

    Science.gov (United States)

    Oktem, Ozgur; Bildik, Gamze; Senbabaoglu, Filiz; Lack, Nathan A; Akin, Nazli; Yakar, Feridun; Urman, Defne; Guzel, Yilmaz; Balaban, Basak; Iwase, Akira; Urman, Bulent

    2016-04-01

    A recently developed technology (xCelligence) integrating micro-electronics and cell biology allows real-time, uninterrupted and quantitative analysis of cell proliferation, viability and cytotoxicity by measuring the electrical impedance of the cell population in the wells without using any labeling agent. In this study we investigated if this system is a suitable model to analyze the effects of mitogenic (FSH) and cytotoxic (chemotherapy) agents with different toxicity profiles on human granulosa cells in comparison to conventional methods of assessing cell viability, DNA damage, apoptosis and steroidogenesis. The system generated the real-time growth curves of the cells, and determined their doubling times, mean cell indices and generated dose-response curves after exposure to cytotoxic and mitogenic stimuli. It accurately predicted the gonadotoxicity of the drugs and distinguished less toxic agents (5-FU and paclitaxel) from more toxic ones (cisplatin and cyclophosphamide). This platform can be a useful tool for specific end-point assays in reproductive toxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Biorelevant media resistant co-culture model mimicking permeability of human intestine.

    Science.gov (United States)

    Antoine, Delphine; Pellequer, Yann; Tempesta, Camille; Lorscheidt, Stefan; Kettel, Bernadette; Tamaddon, Lana; Jannin, Vincent; Demarne, Frédéric; Lamprecht, Alf; Béduneau, Arnaud

    2015-03-15

    Cell culture models are currently used to predict absorption pattern of new compounds and formulations in the human gastro-intestinal tract (GIT). One major drawback is the lack of relevant apical incubation fluids allowing mimicking luminal conditions in the GIT. Here, we suggest a culture model compatible with biorelevant media, namely Fasted State Simulated Intestinal Fluid (FaSSIF) and Fed State Simulated Intestinal Fluid (FeSSIF). Co-culture was set up from Caco-2 and mucus-secreting HT29-MTX cells using an original seeding procedure. Viability and cytotoxicity assays were performed following incubation of FeSSIF and FaSSIF with co-culture. Influence of biorelevant fluids on paracellular permeability or transporter proteins were also evaluated. Results were compared with Caco-2 and HT29-MTX monocultures. While Caco-2 viability was strongly affected with FeSSIF, no toxic effect was detected for the co-cultures in terms of viability and lactate dehydrogenase release. The addition of FeSSIF to the basolateral compartment of the co-culture induced cytotoxic effects which suggested the apical mucus barrier being cell protective. In contrast to FeSSIF, FaSSIF induced a slight increase of the paracellular transport and both tested media inhibited partially the P-gp-mediated efflux in the co-culture. Additionally, the absorptive transport of propranolol hydrochloride, a lipophilic β-blocker, was strongly affected by biorelevant fluids. This study demonstrated the compatibility of the Caco-2/HT29-MTX model with some of the current biorelevant media. Combining biorelevant intestinal fluids with features such as mucus secretion, adjustable paracellular and P-gp mediated transports, is a step forward to more realistic in-vitro models of the human intestine. Copyright © 2015. Published by Elsevier B.V.

  4. Role of Family, Culture, and Peers in the Success of First-Generation Cambodian American College Students

    Directory of Open Access Journals (Sweden)

    Jennifer Tang

    2013-01-01

    Full Text Available Cambodian American college students are often overlooked in academe because of the model minority myth. The stereotype overshadows the challenges and heterogeneity in the Asian American and Pacific Islander population. This exploratory study examined the experiences of 13 first-generation Cambodian American college students at a large, public institution in California. Findings revealed that, despite obstacles of being first-generation with limited cultural capital, students were transformed into successful leaners when they received validation from their parents and peers and felt a sense of belonging to the college community through their involvement in an ethnic-based student organization.

