The Rendezvous Monitoring Display Capabilities of the Rendezvous and Proximity Operations Program

Science.gov (United States)

Brazzel, Jack; Spehar, Pete; Clark, Fred; Foster, Chris; Eldridge, Erin

2013-01-01

The Rendezvous and Proximity Operations Program (RPOP) is a laptop computer- based relative navigation tool and piloting aid that was developed during the Space Shuttle program. RPOP displays a graphical representation of the relative motion between the target and chaser vehicles in a rendezvous, proximity operations and capture scenario. After being used in over 60 Shuttle rendezvous missions, some of the RPOP display concepts have become recognized as a minimum standard for cockpit displays for monitoring the rendezvous task. To support International Space Station (ISS) based crews in monitoring incoming visiting vehicles, RPOP has been modified to allow crews to compare the Cygnus visiting vehicle s onboard navigated state to processed range measurements from an ISS-based, crew-operated Hand Held Lidar sensor. This paper will discuss the display concepts of RPOP that have proven useful in performing and monitoring rendezvous and proximity operations.

Percutaneous rendezvous technique for the management of a bile duct injury.

Science.gov (United States)

Meek, James; Fletcher, Savannah; Crumley, Kristen; Culp, W C; Meek, Mary

2018-02-01

The rendezvous technique typically involves combined efforts of interventional radiology, endoscopy, and surgery. It can be done solely percutaneously, whereby the interventionalist gains desired access to one point in the body by approaching it from two different access sites. We present the case of a woman who underwent cholecystectomy complicated by a bile duct injury. A percutaneous rendezvous procedure enabled placement of an internal-external drain from the intrahepatic ducts through the biloma and distal common bile duct and into the duodenum. Thus, a percutaneous rendezvous technique is feasible for managing a bile duct injury when endoscopic retrograde cholangio-pancreatography or percutaneous transhepatic cholangiogram alone has been unsuccessful.

Percutaneous rendezvous technique for the management of a bile duct injury

Directory of Open Access Journals (Sweden)

James Meek, DO

2018-02-01

Full Text Available The rendezvous technique typically involves combined efforts of interventional radiology, endoscopy, and surgery. It can be done solely percutaneously, whereby the interventionalist gains desired access to one point in the body by approaching it from two different access sites. We present the case of a woman who underwent cholecystectomy complicated by a bile duct injury. A percutaneous rendezvous procedure enabled placement of an internal-external drain from the intrahepatic ducts through the biloma and distal common bile duct and into the duodenum. Thus, a percutaneous rendezvous technique is feasible for managing a bile duct injury when endoscopic retrograde cholangio-pancreatography or percutaneous transhepatic cholangiogram alone has been unsuccessful.

Treatment for retained [corrected] common bile duct stones during laparoscopic cholecystectomy: the rendezvous technique.

Science.gov (United States)

Borzellino, Giuseppe; Rodella, Luca; Saladino, Edoardo; Catalano, Filippo; Politi, Leonardo; Minicozzi, Annamaria; Cordiano, Claudio

2010-12-01

To determine the feasibility and efficacy of the laparoscopic intraoperative rendezvous technique for common bile duct stones (CBDS). Case series. Verona University Hospital, Verona, Italy. A total of 110 patients were enrolled in the study; 47 had biliary colic; 39, acute cholecystitis; 19, acute biliary pancreatitis; and 5, acute biliary pancreatitis with associated acute cholecystitis. In all patients, CBDS diagnosis was reached by intraoperative cholangiography. Intraoperative endoscopy with rendezvous performed during laparascopic cholecystectomy for confirmed CBDS; for such a procedure, a transcystic guide wire was positioned into the duodenum. Intraoperative endoscopy with rendezvous was performed for retrieved CBDS during a laparoscopic cholecystectomy. Laparoscopic rendezvous feasibility, morbidity, postprocedure pancreatitis, and mortality. The laparoscopic rendezvous proved to be feasible in 95.5% (105 of 110 patients). The rendezvous failed in 3 cases of successfully performed laparoscopic cholecystectomy, and a conversion of the laparoscopy was needed in 2 cases of successful rendezvous. Two major complications and 2 cases of bleeding were registered after sphincterotomy was successfully performed with rendezvous, and severe acute pancreatitis complicated a traditional sphincterotomy performed after a failed rendezvous. Rendezvous is a feasible option for treatment of CBDS; it allows one to perform only 1 stage of treatment, even in acute cases such as cholecystitis and pancreatitis. Positioning of the guide wire may allow reduced complications secondary to papilla cannulation but not those of the endoscopic sphincterotomy.

