WorldWideScience

Sample records for ctla-4 gene promoter

  1. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  2. Soluble CTLA-4 receptor an immunological marker of Graves' disease and severity of ophthalmopathy is associated with CTLA-4 Jo31 and CT60 gene polymorphisms.

    Science.gov (United States)

    Daroszewski, Jacek; Pawlak, Edyta; Karabon, Lidia; Frydecka, Irena; Jonkisz, Anna; Slowik, Miroslaw; Bolanowski, Marek

    2009-11-01

    Graves' disease (GD) is an autoimmune disorder with genetic and environmental background. CTLA-4 is a candidate gene for thyroid autoimmunity. Increased serum levels of soluble CTLA-4 (sCTLA-4) were found in some autoimmune diseases. The aim of the study was to evaluate the relation between sCTLA-4 level and clinical manifestation of Graves' ophthalmopathy (GO), thyroid status, and CTLA-4 gene polymorphisms. Serum sCTLA-4 concentrations were determined in 93 GO patients and 93 healthy controls. In the GO group, CTLA-4 gene was genotyped in five polymorphic sites: g.319C>T, c.49A>G, CT60 by means of PRC-RFLP, Jo31, and g.*642AT(8_33) by means of minisequencing assay. Serum sCTLA-4 level was significantly higher in the GO group than in controls (median: 7.94 vs 0.00 ng/ml, P=0.000001). This level was higher in severe than in nonsevere GO (median: 10.3 vs 5.6 ng/ml, P=0.01). sCTLA-4 concentration was related neither to the activity of GO nor to thyroid function. Elevated sCTLA-4 levels were observed in carriers Jo31[G] allele (genotype GG+GT) as compared with subjects with an absence of the [G] allele (TT genotype; median: 9.18 vs 4.0 ng/ml, P=0.02). Also patients possessing CT60[G] allele (genotype GG+GA) had higher serum sCTLA-4 levels than subjects who lack the [G] allele (AA genotype; median: 8.73 vs 2.28 ng/ml, P=0.03). It was shown for the first time that increased serum concentration of sCTLA-4 correlate with the severity of GO. Genetic variation in the CTLA-4 gene region in GD patients at least partially determines the level of sCTLA-4.

  3. Study of the CTLA-4 gene polymorphisms in systemic lupus erythematosus (SLE) samples from Malaysia.

    Science.gov (United States)

    Chua, Kek-Heng; Puah, Suat-Moi; Chew, Ching-Hoong; Tan, Si-Yen; Lian, Lay-Hoong

    2010-04-01

    In this study, we investigated the polymorphisms of the exon 1 (+49A/G), promoter sites (-1722T/C, -1661A/G, -318C/T), and 3'-untranslated region (3'-UTR) (+6230 A/G) of the CTLA-4 gene in systemic lupus erythematosus (SLE) affected patients. Polymerase chain reaction-restriction fragment length polymorphism was used to determine genotypes of these five markers in 130 SLE patients and 130 healthy controls. Of the five tested polymorphisms, there was no statistical significant difference between the genotypic and allelic frequencies of patients with SLE and controls. Hence, we propose that the CTLA-4 gene does not play a major role in the genetic susceptibility to the development of SLE in the Malaysian population.

  4. Cytotoxic T lymphocyte associated molecule -4 (CTLA-4 gene polymorphisms in ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Sirous Naeimi

    2010-09-01

    Full Text Available Background: Ovarian cancer is a relatively common cancer among postmenopausal women. Nowadays, there is controversy about immunotherapy of ovarian cancer patients with interleukins such as interferon to reach better out come in prognosis of patients under chemotherapy. CTLA-4 is a gene, which has an important role in homeostasis and regulation of immune response. Inhibitory nature of CTLA-4 is proved to be of significance in autoimmune diseases as well as in cancer. In this study we intend to find out the relationship between polymorphisms of this gene at the sites of +49 A/G and -318 C/T and ovarian cancer.Methods: The polymorphisms of the CTLA-4 gene at the sites of +49 A/G exon and -318 C/T promoter were investigated. Blood samples of 73 patients with ovarian cancer and 115 healthy subjects used for DNA extraction. Two groups genotypes and alleles were determined using PCR method and compared by statistical t-student test.Results: There was no statistically significant difference in genotypes and alleles prevalence of +49 A/G and -317 C/T between two groups (p>0.05.Conclusion: Further researches with larger sample size while paying attention to the relation between the gene polymorphism and stage and type of tumor is recommended.

  5. Supplementary data: Association of CTLA4, CD28 and ICOS gene ...

    Indian Academy of Sciences (India)

    rs3181097. Promoter. Reverse: AAGCCTCCTCCAACTCACTTCTA rs2140148 ... Reverse: GAAGGAAGGAAAAAGAAAATGGA. CTLA4 (2q33) rs231777. Intron 1 ... Logistic regression analysis of CD28, CTLA4 and ICOS polymorphisms in IgAN patients subgrouped according to the presence of nephrotic range proteinuria ...

  6. CTLA4 gene polymorphism in Italian patients with colorectal adenoma and cancer.

    Science.gov (United States)

    Solerio, E; Tappero, G; Iannace, L; Matullo, G; Ayoubi, M; Parziale, A; Cicilano, M; Sansoè, G; Framarin, L; Vineis, P; Rosina, F

    2005-03-01

    Colorectal cancer is a major health problem. Colonoscopic colorectal cancer screening is cumbersome and expensive. Identification of genetic risk of colorectal cancer may help to select the subjects who could benefit from colonoscopy. The immune system plays a fundamental role in the human-environment interaction, and the carcinogenic effects of many environmental factors are mediated by the chronic activation of the immune system in a genetic-controlled fashion. Cytotoxic T lymphocyte associated antigen 4 (CTLA4) plays an inhibitory role in regulating lymphocyte functions. The loss of CTLA4 function is responsible for loss of mucosal lymphocyte tolerance. The G allele at position +49 of exon 1 of the CTLA4 gene affects the CTLA4 function. We evaluated in an association study the role of CTLA4 A+49G polymorphism as a risk factor for colorectal neoplasm. Five hundred and fifty-six patients (male 295; female 261) who underwent colonoscopy at our Centre were enrolled in the study and divided into three groups: Colorectal cancer (132 patients, M/F 68/64, mean age 66+/-11 years); Colorectal adenoma (186 patients, M/F 110/76, mean age 65+/-11 years); Healthy controls (238 patients, M/F 117/121, mean age 63+/-10 years). DNA was extracted from peripheral blood, CTLA4 gene was amplified by using specific primers, and A+49G polymorphism was analysed by restriction enzyme digestion. No statistically significant differences in the genotype distribution among Control and Adenoma groups (p=0.93), Control and Carcinoma groups (p=0.52), and Adenoma and Carcinoma groups (p=0.53) were observed. There is no significant correlation between CTLA4 A+49G polymorphism and the risk of colorectal neoplasm among Italian Caucasians.

  7. Association between PTPN22/CTLA-4 Gene Polymorphism and Allergic Rhinitis with Asthma in Children.

    Science.gov (United States)

    Song, Shang Hua; Wang, Xiao Qiang; Shen, Yang; Hong, Su Ling; Ke, Xia

    2016-10-01

    Allergic rhinitis (AR) is an IgE-mediated upper airway disease, and its impact on asthma has been widely recognized. Protein tyrosine phosphatase non-receptor 22 (PTPN22) gene and the cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) gene polymorphisms have been reported to be associated with several immune-related diseases. Here we investigated the reffect of these two genes' polymorphisms on the risk of AR and asthma in Chinese Han children. A total of 106 AR patients, 112 AR with asthma patients, and 109 healthy children were enrolled in the study. The SNPs of PTPN22 (rs2488457, rs1310182, rs3789604) and CTLA-4 (rs3087243, rs11571302, rs11571315, rs231725, rs335219727, and rs4553808) were genotyped using a PCR-restriction fragment length polymorphism assay. For PTPN22, an increased prevalence of the CC genotype and C allele in rs1310182 were identified in AR group. For CTLA-4, AA genotype and A allele in rs3087243 and rs231725 were increased in AR with asthma group while in AR group, AA genotype and A allele in rs231725 were obviously decreased. This study reveals a significant association between SNPs in PTPN22, CTLA-4 gene and AR with asthma in Chinese Han children, which might be susceptibility factors for AR and asthma.

  8. Association of CD28 and CTLA-4 gene polymorphisms with aggressive periodontitis in Brazilians.

    Science.gov (United States)

    e Silva, M R M A; Moreira, P R; da Costa, G C; Saraiva, A M; de Souza, P E A; Amormino, S A F; da Costa, J E; Gollob, K J; Dutra, W O

    2013-09-01

    Susceptibility to and severity of periodontal disease is influenced by gene polymorphisms related to the immune response. Co-stimulatory molecules, such as CD28 and CTLA-4, are critical in the development of such responses. Our hypothesis is that polymorphisms in genes that code for these molecules may be associated with periodontitis. The aim of the study was to investigate the association between +17 (T/C) CD28 and +49 (A/G) CTLA-4 gene polymorphisms and periodontitis in Brazilians. Genomic DNA was obtained from oral swabs of 424 individuals categorized into three groups (control group, aggressive, and chronic periodontitis) considering clinical parameters such as probing depth and clinical attachment loss. The genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism. There was an association between the T(-) genotype of the CD28 polymorphism and aggressive periodontitis (P = 0.04). Moreover, the A(+) genotype for CTLA-4 was associated with greater clinical attachment loss in non-smokers with aggressive periodontitis (P = 0.006, OR = 16.25, CI = 2.25-117.11). These findings show that T(-) in CD28 + 17 (T/C) and the A(+) in CTLA-4 +49 (A/G) genotypes are associated with susceptibility to aggressive periodontal disease. Thus, our study highlights these polymorphisms as potential genetic susceptibility markers of periodontitis in Brazilians. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Associations of CTLA4 Gene Polymorphisms with Graves’ Ophthalmopathy: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Pengfei Du

    2014-01-01

    Full Text Available Many studies have established that T-lymphocyte antigen-4 (CTLA4 is a susceptible gene for Graves’ disease (GD. Also many studies showed the association between the CTLA4 exon-1 49A/G polymorphism and the risk of developing Graves’ ophthalmopathy (GO in GD patients. But those results were inconsistent. In recent years many new studies were published which helped to shed light on the relationship of CTLA4 SNP49 with GO. So we performed the meta-analysis to explore the association between the SNP49 and GO susceptibility in GD patients. Studies up to February 29, 2012, were searched by using PubMed. The odds ratio was used to evaluate the strength of the association. Altogether 12 case-control studies involving 2,505 participants were included in the meta-analysis. Results showed that the G allele was related to the increased risk of GO compared with the A allele under allelic genetic model (OR = 1.14, 95% CI: 1.14–1.72, P=0.001 in European subgroup. No publication bias was detected. Our results showed that the SNP49 polymorphism of CTLA4 gene was related to increased risk of GO.

  10. Polymorphic sites at the immunoregulatory CTLA-4 gene are associated with chronic chagas disease and its clinical manifestations.

    Directory of Open Access Journals (Sweden)

    Fabrício C Dias

    Full Text Available BACKGROUND: Chagas disease affects approximately 10 million people mainly in Latin America. The immune regulation by the host seems to be an essential factor for disease evolution, and immune system inhibitory molecules such as CTLA-4 and PD-1 favor the maintenance of peripheral tolerance. Considering that polymorphisms at the immunoregulatory CTLA-4 and PDCD1 genes may alter their inhibitory function, we investigated the association of alleles, genotypes and haplotypes of polymorphic sites observed at the CTLA-4 and PDCD1 genes with different clinical manifestations of chronic Chagas disease (indeterminate, cardiac, digestive and mixed. METHODS: The polymorphisms at the CTLA-4 (-1722T/C, -318C/T and +49A/G and PDCD1 (PD-1.3G/A genes were typed using TaqMan methodology in 277 chronic Chagas disease patients classified into four groups, according to clinical characteristics, and 326 non-infected controls. RESULTS: Our results showed that CTLA-4 -1722CC genotype (22%, -1722C allele (27% and CTLA-4 TCG (8.6%, TCA (26% and CCA (15% haplotypes were strongly associated with the indeterminate form, while the CTLA-4-318CT genotype (82% and CTLA-4-318T allele (47% were found mainly in patients with the mixed form of the disease. The CTLA-4 TCG haplotype (10.2% was associated with the digestive form. On the other hand, the PD-1.3G/A polymorphism was not associated with chronic Chagas disease and its clinical manifestations. CONCLUSIONS: Here, we showed that alleles, genotypes and haplotypes reported to increase the expression of the regulatory molecule CTLA-4 were associated with the indeterminate form of the disease. Taken together, our data support the idea that polymorphic sites at immunoregulatory genes may influence the development of Chagas disease variants.

  11. Polymorphisms in the CD28/CTLA4/ICOS genes: Role in malignant melanoma susceptibility and prognosis?

    NARCIS (Netherlands)

    M.G. Bouwhuis (Marna); A. Gast (Andreas); A. Figl (Adina); A.M.M. Eggermont (Alexander); K. Hemminki (Kari); D. Schadendorf (Dirk); R. Kumar (Rajiv)

    2010-01-01

    textabstractThe appearance of vitiligo and spontaneous regression of the primary lesion in melanoma patients illustrate a relationship between tumor immunity and autoimmunity. T lymphocytes play a major role both in tumor immunity and autoimmunity. CD28, Cytotoxic T lymphocyte antigen 4 (CTLA4) and

  12. ASSOCIATION OF CTLA-4 AND PTPN-22 GENES POLYMORPHISMS WITH INCREASED RISK OF AUTOIMMUNE THYROIDITIS IN TATAR POPULATION

    Directory of Open Access Journals (Sweden)

    E. M. Biktagirova

    2010-01-01

    Full Text Available The aspects of autoimmune thyroiditis (AIT remain quite actual, since many issues of etiology, pathogenesis, morphology, classification, diagnostics, therapy and prediction of this disorder are far from final solution. Since disturbances of fine molecular immune mechanisms underlie pathogenesis of either immune disorder, the genes coding its main components, are regarded as potential candidate genes predisposing for AIT, e.g., genes of surface antigen (CTLA-4 and protein tyrosine phosphatase non-receptor 22 (PTPN-22. We have performed genotyping of 298 Tatar women in Tatar Republic (Russia with respect to age and biochemical parameters (control group, 137 persons; AIT group, 161 patients. The following gene polymorphisms were tested: +49 А/G, -318 С/Т, -1661 А/G of СТLA-4 gene, and 1858 С/Т polymorphism of PTPN-22 gene. Genotyрing was performed by PCR-RFLP method as described earlier. The data were analyzed using Chi-square test and 95% confidential interval (CI. The frequencies of CTLA-4 -1661 G allele and genotype A/G and +49 G/A G allele and genotype GG carriers were significantly higher in AIT patients than in controls (P = 0.04, OR 1.84, 95% CI 2.31-1.4; P = 0.001, OR 2,0 95% CI 1.62-2.31 respectively, with increased contents of serum antibodies to thyroglobulin (OR, 1.56, 95% CI 2.25-3.6; OR 1.12, 95% CI 1.9-2.75, respectively and to thyroperoxidase (OR 1.3, 95% CI 1.5-4.1 for G/G genotype of +49 A/G polymorphism, independently of age (р < 0,05. We showed that the combinations of A/G, T/C and G/G genotypes of -1661 A/G, -318 T/C and +49 G/A polymorphisms is associated with increased risk of genetic predisposition to ITD in Tatar women (OR 7.87, 95% CI 2.03-3.25. A strong association was also observed between the increased level of antibodies to TPO (> 1000 ME/l and GG genotype of +49 G/A polymorphism (OR 1.3, 95% CI 1.5-4.1 and antibodies to TG (> 100 ME/l and genotypes A/G and G/G of CTLA-4 -1661 A/G and +49 G/A polymorphisms

  13. Associations of single nucleotide polymorphisms of PTPN22 and Ctla4 genes with the risk of allergic rhinitis in a Chinese Han population.

    Science.gov (United States)

    Ke, Xia; Song, Shanghua; Wang, Xiaoqiang; Shen, Yang; Kang, Houyong; Hong, Suling

    2017-02-01

    Allergic rhinitis (AR) is an inflammatory disorder of the upper airway. Protein tyrosine phosphatase non-receptor 22 encoded by PTPN22 gene and cytotoxic T-lymphocyte associated 4 encoded by Ctla4 gene are associated with autoimmune diseases. This study was performed to evaluate the potential association of PTPN22 and Ctla4 single nucleotide polymorphisms (SNPs) with AR in a Chinese Han population. A case-control study was performed in 783 Chinese AR patients and 811 healthy controls. Three SNPs in PTPN22 gene (rs2488457, rs1310182, and rs3789604) and 6 SNPs in Ctla4 gene (rs3087243, rs231779, rs11571302, rs11571315, rs231725, and rs35219727) were detected using a polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP). For PTPN22 gene, a significantly decreased prevalence of the rs2488457 CC genotype and C allele was found in AR patients. The frequencies of the rs1310182 CC genotype, CT genotype, and C allele were significantly associated with the risk of AR. For Ctla4 gene, a significantly increased prevalence of the rs11571302 AA genotype, CA genotype and A allele was noted in AR patients. SNPs of PTPN22 and Ctla4 genes are significantly associated with the risk of AR in the Chinese Han population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  14. Association of CTLA-4 gene A/G polymorphism in Japanese type 1 diabetic patients with younger age of onset and autoimmune thyroid disease.

    Science.gov (United States)

    Takara, M; Komiya, I; Kinjo, Y; Tomoyose, T; Yamashiro, S; Akamine, H; Masuda, M; Takasu, N

    2000-07-01

    We studied the association between type 1 diabetes with autoimmune thyroid disease (AITD) and A/G allele polymorphism in exon 1 of the CTLA-4 gene in a Japanese population. We studied 74 Japanese type 1 diabetic patients with or without AITD and 107 normal subjects to identify the association between CTLA-4 polymorphism and type 1 diabetes using polymerase chain reaction-restriction fragment length polymorphism analysis. The frequency of the CTLA-4 G allele differed significantly between the type 1 diabetic patients (61%) and the normal control subjects (48%) (P = 0.016). The difference in the CTLA-4 G allele became greater between patients with a younger age of onset of type 1 diabetes (age at onset frequency of the CTLA-4 G allele did not differ between type 1 diabetic patients with younger and older age of onset (64% vs. 57%). The G allele frequencies in the patients with younger-onset type 1 diabetes and AITD increased more than in the control patients (P = 0.025). These differences reflected a significant increase in the frequency of G/G genotype--that is, 54% in those with younger-onset type 1 diabetes and AITD, 39% in those without AITD, and 28% in control subjects. An association was detected between the CTLA-4 gene polymorphism and younger-onset type 1 diabetes with AITD. The G variant was suggested to be genetically linked to AITD-associated type 1 diabetes of younger onset in this apanese population. The defect in these patients presumably lies in a T-cell-mediated autoimmune mechanism.

  15. Interaction of HLA-DRB1* alleles and CTLA4 (+49 AG) gene polymorphism in Autoimmune Thyroid Disease.

    Science.gov (United States)

    Ramgopal, Sivanadham; Rathika, Chinniah; Padma, Malini Ravi; Murali, Vijayan; Arun, Kannan; Kamaludeen, Mohamed Nainar; Balakrishnan, Karuppiah

    2018-02-05

    Autoimmune Thyroid Diseases (AITDs), including Hashimoto's thyroiditis (HT) and Graves' disease (GD), arise by the complex interaction of genes and environmental factors. The aim of present study was to study the susceptible associations of HLA-DRB1* alleles and CTLA4 +49 AG polymorphism in AITD in south India. AITD patients (n=235; HT=180; GD=55) and age/sex matched healthy controls (n, 235) were enrolled to type HLA-DRB1* alleles and 'CTLA4 +49 AG' by PCR-SSP and PCR-RFLP methods respectively. Analysis revealed CTLA4 +49 'GG' genotype was increased significantly in patients (PL: p=8.7×10-8; HT: p=9.3×10-6; GD: p=0.006). Decreased frequencies of 'AA' genotype was observed in patients (PL: p=9.4×10-6; HT: p=0.008; GD: p=9.0×10-6). Increased frequencies were observed for HLA alleles DRB1*12 (PL: p=1.42×10-10; HT: p=5.75×10-8; GD: p=0.002) and DRB1*11 (PL: p=0.0025; HT: p=0.013) in patients. Decreased frequencies for alleles DRB1*10 (PL: p=0.00002; HT: p=0.018; GD: p=1.63×10-5) and DRB1*03 (PL: p=0.003; HT: p=0.003) were observed, suggesting a protective association. Combinatorial/Synergistic analysis have revealed an increased frequencies for 'DRB1*11+AG' (PL: p=0.022), 'DRB1*12+AG' (PL: p=6.1×10-5; HT: p=0.0001), 'DRB1*04+GG' (PL: p=0.003; HT: p=0.008), 'DRB1*07+GG' (PL: p=0.009; HT: p=0.014) and 'DRB1*12+GG' (PL: p=0.005; HT: p=0.005) in patients. However, the combinations such as 'DRB1*10+AA' (PL: p=1.8×10-6; HT: p=0.003) and 'DRB1*15+AA' (PL: p=0.006; GD: p=0.011) were decreased in patients showing a protective association. The 'GG/G' of CTLA4 +49AG SNP, HLA-DRB1*11/-DRB1*12 (DR5) alleles and the combinations of DRB1*11/DRB1*12 alleles with AG/GG genotype and DRB1*04/07/12 alleles with GG genotype may act as synergistic manner to confer the strong susceptibility to AITD in south India. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Gene expression profiling of anti-CTLA4-treated metastatic melanoma in patients with treatment-induced autoimmunity.

    Science.gov (United States)

    Bresler, Scott C; Min, Le; Rodig, Scott J; Walls, Andrew C; Xu, Shuyun; Geng, Songmei; Hodi, F Stephen; Murphy, George F; Lian, Christine G

    2017-02-01

    Ipilimumab (IPI) is a monoclonal antibody that targets the inhibitory CTLA4 receptor of T cells, enhancing T-cell-driven antitumor responses. IPI therapy in metastatic melanoma results in significant improvement in disease-free and overall survival, although after initial responses disease progression generally ensues. Identification of specific responses in tissue where melanoma tumor cells are subjected to IPI-driven immune attack may reveal mechanisms of treatment efficacy or resistance, permitting refinement of targeted therapeutic approaches. We used NanoString digital barcoding chemistry to identify changes in the transcriptome of metastatic melanoma cells before and after IPI treatment using two comprehensive panels containing a total of 1330 unique genes. Only patients who developed autoimmune disorders following treatment, signifying a robust immune response, were included. Despite evidence of an enhanced immune response, most patients eventually exhibited disease progression. Overall, data from five pre-IPI tumors and four post-IPI tumor samples (from three patients) permitted identification of several candidate genes that showed increased expression based on normalized counts after therapy. These included TTK (~3.1-fold, P=1.18e-4), which encodes a dual-specificity protein tyrosine kinase, a known cell cycle regulator, and BIRC5 (~3.0-fold, P=9.36e-4), which encodes the antiapoptotic protein survivin. Both TTK (MPS1) and survivin are targetable proteins against which a number of pharmacologic agents have been developed. CDK1, which encodes a protein tyrosine kinase known to phosphorylate survivin, was also upregulated (~3.2-fold, P=2.80-3). Tumor cell expression of TTK and survivin proteins was confirmed using immunohistochemistry in an expanded patient cohort. Differences in gene expression for several commonly encountered immune antigens, such as CD3, CD4, CD8, and CTLA4, were not statistically significant, likely reflecting the long length of time

  17. CTLA-4 Exon One +49A/G Gene Variants in Patients with Superficial and Invasive Bladder Cancer: A Study in Southern Iran

    Directory of Open Access Journals (Sweden)

    Nima Zamiri

    2010-01-01

    Full Text Available Introduction: Cytotoxic T-cell lymphocyte antigen 4 (CTLA-4 is a member of the super family of immunoglobulins that are mainly expressed by activated Tcells. It is established that blockade of CTLA-4 receptors leads to the enhancement of an immune response. Different polymorphisms of the CTLA-4 gene have been described which cause increased susceptibility to various malignancies such as lymphoma or multiple myeloma. Considering that bladder cancer is one of the most prevalent cancers worldwide, we have evaluated the role of CTLA-4 gene polymorphism at position +49 A/G in the formation or progression of bladder cancer in southern Iran.Materials and Methods: A total of 226 individuals between February 2005 and June 2006 were included and placed into two subgroups: patients diagnosed with bladder cancer and a control group. Demographic data and risk factors were collected from both groups. The DNA of all subjects was extracted from their blood samples. Different genotypes of the CTLA-4 gene were determined using the restriction fragment length polymorphism (RFLP technique and data were compared in both groups by using Pearson's chi-square test.Results: The prevalence of AA, AG and GG genotypes at position 49, according to the PCR-RFLP method, were 57.5%, 37.2% and 5.3% in the control group, respectively. In the patient group, the prevalence of these genotypes was: AA in 57.5%, AG in 32.7% and GG in 9.8%. Statistical analysis of data showed no significant difference in both groups (P value=0.40. Also there was no correlation between different genotypes of the CTLA-4 gene and invasiveness of the disease in our cases.Conclusion: Although polymorphism of the CTLA-4 gene at position 49 of exon-1 increases susceptibility to several malignancies, our study showed no relationship between polymorphism at this position and genetic susceptibility to the development of bladder cancer, nor was there any association with disease progression.

  18. Blockade of CTLA-4 promotes the development of effector CD8+ T lymphocytes and the therapeutic effect of vaccination with an attenuated protozoan expressing NY-ESO-1.

    Science.gov (United States)

    Dos Santos, Luara Isabela; Galvão-Filho, Bruno; de Faria, Paula Cristina; Junqueira, Caroline; Dutra, Miriam Santos; Teixeira, Santuza Maria Ribeiro; Rodrigues, Maurício Martins; Ritter, Gerd; Bannard, Oliver; Fearon, Douglas Thomas; Antonelli, Lis Ribeiro; Gazzinelli, Ricardo Tostes

    2015-03-01

    The development of cancer immunotherapy has long been a challenge. Here, we report that prophylactic vaccination with a highly attenuated Trypanosoma cruzi strain expressing NY-ESO-1 (CL-14-NY-ESO-1) induces both effector memory and effector CD8(+) T lymphocytes that efficiently prevent tumor development. However, the therapeutic effect of such a vaccine is limited. We also demonstrate that blockade of Cytotoxic T Lymphocyte Antigen 4 (CTLA-4) during vaccination enhances the frequency of NY-ESO-1-specific effector CD8(+) T cells producing IFN-γ and promotes lymphocyte migration to the tumor infiltrate. As a result, therapy with CL-14-NY-ESO-1 together with anti-CTLA-4 is highly effective in controlling the development of an established melanoma.

  19. CTLA-4 (CD152) enhances the Tc17 differentiation program.

    Science.gov (United States)

    Pick, Jonas; Arra, Aditya; Lingel, Holger; Hegel, J Kolja; Huber, Magdalena; Nishanth, Gopala; Jorch, Gerhard; Fischer, Klaus-Dieter; Schlüter, Dirk; Tedford, Kerry; Brunner-Weinzierl, Monika C

    2014-07-01

    Although CD8(+) T cells that produce IL-17 (Tc17 cells) have been linked to host defense, Tc17 cells show reduced cytotoxic activity, which is the characteristic function of CD8(+) T cells. Here, we show that CTLA-4 enhances the frequency of IL-17 in CD8(+) T cells, indicating that CTLA-4 (CD152) specifically promotes Tc17 differentiation. Simultaneous stimulation of CTLA-4(+/+) and CTLA-4(-/-) T cells in cocultures and agonistic CTLA-4 stimulation unambiguously revealed a cell-intrinsic mechanism for IL-17 control by CTLA-4. The quality of CTLA-4-induced Tc17 cells was tested in vivo, utilizing infection with the facultative intracellular bacterium Listeria monocytogenes (LM). Unlike CTLA-4(+/+) Tc17 cells, CTLA-4(-/-) were nearly as efficient as Tc1 CTLA-4(+/+) cells in LM clearance. Additionally, adoptively transferred CTLA-4(-/-) Tc17 cells expressed granzyme B after rechallenge, and produced Tc1 cytokines such as IFN-γ and TNF-α, which strongly correlate with bacterial clearance. CTLA-4(+/+) Tc17 cells demonstrated a high-quality Tc17 differentiation program ex vivo, which was also evident in isolated IL-17-secreting Tc17 cells, with CTLA-4-mediated enhanced upregulation of Tc17-related molecules such as IL-17A, RORγt, and IRF-4. Our results show that CTLA-4 promotes Tc17 differentiation that results in robust Tc17 responses. Its inactivation might therefore represent a central therapeutic target to enhance clearance of infection. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. CTLA-4 (CD152) gene polymorphism at position 49 in exon 1 in Graves' disease in a Polish population of the Lower Silesian region.

    Science.gov (United States)

    Frydecka, Irena; Daroszewski, Jacek; Suwalska, Katarzyna; Zołedziowska, Magdalena; Tutak, Anna; Słowik, Mirosław; Potoczek, Stanisław; Dobosz, Tadeusz

    2004-01-01

    Graves' disease ((GD)is an autoimmune disease believed to be caused by a combination of environmental and genetic factors. The gene encoding cytotoxic T lymphocyte-associated antigen-4 (CTLA-4)is one of the candidate genes for conferring susceptibility to thyroid autoimmunity. he aim of the study was to investigate the association between the exon 1 CTLA-4 gene polymorphism A(49)G and susceptibility to GD and Graves ' ophthalmopathy (GO)as well as its severity in a Polish population of the Lower Silesia region. We analyzed the A(49)G exon 1 CTLA-4 gene polymorphism in 99 unrelated Polish patients with GD, of whom 50 had clinically evident GO (NOSPECS class III and higher), and 154 matched healthy subjects from the Lower Silesia region. Genomic DNA was isolated from whole frozen blood using the NucleoSpin Blood kit. A/G transition was genotyped by polymerase chain reaction followed by labeling with the SnaPshot kit of PE Applied Biosystems and detected using an ABI PRISM 310 capillary genetic analyzer. The distribution of CTLA-4 exon 1 A(49)G enotype, allele, and phenotypic frequencies did not differ between patients with GD and healthy subjects. There was a significantly lower frequency of the AA genotype in the group of patients with clinically evident GO than in patients without severe GO (22% vs. 43%; p=0.02, OR=2.6). Our results showed that the AA genotype in patients with GD is associated with a lower risk of GO severity.

  1. Impact of CTLA4 genotype and other immune response gene polymorphisms on outcomes after single umbilical cord blood transplantation.

    Science.gov (United States)

    Cunha, Renato; Zago, Marco A; Querol, Sergio; Volt, Fernanda; Ruggeri, Annalisa; Sanz, Guillermo; Pouthier, Fabienne; Kogler, Gesine; Vicario, José L; Bergamaschi, Paola; Saccardi, Riccardo; Lamas, Carmen H; Díaz-de-Heredia, Cristina; Michel, Gerard; Bittencourt, Henrique; Tavella, Marli; Panepucci, Rodrigo A; Fernandes, Francisco; Pavan, Julia; Gluckman, Eliane; Rocha, Vanderson

    2017-01-26

    We evaluated the impact of recipient and cord blood unit (CBU) genetic polymorphisms related to immune response on outcomes after unrelated cord blood transplantations (CBTs). Pretransplant DNA samples from 696 CBUs with malignant diseases were genotyped for NLRP1, NLRP2, NLRP3, TIRAP/Mal, IL10, REL, TNFRSF1B, and CTLA4. HLA compatibility was 6 of 6 in 10%, 5 of 6 in 39%, and ≥4 of 6 in 51% of transplants. Myeloablative conditioning was used in 80%, and in vivo T-cell depletion in 81%, of cases. The median number of total nucleated cells infused was 3.4 × 107/kg. In multivariable analysis, patients receiving CBUs with GG-CTLA4 genotype had poorer neutrophil recovery (hazard ratio [HR], 1.33; P = .02), increased nonrelapse mortality (NRM) (HR, 1.50; P < .01), and inferior disease-free survival (HR, 1.41; P = .02). We performed the same analysis in a more homogeneous subset of cohort 1 (cohort 2, n = 305) of patients who received transplants for acute leukemia, all given a myeloablative conditioning regimen, and with available allele HLA typing (HLA-A, -B, -C, and -DRB1). In this more homogeneous but smaller cohort, we were able to demonstrate that GG-CTLA4-CBU was associated with increased NRM (HR, 1.85; P = .01). Use of GG-CTLA4-CBU was associated with higher mortality after CBT, which may be a useful criterion for CBU selection, when multiple CBUs are available. © 2017 by The American Society of Hematology.

  2. Correlations of CTLA-4 Exon-1 49 A/G and Promoter Region 318 C/T Polymorphisms with the Therapeutic Efficacy of 131 I Radionuclide in Graves' Disease in Chinese Han Population.

    Science.gov (United States)

    Han, Xin-Rui; Wen, Xin; Wang, Shan; Fan, Shao-Hua; Zhuang, Juan; Wang, Yong-Jian; Zhang, Zi-Feng; Li, Meng-Qiu; Hu, Bin; Shan, Qun; Sun, Chun-Hui; Bao, Ya-Xing; Luan, Sha; Zhao, Chang-Jiu; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

    2017-08-04

    This study aimed to investigate the correlation of CTLA-4 exon-1 49 A/G and promoter region-318 C/T polymorphisms with the therapeutic efficacy of radionuclide 131 I for Graves' disease in Chinese Han population. The 131 I radionuclide therapy was applied in 261 patients with Graves' disease. The patients were classified into the remission and non-remission groups. PCR-RFLP was implemented to detect CTLA-4 exon-1 49 A/G and promoter region-318 C/T polymorphisms. Haplotypes of CTLA-4 49 A/G and -318 C/T were analyzed using SHEsis software online. Logistic regression model was applied to analyze the association between multiple factors and the efficacy of 131 I therapy. The results showed that CTLA-4 49 A/G was closely related to the efficacy of 131 I treatment for Graves' disease (AG + GG vs. AA: OR = 6.125, 95%CI = 1.431∼26.22, P = 0.006; G vs. A: OR = 2.204, 95%CI = 1.267 ∼3 .835, P = 0.004). Moreover, the findings revealed that haplotype A-C (P = 0.018, OR = 0.424, 95%CI: 0.205∼0.876) and G-C (P = 0.014, OR = 2.204, 95%CI: 1.267∼3.835) were associated with the efficacy of 131 I therapy in treating Graves' disease. Logistic regression analysis indicated that thyroid weight (OR = 1.050, 95%CI = 1.007∼1.095, P = 0.022) and CTLA-4 exon-1 49 A/G polymorphism (OR = 8.082, 95%CI = 1.049∼62.234, P = 0.045) were both related factors with efficacy of 131 I therapy in Graves' disease. These data indicated that CTLA-4 exon-1 49 A/G polymorphism may be associated with therapeutic efficacy of radionuclide 131 I for patients with Graves' disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. [Relationship between factor VIII inhibitor development and polymorphisms of TNFα and CTLA-4 gene in Chinese Han patients with hemophilia A].

    Science.gov (United States)

    Zhang, Lu-lu; Yu, Zi-qiang; Zhang, Wei; Cao, Li-juan; Su, Jian; Bai, Xia; Ruan, Chang-geng

    2011-03-01

    To investigate the potential association between factor VIII inhibitor development and polymorphisms of tumor necrosis factor-α (TNF-α)-308 and cytotoxic T-lymphocyte associated protein-4 gene in Chinese Han patients with hemophilia A (HA). The single base change polymorphism in TNF-α and CTLA-4 gene was analyzed in 140 Chinese Han patients with hemophilia A who have been treated with plasma-derived FVIII concentrates and 108 normal controls by using PCR-restrictive fragment length polymorphism (RFLP). All of the HA patients' plasma samples were measured by modified-Nijmegen assay simultaneously. In HA patients, G/G genotype, G/A genotype and A/A genotype were detected in 118 (84.3%), 18 (12.8%) and 4 cases (2.9%) respectively; C/C genotype, C/T genotype and T/T genotype were detected in 108 (77.2%), 30 (21.4%) and 2 cases (1.4%) respectively. The difference in the genotype frequencies between HA patients and controls was nonsignificant (P > 0.05). Patients who were carriers of homozygotes for A allele had a higher risk of inhibitor development compared with those who were not (OR = 7.519, 95% CI = 3.168 - 17.844). Severe HA patients who were carriers of homozygotes for A allele had a higher risk of inhibitor development compared with those who were not (OR = 8.163, 95% CI = 2.521 - 26.434). There was no statistical difference in the risk of inhibitor development between the patients who were carriers or not (OR = 1.586, 95% CI = 0.729 - 3.450). TNF-α-308 gene polymorphism is significantly associated with inhibitor development in Chinese Han patients with severe hemophilia A. TNF-α gene may be a useful marker and potential modulator of the immune response to replacement therapy for hemophilia A patients.

  4. EFIS Lecture: Understanding the CTLA-4 checkpoint in the maintenance of immune homeostasis.

    Science.gov (United States)

    Walker, Lucy S K

    2017-04-01

    The past 20 years have heralded fascinating developments in the field of CTLA-4 biology. The CTLA-4 protein is a critical negative regulator of T cell immunity and its absence provokes severe lymphoproliferative disease. In a surprising twist, the generation of mixed bone marrow chimeric mice revealed that CTLA-4 predominantly functions in a cell-extrinsic manner, suggesting that CTLA-4 expressed on one cell can modify the behaviour of another cell. This was followed by the demonstration that CTLA-4 is highly expressed in regulatory T cells and can contribute to their suppressive activity. In line with a cell-extrinsic function, increasing evidence indicates that CTLA-4-positive cells can modify the phenotype of antigen presenting cells (APC), thereby regulating the priming of naive T cells. Notably, CTLA-4 is able to downregulate expression of costimulatory ligands on APC via a process of trans-endocytosis. The identification of patients with mutations in the ctla4 gene has provided an opportunity to study the contribution of CTLA-4 to Treg function and immune regulation in the human immune system. Finally, it has become apparent that CTLA-4 also plays a role in controlling humoral immunity, via the regulation of CD28-driven follicular helper T cell differentiation. At the recent German Society for Immunology congress, I discussed some of the contributions of my own lab to the unfolding of the CTLA-4 story, in the context of the work of others in the field. Despite the enormous clinical potential associated with modulation of the CTLA-4 pathway, including the use of soluble CTLA-4 molecules in autoimmune settings and blocking antibodies in cancer, it is clear there is still much to learn about this important pathway. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  5. The Role of Cytotoxic T-lymphocyte-associated Protein 4 (CTLA-4) Gene, Thyroid Stimulating Hormone Receptor (TSHR) Gene and Regulatory T-cells as Risk Factors for Relapse in Patients with Graves Disease.

    Science.gov (United States)

    Eliana, Fatimah; Suwondo, Pradana; Asmarinah, Asmarinah; Harahap, Alida; Djauzi, Samsuridjal; Prihartono, Joedo; Pemayun, Tjokorda Gde Dalem

    2017-07-01

    graves' disease (GD) is the most common condition of thyrotoxicosis. The management of GD is initiated with the administration of antithyroid drugs; however, it requires a long time to achieve remission. In reality more than 50% of patients who had remission may be at risk for relapse after the drug is stopped. This study aimed to evaluate the role of clinical factors such as smoking habit, degree of ophtalmopathy, degree of thyroid enlargement; genetic factors such as CTLA-4 gene on nucleotide 49 at codon 17 of exon 1, CTLA-4 gene of promotor -318, TSHR gene polymorphism rs2268458 of intron 1; and immunological factors such as regulatory T cells (Treg) and thyroid receptor antibody (TRAb); that affecting the relapse of patients with Graves' disease in Indonesia. this was a case-control study, that compared 72 subjects who had relapse and 72 subjects without relapse at 12 months after cessation of antithyroid treatment, who met the inclusion criteria. Genetic polymorphism examination was performed using PCR-RFLP. The number of regulatory T cells was counted using flow cytometry analysis and ELISA was used to measure TRAb. The logistic regression was used since the dependent variables were categorical variables. the analysis of this study demonstrated that there was a correlation between relapse of disease and family factors (p=0.008), age at diagnosis (p=0.021), 2nd degree of Graves' ophthalmopathy (p=0.001), enlarged thyroid gland, which exceeded the lateral edge of the sternocleidomastoid muscles (p=0.040), duration of remission period (p=0.029), GG genotype of CTLA-4 gene on the nucleotide 49 at codon 17 of exon 1 (p=0.016), CC genotype of TSHR gene on the rs2268458 of intron 1 (p=0.003), the number of regulatory T cells (p=0.001) and TRAb levels (p=0.002). genetic polymorphisms of CTLA-4 gene on the nucleotide 49 at codon 17 of exon 1, TSHR gene SNP rs2268458 of intron 1, number of regulatory T cells and TRAb levels play a role as risk factors for relapse in

  6. Association of Cytotoxic T-Lymphocyte-Associated Protein 4 (CTLA4 Gene Polymorphisms with Autoimmune Thyroid Disease in Children and Adults: Case-Control Study.

    Directory of Open Access Journals (Sweden)

    Wei-Hsin Ting

    Full Text Available Autoimmune thyroid disease (AITD, including Graves disease (GD and Hashimoto disease (HD, is an organ-specific autoimmune disease with a strong genetic component. Although the cytotoxic T-lymphocyte-associated protein 4 (CTLA4 polymorphism has been reported to be associated with AITD in adults, few studies have focused on children. The aim of our study was to investigate whether the CTLA4 polymorphisms, including -318C/T (rs5742909, +49A/G (rs231775, and CT60 (rs3087243, were associated with GD and HD in Han Chinese adults and children. We studied 289 adult GD, 265 pediatric GD, 229 pediatric HD patients, and 1058 healthy controls and then compared genotype, allele, carrier, and haplotype frequencies between patients and controls. We found that CTLA4 SNPs +49A/G and CT60 were associated with GD in adults and children. Allele G of +49A/G was significantly associated with GD in adults (odds ratio [OR], 1.50; 95% confidence interval [CI], 1.21-1.84; corrected P value [Pc] < 0.001 and children (OR, 1.42; 95% CI, 1.15-1.77; Pc = 0.002. Allele G of CT60 also significantly increased risk of GD in adults (OR, 1.63; 95% CI, 1.27-2.09; Pc < 0.001 and GD in children (OR, 1.58; 95% CI, 1.22-2.04; Pc < 0.001. Significant linkage disequilibrium was found between +49A/G and CT60 in GD and control subjects (D' = 0.92. Our results showed that CTLA4 was associated with both GD and HD and played an equivalent role in both adult and pediatric GD in Han Chinese population.

  7. The Soluble Form of CTLA-4 from Serum of Patients with Autoimmune Diseases Regulates T-Cell Responses

    Directory of Open Access Journals (Sweden)

    Rita Simone

    2014-01-01

    Full Text Available Cytotoxic T lymphocyte associated antigen-4 (CTLA-4 is a costimulatory receptor transducing a potent inhibitory signal. Increasing evidence showed that CTLA-4 gene is an important susceptibility locus for autoimmune disorders. Alternatively spliced mRNA generates a soluble form, called sCTLA-4. Whereas low levels of sCTLA-4 are detected in normal human serum, increased/high serum levels are observed in several autoimmune diseases. The biological significance of increased sCTLA-4 serum level is not fully clarified yet. It can be envisaged that sCTLA-4 specifically inhibits the early T-cell activation by blocking the interaction of CD80/CD86 with the costimulatory receptor CD28. On the other hand, higher levels of sCTLA-4 could contend the binding of the membrane form of CTLA-4 with CD80/CD86, in later activation phase, causing a reduction of inhibitory signalling. We showed that sCTLA-4 from sera of patients with different autoimmune diseases is able to display functional activities on an in vitro system acting on the proliferation capability and modulating the secretion of cytokines. We observed a dual effect of sCTLA-4: inhibiting the secretion of IFN-γ, IL-2, IL-7, and IL-13 and activating the secretion of TGF-β and IL-10. This study underlines the role of sCTLA-4 in modulating the immune response and its relevance in autoimmune disease pathogenesis.

  8. Association of the +49 A/G Polymorphism of CTLA4 Gene with Idiopathic Recurrent Spontaneous Abortion in Women in Southwest of Iran.

    Science.gov (United States)

    Rasti, Zarnegar; Nasiri, Mahboobeh

    2016-01-01

    Survival of the semi-allograft fetus during pregnancy opens a new area for the immunological based causes of recurrent spontaneous abortion (RSA). Cytotoxic T lymphocyte-associated antigen 4 (CTLA4) is a negative regulator of the T-cell activation, which may modulate peripheral self-tolerance of the allogeneic fetus. The present study aimed to investigate the +49 A/G CTLA4 genetic polymorphism and predisposition to RSA. The total participants were 120 women with at least two miscarriages and 120 healthy post-menopausal women as the control group. The +49 A/G polymorphism was genotyped using PCR-RFLP method. Required demographic information was collected through filling out a questionnaire. The obtained data were fed into SPSS software version 16. The results showed a significant association between the minor alleles (G) with the decreased risk of the RSA. The frequency of the G allele in controls and patients was 25% and 12%, respectively. A GG genotype in the co-dominance model (OR: 0.25, 95%CI: 0.09-0.66) and in the dominant model for allele G (GG+AG vs. AA) (OR: 0.84, 95%CI: 0.8-0.87) showed significant association with RSA by imposing the protective role. The frequency of miscarriage is significantly (p=0.04) higher among the relatives of RSA women (33.3%) in comparison with the women in the control group (21.7%). It can be concluded that +49G allele may act as a dominant allele and reduce the risk of RSA. Family history of miscarriage increased the risk of RSA among women.

  9. CTLA-4 regulates allergen response by modulating GATA-3 protein level per cell

    Science.gov (United States)

    Nasta, Francesca; Corinti, Silvia; Bonura, Angela; Colombo, Paolo; Di Felice, Gabriella; Pioli, Claudio

    2007-01-01

    T helper type 2 (Th2) cell differentiation requires the expression of GATA-3, a transcription factor that allows transcriptional activation of Th2 cytokine genes through chromatin remodelling. We investigated the role of the negative costimulatory receptor cytotoxic T-lymphocyte antigen 4 (CTLA-4) in the regulation of GATA-3 expression, Th2 differentiation and immunoglobulin production during the immune response to allergens. BALB/c mice were immunized with a recombinant major allergenic component of Parietaria judaica pollen, rPar j I, and treated with blocking anti-CTLA-4 or control antibodies. Results showed that in vivo CTLA-4 blockade enhanced the Par j I-specific immunoglobulin E (IgE) serum level. In contrast, Par j I-specific IgG2a serum level was reduced, suggesting that CTLA-4 blockade skewed immunoglobulin production towards interleukin-4 (IL-4) -dependent immunoglobulin isotypes. Consistently, CTLA-4 blockade increased the frequency of Par j I-specific Th2 cells but not Th1 cells, as well as IL-4 and IL-5 but not interferon-γ production. Our data also showed that CTLA-4 blockade enhanced the GATA-3 : T-bet messenger RNA ratio. Interestingly, in vivo CTLA-4 blockade did not increase the frequency of GATA-3 protein-expressing cells. In contrast, it enhances GATA-3 protein level per cell. Further, in vitro results show that the anti-CTLA-4 monoclonal antibody, by competing with CD80 for CTLA-4 binding, induced an enhancement in the frequency of IL-4-producing cells that correlates with the increase in GATA-3 protein level per cell. In conclusion, CTLA-4, by affecting the level of GATA-3 per cell, contributes to keeping this factor under the threshold required to become a Th2 effector cell. Consequently, it affects IgE/IgG2a production and contributes to the outcome of allergen-specific immune responses. PMID:17313444

  10. Costimulatory receptors in a teleost fish: Typical CD28, elusive CTLA4

    Science.gov (United States)

    Bernard, D.; Riteau, B.; Hansen, J.D.; Phillips, R.B.; Michel, F.; Boudinot, P.; Benmansour, A.

    2006-01-01

    T cell activation requires both specific recognition of the peptide-MHC complex by the TCR and additional signals delivered by costimulatory receptors. We have identified rainbow trout sequences similar to CD28 (rbtCD28) and CTLA4 (rbtCTLA4). rbtCD28 and rbtCTLA4 are composed of an extracellular Ig-superfamily V domain, a transmembrane region, and a cytoplasmic tail. The presence of a conserved ligand binding site within the V domain of both molecules suggests that these receptors likely recognize the fish homologues of the B7 family. The mRNA expression pattern of rbtCD28 and rbtCTLA4 in naive trout is reminiscent to that reported in humans and mice, because rbtCTLA4 expression within trout leukocytes was quickly up-regulated following PHA stimulation and virus infection. The cytoplasmic tail of rbtCD28 possesses a typical motif that is conserved in mammalian costimulatory receptors for signaling purposes. A chimeric receptor made of the extracellular domain of human CD28 fused to the cytoplasmic tail of rbtCD28 promoted TCR-induced IL-2 production in a human T cell line, indicating that rbtCD28 is indeed a positive costimulator. The cytoplasmic tail of rtrtCTLA4 lacked obvious signaling motifs and accordingly failed to signal when fused to the huCD28 extracellular domain. Interestingly, rbtCTLA4 and rbtCD28 are not positioned on the same chromosome and thus do not belong to a unique costimulatory cluster as in mammals. Finally, oar results raise questions about the origin and evolution of positive and negative costimulation in vertebrate immune systems. Copyright ?? 2006 by The American Association of Immunologists, Inc.

  11. Enhanced efficacy of CTLA-4 fusion anti-caries DNA vaccines in gnotobiotic hamsters.

    Science.gov (United States)

    Zhang, Feng; Li, Yu-hong; Fan, Ming-wen; Jia, Rong; Xu, Qing-an; Guo, Ji-hua; Yu, Fei; Tian, Qi-wei

    2007-08-01

    To evaluate the comparative immunogenicity and protective efficacy of the cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) fusion anti-caries DNA vaccines pGJA-P/VAX1, pGJA-P, and non-fusion anti-caries DNA construct pGLUA-P in hamsters. In addition, the ability of CTLA-4 to target pGJA-P/VAX1-encoding antigen to dendritic cells was tested in vitro. All DNA constructs contain genes encoding the A-P regions of a cell surface protein (PAc) and the glucan binding (GLU) domain of glucosyltransferases (GTFs) of cariogenic organism Streptococcus mutans. Human dendritic cells were mixed with the CTLA-4-Ig-GLU-A-P protein expressed by pGJA-P/VAX1-transfected cells and analyzed by flow cytometry. Gnotobiotic hamsters were immunized with anti-caries DNA vaccines by intramuscular injection or intranasal administration. Antibody responses to a representative antigen PAc were assayed by ELISA, and caries protection was evaluated by Keyes caries scores. A flow cytometric analysis demonstrated that CTLA-4-Ig-GLU-A-P protein was capable of binding to human dendritic cells. pGJA-P/VAX1 and pGJA-P induced significantly higher specific salivary and serum anti-PAc antibody responses than pGLUA-P. Significantly fewer caries lesions were also observed in hamsters immunized with pGJA-P/VAX1 and pGJA-P. There was no significant difference in the anti-PAc antibody level or caries scores between pGJA-P/VAX1 and pGJA-P-immunized groups. Antigen encoded by CTLA-4 fusion anti-caries DNA vaccine pGJA-P/VAX1 could specifically bind to human dendritic cells through the interaction of CTLA-4 and B7 molecules. Fusing antigen to CTLA-4 has been proven to greatly enhance the immunogenicity and protective efficacy of anti-caries DNA vaccines.

  12. CTLA-4Ig immunotherapy of obesity-induced insulin resistance by manipulation of macrophage polarization in adipose tissues

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Masakazu, E-mail: masakazu731079@yahoo.co.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Inoguchi, Toyoshi, E-mail: toyoshi@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Batchuluun, Battsetseg, E-mail: battsetseg.batchuluun@gmail.com [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Sugiyama, Naonobu, E-mail: nao1@intmed1.med.kyushu-u.ac.jp [Department of Medicine and Biosystemic Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Kobayashi, Kunihisa, E-mail: nihisak@fukuoka-u.ac.jp [Department of Endocrinology and Diabetes Mellitus, Fukuoka University Chikushi Hospital, 1-1-1 Zokumyoin, Chikushino, Fukuoka 818-8502 (Japan); Sonoda, Noriyuki, E-mail: noriyuki@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Takayanagi, Ryoichi, E-mail: takayana@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2013-08-16

    Highlights: •CTLA-4Ig completely alleviates HFD-induced insulin resistance. •CTLA-4Ig reduces epididymal and subcutaneous fat tissue weight and adipocyte size. •CTLA-4Ig alters ATM polarization from inflammatory M1 to anti-inflammatory M2. •CTLA-4Ig may lead to a novel anti-obesity/inflammation/insulin resistance agent. •We identified the mechanism of the novel favorable effects of CTLA-4lg. -- Abstract: It has been established that obesity alters the metabolic and endocrine function of adipose tissue and, together with accumulation of adipose tissue macrophages, contributes to insulin resistance. Although numerous studies have reported that shifting the polarization of macrophages from M1 to M2 can alleviate adipose tissue inflammation, manipulation of macrophage polarization has not been considered as a specific therapy. Here, we determined whether cytotoxic T-lymphocyte-associated antigen-4IgG1 (CTLA-4Ig) can ameliorate insulin resistance by induction of macrophages from proinflammatory M1 to anti-inflammatory M2 polarization in the adipose tissues of high fat diet-induced insulin-resistant mice. CTLA4-Ig treatment prevented insulin resistance by changing gene expression to M2 polarization, which increased the levels of arginase 1. Furthermore, flow cytometric analysis confirmed the alteration of polarization from CD11c (M1)- to CD206 (M2)-positive cells. Concomitantly, CTLA-4Ig treatment resulted in weight reductions of epididymal and subcutaneous adipose tissues, which may be closely related to overexpression of apoptosis inhibitors in macrophages. Moreover, proinflammatory cytokine and chemokine levels decreased significantly. In contrast, CCAAT enhancer binding protein α, peroxisome proliferator-activated receptor γ, and adiponectin expression increased significantly in subcutaneous adipose tissue. This novel mechanism of CTLA-4lg immunotherapy may lead to an ideal anti-obesity/inflammation/insulin resistance agent.

  13. CTLA4 +49 A/G and CT60 polymorphisms in Dutch coeliac disease patients.

    Science.gov (United States)

    van Belzen, Martine J; Mulder, Chris J J; Zhernakova, Alexandra; Pearson, Peter L; Houwen, Roderick H J; Wijmenga, Cisca

    2004-09-01

    Coeliac disease is an autoimmune disorder, characterised by villous atrophy of the small intestine, which results from a T-cell-mediated response to gluten-derived peptides. The cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) is involved in the regulation of T-cell activation and the CTLA4 +49 A/G polymorphism in exon 1 has been implicated in several autoimmune disorders, including coeliac disease. However, this polymorphism was recently excluded as being the causal variant in Graves' disease, autoimmune hypothyroidism and type I diabetes mellitus. This causal variant was mapped to the 3' region of CTLA4, with the CT60 polymorphism showing the strongest association. The aim of this study was to determine the role of the CTLA4 gene in coeliac disease in the Dutch population. The +49 A/G and CT60 polymorphisms were genotyped in a case-control cohort of 215 patients and controls. The frequency of the +49 G-allele was increased in cases, although not significantly. However, the frequency of the CT60 G-allele was increased with borderline significance in coeliac disease patients (P = 0.048), although the genotype distributions did not show a significant difference between cases and controls. These results indicate the involvement of the CTLA4 gene in coeliac disease development. The haplotype carrying the CT60 G-allele was shown to be associated with lower mRNA levels of the soluble CTLA-4 isoform, providing a possible mechanism for the T-cell-mediated destruction of the small intestine.