  5. A cell-microelectronic sensing technique for profiling cytotoxicity of chemicals

    International Nuclear Information System (INIS)

    Boyd, Jessica M.; Huang, Li; Xie Li; Moe, Birget; Gabos, Stephan; Li Xingfang

    2008-01-01

    A cell-microelectronic sensing technique is developed for profiling chemical cytotoxicity and is used to study different cytotoxic effects of the same class chemicals using nitrosamines as examples. This technique uses three human cell lines (T24 bladder, HepG2 liver, and A549 lung carcinoma cells) and Chinese hamster ovary (CHO-K1) cells in parallel as the living components of the sensors of a real-time cell electronic sensing (RT-CES) method for dynamic monitoring of chemical toxicity. The RT-CES technique measures changes in the impedance of individual microelectronic wells that is correlated linearly with changes in cell numbers during t log phase of cell growth, thus allowing determination of cytotoxicity. Four nitrosamines, N-nitrosodimethylamine (NDMA), N-nitrosodiphenylamine (NDPhA), N-nitrosopiperidine (NPip), and N-nitrosopyrrolidine (NPyr), were examined and unique cytotoxicity profiles were detected for each nitrosamine. In vitro cytotoxicity values (IC 50 ) for NDPhA (ranging from 0.6 to 1.9 mM) were significantly lower than the IC 50 values for the well-known carcinogen NDMA (15-95 mM) in all four cell lines. T24 cells were the most sensitive to nitrosamine exposure among the four cell lines tested (T24 > CHO > A549 > HepG2), suggesting that T24 may serve as a new sensitive model for cytotoxicity screening. Cell staining results confirmed that administration of the IC 50 concentration from the RT-CES experiments inhibited cell growth by 50% compared to the controls, indicating that the RT-CES method provides reliable measures of IC 50 . Staining and cell-cycle analysis confirmed that NDPhA caused cell-cycle arrest at the G0/G1 phase, whereas NDMA did not disrupt the cell cycle but induced cell death, thus explaining the different cytotoxicity profiles detected by the RT-CES method. The parallel cytotoxicity profiling of nitrosamines on the four cell lines by the RT-CES method led to the discovery of the unique cytotoxicity of NDPhA causing cell

  6. A cell-microelectronic sensing technique for profiling cytotoxicity of chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Boyd, Jessica M [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Huang, Li [Environmental Health Sciences, Department of Public Health Sciences, School of Public Health, University of Alberta, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Li, Xie; Moe, Birget [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Gabos, Stephan [Public Health Surveillance and Environmental Health, Alberta Health and Wellness, 10025 Jasper Avenue, Box 1360, Edmonton, Alberta, T5J 2N3 (Canada); Xingfang, Li [Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada); Environmental Health Sciences, Department of Public Health Sciences, School of Public Health, University of Alberta, 10-102 Clinical Sciences Building, Edmonton, Alberta, T6G 2G3 (Canada)], E-mail: xingfang.li@ualberta.ca

    2008-05-12

    A cell-microelectronic sensing technique is developed for profiling chemical cytotoxicity and is used to study different cytotoxic effects of the same class chemicals using nitrosamines as examples. This technique uses three human cell lines (T24 bladder, HepG2 liver, and A549 lung carcinoma cells) and Chinese hamster ovary (CHO-K1) cells in parallel as the living components of the sensors of a real-time cell electronic sensing (RT-CES) method for dynamic monitoring of chemical toxicity. The RT-CES technique measures changes in the impedance of individual microelectronic wells that is correlated linearly with changes in cell numbers during t log phase of cell growth, thus allowing determination of cytotoxicity. Four nitrosamines, N-nitrosodimethylamine (NDMA), N-nitrosodiphenylamine (NDPhA), N-nitrosopiperidine (NPip), and N-nitrosopyrrolidine (NPyr), were examined and unique cytotoxicity profiles were detected for each nitrosamine. In vitro cytotoxicity values (IC{sub 50}) for NDPhA (ranging from 0.6 to 1.9 mM) were significantly lower than the IC{sub 50} values for the well-known carcinogen NDMA (15-95 mM) in all four cell lines. T24 cells were the most sensitive to nitrosamine exposure among the four cell lines tested (T24 > CHO > A549 > HepG2), suggesting that T24 may serve as a new sensitive model for cytotoxicity screening. Cell staining results confirmed that administration of the IC{sub 50} concentration from the RT-CES experiments inhibited cell growth by 50% compared to the controls, indicating that the RT-CES method provides reliable measures of IC{sub 50}. Staining and cell-cycle analysis confirmed that NDPhA caused cell-cycle arrest at the G0/G1 phase, whereas NDMA did not disrupt the cell cycle but induced cell death, thus explaining the different cytotoxicity profiles detected by the RT-CES method. The parallel cytotoxicity profiling of nitrosamines on the four cell lines by the RT-CES method led to the discovery of the unique cytotoxicity of NDPh