Cervical Spondylotic Myelopathy (CSM)

Science.gov (United States)

... of CSM occur over time. They can include: neck pain or stiffness arm pain numbness in your hands ... Health, Men, Seniors, WomenTags: adult, elderly, Neck Disorders, neck pain, Neck Swelling, older adults, Rheumatologic, senior September 1, ...

Identifying indications for percutaneous (PTC) vs. endoscopic ultrasound (EUS)- guided "rendezvous" procedure in biliary obstruction and incomplete endoscopic retrograde cholangiography (ERC).

Science.gov (United States)

Albert, J G; Finkelmeier, F; Friedrich-Rust, M; Kronenberger, B; Trojan, J; Zeuzem, S; Sarrazin, C

2014-10-01

The variety of rendezvous (RV) procedures has recently been extended by EUS- and PTCD-guided procedures as a complementary means to conventional ERCP. We have identified indication criteria and the potential of biliary PTCD-guided vs. EUS-guided RV. Consecutive patients with bile duct obstruction who underwent RV were included. In all, ERCP alone was unable to achieve treatment success. Indication, technical success, and outcome in PTCD- vs. EUS-guided RV were retrospectively compared to identify criteria that indicate preference of RV technique. Site of obstruction, clinical scenario (stenosis with abscess vs. no abscess) and reason for previous failure of ERC were evaluated. In 32 patients, three different indications for RV procedures were identified: First, a one-step access to assist in failed ERCP (type 1, intra-ductal RV); second, temporary drainage for prolonged treatment of complex biliary disease (type 2, intra-ductal RV), and drainage of cholangio-abscess with re-establishing bile outflow (type 3, intra-abscess RV). Indication of PTCD- vs. EUS-guided rendezvous was competitive in type 1, but exclusive in favor of PTCD in types 2 and 3. The site of biliary obstruction indicated the anatomic location of RV procedures. This classification may help to define inclusion criteria for prospective studies on biliary RV procedures. Choice of therapeutic strategy depends on the anatomic location of the biliary obstruction and the type of the biliary lesion. PTCD-guided RV might improve outcome in cholangio-abscess. © Georg Thieme Verlag KG Stuttgart · New York.

CSM: Profamilia's approach in Colombia.

Science.gov (United States)

Samuel, S

1982-03-01

Colombia's PROFAMILIA has successfully operated a contraceptive social marketing (CSM) program since 1973. Beginning with 1 salesperson distributing primarily to Cajas de Subsideio, the CSM program is now distributed through 70-80% of the 6000 registered pharmacies in the country, as well as pharmacy counters of several supermakets in urban areas. During 1981, PROFAMILIA's 5 salespersons accountd for commerical sales of oral contraceptives (OCs) to 225,000 couples and sales of barrier methods to another 75,000. Program sales of contraceptives and other products generated approximately US $1.7 million in revenue for the same year. PROFAMILIA's marketing approach is unique in its product and promotinal characteristics. Supplies are obtained directly from local and foreign manufacturers and are resold without any repackaging. While it is generally believed that CSM programs expand the market for contraceptives, data analysis and analysis of PROFAMILIA's distribution system suggests that the PROFAMILIA CSM program has simply absorbed some of the previously existing commerical market. Total commerical market sales of oral contraceptives (OCs) have grown at an annual rate of 3-4% since 1975. During the same period, direct sales of Schering, Wyeth, and other competitors have declined. PROFAMILIA's community-based program operates mainly among urban and semi-rural lower income populations. It sells products through established retail outlets rather than through institutional or non-retail outlets. PROFAMILIA's community-based program in all respects but its use of a staff of 112 salaried "instructoras" is as much a marketing program as PROFAMILIA's sales through pharmacies. Taken together, the 2 program expanded the commerical makert by about 1/2 since 1975. The contraceptive social marketing or pharmacy sales program appears to excel at generation of revenue and delivery of products to higher income clients. The community-based program excels at delivery of information