  14. CTLA-4 Limits Anti-CD20-Mediated Tumor Regression.

    Science.gov (United States)

    Ren, Zhenhua; Guo, Jingya; Liao, Jing; Luan, Yan; Liu, Zhida; Sun, Zhichen; Liu, Xiaojuan; Liang, Yong; Peng, Hua; Fu, Yang-Xin

    2017-01-01

    The inhibition of tumor growth by anti-CD20 antibody (Ab) treatment is mediated by Ab- and complement-dependent cytotoxicity in xenograft tumor models. In addition, anti-CD20 therapy for B-cell lymphoma can result in intrinsic and extrinsic tumor resistance to further Ab treatment. However, adaptive immune response-related resistance has not been well studied in anti-CD20-mediated tumor control, and adaptive immunity has long been underestimated. The purpose of this study was to explore whether T cells are involved in mediating the effects of anti-CD20 therapy and what factors contribute to adaptive immune response-related resistance. Using a syngeneic mouse B-cell lymphoma model, we investigated the role of CD8(+) T cells in anti-CD20-mediated tumor regression. Furthermore, we revealed how the tumor-specific T-cell response was initiated by anti-CD20. Finally, we studied adaptive immune response-related resistance in advanced B-cell lymphoma. CD8(+) T cells played an essential role in anti-CD20-mediated tumor regression. Mechanistically, anti-CD20 therapy promoted dendritic cell (DC)-mediated cross-presentation. Importantly, macrophages were also necessary for the increase in the tumor-specific CTL response after anti-CD20 treatment, via the production of type I IFN to activate DC function. Furthermore, adaptive resistance is gradually developed through the CTLA-4 pathway in Treg cells in larger lymphomas. Further blockade of CTLA-4 can synergize with anti-CD20 treatment in antitumor activities. The therapeutic function of anti-CD20 depends on tumor-specific CD8(+) T-cell responses initiated by anti-CD20 through macrophages and DCs. CTLA-4 blockade can synergize with anti-CD20 to overcome adaptive immune response-related resistance in advanced B-cell lymphoma. Clin Cancer Res; 23(1); 193-203. ©2016 AACR. ©2016 American Association for Cancer Research.

  15. Adjuvanticity of a CTLA-4 3' UTR complementary oligonucleotide for emulsion formulated recombinant subunit and inactivated vaccines.

    Science.gov (United States)

    Li, Xin; Yang, Lei; Zhao, Peiyan; Yao, Yun; Lu, Fangjie; Tu, Liqun; Liu, Jiwei; Li, Zhiqin; Yu, Yongli; Wang, Liying

    2017-04-25

    Cytotoxic T-lymphocyte antigen 4 (CTLA-4) is recognized as a critical inhibitory regulator of T-cell proliferation and activation, opposing the action of CD28-mediated co-stimulation. Interfering or blocking CTLA-4 can result in continuous T-cell activation required for the full immune response to pathogenic microbes and vaccines. To test if nucleic acid-based CTLA-4 inhibitors could be developed into a novel adjuvant, we designed two oligonucleotides, CMD-1 and CMD-2, with the sequences complementary to the conserve regions identical between human and mouse CTLA-4 mRNA 3' untranslated region (3' UTR), and tested their in vitro effects on CTLA-4 production and their adjuvanticity for vaccines in mice. We found that CMD-1 inhibited the antigen-induced CTLA-4 up-regulation on the CD4+ T cells by interfering its mRNA expression, maintained higher levels of CD80 and CD86 on the CD11c+ cells and promoted the recalled proliferation of the CD4+ T cells and CD19+ B cells, and that the CMD-1 enhanced the antibody response against recombinant PCV2b capsid protein or inactivated foot-and-mouth disease virus in both ICR and BALB/c mice. These data suggest that the CMD-1 could be used as a novel vaccine adjuvant capable of inhibiting inhibitory signals rather than inducing stimulatory signals of immune cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. CTLA-4 polymorphisms associate with breast cancer susceptibility in Asians: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Zhiming Dai

    2017-01-01

    Full Text Available Previous studies have investigated the association between cytotoxic T-lymphocyte antigen-4 (CTLA-4 polymorphisms and breast cancer susceptibility, but the results remained inconsistent. Therefore, we evaluated the relationship between four common CTLA-4 polymorphisms and breast cancer risk by a meta-analysis, aiming to derive a comprehensive and precise conclusion. We searched EMBASE, Pubmed, Web of Science, CNKI, and Wanfang databases until July 18th, 2016. Finally, ten eligible studies involving 4,544 breast cancer patients and 4,515 cancer-free controls were included; all these studies were from Asia. Odds ratio (OR and 95% confidence interval (CI were used to evaluate the breast cancer risk in five genetic models. The results indicated that the CTLA-4 +49A>G (rs231775 polymorphism had a significant association with decreased breast cancer risk in allelic, homozygous, dominant and recessive models. Also, the +6230G>A (rs3087243 polymorphism reduced breast cancer risk especially in the Chinese population under homozygous and recessive models. In contrast, the −1661A>G (rs4553808 polymorphism increased breast cancer risk in allelic, heterozygous and dominant models, whereas −1722 T>C (rs733618 did not relate to breast cancer risk. In conclusion, CTLA-4 polymorphisms significantly associate with breast cancer susceptibility in Asian populations, and different gene loci may have different effects on breast cancer development. Further large-scale studies including multi-racial populations are required to confirm our findings.

  17. CD28/CTLA-4/ICOS haplotypes confers susceptibility to Graves' disease and modulates clinical phenotype of disease.

    Science.gov (United States)

    Pawlak-Adamska, Edyta; Frydecka, Irena; Bolanowski, Marek; Tomkiewicz, Anna; Jonkisz, Anna; Karabon, Lidia; Partyka, Anna; Nowak, Oskar; Szalinski, Marek; Daroszewski, Jacek

    2017-01-01

    Graves' disease, an autoimmune disease with heterogeneous symptoms including Graves' orbitopathy, has a combined genetic/environmental background, where variations within CD28/CTLA-4/ICOS genes are considered as disease markers.Association of CD28c.17+3T>C(rs3116496), CTLA-4g.319C>T(rs5742909), CTLA-4c.49A>G(rs231775), CTLA-4g.*642AT(8_33), CT60(rs3087243), Jo31(rs11571302), ICOSc.1554+4GT(8_15) polymorphisms with susceptibility to Graves' disease and clinical outcome was investigated. The study group comprised of 561 Polish Caucasians, including 172 unrelated Graves' disease patients. CTLA-4c.49A>G, CTLA-4g.319C>T, and CT60 were genotyped by PCR-RFLP; Jo31 and CD28c.17+3C>T by minisequencing; CTLA-4g.*642AT(8_33) and ICOSc.1554+4GT(8_15)-PCR and fluorescence-based technique. CD28c.17+3T>C(rs3116496)T/CTLA-4g.319C>T(rs5742909)C/CTLA-4c.49A>G(rs231775)G/CTLA-4g.*642AT(8_33)(AT16-21)/CT60(rs3087243)G/Jo31(rs11571302)G/ICOSc.1554+4GT(8_15)(m) and TCA(ATGraves' disease, especially in males, as well as overall Graves' orbitopathy development with severe outcome. TCG(AT16-21)GG(l) haplotype increased risk of Graves' disease and reduced the chance of successful medical treatment. Although this haplotype was mainly observed in patients without signs of Graves' orbitopathy, if Graves' orbitopathy developed it favored a Graves' orbitopathy outcome. Haplotype TCA(AT>21)GT(m) increased Graves' disease risk in women and, in all patients, was linked to Graves' disease without Graves' orbitopathy. TCG(ATGraves' orbitopathy, whereas TCA(AT16-21)GG(m) was absent in those patients. TCA(AT16-21)GG(m) occurred in patients with a mild Graves' orbitopathy outcome. The marker CTLA-4g.*642AT(8_33) was the only independent Graves' disease risk factor, whereas CT60 was an independent factor for disease progression. Sporadic Graves' disease was related to presence of CTLA-4c.49A>G[A] and the rare CTLA-4g.319C>T[T] allele variant. Familial background of the disease was exclusively associated

  18. Association of Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) and Thyroglobulin (TG) Genetic Variants with Autoimmune Hypothyroidism

    Science.gov (United States)

    Patel, Hinal; Mansuri, Mohmmad Shoab; Singh, Mala; Begum, Rasheedunnisa; Shastri, Minal; Misra, Ambikanandan

    2016-01-01

    Autoimmune hypothyroidism is known to be caused by immune responses related to the thyroid gland and its immunological feature includes presence of autoimmune antibodies. Therefore the aim was to analyze presence of anti-TPO antibodies in hypothyroidism patients in Gujarat. Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) is one of the susceptibility genes for various autoimmune diseases. Hence, exon1 +49A/G and 3’UTR CT60A/G single nucleotide polymorphisms (SNPs) in CTLA4 and its mRNA expression levels were investigated in autoimmune hypothyroidism patients. Thyroglobulin (TG) is known to be associated with autoimmune thyroid disorders and thus exon 33 (E33) SNP in TG was investigated. We analyzed the presence of anti-TPO antibodies in the plasma samples of 84 hypothyroidism patients and 62 controls by ELISA. PCR-RFLP technique was used for genotyping of polymorphisms. sCTLA4 and flCTLA4 mRNA expression levels were assessed by real time PCR. 59.52% of hypothyroid patients had anti-TPO antibodies in their circulation. The genotype and allele frequencies differed significantly for +49A/G (p = 0.0004 for +49AG, p = 0.0019 for +49GG & p = 0.0004 for allele), CT60 (p = 0.0110 for CT60AG, p = 0.0005 for CT60GG & phypothyroidism when adjusted for age and gender. Our results suggest +49A/G and CT60 polymorphism of CTLA4 and E33 polymorphism of TG may be genetic risk factors for autoimmune hypothyroidism susceptibility and down regulation of both forms of CTLA4 advocates the crucial role of CTLA4 in pathogenesis of autoimmune hypothyroidism. PMID:26963610

  19. Basic science for the clinician 55: CTLA-4.

    Science.gov (United States)

    Sigal, Leonard H

    2012-04-01

    In physiological systems, for every "yang," there must be a "yin," for uncontrolled systems can run amok. This is the case for the T-cell compartment of the immune system, where activation must be modulated, dampened, and ultimately reversed; to not apply the brakes leads to dire consequences. In less than 20 years, CTLA-4 has emerged from being an orphan, next becoming a physiological star with ever-emerging effects, and finally to being a therapeutic target-an impressive example of evolution and one that continues. Understanding the costimulatory effects and mechanisms of CTLA-4 and the redundancies intrinsic to costimulation is important in understanding T-cell function and dysfunction in disease. A future article in this series will describe inducible T-cell costimulator, which is a normal by-pass to CTLA-4's effects.

  20. Confirmation of STAT4, IL2/IL21, and CTLA4 polymorphisms in rheumatoid arthritis.

    Science.gov (United States)

    Daha, Nina A; Kurreeman, Fina A S; Marques, Rute B; Stoeken-Rijsbergen, Gerrie; Verduijn, Willem; Huizinga, Tom W J; Toes, René E M

    2009-05-01

    Recent advances have led to novel identification of genetic polymorphisms that are associated with susceptibility to rheumatoid arthritis (RA). Currently, 5 loci (HLA, PTPN22, TRAF1/C5, TNFAIP3, and STAT4) have been consistently reported, whereas others have been observed less systematically. The aim of the present study was to independently replicate 3 recently described RA susceptibility loci, STAT4, IL2/IL21, and CTLA4, in a large Dutch case-control cohort, and to perform a meta-analysis of all published studies to date and investigate the relevance of the findings in clinically well-defined subgroups of RA patients with or without autoantibodies. The STAT4, IL2/IL21, and CTLA4 gene polymorphisms (rs7574865, rs6822844, and rs3087243, respectively) were genotyped in 877 RA patients and 866 healthy individuals. A meta-analysis of all published studies of disease association with these polymorphisms was performed using the Mantel-Haenszel fixed-effects method. An association of STAT4, IL2/IL21, and CTLA4 with RA was detected in Dutch patients (odds ratio [OR] 1.19 [P=0.031], OR 0.84 [P=0.051], and OR 0.87 [P=0.041], respectively). Results from the meta-analysis confirmed an association of all 3 polymorphisms with RA in Caucasians (OR 1.24 [P=1.66x10(-11)], OR 0.78 [P=5.6x10(-5)], and OR 0.91 [P=1.8x10(-3)], respectively). The meta-analysis also revealed that STAT4 predisposed to disease development equally in patients with autoantibodies and those without autoantibodies, and that CTLA4 enhanced the development of anti-citrullinated protein antibody (ACPA)-positive RA as compared with ACPA-negative RA. Our results replicate and firmly establish the association of STAT4 and CTLA4 with RA and provide highly suggestive evidence for IL2/IL21 loci as a risk factor for RA. Given the strong statistical power of our meta-analysis to confirm a true-positive association, these findings provide considerable support for the involvement of CTLA4 in distinct subsets of RA

  1. Association between CTLA-4 60G/A and -1661A/G polymorphisms and the risk of cancers: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Qing Yan

    Full Text Available PURPOSE: CTLA-4 is one of the most fundamental immunosuppressive cotykines which belongs to the immunoglobulin super-family, and is expressed mainly on activated T cells. Previous studies have reported the existence of CTLA4 60G/A and CTLA4 -1661A/G polymorphism in cancers. However, the effects remain conflicting. Hence, we performed a meta-analysis to investigate the association between these polymorphisms and cancer risk. METHODS: We searched the Pubmed and Web of Science databases until October 24, 2013 to obtain relevant published studies. Pooled odds ratios (ORs and corresponding 95% confidence intervals (CIs for the relationship between CTLA4 gene polymorphisms and cancer susceptibility were calculated by stata 11 software. Heterogeneity tests, sensitivity analyses and publication bias assessments were also performed in our meta-analysis. RESULTS: A total of 22 articles comprising 31 case-control studies concerning the CTLA-4 60G/A and CTLA-4 -1661A/G polymorphisms were included in the meta-analysis. The pooled results suggested the CTLA-4 60G/A polymorphism was significantly associated with an increased skin cancer risk (AA vs. GG: OR = 1.32, 95%CI = 1.09-1.59; AA vs. GA+GG: OR = 1.26, 95%CI = 1.07-1.48. For CTLA-4 -1661 A/G polymorphism, the results showed that the CTLA-4 -1661A/G polymorphism was significantly associated with an increased cancer risk (GA vs. AA: OR = 1.44, 95%CI = 1.13-1.82; GA+GG vs. AA: OR = 1.35, 95%CI = 1.07-1.69; G vs. A: OR = 1.21, 95%CI = 1.01-1.47, especially in gastric cancer, breast cancer, other cancers and in Asians population subgroups. CONCLUSION: Our meta-analysis suggests that the CTLA-4 -1661A/G polymorphism is a potential factor for the susceptibility of cancer, especially in gastric cancer, breast cancer and other cancers, and the CTLA-4 60G/A polymorphism is significantly associated with increased skin cancer risk. The effect of the CTLA-4 -1661A/G polymorphism

  2. CTLA-4 and MDR1 polymorphisms increase the risk for ulcerative colitis: A meta-analysis.

    Science.gov (United States)

    Zhao, Jia-Jun; Wang, Di; Yao, Hui; Sun, Da-Wei; Li, Hong-Yu

    2015-09-14

    To evaluate the correlations between cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) and multi-drug resistance 1 (MDR1) genes polymorphisms with ulcerative colitis (UC) risk. PubMed, EMBASE, Web of Science, Cochrane Library, CBM databases, Springerlink, Wiley, EBSCO, Ovid, Wanfang database, VIP database, China National Knowledge Infrastructure, and Weipu Journal databases were exhaustively searched using combinations of keywords relating to CTLA-4, MDR1 and UC. The published studies were filtered using our stringent inclusion and exclusion criteria, the quality assessment for each eligible study was conducted using Critical Appraisal Skill Program and the resultant high-quality data from final selected studies were analyzed using Comprehensive Meta-analysis 2.0 (CMA 2.0) software. The correlations between SNPs of CTLA-4 gene, MDR1 gene and the risk of UC were evaluated by OR at 95%CI. Z test was carried out to evaluate the significance of overall effect values. Cochran's Q-statistic and I(2) tests were applied to quantify heterogeneity among studies. Funnel plots, classic fail-safe N and Egger's linear regression test were inspected for indication of publication bias. A total of 107 studies were initially retrieved and 12 studies were eventually selected for meta-analysis. These 12 case-control studies involved 1860 UC patients and 2663 healthy controls. Our major result revealed that single nucleotide polymorphisms (SNPs) of CTLA-4 gene rs3087243 G > A and rs231775 G > A may increase the risk of UC (rs3087243 G > A: allele model: OR = 1.365, 95%CI: 1.023-1.822, P = 0.035; dominant model: OR = 1.569, 95%CI: 1.269-1.940, P A: allele model: OR = 1.583, 95%CI: = 1.306-1.918, P T might also confer a significant increases for the risk of UC (allele model: OR = 1.389, 95%CI: 1.214-1.590, P A and rs231775 G > A, and MDR1 gene rs1045642 C > T might confer an increase for UC risk.

  3. Association of HLA class II alleles and CTLA-4 polymorphism with type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Rana J EI Wafai

    2011-01-01

    Full Text Available Type-1 diabetes mellitus (T1DM is a progressive complex autoimmune disease in which combinations of environmental as well as genetic factors contribute to T-cell mediated destruction of insulin-secreting β-cells of the pancreas. HLA class II alleles on chromosome 6p21 [insulin dependent diabetes mellitus 1 (IDDM1], especially DR and DQ, show strong association with T1DM. In addition, several studies have suggested that polymorphisms in the CTLA-4 gene (IDDM12 on chromosome 2q33 form part of the genetic susceptibility for type 1 diabetes. The aim of this study was to analyze HLA alleles of the DQB1 and DRB1 genes using polymerase chain reaction using sequence specific primers (PCR-SSP technique and to investigate the asso-ciation of the A49G CTLA-4 polymorphism using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis in Lebanese T1DM patients. The study was conduc-ted on 39 Lebanese T1DM patients. Results of HLA typing showed an increased frequency of the HLA-DQB1FNx010201, HLA-DQB1FNx010302, HLA-DRB1FNx010301 and HLA-DRB1FNx010401 alleles, sugges-ting risk association and thus can be considered as susceptibility alleles. On the other hand, strong protection against the disease was conferred by the HLA-DRB1FNx01110101, HLA-DQB1FNx010301 and HLADQB1FNx010601 alleles. RFLP analysis of the A49G polymorphism showed a significant increase in the G allele and GG genotype frequencies in patients, suggesting that CTLA-4 may be considered as a susceptibility gene for the development of T1DM in the Lebanese population. Analysis of the two polymorphisms showed no detectable association between the two genes. However, a significant negative association of the G allele with the DQB1FNx010201 allele was ob-served. This might indicate that the two genetic risk factors, namely HLA and CTLA-4, act independently of each other with no additive effect.

  4. Oversecretion of soluble CTLA-4 in various autoimmune diseases overlapping celiac disease.

    Science.gov (United States)

    Pesce, Giampaola; Auricchio, Renata; Bagnasco, Marcello; Saverino, Daniele

    2014-01-01

    To evaluate the levels of soluble CTLA-4 (sCTLA-4) in sera of celiac disease (CD) patients with overlapping autoimmune diseases (OAD; diabetes mellitus, autoimmune thyroid diseases, inflammatory bowel diseases, and autoimmune polyendocrine syndromes). Sera from Italian patients with CD were obtained and enzyme-linked immunosorbent assay was used to measure sCTLA-4. Consistently high serum sCTLA-4 levels were observed in CD (13.20 ng/mL, pautoimmune disease (namely, CD and OAD) versus patients with CD alone. Previously, the potential genetic associations of several CTLA-4 polymorphisms to susceptibility to autoimmune diseases have been described, although the relationship between CTLA-4 polymorphisms and the ability to produce the soluble form is not fully clarified. CTLA-4 is a strong actor in the adaptive response: our data give supportive evidence of the common background of autoimmune diseases.

  5. CTLA-4 (CD152) controls homeostasis and suppressive capacity of regulatory T cells in mice.

    Science.gov (United States)

    Kolar, Paula; Knieke, Karin; Hegel, J Kolja E; Quandt, Dagmar; Burmester, Gerd-R; Hoff, Holger; Brunner-Weinzierl, Monika C

    2009-01-01

    CD4+CD25+ regulatory T cells (known as Treg cells) suppress unwanted and autoreactive T cell responses. Treg cells express the costimulatory molecule CTLA-4 intracellularly, but the mechanisms by which Treg cells exploit CTLA-4 signaling remain unclear. The present study was undertaken to investigate the role of CTLA-4 in controlling the homeostasis and suppressive function of Treg cells. Murine Treg cells were analyzed by flow cytometry for coexpression of CTLA-4 and typical Treg cell-expressed molecules, and the influence of CTLA-4 on T cell proliferation, suppression, and apoptosis was investigated by in vitro assays. To analyze the importance of CTLA-4 in Treg cell-mediated suppression in vivo, wild-type Treg cells were transferred into CTLA-4-deficient mice displaying lymphoproliferation, and survival was monitored over time. A strong correlation between expression of forkhead box P3 and ex vivo expression of CTLA-4 in Treg cells was observed. Inhibition of CTLA-4 signaling in Treg cells during in vitro stimulation increased cell cycling and led to enhanced activation-induced cell death (AICD), which was mediated by CD95/CD95 ligand-induced activation of caspases. Blockade of CTLA-4 signaling resulted in impairment of the suppressive capacity of Treg cells. Despite these effects, high amounts of Treg cells persisted in CTLA-4-deficient mice. Results of transfer experiments in CTLA-4-deficient mice showed that the mice had a significantly prolonged lifespan when CTLA-4-competent Treg cells were injected. Expression of CTLA-4 on Treg cells serves to control T cell proliferation, to confer resistance against AICD, and to maintain the suppressive function of Treg cells.

  6. Transgenic expression of human cytoxic T-lymphocyte associated antigen4-immunoglobulin (hCTLA4Ig) by porcine skin for xenogeneic skin grafting.

    Science.gov (United States)

    Wang, Yong; Yang, Hua-Qiang; Jiang, Wen; Fan, Na-Na; Zhao, Ben-Tian; Ou-Yang, Zhen; Liu, Zhao-Ming; Zhao, Yu; Yang, Dong-Shan; Zhou, Xiao-Yang; Shang, Hai-Tao; Wang, Lu-Lu; Xiang, Peng-Ying; Ge, Liang-Peng; Wei, Hong; Lai, Liang-Xue

    2015-04-01

    Porcine skin is frequently used as a substitute of human skin to cover large wounds in clinic practice of wound care. In our previous work, we found that transgenic expression of human cytoxicT-lymphocyte associated antigen4-immunoglobulin (hCTLA4Ig) in murine skin graft remarkably prolonged its survival in xenogeneic wounds without extensive immunosuppression in recipients, suggesting that transgenic hCTLA4Ig expression in skin graft may be an effective and safe method to prolong xenogeneic skin graft survival. In this work, using a transgene construct containing hCTLA4Ig coding sequence under the drive of human Keratine 14 (k14) promoter, hCTLA4Ig transgenic pigs were generated by somatic nuclear transfer. The derived transgenic pigs were healthy and exhibited no signs of susceptibility to infection. The hCTLA4Ig transgene was stably transmitted through germline over generations, and thereby a transgenic pig colony was established. In the derived transgenic pigs, hCTLA4Ig expression in skin was shown to be genetically stable over generations, and detected in heart, kidney and corneal as well as in skin. Transgenic hCTLA4Ig protein in pigs exhibited expected biological activity as it suppressed human lymphocyte proliferation in human mixed lymphocyte culture to extents comparable to those of commercially purchased purified hCTLA4Ig protein. In skin grafting from pigs to rats, transgenic porcine skin grafts exhibited remarkably prolonged survival compared to the wild-type skin grafts derived from the same pig strain (13.33 ± 3.64 vs. 6.25 ± 2.49 days, P porcine skin graft survival in xenogeneic wounds. The transgenic pigs generated in this work can be used as a reproducible resource to provide porcine skin grafts with extended survival for wound coverage, and also as donors to investigate the impacts of hCTLA4Ig on xenotransplantation of other organs (heart, kidney and corneal) due to the ectopic transgenic hCTLA4Ig expression.

  7. The survey of association between Polymorphism of CTLA-4 Exon 1 with Systemic Lupus Erythematosus

    Directory of Open Access Journals (Sweden)

    Mahdieh Shojaa

    2015-01-01

    Full Text Available Background & aim: Cytotoxic lymphocyte antigen-4 (CTLA-4 plays an important role in inhibition of T cell activation and resulting in prevention of autoimmune disorder such as systemic lupus erythematosus (SLE. The purpose of the present study was to investigate the relationship between AG 49's polymorphisms in exon 1with systemic lupus erythematosus. Methods: The present case-control study was conducted on 180 patients and 304 healthy controls who were matched in age and ethnicity to the similar individual patient. After DNA extraction from blood samples, polymerase chain reaction (PCR was used to analyze the genotype and allele frequencies of 49AG polymorphism of CTLA-4 gene. The collected Data was analyzed by SPSS software and Chi-square and Fisher’s exact test. Results: The results indicated that AA genotype was found in 67.2% of patients. A significant difference was seen compared to the control group (p = 0.0001. While the AG genotype with a frequency of 49.7% in healthy subjects compared with patients frequency of 27.8% and G allele with a frequency of 9.2% in healthy subjects and 5% in patients were significantly more common (p = 0.0001. Although the A allele in 81.1 % of patients and in 66% of control group were seen but no significant difference observed. Conclusion: The results showed that the AG 49 polymorphism played an important role in the pathogenesis of systemic lupus erythematosus.

  8. Rigid-body ligand recognition drives cytotoxic T-lymphocyte antigen 4 (CTLA-4) receptor triggering.

    Science.gov (United States)

    Yu, Chao; Sonnen, Andreas F-P; George, Roger; Dessailly, Benoit H; Stagg, Loren J; Evans, Edward J; Orengo, Christine A; Stuart, David I; Ladbury, John E; Ikemizu, Shinji; Gilbert, Robert J C; Davis, Simon J

    2011-02-25

    The inhibitory T-cell surface-expressed receptor, cytotoxic T lymphocyte-associated antigen-4 (CTLA-4), which belongs to the class of cell surface proteins phosphorylated by extrinsic tyrosine kinases that also includes antigen receptors, binds the related ligands, B7-1 and B7-2, expressed on antigen-presenting cells. Conformational changes are commonly invoked to explain ligand-induced "triggering" of this class of receptors. Crystal structures of ligand-bound CTLA-4 have been reported, but not the apo form, precluding analysis of the structural changes accompanying ligand binding. The 1.8-Å resolution structure of an apo human CTLA-4 homodimer emphasizes the shared evolutionary history of the CTLA-4/CD28 subgroup of the immunoglobulin superfamily and the antigen receptors. The ligand-bound and unbound forms of both CTLA-4 and B7-1 are remarkably similar, in marked contrast to B7-2, whose binding to CTLA-4 has elements of induced fit. Isothermal titration calorimetry reveals that ligand binding by CTLA-4 is enthalpically driven and accompanied by unfavorable entropic changes. The similarity of the thermodynamic parameters determined for the interactions of CTLA-4 with B7-1 and B7-2 suggests that the binding is not highly specific, but the conformational changes observed for B7-2 binding suggest some level of selectivity. The new structure establishes that rigid-body ligand interactions are capable of triggering CTLA-4 phosphorylation by extrinsic kinase(s).

  9. Induced Treg Cells Augment the Th17-Mediated Intestinal Inflammatory Response in a CTLA4-Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Nobumasa Watanabe

    Full Text Available Th17 cells and Foxp3+ regulatory T cells (Tregs are thought to promote and suppress inflammatory responses, respectively. However, whether they counteract each other or synergize in regulating immune reactions remains controversial. To determine their interactions, we describe the results of experiments employing mouse models of intestinal inflammation by transferring antigen-specific Th cells (Th1, Th2, and Th17 differentiated in vitro followed by the administration of the cognate antigen via enema. We show that cotransfer of induced Tregs (iTregs suppressed Th1- and Th2-mediated colon inflammation. In contrast, colon inflammation induced by transfer of Th17 cells, was augmented by the cotransfer of iTregs. Furthermore, oral delivery of antigen potentiated Th17-mediated colon inflammation. Administration of a blocking antibody against cytotoxic T lymphocyte-associated antigen 4 (CTLA4 abrogated the effects of cotransfer of iTregs, while the injection of a soluble recombinant immunoglobulin (Ig fusion protein, CTLA4-Ig substituted for the cotransfer of iTregs. These results suggest that antigen-specific activation of iTregs in a local environment stimulates the Th17-mediated inflammatory response in a CTLA4-dependent manner.

  10. Eomesodermin(lo) CTLA4(hi) Alloreactive CD8+ Memory T Cells Are Associated With Prolonged Renal Transplant Survival Induced by Regulatory Dendritic Cell Infusion in CTLA4 Immunoglobulin-Treated Nonhuman Primates.

    Science.gov (United States)

    Ezzelarab, Mohamed B; Lu, Lien; Guo, Hao; Zahorchak, Alan F; Shufesky, William F; Cooper, David K C; Morelli, Adrian E; Thomson, Angus W

    2016-01-01

    Memory T cells (Tmem), particularly those resistant to costimulation blockade (CB), are a major barrier to transplant tolerance. The transcription factor Eomesodermin (Eomes) is critical for Tmem development and maintenance, but its expression by alloactivated T cells has not been examined in nonhuman primates. We evaluated Eomes and coinhibitory cytotoxic T lymphocyte antigen-4 (CTLA4) expression by alloactivated rhesus monkey T cells in the presence of CTLA4 immunoglobulin, both in vitro and in renal allograft recipients treated with CTLA4Ig, with or without regulatory dendritic cell (DCreg) infusion. In normal monkeys, CD8+ T cells expressed significantly more Eomes than CD4+ T cells. By contrast, CD8+ T cells displayed minimal CTLA4. Among T cell subsets, central Tmem (Tcm) expressed the highest levels of Eomes. Notably, Eomes(lo)CTLA4(hi) cells displayed higher levels of CD25 and Foxp3 than Eomes(hi)CTLA4(lo) CD8+ T cells. After allostimulation, distinct proliferating Eomes(lo)CTLA4(hi) and Eomes(hi)CTLA4(lo) CD8+ T cell populations were identified, with a high proportion of Tcm being Eomes(lo)CTLA4(hi). CB with CTLA4Ig during allostimulation of CD8+ T cells reduced CTLA4 but not Eomes expression, significantly reducing Eomes(lo)CTLA4(hi) cells. After transplantation with CB and rapamycin, donor-reactive Eomes(lo)CTLA4(hi) CD8+ T cells were reduced. However, in monkeys also given DCreg, absolute numbers of these cells were elevated significantly. Low Eomes and high CTLA4 expression by donor-reactive CD8+ Tmem is associated with prolonged renal allograft survival induced by DCreg infusion in CTLA4Ig-treated monkeys. Prolonged allograft survival associated with DCreg infusion may be related to maintenance of donor-reactive Eomes(lo)CTLA4(hi) Tcm.

  11. Successful Treatment of T Cell-Mediated Acute Rejection with Delayed CTLA4-Ig in Mice

    Directory of Open Access Journals (Sweden)

    James S. Young

    2017-09-01

    Full Text Available Clinical observations that kidney transplant recipients receiving belatacept who experienced T cell-mediated acute rejection can be successfully treated and subsequently maintained on belatacept-based immunosuppression suggest that belatacept is able to control memory T cells. We recently reported that treatment with CTLA4-Ig from day 6 posttransplantation successfully rescues allografts from acute rejection in a BALB/c to C57BL/6 heart transplant model, in part, by abolishing B cell germinal centers and reducing alloantibody titers. Here, we show that CTLA4-Ig is additionally able to inhibit established T cell responses independently of B cells. CTLA4-Ig inhibited the in vivo cytolytic activity of donor-specific CD8+ T cells, and the production of IFNγ by graft-infiltrating T cells. Delayed CTLA4-Ig treatment did not reduce the numbers of graft-infiltrating T cells nor prevented the accumulation of antigen-experienced donor-specific memory T cells in the spleen. Nevertheless, delayed CTLA4-Ig treatment successfully maintained long-term graft acceptance in the majority of recipients that had experienced a rejection crisis, and enabled the acceptance of secondary BALB/c heart grafts transplanted 30 days after the first transplantation. In summary, we conclude that delayed CTLA4-Ig treatment is able to partially halt ongoing T cell-mediated acute rejection. These findings extend the functional efficacy of CTLA4-Ig therapy to effector T cells and provide an explanation for why CTLA4-Ig-based immunosuppression in the clinic successfully maintains long-term graft survival after T cell-mediated rejection.

  12. Phenotypic Characteristics of PD-1 and CTLA-4 Expression in Symptomatic Acute Hepatitis A.

    Science.gov (United States)

    Cho, Hyosun; Kang, Hyojeung; Kim, Chang Wook; Kim, Hee Yeon; Jang, Jeong Won; Yoon, Seung Kew; Lee, Chang Don

    2016-03-01

    The immunoregulatory molecules programmed death 1 (PD-1) and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) are associated with the dysfunction of antiviral effector T-cells, which leads to T-cell exhaustion and persistent viral infection in patients with chronic hepatitis C and chronic hepatitis B. Little is known about the role of PD-1 and CTLA-4 in patients with symptomatic acute hepatitis A (AHA). Peripheral blood mononuclear cells were isolated from seven patients with AHA and from six patients with nonviral acute toxic hepatitis (ATH) during the symptomatic and convalescent phases of the respective diseases; five healthy subjects acted as controls. The expression of PD-1 and CTLA-4 on T-cells was measured by flow cytometry. PD-1 and CTLA-4 expression during the symptomatic phase was significantly higher in the T-cells of AHA patients than in those of ATH patients or healthy controls (PD-1 18.3% vs 3.7% vs 1.6%, respectively, p<0.05; CTLA-4 23.5% vs 6.1% vs 5.9%, respectively, p<0.05). The levels of both molecules decreased dramatically during the convalescent phase of AHA, whereas a similar pattern was not seen in ATH. Our findings are consistent with a viral-protective effect of PD-1 and CTLA-4 as inhibitory molecules that suppress cytotoxic T-cells and thereby prevent the destruction of virus-infected hepatocytes in AHA.

  13. Acute Malaria Induces PD1+CTLA4+ Effector T Cells with Cell-Extrinsic Suppressor Function.

    Directory of Open Access Journals (Sweden)

    Maria Sophia Mackroth

    2016-11-01

    Full Text Available In acute Plasmodium falciparum (P. falciparum malaria, the pro- and anti-inflammatory immune pathways must be delicately balanced so that the parasitemia is controlled without inducing immunopathology. An important mechanism to fine-tune T cell responses in the periphery is the induction of coinhibitory receptors such as CTLA4 and PD1. However, their role in acute infections such as P. falciparum malaria remains poorly understood. To test whether coinhibitory receptors modulate CD4+ T cell functions in malaria, blood samples were obtained from patients with acute P. falciparum malaria treated in Germany. Flow cytometric analysis showed a more frequent expression of CTLA4 and PD1 on CD4+ T cells of malaria patients than of healthy control subjects. In vitro stimulation with P. falciparum-infected red blood cells revealed a distinct population of PD1+CTLA4+CD4+ T cells that simultaneously produced IFNγ and IL10. This antigen-specific cytokine production was enhanced by blocking PD1/PDL1 and CTLA4. PD1+CTLA4+CD4+ T cells were further isolated based on surface expression of PD1 and their inhibitory function investigated in-vitro. Isolated PD1+CTLA4+CD4+ T cells suppressed the proliferation of the total CD4+ population in response to anti-CD3/28 and plasmodial antigens in a cell-extrinsic manner. The response to other specific antigens was not suppressed. Thus, acute P. falciparum malaria induces P. falciparum-specific PD1+CTLA4+CD4+ Teffector cells that coproduce IFNγ and IL10, and inhibit other CD4+ T cells. Transient induction of regulatory Teffector cells may be an important mechanism that controls T cell responses and might prevent severe inflammation in patients with malaria and potentially other acute infections.

  14. CTLA4-Ig in B7-1-positive diabetic and non-diabetic kidney disease.

    Science.gov (United States)

    Bassi, Roberto; Fornoni, Alessia; Doria, Alessandro; Fiorina, Paolo

    2016-01-01

    Diabetic kidney disease (DKD) is the leading cause of end-stage renal disease in the Western world. Standard treatments have ultimately proven ineffective in blocking DKD progression, thus necessitating the design of new therapies to complement glycaemic and blood pressure control. High glucose levels upregulate the immune-related molecule B7-1 in podocytes, and such an event may play a relevant role in DKD onset, suggesting that B7-1 is a suitable therapeutic target for DKD. CTLA4-Ig is a clinically available fusion protein, approved for the treatment of some autoimmune diseases, which binds B7-1 and blocks its signalling. We have previously demonstrated that CTLA4-Ig restores the physiological structure and cellular motility of podocytes challenged with high glucose in vitro and abrogates the onset of proteinuria in murine models of DKD in vivo. Notably, these beneficial effects occurred independently of any systemic immunological effects of CTLA4-Ig. While the expression of B7-1 on podocytes raises questions regarding the very nature of the podocyte as we know it, the preliminary positive effect of CTLA4-Ig on proteinuria in preclinical models and the evidence of B7-1 expression in kidney biopsies of diabetic individuals suggest a potential novel indication for CTLA4-Ig in DKD. Nonetheless, recent reports of problems with detecting podocyte B7-1 and of inconsistent therapeutic efficacy of CTLA4-Ig in proteinuric patients highlight the necessity to establish uniformly accepted protocols for the detection of B7-1 and underline the need for randomised trials with CTLA4-Ig in kidney diseases.

  15. Allogeneic murine mesenchymal stem cells: migration to inflamed joints in vivo and amelioration of collagen induced arthritis when transduced to express CTLA4Ig.

    Science.gov (United States)

    Sullivan, Catherine; Barry, Frank; Ritter, Thomas; O'Flatharta, Cathal; Howard, Linda; Shaw, Georgina; Anegon, Ignacio; Murphy, Mary

    2013-12-15

    Despite the immunosuppressive, homing, and regenerative capabilities of mesenchymal stem cells (MSCs), their ability to migrate to arthritic joints and influence the course of arthritis in vivo remains poorly understood. The objective of this study was to determine if allogeneic MSCs migrate to inflamed joints in vivo and to determine if MSCs expressing the costimulation blocker cytotoxic T lymphocyte associated antigen-4 coupled to immunoglobulin-G (CTLA4Ig) could be used to ameliorate collagen induced arthritis (CIA). The migration of systemically delivered inbred mouse strain (FVB) MSCs to migrate to inflamed joints in CIA was studied using real-time quantitative polymerase chain reaction. Furthermore, the effect of BALB/c MSCs modified with an adenoviral vector to express CTLA4Ig, on T cell function in vitro and on CIA in vivo was assessed. After systemic delivery of FVB MSCs, eGFP DNA was detectable in the joints of mice with CIA confirming that some MSCs had reached to inflamed joints. BALB/c MSCs suppressed the secretion of both TNFα and IFNγ, and reduced the ratio of Th1:Th2 cytokine expression, by DBA/1 T cells in vitro irrespective of viral modification. The expression of CTLA4Ig did not augment this effect. Despite a worsening of disease scores after infusion of BALB/c MSCs in vivo, BALB/c MSCs expressing CTLA4Ig significantly delayed the onset of inflammatory arthritis in CIA. These data demonstrate that allogeneic MSCs can migrate to the inflamed joints of CIA in vivo and that genetically modified allogeneic MSCs may be considered for development of gene therapy strategies for inflammatory arthritis.

  16. Acquired thymic tolerance: role of CTLA4 in the initiation and maintenance of tolerance in a clinically relevant autoimmune disease model

    DEFF Research Database (Denmark)

    Issazadeh-Navikas, Shohreh; Zhang, M; Sayegh, M H

    1999-01-01

    (CTLA4) engagement. The role of CTLA4 in the induction and maintenance of tolerance was then investigated in the murine experimental autoimmune encephalomyelitis model. CTLA4 blockade abrogated the induction but not the maintenance phase of acquired thymic tolerance induced by intrathymic injection...... for the maintenance of acquired thymic tolerance. This is the first report documenting the role of a CTLA4 negative signaling pathway in the induction of tolerance in an autoimmune disease model....

  17. CTLA-4 blockade during dendritic cell based booster vaccination influences dendritic cell survival and CTL expansion

    DEFF Research Database (Denmark)

    Pedersen, Anders E; Ronchese, Franca

    2007-01-01

    and the lysis of relevant in vivo targets. However, the CTLA-4 blockage dependent expansion of CTLs also affect DC survival during booster DC injections and our data suggest that during a booster DC vaccine, the largest increase in CTL levels is already obtained during the first vaccination.......Dendritic cells (DCs) are potent antigen-presenting cells and critical for the priming of CD8+ T cells. Therefore the use of these cells as adjuvant cells has been tested in a large number of experimental and clinical vaccination studies, in particular cancer vaccine studies. A number of protocols...... are emerging that combine vaccination with CTL expanding strategies, such as e.g. blockade of CTLA-4 signalling. On the other hand, the lifespan and in vivo survival of therapeutic DCs have only been addressed in a few studies, although this is of importance for the kinetics of CTL induction during vaccination...

  18. CTLA4 blockade increases Th17 cells in patients with metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Comin-Anduix Begonya

    2009-05-01

    Full Text Available Abstract Background Th17 cells are CD4+ cells that produce interleukin 17 (IL-17 and are potent inducers of tissue inflammation and autoimmunity. We studied the levels of this T cell subset in peripheral blood of patients treated with the anti-CTLA4 antibody tremelimumab since its major dose limiting toxicities are inflammatory and autoimmune in nature. Methods Peripheral blood mononuclear cells (PBMC were collected before and after receiving tremelimumab within two clinical trials, one with tremelimumab alone (21 patients and another together with autologous dendritic cells (DC pulsed with the melanoma epitope MART-126–35 (6 patients. Cytokines were quantified directly in plasma from patients and after in vitro stimulation of PBMC. We also quantified IL-17 cytokine-producing cells by intracellular cytokine staining (ICS. Results There were no significant changes in 13 assayed cytokines, including IL-17, when analyzing plasma samples obtained from patients before and after administration of tremelimumab. However, when PBMC were activated in vitro, IL-17 cytokine in cell culture supernatant and Th17 cells, detected as IL-17-producing CD4 cells by ICS, significantly increased in post-dosing samples. There were no differences in the levels of Th17 cells between patients with or without an objective tumor response, but samples from patients with inflammatory and autoimmune toxicities during the first cycle of therapy had a significant increase in Th17 cells. Conclusion The anti-CTLA4 blocking antibody tremelimumab increases Th17 cells in peripheral blood of patients with metastatic melanoma. The relation between increases in Th17 cells and severe autoimmune toxicity after CTLA4 blockade may provide insights into the pathogenesis of anti-CTLA4-induced toxicities. Trial Registration Clinical trial registration numbers: NCT0090896 and NCT00471887

  19. CTLA-4 +49 G/A Polymorphism Confers Autoimmune Disease Risk: An Updated Meta-Analysis.

    Science.gov (United States)

    Wang, Ke; Zhu, Qin; Lu, Yunjie; Lu, Hao; Zhang, Feng; Wang, Xuehao; Fan, Ye

    2017-04-01

    Cytotoxic T lymphocyte antigen-4 (CTLA-4) plays a pivotal role in immune homeostasis. Dysregulated expression of CTLA-4 leads to many autoimmune diseases, including rheumatoid arthritis, systemic lupus erythematosus, and type 1 diabetes (T1D). There has been a controversial association between the CTLA-4 +49 G/A SNP (rs231775) and autoimmune diseases. Therefore, this meta-analysis was performed to assess the link between rs231775 and autoimmune disease risk. We retrieved the available studies from PUBMED and EMBASE through February, 2016 and then performed meta-analyses that included all populations, as well as by ethnicity. After evaluating data from 4732 patients and 6270 healthy controls that included both Caucasian and Asian ethnicities, we found that rs231775 is strongly associated with autoimmune disease incidence in a homozygote comparison (GG vs. AA, 95% confidence interval [95% CI] 1.382-2.401), in a heterozygote comparison (AG vs. AA, 95% CI 1.151-1.611), in an allelic model (T allele vs. G allele, 95% CI 1.109-1.441), in a dominant model (GG/AG vs. AA, 95% CI 1.220-1.787), and in a recessive model (GG vs. AA/AG, 95% CI 1.128-1.661). The OR (odds ratio) from all models suggested a very significant association between rs231775 and autoimmune diseases. Our present study indicates that CTLA-4 +49 G/A (rs231775) is associated with the susceptibility of autoimmune disease. Hence, rs231775 might be utilized as a diagnostic biomarker in both Asian and Caucasian populations.

  20. Immunogenicity of CTLA4 fusion anti-caries DNA vaccine in rabbits and monkeys.

    Science.gov (United States)

    Jia, Rong; Guo, Ji Hua; Fan, Ming Wen; Bian, Zhuan; Chen, Zhi; Fan, Bing; Yu, Fei; Xu, Qing An

    2006-06-12

    Enhancement of mucosal and systemic immune responses is still a challenge for the application of DNA vaccine. Here, we show anti-caries DNA vaccines, pGJA-P and pGJA-P/VAX, encoding Streptococcus mutans antigens fused to cytotoxic T lymphocyte antigen-4 (CTLA4), which binds to B7 molecule expressed on the surfaces of antigen-presenting cells. Rabbits and monkeys were immunized via intranasal or intramuscular routes. The fusion vaccine induced accelerated and increased specific antibody responses in serum and saliva compared with non-fusion DNA vaccine in rabbits. Significant specific serum IgG and salivary IgA levels could be detected in fusion vaccine-immunized monkeys. Therefore, this study demonstrates that fusing antigens to CTLA4 results in enhancing immune efficacy and strongly suggests that it may represent a promising approach to prevent dental caries or other mucosal infectious diseases. These findings also suggest that CTLA4 fusion anti-caries DNA vaccine may be effective immunogen in primates.

  1. Inflammatory bowel disease and cancer response due to anti-CTLA-4: is it in the flora?

    Science.gov (United States)

    Carbonnel, Franck; Soularue, Emilie; Coutzac, Clélia; Chaput, Nathalie; Mateus, Christine; Lepage, Patricia; Robert, Caroline

    2017-04-01

    Checkpoint inhibitors blocking CTLA-4 (ipilimumab) and PD-1 (nivolumab, pembrolizumab) have transfigured our cancer treatment paradigm. However, these drugs can induce immune-related adverse events that share clinical and pathological characteristics with immune-mediated diseases. One of the most severe immune-related adverse event observed with anti-CTLA-4 is an enterocolitis that mirrors naturally occurring inflammatory bowel disease. This paper reviews the clinical, immunological, and microbiota data associated with the immune-related enterocolitis induced by the cancer immunotherapy blocking CTLA-4, ipilimumab. A parallel analysis of the mechanisms underlying inflammatory bowel diseases on the one hand, and anti-CTLA-4-induced colitis on the other hand, stresses the crucial role of the gut microbiota and of resident Treg in the genesis of both iatrogenic and spontaneous inflammatory bowel diseases.

  2. A soluble form of CTLA-4 is present in serum of pediatric patients with acute lymphoblastic leukaemia

    Directory of Open Access Journals (Sweden)

    R. Simone

    2011-01-01

    Full Text Available CTLA-4 can regulate and maintain self-telerance, providing a negative signal limiting immunoresponses. Acute lymphoblastic leukemia is a clonal disorder of lymphoid progenitors representing the most frequent malignancy of childhood. Here, we show the presence of significantly elevated levels of a soluble form of CTLA-4 in 70% of B-ALL patients. A possible role of this soluble molecule in the pathogenesis of this neoplastic disease can be envisaged.

  3. Predicting the response to CTLA-4 blockade by longitudinal noninvasive monitoring of CD8 T cells.

    Science.gov (United States)

    Rashidian, Mohammad; Ingram, Jessica R; Dougan, Michael; Dongre, Anushka; Whang, Katherine A; LeGall, Camille; Cragnolini, Juan J; Bierie, Brian; Gostissa, Monica; Gorman, James; Grotenbreg, Gijsbert M; Bhan, Atul; Weinberg, Robert A; Ploegh, Hidde L

    2017-08-07

    Immunotherapy using checkpoint-blocking antibodies against targets such as CTLA-4 and PD-1 can cure melanoma and non-small cell lung cancer in a subset of patients. The presence of CD8 T cells in the tumor correlates with improved survival. We show that immuno-positron emission tomography (immuno-PET) can visualize tumors by detecting infiltrating lymphocytes and, through longitudinal observation of individual animals, distinguish responding tumors from those that do not respond to therapy. We used 89Zr-labeled PEGylated single-domain antibody fragments (VHHs) specific for CD8 to track the presence of intratumoral CD8+ T cells in the immunotherapy-susceptible B16 melanoma model in response to checkpoint blockade. A 89Zr-labeled PEGylated anti-CD8 VHH detected thymus and secondary lymphoid structures as well as intratumoral CD8 T cells. Animals that responded to CTLA-4 therapy showed a homogeneous distribution of the anti-CD8 PET signal throughout the tumor, whereas more heterogeneous infiltration of CD8 T cells correlated with faster tumor growth and worse responses. To support the validity of these observations, we used two different transplantable breast cancer models, yielding results that conformed with predictions based on the antimelanoma response. It may thus be possible to use immuno-PET and monitor antitumor immune responses as a prognostic tool to predict patient responses to checkpoint therapies. © 2017 Rashidian et al.

  4. Both anti-TNF and CTLA4 Ig treatments attenuate the disease severity of staphylococcal dermatitis in mice.

    Directory of Open Access Journals (Sweden)

    Manli Na

    Full Text Available RA patients being treated with biologics are known to have an increased risk of infections. We recently demonstrated that both CTLA4 Ig and anti-TNF treatment aggravate systemic Staphylococcus aureus (S. aureus infection in mice, but with distinct clinical manifestations. However, the effects of CTLA4 Ig and anti-TNF treatments on a local S. aureus infection (e.g., skin infection might differ from their effects on a systemic infection.The aim of this study was to examine the differential effects of anti-TNF versus CTLA4 Ig treatment on S. aureus skin infections in mice.Abatacept (CTLA4 Ig, etanercept (anti-TNF treatment or PBS was given to NMRI mice subcutaneously inoculated with S. aureus strain SH1000. The clinical signs of dermatitis, along with histopathological changes due to skin infection, were compared between the groups.Both CTLA4 Ig and anti-TNF treatment resulted in less severe skin infections and smaller post-infectious hyperpigmentation compared with controls. Consistent with the clinical signs of dermatitis, smaller lesion size, more epithelial hyperplasia and more granulation were found in skin biopsies from mice receiving anti-TNF compared with PBS controls. However, both CTLA4 Ig and anti-TNF therapy tended to prolong the healing time, although this finding was not statistically significant. Serum MCP-1 levels were elevated in the anti-TNF group relative to the CTLA4 Ig and PBS groups, whereas IL-6 levels were higher in PBS controls than in the other two groups. Both anti-TNF and CTLA4 Ig treatments tended to down-regulate the necrosis/apoptosis ratio in the locally infected skin tissue. Importantly, no tangible difference was found in the bacterial burden among groups.Both CTLA4 Ig and anti-TNF therapies attenuate disease severity but may prolong the healing time required for S. aureus skin infections. Neither treatment has an impact on bacterial clearance in skin tissues.

  5. CD4+ natural regulatory T cells prevent experimental cerebral malaria via CTLA-4 when expanded in vivo.

    Directory of Open Access Journals (Sweden)

    Ashraful Haque

    Full Text Available Studies in malaria patients indicate that higher frequencies of peripheral blood CD4(+ Foxp3(+ CD25(+ regulatory T (Treg cells correlate with increased blood parasitemia. This observation implies that Treg cells impair pathogen clearance and thus may be detrimental to the host during infection. In C57BL/6 mice infected with Plasmodium berghei ANKA, depletion of Foxp3(+ cells did not improve parasite control or disease outcome. In contrast, elevating frequencies of natural Treg cells in vivo using IL-2/anti-IL-2 complexes resulted in complete protection against severe disease. This protection was entirely dependent upon Foxp3(+ cells and resulted in lower parasite biomass, impaired antigen-specific CD4(+ T and CD8(+ T cell responses that would normally promote parasite tissue sequestration in this model, and reduced recruitment of conventional T cells to the brain. Furthermore, Foxp3(+ cell-mediated protection was dependent upon CTLA-4 but not IL-10. These data show that T cell-mediated parasite tissue sequestration can be reduced by regulatory T cells in a mouse model of malaria, thereby limiting malaria-induced immune pathology.

  6. Fusion of CTLA-4 with HPV16 E7 and E6 enhanced the potency of therapeutic HPV DNA vaccine.

    Directory of Open Access Journals (Sweden)

    Lili Gan

    Full Text Available Preventive anti-HPV vaccines are effective against HPV infection but not against existing HPV-associated diseases, including cervical cancer and other malignant diseases. Therefore, the development of therapeutic vaccines is urgently needed. To improve anti-tumor effects of therapeutic vaccine, we fused cytotoxic T-lymphocyte antigen 4 (CTLA-4 with HPV16 E7 and E6 as a fusion therapeutic DNA vaccine (pCTLA4-E7E6. pCTLA4-E7E6 induced significantly higher anti-E7E6 specific antibodies and relatively stronger specific CTL responses than the nonfusion DNA vaccine pE7E6 in C57BL/6 mice bearing with TC-1 tumors. pCTLA4-E7E6 showed relatively stronger anti-tumor effects than pE7E6 in therapeutic immunization. These results suggest that fusing CTLA-4 with E7E6 is a useful strategy to develop therapeutic HPV DNA vaccines. In addition, fusing the C-terminal of E7 with the N-terminal of E6 impaired the functions of both E7 and E6.

  7. Fusion of CTLA-4 with HPV16 E7 and E6 enhanced the potency of therapeutic HPV DNA vaccine.

    Science.gov (United States)

    Gan, Lili; Jia, Rong; Zhou, Lili; Guo, Jihua; Fan, Mingwen

    2014-01-01

    Preventive anti-HPV vaccines are effective against HPV infection but not against existing HPV-associated diseases, including cervical cancer and other malignant diseases. Therefore, the development of therapeutic vaccines is urgently needed. To improve anti-tumor effects of therapeutic vaccine, we fused cytotoxic T-lymphocyte antigen 4 (CTLA-4) with HPV16 E7 and E6 as a fusion therapeutic DNA vaccine (pCTLA4-E7E6). pCTLA4-E7E6 induced significantly higher anti-E7E6 specific antibodies and relatively stronger specific CTL responses than the nonfusion DNA vaccine pE7E6 in C57BL/6 mice bearing with TC-1 tumors. pCTLA4-E7E6 showed relatively stronger anti-tumor effects than pE7E6 in therapeutic immunization. These results suggest that fusing CTLA-4 with E7E6 is a useful strategy to develop therapeutic HPV DNA vaccines. In addition, fusing the C-terminal of E7 with the N-terminal of E6 impaired the functions of both E7 and E6.

  8. The immunocytokine L19-IL2 eradicates cancer when used in combination with CTLA-4 blockade or with L19-TNF.

    Science.gov (United States)

    Schwager, Kathrin; Hemmerle, Teresa; Aebischer, David; Neri, Dario

    2013-03-01

    Systemic high-dose IL2 promotes long-term survival in a subset of metastatic melanoma patients, but this treatment is accompanied by severe toxicities. The immunocytokine L19-IL2, in which IL2 is fused to the human L19 antibody capable of selective accumulation on tumor neovasculature, has recently shown encouraging clinical activity in patients with metastatic melanoma. In this study, we have investigated the therapeutic performance of L19-IL2, administered systemically in combination with a murine anti-CTLA-4 antibody or with a second clinical-stage immunocytokine (L19-TNF) in two syngeneic immunocompetent mouse models of cancer. We observed complete tumor eradications when L19-IL2 was used in combination with CTLA-4 blockade. Interestingly, mice cured from F9 tumors developed new lesions when rechallenged with tumor cells after therapy, whereas mice cured from CT26 tumors were resistant to tumor rechallenge. Similarly, L19-IL2 induced complete remissions when administered in a single intratumoral injection in combination with L19-TNF, whereas the two components did not lead to cures when administered as single agents. These findings provide a rationale for combination trials in melanoma, as the individual therapeutic agents have been extensively studied in clinical trials, and the antigen recognized by the L19 antibody has an identical sequence in mouse and man.