  7. Cytotoxicity Potentials of Eleven Bangladeshi Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Amina Khatun

    2014-01-01

    Full Text Available Various forms of cancer are rising all over the world, requiring newer therapy. The quest of anticancer drugs both from natural and synthetic sources is the demand of time. In this study, fourteen extracts of different parts of eleven Bangladeshi medicinal plants which have been traditionally used for the treatment of different types of carcinoma, tumor, leprosy, and diseases associated with cancer were evaluated for their cytotoxicity for the first time. Extraction was conceded using methanol. Phytochemical groups like reducing sugars, tannins, saponins, steroids, gums, flavonoids, and alkaloids were tested using standard chromogenic reagents. Plants were evaluated for cytotoxicity by brine shrimp lethality bioassay using Artemia salina comparing with standard anticancer drug vincristine sulphate. All the extracts showed potent to moderate cytotoxicity ranging from LC50 2 to 115 µg/mL. The highest toxicity was shown by Hygrophila spinosa seeds (LC50=2.93 µg/mL and the lowest by Litsea glutinosa leaves (LC50=114.71 µg/mL in comparison with standard vincristine sulphate (LC50=2.04 µg/mL. Among the plants, the plants traditionally used in different cancer and microbial treatments showed highest cytotoxicity. The results support their ethnomedicinal uses and require advanced investigation to elucidate responsible compounds as well as their mode of action.

  8. Synergistic cytotoxic action of vitamin C and vitamin K3.

    Science.gov (United States)

    Zhang, W; Negoro, T; Satoh, K; Jiang, Y; Hashimoto, K; Kikuchi, H; Nishikawa, H; Miyata, T; Yamamoto, Y; Nakano, K; Yasumoto, E; Nakayachi, T; Mineno, K; Satoh, T; Sakagami, H

    2001-01-01

    We investigated the combination effect of sodium ascorbate (vitamin C) and menadione (vitamin K3) on the viability of various cultured cells. Human oral squamous cell carcinoma (HSC-2, HSC-3) and human promyelocytic leukemia (HL-60) cells were more sensitive to these vitamins as compared to normal cells (human gingival fibroblast HGF, human periodontal ligament fibroblast HPLF, human pulp cell HPC). The combination of vitamin C and vitamin K3 produced synergistic cytotoxicity against all these 6 cell lines. Treatment with vitamin C or vitamin K3, or their combination, induced internucleosomal DNA fragmentation only in HL-60 cells, but not in the oral tumor cell lines (HSC-2, HSC-3, HSG). ESR spectroscopy showed that vitamins C and K3 produce radicals under alkaline conditions and that the combination of these two vitamins synergistically enhanced their respective radical intensities.

  9. Reduction of negative environmental impact generated by residues of plant tissue culture laboratory

    Directory of Open Access Journals (Sweden)

    Yusleidys Cortés Martínez

    2016-01-01

    Full Text Available The research is based on the activity developed by teaching and research laboratories for biotechnology purposes with an environmental approach to determine potential contamination risk and analyze the residuals generated. The physical - chemical characterization of the residuals was carried out from contamination indicators that can affect the dumping of residual water. In order to identify the environmental risks and sources of microbial contamination of plant material propagated by in vitro culture that generate residuals, all the risk activities were identified, the type of risk involved in each activity was analyzed, as well as whether or not the standards were met of aseptic normative. The dilution and neutralization was proposed for residuals with extreme values of pH. Since the results of the work a set of measures was proposed to reduce the negative environmental impact of the laboratory residuals. Key words: biosafety, environmental management, microbial contamination

  10. Low antigen dose formulated in CAF09 adjuvant Favours a cytotoxic T-cell response following intraperitoneal immunization in Göttingen minipigs

    DEFF Research Database (Denmark)