Endoscopic retrograde cholangiopancreatography with rendezvous cannulation reduces pancreatic injury.

Science.gov (United States)

Swahn, Fredrik; Regnér, Sara; Enochsson, Lars; Lundell, Lars; Permert, Johan; Nilsson, Magnus; Thorlacius, Henrik; Arnelo, Urban

2013-09-28

To examine whether rendezvous endoscopic retrograde cholangiopancreatography (ERCP) is associated with less pancreatic damage, measured as leakage of proenzymes, than conventional ERCP. Patients (n = 122) with symptomatic gallstone disease, intact papilla and no ongoing inflammation, were prospectively enrolled in this case-control designed study. Eighty-one patients were subjected to laparoscopic cholecystectomy and if intraoperative cholangiography suggested common bile duct stones (CBDS), rendezvous ERCP was performed intraoperatively (n = 40). Patients with a negative cholangiogram constituted the control group (n = 41). Another 41 patients with CBDS, not subjected to surgery, underwent conventional ERCP. Pancreatic proenzymes, procarboxypeptidase B and trypsinogen-2 levels in plasma, were analysed at 0, 4, 8 and 24 h. The proenzymes were determined in-house with a double-antibody enzyme linked immunosorbent assay. Pancreatic amylase was measured by an enzymatic colourimetric modular analyser with the manufacturer's reagents. All samples were blinded at analysis. Post ERCP pancreatitis (PEP) occurred in 3/41 (7%) of the patients cannulated with conventional ERCP and none in the rendezvous group. Increased serum levels indicating pancreatic leakage were significantly higher in the conventional ERCP group compared with the rendezvous ERCP group regarding pancreatic amylase levels in the 4- and 8-h samples (P = 0.0015; P = 0.03), procarboxypeptidase B in the 4- and 8-h samples (P rendezvous cannulation technique compared with patients that underwent cholecystectomy alone (control group). Post procedural concentrations of pancreatic amylase and procarboxypeptidase B were significantly correlated with pancreatic duct cannulation and opacification. Rendezvous ERCP reduces pancreatic enzyme leakage compared with conventional ERCP cannulation technique. Thus, laparo-endoscopic technique can be recommended with the ambition to minimise the risk for post ERCP

CSM research: Methods and application studies

Science.gov (United States)

Knight, Norman F., Jr.

1989-01-01

Computational mechanics is that discipline of applied science and engineering devoted to the study of physical phenomena by means of computational methods based on mathematical modeling and simulation, utilizing digital computers. The discipline combines theoretical and applied mechanics, approximation theory, numerical analysis, and computer science. Computational mechanics has had a major impact on engineering analysis and design. When applied to structural mechanics, the discipline is referred to herein as computational structural mechanics. Complex structures being considered by NASA for the 1990's include composite primary aircraft structures and the space station. These structures will be much more difficult to analyze than today's structures and necessitate a major upgrade in computerized structural analysis technology. NASA has initiated a research activity in structural analysis called Computational Structural Mechanics (CSM). The broad objective of the CSM activity is to develop advanced structural analysis technology that will exploit modern and emerging computers, such as those with vector and/or parallel processing capabilities. Here, the current research directions for the Methods and Application Studies Team of the Langley CSM activity are described.

Designing the STS-134 Re-Rendezvous: A Preparation for Future Crewed Rendezvous Missions

Science.gov (United States)

Stuit, Timothy D.