  9. Beyond CTLA-4 and PD-1, the Generation Z of Negative Checkpoint Regulators.

    Science.gov (United States)

    Le Mercier, Isabelle; Lines, J Louise; Noelle, Randolph J

    2015-01-01

    In the last two years, clinical trials with blocking antibodies to the negative checkpoint regulators CTLA-4 and PD-1 have rekindled the hope for cancer immunotherapy. Multiple negative checkpoint regulators protect the host against autoimmune reactions but also restrict the ability of T cells to effectively attack tumors. Releasing these brakes has emerged as an exciting strategy for cancer treatment. Conversely, these pathways can be manipulated to achieve durable tolerance for treatment of autoimmune diseases and transplantation. In the future, treatment may involve combination therapy to target multiple cell types and stages of the adaptive immune responses. In this review, we describe the current knowledge on the recently discovered negative checkpoint regulators, future targets for immunotherapy.

  10. Beyond CTLA-4 and PD-1, the generation Z of negative checkpoint regulators.

    Directory of Open Access Journals (Sweden)

    Isabelle eLe Mercier

    2015-08-01

    Full Text Available In the last two years, clinical trials with blocking antibodies to the negative checkpoint regulators CTLA-4 and PD-1 have rekindled the hope for cancer immunotherapy. Multiple negative checkpoint regulators protect the host against autoimmune reactions but also restrict the ability of T cells to effectively attack tumors. Releasing these brakes has emerged as an exciting strategy for cancer treatment. Conversely, these pathways can be manipulated to achieve durable tolerance for treatment of autoimmune diseases and transplantation. In the future, treatment may involve combination therapy to target multiple cell types and stages of the adaptive immune responses. In this review, we describe the current knowledge on the recently discovered negative checkpoint regulators, future targets for immunotherapy.

  11. CD152 (CTLA-4) regulates effector functions of CD8+ T lymphocytes by repressing Eomesodermin.

    Science.gov (United States)

    Hegel, Johannes K; Knieke, Karin; Kolar, Paula; Reiner, Steven L; Brunner-Weinzierl, Monika C

    2009-03-01

    CD8(+) T lymphocytes are required for effective host defense against pathogens and also for mediating effector responses against uncontrolled proliferating self-tissues. In this study, we determine that individual CD8(+) T cells are tightly controlled in their effector functions by CD152 (CTLA-4). We demonstrate that signals induced by CD152 reduce the frequency of IFN-gamma and granzyme B expressing CD8(+) T cells independently of the transcription factors T-bet or cKrox by selectively inhibiting accumulation of Eomesodermin mRNA and protein. Ectopic expression of Eomesodermin reversed the CD152-mediated inhibition of effector molecule production. Additionally, enhanced cytotoxicity of individual CD8(+) T cells differentiated in the absence of CD152 signaling was determined in vivo. These novel insights extend our understanding of how immune responses of CD8(+) T cells are selectively modulated.

  12. CTLA4Ig-mediated blockade of T-cell costimulation in patients with psoriasis vulgaris

    Science.gov (United States)

    Abrams, Judith R.; Lebwohl, Mark G.; Guzzo, Cynthia A.; Jegasothy, Brian V.; Goldfarb, Michael T.; Goffe, Bernard S.; Menter, Alan; Lowe, Nicholas J.; Krueger, Gerald; Brown, Michael J.; Weiner, Russell S.; Birkhofer, Martin J.; Warner, Garvin L.; Berry, Karen K.; Linsley, Peter S.; Krueger, James G.; Ochs, Hans D.; Kelley, Susan L.; Kang, Sewon

    1999-01-01

    Engagement of the B7 family of molecules on antigen-presenting cells with their T cell–associated ligands, CD28 and CD152 (cytotoxic T lymphocyte–associated antigen-4 [CTLA-4]), provides a pivotal costimulatory signal in T-cell activation. We investigated the role of the CD28/CD152 pathway in psoriasis in a 26-week, phase I, open-label dose-escalation study. The importance of this pathway in the generation of humoral immune responses to T cell–dependent neoantigens, bacteriophage φX174 and keyhole limpet hemocyanin, was also evaluated. Forty-three patients with stable psoriasis vulgaris received 4 infusions of the soluble chimeric protein CTLA4Ig (BMS-188667). Forty-six percent of all study patients achieved a 50% or greater sustained improvement in clinical disease activity, with progressively greater effects observed in the highest-dosing cohorts. Improvement in these patients was associated with quantitative reduction in epidermal hyperplasia, which correlated with quantitative reduction in skin-infiltrating T cells. No markedly increased rate of intralesional T-cell apoptosis was identified, suggesting that the decreased number of lesional T cells was probably likely attributable to an inhibition of T-cell proliferation, T-cell recruitment, and/or apoptosis of antigen-specific T cells at extralesional sites. Altered antibody responses to T cell–dependent neoantigens were observed, but immunologic tolerance to these antigens was not demonstrated. This study illustrates the importance of the CD28/CD152 pathway in the pathogenesis of psoriasis and suggests a potential therapeutic use for this novel immunomodulatory approach in an array of T cell–mediated diseases. PMID:10225967

  13. Quantitative CD3 PET Imaging Predicts Tumor Growth Response to Anti-CTLA-4 Therapy.

    Science.gov (United States)

    Larimer, Benjamin M; Wehrenberg-Klee, Eric; Caraballo, Alexander; Mahmood, Umar

    2016-10-01

    Immune checkpoint inhibitors have made rapid advances, resulting in multiple Food and Drug Administration-approved therapeutics that have markedly improved survival. However, these benefits are limited to a minority subpopulation that achieves a response. Predicting which patients are most likely to benefit would be valuable for individual therapy optimization. T-cell markers such as CD3-by examining active recruitment of the T cells responsible for cancer-cell death-represent a more direct approach to monitoring tumor immune response than pretreatment biopsy or genetic screening. This approach could be especially effective as numerous different therapeutic strategies emerge, decreasing the need for drug-specific biomarkers and instead focusing on T-cell infiltration, which has been previously correlated with treatment response. A CD3 PET imaging agent targeting T cells was synthesized to test the role of such imaging as a predictive marker. The (89)Zr-p-isothiocyanatobenzyl-deferoxamine-CD3 PET probe was assessed in a murine tumor xenograft model of anti-cytotoxic T-lymphocyte antigen-4 (CTLA-4) immunotherapy of colon cancer. Imaging on day 14 revealed 2 distinct groups of mice stratified by PET signal intensity. Although there was no significant difference in tumor volume on the day of imaging, in the high-uptake group subsequent measurements revealed significantly smaller tumors than in either the low-uptake group or the untreated controls. In contrast, there was no significant difference in the size of tumors between the low-uptake and untreated control mice. These findings indicate that high CD3 PET uptake in the anti-CTLA-4-treated mice correlated with subsequent reduced tumor volume and was a predictive biomarker of response. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  14. Polymorphisms in CTLA4 influence incidence of drug-induced liver injury after renal transplantation in Chinese recipients.

    Directory of Open Access Journals (Sweden)

    Yifeng Guo

    Full Text Available Genetic polymorphisms in cytotoxic T lymphocyte-associated antigen 4 (CTLA4 play an influential role in graft rejection and the long-term clinical outcome of organ transplantation. We investigated the association of 5 CTLA4 single-nucleotide polymorphisms (SNPs (rs733618 C/T, rs4553808 A/G, rs5742909 C/T, rs231775 A/G, and rs3087243 G/A with drug-induced liver injury (DILI in Chinese renal transplantation (RT recipients. Each recipient underwent a 24-month follow-up observation for drug-induced liver damage. The CTLA4 SNPs were genotyped in 864 renal transplantation recipients. A significant association was found between the rs231775 genotype and an early onset of DILI in the recipients. Multivariate analyses revealed that a risk factor, recipient rs231775 genotype (p = 0.040, was associated with DILI. Five haplotypes were estimated for 4 SNPs (excluding rs733618; the frequency of haplotype ACGG was significantly higher in the DILI group (68.9% than in the non-DILI group (61.1% (p = 0.041. In conclusion, CTLA4 haplotype ACGG was partially associated with the development of DILI in Chinese kidney transplant recipients. The rs231775 GG genotype may be a risk factor for immunosuppressive drug-induced liver damage.

  15. Synergistic effect of CTLA-4 blockade and cancer chemotherapy in the induction of anti-tumor immunity.

    Directory of Open Access Journals (Sweden)

    W Joost Lesterhuis

    Full Text Available Several chemotherapeutics exert immunomodulatory effects. One of these is the nucleoside analogue gemcitabine, which is widely used in patients with lung cancer, ovarian cancer, breast cancer, mesothelioma and several other types of cancer, but with limited efficacy. We hypothesized that the immunopotentiating effects of this drug are partly restrained by the inhibitory T cell molecule CTLA-4 and thus could be augmented by combining it with a blocking antibody against CTLA-4, which on its own has recently shown beneficial clinical effects in the treatment of patients with metastatic melanoma. Here we show, using two non-immunogenic murine tumor models, that treatment with gemcitabine chemotherapy in combination with CTLA-4 blockade results in the induction of a potent anti-tumor immune response. Depletion experiments demonstrated that both CD4(+ and CD8(+ T cells are required for optimal therapeutic effect. Mice treated with the combination exhibited tumor regression and long-term protective immunity. In addition, we show that the efficacy of the combination is moderated by the timing of administration of the two agents. Our results show that immune checkpoint blockade and cytotoxic chemotherapy can have a synergistic effect in the treatment of cancer. These results provide a basis to pursue combination therapies with anti-CTLA-4 and immunopotentiating chemotherapy and have important implications for future studies in cancer patients. Since both drugs are approved for use in patients our data can be immediately translated into clinical trials.

  16. Requirement of CTLA-4 counter receptors for IL-4 but not IL-10 elevations during a primary systemic in vivo immune response

    NARCIS (Netherlands)

    Lu, P.; di Zhou, X.; Chen, S.J.; Moorman, M.; Schoneveld, A.; Morris, S.; Finkelman, F.D.; Linsley, P.; Claassen, E.; Gause, W.C.

    1995-01-01

    The CD28/CTLA-4 costimulatory signal is required for TCR-mediated T cell activation resulting in increased IL-2 production in vitro, but its role in IL-4 production is unclear and few studies have examined the function of CTLA-4/CD28 in the in vivo immune response. We have examined the in vivo

  17. The association between CTLA-4 (+49 A/G) polymorphism and susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Wu, Jian; Zhang, Liang; Zhou, Yixin

    2016-12-01

    The objective of the present meta-analysis was to investigate whether or not cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) polymorphisms are associated with ankylosing spondylitis (AS) susceptibility. A systematic search was conducted from the PubMed, ENBASE, and Springer link database up to April 2014. Odds ratios (ORs) with 95% confidence intervals (95% CIs) were used to assess the strength of association between CTLA-4 (+49 A/G) and AS risk. A subgroup analysis based on geographic region and a sensitivity analysis were also conducted. Five studies were eligible for meta-analysis, including 918 cases and 845 controls. The results showed that no significant association was found between AS and CTLA-4 (+49 A/G) for the additive model (G vs. A), dominant model (GG + AG vs. AA), co-dominant model (GG vs. AA, AG vs. AA) and recessive model (GG vs. AG + AA). The OR was 1.09 (95% CI, 0.87-1.38), 1.16 (95% CI, 0.89-1.51), 1.05 (95% CI, 0.75-1.46), 1.15 (95% CI, 0.86-1.52) and 0.99 (95% CI, 0.79-1.23), respectively. Although subgroup analysis demonstrated no association between CTLA-4 (+49 A/G) polymorphisms and susceptibility to AS in Europe and Taiwan, an association was found in Iran through both the co-dominant and dominant models. Exclusion of any individual study did not alter the significance of the final outcome, excepting the result by omitting the study by Huang et al. The present results suggest that the CTLA-4 may not be a major susceptibility locus in humans with AS. The relationship between them may be affected by different geographic populations. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

  18. Bioreactor engineering using disposable technology for enhanced production of hCTLA4Ig in transgenic rice cell cultures.

    Science.gov (United States)

    Kwon, Jun-Young; Yang, Yong-Suk; Cheon, Su-Hwan; Nam, Hyung-Jin; Jin, Gi-Hong; Kim, Dong-Il

    2013-09-01

    Two kinds of disposable bioreactors, air-lift disposable bioreactors (ADB) and wave disposable bioreactors (WDB) were compared with stirred-tank reactors (5-L STR). These bioreactors were successfully applied to transgenic rice cell cultures for the production of recombinant human cytotoxic T-lymphocyte antigen 4-immunoglobulin (hCTLA4Ig). In both systems, a fed-batch culture method was used to produce hCTLA4Ig efficiently by feeding concentrated amino acids and production levels were enhanced when dissolved oxygen (DO) level was regulated at 30% using pure oxygen sparging. Agitation and aeration rate during cultivation in ADB and WDB were determined by the same mixing time. The results in both disposable bioreactors showed similar values in maximum cell density (11.9 gDCW/L and 12.6 gDCW/L), doubling time (4.8- and 5.0-day), and maximum hCTLA4Ig concentration (43.7 and 43.3 mg/L). Relatively higher cell viability was sustained in the ADB whereas hCTLA4Ig productivity was 1.2-fold higher than that in WDB. The productivity was improved by increasing aeration rate (0.2 vvm). Overall, our experiments demonstrate pneumatically driven disposable bioreactors are applicable for the production of recombinant proteins in plant cell cultures. These results will be useful for development and scale-up studies of disposable bioreactor systems for transgenic plant cell cultures. Copyright © 2013 Wiley Periodicals, Inc.

  19. An African ancestry-specific allele of CTLA4 confers protection against rheumatoid arthritis in African Americans.

    Directory of Open Access Journals (Sweden)

    James M Kelley

    2009-03-01

    Full Text Available Cytotoxic T-lymphocyte associated protein 4 (CTLA4 is a negative regulator of T-cell proliferation. Polymorphisms in CTLA4 have been inconsistently associated with susceptibility to rheumatoid arthritis (RA in populations of European ancestry but have not been examined in African Americans. The prevalence of RA in most populations of European and Asian ancestry is approximately 1.0%; RA is purportedly less common in black Africans, with little known about its prevalence in African Americans. We sought to determine if CTLA4 polymorphisms are associated with RA in African Americans. We performed a 2-stage analysis of 12 haplotype tagging single nucleotide polymorphisms (SNPs across CTLA4 in a total of 505 African American RA patients and 712 African American controls using Illumina and TaqMan platforms. The minor allele (G of the rs231778 SNP was 0.054 in RA patients, compared to 0.209 in controls (4.462 x 10(-26, Fisher's exact. The presence of the G allele was associated with a substantially reduced odds ratio (OR of having RA (AG+GG genotypes vs. AA genotype, OR 0.19, 95% CI: 0.13-0.26, p = 2.4 x 10(-28, Fisher's exact, suggesting a protective effect. This SNP is polymorphic in the African population (minor allele frequency [MAF] 0.09 in the Yoruba population, but is very rare in other groups (MAF = 0.002 in 530 Caucasians genotyped for this study. Markers associated with RA in populations of European ancestry (rs3087243 [+60C/T] and rs231775 [+49A/G] were not replicated in African Americans. We found no confounding of association for rs231778 after stratifying for the HLA-DRB1 shared epitope, presence of anti-cyclic citrullinated peptide antibody, or degree of admixture from the European population. An African ancestry-specific genetic variant of CTLA4 appears to be associated with protection from RA in African Americans. This finding may explain, in part, the relatively low prevalence of RA in black African populations.

  20. New-onset mediastinal and central nervous system sarcoidosis in a patient with metastatic melanoma undergoing CTLA4 monoclonal antibody treatment.

    LENUS (Irish Health Repository)

    Murphy, Kevin P

    2014-01-01

    Ipilimumab, a cytotoxic monoclonal antibody that inhibits cytotoxic T lymphocyte-associated antigen-4 (CTLA-4), has been established as an effective therapy in the management of advanced melanoma. Immune-mediated adverse events are a common side effect.

  1. Association of CTLA4, CD28 and ICOS gene polymorphisms with ...

    Indian Academy of Sciences (India)

    College of Medicine, Soonchunhyang University, Chunan 336-745, Korea; Kohwang Medical Research Institute, Kyung Hee University, Hoegi-dong #1, Dongdaemoon-gu, Seoul 130-701, Korea; Department of Pediatrics, East West Kidney Diseases Research Institute, Kyung Hee University, Hoegi-dong #1, ...

  2. Association of CTLA4, CD28 and ICOS gene polymorphisms with ...

    Indian Academy of Sciences (India)

    sis, tubular atrophy, and/or global sclerosis found by kidney biopsy as pathologic markers. These pathologic lesions have been known to decrease pressure autoregulation of glomeruli and are the most important findings eventually indicating progression of chronic renal diseases. All the demographic characteristics of the ...

  3. A bispecific protein capable of engaging CTLA-4 and MHCII protects non-obese diabetic mice from autoimmune diabetes.

    Directory of Open Access Journals (Sweden)

    Hongmei Zhao

    Full Text Available Crosslinking ligand-engaged cytotoxic T lymphocyte antigen-4 (CTLA-4 to the T cell receptor (TCR with a bispecific fusion protein (BsB comprised of a mutant mouse CD80 and lymphocyte activation antigen-3 (LAG-3 has been shown to attenuate TCR signaling and to direct T-cell differentiation toward Foxp3(+ regulatory T cells (Tregs in an allogenic mixed lymphocyte reaction (MLR. Here, we show that antigen-specific Tregs can also be induced in an antigen-specific setting in vitro. Treatment of non-obese diabetic (NOD female mice between 9-12 weeks of age with a short course of BsB elicited a transient increase of Tregs in the blood and moderately delayed the onset of autoimmune type 1 diabetes (T1D. However, a longer course of treatment (10 weeks of 4-13 weeks-old female NOD animals with BsB significantly delayed the onset of disease or protected animals from developing diabetes, with only 13% of treated animals developing diabetes by 35 weeks of age compared to 80% of the animals in the control group. Histopathological analysis of the pancreata of the BsB-treated mice that remained non-diabetic revealed the preservation of insulin-producing β-cells despite the presence of different degrees of insulitis. Thus, a bifunctional protein capable of engaging CTLA-4 and MHCII and indirectly co-ligating CTLA-4 to the TCR protected NOD mice from developing T1D.

  4. ZAP-70, CTLA-4 and proximal T cell receptor signaling in cows infected with Mycobacterium avium subsp. paratuberculosis.

    Science.gov (United States)

    Leite, Fernando L; Eslabão, Livia B; Pesch, Bruce; Bannantine, John P; Reinhardt, Timothy A; Stabel, Judith R

    2015-09-15

    Paratuberculosis is a chronic intestinal disease of ruminant animals caused by Mycobacterium avium subsp. paratuberculosis (MAP). A hallmark of paratuberculosis is a transition from a cell-mediated Th1 type response to a humoral Th2 response with the progression of disease from a subclinical to clinical state. The objective of this study was to investigate the expression of two crucial molecules in T cell function, ZAP-70 (zeta-chain-associated protein of 70 kDa) and CTLA-4 (cytotoxic T-lymphocyte antigen-4), in cows naturally infected with MAP. Peripheral blood mononuclear cells (PBMCs) isolated from control non-infected cows (n=5), and cows in subclinical (n=6) and clinical stages of paratuberculosis (n=6) were cultured alone (medium only), and with concanavalin A, and a whole cell sonicate of MAP for 24, 72 and 144 h to measure the dynamic changes of ZAP-70 and CTLA-4 expression on CD4, CD8, and gamma delta (γδ) T cells. Flow cytometry was also performed to measure ZAP-70 phosphorylation to examine proximal T cell receptor signaling in animals of different disease status. The surface expression of CTLA-4 was increased in animals in subclinical stage of infection while levels of ZAP-70 were decreased in CD4+ T cells of both subclinical and clinical animals, indicating a change in T cell phenotype with disease state. Interestingly, proximal T cell receptor signaling was not altered in infected animals. This study demonstrated changes in crucial signaling molecules in animals infected with MAP, thereby elucidating T cell alterations associated with disease progression. Published by Elsevier B.V.

  5. Timing of CSF-1/CSF-1R signaling blockade is critical to improving responses to CTLA-4 based immunotherapy.

    Science.gov (United States)

    Holmgaard, Rikke B; Brachfeld, Alexandra; Gasmi, Billel; Jones, David R; Mattar, Marissa; Doman, Thompson; Murphy, Mary; Schaer, David; Wolchok, Jedd D; Merghoub, Taha

    2016-07-01

    Colony stimulating factor-1 (CSF-1) is produced by a variety of cancers and recruits myeloid cells that suppress antitumor immunity, including myeloid-derived suppressor cells (MDSCs.) Here, we show that both CSF-1 and its receptor (CSF-1R) are frequently expressed in tumors from cancer patients, and that this expression correlates with tumor-infiltration of MDSCs. Furthermore, we demonstrate that these tumor-infiltrating MDSCs are highly immunosuppressive but can be reprogrammed toward an antitumor phenotype in vitro upon CSF-1/CSF-1R signaling blockade. Supporting these findings, we show that inhibition of CSF-1/CSF-1R signaling using an anti-CSF-1R antibody can regulate both the number and the function of MDSCs in murine tumors in vivo. We further find that treatment with anti-CSF-1R antibody induces antitumor T-cell responses and tumor regression in multiple tumor models when combined with CTLA-4 blockade therapy. However, this occurs only when administered after or concurrent with CTLA-4 blockade, indicating that timing of each therapeutic intervention is critical for optimal antitumor responses. Importantly, MDSCs present within murine tumors after CTLA-4 blockade showed increased expression of CSF-1R and were capable of suppressing T cell proliferation, and CSF-1/CSF-1R expression in the human tumors was not reduced after treatment with CTLA-4 blockade immunotherapy. Taken together, our findings suggest that CSF-1R-expressing MDSCs can be targeted to modulate the tumor microenvironment and that timing of CSF-1/CSF-1R signaling blockade is critical to improving responses to checkpoint based immunotherapy. Infiltration by immunosuppressive myeloid cells contributes to tumor immune escape and can render patients resistant or less responsive to therapeutic intervention with checkpoint blocking antibodies. Our data demonstrate that blocking CSF-1/CSF-1R signaling using a monoclonal antibody directed to CSF-1R can regulate both the number and function of tumor

  6. CTLA-4 regulates expansion and differentiation of Th1 cells following induction of peripheral T cell tolerance.

    Science.gov (United States)

    Eagar, Todd N; Turley, Danielle M; Padilla, Josette; Karandikar, Nitin J; Tan, Litjen; Bluestone, Jeffrey A; Miller, Stephen D

    2004-06-15

    Intravenous treatment with Ag (peptide)-coupled, ethylene carbodiimide-fixed syngeneic splenocytes (Ag-SP) is a powerful method to induce anergy in vitro and peripheral T cell tolerance in vivo. In this study, we examined the effects of Ag-SP administration on T cell activity ex vivo and in vivo using OVA-specific DO11.10 TCR transgenic T cells. Although treatment with OVA323-339-SP resulted in a strong inhibition of peptide-specific T cell recall responses in vitro, examination of the immediate effects of Ag-SP treatment on T cells in vivo demonstrated that tolerogen injection resulted in rapid T cell activation and proliferation. Although there was an increase in the number of OVA-specific DO11.10 T cells detected in the lymphoid organs, these previously tolerized T cells were strongly inhibited in mounting proliferative or inflammatory responses upon rechallenge in vivo with peptide in CFA. This unresponsiveness was reversible by treatment with anti-CTLA-4 mAb. These results are consistent with the hypothesis that Ag-SP injection induces a state of T cell anergy that is maintained by CTLA-4 engagement.

  7. CTLA4-Ig suppresses development of experimental autoimmune uveitis in the induction and effector phases: Comparison with blockade of interleukin-6.

    Science.gov (United States)

    Iwahashi, Chiharu; Fujimoto, Minoru; Nomura, Shintaro; Serada, Satoshi; Nakai, Kei; Ohguro, Nobuyuki; Nishida, Kohji; Naka, Tetsuji

    2015-11-01

    Recently, a number of biologics have been used in the treatment of autoimmune diseases. However, in the treatment of severe autoimmune uveitis, only TNF-alpha inhibitors are preferably used and the effect of other biologics such as interleukin-6 (IL-6) signaling blockade or cytotoxic T-lymphocyte antigen-4-immunoglobulin fusion protein (CTLA4-Ig) has not been well studied. Previously, we reported that IL-6 blockade effectively suppresses the development of experimental autoimmune uveitis (EAU), a mouse model for uveitis, by inhibiting Th17 cell development. In this study, we investigated the effect of CTLA4-Ig on EAU development and compared it with the effect of anti-IL-6 receptor monoclonal antibody (MR16-1). C57BL/6J mice were immunized with interphotoreceptor retinoid-binding protein (IRBP) and treated once with CTLA4-Ig or MR16-1. Both CTLA4-Ig and MR16-1 administered in the induction phase (the same day as immunization) significantly reduced the clinical and histopathological scores of EAU. Fluorescence-activated cell sorting studies using draining lymph node (LN) cells from EAU mice 10 days after immunization showed that CTLA4-Ig can suppress early T-helper cell activation. CTLA4-Ig administered in the effector phase of the disease (one week after immunization), when IRBP-reactive T cells have been primed, also significantly reduced the clinical and histopathological scores of EAU. In contrast, MR16-1 administered in the effector phase did not ameliorate EAU. To investigate the differences between these biologics in the effector phase, in vitro restimulation analysis of LN cells obtained from EAU mice one week after immunization was performed and revealed that CTLA4-Ig, but not MR16-1, added to culture media could inhibit the proliferation of IRBP-specific CD4(+) T cells which possessed capacities of producing IFN-gamma and/or IL-17. Collectively, CTLA4-Ig ameliorated EAU through preventing initial T-cell activation in the induction phase and suppressing

  8. Evaluation of six CTLA-4 polymorphisms in high-risk melanoma patients receiving adjuvant interferon therapy in the He13A/98 multicenter trial

    Directory of Open Access Journals (Sweden)

    Fountzilas George

    2010-11-01

    Full Text Available ABSTRACT Purpose Interferon is approved for adjuvant treatment of patients with stage IIb/III melanoma. The toxicity and uncertainty regarding survival benefits of interferon have qualified its acceptance, despite significant durable relapse prevention in a fraction of patients. Predictive biomarkers that would enable selection of patients for therapy would have a large impact upon clinical practice. Specific CTLA-4 polymorphisms have previously shown an association with response to CTLA-4 blockade in patients with metastatic melanoma and the development of autoimmunity. Experimental design 286 melanoma patients and 288 healthy controls were genotyped for six CTLA-4 polymorphisms previously suggested to be important (AG 49, CT 318, CT 60, JO 27, JO30 and JO 31. Specific allele frequencies were compared between the healthy and patient populations, as well as presence or absence of these in relation to recurrence. Alleles related to autoimmune disease were also investigated. Results No significant differences were found between the distributions of CTLA-4 polymorphisms in the melanoma population compared with healthy controls. Relapse free survival (RFS and overall survival (OS did not differ significantly between patients with the alleles represented by these polymorphisms. No correlation between autoimmunity and specific alleles was shown. The six polymorphisms evaluated where strongly associated (Fisher's exact p-values Conclusion No polymorphisms of CTLA-4 defined by the SNPs studied were correlated with improved RFS, OS, or autoimmunity in this high-risk group of melanoma patients.

  9. Checkpoint inhibitors in cancer immunotherapy: Cross reactivity of a CTLA-4 antibody and IDO-inhibitor L-1MT in pigs

    DEFF Research Database (Denmark)

    Al-Shatrawi, Zina Adil; Frøsig, Thomas Mørch; Jungersen, Gregers

    -Methyltryptophan (L-1MT) has shown promising results in clinical phase I/II studies of human cancer such as epithelial ovarian cancer. Pre-clinical immune therapeutic studies are usually performed with mice, but Ipilimumab is not reactive with mouse cells. Recent studies indicate that the pig may be a more...... suitable animal model for studies of immune reactivity due to higher similarity of the immunome between pig and man. This study is part of the CANVACPIG project “Accelerating development of vaccines against cancer with pigs as a large animal model” and investigates the reactivity of a fully human...... monoclonal anti CTLA-4 antibody and L-1MT on porcine immune cells. At the genome level, the homology between human and pig CTLA-4 and IDO is 86% and 73%, respectively, while the homology to the mouse is 75% and 63%. Our preliminary in vitro studies indicate that the monoclonal anti CTLA-4 antibody induces...

  10. Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

    Directory of Open Access Journals (Sweden)

    Nahzli Dilek

    Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.

  11. CTLA-4 signaling regulates the intensity of hypersensitivity responses to food antigens, but is not decisive in the induction of sensitization

    NARCIS (Netherlands)

    Wijk, F. van; Hoeks, S.; Nierkens, S.; Koppelman, S.J.; Kooten, P. van; Boon, L.; Knippels, L.M.J.; Pieters, R.

    2005-01-01

    Although food allergy has emerged as a major health problem, the mechanisms that are decisive in the development of sensitization to dietary Ag remain largely unknown. CTLA-4 signaling negatively regulates immune activation, and may play a crucial role in preventing induction and/or progression of

  12. The CD28/CTLA-4-B7 signaling pathway is involved in both allergic sensitization and tolerance induction to orally administered peanut proteins

    NARCIS (Netherlands)

    Wijk, F. van; Nierkens, S.; Jong, W. de; Wehrens, E.J.M.; Boon, L.; Kooten, P. van; Knippels, L.M.J.; Pieters, R.

    2007-01-01

    Dendritic cells are believed to play an essential role in regulating the balance between immunogenic and tolerogenic responses to mucosal Ags by controlling T cell differentiation and activation via costimulatory and coinhibitory signals. The CD28/CTLA-4-CD80/CD86 signaling pathway appears to be one

  13. Cytotoxic T-lymphocyte antigen-4 gene polymorphisms and human T-cell lymphotrophic virus-1 infection: their associations with Hashimoto's thyroiditis in Japanese patients.

    Science.gov (United States)

    Tomoyose, Takeaki; Komiya, Ichiro; Takara, Masaki; Yabiku, Kouichi; Kinjo, Yoshino; Shimajiri, Yoshinori; Yogi, Hiroyuki; Kouki, Tsuyoshi; Masuda, Masato; Takasu, Nobuyuki

    2002-08-01

    Cytotoxic T-lymphocyte antigen-4 (CTLA-4) decreases the immune response of T cells by inactivating the signal that occurs with interaction between CD28 on T cells and B7 on antigen-presenting cells. Gene polymorphisms involving CTLA-4 promoter (-318 C/T), exon 1 (49 A/G), and exon 4 (microsatellite (AT)n) have been linked to Hashimoto's thyroiditis (HT) and other autoimmune diseases. HT also has a reported association with human T-cell lymphotrophic virus-1 (HTLV-1) infection. We investigated the occurrence of CTLA-4 polymorphisms in Japanese patients with HT with and without anti-HTLV-1 antibodies (HTLV-1 Ab). DNA samples from 143 patients with HT and 199 controls were subjected to polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using the restriction enzymes, Bbv 1, Tse 1, and Mse 1. In the HTLV-1 Ab-positive group the exon 1 G allele was more frequent in patients with HT than in controls (67% vs. 53%, p = 0.0377), and in HTLV-1 Ab-negative group it was also frequent in patients with HT than in controls (68% vs. 53%, p = 0.0041). Frequency of the G allele in HT with HTLV-1 Ab was comparable to those without HTLV-1 Ab. Frequency of polymorphism in the promoter did not differ between patients with HT and controls, nor between controls with and without HTLV-1 Ab. HTLV-1 infection is not associated with CTLA-4 polymorphisms in either HT or controls. HTLV-1 infection is not regulated by genetic factor such as CTLA-4, and may affect occurrence of HT as an independent purely environmental factor.

  14. Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4

    Directory of Open Access Journals (Sweden)

    Lacoeuille Yannick

    2011-02-01

    Full Text Available Abstract Background Th2 cell activation and T regulatory cell (Treg deficiency are key features of allergy. This applies for asthma and rhinitis. However with a same atopic background, some patients will develop rhinitis and asthma, whereas others will display rhinitis only. Co-receptors are pivotal in determining the type of T cell activation, but their role in allergic asthma and rhinitis has not been explored. Our objective was to assess whether allergen-induced T cell activation differs from allergic rhinitis to allergic rhinitis with asthma, and explore the role of ICOS, CD28 and CTLA-4. Methods T cell co-receptor and cytokine expressions were assessed by flow cytometry in PBMC from 18 house dust mite (HDM allergic rhinitics (R, 18 HDM allergic rhinitics and asthmatics (AR, 13 non allergic asthmatics (A and 20 controls, with or without anti-co-receptors antibodies. Results In asthmatics (A+AR, a constitutive decrease of CTLA-4+ and of CD4+CD25+Foxp3+ cells was found, with an increase of IFN-γ+ cells. In allergic subjects (R + AR, allergen stimulation induced CD28 together with IL-4 and IL-13, and decreased the proportion of CTLA-4+, IL-10+ and CD4+CD25+Foxp3+ cells. Anti-ICOS and anti-CD28 antibodies blocked allergen-induced IL-4 and IL-13. IL-13 production also involved CTLA-4. Conclusions T cell activation differs between allergic rhinitis and asthma. In asthma, a constitutive, co-receptor independent, Th1 activation and Treg deficiency is found. In allergic rhinitis, an allergen-induced Treg cell deficiency is seen, as well as an ICOS-, CD28- and CTLA-4-dependent Th2 activation. Allergic asthmatics display both characteristics.

  15. Synergistic effects of the immune checkpoint inhibitor CTLA-4 combined with the growth inhibitor lycorine in a mouse model of renal cell carcinoma.

    Science.gov (United States)

    Li, Xiezhao; Xu, Peng; Wang, Chongshan; Xu, Naijin; Xu, Abai; Xu, Yawen; Sadahira, Takuya; Araki, Motoo; Wada, Koichiro; Matsuura, Eiji; Watanabe, Masami; Zheng, Junxia; Sun, Pinghua; Huang, Peng; Nasu, Yasutomo; Liu, Chunxiao

    2017-03-28

    Renal cell carcinoma (RCC) management has undergone a major transformation over the past decade; immune checkpoint inhibitors are currently undergoing clinical trials and show promising results. However, the effectiveness of immune checkpoint inhibitors in patients with metastatic RCC (mRCC) is still limited. Lycorine, an alkaloid extracted from plants of the Amaryllidaceae family, is touted as a potential anti-cancer drug because of its demonstrative growth inhibition capacity (induction of cell cycle arrest and inhibition of vasculogenic mimicry formation). Moreover, T cell checkpoint blockade therapy with antibodies targeting cytotoxic T-lymphocyte associated protein 4 (CTLA-4) has improved outcomes in cancer patients. However, the anti-tumor efficacy of combined lycorine and anti-CTLA-4 therapy remains unknown. Thus, we investigated a combination therapy of lycorine hydrochloride and anti-CTLA-4 using a murine RCC model. As a means of in vitro confirmation, we found that lycorine hydrochloride inhibited the viability of various RCC cell lines. Furthermore, luciferase-expressing Renca cells were implanted in the left kidney and the lung of BALB/c mice to develop a RCC metastatic mouse model. Lycorine hydrochloride and anti-CTLA-4 synergistically decreased tumor weight, lung metastasis, and luciferin-staining in tumor images. Importantly, the observed anti-tumor effects of this combination were dependent on significantly suppressing regulatory T cells while upregulating effector T cells; a decrease in regulatory T cells by 31.43% but an increase in effector T cells by 31.59% were observed in the combination group compared with those in the control group). We suggest that a combination of lycorine hydrochloride and anti-CTLA-4 is a viable therapeutic option for RCC patients.

  16. DNA immunization with fusion of CTLA-4 to hepatitis B virus (HBV core protein enhanced Th2 type responses and cleared HBV with an accelerated kinetic.

    Directory of Open Access Journals (Sweden)

    Ying Yin

    Full Text Available BACKGROUND: Typically, DNA immunization via the intramuscular route induces specific, Th1-dominant immune responses. However, plasmids expressing viral proteins fused to cytotoxic T lymphocyte antigen 4 (CTLA-4 primed Th2-biased responses and were able to induced effective protection against viral challenge in the woodchuck model. Thus, we addressed the question in the mouse model how the Th1/Th2 bias of primed immune responses by a DNA vaccine influences hepatitis B virus (HBV clearance. PRINCIPAL FINDINGS: Plasmids expressing HBV core protein (HBcAg or HBV e antigen and HBcAg fused to the extracellular domain of CTLA-4 (pCTLA-4-HBc, CD27, and full length CD40L were constructed. Immunizations of these DNA plasmids induced HBcAg-specific antibody and cytotoxic T-cell responses in mice, but with different characteristics regarding the titers and subtypes of specific antibodies and intensity of T-cell responses. The plasmid pHBc expressing HBcAg induced an IgG2a-dominant response while immunizations of pCTLA-4-HBc induced a balanced IgG1/IgG2a response. To assess the protective values of the immune responses of different characteristics, mice were pre-immunized with pCTLA-4-HBc and pHBc, and challenged by hydrodynamic injection (HI of pAAV/HBV1.2. HBV surface antigen (HBsAg and DNA in peripheral blood and HBcAg in liver tissue were cleared with significantly accelerated kinetics in both groups. The clearance of HBsAg was completed within 16 days in immunized mice while more than 50% of the control mice are still positive for HBsAg on day 22. Stronger HBcAg-specific T-cell responses were primed by pHBc correlating with a more rapid decline of HBcAg expression in liver tissue, while anti-HBs antibody response developed rapidly in the mice immunized with pCTLA-4-HBc, indicating that the Th1/Th2 bias of vaccine-primed immune responses influences the mode of viral clearance. CONCLUSION: Viral clearance could be efficiently achieved by Th1/Th2-balanced

  17. CTLA-4 polymorphisms and haplotype correlate with survival in ALL after allogeneic stem cell transplantation from related HLA-haplotype-mismatched donor.

    Science.gov (United States)

    Qin, X-Y; Wang, Y; Li, G-X; Qin, Y-Z; Wang, F-R; Xu, L-P; Chen, H; Han, W; Wang, J-Z; Zhang, X-H; Chang, Y-J; Liu, K-Y; Jiang, Z-F; Huang, X-J

    2016-04-27

    Allogeneic hematopoietic stem cell transplantation (allo-HSCT) has been established as an effective treatment for patients with hematological malignancies. Disease relapse remains a major cause of transplant failure. T cell homeostasis is critical to determine the potency of the GVT effect. Recent studies have shown the association of the CTLA-4 polymorphisms with the outcome after HLA-identical sibling allogeneic HSCT. In this study, we focused on four CTLA-4 polymorphisms, and analyzed the impact of donor genotypes and haplotypes on the conditions of 152 acute leukemia patients (ALL 83) after related HLA-haplotype- mismatched transplantation. The four SNP genotypes (-1661, -318, CT60 and +49) were determined by TaqMan SNP genotyping assays. ALL recipients of donors with +49 GG showed significantly lower OS (67.7 vs. 90.3 %, P = 0.015) than those with GA+AA. Multivariate analyses showed that +49 GG was an independent risk factor for OS (HR: 0.306, 95 % CI 0.111-0.842, P = 0.022) .23 ALL patients receiving mDLI showed significantly lower OS with +49 GG donor than those with GA+AA (30.0 vs. 83.1 %, P = 0.003). The haplotype analysis revealed only three haplotypes in the donor population -1661/-318/CT60/+49 i.e., ACGG, ACAA and GTGA, the frequencies were 64.1, 19.4 and 16.5 %, respectively. Donors with and without the ACGG/ACGG haplotype had the same effect on transplant outcomes as those with +49 GG and +49 GA+AA. In summary, the CTLA-4 +49 GG and the haplotype ACGG/ACGG reduced the overall survival in ALL after allo-HSCT from the related HLA-haplotype-mismatched donor, knowledge of the CTLA-4 polymorphism and haplotype may provide useful information for donor selection and individual application of immunosuppressive agents and immunotherapy.

  18. Multicenter Evaluation of the Tolerability of Combined Treatment With PD-1 and CTLA-4 Immune Checkpoint Inhibitors and Palliative Radiation Therapy.

    Science.gov (United States)

    Bang, Andrew; Wilhite, Tyler J; Pike, Luke R G; Cagney, Daniel N; Aizer, Ayal A; Taylor, Allison; Spektor, Alexander; Krishnan, Monica; Ott, Patrick A; Balboni, Tracy A; Hodi, F Stephen; Schoenfeld, Jonathan D

    2017-06-01

    To analyze immune-related adverse events (ir-AEs) in patients treated with radiation and immune checkpoint blockade. We retrospectively reviewed records from patients with metastatic non-small cell lung cancer, melanoma, or renal cell cancer who received at least 1 cycle of a CTLA-4 or PD-1 inhibitor and radiation. Immune-related adverse events, defined using Common Terminology Criteria for Adverse Events version 4.0, were tabulated in relation to treatment variables, and associations with sequencing and timing were assessed. We identified 133 patients, of whom 28 received a CTLA-4 inhibitor alone, 88 received a PD-1 inhibitor alone, and 17 received both classes of inhibitors either sequentially (n=13) or concurrently (n=4). Fifty-six patients received radiation within 14 days of an immune checkpoint inhibitor. Forty-six patients experienced at least 1 ir-AE (34.6%). Patients receiving both CTLA-4 and PD-1 inhibitors experienced more any-grade ir-AEs as compared with either individually (71% vs 29%, P=.0008). Any-grade ir-AEs occurred in 39% of patients in whom radiation was administered within 14 days of immunotherapy, compared with 23% of other patients (P=.06) and more often in patients who received higher equivalent dose in 2-Gy fractions (EQD2) EQD2 (P=.01). However, most toxicities were mild. There were no associations between site irradiated and specific ir-AEs. Our data suggest the combination of focal palliative radiation and CTLA-4 and/or PD-1 inhibitors is well tolerated, with manageable ir-AEs that did not seem to be associated with the particular site irradiated. Although conclusions are limited by the heterogeneity of patients and treatments, and future confirmatory studies are needed, this information can help guide clinical practice for patients receiving immune checkpoint therapy who require palliative radiation therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Multicenter Evaluation of the Tolerability of Combined Treatment With PD-1 and CTLA-4 Immune Checkpoint Inhibitors and Palliative Radiation Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Bang, Andrew [Department of Radiation Oncology, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Division of Radiation Oncology, University of Ottawa, Ottawa, Ontario (Canada); Wilhite, Tyler J. [Harvard Medical School, Boston, Massachusetts (United States); Pike, Luke R.G. [Harvard Radiation Oncology Program, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Cagney, Daniel N.; Aizer, Ayal A.; Taylor, Allison; Spektor, Alexander; Krishnan, Monica [Department of Radiation Oncology, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Ott, Patrick A. [Department of Medical Oncology and Center for Immuno-Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Balboni, Tracy A. [Department of Radiation Oncology, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Hodi, F. Stephen [Department of Medical Oncology and Center for Immuno-Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Schoenfeld, Jonathan D., E-mail: jdschoenfeld@partners.org [Department of Radiation Oncology, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States)

    2017-06-01

    Purpose: To analyze immune-related adverse events (ir-AEs) in patients treated with radiation and immune checkpoint blockade. Methods and Materials: We retrospectively reviewed records from patients with metastatic non-small cell lung cancer, melanoma, or renal cell cancer who received at least 1 cycle of a CTLA-4 or PD-1 inhibitor and radiation. Immune-related adverse events, defined using Common Terminology Criteria for Adverse Events version 4.0, were tabulated in relation to treatment variables, and associations with sequencing and timing were assessed. Results: We identified 133 patients, of whom 28 received a CTLA-4 inhibitor alone, 88 received a PD-1 inhibitor alone, and 17 received both classes of inhibitors either sequentially (n=13) or concurrently (n=4). Fifty-six patients received radiation within 14 days of an immune checkpoint inhibitor. Forty-six patients experienced at least 1 ir-AE (34.6%). Patients receiving both CTLA-4 and PD-1 inhibitors experienced more any-grade ir-AEs as compared with either individually (71% vs 29%, P=.0008). Any-grade ir-AEs occurred in 39% of patients in whom radiation was administered within 14 days of immunotherapy, compared with 23% of other patients (P=.06) and more often in patients who received higher equivalent dose in 2-Gy fractions (EQD2) EQD2 (P=.01). However, most toxicities were mild. There were no associations between site irradiated and specific ir-AEs. Conclusions: Our data suggest the combination of focal palliative radiation and CTLA-4 and/or PD-1 inhibitors is well tolerated, with manageable ir-AEs that did not seem to be associated with the particular site irradiated. Although conclusions are limited by the heterogeneity of patients and treatments, and future confirmatory studies are needed, this information can help guide clinical practice for patients receiving immune checkpoint therapy who require palliative radiation therapy.

  20. Safety and clinical activity of combined PD-1 (nivolumab) and CTLA-4 (ipilimumab) blockade in advanced melanoma patients

    Science.gov (United States)

    Wolchok, Jedd D.; Kluger, Harriet; Callahan, Margaret K.; Postow, Michael A.; Rizvi, Naiyer A.; Lesokhin, Alexander M.; Segal, Neil H.; Ariyan, Charlotte E.; Gordon, Ruth-Ann; Reed, Kathleen; Burke, Matthew M.; Caldwell, Anne; Kronenberg, Stephanie A.; Agunwamba, Blessing U.; Zhang, Xiaoling; Lowy, Israel; Inzunza, Hector David; Feely, William; Horak, Christine E.; Hong, Quan; Korman, Alan J.; Wigginton, Jon M.; Gupta, Ashok; Sznol, Mario

    2017-01-01

    Background In patients with melanoma, ipilimumab (anti-CTLA-4) prolongs overall survival and nivolumab (anti-PD-1) produced durable tumor regressions in a phase 1 trial. Based on their distinct immunologic mechanisms of action and supportive preclinical data, we conducted a phase 1 trial of nivolumab combined with ipilimumab in advanced melanoma patients. Methods Patients received nivolumab and ipilimumab every 3 weeks for 4 doses, followed by nivolumab alone every 3 weeks for 4 doses (concurrent regimen). Combined treatment was subsequently continued every 12 weeks for up to 8 doses. In a sequenced regimen, patients previously treated with ipilimumab received nivolumab every 2 weeks. Results Fifty-three patients received concurrent nivolumab/ipilimumab and 33 received sequenced treatment. The objective response rate, for all concurrent-regimen patients was 40% (modified WHO criteria). Evidence of clinical activity (conventional, unconfirmed, or immune-related response or stable disease ≥24 weeks) was observed in 65% of patients. At the maximum tolerated dose (1 mg/kg nivolumab + 3 mg/kg ipilimumab), 53% of patients achieved an objective response, all with ≥80% tumor reduction. Grade 3–4 related adverse events occurred in 53% of concurrent-regimen patients, but were qualitatively similar to historical monotherapy experience and were generally reversible. Among sequenced-regimen patients, 18% had grade 3–4 related adverse events and the objective response rate was 20%. Conclusions Concurrent nivolumab/ipilimumab had a manageable safety profile and achieved clinical activity that is distinct from published monotherapy data, with rapid and deep tumor regressions in a substantial number of patients. PMID:23724867

  1. Treatment of transplanted CT26 tumour with dendritic cell vaccine in combination with blockade of vascular endothelial growth factor receptor 2 and CTLA-4

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Buus, S; Claesson, M H

    2005-01-01

    We investigated the anti CT26 tumour effect of dendritic cell based vaccination with the MuLV gp70 envelope protein-derived peptides AH1 and p320-333. Vaccination lead to generation of AH1 specific cytotoxic lymphocytes (CTL) and some decrease in tumour growth of simultaneously inoculated CT26...... cells. After combination with an antibody against VEGF receptor 2 (DC101), a significant increase in survival of the tumour cell recipients was observed. Also, monotherapy with an antibody against CTLA-4 (9H10), led to approximately 100% survival of tumour cell recipients. However, effective treatment...

  2. Adenoviral vaccination combined with CD40 stimulation and CTLA-4 blockage can lead to complete tumor regression in a murine melanoma model

    DEFF Research Database (Denmark)

    Sørensen, Maria Rathmann; Holst, Peter J; Steffensen, Maria Abildgaard

    2010-01-01

    Therapeutic vaccination with replication deficient adenovirus expressing a viral antigen linked to invariant chain was recently found to markedly delay the growth of B16.F10 melanomas expressing the same antigen; however, complete regression of the tumors was never observed. Here we show...... that the delay in tumor growth can be converted to complete regression and long-term survival in 30-40% of the mice by a booster vaccination plus combinational treatment with agonistic anti-CD40 monoclonal antibodies (mAb) and anti-CTLA-4 mAb. Regarding the mechanism underlying the improved clinical effect...

  3. IL-2-Mediated In Vivo Expansion of Regulatory T Cells Combined with CD154–CD40 Co-Stimulation Blockade but Not CTLA-4 Ig Prolongs Allograft Survival in Naive and Sensitized Mice

    Directory of Open Access Journals (Sweden)

    Dela Golshayan

    2017-04-01

    Full Text Available In recent years, regulatory T cells (Treg-based immunotherapy has emerged as a promising strategy to promote operational tolerance after solid organ transplantation (SOT. However, a main hurdle for the therapeutic use of Treg in transplantation is their low frequency, particularly in non-lymphopenic hosts. We aimed to expand Treg directly in vivo and determine their efficacy in promoting donor-specific tolerance, using a stringent experimental model. Administration of the IL-2/JES6-1 immune complex at the time of transplantation resulted in significant expansion of donor-specific Treg, which suppressed alloreactive T cells. IL-2-mediated Treg expansion in combination with short-term CD154–CD40 co-stimulation blockade, but not CTLA-4 Ig or rapamycin, led to tolerance to MHC-mismatched skin grafts in non-lymphopenic mice, mainly by hindering alloreactive CD8+ effector T cells and the production of alloantibodies. Importantly, this treatment also allowed prolonged survival of allografts in the presence of either donor-specific or cross-reactive memory cells. However, late rejection occurred in sensitized hosts, partly mediated by activated B cells. Overall, these data illustrate the potential but also some important limitations of Treg-based therapy in clinical SOT as well as the importance of concomitant immunomodulatory strategies in particular in sensitized hosts.

  4. Ctla-4 modulates the differentiation of inducible Foxp3+ Treg cells but IL-10 mediates their function in experimental autoimmune encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Johan Verhagen

    Full Text Available In vitro induced Foxp3+ T regulatory (iTreg cells form a novel and promising target for therapeutic tolerance induction. However, the potential of these cells as a target for the treatment of various immune diseases, as well as the factors involved in their development and function, remain debated. Here, we demonstrate in a myelin basic protein (MBP-specific murine model of CNS autoimmune disease that adoptive transfer of antigen-specific iTreg cells ameliorates disease progression. Moreover, we show that the co-stimulatory molecule CTLA-4 mediates in vitro differentiation of iTreg cells. Finally, we demonstrate that the secreted, immunosuppressive cytokine IL-10 controls the ability of antigen-specific iTreg cells to suppress autoimmune disease. Overall, we conclude that antigen-specific iTreg cells, which depend on various immune regulatory molecules for their differentiation and function, represent a major target for effective immunotherapy of autoimmune disease.

  5. Tolerogenic responses of CD206+, CD83+, FOXP3+, and CTLA-4 to sericin/polyvinyl alcohol/glycerin scaffolds relevant to IL-33 and HSP60 activity.

    Science.gov (United States)

    Ampawong, Sumate; Aramwit, Pornanong

    2016-09-01

    Silk sericin-releasing (sericin/polyvinyl alcohol (PVA)/glycerin) scaffolds have been designed for wound dressing applications using different fabrication techniques that influence scaffold antigenicity. The immunological tolerance of scaffolds depends on the balance of immunogenic and tolerogenic responses modulated by dendritic cells (DCs). An in vivo skin implantation model was used to compare the tolerogenic effect of sericin/PVA/glycerin scaffolds prepared by freeze-drying versus salt-leaching techniques, using an Allevyn® scaffold as a control. Immunohistochemical and histopathological studies were performed to evaluate tolerogenic DCs (CD206+), immunogenic DCs (CD83+), regulatory T-cells (FOXP3+ and CTLA-4), a proinflammatory cytokine (interleukin 33: IL-33), a stress marker (heat shock protein 60; HSP60), histopathological changes and related inflammatory cells. It was found that both sericin/PVA/glycerin scaffolds were tolerogenic and induced early activated Treg functions, while the Allevyn® scaffold was immunogenic. However, the tolerance of the freeze-dried sericin/PVA/glycerin scaffolds was not as consistent as the salt-leached sericin/PVA/glycerin scaffolds, indicated by the low level of CTLA-4 expression. This was probably due to molecular cross-linking and the morphological and mechanical properties of the freeze-drying technique, which would enhance the immune response. Severe inflammatory responses (including mast cell degranulation and foreign body giant cell accumulation) and histopathological changes (including fat infiltration and fibrosis formation) were mainly found with the Allevyn® scaffold, presumably from its architecture and chemical composition, especially polyurethane. The up-regulation of IL-33 and HSP60 with the Allevyn® scaffold was correlated with the inflammatory and pathological levels. Our findings suggested that salt-leached sericin/PVA/glycerin scaffolds were tolerogenic, induced a low inflammatory response and were

  6. The availability of a functional tumor targeting T-cell repertoire determines the anti-tumor efficiency of combination therapy with anti-CTLA-4 and anti-4-1BB antibodies

    DEFF Research Database (Denmark)

    Jensen, Benjamin Anderschou Holbech; Pedersen, Sara Ram; Christensen, Jan Pravsgaard

    2013-01-01

    It has previously been found that combination therapy with anti-CTLA-4 and anti-4-1BB antibodies may enhance tumor immunity. However, this treatment is not efficient against all tumors, and it has been suggested that variations in tumor control may reflect differences in the immunogenicity...

  7. Nucleosomal promoter variation generates gene expression noise.

    Science.gov (United States)

    Brown, Christopher R; Boeger, Hinrich

    2014-12-16

    Gene product molecule numbers fluctuate over time and between cells, confounding deterministic expectations. The molecular origins of this noise of gene expression remain unknown. Recent EM analysis of single PHO5 gene molecules of yeast indicated that promoter molecules stochastically assume alternative nucleosome configurations at steady state, including the fully nucleosomal and nucleosome-free configuration. Given that distinct configurations are unequally conducive to transcription, the nucleosomal variation of promoter molecules may constitute a source of gene expression noise. This notion, however, implies an untested conjecture, namely that the nucleosomal variation arises de novo or intrinsically (i.e., that it cannot be explained as the result of the promoter's deterministic response to variation in its molecular surroundings). Here, we show--by microscopically analyzing the nucleosome configurations of two juxtaposed physically linked PHO5 promoter copies--that the configurational variation, indeed, is intrinsically stochastic and thus, a cause of gene expression noise rather than its effect.

  8. Radiotherapy-Induced Anti-Tumor Immunity Contributes to the Therapeutic Efficacy of Irradiation and Can Be Augmented by CTLA-4 Blockade in a Mouse Model

    Science.gov (United States)

    Yoshimoto, Yuya; Suzuki, Yoshiyuki; Mimura, Kousaku; Ando, Ken; Oike, Takahiro; Sato, Hiro; Okonogi, Noriyuki; Maruyama, Takanori; Izawa, Shinichiro; Noda, Shin-ei; Fujii, Hideki; Kono, Koji; Nakano, Takashi

    2014-01-01

    Purpose There is growing evidence that tumor-specific immune responses play an important role in anti-cancer therapy, including radiotherapy. Using mouse tumor models we demonstrate that irradiation-induced anti-tumor immunity is essential for the therapeutic efficacy of irradiation and can be augmented by modulation of cytotoxic T lymphocyte (CTL) activity. Methods and Materials C57BL/6 mice, syngeneic EL4 lymphoma cells, and Lewis lung carcinoma (LL/C) cells were used. Cells were injected into the right femurs of mice. Ten days after inoculation, tumors were treated with 30 Gy of local X-ray irradiation and their growth was subsequently measured. The effect of irradiation on tumor growth delay (TGD) was defined as the time (in days) for tumors to grow to 500 mm3 in the treated group minus that of the untreated group. Cytokine production and serum antibodies were measured by ELISA and flow cytometry. Results In the EL4 tumor model, tumors were locally controlled by X-ray irradiation and re-introduced EL4 cells were completely rejected. Mouse EL4-specific systemic immunity was confirmed by splenocyte cytokine production and detection of tumor-specific IgG1 antibodies. In the LL/C tumor model, X-ray irradiation also significantly delayed tumor growth (TGD: 15.4 days) and prolonged median survival time (MST) to 59 days (versus 28 days in the non-irradiated group). CD8(+) cell depletion using an anti-CD8 antibody significantly decreased the therapeutic efficacy of irradiation (TGD, 8.7 days; MST, 49 days). Next, we examined whether T cell modulation affected the efficacy of radiotherapy. An anti-CTLA-4 antibody significantly increased the anti-tumor activity of radiotherapy (TGD was prolonged from 13.1 to 19.5 days), while anti-FR4 and anti-GITR antibodies did not affect efficacy. Conclusions Our results indicate that tumor-specific immune responses play an important role in the therapeutic efficacy of irradiation. Immunomodulation, including CTLA-4 blockade, may be a

  9. Radiotherapy-induced anti-tumor immunity contributes to the therapeutic efficacy of irradiation and can be augmented by CTLA-4 blockade in a mouse model.