    Overgaard, Nana Haahr; Frøsig, Thomas Mørch; Jakobsen, Jeanne Toft

    2017-01-01

    in order to generate a certain type of immune response. To investigate this area further, we used Göttingen minipigs asan animal model especially due to the similar body size and high degree of immunome similarity between humans and pigs. In this study, we show that both a humoral and a cell......-dose immunization. Independent of antigen dose, intraperitoneal administration of antigen increased the amount of TT-specific cytotoxic CD8β+ T cells within the cytokine-producing T-cell pool when compared to the non-cytokine producing T-cell compartment. Taken together, these results demonstrate that a full...... protein formulated in the CAF09 adjuvant and administered to pigs via the intraperitoneal route effectively generates a cytotoxic T-cell response. Moreover, we confirm the inverse relationship between the antigen dose and the induction of polyfunctional T cells in a large animal model. These finding can...

  11. The endoperoxide ascaridol shows strong differential cytotoxicity in nucleotide excision repair-deficient cells

    Energy Technology Data Exchange (ETDEWEB)

    Abbasi, Rashda [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Efferth, Thomas [Institute of Pharmacy und Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Kuhmann, Christine [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Opatz, Till [Institute of Organic Chemistry, Johannes Gutenberg University, Duesbergweg 10-14, 55128 Mainz (Germany); Hao, Xiaojiang [Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204 (China); Popanda, Odilia, E-mail: o.popanda@dkfz.de [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Schmezer, Peter [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2012-03-15

    Targeting synthetic lethality in DNA repair pathways has become a promising anti-cancer strategy. However little is known about such interactions with regard to the nucleotide excision repair (NER) pathway. Therefore, cell lines with a defect in the NER genes ERCC6 or XPC and their normal counterparts were screened with 53 chemically defined phytochemicals isolated from plants used in traditional Chinese medicine for differential cytotoxic effects. The screening revealed 12 drugs that killed NER-deficient cells more efficiently than proficient cells. Five drugs were further analyzed for IC{sub 50} values, effects on cell cycle distribution, and induction of DNA damage. Ascaridol was the most effective compound with a difference of > 1000-fold in resistance between normal and NER-deficient cells (IC{sub 50} values for cells with deficiency in ERCC6: 0.15 μM, XPC: 0.18 μM, and normal cells: > 180 μM). NER-deficiency combined with ascaridol treatment led to G2/M-phase arrest, an increased percentage of subG1 cells, and a substantially higher DNA damage induction. These results were confirmed in a second set of NER-deficient and -proficient cell lines with isogenic background. Finally, ascaridol was characterized for its ability to generate oxidative DNA damage. The drug led to a dose-dependent increase in intracellular levels of reactive oxygen species at cytotoxic concentrations, but only NER-deficient cells showed a strongly induced amount of 8-oxodG sites. In summary, ascaridol is a cytotoxic and DNA-damaging compound which generates intracellular reactive oxidative intermediates and which selectively affects NER-deficient cells. This could provide a new therapeutic option to treat cancer cells with mutations in NER genes. -- Highlights: ► Thousand-fold higher Ascaridol activity in NER-deficient versus proficient cells. ► Impaired repair of Ascaridol-induced oxidative DNA damage in NER-deficient cells. ► Selective activity of Ascaridol opens new therapy

  12. The endoperoxide ascaridol shows strong differential cytotoxicity in nucleotide excision repair-deficient cells

    International Nuclear Information System (INIS)

    Abbasi, Rashda; Efferth, Thomas; Kuhmann, Christine; Opatz, Till; Hao, Xiaojiang; Popanda, Odilia; Schmezer, Peter