2011-01-01

In preparation to provide the capability for the Orion spacecraft, also known as the Multi-Purpose Crew Vehicle (MPCV), to rendezvous with the International Space Station (ISS) and future spacecraft, a new suite of relative navigation sensors are in development and were tested on one of the final Space Shuttle missions to ISS. The National Aeronautics and Space Administration (NASA) commissioned a flight test of prototypes of the Orion relative navigation sensors on STS-134, in order to test their performance in the space environment during the nominal rendezvous and docking, as well as a re-rendezvous dedicated to testing the prototype sensors following the undocking of the Space Shuttle orbiter at the end of the mission. Unlike the rendezvous and docking at the beginning of the mission, the re-rendezvous profile replicates the newly designed Orion coelliptic approach trajectory, something never before attempted with the shuttle orbiter. Therefore, there were a number of new parameters that needed to be conceived of, designed, and tested for this rerendezvous to make the flight test successful. Additionally, all of this work had to be integrated with the normal operations of the ISS and shuttle and had to conform to the constraints of the mission and vehicles. The result of this work is a separation and rerendezvous trajectory design that would not only prove the design of the relative navigation sensors for the Orion vehicle, but also would serve as a proof of concept for the Orion rendezvous trajectory itself. This document presents the analysis and decision making process involved in attaining the final STS-134 re-rendezvous design.

75 FR 44794 - Rendezvous International v.

Science.gov (United States)

2010-07-29

... FEDERAL MARITIME COMMISSION [Docket No. 10-07] Rendezvous International v. Chief Cargo Services, Inc., Kaiser Apparel, Inc., Edco Logistics, Inc., Oriental Logistics, Inc., and Razor Enterprise... Federal Maritime Commission (``Commission'') by Rendezvous International (``Rendezvous''), hereinafter...

Intra-urinoma Rendezvous Using a Transconduit Approach to Re-establish Ureteric Integrity

International Nuclear Information System (INIS)

Anderson, Hugh; Alyas, Faisal; Edwin, Patrick Joseph

2005-01-01

Ureteric discontinuity following injury has been traditionally treated surgically. With the advent of improved interventional instrumentation it is possible to stent these lesions percutaneously, retrogradely or failing that using a combined (rendezvous) technique. We describe an intra-urinoma rendezvous procedure combining a percutaneous antegrade-transconduit retrograde technique of stent insertion to successfully re-establish ureteric integrity that was used following the failure of a percutaneous retrograde approach. We illustrate its usefulness as an alternative to surgery

Pakistan/USAID to start CSM project.

Science.gov (United States)

1984-01-01

Pakistan, with the assistance of funds for the US Agency for International Development (USAID), is about to start its novel approach to contraceptive social marketing (CSM). This new effort suggests a marked policy shift on the part of the Pakistan government toward intensifying its family planning activities. The program will be government-operated and supported by AID over the next 5 years with $20 million, more than double the cost of similar CSM projects elswhere. Distribution of a condom on a pilot project basis is expected to begin by December 1984. Sales of a low-dose oral contraceptive (OC) could begin in test market areas by mid-1985, with national launching of both products tentatively scheduled for January 1986. The Pakistan/USAID agreement represents the 1st time since the formation of India's Nirodh project in the late 1960s that a CSM program is being established without the involvement of either an international social marketing contractor or a country's family planning association. The Pakistan CSM program will be managed by a policy board composed of representatives from the government's Ministries of Planning, Health and Education; a resident advisor from USAID; and a local company responsible for product marketing and distribution. The approach has received a skeptical response among international social marketing experts about the program's chances for success. Their doubts extend to 2 other aspects of the proposed design: an official of the Ministry of Planning's Population and Welfare Division expects the CSM program to generate sufficient revenues to cover all operating costs following the 5-year subsidy period, while also providing attractive profit margins for the marketing/distribution company; and the government prohibits mass media advertising of contraceptives. According to AID, the issue of mass media contraceptive advertising has not yet been resolved, and a national survey will be conducted to determine what communication needs are

STS-134 Re-Rendezvous Design History

Science.gov (United States)

Stuit, Timothy D.