    Directory of Open Access Journals (Sweden)

    Yuya Yoshimoto

    Full Text Available PURPOSE: There is growing evidence that tumor-specific immune responses play an important role in anti-cancer therapy, including radiotherapy. Using mouse tumor models we demonstrate that irradiation-induced anti-tumor immunity is essential for the therapeutic efficacy of irradiation and can be augmented by modulation of cytotoxic T lymphocyte (CTL activity. METHODS AND MATERIALS: C57BL/6 mice, syngeneic EL4 lymphoma cells, and Lewis lung carcinoma (LL/C cells were used. Cells were injected into the right femurs of mice. Ten days after inoculation, tumors were treated with 30 Gy of local X-ray irradiation and their growth was subsequently measured. The effect of irradiation on tumor growth delay (TGD was defined as the time (in days for tumors to grow to 500 mm3 in the treated group minus that of the untreated group. Cytokine production and serum antibodies were measured by ELISA and flow cytometry. RESULTS: In the EL4 tumor model, tumors were locally controlled by X-ray irradiation and re-introduced EL4 cells were completely rejected. Mouse EL4-specific systemic immunity was confirmed by splenocyte cytokine production and detection of tumor-specific IgG1 antibodies. In the LL/C tumor model, X-ray irradiation also significantly delayed tumor growth (TGD: 15.4 days and prolonged median survival time (MST to 59 days (versus 28 days in the non-irradiated group. CD8(+ cell depletion using an anti-CD8 antibody significantly decreased the therapeutic efficacy of irradiation (TGD, 8.7 days; MST, 49 days. Next, we examined whether T cell modulation affected the efficacy of radiotherapy. An anti-CTLA-4 antibody significantly increased the anti-tumor activity of radiotherapy (TGD was prolonged from 13.1 to 19.5 days, while anti-FR4 and anti-GITR antibodies did not affect efficacy. CONCLUSIONS: Our results indicate that tumor-specific immune responses play an important role in the therapeutic efficacy of irradiation. Immunomodulation, including CTLA-4

  10. The price of tumor control: an analysis of rare side effects of anti-CTLA-4 therapy in metastatic melanoma from the ipilimumab network.

    Directory of Open Access Journals (Sweden)

    Caroline J Voskens

    Full Text Available Ipilimumab, a cytotoxic T-lymphocyte antigen-4 (CTLA-4 blocking antibody, has been approved for the treatment of metastatic melanoma and induces adverse events (AE in up to 64% of patients. Treatment algorithms for the management of common ipilimumab-induced AEs have lead to a reduction of morbidity, e.g. due to bowel perforations. However, the spectrum of less common AEs is expanding as ipilimumab is increasingly applied. Stringent recognition and management of AEs will reduce drug-induced morbidity and costs, and thus, positively impact the cost-benefit ratio of the drug. To facilitate timely identification and adequate management data on rare AEs were analyzed at 19 skin cancer centers.Patient files (n = 752 were screened for rare ipilimumab-associated AEs. A total of 120 AEs, some of which were life-threatening or even fatal, were reported and summarized by organ system describing the most instructive cases in detail. Previously unreported AEs like drug rash with eosinophilia and systemic symptoms (DRESS, granulomatous inflammation of the central nervous system, and aseptic meningitis, were documented. Obstacles included patientś delay in reporting symptoms and the differentiation of steroid-induced from ipilimumab-induced AEs under steroid treatment. Importantly, response rate was high in this patient population with tumor regression in 30.9% and a tumor control rate of 61.8% in stage IV melanoma patients despite the fact that some patients received only two of four recommended ipilimumab infusions. This suggests that ipilimumab-induced antitumor responses can have an early onset and that severe autoimmune reactions may reflect overtreatment.The wide spectrum of ipilimumab-induced AEs demands doctor and patient awareness to reduce morbidity and treatment costs and true ipilimumab success is dictated by both objective tumor responses and controlling severe side effects.

  11. Site-directed in vitro immunization leads to a complete human monoclonal IgG4λ that binds specifically to the CDR2 region of CTLA-4 (CD152 without interfering the engagement of natural ligands

    Directory of Open Access Journals (Sweden)

    Hsu Shu-Ching

    2007-08-01

    Full Text Available Abstract Background The ability to acquire fully human monoclonal antibodies (mAbs with pre-defined specificities is critical to the development of molecular tags for the analysis of receptor function in addition to promising immunotherapeutics. Yet most of the arriving affinity maturated and complete human immunoglobulin G (IgG molecules, which are actually derived from single human B cells, have not widely been used to study the conserved self antigens (Ags such as CD152 (cytotoxic T lymphocyte antigen-4, CTLA-4 because proper hosts are lacking. Results Here we developed an optimized protocol for site-directed in vitro immunizing peripheral blood mononuclear cells (PBMC by using a selected epitope of human CD152, an essential receptor involved in down-regulation of T cell activation. The resultant stable trioma cell lines constantly produce anti-CD152 mAb (γ4λhuCD152, which contains variable (V regions of the heavy chain and the light chain derived from the VH3 and Vλ human germline genes, respectively, and yet displays an unusual IgG4 isotype. Interestingly, γ4λhuCD152 has a basic pI not commonly found in myeloid monoclonal IgG4λs as revealed by the isoelectric focusing (IEF analysis. Furthermore, γ4λhuCD152 binds specifically, with nanomolar affinity, to an extracellular constituency encompassing the putative second complementarity determining region (CDR2 of CD152, whereby it can react to activated CD3+ cells. Conclusion In a context of specific cell depletion and conditioned medium,in vitro induction of human Abs against a conserved self Ag was successfully acquired and a relatively basic mAb, γ4λhuCD152, with high affinity to CDR2 of CD152 was thus obtained. Application of such a human IgG4λ mAb with designated CDR2 specificity may impact upon and prefer for CD152 labeling both in situ and ex situ, as it does not affect the binding of endogenous B7 ligands and can localize into the confined immunological synapse which may

  12. Safety of resuming anti-PD-1 in patients with immune-related adverse events (irAEs) during combined anti-CTLA-4 and anti-PD1 in metastatic melanoma.

    Science.gov (United States)

    Pollack, M H; Betof, A; Dearden, H; Rapazzo, K; Valentine, I; Brohl, A S; Ancell, K K; Long, G V; Menzies, A M; Eroglu, Z; Johnson, D B; Shoushtari, A N

    2018-01-01

    Combined cytotoxic T-lymphocyte antigen 4 (CTLA-4) and programmed death 1 (PD-1) blockade induces high rates of immune-related adverse events (irAEs). The safety of resuming anti-PD-1 in patients who discontinue combination therapy due to irAEs is not known. We assessed patients who experienced clinically significant irAEs from combined CTLA-4 and PD-1 blockade leading to treatment discontinuation at four academic centers. We assessed the safety of resuming anti-PD-1 in terms of recurrent and distinct irAEs. Eighty patients discontinued combination therapy due to irAEs, including colitis (41%), hepatitis (36%), and pneumonitis (4%). Of these, 96% received corticosteroids and 21% received additional immunosuppression (e.g. infliximab). All were rechallenged with anti-PD-1, and 14 (18%) had recurrent irAEs at a median of 14 days after therapy resumption (six grade 1-2, seven grade 3-4, and one grade 5 Steven-Johnson Syndrome). Colitis was less likely to recur than other irAEs (6% versus 28%, P = 0.01). Clinically significant but distinct toxicities occurred in an additional 17 (21%) patients (11 grade 1-2 and 6 grade 3-4). Duration of steroid taper, severity of initial irAEs and use of additional immunosuppressants did not predict for toxicity on rechallenge, although patients remaining on steroid therapy at anti-PD-1 resumption had higher rates of toxicities (55% versus 31%, P = 0.03). Patients who discontinued CTLA-4/PD-1 blockade for severe irAEs had relatively high rates of recurrent or distinct toxicities with anti-PD-1 resumption. However, many patients, particularly with combination-induced colitis, tolerated anti-PD-1 rechallenge well, and this approach can be considered in selected patients.

  13. The human tyrosine hydroxylase gene promoter.

    Science.gov (United States)

    Kessler, Mark A; Yang, Ming; Gollomp, Kandace L; Jin, Hao; Iacovitti, Lorraine

    2003-04-10

    13.329 kilobases of the single copy human tyrosine hydroxylase (hTH) gene were isolated from a genomic library. The 5' flanking 11 kilobases fused to the reporter green fluorescent protein (GFP) drove high level expression in TH+ cells of the substantia nigra of embryonic and adult transgenic mice as determined by double label fluorescence microscopy. To provide a basis for future analysis of polymorphisms and structure-function studies, the previously unreported distal 10.5 kilobases of the hTH promoter were sequenced with an average coverage of 20-fold, the remainder with 4-fold coverage. Sequence features identified included four perfect matches to the bicoid binding element (BBE, consensus: BBTAATCYV) all of which exhibited specific binding by electrophoretic mobility shift assay (EMSA). Comparison to published sequences of mouse and rat TH promoters revealed five areas of exceptional homology shared by these species in the upstream TH promoter region -2 kb to -9 kb relative to the transcription start site. Within these conserved regions (CRs I-V), potential recognition sites for NR4A2 (Nurr1), HNF-3beta, HOXA4, and HOXA5 were shared across human, mouse, and rat TH promoters.

  14. Correlation between RAGE gene promoter methylation and diabetic retinal inflammation.

    Science.gov (United States)

    Kan, Shifeng; Wu, Jing; Sun, Chengxi; Hao, Jing; Wu, Zhen

    2018-01-01

    The methylation status of the receptor for advanced glycation end products (RAGE) gene promoter in peripheral blood mononuclear cells (PBMCs) of type 2 diabetic retinopathy (DR) patients was evaluated to investigate the correlation between RAGE gene promoter methylation and diabetic retinal inflammation. Eighty patients admitted and diagnosed as type 2 DR in Qilu Hospital, Shandong University during the period from October, 2013 to October, 2015 were enrolled in this study. They were the observation group and 40 healthy subjects were enrolled in the control group. PBMCs were collected from patients using density gradient centrifugation, and the methylation status of RAGE gene promoters was detected using methylation-specific PCP (MSP). Interleukin-1β (IL-1β), IL-6 and tumor necrosis factor-α (TNF-α) levels of in the serum were measured using enzyme-linked immunosorbent assay (ELISA). PBMCs in patients with positive RAGE gene promoter methylation were isolated and cultured and RAGE gene promoter methylation was inhibited using the demethylating agent, 5'-aza-2'-deoxycytidine (5-aza-dC). The methylation status of RAGE gene promoters in PBMCs was detected via MSP. IL-1β, IL-6 and TNF-α levels in the supernatant of PBMC culture solution were evaluated using ELISA. MSP results showed that there were 26 cases (32.50%) of RAGE gene promoter methylation in PBMCs in DR patients. RAGE gene promoters were methylated in all normal healthy subjects. IL-1β, IL-6 and TNF-α levels in serum for positive RAGE gene promoter methylation group were significantly lower than those in negative RAGE gene promoter methylation group (pRAGE gene promoter methylation of PBMCs in patients with positive RAGE gene promoter methylation. The inhibition of methylation in RAGE gene promoter increased the levels of IL-1β, IL-6 and TNF-α in supernatant of culture solution. In conclusion, RAGE gene promoter hypomethylation was detected in DR patients, indicating that RAGE gene promoter

  15. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene ...

  16. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Gene expression is a complex multi-step process. For the efficient expression of foreign genes in plants, it is essential to optimize every step of the process for the plant machinery, which includes choosing suitable promoters. Promoters play the most important role in determining the temporal and spatial expression pattern ...

  17. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  18. Identifying promoters for gene expression in Clostridium thermocellum

    Directory of Open Access Journals (Sweden)

    Daniel G. Olson

    2015-12-01

    Full Text Available A key tool for metabolic engineering is the ability to express heterologous genes. One obstacle to gene expression in non-model organisms, and especially in relatively uncharacterized bacteria, is the lack of well-characterized promoters. Here we test 17 promoter regions for their ability to drive expression of the reporter genes β-galactosidase (lacZ and NADPH-alcohol dehydrogenase (adhB in Clostridium thermocellum, an important bacterium for the production of cellulosic biofuels. Only three promoters have been commonly used for gene expression in C. thermocellum, gapDH, cbp and eno. Of the new promoters tested, 2638, 2926, 966 and 815 showed reliable expression. The 2638 promoter showed relatively higher activity when driving adhB (compared to lacZ, and the 815 promoter showed relatively higher activity when driving lacZ (compared to adhB.

  19. Rationale for combined blockade of PD-1 and CTLA-4 in advanced head and neck squamous cell cancer—review of current data.

    Science.gov (United States)

    Swanson, Mark S; Sinha, Uttam K

    2015-01-01

    Targeted immunotherapy promoting anti-tumor T-cell activity has shown improved survival and durable objective responses in advanced melanoma patients. Data is mounting that concurrent use of ipilimumab and nivolumab has a more pronounced effect than either as monotherapy. Although no completed clinical trials exist for their use in head and neck cancer, preclinical data suggests these therapies would be beneficial in head and neck malignancies as well. Their role in head and neck cancer management is an ongoing research effort. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    Interleukin-10 gene promoter polymorphism as a potential host susceptibility factor in Pakistani patients with pulmonary tuberculosis. MS Afzal, S Anjum, A Salman, S Ashraf, ZUR Farooqi, T Ahmed, Y Waheed, I Qadri ...

  1. Core promoter functions in the regulation of gene expression of Drosophila dorsal target genes.

    Science.gov (United States)

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-04-25

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes.

  2. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  3. Fractal Topology of Gene Promoter Networks at Phase Transitions

    Directory of Open Access Journals (Sweden)

    Preston R. Aldrich

    2010-07-01

    Full Text Available Much is known regarding the structure and logic of genetic regulatory networks. Less understood is the contextual organization of promoter signals used during transcription initiation, the most pivotal stage during gene expression. Here we show that promoter networks organize spontaneously at a dimension between the 1-dimension of the DNA and 3-dimension of the cell. Network methods were used to visualize the global structure of E. coli sigma (σ recognition footprints using published promoter sequences (RegulonDB. Footprints were rendered as networks with weighted edges representing bp-sharing between promoters (nodes. Serial thresholding revealed phase transitions at positions predicted by percolation theory, and nuclei denoting short steps through promoter space with geometrically constrained linkages. The network nuclei are fractals, a power-law organization not yet described for promoters. Genome-wide promoter abundance also scaled as a power-law. We propose a general model for the development of a fractal nucleus in a transcriptional grammar.

  4. Interleukin-18 gene promoter polymorphisms and recurrent spontaneous abortion.

    Science.gov (United States)

    Naeimi, Sirous; Ghiam, Alireza Fotouhi; Mojtahedi, Zahra; Dehaghani, Alamtaj Samsami; Amani, Dawar; Ghaderi, Abbas

    2006-01-01

    IL-18 is a multifunctional cytokine capable of inducing either Th1 or Th2 polarization depending on the immunologic milieu. IL-18 is detected at the materno-fetal interface very soon in early pregnancy. Two polymorphisms in the promoter region of the IL-18 gene at positions of -607 and -137 appear to have functional impacts. This study attempts to evaluate the frequency of these two polymorphisms in the IL-18 gene promoter in patients with recurrent spontaneous abortion (RSA) and normal pregnant women. One hundred and two RSA patients and 103 healthy pregnant women were enrolled in this study. Single nucleotide polymorphisms of the IL-18 gene at positions -607 (C/A) and -137 (G/C) were analyzed by the sequence-specific PCR method. There was no significant association between the allele, genotype, and haplotype frequencies of the two single nucleotide polymorphisms (SNPs) in the IL-18 gene promoter and RSA. The results of this study showed that IL-18 gene promoter polymorphisms at positions -607 and -137 did not confer susceptibility to RSA in southern Iranian patients.

  5. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Roba M. Talaat

    2013-10-09

    Oct 9, 2013 ... Abstract. Purpose: Given the importance of understanding the genetic variations involved in the pathogen- esis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10. (А1082 G/A; rs1800896 and А819 C/T; rs1800871) gene promoter polymorphism on susceptibility.

  6. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  7. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    Artemisinin is the most effective antimalarial drug that is derived from Artemisia annua. Amorpha-4,11-diene synthase (ADS) controls the first committed step in artemisinin biosynthesis. The ADS gene expression is regulated by transcription factors which bind to the cis-acting elements on the ADS promoter and are probably ...

  8. Cloning and analysis of the ascorbate peroxidase gene promoter ...

    African Journals Online (AJOL)

    enoh

    2012-03-22

    Mar 22, 2012 ... (Promega) according to the manufacturer's instructions. The actual value was normalized by protein content of each sample and expressed as the relative luminescence units (RLU)/mg of protein. Analysis of BnAPX gene promoter by light. To understand whether BnAPX contribute to photoprotection or not,.

  9. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with typ...

  10. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Yomi

    2012-02-23

    Feb 23, 2012 ... Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for ...

  11. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  12. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.

    Science.gov (United States)

    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E

    2014-02-01

    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes.

  13. Gene promoter hypermethylation in leukoplakia of the oral mucosa

    Directory of Open Access Journals (Sweden)

    Mingli Liu

    2010-07-01

    Full Text Available Mingli Liu1, Lei Feng2, Ximing Tang3, Shanchun Guo41Department of Physics, Tufts University School of Medicine, Boston, Massachussetts; 2Department of Thoracic/Head and Neck Medical Oncology, 3Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, Texas; 4Sylvester Cancer Center, University of Miami School of Medicine, Florida, USAAbstract: To examine whether aberrant DNA methylation in the promoter region might occur earlier in tumorigenesis, particularly in premalignant lesions, we examined biopsies from 111 participants in a chemoprevention trial aimed at reversal of oral leukoplakia, using methylation-specific polymerase chain reaction for the promoter regions of the tumor suppressor gene CDKN2A (p16, the putative metastasis suppressor gene for death-associated protein kinase (DAP-K, the DNA repair gene O6-methyguanine-DNA-methyltransferase (MGMT, and the detoxification gene glutathione S-transferase p1(GSTP1. p16 promoter hypermethylation was detected in 21 of 82 (25.6%, DAP-K hypermethylation in 28 of 87 (32.2%, and MGMT hypermethylation in 32 of 106 (30.2% oral leukoplakia lesions analyzed. No aberrant methylation was found at the GSTP1 gene in 110 lesions examined. Among 68 biopsies analyzed for all three genes (p16, DAP-K, MGMT, 17 biopsies were detected with an abnormal methylation pattern at only one gene, 15 at two genes, and 8 at all three genes. Among clinical characteristics and their correlation with methylation, only alcohol consumption was correlated with DAP-K methylation (P = 0.027, while MGMT methylation was more frequent in females (P = 0.003 and nonsmokers (P = 0.0005. A significant correlation was found between p16 and DAP-K hypermethylation; p16 promoter was methylated in 14 (56% of 25 lesions with DAP-K methylation, and only 5 (11.1% of 45 DAP-K methylation-negative lesions (P = 0.0001. DAP-K aberrant methylation was also significantly correlated with MGMT methylation (16 of 31 in MGMT methylation

  14. Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis.

    Science.gov (United States)

    Ma, Shisong; Snyder, Michael; Dinesh-Kumar, Savithramma P

    2017-07-17

    Deciphering gene regulatory networks requires identification of gene expression modules. We describe a novel bottom-up approach to identify gene modules regulated by cis-regulatory motifs from a human gene co-expression network. Target genes of a cis-regulatory motif were identified from the network via the motif's enrichment or biased distribution towards transcription start sites in the promoters of co-expressed genes. A gene sub-network containing the target genes was extracted and used to derive gene modules. The analysis revealed known and novel gene modules regulated by the NF-Y motif. The binding of NF-Y proteins to these modules' gene promoters were verified using ENCODE ChIP-Seq data. The analyses also identified 8,048 Sp1 motif target genes, interestingly many of which were not detected by ENCODE ChIP-Seq. These target genes assemble into house-keeping, tissues-specific developmental, and immune response modules. Integration of Sp1 modules with genomic and epigenomic data indicates epigenetic control of Sp1 targets' expression in a cell/tissue specific manner. Finally, known and novel target genes and modules regulated by the YY1, RFX1, IRF1, and 34 other motifs were also identified. The study described here provides a valuable resource to understand transcriptional regulation of various human developmental, disease, or immunity pathways.

  15. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  16. Sense oligonucleotide competition for gene promoter binding and activation.

    Science.gov (United States)

    Cutroneo, Kenneth R; Chiu, Jen-Fu

    2003-01-01

    Considerable evidence has ensued on the importance of growth factors during regeneration both for cell replication and for stimulation of reparative cells to synthesize and secrete extracellular matrix components. During the healing process if the growth factor concentration is too high because of over-expression, abnormal wound healing and tissue fibrosis will occur. The growth factor concentration at the wound site may be controlled by gene therapy and the titration of gene dosage. However, if there is a narrow window between the beneficial effects and adverse effects of gene therapy, oligonucleotide approaches may be used concurrently with gene therapy to control growth factor concentration(s) at the wound site. Antisense oligos offer a method to control the concentration of growth factors at the level of translation. A novel method using sense oligos to the proalpha1 (I) collagen gene to inhibit gene transcription and collagen synthesis has recently been reported. The exogenous modified oligodeoxynucleotide competes with the cis-element (i.e. the transforming growth factor-beta (TGF-beta) element) in the distal 5'-flanking region of the proalpha1 (I) collagen gene for the trans-acting factor (i.e. the TGF-beta activator protein complex), thereby down regulating promoter activity of the proalpha1 (I) collagen gene and inhibiting type I collagen synthesis. The oligonucleotide approaches, both antisense and sense therapies, may be used to regulate over-expression of growth factors and thereby either eliminate or lessen the potential adverse effects of gene therapy.

  17. Allelic variants of CD40 and CD40L genes interact to promote antibiotic-induced cutaneous allergic reactions.

    Science.gov (United States)

    Kim, Sae-H; Lee, J-E; Kim, Sang-H; Jee, Y-K; Kim, Y-K; Park, H-S; Min, K-U; Park, H-W

    2009-12-01

    The danger hypothesis provides a new perspective of the mechanisms underlying drug allergy. In this study, we evaluated associations between variations in the genes involved in danger signal pathways and antibiotic-induced cutaneous allergic reactions (AICARs). Two hundred cases with urticaria, angio-oedema, maculopapular rash, and erythema multiforme caused by antibiotics were extracted from the database of the Adverse Drug Reaction Research Group in Korea. All cases were confirmed by an allergy specialist. Causative antibiotics included penicillin, cephalosporin, quinolone, and others (approximately 40 different types). Ten single nucleotide polymorphisms (SNPs) in seven genes (-318C>T, +49A>G, and +6230G>A in CTLA4, IVS+17T>C in CD28, -3479T>G and I170V in CD86, -1C>T in CD40, -3458A>G in CD40LG, -308G>A in TNF, and -31T>C in IL1B) were scored for cases and for healthy subjects without a history of AICARs. Our analysis failed to reveal differences in the distribution of the 10 SNPs between cases and controls. However, we could find a gene-gene interaction between -1C>T in CD40 and -3458A>G in CD40L using multifactor dimensionality reduction analysis. Subjects with minor alleles of both SNPs showed a significant risk for developing AICARs [P=0.017, odds ratio (OR) (95% confidence interval)=2.93 (1.20-7.97)]. Our findings suggest that a genetic interaction between CD40 and CD40L favours the development of AICARs.

  18. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  19. Conditional gene expression and promoter replacement in Zymoseptoria tritici using fungal nitrate reductase promoters.

    Science.gov (United States)

    Marchegiani, Elisabetta; Sidhu, Yaadwinder; Haynes, Ken; Lebrun, Marc-Henri

    2015-06-01

    Studying essential genes in haploid fungi requires specific tools. Conditional promoter replacement (CPR) is an efficient method for testing gene essentiality. However, this tool requires promoters that can be strongly down-regulated. To this end, we tested the nitrate reductase promoters of Magnaporthe oryzae (pMoNIA1) and Zymoseptoria tritici (pZtNIA1) for their conditional expression in Z. tritici. Expression of EGFP driven by pMoNIA1 or pZtNIA1 was induced on nitrate and down-regulated on glutamate (10-fold less than nitrate). Levels of differential expression were similar for both promoters, demonstrating that the Z. tritici nitrogen regulatory network functions with a heterologous promoter similarly to a native promoter. To establish CPR, the promoter of Z. tritici BGS1, encoding a β-1,3-glucan synthase, was replaced by pZtNIA1 using targeted sequence replacement. Growth of pZtNIA1::BGS1 CPR transformants was strongly reduced in conditions repressing pZtNIA1, while their growth was similar to wild type in conditions inducing pZtNIA1. This differential phenotype demonstrates that BGS1 is important for growth in Z. tritici. In addition, in inducing conditions, pZtNIA1::BGS1 CPR transformants were hyper-sensitive to Calcofluor white, a cell wall disorganizing agent. Nitrate reductase promoters are therefore suitable for conditional promoter replacement in Z. tritici. This tool is a major step toward identifying novel fungicide targets. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    inhibitor into an oncoprotein following P21 loss (20). Moreover, in prostate cancer, P53 negatively regulates AR when over-expressed (21). These...Characterization of the androgen receptor in a benign prostate tissue-derived human prostate epithelial cell line: RC-165N/human telomerase reverse...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9

  1. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  2. Polymorphisms in the leptin gene promoter in Brazilian beef herds.

    Science.gov (United States)

    Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E

    2016-12-02

    Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.

  3. Silencing of CHD5 gene by promoter methylation in leukemia.

    Directory of Open Access Journals (Sweden)

    Rui Zhao

    Full Text Available Chromodomain helicase DNA binding protein 5 (CHD5 was previously proposed to function as a potent tumor suppressor by acting as a master regulator of a tumor-suppressive network. CHD5 is down-regulated in several cancers, including leukemia and is responsible for tumor generation and progression. However, the mechanism of CHD5 down-regulation in leukemia is largely unknown. In this study, quantitative reverse-transcriptase polymerase chain reaction and western blotting analyses revealed that CHD5 was down-regulated in human leukemia cell lines and samples. Luciferase reporter assays showed that most of the baseline regulatory activity was localized from 500 to 200 bp upstream of the transcription start site. Bisulfite DNA sequencing of the identified regulatory element revealed that the CHD5 promoter was hypermethylated in human leukemia cells and samples. Thus, CHD5 expression was inversely correlated with promoter DNA methylation in these samples. Treatment with DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine (DAC activates CHD5 expression in human leukemia cell lines. In vitro luciferase reporter assays demonstrated that methylation of the CHD5 promoter repressed its promoter activity. Furthermore, a chromatin immunoprecipitation assay combined with qualitative PCR identified activating protein 2 (AP2 as a potential transcription factor involved in CHD5 expression and indicated that treatment with DAC increases the recruitment of AP2 to the CHD5 promoter. In vitro transcription-factor activity studies showed that AP2 over-expression was able to activate CHD5 promoter activity. Our findings indicate that repression of CHD5 gene expression in human leukemia is mediated in part by DNA methylation of its promoter.

  4. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  5. Association between cytotoxic T-lymphocyte associated protein 4 gene +49 A/G polymorphism and chronic infection with hepatitis B virus: a meta-analysis.

    Science.gov (United States)

    Xu, Hangdi; Zhao, Mingfei; He, Jiliang; Chen, Zhi

    2013-06-01

    This meta-analysis determined the relationship between polymorphisms of the cytotoxic T-lymphocyte-associated protein 4 (CTLA4) gene and hepatitis B virus (HBV) clearance in chronic hepatitis B. Published studies reporting associations between CTLA4 gene +49A/G polymorphisms and chronic HBV infection were reviewed. Odds ratio (OR) and 95% confidence interval (CI) were calculated to assess the risk of persistent HBV according to genotype. Six studies, involving 1076 chronic HBV patients and 1294 controls, were included. The risk of persistent HBV in patients with a +49 GG/AG genotype decreased significantly compared with the AA genotype (OR 0.65; 95% CI 0.52, 0.82). The variant G allele was negatively associated with chronic HBV infection versus the A allele (OR 0.77; 95% CI 0.68, 0.88). When stratifying by type of study control, a significantly decreased risk was associated with CTLA4+49 variant genotypes (AG and GG) in both spontaneous recovery control group and healthy control group. Findings of this meta-analysis suggest that A at position +49 of the CTLA4 gene may significantly increase the risk of persistent HBV infection, whereas G at position +49 may positively influence virus clearance.

  6. Promoter Methylation Analysis of IDH Genes in Human Gliomas.

    Science.gov (United States)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C Y; Suter, Catherine M; Buckland, Michael E

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a "toxic gain-of-function" to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  7. Promoter methylation analysis of IDH genes in human gliomas

    Directory of Open Access Journals (Sweden)

    Simon eFlanagan

    2012-12-01

    Full Text Available Mutations in isocitrate dehydrogenase (IDH -1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132 or IDH2 (R172. But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a ‘toxic gain of function’ to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumour suppressor gene. As most, if not all, tumour suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumours, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumour suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumours, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumours examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumours. These findings do not support a tumour suppressor role for IDH genes in human gliomas.

  8. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Novel "Superspreader" Bacteriophages Promote Horizontal Gene Transfer by Transformation.

    Science.gov (United States)

    Keen, Eric C; Bliskovsky, Valery V; Malagon, Francisco; Baker, James D; Prince, Jeffrey S; Klaus, James S; Adhya, Sankar L

    2017-01-17

    Bacteriophages infect an estimated 1023 to 1025 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub "superspreaders," releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. Bacteriophages (phages), viruses that infect bacteria, are the planet's most numerous biological entities

  10. Methylation loss at H19 imprinted gene correlates withmethylenetetrahydrofolate reductase gene promoter hypermethylation in semen samples from infertile males

    OpenAIRE

    Rotondo, John C; Selvatici, Rita; Di Domenico, Maura; Marci, Roberto; Vesce, Fortunato; Tognon, Mauro; Martini, Fernanda

    2013-01-01

    Aberrant methylation at the H19 paternal imprinted gene has been identified in different cohorts of infertile males. The causes of H19 methylation errors are poorly understood. In this study, we investigated the methylation status of the H19 gene in semen DNA samples from infertile males affected by MTHFR gene promoter hypermethylation. DNA from normal and abnormal semen samples harbouring MTHFR gene promoter hypermethylated, hmMTHFR-nor and hmMTHFR-abn, and without MTHFR methylation, MTHFR-n...

  11. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  12. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  13. [The methylation of ZHX2 gene promoter enhances AFP gene expression in hepatocellular carcinoma].

    Science.gov (United States)

    Lv, Zili; DU, Yangjun; Wen, Jianming

    2013-07-01

    To investigate the relationship between Zinc-fingers and homeoboxes 2 (ZHX2) promoter methylation and alpha-fetoprotein (AFP) gene expression, and analyze the mechanism of AFP gene expression. HepG2 cell line was cultured with 0.5, 1.0 or 5.0 μmol/L of 5-aza-deoxycytidine (5-Aza-Dc). RT-PCR and Western blotting were used to detect the expressions of ZHX2 and AFP in HepG2 cell line. Methylation-specific PCR was used to detect ZHX2 promoter methylation in 38 hepatocellular carcinoma tissues. The HepG2 cell line showed a low level of ZHX2 mRNA, negative expression of ZHX2 protein, but high expression of AFP at both mRNA and protein levels. After the HepG2 cells were treated with 1.0 or 5.0 μmol/L 5-Aza-Dc for 6 d, the expression of ZHX2 mRNA and protein increased and the expression of AFP mRNA and protein decreased. Among 38 hepatocellular carcinoma tissues, ZHX2 promoter methylation was found in 16 hepatocellular carcinoma tissues with AFP>25 ng/mL in serum. No methylation of ZHX2 promoter was found in 8 hepatocellular carcinoma tissues with AFPexpression.

  14. Soluble CD80 Protein Delays Tumor Growth and Promotes Tumor-Infiltrating Lymphocytes.

    Science.gov (United States)

    Horn, Lucas A; Long, Tiha M; Atkinson, Ryan; Clements, Virginia; Ostrand-Rosenberg, Suzanne

    2018-01-01

    Tumor cells use various immune-suppressive strategies to overcome antitumor immunity. One such method is tumor expression of programmed death ligand-1 (PD-L1), which triggers apoptotic death or anergy upon binding programmed death-1 (PD-1) on T cells. Our previous in vitro cellular studies with human and mouse PD-L1+ tumor cells demonstrated that a soluble form of the costimulatory molecule CD80 prevented PD-L1-mediated immune suppression and restored T-cell activation by binding PD-L1 and blocking interaction with PD-1. We now report that in vivo treatment of established syngeneic PD-L1+ CT26 colon carcinoma and B16F10 melanoma tumors with CD80-Fc delays tumor growth and promotes tumor-infiltrating T cells. Studies with PD-1-/- and CD28-/- mice demonstrate that soluble CD80 acts in vivo by simultaneously neutralizing PD-1 suppression and activating through CD28. We also report that soluble CD80 mediates its effects by activating transcription factors EGR1-4, NF-κB, and MAPK, downstream signaling components of the CD28 and T-cell receptor pathways. Soluble CD80 binds to CTLA-4 on activated human peripheral blood mononuclear cells. However, increasing quantities of CTLA-4 antagonist antibodies do not increase T-cell activation. These results indicate that soluble CD80 does not suppress T-cell function through CTLA-4 and suggest that CTLA-4 acts as a decoy receptor for CD80, rather than functioning as a suppressive signaling receptor. Collectively, these studies demonstrate that soluble CD80 has therapeutic efficacy in vivo in mouse tumor systems and that its effects are due to its ability to inhibit PD-1-mediated suppression while concurrently activating T cells through CD28. Cancer Immunol Res; 6(1); 59-68. ©2017 AACR. ©2017 American Association for Cancer Research.

  15. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  16. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...

  17. Plant Growth-Promoting Genes can Switch to be Virulence Factors via Horizontal Gene Transfer.

    Science.gov (United States)

    Stritzler, Margarita; Soto, Gabriela; Ayub, Nicolás

    2018-02-23

    There are increasing evidences that horizontal gene transfer (HGT) is a critical mechanism of bacterial evolution, while its complete impact remains unclear. A main constraint of HGT effects on microbial evolution seems to be the conservation of the function of the horizontally transferred genes. From this perspective, inflexible nomenclature and functionality criteria have been established for some mobile genetic elements such as pathogenic and symbiotic islands. Adhesion is a universal prerequisite for both beneficial and pathogenic plant-microbe interactions, and thus, adhesion systems (e.g., the Lap cluster) are candidates to have a dual function depending on the genomic background. In this study, we showed that the virulent factor Lap of the phytopathogen Erwinia carotovora SCRI1043, which is located within a genomic island, was acquired by HGT and probably derived from Pseudomonas. The transformation of the phytopathogen Erwinia pyrifoliae Ep1/96 with the beneficial factor Lap from the plant growth-promoting bacterium Pseudomonas fluorescens Pf-5 significantly increased its natural virulence, experimentally recapitulating the beneficial-to-virulence functional switch of the Lap cluster via HGT. To our knowledge, this is the first report of a functional switch of an individual gene or a cluster of genes mediated by HGT.

  18. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  19. Absence of Heterozygous K83E and R257X Mutations of the AIRE-1 Gene in 46 Children with Type 1 Diabetes and 44 Children with Graves’ Disease

    OpenAIRE

    Iwama, Saika; Ikezaki, Ayako; Matsuoka, Hisafumi; Hoshi, Mari; Sato, Hirokazu; Miyamoto, Shigeki; Sugihara, Shigetaka

    2005-01-01

    Type 1 diabetes mellitus (DM) and Graves’ disease are autoimmune diseases, and a number of genetic factors, including HLA and CTLA-4 genes, have been reported to contribute to their etiology. The gene responsible for autoimmune polyendocrinopathy- candidiasis-ectodermal dystrophy (APECED) has been cloned and named the autoimmune regulator-1 (AIRE-1) gene. AIRE-1 protein is thought to be a transcription regulatory protein and to have a role in the maintenance of immunological tolerance. The ai...

  20. Absence of Heterozygous K83E and R257X Mutations of the AIRE-1 Gene in 46 Children with Type 1 Diabetes and 44 Children with Graves' Disease

    OpenAIRE

    Saika, Iwama; Ayako, Ikezaki; Hisafumi, Matsuoka; Mari, Hoshi; Hirokazu, Sato; Shigeki, Miyamoto; Shigetaka, Sugihara; Department of Pediatrics, Tokyo Women's Medical University Daini Hospital; Department of Pediatrics, Tokyo Women's Medical University Daini Hospital; Department of Pediatrics, Tokyo Women's Medical University Daini Hospital; Department of Pediatrics, Matsudo Municipal Hospital; Chiba Children's Hospital; Chiba Children's Hospital; Department of Pediatrics, Tokyo Women's Medical University Daini Hospital

    2005-01-01

    Type 1 diabetes mellitus (DM) and Graves' disease are autoimmune diseases, and a number of genetic factors, including HLA and CTLA-4 genes, have been reported to contribute to their etiology. The gene responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) has been cloned and named the autoimmune regulator-1 (AIRE-1) gene. AIRE-1 protein is thought to be a transcription regulatory protein and to have a role in the maintenance of immunological tolerance. The aim...

  1. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Science.gov (United States)

    Pan, Jianqing; Wang, Hao; Liu, Xinmin; Hu, Jiliang; Song, Weijian; Luo, Jie; Jiang, Shan; Yan, Fei; Zhai, Baojin

    2015-01-01

    Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog) promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373). Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk) driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  2. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  3. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  4. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Human miR223 promoter as a novel myelo-specific promoter for chronic granulomatous disease gene therapy.

    Science.gov (United States)

    Brendel, Christian; Hänseler, Walther; Wohlgensinger, Vital; Bianchi, Matteo; Tokmak, Serap; Chen-Wichmann, Linping; Kuzmenko, Elena; Cesarovic, Nikola; Nicholls, Flora; Reichenbach, Janine; Seger, Reinhard; Grez, Manuel; Siler, Ulrich

    2013-06-01

    Targeting transgene expression to specific hematopoietic cell lineages could contribute to the safety of retroviral vectors in gene therapeutic applications. Chronic granulomatous disease (CGD), a defect of phagocytic cells, can be managed by gene therapy, using retroviral vectors with targeted expression to myeloid cells. In this context, we analyzed the myelospecificity of the human miR223 promoter, which is known to be strongly upregulated during myeloid differentiation, to drive myeloid-restricted expression of p47(phox) and gp91(phox) in mouse models of CGD and in primary patient-derived cells. The miR223 promoter restricted the expression of p47(phox), gp91(phox), and green fluorescent protein (GFP) within self-inactivating (SIN) gamma- and lentiviral vectors to granulocytes and macrophages, with only marginal expression in lymphocytes or hematopoietic stem and progenitor cells. Furthermore, gene transfer into primary CD34+ cells derived from a p47(phox) patient followed by ex vivo differentiation to neutrophils resulted in restoration of Escherichia coli killing activity by miR223 promoter-mediated p47(phox) expression. These results indicate that the miR223 promoter as an internal promoter within SIN gene therapy vectors is able to efficiently correct the CGD phenotype with negligible activity in hematopoietic progenitors, thereby limiting the risk of insertional oncogenesis and development of clonal dominance.

  6. Gene promoter evolution targets the center of the human protein interaction network.

    Directory of Open Access Journals (Sweden)

    Jordi Planas

    Full Text Available Assessing the contribution of promoters and coding sequences to gene evolution is an important step toward discovering the major genetic determinants of human evolution. Many specific examples have revealed the evolutionary importance of cis-regulatory regions. However, the relative contribution of regulatory and coding regions to the evolutionary process and whether systemic factors differentially influence their evolution remains unclear. To address these questions, we carried out an analysis at the genome scale to identify signatures of positive selection in human proximal promoters. Next, we examined whether genes with positively selected promoters (Prom+ genes show systemic differences with respect to a set of genes with positively selected protein-coding regions (Cod+ genes. We found that the number of genes in each set was not significantly different (8.1% and 8.5%, respectively. Furthermore, a functional analysis showed that, in both cases, positive selection affects almost all biological processes and only a few genes of each group are located in enriched categories, indicating that promoters and coding regions are not evolutionarily specialized with respect to gene function. On the other hand, we show that the topology of the human protein network has a different influence on the molecular evolution of proximal promoters and coding regions. Notably, Prom+ genes have an unexpectedly high centrality when compared with a reference distribution (P=0.008, for Eigenvalue centrality. Moreover, the frequency of Prom+ genes increases from the periphery to the center of the protein network (P=0.02, for the logistic regression coefficient. This means that gene centrality does not constrain the evolution of proximal promoters, unlike the case with coding regions, and further indicates that the evolution of proximal promoters is more efficient in the center of the protein network than in the periphery. These results show that proximal promoters

  7. Gene Promoter Evolution Targets the Center of the Human Protein Interaction Network

    Science.gov (United States)

    Planas, Jordi; Serrat, Josep M.

    2010-01-01

    Assessing the contribution of promoters and coding sequences to gene evolution is an important step toward discovering the major genetic determinants of human evolution. Many specific examples have revealed the evolutionary importance of cis-regulatory regions. However, the relative contribution of regulatory and coding regions to the evolutionary process and whether systemic factors differentially influence their evolution remains unclear. To address these questions, we carried out an analysis at the genome scale to identify signatures of positive selection in human proximal promoters. Next, we examined whether genes with positively selected promoters (Prom+ genes) show systemic differences with respect to a set of genes with positively selected protein-coding regions (Cod+ genes). We found that the number of genes in each set was not significantly different (8.1% and 8.5%, respectively). Furthermore, a functional analysis showed that, in both cases, positive selection affects almost all biological processes and only a few genes of each group are located in enriched categories, indicating that promoters and coding regions are not evolutionarily specialized with respect to gene function. On the other hand, we show that the topology of the human protein network has a different influence on the molecular evolution of proximal promoters and coding regions. Notably, Prom+ genes have an unexpectedly high centrality when compared with a reference distribution (P = 0.008, for Eigenvalue centrality). Moreover, the frequency of Prom+ genes increases from the periphery to the center of the protein network (P = 0.02, for the logistic regression coefficient). This means that gene centrality does not constrain the evolution of proximal promoters, unlike the case with coding regions, and further indicates that the evolution of proximal promoters is more efficient in the center of the protein network than in the periphery. These results show that proximal promoters have

  8. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available Introns, especially the first intron in the 5' untranslated region (5'UTR, can significantly impact gene expression via intron-mediated enhancement (IME. In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A gene (GmScreamM8 was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  9. Investigation of Interleukin-17 gene polymorphism on DAP-Kinase gene promoter methylation in Patients with Breast Cancer

    Directory of Open Access Journals (Sweden)

    S Naeimi

    2016-02-01

    Full Text Available Background & Aim: Breast cancer is the most common malignancy in women . Studies have shown that increased in methylation of CpG islands (CpG island hyper methylation, CIHM, is one of the important mechanisms in gene down regulation. DAP-Kinase protein plays an important role in the process of Apoptosis. Interleukin-17 is an proinflammatory cytokine and inflammation,is one of the factors  that affect on gene methylation . the purpose of this study was to evaluate the polymorphism of the IL-17 gene promoter methylation Dap-kinase and its relationship to breast cancer. Methods: In this case - control study, A total of 40 Women with Breast cancer and 40 healthy women in Iran were examined.DNA was extracted by saluting out method and Single nucleotide Polymorphisms of the IL-17 gene were analyzed by the PCR-RFLP method and To study gene promoter methylation Dap-kinase, MSPCR method was used.data were compared in both groups by using Pearson’s chi-square and Hardy-weinberg equilibrium test. RESULTS: Results confirm the fact that, there is a relationship between DAP-kinase gene promoter methylation and breast cancer disease So that the promoter of this gene in patients than in healthy individuals was much more methylated( p0.05 Conclusion: Due to the fact, that promoter genes methylation is one of the mechanisms of epigenetic genes silencing, it seems that DAP-kinase gene promoter methylation increases is associated with the risk of breast cancer in women.

  10. Identification and functional analysis of an alternative promoter of human intersectin 1 gene

    Directory of Open Access Journals (Sweden)

    Rynditch A. V.

    2010-04-01

    Full Text Available Aim. Intersectin 1 (ITSN1 gene encodes an evolutionarily conserved adaptor protein that functions in clathrin-mediated endocytosis, cell signalling, apoptosis and cytoskeleton rearrangements. Its expression is characterized by multiple alternative splicing. Alternative promoter usage is an additional way to create diversity and flexibility in the regulation of gene expression. The aim of this study was to identify possible alternative promoters of ITSN1 gene. Methods. In silico prediction, 5' RACE, RT-PCR and reporter gene expression assay were used for identification and functional characterization of alternative promoter region. Results. We detected an alternative promoter of human ITSN1 gene which is located in intron 5 and generates 5' truncated transcripts containing in-frame ATG codon with strong Kozak sequence and could encode an N-terminally truncated isoforms lacking first EH domain. The region located 246–190 bp upstream of exon 6 is required for alternative promoter activity. ITSN1 transcripts generated from an alternative promoter were detected in human kidney, liver, lung and brain tissues. However, the level of their expression was significantly lower than that of major ITSN1 isoforms. Conclusion. The results obtained suggest that alternative promoter region located in intron 5 of ITSN1 gene functions as a weak promoter. Further experiments are required to clarify the role of 5' truncated ITSN1 transcripts.

  11. MDM2 negatively regulates the human telomerase RNA gene promoter

    Directory of Open Access Journals (Sweden)

    Keith W Nicol

    2005-01-01

    Full Text Available Abstract Background We have previously demonstrated that NF-Y and Sp1 interact with the human telomerase RNA (hTR promoter and play a central role in its regulation. We have also shown that pRB activates the hTR promoter, but the mechanism of pRb directed activation is unknown. It has recently been reported that pRB induces Sp1 activity by relieving inhibition mediated by mdm2. The aim was to investigate possible roles for mdm2 in hTR promoter regulation. Methods Chromatin immunoprecipitation was used to determine binding of mdm2 to the hTR promoter. Transfection and luciferase assays were used to investigate mdm2 repression of the promoter activity and interaction with known transcriptional modulators. Results Here we show using chromatin immunoprecipitation that mdm2 specifically binds the hTR promoter in vivo. Transient co-transfection experiments using an hTR promoter luciferase reporter construct show that hTR promoter activity is inhibited by over-expression of mdm2 in 5637 bladder carcinoma cells (p53 and pRB negative, low mdm2. Titration of mdm2 was able to antagonise activation of hTR promoter activity mediated by pRB or Sp1 over-expression, although in the presence of pRB, mdm2 could not repress promoter activity below basal levels. Using an Sp1 binding site mutation construct we showed that mdm2 repression did not absolutely require Sp1 binding sites in the hTR promoter, suggesting the possibility of pRB/Sp1 independent mechanisms of repression. Finally, we show that NF-Y mediated transactivation of the hTR promoter was also suppressed by mdm2 in a dose-dependent manner. Conclusions These studies suggest that mdm2 may inhibit the hTR promoter by multiple mechanisms. Mdm2 may directly repress activation by both pRB and Sp1, or activation by NF-Y. Furthermore, the ability of mdm2 to interact and interfere with components of the general transcription machinery might partly explain the general repressive effect seen here. Elucidation of

  12. Selection of Arabidopsis mutants overexpressing genes driven by the promoter of an auxin-inducible glutathione S-transferase gene

    NARCIS (Netherlands)

    Kop, D.A.M. van der; Schuyer, M.; Pinas, J.E.; Zaal, B.J. van der; Hooykaas, P.J.J.

    1999-01-01

    Transgenic arabidopsis plants were isolated that contained a T-DNA construct in which the promoter of an auxin-inducible glutathione S-transferase (GST) gene from tobacco was fused to the kanamycin resistance (nptII) as well as to the β-glucuronidase (gusA) reporter gene. Subsequently, seeds were

  13. A novel method for the determination of basal gene expression of tissue-specific promoters: an analysis of prostate-specific promoters.

    NARCIS (Netherlands)

    Poel, H.G. van der; McCadden, J.; Verhaegh, G.W.C.T.; Kruszewski, M.; Ferrer, F.; Schalken, J.A.; Carducci, M.; Rodriguez, R.

    2001-01-01

    Because the toxicity of suicide gene therapeutics is directly related to basal promoter activity, we developed an assay to test for promoter "leakiness" using a diphtheria toxin mutant. Sequences of 15 prostate-specific gene promoter constructs were cloned in an expression plasmid (pBK; Stratagene,

  14. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.

    Science.gov (United States)

    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander

    2015-02-26

    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  15. Heterologous expression of the Pleurotus ostreatus MnP3 gene by the laccase gene promoter in Lentinula edodes.

    Science.gov (United States)

    Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko

    2017-08-01

    Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.

  16. Isolating Barley (Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Yomi

    2012-04-10

    Apr 10, 2012 ... region of B1 hordein gene was isolated from the genomic DNA of Walfajre and Alger barley by polymerase chain reaction. ..... also named an endosperm box and is the binding site of endosperm-specific nuclear .... and common structural features of the complete phenylalanine ammonia-lyase gene family ...

  17. Hepatitis B viral core protein disrupts human host gene expression by binding to promoter regions

    Directory of Open Access Journals (Sweden)

    Guo Yanhai

    2012-10-01

    Full Text Available Abstract Background The core protein (HBc of hepatitis B virus (HBV has been implicated in the malignant transformation of chronically-infected hepatocytes and displays pleiotropic functions, including RNA- and DNA-binding activities. However, the mechanism by which HBc interacts with the human genome to exert effects on hepatocyte function remains unknown. This study investigated the distribution of HBc binding to promoters in the human genome and evaluated its effects on the related genes’ expression. Results Whole-genome chromatin immunoprecipitation microarray (ChIP-on-chip analysis was used to identify HBc-bound human gene promoters. Gene Ontology and pathway analyses were performed on related genes. The quantitative polymerase chain reaction assay was used to verify ChIP-on-chip results. Five novel genes were selected for luciferase reporter assay evaluation to assess the influence of HBc promoter binding. The HBc antibody immunoprecipitated approximately 3100 human gene promoters. Among these, 1993 are associated with known biological processes, and 2208 regulate genes with defined molecular functions. In total, 1286 of the related genes mediate primary metabolic processes, and 1398 encode proteins with binding activity. Sixty-four of the promoters regulate genes related to the mitogen-activated protein kinase (MAPK pathways, and 41 regulate Wnt/beta-catenin pathway genes. The reporter gene assay indicated that HBc binding up-regulates proto-oncogene tyrosine-protein kinase (SRC, type 1 insulin-like growth factor receptor (IGF1R, and neurotrophic tyrosine kinase receptor 2 (NTRK2, and down-regulates v-Ha-ras Harvey rat sarcoma viral oncogene (HRAS. Conclusion HBc has the ability to bind a large number of human gene promoters, and can disrupt normal host gene expression. Manipulation of the transcriptional profile in HBV-infected hepatocytes may represent a key pathogenic mechanism of HBV infection.

  18. Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

    Science.gov (United States)

    Rosario, Christopher J; Tan, Ming

    2015-11-02

    Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number

  19. Isolation of promoter for N-methyltransferase gene associated with caffeine biosynthesis in Coffea canephora.

    Science.gov (United States)

    Satyanarayana, K V; Kumar, Vinod; Chandrashekar, A; Ravishankar, G A

    2005-09-22

    N-Methyltransferases (NMTs) catalyze the three SAM dependent sequential methylation of xanthosine, producing caffeine in Coffea species. In the present work, a PCR based genome walking method was adopted to isolate and clone the promoter for the NMT gene. Inspection of the promoter sequence revealed the presence of several motifs important for the regulation of the gene expression. The whole fragment was fused to the beta-glucuronidase (gus) reporter gene and used in Agrobacterium tumefaciens mediated transformation of Nicotiana tabacum. GUS assays proved that the isolated promoter was able to direct the expression of the reporter gene in transgenic tobacco. Based on the promoter sequence, primer was designed and the genomic fragment comprising the promoter and its corresponding gene was amplified and cloned. Sequencing of one of the genomic clones revealed the presence of four exons and three introns in NMT gene. The differences in the restriction pattern among the genomic clones were studied using PCR-RFLP. This is the first report of cloning of the promoter for a gene involved in caffeine biosynthetic pathway and it opens up the possibility of studying the molecular mechanisms that regulate the production of caffeine.

  20. Promoter-sharing by different genes in human genome – CPNE1 and RBM12 gene pair as an example

    Directory of Open Access Journals (Sweden)

    Yiu Siu-Ming

    2008-10-01

    Full Text Available Abstract Background Regulation of gene expression plays important role in cellular functions. Co-regulation of different genes may indicate functional connection or even physical interaction between gene products. Thus analysis on genomic structures that may affect gene expression regulation could shed light on the functions of genes. Results In a whole genome analysis of alternative splicing events, we found that two distinct genes, copine I (CPNE1 and RNA binding motif protein 12 (RBM12, share the most 5' exons and therefore the promoter region in human. Further analysis identified many gene pairs in human genome that share the same promoters and 5' exons but have totally different coding sequences. Analysis of genomic and expressed sequences, either cDNAs or expressed sequence tags (ESTs for CPNE1 and RBM12, confirmed the conservation of this phenomenon during evolutionary courses. The co-expression of the two genes initiated from the same promoter is confirmed by Reverse Transcription-Polymerase Chain Reaction (RT-PCR in different tissues in both human and mouse. High degrees of sequence conservation among multiple species in the 5'UTR region common to CPNE1 and RBM12 were also identified. Conclusion Promoter and 5'UTR sharing between CPNE1 and RBM12 is observed in human, mouse and zebrafish. Conservation of this genomic structure in evolutionary courses indicates potential functional interaction between the two genes. More than 20 other gene pairs in human genome were found to have the similar genomic structure in a genome-wide analysis, and it may represent a unique pattern of genomic arrangement that may affect expression regulation of the corresponding genes.

  1. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  2. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  3. Isolation and characterization of a polyubiquitin gene and its promoter region from Mesembryanthemum crystallinum.

    Science.gov (United States)

    Azad, Muhammad Abul Kalam; Morita, Kunio; Ohnishi, Jun-ichi; Kore-eda, Shin

    2013-01-01

    Transcript levels of the polyubiquitin gene McUBI1 had been reported to be constant during Crassulacean acid metabolism (CAM) induction in the facultative CAM plant, Mesembryanthemum crystallinum. Here, we report the sequences of the full-length cDNA of McUBI1 and its promoter, and validation of the McUBI1 promoter as an internal control driving constitutive expression in transient assays using the dual-luciferase system to investigate the regulation of CAM-related gene expression. The McUBI1 promoter drove strong, constitutive expression during CAM induction. We compared the activities of this promoter with those of the cauliflower mosaic virus (CaMV) 35S promoter in detached C3- and CAM-performing M. crystallinum and tobacco leaves. We confirmed stable expression of the genes controlled by the McUBI1 promoter with far less variability than under the CaMV 35S promoter in M. crystallinum, whereas both promoters worked well in tobacco. We found the McUBI1 promoter more suitable than the CaMV 35S promoter as an internal control for transient expression assays in M. crystallinum.

  4. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  5. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  6. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  7. Tuning Gene Expression in Yarrowia lipolytica by a Hybrid Promoter Approach▿†

    Science.gov (United States)

    Blazeck, John; Liu, Leqian; Redden, Heidi; Alper, Hal

    2011-01-01

    The development of strong and tunable promoter elements is necessary to enable metabolic and pathway engineering applications for any host organism. Here, we have expanded and generalized a hybrid promoter approach to produce libraries of high-expressing, tunable promoters in the nonconventional yeast Yarrowia lipolytica. These synthetic promoters are comprised of two modular components: the enhancer element and the core promoter element. By exploiting this basic promoter architecture, we have overcome native expression limitations and provided a strategy for both increasing the native promoter capacity and producing libraries for tunable gene expression in a cellular system with ill-defined genetic tools. In doing so, this work has created the strongest promoters ever reported for Y. lipolytica. Furthermore, we have characterized these promoters at the single-cell level through the use of a developed fluorescence-based assay as well as at the transcriptional and whole-cell levels. The resulting promoter libraries exhibited a range of more than 400-fold in terms of mRNA levels, and the strongest promoters in this set had 8-fold-higher fluorescence levels than those of typically used endogenous promoters. These results suggest that promoters in Y. lipolytica are enhancer limited and that this limitation can be partially or fully alleviated through the addition of tandem copies of upstream activation sequences (UASs). Finally, this work illustrates that tandem copies of UAS regions can serve as synthetic transcriptional amplifiers that may be generically used to increase the expression levels of promoters. PMID:21926196

  8. Identification and functional characterization of glioma-specific promoters and their application in suicide gene therapy.