    2012-01-01

    Targeting synthetic lethality in DNA repair pathways has become a promising anti-cancer strategy. However little is known about such interactions with regard to the nucleotide excision repair (NER) pathway. Therefore, cell lines with a defect in the NER genes ERCC6 or XPC and their normal counterparts were screened with 53 chemically defined phytochemicals isolated from plants used in traditional Chinese medicine for differential cytotoxic effects. The screening revealed 12 drugs that killed NER-deficient cells more efficiently than proficient cells. Five drugs were further analyzed for IC 50 values, effects on cell cycle distribution, and induction of DNA damage. Ascaridol was the most effective compound with a difference of > 1000-fold in resistance between normal and NER-deficient cells (IC 50 values for cells with deficiency in ERCC6: 0.15 μM, XPC: 0.18 μM, and normal cells: > 180 μM). NER-deficiency combined with ascaridol treatment led to G2/M-phase arrest, an increased percentage of subG1 cells, and a substantially higher DNA damage induction. These results were confirmed in a second set of NER-deficient and -proficient cell lines with isogenic background. Finally, ascaridol was characterized for its ability to generate oxidative DNA damage. The drug led to a dose-dependent increase in intracellular levels of reactive oxygen species at cytotoxic concentrations, but only NER-deficient cells showed a strongly induced amount of 8-oxodG sites. In summary, ascaridol is a cytotoxic and DNA-damaging compound which generates intracellular reactive oxidative intermediates and which selectively affects NER-deficient cells. This could provide a new therapeutic option to treat cancer cells with mutations in NER genes. -- Highlights: ► Thousand-fold higher Ascaridol activity in NER-deficient versus proficient cells. ► Impaired repair of Ascaridol-induced oxidative DNA damage in NER-deficient cells. ► Selective activity of Ascaridol opens new therapy options in

  13. Cytotoxic CD4 T Cells: Differentiation, Function, and Application to Dengue Virus Infection.

    Science.gov (United States)

    Tian, Yuan; Sette, Alessandro; Weiskopf, Daniela

    2016-01-01

    Dengue virus (DENV) has spread through most tropical and subtropical areas of the world and represents a serious public health problem. The control of DENV infection has not yet been fully successful due to lack of effective therapeutics or vaccines. Nevertheless, a better understanding of the immune responses against DENV infection may reveal new strategies for eliciting and improving antiviral immunity. T cells provide protective immunity against various viral infections by generating effector cells that cooperate to eliminate antigens and memory cells that can survive for long periods with enhanced abilities to control recurring pathogens. Following activation, CD8 T cells can migrate to sites of infection and kill infected cells, whereas CD4 T cells contribute to the elimination of pathogens by trafficking to infected tissues and providing help to innate immune responses, B cells, as well as CD8 T cells. However, it is now evident that CD4 T cells can also perform cytotoxic functions and induce the apoptosis of target cells. Importantly, accumulating studies demonstrate that cytotoxic CD4 T cells develop following DENV infections and may play a crucial role in protecting the host from severe dengue disease. We review our current understanding of the differentiation and function of cytotoxic CD4 T cells, with a focus on DENV infection, and discuss the potential of harnessing these cells for the prevention and treatment of DENV infection and disease.

  14. Phosphate-enhanced cytotoxicity of zinc oxide nanoparticles and agglomerates.

    Science.gov (United States)

    Everett, W Neil; Chern, Christina; Sun, Dazhi; McMahon, Rebecca E; Zhang, Xi; Chen, Wei-Jung A; Hahn, Mariah S; Sue, H-J

    2014-02-10

    Zinc oxide (ZnO) nanoparticles (NPs) have been found to readily react with phosphate ions to form zinc phosphate (Zn3(PO4)2) crystallites. Because phosphates are ubiquitous in physiological fluids as well as waste water streams, it is important to examine the potential effects that the formation of Zn3(PO4)2 crystallites may have on cell viability. Thus, the cytotoxic response of NIH/3T3 fibroblast cells was assessed following 24h of exposure to ZnO NPs suspended in media with and without the standard phosphate salt supplement. Both particle dosage and size have been shown to impact the cytotoxic effects of ZnO NPs, so doses ranging from 5 to 50 μg/mL were examined and agglomerate size effects were investigated by using the bioinert amphiphilic polymer polyvinylpyrrolidone (PVP) to generate water-soluble ZnO ranging from individually dispersed 4 nm NPs up to micron-sized agglomerates. Cell metabolic activity measures indicated that the presence of phosphate in the suspension media can led to significantly reduced cell viability at all agglomerate sizes and at lower ZnO dosages. In addition, a reduction in cell viability was observed when agglomerate size was decreased, but only in the phosphate-containing media. These metabolic activity results were reflected in separate measures of cell death via the lactate dehydrogenase assay. Our results suggest that, while higher doses of water-soluble ZnO NPs are cytotoxic, the presence of phosphates in the surrounding fluid can lead to significantly elevated levels of cell death at lower ZnO NP doses. Moreover, the extent of this death can potentially be modulated or offset by tuning the agglomerate size. These findings underscore the importance of understanding how nanoscale materials can interact with the components of surrounding fluids so that potential adverse effects of such interactions can be controlled. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Studies on constituents with cytotoxic and cytostatic activity of two Turkish medicinal plants Phlomis armeniaca and Scutellaria salviifolia.