2011-01-01

In preparation to provide the capability for the Orion spacecraft to rendezvous with the International Space Station (ISS), a new suite of relative navigation sensors are in development and will be tested on one of the final Space Shuttle missions to ISS. The National Aeronautics and Space Administration (NASA) commissioned a flight test of prototypes of the instruments on STS-134, in order to test their performance in the space environment during the nominal rendezvous and docking, as well as a re-rendezvous dedicated to testing the prototype sensors following the undocking of the Space Shuttle Orbiter at the end of the mission. Unlike the initial rendezvous and docking, the re-rendezvous profile would replicate the newly designed Orion coelliptic approach trajectory, something never before attempted with the Shuttle Orbiter. Therefore, there were a number of new parameters that needed to be conceived of, designed, and tested for this re-rendezvous to make the flight test successful. And all of this work had to be integrated with the normal operations of the ISS and Shuttle and had to conform to the constraints of the mission and vehicles. The result of this work is a separation and re-rendezvous trajectory design that will prove not only the design of the relative navigation sensors for the Orion vehicle, but also will serve as a proof of concept for the Orion rendezvous trajectory itself. This document presents the analysis and decision making process involved in attaining the final STS-134 re-rendezvous design.

Geological and structural setting of the CSM/OCRD test site: CSM experimental mine, Idaho Springs, Colorado

International Nuclear Information System (INIS)

Hutchinson, R.M.

1983-09-01

This report is the second in a series describing research conducted by the Colorado School of Mines (CSM) for the Office of Crystalline Repository Development (OCRD) to determine the extent of blast damage in rock surrounding an underground opening. A special room, called the CSM/OCRD room, was excavated for the purpose of assessing blast damage in the rock around the room. Even though this mine is not proposed as a nuclear waste repository site, the instrumentation and methods of blast damage assessment developed in this project are applicable to proposed repository sites. In order to understand which instruments and techniques are most applicable and what types of fractures existed before blasting, a thorough description of the rock mass surrounding the room is necessary. This report describes the geologic history of the area surrounding the Colorado School of Mines' Experimental Mine. The purpose of the historical description is to explain the probable origin of faults, fractures, and joints that affect rock mass permeability around the excavation site. This report will also provide probable cause of original rock mass stress in existence prior to excavating the experimental room. Furthermore, it provides a basis for detailed mapping of the CSM/OCRD experimental room wall rock. 19 references, 19 figures

Endoskopisk ultralydvejledt rendezvous til intern drænage ved galdevejsobstruktion

DEFF Research Database (Denmark)

Knudsen, Marie Høxbro; Vilmann, Peter; Hassan, Hazem

2015-01-01

Endoscopic retrograde cholangiography (ERCP) is currently standard treatment for biliary drainage. Endoscopic ultrasound guided rendezvous (EUS-RV) is a novel method to overcome an unsuccessful biliary drainage procedure. Under endoscopic ultrasound guidance a guidewire is passed via a needle from...

Comparison of two matrix data structures for advanced CSM testbed applications

Science.gov (United States)

Regelbrugge, M. E.; Brogan, F. A.; Nour-Omid, B.; Rankin, C. C.; Wright, M. A.

1989-01-01

The first section describes data storage schemes presently used by the Computational Structural Mechanics (CSM) testbed sparse matrix facilities and similar skyline (profile) matrix facilities. The second section contains a discussion of certain features required for the implementation of particular advanced CSM algorithms, and how these features might be incorporated into the data storage schemes described previously. The third section presents recommendations, based on the discussions of the prior sections, for directing future CSM testbed development to provide necessary matrix facilities for advanced algorithm implementation and use. The objective is to lend insight into the matrix structures discussed and to help explain the process of evaluating alternative matrix data structures and utilities for subsequent use in the CSM testbed.

Rendezvous and Docking for Space Exploration

Science.gov (United States)

Machula, M. F.; Crain, T.; Sandhoo, G. S.