    Science.gov (United States)

    Yawata, Toshio; Maeda, Yusuke; Okiku, Makiko; Ishida, Eri; Ikenaka, Kazuhiro; Shimizu, Keiji

    2011-09-01

    Suicide gene therapy has been shown to be effective in inducing tumor regression. In this study, a human brain tumor-specific promoter was identified and used to develop transcriptionally targeted gene therapy. We searched for genes with brain tumor-specific expression. By in silico and reverse-transcription polymerase chain reaction screening, MAGE-A3 and SSX4 were found to be expressed in a tumor-specific manner. SSX4 gene promoter activity was high in human brain tumor cells but not in normal human astrocyte cells, whereas the MAGE-A3 promoter showed activity in both tumor and normal cells. A retrovirus vector carrying a suicide gene, the herpes simplex virus thymidine kinase gene controlled by the SSX4 promoter, was constructed to evaluate the efficacy of the promoter in tumor-specific gene therapy. Glioma and human telomerase catalytic subunit-immortalized fibroblast BJ-5ta cell lines transduced with retrovirus vectors were assayed for killing activity by ganciclovir. Glioma cell lines were effectively killed by ganciclovir in a concentration-dependent manner, whereas BJ-5ta cells were not. By contrast, MAGE-A3 promoter failed to induce cytotoxicity in a brain tumor-specific manner. In addition, mouse glioma RSV-M cells transduced with retrovirus vector also showed suppressed tumor formation activity in syngeneic mice in response to ganciclovir administration. Therefore, the SSX4 promoter is a candidate for brain tumor-specific gene therapy and supports the efficacy and safety of suicide gene therapy for malignant brain tumors.

  9. Transcriptional Activity of the FUT1 Gene Promoter Region in Pigs

    Directory of Open Access Journals (Sweden)

    Chen Zi

    2013-12-01

    Full Text Available This study aims to provide a theoretical basis on the regulatory mechanism of the α-l,2-fucosyltransferase (FUT1 gene in pigs by analyzing the transcriptional activity of its promoter region. On the basis of the previously obtained promoter sequence, primers upstream and downstream of the gene were designed using the restriction endonucleases KpnI and HindIII respectively, and the recombinant plasmids of the pGL3-promoter were constructed by inserting promoter sequences with partially missing regions. The resultant mutants were observed by transient transfection assay into HEK293 cells, and the transcriptional activity of the promoter region was determined by luciferase activity. The 5'-flanking region of the FUT1 gene (−1150 to +50 bp exhibited promoter activity. The −1150-bp to −849-bp region showed negative regulation of the gene. The recombinant plasmid pGL3-898 showed the strongest luciferase activity, and the activity showed a decreasing trend when the deleted region was increased. Recombinant plasmids were successfully constructed, verified, and the positive and negative regulation areas and core promoter region were detected, providing a deeper insight into the transcriptional regulatory mechanism of the FUT1 gene.

  10. Aberrant gene promoter methylation in sputum from individuals exposed to smoky coal emissions

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Y.; Lan, Q.; Shen, M.; Jin, J.; Mumford, J.; Ren, D.X.; Keohavong, P. [University of Pittsburgh, Pittsburgh, PA (United States). Dept. of Environment and Occupational Health

    2008-07-15

    Recent studies suggested the potential for aberrant gene promoter methylation in sputum as a predictive marker for lung cancer. Here, the promoter methylation of p16, MGMT, RASSF1A and DAPK genes was investigated in sputum of individuals exposed to smoky coal emissions in Xuan Wei, China, where the lung cancer rate is more than 6 times the Chinese national average. Sputum DNA of 107 noncancer individuals and 58 lung cancer patients was screened for promoter methylation using methylation-specific PCR. Promoter methylation of the p16 gene was detected in about half (51.4% (551107)) of sputum DNA from noncancer individuals, a frequency higher than that observed for the RASSF1A (29.9%), MGMT (17.8%) and DAPK (15.9%) genes. Furthermore, the p16 gene was affected by promoter methylation at a frequency even higher among the lung cancer group, compared with the noncancer group (70.7% (41/58) versus 51.7% (55/107), p=0.017). Individuals exposed to smoky coal emissions in this region harbored frequent promoter methylation of these genes in their sputum and some of such alterations may be involved in lung tumor development.

  11. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  12. [Cloning of ID4 gene expression regulation promoter and subcloning of recombinant ID4 promoter luciferase reporter].

    Science.gov (United States)

    Li, Wei; Huang, Yu; Yang, Bo; Chi, Xiao-Hua; Liu, Li-Hong; Zhang, Feng; Yan, Jiang-Wei; Lu, Xue-Chun

    2010-04-01

    The present study was aimed to clone ID4 gene promoter and upstream regulatory region, and to construct a series of recombinant promoter-luciferase reporter for exploring the mechanism of ID4 gene expression regulation. the upstream 5' flanking sequence of 2242 bp from transcriptional start site (TSS) and downstream 5' non-coding region of 212 bp on ID4 gene were searched out and downloaded from human genome databank of NCBI using whole length of ID4 gene cDNA as a probe; On-line promoter analysis softwares, including TESS and Genomax, were employed to analyze the characteristics of ID4 gene promoter and upstream regulatory elements. Then, based on the analytic results, PCR primers were designed and synthesized. Segmental amplification method was adopted to obtain two fragments of 1829 bp and 784 bp. The two fragments were inserted into the plasmid pGEM-T, transformed into TOP10 competent E. coli., and positive recombinants were screened respectively. Subsequently, restriction enzymes KpnI/NheI and KpnI/EcoRI were used to digest the above-mentioned two plasmids pGEM-T and pGL3, and ligation was completed by T4 DNA ligase. After transformation to TOP10 competent E. coli. and screening of positive colonies, the basic recombinant ID4 gene promoter-pGL3 was successfully constructed. KpnI/NheI double digestion and sequencing showed that the target fragment was 2 459 bp and consistent with the corresponding sequence of GenBank; Using the 2459 bp fragment as a template, 5 pairs of primers with identical 3' terminus and different 5' terminus were designed and synthesized for half-nest PCR amplification. 5 fragments with an interval of approximate 400 bp each other, i.e. 2112 bp, 1703 bp, 1290 bp, 784 bp and 496 bp, were produced and inserted into pGEM-T after recovery and purification for transformation to TOP10 competent E. coli. and screening of positive colonies. After that, KpnI/NheI was used to digest the above-mentioned five pGEM-T recombinant plasmids and pGL3 basic

  13. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... ness, salicylic acid and abscisic acid responsiveness, induc- tion upon fungal elicitation, endosperm expression, MeJA- responsiveness, low-temperature responsiveness, elicitation, wounding and pathogen responsiveness were also found in. ADS promoters of all or some of the seven Artemisia species.

  14. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    Science.gov (United States)

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  15. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  16. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  17. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  18. Horizontal gene transfer promoted evolution of the ability to propagate under anaerobic conditions in yeasts

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.

    2004-01-01

    . We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...... a bacterial gene for DHODase, which subsequently allowed cell growth gradually to become independent of oxygen....

  19. Interleukin 10 gene promoter polymorphism and risk of diffuse large B cell lymphoma (DLBCL

    Directory of Open Access Journals (Sweden)

    Roba M. Talaat

    2014-01-01

    Conclusions: Taken together, our findings demonstrated that IL-10 promoter gene polymorphism (−1082 and −819 may not have an influence on the clinical outcome of DLBCL, especially in terms of overall secretion level. Further investigations of other cytokine gene polymorphisms will lead to a better understanding of the disease’s biological background.

  20. Cloning and analysis of plant fatty acid desaturase 7 gene promoter ...

    African Journals Online (AJOL)

    In order to investigate the regulation mode of Brassica napus FAD7 gene in response of thermal stress, we measured the protein levels of BnFAD7 in plant at low and high temperature, and then analyzed promoter activity of 5'-flanking regions of BnFAD7 by transient gene expression in B. napus protoplasts at different ...

  1. Inducible Promoter Systems for Gene Perturbation Experiments in Arabidopsis.

    Science.gov (United States)

    Thomson, Bennett; Graciet, Emmanuelle; Wellmer, Frank

    2017-01-01

    Assessing molecular changes that occur through altering a gene's activity is often hampered by difficulties that arise due to the typically static nature of the introduced perturbation. This is especially problematic when investigating molecular events at specific stages and/or in certain tissues or organs during Arabidopsis development. To circumvent these issues, we have employed chemically inducible artificial microRNAs (amiRNAs) for the specific knockdown of developmental regulators. For our own research, we have combined this gene perturbation approach with a floral induction system, which allows the simultaneous induction of a large number of flowers on the inflorescence of a single plant, and the ability to knock down a gene's activity at any given stage of development. To enable the plant community to avail of the full benefits of these systems, we describe, in this chapter, strategies for amiRNA-mediated gene perturbations and address some common problems that can be encountered when generating inducible amiRNA constructs, growing these plants, and collecting floral buds for analysis.

  2. Gene promoter methylation patterns throughout the process of cervical carcinogenesis

    NARCIS (Netherlands)

    Yang, Nan; Nijhuis, Esther R.; Volders, Haukeline H.; Eijsink, Jasper J. H.; Lendvai, Agnes; Zhang, Bo; Hollema, Harry; Schuuring, Ed; Wisman, G. Bea A.; van der Zee, Ate G. J.

    2010-01-01

    Objectives: To determine methylation status of nine genes, previously described to be frequently methylated in cervical cancer, in squamous intraepithelial lesions (SIL). Methods: QMSP was performed in normal cervix, low-grade ( L) SIL, high-grade (H) SIL, adenocarcinomas and squamous cell cervical

  3. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...

  4. Long distance relationships: enhancer-promoter communication and dynamic gene transcription.

    Science.gov (United States)

    Marsman, Judith; Horsfield, Julia A

    2012-01-01

    The three-dimensional regulation of gene transcription involves loop formation between enhancer and promoter elements, controlling spatiotemporal gene expression in multicellular organisms. Enhancers are usually located in non-coding DNA and can activate gene transcription by recruiting transcription factors, chromatin remodeling factors and RNA Polymerase II. Research over the last few years has revealed that enhancers have tell-tale characteristics that facilitate their detection by several approaches, although the hallmarks of enhancers are not always uniform. Enhancers likely play an important role in the activation of genes by functioning as a primary point of contact for transcriptional activators, and by making physical contact with gene promoters often by means of a chromatin loop. Although numerous transcriptional regulators participate in the formation of chromatin loops that bring enhancers into proximity with promoters, the mechanism(s) of enhancer-promoter connectivity remain enigmatic. Here we discuss enhancer function, review some of the many proteins shown to be involved in establishing enhancer-promoter loops, and describe the dynamics of enhancer-promoter contacts during development, differentiation and in specific cell types. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  6. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

    Directory of Open Access Journals (Sweden)

    Maria M Alonso-Peral

    Full Text Available The VERNALIZATION1 (VRN1 gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare. A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

  7. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  8. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    The ZNF230 gene is a recently cloned gene which is transcribed only in fertile male testes and may be related to human spermatogenesis. To characterize the multiple stage-specific transcription elements necessary for ZNF230 expression, we cloned ZNF230 promoter and constructed chimeric luciferase...... reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  9. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  10. Promoter hypermethylation-mediated inactivation of multiple Slit-Robo pathway genes in cervical cancer progression

    Directory of Open Access Journals (Sweden)

    Mansukhani Mahesh

    2006-05-01

    Full Text Available Abstract Background Cervical Cancer (CC exhibits highly complex genomic alterations. These include hemizygous deletions at 4p15.3, 10q24, 5q35, 3p12.3, and 11q24, the chromosomal sites of Slit-Robo pathway genes. However, no candidate tumor suppressor genes at these regions have been identified so far. Slit family of secreted proteins modulates chemokine-induced cell migration of distinct somatic cell types. Slit genes mediate their effect by binding to its receptor Roundabout (Robo. These genes have shown to be inactivated by promoter hypermethylation in a number of human cancers. Results To test whether Slit-Robo pathway genes are targets of inactivation at these sites of deletion, we examined promoter hypermethylation of SLIT1, SLIT2, SLIT3, ROBO1, and ROBO3 genes in invasive CC and its precursor lesions. We identified a high frequency of promoter hypermethylation in all the Slit-Robo genes resulting in down regulated gene expression in invasive CC, but the inhibitors of DNA methylation and histone deacetylases (HDACs in CC cell lines failed to effectively reactivate the down-regulated expression. These results suggest a complex mechanism of inactivation in the Slit-Robo pathway in CC. By analysis of cervical precancerous lesions, we further show that promoter hypermethylation of Slit-Robo pathway occurs early in tumor progression. Conclusion Taken together, these findings suggest that epigenetic alterations of Slit-Robo pathway genes (i play a role in CC development, (ii further delineation of molecular basis of promoter methylation-mediated gene regulation provides a potential basis for epigenetic-based therapy in advanced stage CC, and (iii form epigenetic signatures to identify precancerous lesions at risk to progression.

  11. Promoter hypermethylation-mediated inactivation of multiple Slit-Robo pathway genes in cervical cancer progression.

    Science.gov (United States)

    Narayan, Gopeshwar; Goparaju, Chandra; Arias-Pulido, Hugo; Kaufmann, Andreas M; Schneider, Achim; Dürst, Matthias; Mansukhani, Mahesh; Pothuri, Bhavana; Murty, Vundavalli V

    2006-05-15

    Cervical Cancer (CC) exhibits highly complex genomic alterations. These include hemizygous deletions at 4p15.3, 10q24, 5q35, 3p12.3, and 11q24, the chromosomal sites of Slit-Robo pathway genes. However, no candidate tumor suppressor genes at these regions have been identified so far. Slit family of secreted proteins modulates chemokine-induced cell migration of distinct somatic cell types. Slit genes mediate their effect by binding to its receptor Roundabout (Robo). These genes have shown to be inactivated by promoter hypermethylation in a number of human cancers. To test whether Slit-Robo pathway genes are targets of inactivation at these sites of deletion, we examined promoter hypermethylation of SLIT1, SLIT2, SLIT3, ROBO1, and ROBO3 genes in invasive CC and its precursor lesions. We identified a high frequency of promoter hypermethylation in all the Slit-Robo genes resulting in down regulated gene expression in invasive CC, but the inhibitors of DNA methylation and histone deacetylases (HDACs) in CC cell lines failed to effectively reactivate the down-regulated expression. These results suggest a complex mechanism of inactivation in the Slit-Robo pathway in CC. By analysis of cervical precancerous lesions, we further show that promoter hypermethylation of Slit-Robo pathway occurs early in tumor progression. Taken together, these findings suggest that epigenetic alterations of Slit-Robo pathway genes (i) play a role in CC development, (ii) further delineation of molecular basis of promoter methylation-mediated gene regulation provides a potential basis for epigenetic-based therapy in advanced stage CC, and (iii) form epigenetic signatures to identify precancerous lesions at risk to progression.

  12. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  13. Epigenomic modifications predict active promoters and gene structure in Toxoplasma gondii.

    Directory of Open Access Journals (Sweden)

    Mathieu Gissot

    2007-06-01

    Full Text Available Mechanisms of gene regulation are poorly understood in Apicomplexa, a phylum that encompasses deadly human pathogens like Plasmodium and Toxoplasma. Initial studies suggest that epigenetic phenomena, including histone modifications and chromatin remodeling, have a profound effect upon gene expression and expression of virulence traits. Using the model organism Toxoplasma gondii, we characterized the epigenetic organization and transcription patterns of a contiguous 1% of the T. gondii genome using custom oligonucleotide microarrays. We show that methylation and acetylation of histones H3 and H4 are landmarks of active promoters in T. gondii that allow us to deduce the position and directionality of gene promoters with >95% accuracy. These histone methylation and acetylation "activation" marks are strongly associated with gene expression. We also demonstrate that the pattern of histone H3 arginine methylation distinguishes certain promoters, illustrating the complexity of the histone modification machinery in Toxoplasma. By integrating epigenetic data, gene prediction analysis, and gene expression data from the tachyzoite stage, we illustrate feasibility of creating an epigenomic map of T. gondii tachyzoite gene expression. Further, we illustrate the utility of the epigenomic map to empirically and biologically annotate the genome and show that this approach enables identification of previously unknown genes. Thus, our epigenomics approach provides novel insights into regulation of gene expression in the Apicomplexa. In addition, with its compact genome, genetic tractability, and discrete life cycle stages, T. gondii provides an important new model to study the evolutionarily conserved components of the histone code.

  14. A reporter gene system for the precise measurement of promoter activity in Thermus thermophilus HB27.

    Science.gov (United States)

    Fujita, Atsushi; Sato, Takaaki; Koyama, Yoshinori; Misumi, Yoshio

    2015-11-01

    We developed a reporter gene system that enables precise analysis of promoter activity in Thermus thermophilus HB27. The reporter vector employs a promoterless β-galactosidase gene of Thermus spp. strain T2. However, T. thermophilus HB27 strain has three genes (TTP0042, TTP0220 and TTP0222) whose products have β-galactosidase activity, which would interfere with correct measurements of promoter activities. Thus, to eliminate this background activity, we disrupted all three of these genes to generate a host strain for measuring promoter expression as β-galactosidase activity. In addition, T. thermophilus strains also produce carotenoids called thermoxanthins that are yellow pigments. To avoid the influence of these carotenoids on the β-galactosidase assay, we also disrupted the phytoene synthase gene (crtB). The reporter gene system developed here is a powerful tool for studying transcriptional activity and the mechanisms that regulate gene expression in T. thermophilus HB27. We also showed that the crtB gene cassette could be used in repeated gene-disruption experiments to screen transformants by colony colour, thus eliminating the need for antibiotic resistance markers.

  15. RNA Pol II accumulates at promoters of growth genes during developmental arrest.

    Science.gov (United States)

    Baugh, L Ryan; Demodena, John; Sternberg, Paul W

    2009-04-03

    When Caenorhabditis elegans larvae hatch from the egg case in the absence of food, their development is arrested (L1 arrest), and they show increased stress resistance until food becomes available. To study nutritional control of larval development, we analyzed growth and gene expression profiles during L1 arrest and recovery. Larvae that were fed responded relatively slowly to starvation compared with the rapid response of arrested larvae to feeding. Chromatin immunoprecipitation of RNA polymerase II (Pol II) followed by deep sequencing showed that during L1 arrest, Pol II continued transcribing starvation-response genes, but the enzyme accumulated on the promoters of growth and development genes. In response to feeding, promoter accumulation decreased, and elongation and messenger RNA levels increased. Therefore, accumulation of Pol II at promoters anticipates nutritionally controlled gene expression during C. elegans development.

  16. Promoter polymorphism of transforming growth factor-beta1 gene and ulcerative colitis.

    Science.gov (United States)

    Tamizifar, B; Lankarani, K B; Naeimi, S; Rismankar Zadeh, M; Taghavi, A; Ghaderi, A

    2008-01-14

    To elucidate the possible difference in two promoter polymorphisms of the transforming growth factor-beta1 (TGF-beta1) gene (-800G > A, -509C > T) between ulcerative colitis (UC) patients and normal subjects. A total of 155 patients with established ulcerative colitis and 139 normal subjects were selected as controls. Two single nucleotide polymorphisms within the promoter region of TGF-beta1 gene (-509C > T and -800G > A) were genotyped using PCR-RFLP. There was a statistically significant difference in genotype and allele frequency distributions between UC patients and controls for the -800G > A polymorphism of the TGF-beta1 gene (P A of TGF-beta1 gene promoter between Iranian patients with UC and normal subjects.

  17. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  18. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  19. Characterization of the human Glvr-1 phosphate transporter/retrovirus receptor gene and promoter region.

    Science.gov (United States)

    Palmer, G; Manen, D; Bonjour, J P; Caverzasio, J

    1999-01-08

    The cell surface receptor for gibbon ape leukemia virus (Glvr-1) belongs to the type III sodium-dependent phosphate transporter/retrovirus receptor gene family. Several observations have suggested an important role for Glvr-1 in regulated Pi handling in bone forming cells and prompted us to investigate further the molecular mechanisms regulating Glvr-1 gene expression. In addition, the regulation of Glvr-1 gene expression also has potential applications to gene therapy, since retroviral vectors carrying gibbon ape leukemia virus envelope proteins are used for gene delivery into different cell types. The aim of this study was thus to clone the human Glvr-1 gene in order to describe its structure and its promoter region. Our results indicate that the Glvr-1 gene consists of 11 exons and 10 introns spread over 18kb of genomic DNA. The translation initiation site is located within exon II and the translation stop codon within exon XI. Rapid amplification of cDNA ends (5'-RACE) suggests that, in human SaOS-2 osteoblast-like cells, transcription of Glvr-1 is initiated at multiple sites, mostly located between bp 32 and 50 of the published cDNA sequence, which was initially obtained from HL-60 cells. The 5'-flanking region of the gene is characterized by a very high GC content. Reporter gene assays demonstrate the presence of a functional promoter upstream of exon I and indicate that a GC-rich region, containing two potential SP1 binding sites, is required for high promoter activity in transiently transfected SaOS-2 cells. The description of the human Glvr-1 gene structure, as well as the analysis of some structural and functional characteristics of its promoter region, provide a basis for more detailed investigation of the molecular mechanisms controlling expression of the Glvr-1 gene in bone forming cells and in other cell types.

  20. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  1. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  2. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  3. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  4. Promoter mutagenesis for fine-tuning expression of essential genes in Mycobacterium tuberculosis.

    Science.gov (United States)

    Boldrin, Francesca; Degiacomi, Giulia; Serafini, Agnese; Kolly, Gaëlle S; Ventura, Marcello; Sala, Claudia; Provvedi, Roberta; Palù, Giorgio; Cole, Stewart T; Manganelli, Riccardo

    2018-01-01

    A range of regulated gene expression systems has been developed for mycobacteria in the last few years to facilitate the study of essential genes, validate novel drug targets and evaluate their vulnerability. Among these, the TetR/Pip-OFF repressible promoter system was successfully used in several mycobacterial species both in vitro and in vivo. In the first version of the system, the repressible promoter was Pptr , a strong Pip-repressible promoter of Streptomyces pristinaespiralis, which might hamper effective downregulation of genes with a low basal expression level. Here, we report an enhanced system that allows more effective control of genes expressed at low level. To this end, we subjected Pptr to targeted mutagenesis and produced 16 different promoters with different strength. Three of them, weaker than the wild-type promoter, were selected and characterized showing that they can indeed improve the performances of TetR/Pip-OFF repressible system both in vitro and in vivo increasing its stringency. Finally, we used these promoters to construct a series of bacterial biosensors with different sensitivity to DprE1 inhibitors and developed a whole-cell screening assay to identify inhibitors of this enzyme. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  5. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  6. High-risk oral leukoplakia is associated with aberrant promoter methylation of multiple genes.

    Science.gov (United States)

    Abe, Masanobu; Yamashita, Satoshi; Mori, Yoshiyuki; Abe, Takahiro; Saijo, Hideto; Hoshi, Kazuto; Ushijima, Toshikazu; Takato, Tsuyoshi

    2016-06-03

    Early detection of oral squamous cell carcinomas (OSCCs) is urgently needed to improve the prognosis and quality of life (QOL) of patients. Oral leukoplakias (OLs), known as the most common premalignant lesions in the oral cavity, often precede OSCCs. Especially, OLs with dysplasia are known to have a high risk of malignant transformation. Here, we searched for the promoter methylation characteristic of high-risk OLs. To identify methylation-silenced genes, a combined analysis of methylated DNA immunoprecipitation (MeDIP) - CpG island (CGI) microarray analysis and expression microarray analysis after treatment with a demethylating agent was performed in two OSCC cell lines (Ca9-22 and HSC-2). The methylation statuses of each gene were examined by methylation-specific PCR. A total of 52 genes were identified as candidates for methylation-silenced genes in Ca9-22 or HSC-2. The promoter regions of 13 genes among the 15 genes randomly selected for further analysis were confirmed to be methylated in one or more of five cell lines. In OSCC tissues (n = 26), 8 of the 13 genes, TSPYL5, EGFLAM, CLDN11, NKX2-3, RBP4, CMTM3, TRPC4, and MAP6, were methylated. In OL tissues (n = 24), seven of the eight genes, except for EGFLAM, were found to be methylated in their promoter regions. There were significantly greater numbers of methylated genes in OLs with dysplasia than in those without dysplasia (p < 0.0001). OLs at high risk for malignant transformation were associated with aberrant promoter methylation of multiple genes.

  7. Culex tarsalis vitellogenin gene promoters investigated in silico and in vivo using transgenic Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Song Chen

    Full Text Available Genetic modification, or transgenesis, is a powerful technique to investigate the molecular interactions between vector-borne pathogens and their arthropod hosts, as well as a potential novel approach for vector-borne disease control. Transgenesis requires the use of specific regulatory regions, or promoters, to drive expression of genes of interest in desired target tissues. In mosquitoes, the vast majority of described promoters are from Anopheles and Aedes mosquitoes.Culex tarsalis is one of the most important vectors of arboviruses (including West Nile virus in North America, yet it has not been the subject of molecular genetic study. In order to facilitate molecular genetic work in this important vector species, we isolated four fat body-specific promoter sequences located upstream of the Cx. tarsalis vitellogenin genes (Vg1a, Vg1b, Vg2a and Vg2b. Sequences were analyzed in silico to identify requisite cis-acting elements. The ability for promoter sequences to drive expression of green fluorescent protein (GFP in vivo was investigated using transgenic Drosophila melanogaster. All four promoters were able to drive GFP expression but there was dramatic variation between promoters and between individual Drosophila lines, indicating significant position effects. The highest expression was observed in line Vg2bL3, which was >300-fold higher than the lowest line Vg1aL2.These new promoters will be useful for driving expression of genes of interest in transgenic Cx. tarsalis and perhaps other insects.

  8. Structural features of DNA are conserved in the promoter region of orthologous genes across different strains of Helicobacter pylori.

    Science.gov (United States)

    Kumar, Aditya; Manivelan, Vasumathi; Bansal, Manju

    2016-09-01

    Promoter regions play a key role in the process of transcription initiation and gene expression, hence promoter identification is an inherent component of the genome annotation process. Identification and characterization of promoters in fully sequenced genomes is a challenging and complex task. An analysis of sequence-dependent DNA structural properties in the promoter region of orthologous and non-orthologous genes can help in characterizing promoters and also provide insights into transcription initiation. Various structural properties, such as duplex stability, protein-induced bendability and intrinsic curvature of promoter sequences have been calculated and compared for 10 different strains of Helicobacter pylori genomes, and it is found that promoter regions in orthologous and non-orthologous genes show distinct trends for these properties, with orthologous genes showing sharper low-stability peak, lower bendability and higher curvature. The average GC content of orthologous genes is higher than that of non-orthologous genes, and relative stability-based promoter annotation tool PromPredict performs better for orthologous genes than non-orthologous genes. The characteristic sequence-dependent structural properties of promoters show significant differences between orthologous and non-orthologous genes. Interestingly, these structural properties of promoters are conserved, but the genes themselves vary in their evolutionary selection rate. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  10. Regulation of a Mammalian Gene Bearing a CpG Island Promoter and a Distal Enhancer

    Directory of Open Access Journals (Sweden)

    Georgina Berrozpe

    2013-08-01

    Full Text Available A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors.

  11. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  12. Analysis of the mouse dhfr promoter region: existence of a divergently transcribed gene.

    Science.gov (United States)

    Crouse, G F; Leys, E J; McEwan, R N; Frayne, E G; Kellems, R E

    1985-01-01

    The use of murine dihydrofolate reductase (dhfr) gene amplification mutants enabled us to identify important structural and functional features of the dhfr promoter region. We found another transcription unit, at least 14 kilobases in size, which initiates within 130 base pairs of the major dhfr transcript and is transcribed divergently. The 5' ends of both transcripts were analyzed and found to have multiple initiation sites. The major dhfr transcript and the divergent transcript appear to share the same promoter region; the longer transcripts of the dhfr gene overlap with the divergent transcripts and use a different promoter region. The divergent transcript appears to code for a protein; an homologous sequence to its first exon is found in the corresponding location near the human dhfr gene. Images PMID:3018531

  13. Identification of the minimal melanocyte-specific promoter in the melanocortin receptor 1 gene

    Directory of Open Access Journals (Sweden)

    Natali Pier

    2008-11-01

    Full Text Available Abstract Background The understanding of cutaneous pigmentation biology is relevant from the biologic and clinical point of view. The binding of α-melanocortin and its specific receptor, on the plasma membrane of melanin synthesising cells, plays a crucial role in melanins biosynthesis. Furthermore, loss of MC1R function is associated with an increased incidence of melanoma and non-melanoma skin cancer. The expression of the α-melanocortin receptor gene is highly controlled but, at the present, region responsible for tissue-specific activity of the gene promoter has not been identified. Methods We have cloned the genomic sequences upstream the human MC1R coding gene. A DNA fragment of 5 kilobases upstream the human MC1R encoding sequence was placed in front of a reporter gene and several deletion mutants of such fragment have been prepared. These constructs have been tested for the ability to drive the melanocyte-specific gene expression of the reporter gene using transfection experiments in melanocyte and non-melanocyte cell lines. From these experiments we identified a DNA fragment with the ability to drive the gene transcription in a tissue-specific way and we used this small DNA fragment in DNA-protein interaction assays. Results We show that the 150 base pairs upstream the MC1R gene initiation codon are able to drive the melanocyte-specific gene transcription. Furthermore, we provide experimental evidences suggesting that on such minimal melanocyte-specific gene promoter can assemble tissue-specific complexes. Conclusion The present results strongly imply that the transcriptional regulation of the melanocyte-specific MC1R gene requires an internal promoter located in the 150 base pairs upstream the initiation codon.

  14. GAL promoter-driven heterologous gene expression in Saccharomyces cerevisiae Δ strain at anaerobic alcoholic fermentation.

    Science.gov (United States)

    Ahn, Jungoh; Park, Kyung-Min; Lee, Hongweon; Son, Yeo-Jin; Choi, Eui-Sung

    2013-02-01

    The removal of Gal80 protein by gene disruption turned into efficient GAL promoter-driven heterologous gene expression under anaerobic alcoholic fermentation of Saccharomyces cerevisiae. Using lipase B from Candida antarctica as a reporter, the relative strength of GAL10 promoter (P(GAL10) ) in Δgal80 mutant that does not require galactose as an inducer was compared to those of ADH1, PDC1, and PGK promoters, which have been known to work well anaerobically in actively fermenting yeast cells under high glucose concentration. P(GAL10) in the Δgal80 mutant showed 0.8-fold (ADH1), fourfold (PDC1), and 50-fold (PGK) in promoter strength. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  16. Organization of human ACAT-2 gene and its cell-type-specific promoter activity.

    Science.gov (United States)

    Song, B L; Qi, W; Yang, X Y; Chang, C C; Zhu, J Q; Chang, T Y; Li, B L

    2001-03-30

    Acyl-CoA:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis. Two ACAT genes exist in mammals. We report here the genomic organization of human ACAT-2 gene and analysis of its promoter activity in various cell lines. The human ACAT-2 gene spans over 18 kb and contains 15 exons. Three transcription start sites and one poly(A) site are identified by the 5'/3'-RACE. In addition, the human ACAT-2 gene is linked to the insulin-like growth factor binding protein 6 (IGFBP-6) gene in a head-to-tail manner with a small intergenic region of about 1.2 kb. The 5'-flanking region of human ACAT-2 gene contains many potential cis-acting elements for multiple transcriptional regulatory factors but lacks TATA and CCAAT boxes. Using promoter-luciferase reporter assays, we demonstrate the transcriptional activity of ACAT-2 gene promoter is high in Caco-2 cells, especially after these cells become postconfluent and behave as intestinal enterocytes. Copyright 2001 Academic Press.

  17. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  18. La inmunización con productos de excreción-secreción de Trichinella spiralis unido al bloqueo de CTLA-4 produce un elevado grado de protección ante un reto con el parásito

    Directory of Open Access Journals (Sweden)

    José Lino Zumaquero-Ríos

    2017-04-01

    Full Text Available En la búsqueda de una vacuna experimental efectiva contra Trichinella spiralis se han utilizado diferentes estrategias, pero el grado de protección alcanzado en la casi totalidad de los ensayos es insuficiente para lograr un adecuado control de la enfermedad. En la literatura hay evidencias de que moléculas inhibidoras de la activación de los linfocitos T están implicadas en la regulación de la respuesta inmune contra los helmintos. El bloqueo de estas moléculas puede ser un blanco potencial para el tratamiento de las infecciones causadas por estos parásitos. Por otra parte, se ha informado que la inmunización con productos de excreción-secreción de larvas musculares de T. spiralis proporciona una inmunidad protectora parcial. La infección con el parásito induce una elevada población de linfocitos T reguladores que modulan la respuesta inmune. En este trabajo encontramos que la inmunización con antígenos de excreción-secreción de larvas musculares, más el bloqueo de la molécula inhibidora CTLA-4 en los linfocitos T, causa una significativa reducción de las larvas del parásito en un modelo experimental murino. De esta forma, queda demostrado que la eliminación del efecto supresor inducido por el helminto da por resultado una respuesta Th2 protectora más potente.

  19. Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

    Science.gov (United States)

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

    1999-11-19

    As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

  20. Promoter Identification and Transcription Analysis of Penicillin-Binding Protein Genes in Streptococcus pneumoniae R6.

    Science.gov (United States)

    Peters, Katharina; Pipo, Julia; Schweizer, Inga; Hakenbeck, Regine; Denapaite, Dalia

    2016-09-01

    Penicillin-binding proteins (PBPs) are membrane-associated enzymes, which are involved in the last two steps of peptidoglycan biosynthesis, and some of them are key players in cell division. Furthermore, they are targets of β-lactams, the most widely used antibiotics. Nevertheless, very little is known about the expression and regulation of PBP genes. Using transcriptional mapping, we now determined the promoter regions of PBP genes from the laboratory strain Streptococcus pneumoniae R6 and examined the expression profile of these six promoters. The extended -10 region is highly conserved and complies with a σ(A)-type promoter consensus sequence. In contrast, the -35 region is poorly conserved, indicating the possibility for differential PBP regulation. All PBP promoters were constitutively expressed and highly active during the exponential and early stationary growth phase. However, the individual expression of PBP promoters varied approximately fourfold, with pbp1a being the highest and pbp3 the lowest. Furthermore, the deletion of one nucleotide in the spacer region of the PBP3 promoter reduced pbp3 expression ∼10-fold. The addition of cefotaxime above the minimal inhibitory concentration (MIC) did not affect PBP expression in the penicillin-sensitive R6 strain. No evidence for regulation of S. pneumoniae PBP genes was obtained.

  1. Analysis of the rice Os05g0442400 gene promoter and expression of the GUS fusion gene under control of the rice Os05g0442400 gene promoter in transgenic rice

    Directory of Open Access Journals (Sweden)

    SONG Yae

    2013-04-01

    Full Text Available The promoter sequence of the rice Os05g0442400 gene was analyzed using Plant CARE and PLACE programs.Except the basic promoter cis-acting elements,several cis-acting elements,including the elements that related to plant resistance to abiotic stress,light-inducible promoter elements,pathogen-induced factor elements and the root specific motif,were recognized in a 1500bp promoter sequence upstream of the initial codon ATG.The Os05g0442400 promoter::gus contruct was transferred into rice successfully by Agrobacterium tumefaciens-mediated.The GUS expression in different tissues was assayed using GUS staining.The results showed that endogenous Os05g0442400 gene may mainly expressed in roots.With the continuation of rice reproductive stage,the expression area of Os05g0442400 gene in rice glume increased from top to bottom,and after heading the expression area reached the maximum.These results may have some contact with the root specific motif and light-inducible promoter elements of Os05g0442400 gene promoter.

  2. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  3. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    Science.gov (United States)

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  4. Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species

    OpenAIRE

    Mohanty, Bijayalaxmi; Krishnan, S. P. T.; Swarup, Sanjay; Bajic, Vladimir B.

    2005-01-01

    • Background and Aims Plants can suffer from oxygen limitation during flooding or more complete submergence and may therefore switch from Kreb's cycle respiration to fermentation in association with the expression of anaerobically inducible genes coding for enzymes involved in glycolysis and fermentation. The aim of this study was to clarify mechanisms of transcriptional regulation of these anaerobic genes by identifying motifs shared by their promoter regions.

  5. RNA polymerase III promoter elements enhance transcription of RNA polymerase II genes

    Energy Technology Data Exchange (ETDEWEB)

    Oliviero, S.; Monaci, P.

    1988-02-25

    Using transient expression assays in cultured human cells the authors have observed that RNA Polymerase III promoter sequences exert a positive cis-acting enhancer effect on RNA Polymerase II transcription. A DNA segment containing a copy of the Alu repeated element enhances transcription of the liver specific Haptoglobin related (Hpr) promoter in Hepatoma cell lines but not in HeLa cells. A tRNA/sup pro/ gene acts as enhancer of the SV40 promoter both in Hepatoma and in HeLa cell lines. Transcription from the SV40 promoter is also enhanced by DNA segments containing only the box A or the box B of the tRNA/sup pro/ promoter.

  6. Lowly expressed genes in Arabidopsis thaliana bear the signature of possible pseudogenization by promoter degradation.

    Science.gov (United States)

    Yang, Liang; Takuno, Shohei; Waters, Elizabeth R; Gaut, Brandon S

    2011-03-01

    Pseudogenes are defined as nonfunctional DNA sequences with homology to functional protein-coding genes, and they typically contain nonfunctional mutations within the presumptive coding region. In theory, pseudogenes can also be caused by mutations in upstream regulatory regions, appearing as open reading frames with attenuated expression. In this study, we identified 1,939 annotated protein-coding genes with little evidence of expression in Arabidopsis thaliana and characterized their molecular evolutionary characteristics. On average, this set of genes was shorter than expressed genes and evolved with a 2-fold higher rate of nonsynonymous substitutions. The divergence of upstream sequences, based on ortholog comparisons to A. lyrata, was also higher than expressed genes, suggesting that these lowly expressed genes could be examples of pseudogenization by promoter disablement, often due to transposable element insertion. We complemented our empirical study by extending the models of Force et al. (Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J. 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531-1545.) to derive the probability of promoter disablements after gene duplication.

  7. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    Directory of Open Access Journals (Sweden)

    Adam Rodney D

    2007-04-01

    Full Text Available Abstract Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome.

  8. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  9. Functional analysis of a cotton cellulose synthase A4 gene promoter in transgenic tobacco plants.

    Science.gov (United States)

    Wu, Ai-Min; Hu, John S; Liu, Jin-Yuan

    2009-10-01

    A 1,482-bp promoter sequence of the cotton cellulose synthase gene (GhCesA4) was isolated from Chinese cultivar CRI12 of Gossypium hirsutum, and transcriptionally fused to a beta-glucuronidase (GUS) reporter gene for investigation of important regions controlling gene expression in transgenic tobacco plants. Histochemical staining showed that the full-length promoter directs efficient expression of the reporter gene in the roots, hypocotyls, vascular tissues of stems, trichomes, the central leaf veins, as well as in the anthers and pollen. Quantitative measurements of GUS activity demonstrated that higher expression levels were detected in the stems, fully expanded leaves, and styles of flowers. A series of 5' progressive deletions of the promoter revealed the presence of a negative regulatory region (-767 to -424) for promoter activity and a 247-bp fragment (-247 to -1) with the vascular tissue specificity of the basic transcription activity in the GhCesA4 promoter. Exposure of the transgenic tobacco to various abiotic stresses showed that the full-length construct predominantly responded to NAA, kinetin, and sugar. Furthermore, the NAA-response region was found to be located in the -1,482/-1204 fragment, while the element(s) for the sucrose-responsive expression may be present in the -247/-1 region in the GhCesA4 promoter. These findings will not only contribute to an explanation of the molecular mechanisms by which GhCesA4 participates in secondary cell wall morphogenesis and stress responses, but will also provide a good candidate for expression or accumulation of foreign genes of interest whose products are preferentially required in vascular tissues and are inducible under auxin treatment.

  10. Characterization of the promoter region of biosynthetic enzyme genes involved in berberine biosynthesis in Coptis japonica

    Directory of Open Access Journals (Sweden)

    Yasuyuki Yamada

    2016-09-01

    Full Text Available The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs, a plant-specific WRKY-type transcription factor, CjWRKY1, and a basic helix-loop-helix (bHLH transcription factor, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4’OMT and CYP719A1 were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay (EMSA and by a chromatin immunoprecipitation (ChIP assay. In addition, CjbHLH1 also activated transcription from truncated 4’OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed.

  11. Specification of Vδ and Vα usage by Tcra/Tcrd locus V gene segment promoters.

    Science.gov (United States)

    Naik, Abani Kanta; Hawwari, Abbas; Krangel, Michael S

    2015-01-15

    The Tcra/Tcrd locus undergoes V-Dδ-Jδ rearrangement in CD4(-)CD8(-) thymocytes to form the TCRδ chain of the γδ TCR and V-Jα rearrangement in CD4(+)CD8(+) thymocytes to form the TCRα-chain of the αβ TCR. Most V segments in the locus participate in V-Jα rearrangement, but only a small and partially overlapping subset participates in V-Dδ-Jδ rearrangement. What specifies any particular Tcra/Tcrd locus V gene segment as a Vδ, a Vα, or both is currently unknown. We tested the hypothesis that V segment usage is specified by V segment promoter-dependent chromatin accessibility in developing thymocytes. TRAV15/DV6 family V gene segments contribute to both the Tcrd and the Tcra repertoires, whereas TRAV12 family V gene segments contribute almost exclusively to the Tcra repertoire. To understand whether the TRAV15/DV6 promoter region specifies TRAV15/DV6 as a Vδ, we used gene targeting to replace the promoter region of a TRAV12 family member with one from a TRAV15/DV6 family member. The TRAV15/DV6 promoter region conferred increased germline transcription and histone modifications to TRAV12 in double-negative thymocytes and caused a substantial increase in usage of TRAV12 in Tcrd recombination events. Our results demonstrate that usage of TRAV15/DV6 family V gene segments for Tcrd recombination in double-negative thymocytes is regulated, at least in part, by intrinsic features of TRAV15/DV6 promoters, and argue that Tcra/Tcrd locus Vδ gene segments are defined by their local chromatin accessibility in CD4(-)CD8(-) thymocytes. Copyright © 2015 by The American Association of Immunologists, Inc.

  12. Hypermethylation of MGMT and DAPK gene promoters is associated with tumorigenesis and metastasis in oral squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yong-Kie Wong

    2011-09-01

    Conclusions: Our study supports the hypothesis that hypermethylation of p16 gene promoters may indicate a high risk of oral cancer, and hypermethylation of the MGMT and DAPK genes may be a major indicator of early OSCC metastasis.

  13. Gene Promoter Hypermethylation in Tumors and Plasma of Breast Cancer Patients

    Science.gov (United States)

    Shim, Young Ran; Choi, Joon Hyuk; Kim, Mi Jin; Gabrielson, Edward; Lee, Soo Jung; Hwang, Tae Yoon; Shin, Sei One

    2005-01-01

    Purpose To measure the hypermethylation of four genes in primary tumors and paired plasma samples to determine the feasibility of gene promoter hypermethylation markers for detecting breast cancer in the plasma. Materials and Methods DNA was extracted from the tumor tissues and peripheral blood plasma of 34 patients with invasive breast cancer, and the samples examined for aberrant hypermethylation in cyclin D2, retinoic acid receptor β (RARβ), twist and high in normal-1 (HIN-1) genes using methylation-specific PCR (MSP), and the results correlated with the clinicopathological parameters. Results Promoter hypermethylation was detected at high frequency in the primary tumors for cyclin D2 (53%), RARβ (56%), twist (41%) and HIN-1 (77%). Thirty-three of the 34 (97%) primary tumors displayed promoter hypermethylation in at least one of the genes examined. The corresponding plasma samples showed hyperme thylation of the same genes, although at lower frequencies (6% for cyclin D2, 16% for RARβ, 36% for twist, and 54% for HIN-1). Overall, 22 of the 33 (67%) primary tumors with hypermethylation of at least one of the four genes also had abnormally hypermethylated DNA in their matched plasma samples. No significant relationship was recognized between any of the clinical or pathological parameters (tumor size, axillary lymph node metastasis, stage, or Ki-67 labeling index) with the frequency of hypermethylated DNA in the primary tumor or plasma. Conclusion The detection of aberrant promoter hypermethylation of cancer-related genes in the plasma may be a useful tool for the detection of breast cancer. PMID:19956520

  14. Identification of a Gene Sharing a Promoter and Peroxisome Proliferator-Response Elements With Acyl-CoA Oxidase Gene

    Directory of Open Access Journals (Sweden)

    Mst. Hasina Akter

    2006-01-01

    Full Text Available Many mammalian genes are clustered on the genomes, and hence the genes in the same cluster can be regulated through a common regulatory element. We indeed showed previously that the perilipin/PEX11α gene pair is transactivated tissue-selectively by PPARγ and PPARα, respectively, through a common binding site. In the present study, we identified a gene, named GSPA, neighboring a canonical PPAR target, acyl-CoA oxidase (AOX gene. GSPA expression was induced by a peroxisome proliferator, Wy14,643, in the liver of wild-type mice, but not PPARα-null mice. GSPA and AOX share the promoter and two peroxisome proliferator-response elements. GSPA mRNA was also found in the heart and skeletal muscle, as well as 3T3-L1 cells. GSPA encodes a protein of 161 amino acids that is enriched in 3T3-L1 cells. Even other gene pairs might be regulated through common sequence elements, and conversely it would be interesting how each gene is aptly regulated in clusters.

  15. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  16. Promoter polymorphisms of the CD14 gene are associated with atopy in Pakistani adults.

    NARCIS (Netherlands)

    Micheal, S.; Minhas, K.; Ishaque, M.; Ahmed, F.; Ahmed, A.

    2011-01-01

    BACKGROUND: Several studies have shown that promoter polymorphisms of the CD14 gene are associated with atopic asthma. However, the results of association studies in different populations are conflicting. This study aimed to investigate the possible association between the CD14 polymorphisms A-1145G

  17. The human β-globin gene promoter; nuclear protein factors and erythroid specific induction of transcription.

    NARCIS (Netherlands)

    E. de Boer (Ernie); M. Antoniou (Michael); V. Mignotte; L. Wall (Lee); F.G. Grosveld (Frank)

    1988-01-01

    textabstractWe have shown that the promoter of the human beta-globin gene contains three regions in addition to the known CAC, CAAT and TATA box regions that are important for the induction of transcription in erythroid cells. By using DNaseI footprinting and gel mobility shift assays we were able

  18. TRF2 associates with DREF and directs promoter-selective gene expression in Drosophila.

    Science.gov (United States)

    Hochheimer, Andreas; Zhou, Sharleen; Zheng, Shuang; Holmes, Michael C; Tjian, Robert

    2002-11-28

    Drosophila TATA-box-binding protein (TBP)-related factor 2 (TRF2) is a member of a family of TBP-related factors present in metazoan organisms. Recent evidence suggests that TRF2s are required for proper embryonic development and differentiation. However, true target promoters and the mechanisms by which TRF2 operates to control transcription remain elusive. Here we report the antibody affinity purification of a Drosophila TRF2-containing complex that contains components of the nucleosome remodelling factor (NURF) chromatin remodelling complex as well as the DNA replication-related element (DRE)-binding factor DREF. This latter finding led us to potential target genes containing TRF2-responsive promoters. We have used a combination of in vitro and in vivo assays to show that the DREF-containing TRF2 complex directs core promoter recognition of the proliferating cell nuclear antigen (PCNA) gene. We also identified additional TRF2-responsive target genes involved in DNA replication and cell proliferation. These data suggest that TRF2 functions as a core promoter-selectivity factor responsible for coordinating transcription of a subset of genes in Drosophila.

  19. Transcriptional regulation of teleost aicda genes. Pt 1 suppressors of promiscuous promoters

    Science.gov (United States)

    In order to better understand antibody affinity maturation in fishes we sought to identify gene regulatory elements that could drive expression of activated B-cell specific fluorescent reporter transgenes in zebrafish. Specifically the promoter and several non-coding regions of the channel catfish (...

  20. Synthetic gene involving azobenzene-tethered T7 promoter for the photocontrol of gene expression by visible light.

    Science.gov (United States)

    Kamiya, Yukiko; Takagi, Toshiki; Ooi, Hideaki; Ito, Hiroshi; Liang, Xingguo; Asanuma, Hiroyuki

    2015-04-17

    In the present study, we demonstrate photoregulation of gene expression in a cell-free translation system from a T7 promoter containing two azobenzene derivatives at specific positions. As photoswitches, we prepared azobenzene-4'-carboxlyic acid (Azo) and 2,6-dimethylazobenzene-4'-carboxylic acid (DM-Azo), which were isomerized from trans to cis upon irradiation with UV light (λ azobenzene-4'-carobxylic acid (S-DM-Azo), which were cis-isomerized by irradiation with 400 nm visible light. Expression of green fluorescent protein from a promoter modified with S-Azo or S-DM-Azo could be induced by harmless visible light whereas that from a promoter modified with Azo or DM-Azo was induced only by UV light (340-360 nm). Thus, efficient photoregulation of green fluorescent protein production was achieved in a cell-free translation system with visible light without photodamage.

  1. Transcription Factor Sp1 Promotes the Expression of Porcine ROCK1 Gene

    Directory of Open Access Journals (Sweden)

    Ruirui Zhang

    2016-01-01

    Full Text Available Rho-associated, coiled-coil containing protein kinase 1 (ROCK1 gene plays a crucial role in maintaining genomic stability, tumorigenesis and myogenesis. However, little is known about the regulatory elements governing the transcription of porcine ROCK1 gene. In the current study, the transcription start site (TSS was identified by 5’-RACE, and was found to differ from the predicted one. The region in ROCK1 promoter which is critical for promoter activity was investigated via progressive deletions. Site-directed mutagenesis indicated that the region from −604 to −554 bp contains responsive elements for Sp1. Subsequent experiments showed that ROCK1 promoter activity is enhanced by Sp1 in a dose-dependent manner, whereas treatment with specific siRNA repressed ROCK1 promoter activity. Electrophoretic mobility shift assay (EMSA, DNA pull down and chromatin immunoprecipitation (ChIP assays revealed Sp1 can bind to this region. qRT-PCR and Western blotting research followed by overexpression or inhibition of Sp1 indicate that Sp1 can affect endogenous ROCK1 expression at both mRNA and protein levels. Overexpression of Sp1 can promote the expression of myogenic differentiation 1(MyoD, myogenin (MyoG, myosin heavy chain (MyHC. Taken together, we conclude that Sp1 positively regulates ROCK1 transcription by directly binding to the ROCK1 promoter region (from −604 to −532 bp and may affect the process of myogenesis.

  2. The expression profile and promoter analysis of ultraspiracle gene in the silkworm Bombyx mori.

    Science.gov (United States)

    Huang, Ming-xia; Du, Jie; Su, Bao-jin; Zhao, Guo-dong; Shen, Wei-de; Wei, Zheng-guo

    2014-12-01

    The nuclear receptor, ultraspiracle protein (USP), is a transcription factor and an essential component of a heterodimeric receptor complex with ecdysone receptor. However, the mechanisms underlying the transcriptional regulation of USP in silkworm are unknown. In this study, using dual-spike-in qPCR method, we examined the expression of Bombyx ultraspiracle gene (BmUSP) in various tissues of silkworm as well as expression changes after stimulation with ecdysone. The results showed that the expression levels of BmUSP gene varied in different tissues and were increased 2 h after exposure to ecdysone. To identify the molecular mechanism underlying the regulation of USP gene expression in silkworm Bombyx mori, promoter truncation analyses were performed using the luciferase reporter assay and Bac-to-Bac expression system in several tissues of B. mori. BmUSP gene promoter with 5' end serial deletions showed different levels of activity in various tissues, higher in fat body and Malpighian tubule. Deletion of the region from -485 to -445 and -307 to -281 upstream of BmUSP gene abolished and increased its promoter activity, respectively. This region contains AP-1, Dfd transcription factor binding sites. These results indicate that BmUSP are expressed at different levels in different tissues of the silkworm, but all are subjected to the regulation by ecdysone. This study would provide an important foundation for investigating the mechanism underlying the transcriptional regulation of BmUSP in the silkworm.

  3. Novel and Functional DNA Sequence Variants within the GATA6 Gene Promoter in Ventricular Septal Defects

    Directory of Open Access Journals (Sweden)

    Chunyu Li

    2014-07-01

    Full Text Available Congenital heart disease (CHD is the most common birth defect in humans. Genetic causes and underlying molecular mechanisms for isolated CHD remain largely unknown. Studies have demonstrated that GATA transcription factor 6 (GATA6 plays an essential role in the heart development. Mutations in GATA6 gene have been associated with diverse types of CHD. As GATA6 functions in a dosage-dependent manner, we speculated that changed GATA6 levels, resulting from DNA sequence variants (DSVs within the gene regulatory regions, may mediate the CHD development. In the present study, GATA6 gene promoter was genetically and functionally analyzed in large groups of patients with ventricular septal defect (VSD (n = 359 and ethnic-matched healthy controls (n = 365. In total, 11 DSVs, including four SNPs, were identified in VSD patients and controls. Two novel and heterozygous DSVs, g.22169190A>T and g.22169311C>G, were identified in two VSD patients, but in none of controls. In cultured cardiomyocytes, the activities of the GATA6 gene promoter were significantly reduced by the DSVs g.22169190A>T and g.22169311C>G. Therefore, our findings suggested that the DSVs within the GATA6 gene promoter identified in VSD patients may change GATA6 levels, contributing to the VSD development as a risk factor.

  4. Methylation of the SLC6a2 gene promoter in major depression and panic disorder.

    Directory of Open Access Journals (Sweden)

    Richard Bayles

    Full Text Available Reduced function of the noradrenaline transporter (NET has been demonstrated in patients with major depressive disorder (MDD and panic disorder. Attempts to explain NET dysfunction in MDD and panic disorder by genetic variation in the NET gene SLC6a2 have been inconclusive. Transcriptional silencing of the SLC6a2 gene may be an alternative mechanism which can lead to NET dysfunction independent of DNA sequence. The objective of this study was to characterise the DNA methylation state of the SLC6a2 gene promoter in patients with MDD and panic disorder. SLC6a2 promoter methylation was also analysed before and after antidepressant treatment. This study was performed with DNA from blood, using bisulphite sequencing and EpiTYPER methylation analyses. Patients with MDD or panic disorder were not found to differ significantly from healthy controls in the pattern of methylation of the SLC6a2 gene promotor. While significant correlations between methylation levels at some CpG sites and physiological measures were identified, overall the variation in DNA methylation between patients was small, and the significance of this variation remains equivocal. No significant changes in SLC6a2 promoter methylation were observed in response to antidepressant treatment. Further in-depth analysis of alternative mechanisms of transcriptional regulation of the SLC6a2 gene in human health and disease would be of value.