    Science.gov (United States)

    Saracoglu, I; Inoue, M; Calis, I; Ogihara, Y

    1995-10-01

    Ten known glycosidic compounds, betulalbuside A (1), 8-hydroxylinaloyl,3-O-beta-D-glucopyranoside (2) (monoterpen glycosides), ipolamide (3) (iridoid glycoside), acteoside (verbascoside) (4), leucosceptoside A (5), martynoside (6), forsythoside B (7), phlinoside B (8), phlinoside C (9), and teuerioside (10) (phenylpropanoid glycosides) were isolated from methanolic extracts of Phlomis armeniaca and Scutellaria salviifolia (Labiatae). Structure elucidations were carried out using 1H-, 13C-NMR and FAB-MS spectra, as well as chemical evidence. The cytotoxic and cytostatic activities of isolated compounds were investigated by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) method. Among the glycosides obtained here, caffeic acid-containing phenylpropanoid (or phenethyl alcohol, or phenylethanoid) glycosides were found to show activity against several kinds of cancer cells. However, they didn't affect the growth and viability of primary-cultured rat hepatocytes. Study of the structure-activity relationship indicated that ortho-dihydroxy aromatic systems of phenylpropanoid glycosides are necessary for their cytotoxic and cytostatic activities.

  16. Permeation of cytotoxic formulations through swatches from selected medical gloves.

    Science.gov (United States)

    Klein, Michael; Lambov, Nikolai; Samev, Nikola; Carstens, Gerhard

    2003-05-15

    The permeability of selected medical glove materials to various cytotoxic agents is described. Fifteen cytotoxic agents were prepared at the highest concentrations normally encountered by hospital personnel. Four single-layer and two double-layer glove systems made of two materials--latex and neoprene--were exposed to the drugs for 30, 60, 90, 120, 150, and 180 minutes. Circular sections of the glove material were cut from the cuff and evaluated without any pretreatment. Permeability tests were conducted in an apparatus consisting of a donor chamber containing the cytotoxic solution and a collection chamber filled with water (the acceptor medium). The two sections were separated by the glove material. Permeating portions, collected in water as the acceptor medium, were analyzed by either ultraviolet-visible light spectrophotometry or high-performance liquid chromatography (HPLC). Permeation rates were calculated on the basis of the concentration of the cytotoxic agent in the acceptor medium. Spectrophotometric measurements were taken every 30 minutes, and HPLC analysis was performed at the end of the three-hour period. Average permeation rates for 14 drugs were low (materials. All glove materials tested were impermeable to most of the cytotoxic agents over a period of three hours. Carmustine was the only agent that substantially permeated single-layer latex glove materials. Permeation of most tested cytotoxic formulations was low through swatches of material from various medical gloves.

  17. Putrescine-dependent re-localization of TvCP39, a cysteine proteinase involved in Trichomonas vaginalis cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Bertha Isabel Carvajal-Gamez

    Full Text Available Polyamines are involved in the regulation of some Trichomonas vaginalis virulence factors such as the transcript, proteolytic activity, and cytotoxicity of TvCP65, a cysteine proteinase (CP involved in the trichomonal cytotoxicity. In this work, we reported the putrescine effect on TvCP39, other CP that also participate in the trichomonal cytotoxicity. Parasites treated with 1,4-diamino-2-butanone (DAB (an inhibitor of putrescine biosynthesis, diminished the amount and proteolytic activity of TvCP39 as compared with untreated parasites. Inhibition of putrescine biosynthesis also reduced ∼ 80% the tvcp39 mRNA levels according to RT-PCR and qRT-PCR assays. Additionally, actinomycin D-treatment showed that the tvcp39 mRNA half-life decreased in the absence of putrescine. However, this reduction was restored by exogenous putrescine addition, suggesting that putrescine is necessary for tvcp39 mRNA stability. TvCP39 was localized in the cytoplasm but, in DAB treated parasites transferred into exogenous putrescine culture media, TvCP39 was re-localized to the nucleus and nuclear periphery of trichomonads. Interestingly, the amount and proteolytic activity of TvCP39 was recovered as well as the tvcp39 mRNA levels were restored when putrescine exogenous was added to the DAB-treated parasites. In conclusion, our data show that putrescine regulate the TvCP39 expression, protein amount, proteolytic activity, and cellular localization.