2005-01-01

To achieve the exploration goals, new approaches to exploration are being envisioned that include robotic networks, modular systems, pre-positioned propellants and in-space assembly in Earth orbit, Lunar orbit and other locations around the cosmos. A fundamental requirement for rendezvous and docking to accomplish in-space assembly exists in each of these locations. While existing systems and technologies can accomplish rendezvous and docking in low earth orbit, and rendezvous and docking with crewed systems has been successfully accomplished in low lunar orbit, our capability must extend toward autonomous rendezvous and docking. To meet the needs of the exploration vision in-space assembly requiring both crewed and uncrewed vehicles will be an integral part of the exploration architecture. This paper focuses on the intelligent application of autonomous rendezvous and docking technologies to meet the needs of that architecture. It also describes key technology investments that will increase the exploration program's ability to ensure mission success, regardless of whether the rendezvous are fully automated or have humans in the loop.

Over-the-catheter precut to gain access to the biliary duct during ERCP rendezvous.

Science.gov (United States)

Manes, Gianpiero; Baratti, Cinzia; Ardizzone, Sandro; Ferla, Fabio; Spiropoulos, Jean; Corsi, Fabio; Foschi, Diego; Trabucchi, Emilio; Bianchi Porro, Gabriele

2008-10-01

Endoscopic retrograde cholangiopancreatography (ERCP) rendezvous during laparoscopic cholecystectomy is an efficient and safe method to treat cholecystocholedocholithiasis. Advancing a guidewire through the cystic duct into the duodenum and withdrawing it in the accessory channel of duodenoscope may be, however, laborious. Moreover, rendezvous performed in the typical manner needs the use of several costly accessories. We herein describe a simpler and cheaper method to gain access to the biliary duct at rendezvous. Twenty-four consecutive patients undergoing ERCP rendezvous during laparoscopic cholecystectomy were considered. A catheter was introduced in the cystic duct and advanced into the duodenum. Access to the bile duct was than achieved by means of a precut sphincterotomy performed over the catheter emerging from the papilla. Cannulation was successful in all but two patients, in whom ERCP was performed in the conventional manner. The only complication was a case of mild post-sphincterotomy bleeding. In comparison with the typical rendezvous technique our procedure allowed savings of about 250, since its performance only requires a catheter and a knife sphincterotome. Over-the-catheter precut during ERCP rendezvous is a feasible and safe method which avoids the need for the manipulation of several accessories and guidewires, and thus results in money and time savings.

Chamber service module (CSM1) for MDT

CERN Document Server

Binchi, P

2002-01-01

CSM-1 is the second and latest version of the high speed electronic unit whose primary task is to multiplex serial data from up to 18 ASD /TDC cards located at the ends of the Monitored Drift Tubes. Each CSM will capture data from all 24 channel TDC (AMT-2 units) of a given chamber and transfer it along a single optic fiber to the MROD, the event builder and readout driver. The core of the board is a Xilinx VirtexII FPGA which will use JTAG protocol (IEEE Std. 1149.1) for logic configuration parameter loading.

History of Space Shuttle Rendezvous

Science.gov (United States)

Goodman, John L.

2011-01-01

This technical history is intended to provide a technical audience with an introduction to the rendezvous and proximity operations history of the Space Shuttle Program. It details the programmatic constraints and technical challenges encountered during shuttle development in the 1970s and over thirty years of shuttle missions. An overview of rendezvous and proximity operations on many shuttle missions is provided, as well as how some shuttle rendezvous and proximity operations systems and flight techniques evolved to meet new programmatic objectives. This revised edition provides additional information on Mercury, Gemini, Apollo, Skylab, and Apollo/Soyuz. Some chapters on the Space Shuttle have been updated and expanded. Four special focus chapters have been added to provide more detailed information on shuttle rendezvous. A chapter on the STS-39 mission of April/May 1991 describes the most complex deploy/retrieve mission flown by the shuttle. Another chapter focuses on the Hubble Space Telescope servicing missions. A third chapter gives the reader a detailed look at the February 2010 STS-130 mission to the International Space Station. The fourth chapter answers the question why rendezvous was not completely automated on the Gemini, Apollo, and Space Shuttle vehicles.