  5. Validation study of genes with hypermethylated promoter regions associated with prostate cancer recurrence.

    Science.gov (United States)

    Stott-Miller, Marni; Zhao, Shanshan; Wright, Jonathan L; Kolb, Suzanne; Bibikova, Marina; Klotzle, Brandy; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

    2014-07-01

    One challenge in prostate cancer is distinguishing indolent from aggressive disease at diagnosis. DNA promoter hypermethylation is a frequent epigenetic event in prostate cancer, but few studies of DNA methylation in relation to features of more aggressive tumors or prostate cancer recurrence have been completed. We used the Infinium HumanMethylation450 BeadChip to assess DNA methylation in tumor tissue from 407 patients with clinically localized prostate cancer who underwent radical prostatectomy. Recurrence status was determined by follow-up patient surveys, medical record review, and linkage with the Surveillance, Epidemiology, and End Results (SEER) registry. The methylation status of 14 genes for which promoter hypermethylation was previously correlated with advanced disease or biochemical recurrence was evaluated. Average methylation level for promoter region CpGs in patients who recurred compared with those with no evidence of recurrence was analyzed. For two genes with differential methylation, time to recurrence was examined. During an average follow-up of 11.7 years, 104 (26%) patients recurred. Significant promoter hypermethylation in at least 50% of CpG sites in two genes, ABHD9 and HOXD3, was found in tumors from patients who recurred compared with those without recurrence. Evidence was strongest for HOXD3 (lowest P = 9.46 × 10(-6)), with higher average methylation across promoter region CpGs associated with reduced recurrence-free survival (P = 2 × 10(-4)). DNA methylation profiles did not differ by recurrence status for the other genes. These results validate the association between promoter hypermethylation of ADHB9 and HOXD3 and prostate cancer recurrence. Tumor DNA methylation profiling may help to distinguish patients with prostate cancer at higher risk for disease recurrence. ©2014 American Association for Cancer Research.

  6. Analysis of Promoters of Arabidopsis thaliana Divergent Gene Pair SERAT3;2 and IDH-III Shows SERAT3;2 Promoter is Nested Within the IDH-III Promoter.

    Science.gov (United States)

    Raipuria, Ritesh Kumar; Kumar, Vajinder; Guruprasad, Kadur Narayan; Bhat, Shripad Ramachandra

    2017-07-01

    Intergenic regions of divergent gene pairs show bidirectional promoter activity but whether regulatory sequences for gene expression in opposite directions are shared is not established. In this study, promoters of divergently arranged gene pair At4g35640-At4g35650 (SERAT3;2-IDH-III) of Arabidopsis thaliana were analyzed to identify overlapping regulatory regions. Both genes showed the highest expression in flower buds and flowers. 5' RACE experiments extended the intergenic region from 161 bp shown in TAIR annotation to 512 bp. GUS analysis of transgenic A. thaliana plants carrying the 691 bp fragment (512 bp intergenic region plus 5' UTR of both the genes) linked to uidA gene revealed that SERAT3;2 promoter drives gene expression in the tapetum, whereas IDH-III promoter functions specifically in microspores/pollen. Serial 5' deletion of the 691 bp fragment showed SERAT3;2 promoter extends up to -355 position, whereas IDH-III promoter encompasses the 512 bp intergenic region. In transgenics, uidA transcript levels were lower than native SERAT3;2 and IDH-III transcripts indicating presence of additional cis regulatory elements beyond the 691 bp fragment. The present study demonstrated for the first time occurrence of a nested promoter in plants and identified a novel bidirectional promoter capable of driving gene expression in tapetum and microspores/pollen.

  7. Genetic variation in TGF-beta 1 gene promoter and risk of gestational trophoblastic disease.

    Science.gov (United States)

    Dehaghani, Alamtaj Samsami; Zamanpour, Tarlan; Naeimi, Sirous; Sameni, Safoura; Robati, Minoo; Ghaderi, Abbas

    2010-01-01

    To examine the relationship of transforming growth factor beta 1 (TGF-beta 1) gene polymorphisms at promoter positions -509 (C/T) and -800 (G/A) with the risk of gestational trophoblastic disease (GTD) as compared to normal controls Polymerase chain reaction-restriction fragment length polymorphism was performed on peripheral blood of 102 patients with GTD and 124 normal, healthy, pregnant women as the control group. In this study, TGF-beta 1 gene polymorphisms at positions -509 (C/T) and -800 (G/A) failed to correlate with GTD. Our findings suggest that promoter gene polymorphisms of TGF-beta 1 do not play major roles in GTD and may not be risk factors for this disease.

  8. Single-nucleotide polymorphisms in the promoter region of the PARKIN gene and Parkinson's disease.

    Science.gov (United States)

    Mata, Ignacio F; Alvarez, Victoria; García-Moreira, Vanessa; Guisasola, Luis M; Ribacoba, René; Salvador, Carlos; Blázquez, Marta; Sarmiento, Rogelio González; Lahoz, Carlos H; Menes, Bernardino B; García, Eliecer Coto

    2002-08-30

    Mutations in the PARKIN gene have been identified in families with recessively inherited Parkinson disease (PD). Common DNA-polymorphisms at the PARKIN gene could contribute to the risk for PD in the general population. Here we searched for DNA-polymorphisms in the PARKIN promoter. We found two single nucleotide polymorphisms (-324 A/G and -797 A/G). In order to analyse the association of PD with these and two previously described polymorphisms (1281 G/A, Asp394Asn, and 601 G/A, Ser167Asn) we genotyped 105 patients and 150 healthy controls. Allele and genotype frequencies for the four polymorphisms did not differ between patients and controls, or between patients with an early-onset (40 years; n = 85). According to our data, the genetic variation at the PARKIN gene (including promoter polymorphisms) did not contribute to the risk of developing PD in the general population. Copyright 2002 Elsevier Science Ireland Ltd.

  9. Cloning and functional analysis of the chitinase gene promoter in peanut.

    Science.gov (United States)

    Chen, X L; Song, R T; Yu, M Y; Sui, J M; Wang, J S; Qiao, L X

    2015-10-19

    Chitinase is an important pathogenesis-related protein in plants, and it can accumulate when induced by salicylic acid (SA) or other elicitors. Here, we found that chitinase mRNA levels were 4.5-times greater when peanut seedlings were sprayed with 1.5 mM SA, as compared to water. The upstream promoter sequence of the chitinase gene was cloned by TAIL-PCR and the potential cis-regulatory elements in this promoter were predicted by the cis-element databases PLACE and plantCARE. Elements in the promoter related to SA induction and disease resistance response included AS-1, GT1-motif, GRWAAW, TGTCA, W-box, and WB-box. The full-length promoter (P) and a series of 5'-deleted promoters (P1-P5) were cloned and then substituted for the 35S promoter of pCAMBIA1301-xylA, which carries the xylose isomerase gene as the selectable marker and GUS as the reporter gene. Six plant expression vectors (pCAMBIA1301-xylA-P-pCAMBIA1301-xylA-P5) were obtained. The six expression vectors were then transferred into onion epidermal cells and peanut plants by Agrobacterium-mediated transformation. Both the full-length and deleted promoters resulted in GUS staining of the onion epidermis cells when induced by SA. In onion epidermis cells, GUS enzyme activity was greater after SA induction. In transgenic peanut plants, GUS mRNA levels were greater after SA induction. Consideration of the cis-regulatory elements predicted by PLACE and plantCARE suggested that AS-1, GRWAAW, and W-box are positive regulatory elements in P2 and P3 and that GT1-motif and TGTCA are negative regulatory elements between P and P2.

  10. High level transgenic expression of soybean (Glycine max GmERF and Gmubi gene promoters isolated by a novel promoter analysis pipeline

    Directory of Open Access Journals (Sweden)

    Jones Michelle L

    2010-11-01

    Full Text Available Abstract Background Although numerous factors can influence gene expression, promoters are perhaps the most important component of the regulatory control process. Promoter regions are often defined as a region upstream of the transcriptional start. They contain regulatory elements that interact with regulatory proteins to modulate gene expression. Most genes possess their own unique promoter and large numbers of promoters are therefore available for study. Unfortunately, relatively few promoters have been isolated and characterized; particularly from soybean (Glycine max. Results In this research, a bioinformatics approach was first performed to identify members of the Gmubi (G.max ubiquitin and the GmERF (G. max Ethylene Response Factor gene families of soybean. Ten Gmubi and ten GmERF promoters from selected genes were cloned upstream of the gfp gene and successfully characterized using rapid validation tools developed for both transient and stable expression. Quantification of promoter strength using transient expression in lima bean (Phaseolus lunatus cotyledonary tissue and stable expression in soybean hairy roots showed that the intensity of gfp gene expression was mostly conserved across the two expression systems. Seven of the ten Gmubi promoters yielded from 2- to 7-fold higher expression than a standard CaMV35S promoter while four of the ten GmERF promoters showed from 1.5- to 2.2-times higher GFP levels compared to the CaMV35S promoter. Quantification of GFP expression in stably-transformed hairy roots of soybean was variable among roots derived from different transformation events but consistent among secondary roots, derived from the same primary transformation events. Molecular analysis of hairy root events revealed a direct relationship between copy number and expression intensity; higher copy number events displayed higher GFP expression. Conclusion In this study, we present expression intensity data on 20 novel soybean promoters

  11. [Transcriptional targeting gene therapy of double suicide gene driven by hTERT promoter in hepatic carcinoma].

    Science.gov (United States)

    Fan, Wen-zhe; Yang, Jian-yong; Chen, Wei; Huang, Yong-hui; Wang, Yu; Zhang, Ying-qiang; Li, Jia-ping

    2011-11-22

    To examine the selective killing effects of pEGFP-C1-mediated double suicide gene system driven by the hTERT promoter (hTERT-CDglyTK) on hepatic carcinoma cells. The hTERT promoter and gene fragments SV40, yCD and TKgly were amplified by PCR (polymerase chain reaction) and then inserted into pEGFP-C1. And the constructs of pEGFP-hTERT-CD, pEGFP-hTERT-TK and pEGFP-hTERT-CDglyTK were transfected to SMMC 7721 or HL7702 respectively. The transfection effects were observed and the cellular expressions of suicide genes detected by RT-PCR (reverse transcription-polymerase chain reaction), QPCR (quantitative polymerase chain reaction) and Western blot. The transfected cells were treated with 5-fluorocytosine and ganciclovir at different concentrations and the cell-killing and bystander effects evaluated by the method of MTT (3-(4,5)-dimethyl thiadiazole (-z-y1)-3,5-di-phenytetrazoliumromide). The activity of cell telomerase was detected by the method of TRAP-argentation and the apoptotic rates analyzed by flow cytometry. All results of double and single gene systems were analyzed. The fragments of enzyme digestion corresponded to the expectations. RT-PCR, QPCR and Western blot demonstrated the expressions of CD, TK and CDglyTK. pEGFP-hTERT-CD, pEGFP-hTERT-TK and pEGFP-hTERT-CDglyTK showed the similar transfection efficiencies in SMMC7721 (74.5%, 76.3%, 76.9%). More sensitive to the prodrugs (P = 0.020, P = 0.015), higher apoptotic rates (P = 0.023, P = 0.017) and bystander effects (P = 0.012, P = 0.001)and lower telomerase activities (P = 0.045, P = 0.038) were observed in double gene system versus those in single gene system. However, the transfection and growth of HL7702 cell could not be infected by this double suicide gene. The plasmid of CDglyTK fusion gene system driven by hTERT promoter has been successfully constructed. It has demonstrated highly specific killing effects on hepatic carcinoma cells.

  12. Myocardial Gene Expression of T-bet, GATA-3, Ror-γt, FoxP3, and Hallmark Cytokines in Chronic Chagas Disease Cardiomyopathy: An Essentially Unopposed TH1-Type Response

    Directory of Open Access Journals (Sweden)

    Luciana Gabriel Nogueira

    2014-01-01

    Full Text Available Background. Chronic Chagas disease cardiomyopathy (CCC, a late consequence of Trypanosoma cruzi infection, is an inflammatory cardiomyopathy with prognosis worse than those of noninflammatory etiology (NIC. Although the T cell-rich myocarditis is known to play a pathogenetic role, the relative contribution of each of the functional T cell subsets has never been thoroughly investigated. We therefore assessed gene expression of cytokines and transcription factors involved in differentiation and effector function of each functional T cell subset (TH1/TH2/TH17/Treg in CCC, NIC, and heart donor myocardial samples. Methods and Results. Quantitative PCR showed markedly upregulated expression of IFN-γ and transcription factor T-bet, and minor increases of GATA-3; FoxP3 and CTLA-4; IL-17 and IL-18 in CCC as compared with NIC samples. Conversely, cytokines expressed by TH2 cells (IL-4, IL-5, and IL-13 or associated with Treg (TGF-β and IL-10 were not upregulated in CCC myocardium. Expression of TH1-related genes such as T-bet, IFN-γ, and IL-18 correlated with ventricular dilation, FoxP3, and CTLA-4. Conclusions. Results are consistent with a strong local TH1-mediated response in most samples, possibly associated with pathological myocardial remodeling, and a proportionally smaller FoxP3+CTLA4+ Treg cell population, which is unable to completely curb IFN-γ production in CCC myocardium, therefore fueling inflammation.

  13. Selective suicide gene therapy of colon cancer exploiting the urokinase plasminogen activator receptor promoter.

    Science.gov (United States)

    Teimoori-Toolabi, Ladan; Azadmanesh, Kayhan; Amanzadeh, Amir; Zeinali, Sirous

    2010-04-01

    Colon cancer is the third and fourth most prevalent cancer among Iranian men and women, respectively. Suicide gene therapy is one of the alternative therapeutic modalities for cancer. The application of specific promoters for therapeutic genes should decrease the adverse effects of this modality. The combined aims of this study were to design a specific suicide gene therapy construct for colon cancer and study its effect in distinct representatives of transformed and nontransformed cells. The KRAS oncogene signaling pathway is one of the most important signaling pathways activated in colon cancer; therefore, we inserted the urokinase plasminogen activator receptor (uPAR; PLAUR gene) promoter as one of the upregulated promoters by this pathway upstream of a suicide gene (thymidine kinase [TK]) and a reporter gene (beta-galactosidase, beta-gal [LacZ]). This promoter is a natural combination of different motifs responsive to the RAS signaling pathway, such as the transcription factors AP1 (FOS/JUN), SP1, SP3, and AP2alpha, and nuclear factor kappa B (NFkappaB). The reporter plasmid under the control of the uPAR promoter (PUCUPARLacZ) had the ability to express beta-gal in colon cancer cells (human colon adenocarcinoma [SW480] and human colorectal carcinoma [HCT116] cell lines), while it could not express beta-gal in nontransformed human umbilical vein endothelial cells (HUVEC) and normal colon cells. After confirming the ability of pUCUPARTK (suicide plasmid) to express TK in SW480 and HCT116 cells by real-time PCR, cytotoxicity assays showed that pUCUPARTK decreased the viability of these cells in the presence of ganciclovir 20 and 40 microg/mL (and higher), respectively. Although M30 CytoDEATH antibody could not detect a significant rate of apoptosis induced by ganciclovir in pUCUPARTK-transfected HCT116 cells, the percentage of stained cells was marked in comparison with untreated cells. While this antibody could detect apoptosis in HCT116 cell line transfected

  14. Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

    Science.gov (United States)

    Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

    2013-01-01

    In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

  15. Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

    Directory of Open Access Journals (Sweden)

    Ravikanth Danda

    Full Text Available In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM promoter (EGP-2 that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB, a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve/let-7b(down-regulated, EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve/let-7b(up-regulated, and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve/let-7b(up-regulated in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

  16. Comparative Genomic Analysis of the Streptococcus dysgalactiae Species Group: Gene Content, Molecular Adaptation, and Promoter Evolution

    Science.gov (United States)

    Suzuki, Haruo; Lefébure, Tristan; Hubisz, Melissa Jane; Pavinski Bitar, Paulina; Lang, Ping; Siepel, Adam; Stanhope, Michael J.

    2011-01-01

    Comparative genomics of closely related bacterial species with different pathogenesis and host preference can provide a means of identifying the specifics of adaptive differences. Streptococcus dysgalactiae (SD) is comprised of two subspecies: S. dysgalactiae subsp. equisimilis is both a human commensal organism and a human pathogen, and S. dysgalactiae subsp. dysgalactiae is strictly an animal pathogen. Here, we present complete genome sequences for both taxa, with analyses involving other species of Streptococcus but focusing on adaptation in the SD species group. We found little evidence for enrichment in biochemical categories of genes carried by each SD strain, however, differences in the virulence gene repertoire were apparent. Some of the differences could be ascribed to prophage and integrative conjugative elements. We identified approximately 9% of the nonrecombinant core genome to be under positive selection, some of which involved known virulence factors in other bacteria. Analyses of proteomes by pooling data across genes, by biochemical category, clade, or branch, provided evidence for increased rates of evolution in several gene categories, as well as external branches of the tree. Promoters were primarily evolving under purifying selection but with certain categories of genes evolving faster. Many of these fast-evolving categories were the same as those associated with rapid evolution in proteins. Overall, these results suggest that adaptation to changing environments and new hosts in the SD species group has involved the acquisition of key virulence genes along with selection of orthologous protein-coding loci and operon promoters. PMID:21282711

  17. Nanoalumina promotes the horizontal transfer of multiresistance genes mediated by plasmids across genera.

    Science.gov (United States)

    Qiu, Zhigang; Yu, Yunmei; Chen, Zhaoli; Jin, Min; Yang, Dong; Zhao, Zuguo; Wang, Jingfeng; Shen, Zhiqiang; Wang, Xinwei; Qian, Di; Huang, Aihua; Zhang, Buchang; Li, Jun-Wen

    2012-03-27

    Antibiotic resistance is a worldwide public health concern. Conjugative transfer between closely related strains or species of bacteria is an important method for the horizontal transfer of multidrug-resistance genes. The extent to which nanomaterials are able to cause an increase in antibiotic resistance by the regulation of the conjugative transfer of antibiotic-resistance genes in bacteria, especially across genera, is still unknown. Here we show that nanomaterials in water can significantly promote the horizontal conjugative transfer of multidrug-resistance genes mediated by the RP4, RK2, and pCF10 plasmids. Nanoalumina can promote the conjugative transfer of the RP4 plasmid from Escherichia coli to Salmonella spp. by up to 200-fold compared with untreated cells. We also explored the mechanisms behind this phenomenon and demonstrate that nanoalumina is able to induce oxidative stress, damage bacterial cell membranes, enhance the expression of mating pair formation genes and DNA transfer and replication genes, and depress the expression of global regulatory genes that regulate the conjugative transfer of RP4. These findings are important in assessing the risk of nanomaterials to the environment, particularly from water and wastewater treatment systems, and in the estimation of the effect of manufacture and use of nanomaterials on the environment.

  18. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  19. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  20. Dynamic regulation of gene expression using sucrose responsive promoters and RNA interference in Saccharomyces cerevisiae.

    Science.gov (United States)

    Williams, Thomas C; Espinosa, Monica I; Nielsen, Lars K; Vickers, Claudia E

    2015-04-01

    Engineering dynamic, environmentally- and temporally-responsive control of gene expression is one of the principle objectives in the field of synthetic biology. Dynamic regulation is desirable because many engineered functions conflict with endogenous processes which have evolved to facilitate growth and survival, and minimising conflict between growth and production phases can improve product titres in microbial cell factories. There are a limited number of mechanisms that enable dynamic regulation in yeast, and fewer still that are appropriate for application in an industrial setting. To address this problem we have identified promoters that are repressed during growth on glucose, and activated during growth on sucrose. Catabolite repression and preferential glucose utilisation allows active growth on glucose before switching to production on sucrose. Using sucrose as an activator of gene expression circumvents the need for expensive inducer compounds and enables gene expression to be triggered during growth on a fermentable, high energy-yield carbon source. The ability to fine-tune the timing and population density at which gene expression is activated from the SUC2 promoter was demonstrated by varying the ratio of glucose to sucrose in the growth medium. Finally, we demonstrated that the system could also be used to repress gene expression (a process also required for many engineering projects). We used the glucose/sucrose system to control a heterologous RNA interference module and dynamically repress the expression of a constitutively regulated GFP gene. The low noise levels and high dynamic range of the SUC2 promoter make it a promising option for implementing dynamic regulation in yeast. The capacity to repress gene expression using RNA interference makes the system highly versatile, with great potential for metabolic engineering applications.

  1. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  2. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  3. A novel method for the determination of basal gene expression of tissue-specific promoters: an analysis of prostate-specific promoters.

    Science.gov (United States)

    van der Poel, H G; McCadden, J; Verhaegh, G W; Kruszewski, M; Ferrer, F; Schalken, J A; Carducci, M; Rodriguez, R

    2001-12-01

    Because the toxicity of suicide gene therapeutics is directly related to basal promoter activity, we developed an assay to test for promoter "leakiness" using a diphtheria toxin mutant. Sequences of 15 prostate-specific gene promoter constructs were cloned in an expression plasmid (pBK; Stratagene, La Jolla, CA) backbone driving expression of an attenuated mutant of diphtheria toxin A (tox176). Low expression levels of the DT-tox176 result in significant protein synthesis inhibition reflected by a decreased expression of the luciferase activity of a simultaneously transfected CMV luciferase construct. ID50 (dose of plasmid with 50% luciferase inhibition) was calculated for each promoter construct in different cell lines. Highest transactivational activity (ID50 CN65 (PSA promoter/enhancer) and PSE-hK2 (PSA enhancer and basal human kallikrein 2 promoter) in HEK293 and DLD cells indicating "leakiness" of these promoter constructs. Low basal promoter activity in nonprostate cell lines was found for the minimal PSA promoter, hK2, DD3, and OC promoters. The DT-tox176 assay can better predict basal promoter activity compared to less sensitive dual luciferase assay.

  4. Aromatase (CYP19) promoter gene polymorphism and risk of nonviral hepatitis-related hepatocellular carcinoma.

    Science.gov (United States)

    Koh, Woon-Puay; Yuan, Jian-Min; Wang, Renwei; Govindarajan, Sugantha; Oppenheimer, Rowena; Zhang, Zhen Quan; Yu, Mimi C; Ingles, Sue Ann

    2011-08-01

    Experimental studies suggest that sex hormones may induce or promote the development of hepatocellular carcinoma (HCC). Androgens are converted to estrogens by the CYP19 gene product, aromatase. Hepatic aromatase level and activity have been shown to be markedly elevated in HCC. Aromatase expression in liver tumors is driven by a promoter upstream of CYP19 exon I.6. First, the authors identified an A/C polymorphism in the exon I.6 promoter of the CYP19 gene. To determine whether allelic variants in the CYP19 I.6 promoter differ in their ability to drive gene expression, we carried out an in vitro reporter gene assay. Then, the authors studied the association between this polymorphism and HCC risk in 2 complementary case-control studies: 1 in high-risk southern Guangxi, China, and another in low-risk US non-Asians of Los Angeles County. Transcriptional activity was 60% higher for promoter vectors carrying the rs10459592 C allele compared with those carrying an A allele (P = .007). In both study populations, among subjects negative for at-risk serologic markers of hepatitis B or C, there was a dose-dependent association between number of high activity C allele and risk of HCC (P(trend) = .014). Risk of HCC was significantly higher (odds ratio [OR], 2.25; 95% confidence interval (CI), 1.18-4.31) in subjects homozygous for the C allele compared with those homozygous for the A allele. This study provides epidemiologic evidence for the role of hepatic aromatization of androgen into estrogen in the development of nonviral hepatitis-related HCC. Copyright © 2011 American Cancer Society.

  5. Myeloid translocation gene-16 co-repressor promotes degradation of hypoxia-inducible factor 1.

    Directory of Open Access Journals (Sweden)

    Parveen Kumar

    Full Text Available The myeloid translocation gene 16 (MTG16 co-repressor down regulates expression of multiple glycolytic genes, which are targets of the hypoxia-inducible factor 1 (HIF1 heterodimer transcription factor that is composed of oxygen-regulated labile HIF1α and stable HIF1β subunits. For this reason, we investigated whether MTG16 might regulate HIF1 negatively contributing to inhibition of glycolysis and stimulation of mitochondrial respiration. A doxycycline Tet-On system was used to control levels of MTG16 in B-lymphoblastic Raji cells. Results from co-association studies revealed MTG16 to interact with HIF1α. The co-association required intact N-terminal MTG16 residues including Nervy Homology Region 1 (NHR1. Furthermore, electrophoretic mobility shift assays demonstrated an association of MTG16 with hypoxia response elements (HREs in PFKFB3, PFKFB4 and PDK1 promoters in-vitro. Results from chromatin immunoprecipitation assays revealed co-occupancy of these and other glycolytic gene promoters by HIF1α, HIF1β and MTG16 in agreement with possible involvement of these proteins in regulation of glycolytic target genes. In addition, MTG16 interacted with prolyl hydroxylase D2 and promoted ubiquitination and proteasomal degradation of HIF1α. Our findings broaden the area of MTG co-repressor functions and reveal MTG16 to be part of a protein complex that controls the levels of HIF1α.

  6. Histone deacetylase inhibition modulates histone acetylation at gene promoter regions and affects genome-wide gene transcription in Schistosoma mansoni.

    Directory of Open Access Journals (Sweden)

    Letícia Anderson

    2017-04-01

    Full Text Available Schistosomiasis is a parasitic disease infecting hundreds of millions of people worldwide. Treatment depends on a single drug, praziquantel, which kills the Schistosoma spp. parasite only at the adult stage. HDAC inhibitors (HDACi such as Trichostatin A (TSA induce parasite mortality in vitro (schistosomula and adult worms, however the downstream effects of histone hyperacetylation on the parasite are not known.TSA treatment of adult worms in vitro increased histone acetylation at H3K9ac and H3K14ac, which are transcription activation marks, not affecting the unrelated transcription repression mark H3K27me3. We investigated the effect of TSA HDACi on schistosomula gene expression at three different time points, finding a marked genome-wide change in the transcriptome profile. Gene transcription activity was correlated with changes on the chromatin acetylation mark at gene promoter regions. Moreover, combining expression data with ChIP-Seq public data for schistosomula, we found that differentially expressed genes having the H3K4me3 mark at their promoter region in general showed transcription activation upon HDACi treatment, compared with those without the mark, which showed transcription down-regulation. Affected genes are enriched for DNA replication processes, most of them being up-regulated. Twenty out of 22 genes encoding proteins involved in reducing reactive oxygen species accumulation were down-regulated. Dozens of genes encoding proteins with histone reader motifs were changed, including SmEED from the PRC2 complex. We targeted SmEZH2 methyltransferase PRC2 component with a new EZH2 inhibitor (GSK343 and showed a synergistic effect with TSA, significantly increasing schistosomula mortality.Genome-wide gene expression analyses have identified important pathways and cellular functions that were affected and may explain the schistosomicidal effect of TSA HDACi. The change in expression of dozens of histone reader genes involved in

  7. Expression of multi-functional cellulase gene mfc in Coprinus cinereus under control of different basidiomycete promoters.

    Science.gov (United States)

    Cheng, Shujie; Yang, Peizhou; Guo, Liqiong; Lin, Junfang; Lou, Nannan

    2009-10-01

    Multi-functional cellulase gene mfc was expressed in Coprinus cinereus under naturally non-inductive conditions using three heterologous promoters. Endo-beta-1,4-glucanase expression was achieved in solid and liquid media with promoter sequences from the Lentinula edodesgpd gene, the Flammulina velutipes gpd gene and the Volvariella volvaceagpd gene. As measured by enzyme activity in liquid cultures, a 613-bp gpd promoter fragment from L. edodes was most efficient, followed by a 752-bp gpd fragment from F. velutipes. The V. volvacea gpd promoter sequence was less active, in comparison. Irrespective of the promoter used, enzymatic activities increase 34-fold for highly active transformants and 29-fold for less active one by using cellulase-inducing medium. The highest activities of endo-beta-1,4-glucanase (34.234 U/ml) and endo-beta-1,4-xylanase (263.695 U/ml) were reached by using the L. edodesgpd promoter.

  8. Chicken Ovalbumin Upstream Promoter Transcription Factor II Regulates Renin Gene Expression*

    Science.gov (United States)

    Mayer, Sandra; Roeser, Marc; Lachmann, Peter; Ishii, Sumiyashi; Suh, Jae Mi; Harlander, Sabine; Desch, Michael; Brunssen, Coy; Morawietz, Henning; Tsai, Sophia Y.; Tsai, Ming-Jer; Hohenstein, Bernd; Hugo, Christian; Todorov, Vladimir T.

    2012-01-01

    This study aimed to investigate the possible involvement of the orphan nuclear receptor chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) in the regulation of renin gene expression. COUP-TFII colocalized with renin in the juxtaglomerular cells of the kidney, which are the main source of renin in vivo. Protein-DNA binding studies demonstrated that COUP-TFII binds to an imperfect direct repeat COUP-TFII recognition sequence (termed hereafter proxDR) in the proximal renin promoter. Because cAMP signaling plays a central role in the control of the renin gene expression, we suggested that COUP-TFII may modulate this cAMP effect. Accordingly, knockdown of COUP-TFII in the clonal renin-producing cell lines As4.1 and Calu-6 diminished the stimulation of the renin mRNA expression by cAMP agonists. In addition, the mutation of the proxDR element in renin promoter reporter gene constructs abrogated the inducibility by cAMP. The proxDR sequence was found to be necessary for the function of a proximal renin promoter cAMP-response element (CRE). Knockdown of COUP-TFII or cAMP-binding protein (CREB), which is the archetypal transcription factor binding to CRE, decreased the basal renin gene expression. However, the deficiency of COUP-TFII did not further diminish the renin expression when CREB was knocked down. In agreement with the cell culture studies, mutant mice deficient in COUP-TFII have lower renin expression than their control strain. Altogether our data show that COUP-TFII is involved in the control of renin gene expression. PMID:22645148

  9. Functional characterization of a promoter region in the human MEN1 tumor suppressor gene.

    Science.gov (United States)

    Fromaget, Maud; Vercherat, Cécile; Zhang, Chang X; Zablewska, Barbara; Gaudray, Patrick; Chayvialle, Jean-Alain; Calender, Alain; Cordier-Bussat, Martine

    2003-10-10

    Our previous studies on the human MEN1 (multiple endocrine neoplasia type 1) gene revealed heterogeneity of MEN1 2.8 kb transcripts related to variation in their 5' UTR only. Six distinct exons 1 (e1A-e1F) were isolated that suggested the existence of multiple but not already identified transcriptional start sites (TSS) and of a complex transcriptional control. Identification of a minimal promoter region and its adjacent regulatory regions appears an inescapable step to the understanding of MEN1 gene transcriptional regulation in normal and pathological situations. For this purpose, we subcloned the approximately 2000 bp region situated directly upstream of the exon 2 in front of a luciferase reporter gene, and we analyzed functional consequences of 5' and 3' serial deletions, comparatively in a series of endocrine versus non-endocrine cell lines. Primer extension and RPA experiments demonstrate that in HEK293 cells transcription initiated simultaneously at several points in endogenous MEN1 promoter as well as in transfected promoter fragments in reporter plasmids, mainly in Inr elements that are efficiently employed to synthetize previously described exons e1A-e1D. Functional consequences of TSS deletion are directly related to cellular context. The minimal promoter region is localized between -135 and -36. Five large adjacent cis-regulatory regions (UR1-UR5) exist upstream of this minimal promoter region, whose activity depend not only on the cellular context but also on the presence of a downstream sequence DR1. Five small cis-regulatory elements (C1-C5) are localized between -325 and -107. Overexpression of exogenous menin, the MEN1 gene's product, in mouse embryonic fibroblasts from Men1(-/-) knock-out mice dose-dependently decreases MEN1 promoter activity, through sequences surrounding the minimal promoter. Our data highlight the existence of a complex transcriptional regulation of the MEN1 gene, whose activity is clearly modulated depending not only on the

  10. Osa associates with the Brahma chromatin remodeling complex and promotes the activation of some target genes.

    Science.gov (United States)

    Collins, R T; Furukawa, T; Tanese, N; Treisman, J E

    1999-01-01

    The yeast SWI/SNF complex and its Drosophila and mammalian homologs are thought to control gene expression by altering chromatin structure, but the mechanism and specificity of this process are not fully understood. The Drosophila osa gene, like yeast SWI1, encodes an AT-rich interaction (ARID) domain protein. We present genetic and biochemical evidence that Osa is a component of the Brahma complex, the Drosophila homolog of SWI/SNF. The ARID domain of Osa binds DNA without sequence specificity in vitro, but it is sufficient to direct transcriptional regulatory domains to specific target genes in vivo. Endogenous Osa appears to promote the activation of some of these genes. We show evidence that some Brahma-containing complexes do not contain Osa and that Osa is not required to localize Brahma to chromatin. These data suggest that Osa modulates the function of the Brahma complex. PMID:10601025

  11. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  12. Local regulation of gene expression by lncRNA promoters, transcription and splicing.

    Science.gov (United States)

    Engreitz, Jesse M; Haines, Jenna E; Perez, Elizabeth M; Munson, Glen; Chen, Jenny; Kane, Michael; McDonel, Patrick E; Guttman, Mitchell; Lander, Eric S

    2016-11-17

    Mammalian genomes are pervasively transcribed to produce thousands of long non-coding RNAs (lncRNAs). A few of these lncRNAs have been shown to recruit regulatory complexes through RNA-protein interactions to influence the expression of nearby genes, and it has been suggested that many other lncRNAs can also act as local regulators. Such local functions could explain the observation that lncRNA expression is often correlated with the expression of nearby genes. However, these correlations have been challenging to dissect and could alternatively result from processes that are not mediated by the lncRNA transcripts themselves. For example, some gene promoters have been proposed to have dual functions as enhancers, and the process of transcription itself may contribute to gene regulation by recruiting activating factors or remodelling nucleosomes. Here we use genetic manipulation in mouse cell lines to dissect 12 genomic loci that produce lncRNAs and find that 5 of these loci influence the expression of a neighbouring gene in cis. Notably, none of these effects requires the specific lncRNA transcripts themselves and instead involves general processes associated with their production, including enhancer-like activity of gene promoters, the process of transcription, and the splicing of the transcript. Furthermore, such effects are not limited to lncRNA loci: we find that four out of six protein-coding loci also influence the expression of a neighbour. These results demonstrate that cross-talk among neighbouring genes is a prevalent phenomenon that can involve multiple mechanisms and cis-regulatory signals, including a role for RNA splice sites. These mechanisms may explain the function and evolution of some genomic loci that produce lncRNAs and broadly contribute to the regulation of both coding and non-coding genes.

  13. Rat tenascin-R gene: structure, chromosome location and transcriptional activity of promoter and exon 1.

    Science.gov (United States)

    Leprini, A; Gherzi, R; Vecchi, E; Borsi, L; Zardi, L; Siri, A

    1998-01-01

    Tenascin-R is an extracellular matrix protein expressed exclusively in the central nervous system where it is thought to play a relevant role in regulating neurite outgrowth. We have i) cloned the cDNA of the rat tenascin-R 5' region; ii) defined its genomic organization, obtaining the sequence of two novel untranslated exons; iii) mapped the gene to rat chromosome 13q23 and suggested a previously unreported synteny between rat chromosome 13q23, human chromosome 1q24, and mouse chromosome 4E; and iv) sequenced and characterized the elements responsible for its neural cell-restricted transcription. We found that two discrete regions of the rat gene (the first in the proximal promoter, the second in the first exon) are independently able to activate to a high degree the transcription of a reporter gene in either human or rat neuroblastoma cell lines but not in other cell lines. Based on this observation, we re-evaluated the arrangement of transcriptionally active regions in the human tenascin-R gene we recently cloned and found that the human gene also contains an exon sequence able to initiate and sustain transcription independently of promoter sequences.

  14. A promoter polymorphism of the alpha2-HS glycoprotein gene is associated with its transcriptional activity.

    Science.gov (United States)

    Inoue, Mari; Takata, Hiroshi; Ikeda, Yukio; Suehiro, Tadashi; Inada, Shojiro; Osaki, Fumiaki; Arii, Kaoru; Kumon, Yoshitaka; Hashimoto, Kozo

    2008-01-01

    alpha2-Heremans Schmid glycoprotein (AHSG), also designated fetuin-A, is an abundant plasma protein that is expressed in hepatocytes. AHSG/fetuin-A has diverse biological functions including regulation of calcium homeostasis and inhibition of insulin receptor tyrosine kinase activity. The aim of this study was to detect single nucleotide polymorphisms (SNPs) of the AHSG gene that can be involved in regulation of AHSG/fetuin-A expression. By a cycle sequencing method, two common SNPs in the promoter region of AHSG gene, -799A/T (rs2248690, dbSNP ID) and -425G/T (rs2077119), were identified. A reporter gene assay using HepG2 cells showed that the -799A allele had significantly higher promoter activity compared with the -799T allele. The overexpression of c-Fos/c-Jun significantly repressed transcriptional activity and a gel shift assay showed that the -799T DNA fragment had a greater affinity for transcription factor AP-1 than the -799A. In 40 unrelated healthy subjects, serum AHSG/fetuin-A levels increased with the following order of genotypes: -799TTAHSG gene affects the AHSG gene transcription, possibly by producing different association with AP-1.

  15. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  16. Saturation mutagenesis of the TATA box and upstream activator sequence in the haloarchaeal bop gene promoter.

    Science.gov (United States)

    Baliga, N S; DasSarma, S

    1999-04-01

    Degenerate oligonucleotides were used to randomize 21 bp of the 53-bp minimal bop promoter in three 7-bp segments, including the putative TATA box and the upstream activator sequence (UAS). The mutagenized bop promoter and the wild-type structural gene and transcriptional terminator were inserted into a shuttle plasmid capable of replication in the halophilic archaeon Halobacterium sp. strain S9. Active promoters were isolated by screening transformants of an orange (Pum- bop) Halobacterium mutant for purple (Pum+ bop+) colonies on agar plates and analyzed for bop mRNA and/or bacteriorhodopsin content. Sequence analysis yielded the consensus sequence 5'-tyT(T/a)Ta-3', corresponding to the promoter TATA box element 30 to 25 bp 5' of the transcription start site. A putative UAS, 5'-ACCcnactagTTnG-3', located 52 to 39 bp 5' of the transcription start site was found to be conserved in active promoters. This study provides direct evidence for the requirement of the TATA box and UAS for bop promoter activity.

  17. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    ABSTRACT: INTRODUCTION: In a cross between the susceptible B10.RIII (H-2r) and resistant RIIIS/J (H-2r) mouse strains, a locus on mouse chromosome 5 (Eae39) was previously shown to control experimental autoimmune encephalomyelitis (EAE). Recently, quantitative trait loci (QTL), linked to disease...... with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease...

  18. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  19. Association between Osteopontin Promoter Gene Polymorphisms and Haplotypes with Risk of Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Balneek Singh Cheema

    2015-06-01

    Full Text Available Background: Osteopontin (OPN C-443T promoter polymorphism has been shown as a genetic risk factor for diabetic nephropathy (DN in type 2 diabetic patients (T2D. Methods: In the present study we investigated the association of three functional promoter gene polymorphisms C-443T, delG-156G, and G-66T and their haplotypes with the risk of DN and estimated Glomerular Filtration Rate (eGFR in Asian Indians T2D patients using Real time PCR based Taqman assay. A total of 1165 T2D patients, belonging to two independently ascertained Indian Asian cohorts, were genotyped for three OPN promoter polymorphisms C-443T (rs11730582, delG-156G (rs17524488 and G-66T (rs28357094. Results: -156G allele and GG genotypes (delG-156G and haplotypes G-C-G and T-C-G (G-66T, C-443T, delG-156G were associated with decreased risk of DN and higher eGFR. Haplotype G-T-delG and T-T-delG (G-66T, C-443T, delG-156G were identified as risk haplotypes, as shown by lower eGFR. Conclusion: This is the first study to report an association of OPN promoter gene polymorphisms; G-66T and delG-156G and their haplotypes with DN in T2D. Our results suggest an association between OPN promoter gene polymorphisms and their haplotypes with DN.

  20. Genetic association of IL-10 gene promoter polymorphism and HIV-1 infection in North Indians.

    Science.gov (United States)

    Chatterjee, Animesh; Rathore, Anurag; Sivarama, P; Yamamoto, Naohiko; Dhole, Tapan N

    2009-01-01

    Cytokines play a significant role in host immune defense. IL-10 is an anti-inflammatory, immunomodulatory cytokine that can both stimulate and suppress the immune response and inhibits HIV-1 replication in vivo. Interindividual variations in IL-10 production were genetically contributed to polymorphisms within IL-10 promoter region. The aim of this study was to investigate the association of IL-10 gene promoter -1082 G/A, -819 C/T, and 592 C/A polymorphism on HIV-1 transmission /progression in North Indian individuals. A total of 180 HIV-1 seropositive (HSP) stratified on the basis of disease severity (stage I, II, and III), 50 HIV-1 exposed seronegative (HES) and 305 HIV-1 seronegative (HSN) individuals were genotyped for IL-10 gene promoter by polymerase chain reaction-restriction fragment length polymorphism. A suggestive evidence of association was obtained for IL-10 592 C/A promoter polymorphism at the level of allele and genotype distribution. The frequency of IL-10 592 A allele and genotype was significantly increased in HSP compared to HSN (p = 0.013; OR = 1.412 and p = 0.034; OR = 1.685 respectively). Further comparison in between different clinical stages of HIV-1 infected patients of IL-10 592 A allele and genotype revealed a significant increase in its frequency in the stage III compared with those together in stage I (p = 0.004, OR = 2.181 and p = 0.002, OR = 4.156, respectively). This study reports for the first time that IL-10 gene promoter 592 C/A polymorphism may be a risk factor for HIV-1 transmission/progression in HIV-1 infected North Indian individuals.

  1. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  2. Functional genetic variants within the SIRT2 gene promoter in type 2 diabetes mellitus.

    Science.gov (United States)

    Liu, Tingting; Yang, Wentao; Pang, Shuchao; Yu, Shipeng; Yan, Bo

    2018-01-22

    Type 2 diabetes mellitus (T2D) is a common and complex metabolic diseases caused by interactions between environmental and genetic factors. Genome-wide association studies have identified more than 80 common genetic variants for T2D, which account for only ∼10% of the heritability of T2D cases. SIRT2, a member of NAD(+)-dependent class III deacetylases, is involved in genomic stability, metabolism, inflammation, oxidative stress and autophagy. In maintaining metabolic homeostasis, SIRT2 regulates adipocyte differentiation, fatty acid oxidation, gluconeogenesis, and insulin sensitivity. Thus, we hypothesized that DNA sequence variants (DSVs) in SIRT2 gene promoter may change SIRT2 levels, contributing to T2D. SIRT2 gene promoter was genetically and functionally analyzed in large cohorts of T2D patients (n=365) and ethnic-matched controls (n=358). A total of 18 DSVs, including 5 SNPs, were identified in this study. Four novel heterozygous DSVs (g.38900912G>T, g.38900561C>T, g.38900359C>T and g.38900237G>A) were identified in four T2D patients, three of which (g.38900912G>T, g.38900359C>T and g.38900237G>A) significantly increased the transcriptional activity of the SIRT2 gene promoter in cultured pancreatic beta cells (P0.05). Our findings suggested that the DSVs may increase SIRT2 gene promoter activity and SIRT2 levels, contributing to T2D development as a risk factor. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  4. Wood Smoke Exposure and Gene Promoter Methylation Are Associated with Increased Risk for COPD in Smokers

    Science.gov (United States)

    Sood, Akshay; Petersen, Hans; Blanchette, Christopher M.; Meek, Paula; Picchi, Maria A.; Belinsky, Steven A.; Tesfaigzi, Yohannes

    2010-01-01

    Rationale: Wood smoke–associated chronic obstructive pulmonary disease (COPD) is common in women in developing countries but has not been adequately described in developed countries. Objectives: Our objective was to determine whether wood smoke exposure was a risk factor for COPD in a population of smokers in the United States and whether aberrant gene promoter methylation in sputum may modify this association. Methods: For this cross-sectional study, 1,827 subjects were drawn from the Lovelace Smokers' Cohort, a predominantly female cohort of smokers. Wood smoke exposure was self-reported. Postbronchodilator spirometry was obtained, and COPD outcomes studied included percent predicted FEV1, airflow obstruction, and chronic bronchitis. Effect modification of wood smoke exposure with current cigarette smoke, ethnicity, sex, and promoter methylation of lung cancer-related genes in sputum on COPD outcomes were separately explored. Multivariable logistic and poisson regression models were used for binary and rate-based outcomes, respectively. Measurements and Main Results: Self-reported wood smoke exposure was independently associated with a lower percent predicted FEV1 (point estimate [± SE] −0.03 ± 0.01) and a higher prevalence of airflow obstruction and chronic bronchitis (odds ratio, 1.96; 95% confidence interval, 1.52–2.52 and 1.64 (95% confidence interval, 1.31–2.06, respectively). These associations were stronger among current cigarette smokers, non-Hispanic whites, and men. Wood smoke exposure interacted in a multiplicative manner with aberrant promoter methylation of the p16 or GATA4 genes on lower percent predicted FEV1. Conclusions: These studies identify a novel link between wood smoke exposure and gene promoter methylation that synergistically increases the risk for reduced lung function in cigarette smokers. PMID:20595226

  5. Remodeling epigenetic modifications at tumor suppressor gene promoters with bovine oocyte extract.

    Science.gov (United States)

    Wang, Zhenfei; Yue, Yongli; Han, Pengyong; Sa, Rula; Ren, Xiaolv; Wang, Jie; Bai, Haidong; Yu, Haiquan

    2013-09-01

    Epigenetic silencing of tumor suppressor genes by aberrant DNA methylation and histone modifications at their promoter regions plays an important role in the initiation and progression of cancer. The therapeutic effect of the widely used epigenetic drugs, including DNA methyltransferase inhibitors and histone deacetylase inhibitors, remains unsatisfactory. One important underlying factor in the ineffectiveness of these drugs is that their actions lack specificity. To investigate whether oocyte extract can be used for epigenetic re-programming of cancer cells, H460 human lung cancer cells were reversibly permeabilized and incubated with bovine oocyte extract. Bisulfite sequencing showed that bovine oocyte extract induced significant demethylation at hypermethylated promoter CpG islands of the tumor suppressor genes RUNX3 and CDH1; however, the DNA methylation levels of repetitive sequences were not affected. Chromatin immunoprecipitation showed that bovine oocyte extract significantly reduced transcriptionally repressive histone modifications and increased transcriptionally activating histone modifications at the promoter regions of RUNX3 and CDH1. Bovine oocyte extract reactivated the expression of RUNX3 and CDH1 at both the messenger RNA and the protein levels without up-regulating the transcription of pluripotency-associated genes. At the functional level, anchorage-independent proliferation, migration and invasion of H460 cells was strongly inhibited. These results demonstrate that bovine oocyte extract reactivates epigenetically silenced tumor suppressor genes by remodeling the epigenetic modifications at their promoter regions. Bovine oocyte extract may provide a useful tool for investigating epigenetic mechanisms in cancer and a valuable source for developing novel safe therapeutic approaches that target epigenetic alterations. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  6. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.

    Science.gov (United States)

    Aldea, M; Garrido, T; Pla, J; Vicente, M

    1990-11-01

    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle.

  7. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  8. Metazoan Nuclear Pores Provide a Scaffold for Poised Genes and Mediate Induced Enhancer-Promoter Contacts.

    Science.gov (United States)

    Pascual-Garcia, Pau; Debo, Brian; Aleman, Jennifer R; Talamas, Jessica A; Lan, Yemin; Nguyen, Nha H; Won, Kyoung J; Capelson, Maya

    2017-04-06

    Nuclear pore complex components (Nups) have been implicated in transcriptional regulation, yet what regulatory steps are controlled by metazoan Nups remains unclear. We identified the presence of multiple Nups at promoters, enhancers, and insulators in the Drosophila genome. In line with this binding, we uncovered a functional role for Nup98 in mediating enhancer-promoter looping at ecdysone-inducible genes. These genes were found to be stably associated with nuclear pores before and after activation. Although changing levels of Nup98 disrupted enhancer-promoter contacts, it did not affect ongoing transcription but instead compromised subsequent transcriptional activation or transcriptional memory. In support of the enhancer-looping role, we found Nup98 to gain and retain physical interactions with architectural proteins upon stimulation with ecdysone. Together, our data identify Nups as a class of architectural proteins for enhancers and supports a model in which animal genomes use the nuclear pore as an organizing scaffold for inducible poised genes. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Expression of the 90K immunostimulator gene is controlled by a promoter with unique features

    DEFF Research Database (Denmark)

    Brakebusch, C; Jallal, B; Fusco, O

    1997-01-01

    90K is a secreted glycoprotein with tumor suppressive functions, which is up-regulated in various types of cancer and in AIDS. In order to understand the regulation of its expression, the mouse 90K gene was isolated and analyzed. The gene spans about 8.8-kilobase pairs and consists of 6 exons...... and was localized on chromosome 11, region E. RNase protection identified one major transcription start site (+1) and three minor ones (-3, +32, +34). The mouse 90K gene was found to have a TATA-less promoter of unusual structure. The 2. 3-kilobase pair 5'-flanking region exhibited strong promoter activity in NIH 3......T3 cells; however, it contained neither a TATA-box nor a SP1 site and was not GC-rich. No known initiator motif was found around the transcription start site. 5'- and 3'-deletions defined a minimal promoter of 51 base pairs (-66 --> -16), not including the start site, essential and sufficient...

  10. Association between methylenetetrahydrofolate reductase (MTHFR) gene promoter hypermethylation and the risk of idiopathic male infertility.

    Science.gov (United States)

    Karaca, M Z; Konac, E; Yurteri, B; Bozdag, G; Sogutdelen, E; Bilen, C Y

    2017-09-01

    Epigenetics has become a major field of reproductive medicine after the epigenetic regulation of gene expression was discovered. The aim of this study was to find out whether or not methylenetetrahydrofolate reductase (MTHFR) gene promoter hypermethylation in the spermatozoa of men who were offered assisted reproduction is associated with idiopathic male infertility. Sperm DNAs from 40 idiopathic infertile men with normozoospermia and 40 controls consisting of healthy fertile men were isolated. Following the modification of DNAs by sodium bisulphite, the methylation status of the MTHFR gene promoter was quantified by pyrosequencing. No significant differences were observed between the clinical characteristics of patients and controls. The percentage of MTHFR promoter methylation in infertile men with normozoospermia (11%) was significantly higher than that in the healthy control (4.3%) group (p = .01). A 9.5% of methylation level was determined via receiver operator characteristic (ROC) analysis as the cut-off value. There were 21 (53%) hypermethylated men among the infertile men and 2 (5%) in the control group (p = .0001). The intragroup analysis of the infertile group did not reveal any statistically significant differences in terms of overall clinical characteristics between hyper- and normo-methylated infertile men. Our results suggest that epigenetic silencing (hypermethylation) of MTHFR could result in an elevated risk of male infertility. © 2016 Blackwell Verlag GmbH.

  11. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  12. Structure of 5' region of human tenascin-R gene and characterization of its promoter.

    Science.gov (United States)

    Gherzi, R; Leprini, A; Siri, A; Zardi, L

    1998-03-01

    The tenascin-R (TN-R) gene encodes a multidomain extracellular matrix protein belonging to the tenascin family, previously detected only in the central nervous system. In this report, we describe the structure of the 5' region of the human TN-R gene and characterize the activity of its promoter. We cloned two previously unreported nontranslated exons (exons 1 and 2, 539 and 101 bp in length, respectively) separated by a large (> or = 40-kb) intron. The intron between exons 2 and 3 (containing the ATG codon) is 122 kb in length. Tenascin-R transcripts in fetal, adult, and neoplastic human brain contain both exons 1 and 2, as demonstrated by S1 nuclease analysis and reverse transcriptase-polymerase chain reaction. The human TN-R promoter displays relatively unusual features in terms of sequence in that it lacks any TATA box, CAAT box, GC-rich regions, or initiator element. The promoter displays its activity only in cultured cells of neural and glial origin, not in transformed epithelial cells and melanoma cells. All the elements required for the full and cell-specific activity of the promoter are contained in the 57-bp sequence closest to the transcription startpoint.

  13. Gene expression of axon growth promoting factors in the deer antler.

    Directory of Open Access Journals (Sweden)

    Wolfgang Pita-Thomas

    Full Text Available The annual regeneration cycle of deer (Cervidae, Artiodactyla antlers represents a unique model of epimorphic regeneration and rapid growth in adult mammals. Regenerating antlers are innervated by trigeminal sensory axons growing through the velvet, the modified form of skin that envelopes the antler, at elongation velocities that reach one centimetre per day in the common deer (Cervus elaphus. Several axon growth promoters like NT-3, NGF or IGF-1 have been described in the antler. To increase the knowledge on the axon growth environment, we have combined different gene-expression techniques to identify and characterize the expression of promoting molecules not previously described in the antler velvet. Cross-species microarray analyses of deer samples on human arrays allowed us to build up a list of 90 extracellular or membrane molecules involved in axon growth that were potentially being expressed in the antler. Fifteen of these genes were analysed using PCR and sequencing techniques to confirm their expression in the velvet and to compare it with the expression in other antler and skin samples. Expression of 8 axon growth promoters was confirmed in the velvet, 5 of them not previously described in the antler. In conclusion, our work shows that antler velvet provides growing axons with a variety of promoters of axon growth, sharing many of them with deer's normal and pedicle skin.

  14. Sequence and Phylogenetic Analysis of the Untranslated Promoter Regions for HLA Class I Genes.

    Science.gov (United States)

    Ramsuran, Veron; Hernández-Sanchez, Pedro G; O'hUigin, Colm; Sharma, Gaurav; Spence, Niamh; Augusto, Danillo G; Gao, Xiaojiang; García-Sepúlveda, Christian A; Kaur, Gurvinder; Mehra, Narinder K; Carrington, Mary

    2017-03-15

    Polymorphisms located within the MHC have been linked to many disease outcomes by mechanisms not yet fully understood in most cases. Variants located within untranslated regions of HLA genes are involved in allele-specific expression and may therefore underlie some of these disease associations. We determined sequences extending nearly 2 kb upstream of the transcription start site for 68 alleles from 57 major lineages of classical HLA class I genes. The nucleotide diversity within this promoter segment roughly follows that seen within the coding regions, with HLA-B showing the highest (∼1.9%), followed by HLA-A (∼1.8%), and HLA-C showing the lowest diversity (∼0.9%). Despite its greater diversity, HLA-B mRNA expression levels determined in 178 European Americans do not vary in an allele- or lineage-specific manner, unlike the differential expression levels of HLA-A or HLA-C reported previously. Close proximity of promoter sequences in phylogenetic trees is roughly reflected by similarity of expression pattern for most HLA-A and -C loci. Although promoter sequence divergence might impact promoter activity, we observed no clear link between the phylogenetic structures as represented by pairwise nucleotide differences in the promoter regions with estimated differences in mRNA expression levels for the classical class I loci. Further, no pair of class I loci showed coordinated expression levels, suggesting that distinct mechanisms across loci determine their expression level under nonstimulated conditions. These data serve as a foundation for more in-depth analysis of the functional consequences of promoter region variation within the classical HLA class I loci. Copyright © 2017 by The American Association of Immunologists, Inc.

  15. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  16. Bicarbonate Increases Binding Affinity of Vibrio cholerae ToxT to Virulence Gene Promoters

    Science.gov (United States)

    Thomson, Joshua J.

    2014-01-01

    The major Vibrio cholerae virulence gene transcription activator, ToxT, is responsible for the production of the diarrhea-inducing cholera toxin (CT) and the major colonization factor, toxin coregulated pilus (TCP). In addition to the two primary virulence factors mentioned, ToxT is responsible for the activation of accessory virulence genes, such as aldA, tagA, acfA, acfD, tcpI, and tarAB. ToxT activity is negatively modulated by bile and unsaturated fatty acids found in the upper small intestine. Conversely, previous work identified another intestinal signal, bicarbonate, which enhances the ability of ToxT to activate production of CT and TCP. The work presented here further elucidates the mechanism for the enhancement of ToxT activity by bicarbonate. Bicarbonate was found to increase the activation of ToxT-dependent accessory virulence promoters in addition to those that produce CT and TCP. Bicarbonate is taken up into the V. cholerae cell, where it positively affects ToxT activity by increasing DNA binding affinity for the virulence gene promoters that ToxT activates regardless of toxbox configuration. The increase in ToxT binding affinity in the presence of bicarbonate explains the elevated level of virulence gene transcription. PMID:25182489

  17. Tissue-specific expression of a soybean hypersensitive-induced response (HIR) protein gene promoter.

    Science.gov (United States)

    Koellhoffer, Jessica P; Xing, Aiqiu; Moon, Bryan P; Li, Zhongsen

    2015-02-01

    A Glycine max gene encoding a putative protein similar to hypersensitive-induced response proteins (HIR) was identified as a gene with preferred expressions in flowers and developing seeds by whole transcriptome gene expression profiling. Its promoter gm-hir1 was cloned and revealed to strongly express a fluorescence reporter gene primarily in integuments, anther tapetum, and seed coat with unique tissue-specificity. Expression in the inner integument was apparent prior to pollination, while expression in the outer integument started to develop from the micropylar end outward as the embryo matured. A 5'-deletion study showed that the promoter can be truncated to 600 bp long relative to the translation start site without affecting expression. A positive regulatory element was identified between 600 and 481 bp that controls expression in the inner integument, with no noticeable effect on expression in the outer integument or tapetum. Additionally, removal of the 5'UTR intron had no effect on levels or location of gm-hir1 expression while truncation to 370 bp resulted in a complete loss of expression suggesting that elements controlling both the outer integument and tapetum expression are located within the 481-370 bp region.