  18. A comparison of cytotoxicity and oxidative stress from welding fumes generated with a new nickel-, copper-based consumable versus mild and stainless steel-based welding in RAW 264.7 mouse macrophages.

    Science.gov (United States)

    Badding, Melissa A; Fix, Natalie R; Antonini, James M; Leonard, Stephen S

    2014-01-01

    Welding processes that generate fumes containing toxic metals, such as hexavalent chromium (Cr(VI)), manganese (Mn), and nickel (Ni), have been implicated in lung injury, inflammation, and lung tumor promotion in animal models. While federal regulations have reduced permissible worker exposure limits to Cr(VI), this is not always practical considering that welders may work in confined spaces and exhaust ventilation may be ineffective. Thus, there has been a recent initiative to minimize the potentially hazardous components in welding materials by developing new consumables containing much less Cr(VI) and Mn. A new nickel (Ni) and copper (Cu)-based material (Ni-Cu WF) is being suggested as a safer alternative to stainless steel consumables; however, its adverse cellular effects have not been studied. This study compared the cytotoxic effects of the newly developed Ni-Cu WF with two well-characterized welding fumes, collected from gas metal arc welding using mild steel (GMA-MS) or stainless steel (GMA-SS) electrodes. RAW 264.7 mouse macrophages were exposed to the three welding fumes at two doses (50 µg/ml and 250 µg/ml) for up to 24 hours. Cell viability, reactive oxygen species (ROS) production, phagocytic function, and cytokine production were examined. The GMA-MS and GMA-SS samples were found to be more reactive in terms of ROS production compared to the Ni-Cu WF. However, the fumes from this new material were more cytotoxic, inducing cell death and mitochondrial dysfunction at a lower dose. Additionally, pre-treatment with Ni-Cu WF particles impaired the ability of cells to phagocytize E. coli, suggesting macrophage dysfunction. Thus, the toxic cellular responses to welding fumes are largely due to the metal composition. The results also suggest that reducing Cr(VI) and Mn in the generated fume by increasing the concentration of other metals (e.g., Ni, Cu) may not necessarily improve welder safety.

  19. Cytotoxic and pathogenic properties of Klebsiella oxytoca isolated from laboratory animals.

    Directory of Open Access Journals (Sweden)

    Alison Darby

    Full Text Available Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline

  20. Cytotoxic activity of some medicinal plants from hamedan district of iran.

    Science.gov (United States)

    Behzad, Sahar; Pirani, Atefeh; Mosaddegh, Mahmoud

    2014-01-01

    Medicinal plants have been investigated for possible anti-cancer effects. The aim of the present study was to examine the cytotoxic activity of several medicinal plants on different tumor cell lines. 11 selected plant species which have been used in folkloric prescriptions were collected from different sites of Hamedan district of Iran. The methanolic extracts of the plants were prepared and their cytotoxic effects on four human cancer cell lines (A549, human lung adenocarcinoma; MCF7, human breast adenocarcinoma; HepG2, hepatocellular carcinoma and HT-29, human colon carcinoma) and one normal cell line (MDBK, bovine kidney) were examined using the MTT assay. Three of these were exhibited antiproliferative activity against one or more of the cell lines. The extract from Primula auriculata demonstrated the highest cytotoxicity with IC50 of 25.79, 35.79 and 43.34 μg.mL-1 against MCF7, HepG2 and HT- 29 cells, respectively. For some of the plants, their traditional use was correlated with the cytotoxic results, whereas for others the results may support the non-cytotoxicity of species used traditionally as natural remedies. The cytotoxic species could be considered as potential of anticancer compounds.