Rendezvous technique for recanalization of long-segmental chronic total occlusion above the knee following unsuccessful standard angioplasty.

Science.gov (United States)

Cao, Jun; Lu, Hai-Tao; Wei, Li-Ming; Zhao, Jun-Gong; Zhu, Yue-Qi

2016-04-01

To assess the technical feasibility and efficacy of the rendezvous technique, a type of subintimal retrograde wiring, for the treatment of long-segmental chronic total occlusions above the knee following unsuccessful standard angioplasty. The rendezvous technique was attempted in eight limbs of eight patients with chronic total occlusions above the knee after standard angioplasty failed. The clinical symptoms and ankle-brachial index were compared before and after the procedure. At follow-up, pain relief, wound healing, limb salvage, and the presence of restenosis of the target vessels were evaluated. The rendezvous technique was performed successfully in seven patients (87.5%) and failed in one patient (12.5%). Foot pain improved in all seven patients who underwent successful treatment, with ankle-brachial indexes improving from 0.23 ± 0.13 before to 0.71 ± 0.09 after the procedure (P rendezvous technique is a feasible and effective treatment for chronic total occlusions above the knee when standard angioplasty fails. © The Author(s) 2015.

Comparison of transhepatic and extrahepatic routes for EUS-guided rendezvous procedure for distal CBD obstruction.

Science.gov (United States)

Dhir, Vinay; Bhandari, Suryaprakash; Bapat, Mukta; Joshi, Nitin; Vivekanandarajah, Suhirdan; Maydeo, Amit

2013-04-01

EUS-guided rendezvous procedure (EUS-RV) can be done by the transhepatic (TH) or the extrahepatic (EH) route. There is no data on the preferred access route when both routes are available. To compare the success, complications, and duration of hospitalization for patients undergoing EUS-RV by the TH or the EH route. Patients with distal common bile duct (CBD) obstruction, who failed selective cannulation, underwent EUS-RV by the TH route through the stomach or the EH route through the duodenum. A total of 35 patients were analysed (17 TH, 18 EH). The mean procedure time was significantly longer for the TH group (34.4 vs. 25.7 min; p = 0.0004). There was no difference in the technical success (94.1 vs. 100%). However, the TH group had a higher incidence of post-procedure pain (44.1 vs. 5.5%; p = 0.017), bile leak (11.7 vs. 0; p = 0.228), and air under diaphragm (11.7 vs. 0; p = 0.228). All bile leaks were small and managed conservatively. Duration of hospitalization was significantly higher for the TH group (2.52 vs. 0.17 days; p = 0.015). EUS-RV has similar success rate by the TH or the EH route. However, the TH route has higher post-procedure pain, longer procedure time, and longer duration of hospitalization. The EH route should be preferred for EUS-RV in patients with distal CBD obstruction when both access routes are technically feasible.

Survey of orbital dynamics and control of space rendezvous

Directory of Open Access Journals (Sweden)

Luo Yazhong

2014-02-01

Full Text Available Rendezvous orbital dynamics and control (RODC is a key technology for operating space rendezvous and docking missions. This paper surveys the studies on RODC. Firstly, the basic relative dynamics equation set is introduced and its improved versions are evaluated. Secondly, studies on rendezvous trajectory optimization are commented from three aspects: the linear rendezvous, the nonlinear two-body rendezvous, and the perturbed and constrained rendezvous. Thirdly, studies on relative navigation are briefly reviewed, and then close-range control methods including automated control, manual control, and telecontrol are analyzed. Fourthly, advances in rendezvous trajectory safety and robust analysis are surveyed, and their applications in trajectory optimization are discussed. Finally, conclusions are drawn and prospects of studies on RODC are presented.

Current status of laparoendoscopic rendezvous in the treatment of cholelithiasis with concomitant choledocholithiasis.