  18. Changes in Methylation Patterns of Kiss1 and Kiss1r Gene Promoters across Puberty

    Directory of Open Access Journals (Sweden)

    Amanda K. Wyatt

    2013-01-01

    Full Text Available The initiation of mammalian puberty is underpinned by an increase in Kisspeptin (Kiss1 signaling via its receptor (Kiss1r/GPR54 on gonadotropin-releasing hormone (GnRH neurons. Animals and humans with loss-of-function mutations in Kiss1 or Kiss1r fail to go through puberty. The timing of puberty is dependent on environmental factors, and malleability in puberty timing suggests a mechanism that can translate environmental signals into patterns of Kiss1/Kiss1r gene expression. Epigenetics is a powerful mechanism that can control gene expression in an environment-dependent manner. We investigated whether epigenetic DNA methylation is associated with gene expression changes at puberty. We used bisulfite-PCR-pyrosequencing to define the methylation in the promoters of Kiss1 and Kiss1r before and after puberty in female rats. Both Kiss1 and Kiss1r showed highly significant puberty-specific differential promoter methylation patterns. By identifying key differentially methylated residues associated with puberty, these findings will be important for further studies investigating the control of gene expression across the pubertal transition.

  19. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  20. Association of Interleukin-10 Gene Promoter Polymorphisms in Saudi Patients with Vitiligo

    Directory of Open Access Journals (Sweden)

    Abdullah Abanmi

    2008-01-01

    Full Text Available The promoter region of human Interleukin −10 gene is highly polymorphic and has been associated with numerous autoimmune diseases. Recent studies have linked vitiligo with defective autoimmune system. This study is aimed to explore a possible association between IL-10 gene polymorphism and vitiligo in Saudi population. This case control study consisted of 184 Saudi subjects including 83 vitiligo patients (40 males, 43 females mean age 27.85 ± 12.43 years and 101 matched controls. Genomic DNA was extracted from the blood samples of healthy controls and Vitiligo patients visiting out patient clinic of Department of Dermatology, Riyadh Armed Forces Hospital, using QIA ampR DNA mini kit (Qiagen CA, USA. Interleukin-10 gene was amplified by polymerase chain reaction (PCR using Arms primers to detect any polymorphism involved at positions −592, −819 and −1082.

  1. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  2. Symmetry in the Language of Gene Expression: A Survey of Gene Promoter Networks in Multiple Bacterial Species and Non-σ Regulons

    Directory of Open Access Journals (Sweden)

    Stefan M. Turcic

    2011-11-01

    Full Text Available The language of gene expression displays topological symmetry. An important step during gene expression is the binding of transcriptional proteins to DNA promoters adjacent to a gene. Some proteins bind to many promoters in a genome, defining a regulon of genes wherein each promoter might vary in DNA sequence relative to the average consensus. Here we examine the linguistic organization of gene promoter networks, wherein each node in the network represents a promoter and links between nodes represent the extent of base pair-sharing. Prior work revealed a fractal nucleus in several σ-factor regulons from Escherichia coli. We extend these findings to show fractal nuclei in gene promoter networks from three bacterial species, E. coli, Bacillus subtilis, and Pseudomonas aeruginosa. We surveyed several non-σ transcription factors from these species and found that many contain a nucleus that is both visually and numerically fractal. Promoter footprint size scaled as a negative power-law with both information entropy and fractal dimension, while the latter two parameters scaled positively and linearly. The fractal dimension of the diffuse networks (dB = ~1.7 was close to that expected of a diffusion limited aggregation process, confirming prior predictions as to a possible mechanism for development of this structure.

  3. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    Energy Technology Data Exchange (ETDEWEB)

    Orlov, Sergey V., E-mail: serge@iem.sp.ru [Department of Biochemistry, Institute of Experimental Medicine, Russian Academy of Medical Sciences, 197376 St. Petersburg (Russian Federation); Department of Embryology, St. Petersburg State University, 199034 St. Petersburg (Russian Federation); Mogilenko, Denis A. [Department of Biochemistry, Institute of Experimental Medicine, Russian Academy of Medical Sciences, 197376 St. Petersburg (Russian Federation); Department of Embryology, St. Petersburg State University, 199034 St. Petersburg (Russian Federation); Shavva, Vladimir S. [Department of Embryology, St. Petersburg State University, 199034 St. Petersburg (Russian Federation); Dizhe, Ella B.; Ignatovich, Irina A. [Department of Biochemistry, Institute of Experimental Medicine, Russian Academy of Medical Sciences, 197376 St. Petersburg (Russian Federation); Perevozchikov, Andrej P., E-mail: app@iem.sp.ru [Department of Biochemistry, Institute of Experimental Medicine, Russian Academy of Medical Sciences, 197376 St. Petersburg (Russian Federation); Department of Embryology, St. Petersburg State University, 199034 St. Petersburg (Russian Federation)

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  4. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  5. Viral microRNAs targeting virus genes promote virus infection in shrimp in vivo.

    Science.gov (United States)

    He, Yaodong; Yang, Kai; Zhang, Xiaobo

    2014-01-01

    Viral microRNAs (miRNAs), most of which are characterized in cell lines, have been found to play important roles in the virus life cycle to avoid attack by the host immune system or to keep virus in the latency state. Viral miRNAs targeting virus genes can inhibit virus infection. In this study, in vivo findings in Marsupenaeus japonicus shrimp revealed that the viral miRNAs could target virus genes and further promote the virus infection. The results showed that white spot syndrome virus (WSSV)-encoded miRNAs WSSV-miR-66 and WSSV-miR-68 were transcribed at the early stage of WSSV infection. When the expression of WSSV-miR-66 and WSSV-miR-68 was silenced with sequence-specific anti-miRNA oligonucleotides (AMOs), the number of copies of WSSV and the WSSV-infected shrimp mortality were significantly decreased, indicating that the two viral miRNAs had a great effect on virus infection. It was revealed that the WSSV wsv094 and wsv177 genes were the targets of WSSV-miR-66 and that the wsv248 and wsv309 genes were the targets of WSSV-miR-68. The data demonstrate that the four target genes play negative roles in the WSSV infection. The targeting of the four virus genes by WSSV-miR-66 and WSSV-miR-68 led to the promotion of virus infection. Therefore, our in vivo findings show a novel aspect of viral miRNAs in virus-host interactions.

  6. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  7. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  8. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  9. Identification of functional hypoxia inducible factor response elements in the human lysyl oxidase gene promoter.

    Science.gov (United States)

    Wang, Victoria; Davis, David A; Yarchoan, Robert

    2017-08-19

    Human lysyl oxidase (LOX) is a hypoxia-responsive gene whose product catalyzes collagen crosslinking and is thought to be important in cancer metastasis and osteoarthritis. We previously demonstrated that LOX was upregulated by hypoxia inducible factor 2 (HIF-2) more strongly than hypoxia inducible 1 (HIF-1). Here, we further investigated the response of the LOX gene and LOX promoter to HIFs. LOX mRNA, measured by real time reverse transcriptase-PCR, was strongly up-regulated (almost 40-fold), by transfection of HEK-293T cells with a plasmid encoding the HIF-2α subunit of HIF-2, but only three-fold by a plasmid encoding HIF-1α. LOX protein was detectable by Western blot of cells transfected with HIF-2α, but not with HIF-1α. Analysis of a 1487 bp promoter sequence upstream of the human LOX gene revealed 9 potential hypoxia response elements (HREs). Promoter truncation allowed the mapping of two previously unidentified functional HREs, called here HRE8 and HRE7; -455 to -451 and -382 to -386 bp, respectively, upstream of the start codon for LOX. Removal or mutation of these HREs led to a substantial reduction in both HIF-1α and HIF-2α responsiveness. Also, expression of LOX was significantly inhibited by a small molecule specific HIF-2 inhibitor. In conclusion, LOX is highly responsive to HIF-2α and this is largely mediated by two previously unidentified HREs. These observations enhance our understanding of the regulation of this important gene involved in cancer and osteoarthritis, and suggest that these conditions may be targeted by HIF-2 inhibitors. Published by Elsevier Inc.

  10. Characterization and promoter analysis of a cotton RING-type ubiquitin ligase (E3) gene.

    Science.gov (United States)

    Ho, Meng-Hsuan; Saha, Sukumar; Jenkins, Johnie N; Ma, Din-Pow

    2010-10-01

    A cotton fiber cDNA, GhRING1, and its corresponding gene have been cloned and characterized. The GhRING1 gene encodes a RING-type ubiquitin ligase (E3) containing 338 amino acids (aa). The GhRING1 protein contains a RING finger motif with conserved cysteine and histine residues at the C-terminus, and is classified as a C(3)H(2)C(3)-type RING protein. Blast searches show that GhRING1 has the highest homology to At3g19950, a zinc finger family protein from Arabidopsis. Real time RT-PCR analysis indicates that the GhRING1 gene is expressed in cotton fibers in a developmental manner. The transcript level of GhRING1 gene reaches a maximum in elongating fibers at 15 days post-anthesis (DPA). In vitro auto-ubiquitination assays using wheat germ extract and a reconstitution system demonstrate that GhRING1 has the ubiquitin E3 ligase activity. The histochemical GUS assay was performed to analyze tissue specificity of the GhRING1 and At3g19950 promoters in transgenic Arabidopsis plants. The GUS assay shows that the promoter of At3g19950 is highly activated in leaves, roots, trichomes, and also in anthers and stigma of flowers. In contrast, the GUS expression directed by the GhRING1 promoter is only located at stipules and anthers. The expression pattern of GhRING1 suggests that protein ubiquitination and turnover may be involved in transition to different stages of cotton fiber development.

  11. Functional analysis of promoter variants in the microsomal triglyceride transfer protein (MTTP) gene.

    Science.gov (United States)

    Rubin, Diana; Schneider-Muntau, Alexandra; Klapper, Maja; Nitz, Inke; Helwig, Ulf; Fölsch, Ulrich R; Schrezenmeir, Jürgen; Döring, Frank

    2008-01-01

    The microsomal triglyceride transfer protein (MTTP) is required for the assembly and secretion of apolipoprotein B (apoB)-containing lipoproteins from the intestine and liver. According to this function, polymorphic sites in the MTTP gene showed associations to low-density lipoprotein (LDL) cholesterol and related traits of the metabolic syndrome. Here we studied the functional impact of common MTTP promoter polymorphisms rs1800804:T>C (-164T>C), rs1800803:A>T (-400A>T), and rs1800591:G>T (-493G>T) using gene-reporter assays in intestinal Caco-2 and liver Huh-7 cells. Significant results were obtained in Huh-7 cells. The common MTTP promoter haplotype -164T/-400A/-493G showed about two-fold lower activity than the rare haplotype -164C/-400T/-493T. MTTP promoter mutant constructs -164T/-400A/-493T and -164T/-400T/-493T exhibited similar activity than the common haplotype. Activities of mutants -164C/-400A/-493G and -164C/-400A/-493T resembled the rare MTTP promoter haplotype. Electrophoretic mobility shift assays (EMSAs) revealed higher binding capacity of the transcriptional factor Sterol regulatory element binding protein1a (SREBP1a) to the -164T probe in comparison to the -164C probe. In conclusion, our study indicates that the polymorphism -164T>C mediates different activities of common MTTP promoter haplotypes via SREBP1a. This suggested that the already described SREBP-dependent modulation of MTTP expression by diet is more effective in -164T than in -164C carriers. (c) 2007 Wiley-Liss, Inc.

  12. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  13. Cloning and functional analysis of human acyl coenzyme A: Cholesterol acyltransferase1 gene P1 promoter.

    Science.gov (United States)

    Ge, Jing; Cheng, Bei; Qi, Benling; Peng, Wen; Wen, Hui; Bai, Lijuan; Liu, Yun; Zhai, Wei

    2016-07-01

    Acyl-coenzyme A: cholesterol acyltransferase 1 (ACAT1) catalyzes the conversion of free cholesterol (FC) to cholesterol ester. The human ACAT1 gene P1 promoter has been cloned. However, the activity and specificity of the ACAT1 gene P1 promoter in diverse cell types remains unclear. The P1 promoter fragment was digested with KpnI/XhoI from a P1 promoter cloning vector, and was subcloned into the multiple cloning site of the Firefly luciferase vector pGL3‑Enhancer to obtain the construct P1E‑1. According to the analysis of biological information, the P1E‑1 plasmid was used to generate deletions of the ACAT1 gene P1 promoter with varying 5' ends and an identical 3' end at +65 by polymerase chain reaction (PCR). All the 5'‑deletion constructs of the P1 promoter were identified by PCR, restriction enzyme digestion mapping and DNA sequencing. The transcriptional activity of each construct was detected after transient transfection into THP‑1, HepG2, HEK293 and Hela cells using DEAE‑dextran and Lipofectamine 2000 liposome transfection reagent. Results showed that the transcriptional activity of the ACAT1 gene P1 promoter and deletions of P1 promoter in THP‑1 and HepG2 cells was higher than that in HEK293 and HeLa cells. Moreover, the transcriptional activity of P1E‑9 was higher compared with those of other deletions in THP‑1, HepG2, HEK293 and HeLa cells. These findings indicate that the transcriptional activity of the P1 promoter and the effects of deletions vary with different cell lines. Thus, the P1 promoter may drive ACAT1 gene expression with cell‑type specificity. In addition, the core sequence of ACAT1 gene P1 promoter was suggested to be between -125 and +65 bp.

  14. Interleukin 4 (IL-4) gene promoter polymorphisms in Rhombomys opimus, the main reservoir of zoonotic cutaneous leishmaniasis.

    Science.gov (United States)

    Bakhshi, H; Borhani, N; Mohebali, M; Khamesipour, A; Abai, M R; Hajjaran, H; Tajedin, L; Rassi, Y; Akhavan, A A; Mohtarami, F; Oshaghi, M A

    2014-01-01

    Great gerbils (Rhombomys opimus) are the most common gerbils in center to northeast of Iran as well as central Asia and serve as reservoirs for the zoonotic agents, including Leishmania major, the principal etiologic agent of zoonotic cutaneous leishmaniasis (ZCL). The outcome of L. major infection in gerbils is not uniform. Among several immune-related factors including cytokine genes, the polymorphism in interleukin 4 (IL-4) promoter gene showed a great impact on outcome and pathological symptoms of L. major infection at least in mouse model. In this study gerbils' IL-4 promoter gene polymorphism is assessed. Specific primers were designed to develop a PCR-based assay to amplify IL-4 promoter gene to possibly define IL-4 promoter gene polymorphism in great gerbil populations with a range of Leishmania infection and symptoms collected from different foci of the central, north and northeast regions of Iran. The results showed that the designed primers amplify 689bp of the promoter gene. Sequence analysis of the promoter gene revealed five polymorphic sites assembly six haplotypes among the gerbil populations. Further studies are needed to assess whether or not the five polymorphisms cause different outcome phenotypes following infection with L. major in great gerbils. The data might be used to characterize the immune responses of R. opimus against L. major infection. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  16. A sequence-specific core promoter-binding transcription factor recruits TRF2 to coordinately transcribe ribosomal protein genes.

    Science.gov (United States)

    Baumann, Douglas G; Gilmour, David S

    2017-10-13

    Ribosomal protein (RP) genes must be coordinately expressed for proper assembly of the ribosome yet the mechanisms that control expression of RP genes in metazoans are poorly understood. Recently, TATA-binding protein-related factor 2 (TRF2) rather than the TATA-binding protein (TBP) was found to function in transcription of RP genes in Drosophila. Unlike TBP, TRF2 lacks sequence-specific DNA binding activity, so the mechanism by which TRF2 is recruited to promoters is unclear. We show that the transcription factor M1BP, which associates with the core promoter region, activates transcription of RP genes. Moreover, M1BP directly interacts with TRF2 to recruit it to the RP gene promoter. High resolution ChIP-exo was used to analyze in vivo the association of M1BP, TRF2 and TFIID subunit, TAF1. Despite recent work suggesting that TFIID does not associate with RP genes in Drosophila, we find that TAF1 is present at RP gene promoters and that its interaction might also be directed by M1BP. Although M1BP associates with thousands of genes, its colocalization with TRF2 is largely restricted to RP genes, suggesting that this combination is key to coordinately regulating transcription of the majority of RP genes in Drosophila. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  18. Molecular cloning and analysis of a receptor-like promoter of Gbvdr3 gene in sea island cotton.

    Science.gov (United States)

    Zhang, B-J; Zhang, H-P; Chen, Q-Z; Tang, N; Wang, L-K; Wang, R-F; Zhang, B-L

    2016-05-23

    Verticillium wilt caused by soil borne fungus Verticillium dahliae could significantly reduce cotton yield. The Ve1 homologous gene Gbvdr3 is resistant to Verticillium wilt. In order to understand of the function of the promoter Gbvdr3 in Gossypium barbadense, the promoter region of the receptor-like gene Gbvdr3 was obtained by genome walking, and the cis-element in the promoter was identified using the PLACE software in this study. The sequence analysis showed that the promoter contained elements related to stress resistance and light regulation. The cloned promoter was fused to the GUS reporter gene and transformed into Arabidopsis. GUS expression was specifically detected in roots, flowers, and seeds, suggesting that the expression of Gbvdr3 is tissue-specific. Separation and characterization analysis of the promoter of Gbvdr3 provides a platform for further research and application of this gene. Thorough understanding of the function of the Gbvdr3 promoter is important for better understanding of Gbvdr3 function. These results indicated that the promoter of Gbvdr3 was a tissue-specific promoter.

  19. Footprinting the 'essential regulatory region' of the retinoblastoma gene promoter in intact human cells.

    Science.gov (United States)

    Temple, Mark D; Murray, Vincent

    2005-03-01

    The retinoblastoma tumour suppressor protein is a key cell cycle regulator. Protein-DNA interactions at the retinoblastoma (RB1) promoter, including the 'essential regulatory region', were investigated using novel DNA-targeted nitrogen mustards in intact human cells. The footprinting experiments were carried out in two different environments: in intact HeLa and K562 cells where the access of DNA-targeted probes to chromatin is affected by cellular protein-DNA interactions associated with gene regulation; and in purified DNA where their access is unencumbered by protein-DNA interactions. Using the ligation-mediated PCR (LMPCR) technique, the sites of damage were determined at base pair resolution on DNA sequencing gels. Our results demonstrate that, in intact cells, footprints were observed at the E2F, ATF and RBF1/Sp1 DNA binding motifs in the RB1 promoter. In addition, a novel footprint was observed at a previously unidentified cycle homology region (CHR) and at four uncharacterised protein-DNA binding sites. In further experiments, nitrogen mustard-treated cells were FACS sorted into G1, S and G2/M phases of the cell cycle prior to LMPCR analysis. Expression of the RB1 gene is cell cycle-regulated and footprinting studies of the promoter in FACS-sorted cells indicated that transcription factor binding at the GC box, CHR binding motif and the 'essential regulatory region' are cell cycle dependent.

  20. 5-Hydroxy tryptamine transporter (5HTT) gene promoter region polymorphism in anxiety and depressive disorders.

    Science.gov (United States)

    Mushtaq, Raheel; Shoib, Sheikh; Shah, Tabindah; Mushtaq, Sahil

    2014-01-01

    5HTTLPR polymorphism (5- Hydroxy tryptamine transporter linked promoter region polymorphism) is the most widely studied genetic variant in psychiatry. The present study is a modest effort at ascertaining the role of 5HT transporter linked promoter region polymorphism (5HTTLPR) in anxiety and depressive disorders in Kashmir (India).The aim of this study was to examine 5-Hydroxy tryptamine transporter (5HTT) gene promoter region polymorphism in anxiety and depressive disorders. Thirty patients with unipolar depressive disorders, 30 patients with anxiety disorders and 40 healthy volunteers (controls) were studied on a case control design, using polymerase chain reaction (PCR) and agarose gel electrophoresis after digestion with endonuclease enzyme. Genotypes and allele frequencies were compared using chi square tests, and p value of 0.05). The genetic studies are still evolving as pathogenesis of anxiety and depressive disorders and involve the interaction of environmental factors with various genes. Genetic variation in different populations and hence different environments is important for elucidation of the mechanisms of these disorders. However, the study concludes that the locus under study is not shared between the two disorders.

  1. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  2. Differences in Gene-Gene Interactions in Graves' Disease Patients Stratified by Age of Onset.

    Directory of Open Access Journals (Sweden)

    Beata Jurecka-Lubieniecka

    Full Text Available Graves' disease (GD is a complex disease in which genetic predisposition is modified by environmental factors. Each gene exerts limited effects on the development of autoimmune disease (OR = 1.2-1.5. An epidemiological study revealed that nearly 70% of the risk of developing inherited autoimmunological thyroid diseases (AITD is the result of gene interactions. In the present study, we analyzed the effects of the interactions of multiple loci on the genetic predisposition to GD. The aim of our analyses was to identify pairs of genes that exhibit a multiplicative interaction effect.A total of 709 patients with GD were included in the study. The patients were stratified into more homogeneous groups depending on the age at time of GD onset: younger patients less than 30 years of age and older patients greater than 30 years of age. Association analyses were performed for genes that influence the development of GD: HLADRB1, PTPN22, CTLA4 and TSHR. The interactions among polymorphisms were analyzed using the multiple logistic regression and multifactor dimensionality reduction (MDR methods.GD patients stratified by the age of onset differed in the allele frequencies of the HLADRB1*03 and 1858T polymorphisms of the PTPN22 gene (OR = 1.7, p = 0.003; OR = 1.49, p = 0.01, respectively. We evaluated the genetic interactions of four SNPs in a pairwise fashion with regard to disease risk. The coexistence of HLADRB1 with CTLA4 or HLADRB1 with PTPN22 exhibited interactions on more than additive levels (OR = 3.64, p = 0.002; OR = 4.20, p < 0.001, respectively. These results suggest that interactions between these pairs of genes contribute to the development of GD. MDR analysis confirmed these interactions.In contrast to a single gene effect, we observed that interactions between the HLADRB1/PTPN22 and HLADRB1/CTLA4 genes more closely predicted the risk of GD onset in young patients.

  3. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  4. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  5. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  6. Primary characterization and basal promoter activity of two hexamerin genes of Musca domestica

    Directory of Open Access Journals (Sweden)

    C.K. Moreira

    2004-02-01

    Full Text Available Hexamerins are high molecular-weight proteins found in the hemolymph of insects and have been proposed to function as storage proteins. In previous studies, two Musca domestica hexamerins, designated Hex-L and Hex-F were characterized. Hex-L is synthesized exclusively by the larval fat bodies, is secreted into the hemolymph and likely provides a source of amino acids and energy during metamorphosis. Hex-F synthesis is induced by a proteinaceous meal and occurs only in the adult insect fat bodies. Hex-F also is secreted into the hemolymph and it has been suggested that in females it may be an amino acid reservoir to be used during the final stages of egg formation. Genomic clones containing full-length copies of the genes MdHexL1 and MdHexF1, encoding subunits of the larval and the adult female hexamerin, respectively, were isolated. Complete nucleotide sequences, including the 5'-end untranscribed regions, were determined and analyzed for each of the genes. Comparisons of the conceptual translation products of the cloned genes indicated that MdHexL1 and MdHexF1 are related to the larval serum proteins (LSP 1 and 2 of Calliphora vicina and Drosophila melanogaster. DNA fragments containing the putative promoters of the two hexamerin genes were compared and cloned into a plasmid vector so as to drive the expression of the GFP reporter gene. The constructs were assayed in vitro in transfected S2 Drosophila melanogaster cells demonstrating that the cloned M. domestica DNA fragments exhibit promoter activity.

  7. Mechanical Strain Promotes Oligodendrocyte Differentiation by Global Changes of Gene Expression

    Directory of Open Access Journals (Sweden)

    Krystyn J. Van Vliet

    2017-04-01

    Full Text Available Differentiation of oligodendrocyte progenitor cells (OPC to oligodendrocytes and subsequent axon myelination are critical steps in vertebrate central nervous system (CNS development and regeneration. Growing evidence supports the significance of mechanical factors in oligodendrocyte biology. Here, we explore the effect of mechanical strains within physiological range on OPC proliferation and differentiation, and strain-associated changes in chromatin structure, epigenetics, and gene expression. Sustained tensile strain of 10–15% inhibited OPC proliferation and promoted differentiation into oligodendrocytes. This response to strain required specific interactions of OPCs with extracellular matrix ligands. Applied strain induced changes in nuclear shape, chromatin organization, and resulted in enhanced histone deacetylation, consistent with increased oligodendrocyte differentiation. This response was concurrent with increased mRNA levels of the epigenetic modifier histone deacetylase Hdac11. Inhibition of HDAC proteins eliminated the strain-mediated increase of OPC differentiation, demonstrating a role of HDACs in mechanotransduction of strain to chromatin. RNA sequencing revealed global changes in gene expression associated with strain. Specifically, expression of multiple genes associated with oligodendrocyte differentiation and axon-oligodendrocyte interactions was increased, including cell surface ligands (Ncam, ephrins, cyto- and nucleo-skeleton genes (Fyn, actinins, myosin, nesprin, Sun1, transcription factors (Sox10, Zfp191, Nkx2.2, and myelin genes (Cnp, Plp, Mag. These findings show how mechanical strain can be transmitted to the nucleus to promote oligodendrocyte differentiation, and identify the global landscape of signaling pathways involved in mechanotransduction. These data provide a source of potential new therapeutic avenues to enhance OPC differentiation in vivo.

  8. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Directory of Open Access Journals (Sweden)

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  9. Indirect Fitness Benefits Enable the Spread of Host Genes Promoting Costly Transfer of Beneficial Plasmids.

    Directory of Open Access Journals (Sweden)

    Tatiana Dimitriu

    2016-06-01

    Full Text Available Bacterial genes that confer crucial phenotypes, such as antibiotic resistance, can spread horizontally by residing on mobile genetic elements (MGEs. Although many mobile genes provide strong benefits to their hosts, the fitness consequences of the process of transfer itself are less clear. In previous studies, transfer has been interpreted as a parasitic trait of the MGEs because of its costs to the host but also as a trait benefiting host populations through the sharing of a common gene pool. Here, we show that costly donation is an altruistic act when it spreads beneficial MGEs favoured when it increases the inclusive fitness of donor ability alleles. We show mathematically that donor ability can be selected when relatedness at the locus modulating transfer is sufficiently high between donor and recipients, ensuring high frequency of transfer between cells sharing donor alleles. We further experimentally demonstrate that either population structure or discrimination in transfer can increase relatedness to a level selecting for chromosomal transfer alleles. Both mechanisms are likely to occur in natural environments. The simple process of strong dilution can create sufficient population structure to select for donor ability. Another mechanism observed in natural isolates, discrimination in transfer, can emerge through coselection of transfer and discrimination alleles. Our work shows that horizontal gene transfer in bacteria can be promoted by bacterial hosts themselves and not only by MGEs. In the longer term, the success of cells bearing beneficial MGEs combined with biased transfer leads to an association between high donor ability, discrimination, and mobile beneficial genes. However, in conditions that do not select for altruism, host bacteria promoting transfer are outcompeted by hosts with lower transfer rate, an aspect that could be relevant in the fight against the spread of antibiotic resistance.

  10. Indirect Fitness Benefits Enable the Spread of Host Genes Promoting Costly Transfer of Beneficial Plasmids.

    Science.gov (United States)

    Dimitriu, Tatiana; Misevic, Dusan; Lotton, Chantal; Brown, Sam P; Lindner, Ariel B; Taddei, François

    2016-06-01

    Bacterial genes that confer crucial phenotypes, such as antibiotic resistance, can spread horizontally by residing on mobile genetic elements (MGEs). Although many mobile genes provide strong benefits to their hosts, the fitness consequences of the process of transfer itself are less clear. In previous studies, transfer has been interpreted as a parasitic trait of the MGEs because of its costs to the host but also as a trait benefiting host populations through the sharing of a common gene pool. Here, we show that costly donation is an altruistic act when it spreads beneficial MGEs favoured when it increases the inclusive fitness of donor ability alleles. We show mathematically that donor ability can be selected when relatedness at the locus modulating transfer is sufficiently high between donor and recipients, ensuring high frequency of transfer between cells sharing donor alleles. We further experimentally demonstrate that either population structure or discrimination in transfer can increase relatedness to a level selecting for chromosomal transfer alleles. Both mechanisms are likely to occur in natural environments. The simple process of strong dilution can create sufficient population structure to select for donor ability. Another mechanism observed in natural isolates, discrimination in transfer, can emerge through coselection of transfer and discrimination alleles. Our work shows that horizontal gene transfer in bacteria can be promoted by bacterial hosts themselves and not only by MGEs. In the longer term, the success of cells bearing beneficial MGEs combined with biased transfer leads to an association between high donor ability, discrimination, and mobile beneficial genes. However, in conditions that do not select for altruism, host bacteria promoting transfer are outcompeted by hosts with lower transfer rate, an aspect that could be relevant in the fight against the spread of antibiotic resistance.

  11. Mechanical Strain Promotes Oligodendrocyte Differentiation by Global Changes of Gene Expression.

    Science.gov (United States)

    Jagielska, Anna; Lowe, Alexis L; Makhija, Ekta; Wroblewska, Liliana; Guck, Jochen; Franklin, Robin J M; Shivashankar, G V; Van Vliet, Krystyn J

    2017-01-01

    Differentiation of oligodendrocyte progenitor cells (OPC) to oligodendrocytes and subsequent axon myelination are critical steps in vertebrate central nervous system (CNS) development and regeneration. Growing evidence supports the significance of mechanical factors in oligodendrocyte biology. Here, we explore the effect of mechanical strains within physiological range on OPC proliferation and differentiation, and strain-associated changes in chromatin structure, epigenetics, and gene expression. Sustained tensile strain of 10-15% inhibited OPC proliferation and promoted differentiation into oligodendrocytes. This response to strain required specific interactions of OPCs with extracellular matrix ligands. Applied strain induced changes in nuclear shape, chromatin organization, and resulted in enhanced histone deacetylation, consistent with increased oligodendrocyte differentiation. This response was concurrent with increased mRNA levels of the epigenetic modifier histone deacetylase Hdac11. Inhibition of HDAC proteins eliminated the strain-mediated increase of OPC differentiation, demonstrating a role of HDACs in mechanotransduction of strain to chromatin. RNA sequencing revealed global changes in gene expression associated with strain. Specifically, expression of multiple genes associated with oligodendrocyte differentiation and axon-oligodendrocyte interactions was increased, including cell surface ligands (Ncam, ephrins), cyto- and nucleo-skeleton genes (Fyn, actinins, myosin, nesprin, Sun1), transcription factors (Sox10, Zfp191, Nkx2.2), and myelin genes (Cnp, Plp, Mag). These findings show how mechanical strain can be transmitted to the nucleus to promote oligodendrocyte differentiation, and identify the global landscape of signaling pathways involved in mechanotransduction. These data provide a source of potential new therapeutic avenues to enhance OPC differentiation in vivo.

  12. Deep sequencing reveals a novel class of bidirectional promoters associated with neuronal genes.

    Science.gov (United States)

    Hu, Hai Yang; He, Liu; Khaitovich, Philipp

    2014-06-10

    Comprehensive annotation of transcripts expressed in a given tissue is a critical step towards the understanding of regulatory and functional pathways that shape the transcriptome. Here, we reconstructed a cumulative transcriptome of the human prefrontal cortex (PFC) based on approximately 300 million strand-specific RNA sequence (RNA-seq) reads collected at different stages of postnatal development. We find that more than 50% of reconstructed transcripts represent novel transcriptome elements, including 8,343 novel exons and exon extensions of annotated coding genes, 11,217 novel antisense transcripts and 29,541 novel intergenic transcripts or their fragments showing canonical features of long non-coding RNAs (lncRNAs). Our analysis further led to a surprising discovery of a novel class of bidirectional promoters (NBiPs) driving divergent transcription of mRNA and novel lncRNA pairs and displaying a distinct set of sequence and epigenetic features. In contrast to known bidirectional and unidirectional promoters, NBiPs are strongly associated with genes involved in neuronal functions and regulated by neuron-associated transcription factors. Taken together, our results demonstrate that large portions of the human transcriptome remain uncharacterized. The distinct sequence and epigenetic features of NBiPs, as well as their specific association with neuronal genes, further suggest existence of regulatory pathways specific to the human brain.

  13. Novel screening assay for in vivo selection of Klebsiella pneumoniae genes promoting gastrointestinal colonisation

    Science.gov (United States)

    2012-01-01

    Background Klebsiella pneumoniae is an important opportunistic pathogen causing pneumonia, sepsis and urinary tract infections. Colonisation of the gastrointestinal (GI) tract is a key step in the development of infections; yet the specific factors important for K. pneumoniae to colonize and reside in the GI tract of the host are largely unknown. To identify K. pneumoniae genes promoting GI colonisation, a novel genomic-library-based approach was employed. Results Screening of a K. pneumoniae C3091 genomic library, expressed in E. coli strain EPI100, in a mouse model of GI colonisation led to the positive selection of five clones containing genes promoting persistent colonisation of the mouse GI tract. These included genes encoding the global response regulator ArcA; GalET of the galactose operon; and a cluster of two putative membrane-associated proteins of unknown function. Both ArcA and GalET are known to be involved in metabolic pathways in Klebsiella but may have additional biological actions beneficial to the pathogen. In support of this, GalET was found to confer decreased bile salt sensitivity to EPI100. Conclusions The present work establishes the use of genomic-library-based in vivo screening assays as a valuable tool for identification and characterization of virulence factors in K. pneumoniae and other bacterial pathogens. PMID:22967317

  14. Gene expression noise in spatial patterning: hunchback promoter structure affects noise amplitude and distribution in Drosophila segmentation

    National Research Council Canada - National Science Library

    Holloway, David M; Lopes, Francisco J P; da Fontoura Costa, Luciano; Travençolo, Bruno A N; Golyandina, Nina; Usevich, Konstantin; Spirov, Alexander V

    2011-01-01

    .... We identify means by which noise is controlled during gene expression by characterizing the dependence of hb mRNA and protein output noise on hb promoter structure and transcriptional dynamics...

  15. Expression of human interferon-α8 synthetic gene under P(BAD) promoter.

    Science.gov (United States)

    Mohammed, Y; El-Baky, N A; Redwan, N A; Redwan, E M

    2012-10-01

    Recombinant human interferon-α8 (rhIFN-α8) was obtained by synthesizing a codon-optimized gene in a two-step polymerase chain reaction (PCR) and expressing it in Escherichia coli. The gene encoding human IFN-α8 shows a high content of rare codons. These were replaced based on E. coli codon usage and balancing TA-GC ratio contents of the entire gene. The two-step PCR was performed using long (45-60 nucleotides) overlapped primers and two Taq polymerases (pfu clone and GC-rich system) and resulted in a DNA band of 504 base pairs (bp) corresponding to the calculated size of the IFN-α8 coding sequence; the pfu clone failed to amplify the gene in the correct size without unspecific bands. The full gene was cloned into the pBAD-TOPO expression vector. After cloning, the gene was reoriented by NcoI restriction digestion and religation. The ligated pBAD-TOPO-IFN-α8 (pBAD-IFNα8) plasmid carried the IFN-α8 gene under transcriptional control of the L-arabinose-inducible P(BAD) promoter. IFN-α8 expression was optimized with respect to L-arabinose concentration, temperature, and time of induction in shake flask cultures to maximize the yield of soluble IFN-α8. The produced IFN-α8 was characterized by polyacrylamide gel electrophoresis and immunoassays. After purification on DEAE-Sepharose, the yield was 100 mg/liter. The antiviral and anticancer activities of the IFN-α8 were evaluated in comparison with IFN-α2a, and the results are discussed.

  16. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  17. Distinct promoter activation mechanisms modulate noise-driven HIV gene expression

    Science.gov (United States)

    Chavali, Arvind K.; Wong, Victor C.; Miller-Jensen, Kathryn

    2015-12-01

    Latent human immunodeficiency virus (HIV) infections occur when the virus occupies a transcriptionally silent but reversible state, presenting a major obstacle to cure. There is experimental evidence that random fluctuations in gene expression, when coupled to the strong positive feedback encoded by the HIV genetic circuit, act as a ‘molecular switch’ controlling cell fate, i.e., viral replication versus latency. Here, we implemented a stochastic computational modeling approach to explore how different promoter activation mechanisms in the presence of positive feedback would affect noise-driven activation from latency. We modeled the HIV promoter as existing in one, two, or three states that are representative of increasingly complex mechanisms of promoter repression underlying latency. We demonstrate that two-state and three-state models are associated with greater variability in noisy activation behaviors, and we find that Fano factor (defined as variance over mean) proves to be a useful noise metric to compare variability across model structures and parameter values. Finally, we show how three-state promoter models can be used to qualitatively describe complex reactivation phenotypes in response to therapeutic perturbations that we observe experimentally. Ultimately, our analysis suggests that multi-state models more accurately reflect observed heterogeneous reactivation and may be better suited to evaluate how noise affects viral clearance.

  18. Long non-coding RNA ROR decoys gene-specific histone methylation to promote tumorigenesis.

    Science.gov (United States)

    Fan, Jiayan; Xing, Yue; Wen, Xuyang; Jia, Renbin; Ni, Hongyan; He, Jie; Ding, Xia; Pan, Hui; Qian, Guanxiang; Ge, Shengfang; Hoffman, Andrew R; Zhang, He; Fan, Xianqun

    2015-07-14

    Long non-coding RNAs (lncRNAs) are not translated into proteins and were initially considered to be part of the 'dark matter' of the genome. Recently, it has been shown that lncRNAs play a role in the recruitment of chromatin modifying complexes and can influence gene expression. However, it is unknown if lncRNAs function in a similar way in cancer. Here, we show that the lncRNA ROR occupies and activates the TESC promoter by repelling the histone G9A methyltransferase and promoting the release of histone H3K9 methylation. Suppression of ROR in tumors results in silencing of TESC expression, and G9A-mediated histone H3K9 methylation in the TESC promoter is restored, which significantly reduces tumor growth and metastasis. Without ROR silencing, TESC knockdown presents consistent and significant reductions in tumor progression. Our results reveal a novel mechanism by which ROR may serve as a decoy oncoRNA that blocks binding surfaces, preventing the recruitment of histone modifying enzymes, thereby specifying a new pattern of histone modifications that promote tumorigenesis.

  19. Effects of dietary intake and genetic factors on hypermethylation of the hMLH1 gene promoter in gastric cancer

    Science.gov (United States)

    Nan, Hong-Mei; Song, Young-Jin; Yun, Hyo-Yung; Park, Joo-Seung; Kim, Heon

    2005-01-01

    AIM: Hypermethylation of the promoter of the hMLH1 gene, which plays an important role in mismatch repair during DNA replication, occurs in more than 30% of human gastric cancer tissues. The purpose of this study was to investigate the effects of environmental factors, genetic polymorphisms of major metabolic enzymes, and microsatellite instability on hypermethylation of the promoter of the hMLH1 gene in gastric cancer. METHODS: Data were obtained from a hospital-based, case-control study of gastric cancer. One hundred and ten gastric cancer patients and 220 age- and sex-matched control patients completed a structured questionnaire regarding their exposure to environmental risk factors. Hypermethylation of the hMLH1 gene promoter, polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2 and L-myc genes, microsatellite instability and mutations of p53 and Ki-ras genes were investigated. RESULTS: Both smoking and alcohol consumption were associated with a higher risk of gastric cancer with hypermethylation of the hMLH1 gene promoter. High intake of vegetables and low intake of potato were associated with increased likelihood of gastric cancer with hypermethylation of the hMLH1 gene promoter. Genetic polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2, and L-myc genes were not significantly associated with the risk of gastric cancer either with or without hypermethylation in the promoter of the hMLH1 gene. Hypermethylation of the hMLH1 promoter was significantly associated with microsatellite instability (MSI): 10 of the 14 (71.4%) MSI-positive tumors showed hypermethylation, whereas 28 of 94 (29.8%) the MSI-negative tumors were hypermethylated at the hMLH1 promoter region. Hypermethylation of the hMLH1 gene promoter was significantly inversely correlated with mutation of the p53 gene. CONCLUSION: These results suggest that cigarette smoking and alcohol consumption may influence the development of hMLH1-positive gastric cancer. Most dietary factors and

  20. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    Energy Technology Data Exchange (ETDEWEB)

    Leuze, Michael Rex [ORNL; Karpinets, Tatiana V [ORNL; Syed, Mustafa H [ORNL; Beliaev, Alexander S [ORNL; Uberbacher, Edward C [ORNL

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  1. Study of P14/ARF Gene Promoter Methylation and Effect of Interleukin-17 Gene Polymorphism on this Methylation among Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Sirous Naeimi

    2016-11-01

    Full Text Available Background: hyper-methylation in CpG Island is one of the major mechanisms in gene silencing. In many cancers, different genes are experiencing CIHM (CpG island hyper methylation. P14 / ARF regulatory factor, involved in negative regulation of the cell cycle through the effect on P53 factor pathway. On the other hand, Interleukin 17 can be increased methylation by inflammatory effects. The purpose of this study was to study the P14/ARF gene promoter methylation and effect of Interleukin-17 on this methylation among breast cancer patients in the south of the country and its comparison with healthy people. Materials and Methods: in this case–control study, peripheral blood of 40 patients with breast cancer who were referred to hospitals in Shiraz and 40 healthy women was used to DNA extraction by using salt out and K proteinase . Control subjects with a family history of cancer or autoimmune diseases were excluded from the study. We used PCR-RFLP method In order to study of Interleukin-17 gene polymorphism, and MSPCR method was used to study of P14/ARF gene promoter methylation. The results of the study were studied by using SPSS software, Arlequin, chi-square and Hardy-weinberg equilibrium test was used respectively. Results: findings confirms that there was a significant association between P14/ARF gene promoter methylation and disease and mentioned gene promoter was less methylated in healthy subjects compared to patients (p<0.05. On the other hand, there is a significant association between GG genotype in IL17 F gene polymorphisms and P14 /ARF gene methylation (P<0.05. Conclusion: P14/ARF gene promoter’s methylation play an important role in breast cancer. Due to the decline of P14P14/ARF gene promoters methylation and its association with this disease, seems that it could be used as a biomarker for diagnosis.  

  2. [The role of promoter CpG islands methylation of leptin gene in osteoarthritis].

    Science.gov (United States)

    Niu, Su-ping; Huang, Ci-bo; Zhao, Li-ke; Cheng, Yong-jing; Yang, Tuo

    2011-01-01

    To investigate the effects of 5-Aza-CdR (methylation transferase inhibitor)on the expression levels of leptin gene in chondrocytes and methylation states of leptin promoter region between osteoarthritis (OA) group and control. The chondrocytes in osteoarthritis group were treated with 5-Aza-CdR with different doses and time-points, and the expression level of leptin was detected by real-time polymerase chain reaction for picking up the optimum dose and time-point. Next, the chondrocytes in 5 osteoarthritis patients and 5 control patients (amputation due to severe trauma) were treated with 5-Aza-CdR. Lastly, leptin mRNA expression levels in the four groups osteoarthritis and control chondrocytes treated with/without 5-Aza-CdR were measured by real-time PCR and the methylation state of promoter region (-280 - +79) was detected by epitope quantitative DNA methylation analysis. (1) After treating the chondrocytes in OA groups with 10 µmol/L 5-Aza-CdR for 72 h, the mRNA expression levels of leptin were increased significantly. (2) The mRNA expression levels of leptin were significantly different among the four groups (P osteoarthritis groups treated with 5-Aza-CdR showed a marked induction of leptin mRNA expression. (3) Analysis of quantitative methylation data using an unsupervised hierarchical clustering algorithm, showed that methylation patterns of leptin promoter was different between control and osteoarthritis chondrocyte treated with/without 5-Aza-CdR. Demethylation of leptin promoter might up-regulate leptin gene expression level and it might contribute to osteoarthritis.

  3. Identification of novel motif patterns to decipher the promoter architecture of co-expressed genes in Arabidopsis thaliana.

    Science.gov (United States)

    López, Yosvany; Patil, Ashwini; Nakai, Kenta

    2013-10-16

    The understanding of the mechanisms of transcriptional regulation remains a challenge for molecular biologists in the post-genome era. It is hypothesized that the regulatory regions of genes expressed in the same tissue or cell type share a similar structure. Though several studies have analyzed the promoters of genes expressed in specific metazoan tissues or cells, little research has been done in plants. Hence finding specific patterns of motifs to explain the promoter architecture of co-expressed genes in plants could shed light on their transcription mechanism. We identified novel patterns of sets of motifs in promoters of genes co-expressed in four different plant structures (PSs) and in the entire plant in Arabidopsis thaliana. Sets of genes expressed in four PSs (flower, seed, root, shoot) and housekeeping genes expressed in the entire plant were taken from a database of co-expressed genes in A. thaliana. PS-specific motifs were predicted using three motif-discovery algorithms, 8 of which are novel, to the best of our knowledge. A support vector machine was trained using the average upstream distance of the identified motifs from the translation start site on both strands of binding sites. The correctly classified promoters per PS were used to construct specific patterns of sets of motifs to describe the promoter architecture of those co-expressed genes. The discovered PS-specific patterns were tested in the entire A. thaliana genome, correctly identifying 77.8%, 81.2%, 70.8% and 53.7% genes expressed in petal differentiation, synergid cells, root hair and trichome, as well as 88.4% housekeeping genes. We present five patterns of sets of motifs which describe the promoter architecture of co-expressed genes in five PSs with the ability to predict them from the entire A. thaliana genome. Based on these findings, we conclude that the positioning and orientation of transcription factor binding sites at specific distances from the translation start site is a

  4. The bidirectional promoter of the divergently transcribed mouse Surf-1 and Surf-2 genes.

    OpenAIRE

    Lennard, A C; Fried, M.

    1991-01-01

    The ubiquitously expressed mouse Surf-1 and Surf-2 genes are divergently transcribed, and their heterogeneous start sites are separated by up to a maximum of only 73 bp. By using in vitro DNase I, dimethyl sulfate methylation, and gel retardation assays, we have identified five putative promoter control elements between and around the Surf-1 and Surf-2 start sites. The effects of each site on the regulation of Surf-1 and Surf-2 transcription have been studied in vivo, and four sites were foun...

  5. Natural changes in light interact with circadian regulation at promoters to control gene expression in cyanobacteria

    Science.gov (United States)

    2017-01-01

    The circadian clock interacts with other regulatory pathways to tune physiology to predictable daily changes and unexpected environmental fluctuations. However, the complexity of circadian clocks in higher organisms has prevented a clear understanding of how natural environmental conditions affect circadian clocks and their physiological outputs. Here, we dissect the interaction between circadian regulation and responses to fluctuating light in the cyanobacterium Synechococcus elongatus. We demonstrate that natural changes in light intensity substantially affect the expression of hundreds of circadian-clock-controlled genes, many of which are involved in key steps of metabolism. These changes in expression arise from circadian and light-responsive control of RNA polymerase recruitment to promoters by a network of transcription factors including RpaA and RpaB. Using phenomenological modeling constrained by our data, we reveal simple principles that underlie the small number of stereotyped responses of dusk circadian genes to changes in light. PMID:29239721

  6. Nonsteroidal anti-inflammatory drugs repress β-secretase gene promoter activity by the activation of PPARγ

    Science.gov (United States)

    Sastre, Magdalena; Dewachter, Ilse; Rossner, Steffen; Bogdanovic, Nenad; Rosen, Evan; Borghgraef, Peter; Evert, Bernd O.; Dumitrescu-Ozimek, Lucia; Thal, Dietmar R.; Landreth, Gary; Walter, Jochen; Klockgether, Thomas; van Leuven, Fred; Heneka, Michael T.

    2006-01-01

    Epidemiological evidence suggests that nonsteroidal anti-inflammatory drugs (NSAIDs) decrease the risk for Alzheimer's disease (AD). Certain NSAIDs can activate the peroxisome proliferator-activated receptor-γ (PPARγ), which is a nuclear transcriptional regulator. Here we show that PPARγ depletion potentiates β-secretase [β-site amyloid precursor protein cleaving enzyme (BACE1)] mRNA levels by increasing BACE1 gene promoter activity. Conversely, overexpression of PPARγ, as well as NSAIDs and PPARγ activators, reduced BACE1 gene promoter activity. These results suggested that PPARγ could be a repressor of BACE1. We then identified a PPARγ responsive element (PPRE) in the BACE1 gene promoter. Mutagenesis of the PPRE abolished the binding of PPARγ to the PPRE and increased BACE1 gene promoter activity. Furthermore, proinflammatory cytokines decreased PPARγ gene transcription, and this effect was supressed by NSAIDs. We also demonstrate that in vivo treatment with PPARγ agonists increased PPARγ and reduced BACE1 mRNA and intracellular β-amyloid levels. Interestingly, brain extracts from AD patients showed decreased PPARγ expression and binding to PPRE in the BACE1 gene promoter. Our data strongly support a major role of PPARγ in the modulation of amyloid-β generation by inflammation and suggest that the protective mechanism of NSAIDs in AD involves activation of PPARγ and decreased BACE1 gene transcription. PMID:16407166

  7. Promoters Architecture-Based Mechanism for Noise-Induced Oscillations in a Single-Gene Circuit.

    Science.gov (United States)

    Guisoni, N; Monteoliva, D; Diambra, L

    2016-01-01

    It is well known that single-gene circuits with negative feedback loop can lead to oscillatory gene expression when they operate with time delay. In order to generate these oscillations many processes can contribute to properly timing such delay. Here we show that the time delay coming from the transitions between internal states of the cis-regulatory system (CRS) can drive sustained oscillations in an auto-repressive single-gene circuit operating in a small volume like a cell. We found that the cooperative binding of repressor molecules is not mandatory for a oscillatory behavior if there are enough binding sites in the CRS. These oscillations depend on an adequate balance between the CRS kinetic, and the synthesis/degradation rates of repressor molecules. This finding suggest that the multi-site CRS architecture can play a key role for oscillatory behavior of gene expression. Finally, our results can also help to synthetic biologists on the design of the promoters architecture for new genetic oscillatory circuits.

  8. Association between promoter polymorphisms of interleukin-4 gene and allergic rhinitis risk: a meta-analysis.

    Science.gov (United States)

    Li, Zhi-peng; Yin, Li-li; Wang, Hui; Liu, Li-si

    2014-06-01

    The relationship of interleukin-4 (IL-4) C-33T and C-590T (C-589T) gene polymorphisms with allergic rhinitis was analyzed. Data about the case control studies of IL-4 gene promoter polymorphisms [C-33T and C-590T (C-589T)] and their association with allergic diseases and correlation between serum IL-4 levels and allergic rhinitis were retrieved. The Stata 12.0 statistical software was applied to analyze the correlation between IL-4 gene polymorphisms and allergic rhinitis. The meta-analysis result of TT/CC genotype of -590 (-589) polymorphism showed a significant association with allergic diseases [OR=1.93, 95% CI (1.61-2.31), P=0.00]. Meta-analysis of the TT+TC versus CC genotype of IL-4 C-33/T polymorphism revealed significant associations with allergic diseases [OR=3.23, 95% CI (1.13-9.25), P=0.03]. Meanwhile, there was a significant correlation between serum IL-4 levels and allergic rhinitis [OR=2.52, 95% CI=(1.80-3.23), P=0.00]. IL-4 gene -590 TT genotype may increase the risk of allergic rhinitis and the T allele mutation of -33 might be correlated with allergic rhinitis.

  9. Hydrogel Design for Supporting Neurite Outgrowth and Promoting Gene Delivery to Maximize Neurite Extension

    Science.gov (United States)

    Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.

    2012-01-01

    Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654

  10. Mutational analysis of the mycobacteriophage BPs promoter PR reveals context-dependent sequences for mycobacterial gene expression.

    Science.gov (United States)

    Oldfield, Lauren M; Hatfull, Graham F

    2014-10-01

    The PR promoter of mycobacteriophage BPs directs early lytic gene expression and is under the control of the BPs repressor, gp33. Reporter gene fusions showed that PR has modest activity in an extrachromosomal context but has activity that is barely detectable in an integrated context, even in the absence of its repressor. Mutational dissection of PR showed that it uses a canonical -10 hexamer recognized by SigA, and mutants with mutations to the sequence 5'-TATAMT had the greatest activities. It does not contain a 5'-TGN-extended -10 sequence, although mutants with mutations creating an extended -10 sequence had substantially increased promoter activity. Mutations in the -35 hexamer also influenced promoter activity but were strongly context dependent, and similar substitutions in the -35 hexamer differentially affected promoter activity, depending on the -10 and extended -10 motifs. This warrants caution in the construction of synthetic promoters or the bioinformatic prediction of promoter activity. Combinations of mutations throughout PR generated a calibrated series of promoters for expression of stably integrated recombinant genes in both Mycobacterium smegmatis and M. tuberculosis, with maximal promoter activity being more than 2-fold that of the strong hsp60 promoter. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  11. Association of CXCL12 gene promoter methylation with periodontitis in patients with diabetes mellitus type 2.

    Science.gov (United States)

    Grdović, Nevena; Rajić, Jovana; Petrović, Sanja Matić; Dinić, Svetlana; Uskoković, Aleksandra; Mihailović, Mirjana; Jovanović, Jelena Arambašić; Tolić, Anja; Pucar, Ana; Milašin, Jelena; Vidaković, Melita

    2016-12-01

    CXCL12 is widely expressed, constitutive chemokine involved in tissue repair and regeneration, while the extent of its expression is important in various chronic inflammatory conditions. Involvement of DNA methylation in CXCL12 gene suppression (CXCL12) has been shown in malignancy and some autoimmune diseases. The aim of this study was to investigate whether the alterations in DNA methylation of CXCL12 are also involved in progression of periodontitis in combination with diabetes, as these chronic inflammatory conditions are strongly interrelated. Study included 72 subjects divided in three groups: healthy control (C, n=21), periodontitis (P, n=29) and diabetes/periodontitis group (D/P, n=22). DNA extracted from epithelial cells obtained by sterile cotton swabs from buccal mucosa was subjected to methylation specific polymerase chain reaction (MSP) to obtain DNA methylation pattern of CXCL12 promoter. CXCL12 promoter was predominantly unmethylated in all groups. However, increase in the frequency of the methylated form and increase in percent of methylation of CXCL12 promoter in periodontitis and diabetes/periodontitis group compared to control group were found, although without statistical significance. However, statistically significant increase in Tm of MSP products in diabetes/periodontitis group was observed. Correlation analysis revealed statistically significant relationship between the extent of DNA methylation of the CXCL12 promoter and periodontal parameters, as well as between DNA methylation of CXCL12 and glycosylated hemoglobin. Presented results suggest that chronic inflammation contributes to the change of CXCL12 DNA methylation in buccal cells and that DNA methylation profile of CXCL12 promoter plays important role in development and progression of periodontal disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. The MuvB complex sequentially recruits B-Myb and FoxM1 to promote mitotic gene expression

    Science.gov (United States)

    Sadasivam, Subhashini; Duan, Shenghua; DeCaprio, James A.

    2012-01-01

    Cell cycle progression is dependent on two major waves of gene expression. Early cell cycle gene expression occurs during G1/S to generate factors required for DNA replication, while late cell cycle gene expression begins during G2 to prepare for mitosis. Here we demonstrate that the MuvB complex—comprised of LIN9, LIN37, LIN52, LIN54, and RBBP4—serves an essential role in three distinct transcription complexes to regulate cell cycle gene expression. The MuvB complex, together with the Rb-like protein p130, E2F4, and DP1, forms the DREAM complex during quiescence and represses expression of both early and late genes. Upon cell cycle entry, the MuvB complex dissociates from p130/DREAM, binds to B-Myb, and reassociates with the promoters of late genes during S phase. MuvB and B-Myb are required for the subsequent recruitment of FoxM1 to late gene promoters during G2. The MuvB complex remains bound to FoxM1 during peak late cell cycle gene expression, while B-Myb binding is lost when it undergoes phosphorylation-dependent, proteasome-mediated degradation during late S phase. Our results reveal a novel role for the MuvB complex in recruiting B-Myb and FoxM1 to promote late cell cycle gene expression and in regulating cell cycle gene expression from quiescence through mitosis. PMID:22391450

  13. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  14. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  15. Targeted killing effects of double CD and TK suicide genes controlled by survivin promoter on gastric cancer cell.

    Science.gov (United States)

    Luo, Xian-Run; Li, Jian-Sheng; Niu, Ying; Miao, Li

    2011-02-01

    Suicide genes such as cytosine deaminase (CD) and herpes simplex virus thymidine kinase (TK) encode products that convert nontoxic substances (prodrugs) into toxic metabolites. Studies in recent years indicated that survivin(sur) expression was associated with the biological behaviors of gastric carcinoma. In the present study, targeted killing effects of double CD and TK suicide genes controlled by survivin promoter on gastric cancer cell were investigated, the recombinant pSCT vector containing CD and TK genes driven by sur promoter was constructed and transfected into SGC-7901 cells. After adding the CCV and 5-FC, the effects of double suicide genes on cell growth, cell cycle and proliferation were determined by MTT assay and flow cytometry (FCM). The results showed that sur promoter could specifically drive the expression of double CD/TK gene in SGC-7901 cells, whereas not in the normal GES-1 cell. After using CCV and 5-FC, the growth of SGC-7901 cells was inhibited. G1 phase proportion was significantly higher in SGC-7901 cells transfected with double suicide genes than the untransfected cells. These results suggest that CD and TK double suicide genes driven by sur promoter could provide a new approach for enhancing selective suicide gene therapy of CD/5-FC for the treatment of advanced gastric carcinoma.

  16. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    Science.gov (United States)

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  17. Silencing of tumor suppressor genes RASSF1A, SLIT2, and WIF1 by promoter hypermethylation in hereditary breast cancer.

    Science.gov (United States)

    Alvarez, Carolina; Tapia, Teresa; Cornejo, Valeria; Fernandez, Wanda; Muñoz, Alex; Camus, Mauricio; Alvarez, Manuel; Devoto, Luigi; Carvallo, Pilar

    2013-06-01

    Promoter hypermethylation is gaining strength as one of the main mechanisms through which tumor suppressor genes are silenced during tumor progression. Three tumor suppressor genes are frequently found methylated in their promoter, in concordance with absence of expression, RASSF1A, SLIT2, and WIF1. In addition, a previous array-CGH analysis from our group showed that these genes are found in deleted genomic regions observed in hereditary breast cancer tumors. In the present work we analyzed the methylation status of these three tumor suppressor gene promoters in 47 hereditary breast cancer tumors. Promoter methylation status analysis of hereditary breast tumors revealed high methylation frequencies for the three genes (67% RASSF1A, 80% SLIT2, and 72% WIF1). Additionally, the presence of methylated PCR products was associated with absence of protein expression for the three genes and statistically significant for RASSF1A and WIF1. Interestingly, methylation of all the three genes was found in 4 out of 6 grade I invasive ductal carcinoma tumors. Association between RASSF1A methylation and DCIS tumors was found. These results suggest that silencing of these tumor suppressor genes is an early event in hereditary breast cancer, and could be a marker for pre-malignant phenotypes. Copyright © 2012 Wiley Periodicals, Inc.

  18. The role of the P1BS element containing promoter-driven genes in Pi transport and homeostasis in plants

    DEFF Research Database (Denmark)

    Sobkowiak, Lukasz; Bielewicz, Dawid; Malecka, Ewelina M.

    2012-01-01

    level) and biotic (e.g.,mycorrhizal) factors regulating the expression of Pi-responsive genes. Transcription factors binding to the promoters of Pi-responsive genes activate different pathways of Pi transport, distribution, and homeostasis maintenance. Pi metabolism involves not only functional proteins...

  19. Eukaryotic and prokaryotic promoter databases as valuable tools in exploring the regulation of gene transcription: a comprehensive overview.

    Science.gov (United States)

    Majewska, Małgorzata; Wysokińska, Halina; Kuźma, Łukasz; Szymczyk, Piotr

    2017-11-02

    The complete exploration of the regulation of gene expression remains one of the top-priority goals for researchers. As the regulation is mainly controlled at the level of transcription by promoters, study on promoters and findings are of great importance. This review summarizes forty selected databases that centralize experimental and theoretical knowledge regarding the organization of promoters, interacting transcription factors (TFs) and microRNAs (miRNAs) in many eukaryotic and prokaryotic species. The presented databases offer researchers valuable support in elucidating the regulation of gene transcription. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  1. Cestrum yellow leaf curling virus (CmYLCV) promoter: a new strong constitutive promoter for heterologous gene expression in a wide variety of crops.

    Science.gov (United States)

    Stavolone, Livia; Kononova, Maria; Pauli, Sandra; Ragozzino, Antonio; de Haan, Peter; Milligan, Steve; Lawton, Kay; Hohn, Thomas

    2003-11-01

    Appropriately regulated gene expression requires a suitable promoter. A number of promoters have been isolated and shown to be functional in plants, but only a few of them activate transcription of transgenes at high levels constitutively. We report here the cloning and characterization of a novel, constitutively expressed promoter isolated from Cestrum yellow leaf curling virus (CmYLCV), a double-stranded DNA plant pararetrovirus belonging to the Caulimoviridae family. The CmYLCV promoter is highly active in callus, meristems and vegetative and reproductive tissues in Arabidopsis thaliana, Nicotiana tabacum, Lycopersicon esculentum, Zea mays and Oryza sativa. Furthermore, the level of expression is comparable to, or higher than, that from the CaMV 35S, the 'super-promoter' or the maize ubiquitin 1 promoters, three frequently used promoters in agricultural biotechnology. The heritable, strong and constitutive activity in both monocotyledonous and dicotyledonous plants, combined with the extremely narrow CmYLCV host range, makes the CmYLCV promoter an attractive tool for regulating transgene expression in a wide variety of plant species.

  2. Prolactin promoter gene as marker assisted selection (MAS for the control of broodiness of Kampung chicken

    Directory of Open Access Journals (Sweden)

    Tike Sartika

    2004-12-01

    Full Text Available Preliminary research about MAS (Marker Assisted Selection was conducted to detect broodiness trait of Kampung chicken. MAS currently is very important in situations, where the accuracy of selection is low, such as, traits with low heritability, e.g. broodiness trait and egg production. Prolactin promoter was selected as a marker gene for broodiness because it plays a critical part in the neuroendocrine cascade which is triggered at the onset of broodiness. DNA samples were collected from low and highbroodiness samples on basic population (G0 each 24 samples, and from selected population (G3 each 28 samples. As control population without broody behavior was used 16 samples White Leghorn (WL chicken. Prolactin promoter gene was amplified using polymerase chain reaction (PCR. PCR product was analyzed using electrophoresis agarose gel 2%. The results showed four types of bands represent in the Kampung chicken, three types called as wild type band and one type as the WL band. The chickens with low and high broodiness on G0 generation have 75 and 87.5% of wild type band while in the G3 generation was decreased to 25 and 75%. Conclusions of the research indicated that the selected breed of the Kampung chicken on G3 generation increased WL band like White Leghorn chicken as much as 31,25% from the G0 generation.

  3. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  4. Profiling gene promoter occupancy of Sox2 in two phenotypically distinct breast cancer cell subsets using chromatin immunoprecipitation and genome-wide promoter microarrays.

    Science.gov (United States)

    Jung, Karen; Wang, Peng; Gupta, Nidhi; Gopal, Keshav; Wu, Fang; Ye, Xiaoxia; Alshareef, Abdulraheem; Bigras, Gilbert; McMullen, Todd P; Abdulkarim, Bassam S; Lai, Raymond

    2014-11-08

    Aberrant expression of the embryonic stem cell marker Sox2 has been reported in breast cancer (BC). We previously identified two phenotypically distinct BC cell subsets separated based on their differential response to a Sox2 transcription activity reporter, namely the reporter-unresponsive (RU) and the more tumorigenic reporter-responsive (RR) cells. We hypothesized that Sox2, as a transcription factor, contributes to their phenotypic differences by mediating differential gene expression in these two cell subsets. We used chromatin immunoprecipitation and a human genome-wide promoter microarray (ChIP-chip) to determine the promoter occupancies of Sox2 in the MCF7 RU and RR breast cancer cell populations. We validated our findings with conventional chromatin immunoprecipitation, quantitative reverse transcription polymerase chain reaction (qPCR), and western blotting using cell lines, and also performed qPCR using patient RU and RR samples. We found a largely mutually exclusive profile of gene promoters bound by Sox2 between RU and RR cells derived from MCF7 (1830 and 456 genes, respectively, with only 62 overlapping genes). Sox2 was bound to stem cell- and cancer-associated genes in RR cells. Using quantitative RT-PCR, we confirmed that 15 such genes, including PROM1 (CD133), BMI1, GPR49 (LGR5), and MUC15, were expressed significantly higher in RR cells. Using siRNA knockdown or enforced expression of Sox2, we found that Sox2 directly contributes to the higher expression of these genes in RR cells. Mucin-15, a novel Sox2 downstream target in BC, contributes to the mammosphere formation of BC cells. Parallel findings were observed in the RU and RR cells derived from patient samples. In conclusion, our data supports the model that the Sox2 induces differential gene expression in the two distinct cell subsets in BC, and contributes to their phenotypic differences.

  5. Regulation of gene expression in the protozoan parasite Entamoeba invadens identification of core promoter elements and promoters with stage-specific expression patterns

    Science.gov (United States)

    Manna, Dipak; Ehrenkaufer, Gretchen M.; Singh, Upinder

    2014-01-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points . In this study RNA-Seq data was utilized to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5’ and 3’ untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3’- U-Rich Motif (Ei3’-URM) (TTTGTT) in the 5’ and 3’ flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analyzed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic

  6. Regulation of gene expression in the protozoan parasite Entamoeba invadens: identification of core promoter elements and promoters with stage-specific expression patterns.

    Science.gov (United States)

    Manna, Dipak; Ehrenkaufer, Gretchen M; Singh, Upinder

    2014-10-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points. In this study RNA-Seq data was utilised to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5' and 3' untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3'-U-Rich Motif (Ei3'-URM) (TTTGTT) in the 5' and 3' flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analysed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic manipulation of E

  7. Transcriptional activity of novel ALDH1L1 promoters in the rat brain following AAV vector-mediated gene transfer

    Directory of Open Access Journals (Sweden)

    Janitha M Mudannayake

    2016-01-01

    Full Text Available Aldehyde dehydrogenase family 1, member L1 (ALDH1L1 is a recently characterized pan-astrocytic marker that is more homogenously expressed throughout the brain than the classic astrocytic marker, glial fibrillary acidic protein. We generated putative promoter sequence variants of the rat ALDH1L1 gene for use in adeno-associated viral vector-mediated gene transfer, with an aim to achieve selective regulation of transgene expression in astrocytes in the rat brain. Unexpectedly, ALDH1L1 promoter variants mediated transcriptional activity exclusively in neurons in the substantia nigra pars compacta as assessed by luciferase reporter expression at 3 weeks postvector infusion. This selectivity for neurons in the substantia nigra pars compacta also persisted in the context of adeno-associated viral serotype 5, 8 or 9 vector-mediated gene delivery. An in vivo promoter comparison showed the highest performing ALDH1L1 promoter variant mediated higher transgene expression than the neuronal-specific synapsin 1 and tyrosine hydroxylase promoters. The ALDH1L1 promoter was also transcriptionally active in dentate granule neurons following intrahippocampal adeno-associated viral vector infusion, whereas transgene expression was detected in both striatal neurons and astrocytes following vector infusion into the striatum. Our results demonstrate the potential suitability of the ALDH1L1 promoter as a new tool in the development of gene therapy and disease modelling applications.

  8. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  9. Gene methylation of human ovarian carcinoma stromal progenitor cells promotes tumorigenesis.

    Science.gov (United States)

    Ho, Chih-Ming; Shih, Daniel Tzu-Bi; Hsiao, Chih-Chiang; Huang, Shih-Hung; Chang, Shwu-Fen; Cheng, Wen-Fang

    2015-11-23

    This study aimed to investigate whether the DNA methylation of human ovarian carcinoma stromal progenitor cells (OCSPCs) could promote the tumorigenesis of ovarian carcinoma. OCSPCs were first isolated from fresh tumor tissues and ascites of ovarian cancer patients. In vivo and in vitro experiments on the effect of the OCSPCs on tumorigenesis and the effects of DNA demethylation on the OCSPCs were then performed. The OCSPCs possessed self-renewal and multipotent differentiation capacity with elevated expressions of OCT4, NANOG, BMP2, BMP4, Rex-1, AC133 and TGF-β. The OCSPCs, when combined with tumor cells in vivo could promote tumor growth. The methylation profiles of tumor suppressor genes (TSGs) were significantly higher in the OCSPCs than in ovarian cancer cells (p cells. The expression levels of TSGs were re-expressed by 5-aza-2-dC to inhibit the self-renewal and growth of OCSPCs. OCSPCs with decreased TSG expressions in the ovarian tumor microenvironment were able to promote tumorigenesis which could be reversed by DNA demethylation. DNA demethylation reversing the expression of TSGs in OCSPCs may represent a potential therapeutic target for ovarian cancer.

  10. Sequence tolerance of the phage lambda PRM promoter: implications for evolution of gene regulatory circuitry.

    Science.gov (United States)

    Michalowski, Christine B; Short, Megan D; Little, John W

    2004-12-01

    Much of the gene regulatory circuitry of phage lambda centers on a complex region called the O(R) region. This approximately 100-bp region is densely packed with regulatory sites, including two promoters and three repressor-binding sites. The dense packing of this region is likely to impose severe constraints on its ability to change during evolution, raising the question of how the specific arrangement of sites and their exact sequences could evolve to their present form. Here we ask whether the sequence of a cis-acting site can be widely varied while retaining its function; if it can, evolution could proceed by a larger number of paths. To help address this question, we developed a lambda cloning vector that allowed us to clone fragments spanning the O(R) region. By using this vector, we carried out intensive mutagenesis of the P(RM) promoter, which drives expression of CI repressor and is activated by CI itself. We made a pool of fragments in which 8 of the 12 positions in the -35 and -10 regions were randomized and cloned this pool into the vector, making a pool of P(RM) variant phage. About 10% of the P(RM) variants were able to lysogenize, suggesting that the lambda regulatory circuitry is compatible with a wide range of P(RM) sequences. Analysis of several of these phages indicated a range of behaviors in prophage induction. Several isolates had induction properties similar to those of the wild type, and their promoters resembled the wild type in their responses to CI. We term this property of different sequences allowing roughly equivalent function "sequence tolerance " and discuss its role in the evolution of gene regulatory circuitry.

  11. Human DNA repair genes possess potential G-quadruplex sequences in their promoters and 5`-untranslated regions.

    Science.gov (United States)

    Fleming, Aaron M; Zhu, Judy; Ding, Yun; Visser, Joshua A; Zhu, Julia; Burrows, Cynthia J

    2018-01-10

    The cellular response to oxidative stress includes transcriptional changes, particularly for genes involved in DNA repair. Recently, our laboratory demonstrated that oxidation of 2`-deoxyguanosine (G) to 8-oxo-7,8-dihydro-2`-deoxyguanosine (OG) in G-rich potential G-quadruplex sequences (PQSs) in gene promoters impacts the level of gene expression up or down depending on the position of the PQS in the promoter. In the present report, bioinformatic analysis found that the 390 human DNA repair genes in the genome ontology initiative harbor 2,936 PQSs in their promoters and 5`-untranslated regions (5`-UTRs). The average density of PQSs in human DNA repair genes was found to be nearly twofold greater than the average density of PQSs in all coding and non-coding human genes (7.5 vs. 4.3 per gene). The distribution of the PQSs in the DNA repair genes on the non-transcribed (coding) vs. transcribed strands reflects that of PQSs in all human genes. Next, literature data were interrogated to select 30 PQSs to catalog their ability to adopt G-quadruplex (G4) folds in vitro using five different experimental tests. The G4 characterization experiments concluded that 26 of the 30 sequences could adopt G4 topologies in solution. Last, four PQSs were synthesized into the promoter of a luciferase plasmid and co-transfected with the G4-specific ligands pyridostatin, Phen-DC3, or BRACO-19 in human cells to determine whether the PQSs could adopt G4 folds. The cell studies identified changes in luciferase expression when the G4 ligands were present, and the magnitude of the expression changes dependent on the PQS and the coding vs. template strand on which the sequence resided. Our studies demonstrate PQSs exist at a high density in human DNA repair gene promoters and a subset of the identified sequences fold in vitro and in vivo.

  12. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  13. [GFP reporter gene under the direction of chicken ovalbumin gene promoter expressed in the CHO cell and in the primary cell cultures of chicken oviduct].

    Science.gov (United States)

    Pang, Yue; Li, Qing-Wei

    2005-01-01

    To reseach GFP reporter gene under the control of chick ovalbumin gene regulatory elements express in the CHO cell and in the primary cell cultures of chicken oviduct. 1.5kb fragment and 2.9kb fragment were amplicated by PCR method, two fragments were subeloned to manmalian expression vector pGFP-N2 by recombinant DNA technology, the CMV promoter was cut off from pGFP-N2, so two expression vectors were constructed, one is the P2.9koval-GFP including promoter, first exon, first intron of chicken ovalbumin gene, the other is the P1.5koval-GFP including first intron of chicken ovalbumin gene. Restriction enzyme digestion and DNA sequence analysis revealed that 5'upstream regions of ovalbumin gene were not only identical to those of the published chicken ovalbumin gene, but also were contained in the recombinant vector. They were transfected into the CHO cell and the primary cell cultures of chicken oviduct by Lipofectin, they were used for fluorescence detection. GFP protein existed in GFP transfected the CHO cell and the primary cell cultures of chicken oviduct. It is demonstrated that GFP reporter gene under the direction of chick ovalbumin gene promoter could be expressed in the CHO cell and in the primary cell cultures of chicken oviduct.

  14. Understanding the transcriptional regulation of cervix cancer using microarray gene expression data and promoter sequence analysis of a curated gene set.

    Science.gov (United States)

    Srivastava, Prashant; Mangal, Manu; Agarwal, Subhash Mohan

    2014-02-10

    Cervical cancer, the malignant neoplasm of the cervix uteri is the second most common cancer among women worldwide and the top-most cancer in India. Several factors are responsible for causing cervical cancer, which alter the expression of oncogenic genes resulting in up or down-regulation of gene expression and inactivation of tumor-suppressor genes/gene products. Gene expression is regulated by interactions between transcription factors (TFs) and specific regulatory elements in the promoter regions of target genes. Thus, it is important to decipher and analyze TFs that bind to regulatory regions of diseased genes and regulate their expression. In the present study, computational methods involving the combination of gene expression data from microarray experiments and promoter sequence analysis of a curated gene set involved in the cervical cancer causation have been utilized for identifying potential regulatory elements. Consensus predictions of two approaches led to the identification of twelve TFs that might be crucial to the regulation of cervical cancer progression. Subsequently, TF enrichment and oncomine expression analysis suggested that the transcription factor family E2F played an important role for the regulation of genes involve in cervical carcinogenesis. Our results suggest that E2F possesses diagnostic/prognostic value and can act as a potential drug target in cervical cancer. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10+/+ mice. After total body irradiation (TBI), Grb10m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10+/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs.

    Science.gov (United States)

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8-14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  18. Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu JW

    2015-12-01

    Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN

  19. Immune regulatory gene polymorphisms as predisposing risk factors for the development of factor VIII inhibitors in Indian severe haemophilia A patients.

    Science.gov (United States)

    Pinto, P; Ghosh, K; Shetty, S

    2012-09-01

    Development of inhibitors to factor VIII, a serious complication of replacement therapy in haemophilia A patients, leads to increased bleeding, morbidity and mortality. There is no data on the risk factors for inhibitor development in Indian patients with severe haemophilia A. Our aim was to study the role of immune regulatory gene polymorphisms in the development of inhibitors. Fourteen immune regulatory gene polymorphisms (IL1β, IL4, IL10, TNFA and CTLA4) were analysed in 120 patients with severe haemophilia A, i.e. 50 inhibitor positive patients, and 70 inhibitor negative control patients, by PCR-RFLP, DNA sequencing and allele-specific PCRs. The IL10 promoter 'GCC' haplotypes overall (P: 0.002, OR: 3.452, 95% CI: 1.607-7.416), and 'GCC/ATA' (P: 0.011, OR: 3.492, 95% CI: 1.402-8.696) haplotype, associated with high and intermediate IL10 production, respectively, were significantly higher in inhibitor positive patients, whereas the 'non-GCC' haplotypes overall (P: 0.002,OR: 0.290, 95% CI 0.135-0.622) and 'ATA/ATA' haplotype (P: 0.025, OR: 0.278, 95% CI: 0.096-0.802), associated with low IL10 synthesis, were significantly higher among inhibitor negative patients. The TNFA rs1799724 C/T heterozygote prevalence was significantly higher in the inhibitor positive group (P: 0.021, OR: 3.190, 95% CI: 1.273-7.990), whereas the other polymorphisms showed no statistically significant association with the presence of inhibitors. Different immune regulatory gene polymorphisms play a significant role as possible risk factors for the development of inhibitors in severe haemophilia A patients. © 2012 Blackwell Publishing Ltd.

  20. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  1. Identification of the cornea-specific keratin 12 promoter by in vivo particle-mediated gene transfer.

    Science.gov (United States)

    Shiraishi, A; Converse, R L; Liu, C Y; Zhou, F; Kao, C W; Kao, W W

    1998-12-01

    Keratin 12 (K12) is a cornea epithelial cell-specific intermediate filament component. To provide a better understanding of its expression, it is necessary to identify and characterize the promoter of Krt1.12 gene. The 2.5-kb DNA 5' to Krt1.12 gene was sequenced. Krt1.12 promoter-beta-gal DNA constructs were prepared and used in vivo to transfect rabbit corneas, conjunctivas, and skin by particle-mediated gene transfer (Gene Gun). In vitro, the DNA constructs were transfected into cultured T-antigen-transformed rabbit corneal epithelial (RCE-T) cells and human fibrosarcoma HT-1080 fibroblasts with lipofectamine. The promoter activity was assessed by measuring beta-gal (beta-galactosidase) activity using histochemical staining with 5-Bromo-4-chloro-3-indolyl-beta-D-galactoside and enzyme assay with o-nitrophenyl beta-D-galactopyranoside. There are four Pax-6 pair box binding elements found between -910 and -2000 bp 5'-flanking the transcription initiation site of the Krt1.12 gene. None of promoter constricts can be expressed by HT-1080 cells. Cotransfection of Pax-6 cDNA with K12 promoter-beta-gal constructs containing Pax-6 elements results in a fourfold increase of beta-gal activities in RCE-T cells but not HT-1080 fibroblasts. The data of in vivo transfection in the rabbit by Gene Gun indicate that reporter gene constructs containing 0.6-kb and longer DNA fragments 5'-flanking Krt1.12 gene are effectively expressed in corneal, but not conjunctival or epidermal epithelial cells. The particle-mediated gene transfer is a suitable technique for in vivo delivery of transgenes to corneal epithelial cells. The 2.5-kb DNA fragment 5'-flanking Krt1.12 contains corneal epithelial cell-specific regulatory cis-DNA elements. Pax-6 is a positive transcription factor essential for keratin 12 expression.

  2. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    Energy Technology Data Exchange (ETDEWEB)

    Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which

  3. Control of intestinal promoter activity of the cellular migratory regulator gene ELMO3 by CDX2 and SP1

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Boyd, Mette; Olsen, Jørgen

    2010-01-01

    in the differentiated human intestinal cancer cell line Caco-2 in order to identify CDX2-regulated genes involved in cellular migration. The engulfment and cell motility 3 (ELMO3) gene was identified as a potential CDX2 target gene. ELMO3 is an essential upstream regulator of the GTP-binding protein RAC during cell...... migration. However, no information is available about the transcriptional regulation of the ELMO3 gene. The aim of this study was to investigate the potential role of CDX2 in the regulation of the ELMO3 promoter activity. Electrophoretic mobility shift assays showed that CDX2 bound to conserved CDX2...... sequences and mutations of the CDX2-binding sites, significantly reduced the promoter activity. Reporter gene assays demonstrated that the region mediating ELMO3 basal transcriptional activity to be located between -270 and -31 bp. Sequence analysis revealed no typical TATA-box, but four GC-rich sequences...

  4. δ-Catenin promotes prostate cancer cell growth and progression by altering cell cycle and survival gene profiles

    Directory of Open Access Journals (Sweden)

    Chen Yan-Hua

    2009-03-01

    Full Text Available Abstract Background δ-Catenin is a unique member of β-catenin/armadillo domain superfamily proteins and its primary expression is restricted to the brain. However, δ-catenin is upregulated in human prostatic adenocarcinomas, although the effects of δ-catenin overexpression in prostate cancer are unclear. We hypothesized that δ-catenin plays a direct role in prostate cancer progression by altering gene profiles of cell cycle regulation and cell survival. Results We employed gene transfection and small interfering RNA to demonstrate that increased δ-catenin expression promoted, whereas its knockdown suppressed prostate cancer cell viability. δ-Catenin promoted prostate cancer cell colony formation in soft agar as well as tumor xenograft growth in nude mice. Deletion of either the amino-terminal or carboxyl-terminal sequences outside the armadillo domains abolished the tumor promoting effects of δ-catenin. Quantitative RT2 Profiler™ PCR Arrays demonstrated gene alterations involved in cell cycle and survival regulation. δ-Catenin overexpression upregulated cyclin D1 and cdc34, increased phosphorylated histone-H3, and promoted the entry of mitosis. In addition, δ-catenin overexpression resulted in increased expression of cell survival genes Bcl-2 and survivin while reducing the cell cycle inhibitor p21Cip1. Conclusion Taken together, our studies suggest that at least one consequence of an increased expression of δ-catenin in human prostate cancer is the alteration of cell cycle and survival gene profiles, thereby promoting tumor progression.

  5. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  6. β-catenin promoter ChIP-chip reveals potential schizophrenia and bipolar disorder gene network.

    Science.gov (United States)

    Pedrosa, Erika; Shah, Abhishek; Tenore, Christopher; Capogna, Michael; Villa, Catalina; Guo, Xingyi; Zheng, Deyou; Lachman, Herbert M

    2010-12-01

    Therapeutic concentrations of lithium salts inhibit glycogen synthase kinase 3 beta (GSK3β) and phosphoinositide (PI) signaling suggesting that abnormal activation of these pathways could be a factor in the pathophysiology of bipolar disorder (BD). Involvement of these pathways is also supported by recent genome-wide association studies (GWASs). One way investigators have investigated the molecular basis of BD and the therapeutic action of lithium is by microarray expression studies, since both GSK3β- and PI-mediated signal transduction pathways are coupled to transcriptional activation and inhibition. However, expression profiling has some limitations and investigators cannot use the approach to analyze fetal brain tissue, arguably the most relevant biological structure related to the development of genetically based psychiatric disorders. To address these shortcomings, the authors have taken a novel approach using chromatin immunoprecipitation-enriched material annealed to microarrays (ChIP-chip) targeting genes in fetal brain tissue bound by β-catenin, a transcription factor that is directly regulated by GSK3β. The promoters for 640 genes were found to be bound by β-catenin, many of which are known schizophrenia (SZ), autism spectrum disorder (ASD), and BD candidates, including CACNA1B, NRNG, SNAP29, FGFR1, PCDH9, and nine others identified in recently published GWASs and genome-wide searches for copy number variants (CNVs). The findings suggest that seemingly disparate candidate genes for SZ and BD can be incorporated into a common molecular network revolving around GSK3β/β-catenin signaling. In addition, the finding that a putative lithium-responsive pathway may influence a subgroup of SZ and ASD candidate genes could have therapeutic implications.

  7. Analysis of mutation and promoter methylation of TP53 gene in tumors of the head and neck

    Directory of Open Access Journals (Sweden)

    Jarzynski Adrian

    2016-06-01

    Full Text Available According to current World Health Organization data, worldwide, cancer is second to cardiovascular diseases as the leading cause of death. The p53 protein is a translation product of the TP53 gene, and it has many functions in cells. Indeed, for this, it is commonly called the “guardian of the genome”. The aim of this study was to evaluate the prevalence of mutation and methylation in the promoter of the TP53 gene in cells affected with squamous cell carcinoma of the head and neck. The research material consisted of 34 DNA samples isolated from surgically removed tissue fragments of head and neck tumors. In this work, analysis of all samples for the presence of mutations proved negative. This result simultaneously revealed an absence of mutation in the TP53 gene promoter in the analyzed material. However, the detection of changes in the methylation profile status of the promoter of the TP53 gene in the DNA samples revealed the presence of both methylated alleles in 76.5% of the sample population, while in the remaining 23.5%, methylation was present in only one allele of the studied gene. In our work, we assumed that samples displaying methylation involving two alleles will show greater predisposition to the development of a malignant tumor. The obtained results reveal that despite the lack of mutation in the TP53 gene promoter, its functioning may be impaired by other mechanisms – either epigenetic or environmental.

  8. Promoter Structure of the RNA Polymerase II Large Subunit Gene in Caenorhabditis elegans and C. briggsae.

    Science.gov (United States)

    Bird, D M; Kaloshian, I; Molinari, S

    1997-06-01

    The 5'-end of the Caenorhabditis elegans ama-1 gene transcript, which encodes the largest subunit of RNA polymerase II, was cloned. Sequencing revealed that the message is trans-spliced. To characterize the Ce-ama-1 promoter, DNA sequence spanning 3 kb upstream from the initiation codon was determined. Typical elements, such as TATA and Spl sites, were absent. The homologue of ama-1 in C. briggsae, Cb-ama-1, was isolated and its 5' flanking sequence compared with that of Ce-ama-1, revealing only limited similarity, although both sequences included a potential initiator-class transcriptional regulator and phased repeats of an ATC motif. The latter elements are postulated to facilitate DNA bending and may play a role in transcription regulation.

  9. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  10. A 5'-regulatory region and two coding region polymorphisms modulate promoter activity and gene expression of the growth suppressor gene ZBED6 in cattle.

    Directory of Open Access Journals (Sweden)

    Yong-Zhen Huang

    Full Text Available Zinc finger, BED-type containing 6 (ZBED6 is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. Polymorphisms in its promoter and coding regions are likely to impact ZBED6 transcription and growth traits. In this study, rapid amplification of 5' cDNA ends (5'-RACE analysis revealed two transcription start sites (TSS for the bovine ZBED6 starting within exon 1 of the ZC3H11A gene (TSS-1 and upstream of the translation start codon of the ZBED6 gene (TSS-2. There was one SNP in the promoter and two missense mutations in the coding region of the bovine ZBED6 by sequencing of the pooled DNA samples (Pool-Seq, n = 100. The promoter and coding region are the key regions for gene function; polymorphisms in these regions can alter gene expression. Quantitative real-time PCR (qPCR analysis showed that ZBED6 has a broad tissue distribution in cattle and is highly expressed in skeletal muscle. Eleven promoter-detection vectors were constructed, which enabled the cloning of putative promoter sequences and analysis of ZBED6 transcriptional activity by luciferase reporter gene assays. The core region of the basal promoter of bovine ZBED6 is located within region -866 to -556. The activity of WT-826G-pGL3 in driving reporter gene transcription is significantly higher than that of the M-826A-pGL3 construct (P < 0.01. Analysis of gene expression patterns in homozygous full-sibling Chinese Qinchuan cattle showed that the mutant-type Hap-AGG exhibited a lower mRNA level than the wild-type Hap-GCA (P < 0.05 in longissimus dorsi muscle (LDM. Moreover, ZBED6 mRNA expression was low in C2C12 cells overexpressing the mutant-type ZBED6 (pcDNA3.1(+-Hap-GG (P < 0.01. Our results suggest that the polymorphisms in the promoter and coding regions may modulate the promoter activity and gene expression of bovine ZBED6 in the skeletal muscles of these cattle breeds.

  11. IGF-I gene transfer by electroporation promotes regeneration in a muscle injury model.

    Science.gov (United States)

    Takahashi, T; Ishida, K; Itoh, K; Konishi, Y; Yagyu, K-I; Tominaga, A; Miyazaki, J-I; Yamamoto, H

    2003-04-01

    The goal of this study was to determine whether insulin-like growth factor-I (IGF-I) gene delivery by electroporation promotes repair after muscle injury. An injury-repair model was created using mice in which a hamstring muscle was cut and sutured. A total of 50 microg of IGF-I DNA or green fluorescent protein (GFP) DNA (both in pCAGGS) was injected into the lesion and introduced into muscle cells by electrostimulation using an electric pulse generator. The number of regenerating muscle fibers in the IGF-I DNA group was significantly more than that in the GFP DNA group at 2 weeks after injection. The diameter of regenerating muscle fibers from the IGF-I DNA group was larger than that of the GFP DNA group at 4 weeks after injection. There was no significant difference in the serum IGF-I concentration between the IGF-I DNA group and the GFP DNA group at 1, 2, and 4 weeks after injection. However, muscle IGF-I concentration in the IGF-I DNA injection group was significantly greater than that in the GFP DNA injection group at 2 weeks after injection. These results demonstrated that the effects of enhanced IGF-I production were local and limited to the injected area. The ratio (injected/uninjected; intact) of the amplitude of compound muscle action potentials (CMAP) in the IGF-I DNA injection group was greater than that in the GFP DNA injection group at 4 weeks after injection and of the control group. In conclusion, IGF-I gene transfer by electroporation proved to be a simple, safe, inexpensive, and effective method to promote the regeneration of injured muscles in our injury model.

  12. IL2 Variant Circumvents ICOS+ Regulatory T-cell Expansion and Promotes NK Cell Activation.

    Science.gov (United States)

    Sim, Geok Choo; Liu, Chengwen; Wang, Ena; Liu, Hui; Creasy, Caitlin; Dai, Zhimin; Overwijk, Willem W; Roszik, Jason; Marincola, Francesco; Hwu, Patrick; Grimm, Elizabeth; Radvanyi, Laszlo

    2016-11-01

    Clinical responses to high-dose IL2 therapy are limited due to selective expansion of CD4+CD25+Foxp3+ T-regulatory cells (Treg), especially ICOS+ Tregs, rather than natural killer (NK) cells and effector T cells. These ICOS+ Tregs are highly suppressive and constitutively express high levels of IL2Rα (CD25) and CD39. Here, we characterized the effect of a mutant form of IL2 (F42K), which preferentially binds to the lower affinity IL2Rβγ with reduced binding to CD25, on Tregs, effector NK cells, and T-cell subsets. Unlike wild-type (WT) IL2, F42K did not efficiently induce the expansion of highly suppressive ICOS+ Tregs in peripheral blood mononuclear cells (PBMC) from healthy controls and melanoma patients. Instead, it promoted the expansion of CD16+CD56+ NK cells and CD56hiCD16- NK cell subsets in both short- and long-term cultures, with enhanced Bcl-2 expression. Stimulation of PBMCs with F42K induced expression of more NK cell activation molecules, such as NKp30, NKp44, DNAM-1, NKG2D, 4-1BB/CD137, and Tim-3, than WT IL2. F42K induced greater upregulation of TRAIL, and NK-mediated cytolytic activity was increased against both autologous and HLA-mismatched melanoma cells compared with WT IL2. Gene expression analysis revealed distinct gene expression profiles stimulated by F42K, WT IL2, and IL15. F42K therapy in vivo also induced a dramatic reduction in the expansion of ICOS+ Tregs, promoted NK cell expansion, and inhibited melanoma tumor growth more efficiently than WT IL2 and more effectively than anti-CTLA-4. Our findings suggest that F42K could be a potential substitute for WT IL2 as a cytokine therapy for cancer. Cancer Immunol Res; 4(11); 983-94. ©2016 AACR. ©2016 American Association for Cancer Research.

  13. CpG promoter methylation status is not a prognostic indicator of gene expression in beryllium challenge.

    Science.gov (United States)

    Tooker, Brian C; Ozawa, Katherine; Newman, Lee S

    2016-05-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the six CpG sites tested. H36.12J cell TNFα expression was shown to be metal-specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride, but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNγ promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p methylation may be necessary to allow expression of metal-induced TNFα and that promoter

  14. Influence of the serotonin transporter promoter gene and shyness on children's cerebral responses to facial expressions.

    Science.gov (United States)

    Battaglia, Marco; Ogliari, Anna; Zanoni, Annalisa; Citterio, Alessandra; Pozzoli, Uberto; Giorda, Roberto; Maffei, Cesare; Marino, Cecilia

    2005-01-01

    Childhood shyness can predate social anxiety disorder and may be associated with biased discrimination of facial expressions of emotions. To determine whether childhood shyness, or the serotonin transporter promoter polymorphism genotype, can predict participants' visual event-related potentials in response to expressions of children of similar ages. Study group drawn from an inception cohort of 149 subjects characterized 1 year before the present study by their degree of shyness. Third- and fourth-grade schoolchildren. Forty-nine of the inception cohort children, randomly selected. Latencies and amplitudes of the N400 waveform in response to happy, neutral, and angry expressions. Shyness predicted significantly smaller N400 amplitudes in response to anger (at Pz: P Shyness was significantly different across the 3 genotypes, the SS genotype being associated with higher shyness levels (analysis of variance: F(2,42) = 4.47, P shyness or have 1 or 2 copies of the short allele of the serotonin transporter promoter gene appear to have a different pattern of processing affective stimuli of interpersonal hostility.

  15. Dragon (repulsive guidance molecule b, RGMb) is a novel gene that promotes colorectal cancer growth.

    Science.gov (United States)

    Shi, Ying; Chen, Guo-Bin; Huang, Xiao-Xiao; Xiao, Chuan-Xing; Wang, Huan-Huan; Li, Ye-Sen; Zhang, Jin-Fang; Li, Shao; Xia, Yin; Ren, Jian-Lin; Guleng, Bayasi

    2015-08-21

    Colorectal cancer (CRC) is one of the most commonly diagnosed cancers and a major cause of cancer death. However, the molecular mechanisms underlying CRC initiation, growth and metastasis are poorly understood. Dragon (RGMb), a member of the repulsive guidance molecule (RGM) family, has been recently identified as a co-receptor for bone morphogenetic protein (BMP) signaling, but the role of Dragon in CRC development is undefined. Here, we show that Dragon expression was increased in colon cancer tissues compared to control tissues in CAC mouse model and in human patients. Dragon promoted proliferation of CT26.WT and CMT93 colon cancer cells and accelerated tumor growth in the xenograft mouse model. Dragon's action on colon cancer development was mediated via the BMP4-Smad1/5/8 and Erk1/2 pathways. Therefore, our results have revealed that Dragon is a novel gene that promotes CRC growth through the BMP pathway. Dragon may be exploited as a potential therapeutic target for CRC treatment.

  16. Gene promoter polymorphism of RUNX2 and risk of osteoporosis in postmenopausal Indonesian women

    Science.gov (United States)

    Suryandari, Dwi A; Umami, Sri S; Kusdhany, Lindawati S; Siregar, Tut Wuri A; Rahardjo, Tri Budi W; Talbot, Christopher; Hogervorst, Eef

    2014-01-01

    Objectives: Osteoporosis is a metabolic bone disease of reduced bone mass density (BMD) and elevated risk of fracture due to an imbalance in bone formation and resorption. The risk and incidence of osteoporosis increase towards advanced age, particularly in postmenopausal women, and the risk is known to be affected by the variation in the expression of the associated regulatory genes. This work aimed to clarify the impact of variation in RUNX2 (runt domain transcription factor 2), which is an osteoblast-specific transcription factor that normally stimulates bone formation and osteoblast differentiation, regarding single-nucleotide polymorphism within RUNX2 promoter (P1) and risk of osteoporosis in postmenopausal Indonesian women. Methods: Using DNA sampling from blood, the variation at the single-nucleotide polymorphism (-330, G→T, rs59983488) at the RUNX2 P1 promoter was investigated using polymerase chain reaction–restriction fragment length polymorphism for 180 consenting postmenopausal Indonesian women. The subjects were examined for bone mass density and classification to normal and those with osteopenia or osteoporosis by T-scoring with dual-energy X-ray absorptiometry. Chi-square testing and logistic regression were mainly used for statistical assessment. Results: The results showed a general trend with increased risk of osteoporosis associated with the genotype TT (mutant type) and the corresponding T allele of the tested polymorphism of RUNX2 promoter P1. The trend was, however, not significant in multivariate testing adjusted for age and time after menopause. Conclusion: To confirm the potential risk with TT genotype would require testing of a much larger sample of subjects. As the tested single-nucleotide polymorphism only represents one of the relevant candidate locations of RUNX2, the results are taken nevertheless to suggest an impact by overall RUNX2 variation in the risk of osteoporosis in Indonesian postmenopausal women. PMID:26770724

  17. Gene promoter polymorphism of RUNX2 and risk of osteoporosis in postmenopausal Indonesian women

    Directory of Open Access Journals (Sweden)

    Elza I Auerkari

    2014-04-01

    Full Text Available Objectives: Osteoporosis is a metabolic bone disease of reduced bone mass density (BMD and elevated risk of fracture due to an imbalance in bone formation and resorption. The risk and incidence of osteoporosis increase towards advanced age, particularly in postmenopausal women, and the risk is known to be affected by the variation in the expression of the associated regulatory genes. This work aimed to clarify the impact of variation in RUNX2 (runt domain transcription factor 2, which is an osteoblast-specific transcription factor that normally stimulates bone formation and osteoblast differentiation, regarding single-nucleotide polymorphism within RUNX2 promoter (P1 and risk of osteoporosis in postmenopausal Indonesian women. Methods: Using DNA sampling from blood, the variation at the single-nucleotide polymorphism (-330, G→T, rs59983488 at the RUNX2 P1 promoter was investigated using polymerase chain reaction–restriction fragment length polymorphism for 180 consenting postmenopausal Indonesian women. The subjects were examined for bone mass density and classification to normal and those with osteopenia or osteoporosis by T-scoring with dual-energy X-ray absorptiometry. Chi-square testing and logistic regression were mainly used for statistical assessment. Results: The results showed a general trend with increased risk of osteoporosis associated with the genotype TT (mutant type and the corresponding T allele of the tested polymorphism of RUNX2 promoter P1. The trend was, however, not significant in multivariate testing adjusted for age and time after menopause. Conclusion: To confirm the potential risk with TT genotype would require testing of a much larger sample of subjects. As the tested single-nucleotide polymorphism only represents one of the relevant candidate locations of RUNX2, the results are taken nevertheless to suggest an impact by overall RUNX2 variation in the risk of osteoporosis in Indonesian postmenopausal women.

  18. Mesoderm/mesenchyme homeobox gene l promotes vascular smooth muscle cell phenotypic modulation and vascular remodeling.

    Science.gov (United States)

    Wu, Bing; Zhang, Lei; Zhu, Yun-He; Zhang, You-En; Zheng, Fei; Yang, Jian-Ye; Guo, Ling-Yun; Li, Xing-Yuan; Wang, Lu; Tang, Jun-Ming; Chen, Shi-You; Wang, Jia-Ning

    2018-01-15

    To investigate the role of mesoderm/mesenchyme homeobox gene l (Meox1) in vascular smooth muscle cells (SMCs) phenotypic modulation during vascular remodeling. By using immunostaining, Western blot, and histological analyses, we found that Meox1 was up-regulated in PDGF-BB-treated SMCs in vitro and balloon injury-induced arterial SMCs in vivo. Meox1 knockdown by shRNA restored the expression of contractile SMCs phenotype markers including smooth muscle α-actin (α-SMA) and calponin. In contrast, overexpression of Moex1 inhibited α-SMA and calponin expressions while inducing the expressions of synthetic SMCs phenotype markers such as matrix gla protein, osteopontin, and proliferating cell nuclear antigen. Mechanistically, Meox1 mediated the SMCs phenotypic modulation through FAK-ERK1/2 signaling, which appears to induce autophagy in SMCs. In vivo, knockdown of Meox1 attenuated injury-induced neointima formation and promoted SMCs contractile proteins expressions. Meox1 knockdown also reduced the number of proliferating SMCs, suggesting that Meox1 was important for SMCs proliferation in vivo. Moreover, knockdown of Meox1 attenuated ERK1/2 signaling and autophagy markers expressions, suggesting that Meox1 may promote SMCs phenotypic modulation via ERK1/2 signaling-autophagy in vivo. Our data indicated that Meox1 promotes SMCs phenotypic modulation and injury-induced vascular remodeling by regulating the FAK-ERK1/2-autophagy signaling cascade. Thus, targeting Meox1 may be an attractive approach for treating proliferating vascular diseases. Copyright © 2017. Published by Elsevier B.V.

  19. Integration of ALV intoCTDSPLandCTDSPL2genes in B-cell lymphomas promotes cell immortalization, migration and survival.

    Science.gov (United States)

    Winans, Shelby; Flynn, Alyssa; Malhotra, Sanandan; Balagopal, Vidya; Beemon, Karen L

    2017-08-22

    Avian leukosis virus induces tumors in chickens by integrating into the genome and altering expression of nearby genes. Thus, ALV can be used as an insertional mutagenesis tool to identify novel genes involved in tumorigenesis. Deep sequencing analysis of viral integration sites has identified CTDSPL and CTDSPL2 as common integration sites in ALV-induced B-cell lymphomas, suggesting a potential role in driving oncogenesis. We show that in tumors with integrations in these genes, the viral promoter is driving the expression of a truncated fusion transcript. Overexpression in cultured chick embryo fibroblasts reveals that CTDSPL and CTDSPL2 have oncogenic properties, including promoting cell migration. We also show that CTDSPL2 has a previously uncharacterized role in protecting cells from apoptosis induced by oxidative stress. Further, the truncated viral fusion transcripts of both CTDSPL and CTDSPL2 promote immortalization in primary cell culture.

  20. Promotion of invasion by mutant RAS is dependent on activation of the WASF3 metastasis promoter gene.

    Science.gov (United States)

    Teng, Yong; Ngoka, Lambert; Cowell, John K

    2017-06-01

    Metastasis represents an end stage in the evolution of cancer progression and has been related to specific genetic pathways. Overexpression of mutant RAS in particular appears to promote invasion and metastasis, although exactly how this occurs has not been well characterized. It was previously showed that activation of the WASF3 protein regulates actin cytoskeleton dynamics that promote invasion. In this report, how WASF3 overexpression interacts with mutant RAS to increase invasion and metastasis was investigated. The ability of RAS to promote invasion and metastasis was shown to be dependent on WASF3 activation in a PI3K and AKT dependent manner. Proteomics analysis demonstrates the presence of AKT in the WASF3 immunocomplex which is enhanced by overexpression of mutant RAS. During these processes activation of ERK1/2 is not affected by loss of WASF3 expression. Analysis of the relative involvement of p85 and p110 in the WASF3 complex demonstrates that mutant RAS promotes dissociation of p85 promoting activation of p110. These studies provide a deeper understanding of the critical role for WASF3 in facilitating increased invasion potential in cancer cells expressing mutant RAS and supports the idea that targeting WASF3 in metastatic cells overexpressing RAS may be used to suppress invasion and metastasis. © 2017 Wiley Periodicals, Inc.

  1. Isolation and characterization of a rice glutathione S-transferase gene promoter regulated by herbicides and hormones.

    Science.gov (United States)

    Hu, Tingzhang; He, Shuai; Yang, Guojun; Zeng, Hua; Wang, Guixue; Chen, Zaigang; Huang, Xiaoyun

    2011-04-01

    OsGSTL2, encoding glutathione S-transferase, is a lambda class gene on chromosome 3 of rice (Oryza sativa L.). RNA blot analysis and semi-quantitative RT-PCR assays demonstrated that the transcription of OsGSTL2 in rice roots treated with chlorsulfuron increased significantly. To further understand OsGSTL2 promoter activity, a DNA fragment (GST2171) of 2,171 bp upstream of the OsGSTL2 coding region was isolated. In silico sequence analysis revealed that this fragment contains stress-regulated regulatory elements, hormone-responsive elements and three transposable elements. To define the core promoter sequence, a series of 5' truncation derivatives of GST2171 were fused to uidA gene. The chimeric genes were introduced into rice plants via Agrobacterium-mediated transformation. The expression of the GST2171::GUS transgene varied considerably. GUS staining indicated that the uidA gene is expressed in young seedlings, older leaves, flowering glumes and seeds, but not in older roots. Quantitative fluorescence assays revealed that the expression of the uidA gene is strong in young seedlings and decreases gradually over a period of 25 days. To our surprise, among the 5' truncation derivatives, the shortest promoter GST525 showed the highest GUS expression, and the second shortest promoter GST962 showed the lowest GUS expression. The uidA gene expression in the roots of transgenic rice seedlings is upregulated by chlorsulfuron, glyphosate, salicylic acid (SA) and naphthalene acetic acid (NAA). The possible roles of the repetitive elements on the OsGSTL2 promoter were discussed in terms of transcription repression and promoter induction by herbicides and hormones.

  2. The effect of 5-HTT gene promoter polymorphism on impulsivity depends on family relations in girls.

    Science.gov (United States)

    Paaver, Marika; Kurrikoff, Triin; Nordquist, Niklas; Oreland, Lars; Harro, Jaanus

    2008-07-01

    The short (S) allele of the 5-HTT gene promoter region polymorphism (5-HTTLPR), in combination with adverse environmental influence, leads to higher likelihood of depression. Impulsivity has been related to low serotonin turnover, poor regulation of affect, and problems in the family, including child maltreatment. The current study explored the effect of the 5-HTTLPR polymorphism in the serotonin transporter gene and adverse family environment on impulsivity in adolescents. Healthy adolescents participating in the Estonian Children Personality Behaviour and Health Study (n=483) filled the Adaptive and Maladaptive Impulsivity Scale (AMIS), Barratt Impulsiveness Scale (BIS-11), a scale measuring family relations, and were genotyped. While genotype alone was not associated with thoughtlessness, BIS-11 impulsiveness, fast decision-making or excitement seeking, 5-HTTLPR S allele carriers, however, had higher scores of disinhibition. In girls carrying the S allele, scores of thoughtlessness and disinhibition depended on family relations, being higher with less warmth in the family. Adverse family relations had no effect on impulsivity in girls with LL genotype. In boys, the effects of family relations on maladaptive impulsivity did not depend on genotype. However, the S allele and high maltreatment in the family both independently increased disinhibition and the BIS-11 score in boys. Family environment and the 5-HTTLPR genotype had no interactive effect on excitement seeking or fast decision-making. In summary, carrying the S allele may lead to high maladaptive impulsivity due to higher sensitivity to environmental adversity, which is more significantly expressed in girls.

  3. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    Science.gov (United States)

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  4. Amphiphilic block copolymers promote gene delivery in vivo to pathological skeletal muscles.

    Science.gov (United States)

    Richard, Peggy; Bossard, Florian; Desigaux, Lea; Lanctin, Caroline; Bello-Roufai, Mahajoub; Pitard, Bruno

    2005-11-01

    We reported that amphiphilic block copolymers hold promise as nonviral vectors for the delivery of plasmid DNA, ranging from 4.7 to 6.2 kb, to healthy muscle for the production of local or secreted proteins. To evaluate the efficiency of these vectors to deliver large plasmid DNA molecules to pathological muscles, plasmid DNAs of various lengths were complexed with Lutrol or poloxamine 304 and injected intramuscularly into dystrophic muscles. Lutrol-DNA and poloxamine 304-DNA complexes promoted gene transfer into muscles of the naturally occurring mouse model for DMD (mdx) in a dose- and plasmid DNA size-dependent manner. For small plasmid DNAs encoding reporter genes, this improvement over naked DNA was smaller in mdx than in the wild-type control strain. By contrast, Lutrol enabled us to deliver the large plasmid (16.1 kb) encoding the rod-deleted dystrophin in mdx mouse muscle, whereas the same amount of naked DNA did not lead to dystrophin expression, under the same experimental conditions. Lutrol-treated mdx mice showed the production of dystrophin in large numbers of muscle fibers. More importantly, we also found that expressing dystrophin with Lutrol led to restoration of the dystrophin-associated protein complex. Thus, we conclude that block copolymers constitute a novel class of vectors for the delivery of large plasmid DNA not only to healthy muscles but also to pathological muscle tissues.

  5. Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)

    2010-02-01

    Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.

  6. Development and validation of promoter-probe vectors for the study of methane monooxygenase gene expression in Methylococcus capsulatus Bath.

    Science.gov (United States)

    Ali, Hanif; Murrell, J Colin

    2009-03-01

    A series of integrative and versatile broad-host-range promoter-probe vectors carrying reporter genes encoding green fluorescent protein (GFP), catechol 2,3-dioxygenase (XylE) or beta-galactosidase (LacZ) were constructed for use in methanotrophs. These vectors facilitated the measurement of in vivo promoter activity in methanotrophs under defined growth conditions. They were tested by constructing transcriptional fusions between the soluble methane monooxygenase (sMMO) sigma(54) promoter or particulate methane monooxygenase (pMMO) sigma(70) promoter from Methylococcus capsulatus and the reporter genes. Reporter gene activity was measured under high- and low-copper growth conditions and the data obtained closely reflected transcriptional regulation of the sMMO or pMMO operon, thus demonstrating the suitability of these vectors for assessing promoter activity in methanotrophs. When beta-galactosidase expression was coupled with the fluorogenic substrate 4-methylumbelliferyl beta-D-glucuronide it yielded a sensitive and powerful screening system for detecting cells expressing this reporter gene. These data were substantiated with independent experiments using RT-PCR and RNA dot-blot analysis.

  7. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    Science.gov (United States)

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  8. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  9. Polyplex micelles with thermoresponsive heterogeneous coronas for prolonged blood retention and promoted gene transfection.

    Science.gov (United States)

    Li, Yang; Li, Junjie; Chen, Biao; Chen, Qixian; Zhang, Guoying; Liu, Shiyong; Ge, Zhishen

    2014-08-11

    Adequate retention in blood circulation is a prerequisite for construction of gene delivery carriers for systemic applications. The stability of gene carriers in the bloodstream requires them to effectively resist protein adsorption and maintain small size in the bloodstream avoiding dissociation, aggregation, and nuclease digestion under salty and proteinous medium. Herein, a mixture of two block catiomers consisting of the same cationic block, poly{N-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PAsp(DET)), but varying shell-forming blocks, poly[2-(2-methoxyethoxy) ethyl methacrylate] (PMEO2MA), and poly[oligo(ethylene glycol) methyl ether methacrylate] (POEGMA), was used to complex with plasmid DNA (pDNA) to fabricate polyplex micelles with mixed shells (MPMs) at 20 °C. The thermoresponsive property of PMEO2MA allows distinct phase transition from hydrophilic to hydrophobic by increasing incubation temperature from 20 to 37 °C, which results in a distinct heterogeneous corona containing hydrophilic and hydrophobic regions at the surface of the MPMs. Subsequent study verified that this transition promoted further condensation of pDNA, thereby giving rise to improved complex and colloidal stability. The proposed system has shown remarkable stability in salty and proteinous solution and superior tolerance to nuclease degradation. As compared with polyplex micelles formed from single POEGMA-b-PAsp(DET) block copolymer, in vivo circulation experiments in the bloodstream further confirmed that the retention time of MPMs was prolonged significantly. Moreover, the proposed system exhibited remarkably high cell transfection activity especially at low N/P ratios and negligible cytotoxicity and thus portends promising utility for systemic gene therapy applications.

  10. Correlating interleukin-10 promoter gene polymorphisms with human cerebral infarction onset

    Directory of Open Access Journals (Sweden)

    Xin-hong Jiang

    2015-01-01

    Full Text Available Evidence suggests that interleukin-10 (IL-10 deficiency exacerbates inflammation and worsens the outcome of brain ischemia. In view of the critical role of the single nucleotide polymorphic sites -1082 (A/G and -819 (C/T in the promoter region of the IL-10 gene, we hypothesized that they are associated with cerebral infarction morbidity in the Chinese Han population. We genotyped these allelic gene polymorphisms by amplification refractory mutation system-polymerase chain reaction methods in 181 patients with cerebral infarction (cerebral infarction group and 115 healthy subjects (control group. We identified significant differences in genotype distribution and allele frequency of the IL-10-1082 A/G allele between cerebral infarction and control groups (χ2 = 6.643, P = 0.010. The IL-10-1082 A allele frequency was significantly higher in the cerebral infarction group (92.3% than in the control group (86.1% (P = 0.015. Moreover, cerebral infarction risk of the AA genotype was 2-fold higher than with the AG genotype (OR = 2.031, 95%CI: 1.134-3.637. In addition, AA genotype together with hypertension was the independent risk factor of cerebral infarction (OR = 2.073,