Science.gov (United States)

Baloyiannis, Ioannis; Tzovaras, George

2015-06-25

The current evidence in favor of the laparoendoscopic rendezvous is promising and demonstrates the main advantages of this technique in regard to shorter hospital stay and selective cannulation of the common bile duct (CBD), avoiding thus the inadvertent cannulation of the pancreatic duct. In addition, in the rendezvous technique the contrast medium is not injected retrogradely as during the traditional endoscopic retrograde cholangiopancreatography (ERCP), when the medium accidentally could be injected under pressure into the pancreatic duct. The RV technique minimizes that risk. Both these main advantages of the RV technique over the classic ERCP, are related with a significant lower incidence of hyperamylasemia and post-ERCP pancreatitis, compared with the traditional two stage procedure. Choledocholithiasis is present in 10% to 15% of patients undergoing cholecystectomy. To date, the ideal management of CBD stones remains controversial. Prospective randomized trials have shown that laparoscopic management of the CBD stones, as a single stage procedure, is the most efficient and cost effective method of treatment. Laparoendoscopic rendezvous has been proposed as an alternative single stage approach. Several studies have shown the effective use of this technique in the treatment of CBD stones by improving patient compliance and clinical results including shorter hospital stay, higher success rate and less cost. The current evidence about the use of this technique presented in this review article is promising and demonstrates the main advantages of the procedure.

Comparison of EUS-guided rendezvous and precut papillotomy techniques for biliary access (with videos).

Science.gov (United States)

Dhir, Vinay; Bhandari, Suryaprakash; Bapat, Mukta; Maydeo, Amit

2012-02-01

Precut papillotomy after failed bile duct cannulation is associated with an increased risk of pancreatitis. EUS-guided rendezvous drainage is a novel alternative technique, but there are no data comparing this approach with precut papillotomy. To evaluate the safety and efficacy of EUS-guided rendezvous drainage of the bile duct and compare its outcome with that of precut papillotomy. Retrospective study. Tertiary care referral center. Consecutive patients with distal bile duct obstruction, in whom selective cannulation of the bile duct at ERCP failed after 5 attempts with a guidewire and sphincterotome, underwent an EUS-guided rendezvous procedure. The outcomes were compared with those in a historical cohort of patients who underwent precut papillotomy. Patients in whom selective cannulation failed underwent EUS-guided rendezvous drainage by use of the short wire technique or precut papillotomy by use of the Erlangen papillotome. At EUS, after the extrahepatic bile duct was punctured with a 19-gauge needle, a hydrophilic angled-tip guidewire 260 cm long was passed in an antegrade manner across the papilla into the duodenum. The echoendoscope was then exchanged for a duodenoscope, which was introduced alongside the EUS-placed guidewire. The transpapillary guidewire was retrieved through its biopsy channel, and accessories were passed over the wire to perform the requisite endotherapy. Comparison of the rates of technical success and complications between patients treated by the EUS-guided rendezvous and those treated by precut papillotomy techniques. Treatment success was defined as completion of the requisite endotherapy in one treatment session. Treatment success was significantly higher for the EUS-guided rendezvous (57/58 patients) than for those undergoing precut papillotomy technique (130/144 patients) (98.3% vs 90.3%; P = .03). There was no significant difference in the rate of procedural complications between the EUS and precut papillotomy techniques (3

[Endoscopic ultrasound guided rendezvous for biliary drainage].

Science.gov (United States)

Knudsen, Marie Høxbro; Vilmann, Peter; Hassan, Hazem; Karstensen, John Gésdal

2015-04-27

Endoscopic retrograde cholangiography (ERCP) is currently standard treatment for biliary drainage. Endoscopic ultrasound guided rendezvous (EUS-RV) is a novel method to overcome an unsuccessful biliary drainage procedure. Under endoscopic ultrasound guidance a guidewire is passed via a needle from the stomach or duodenum to the common bile duct and from there on to the duodenum enabling ERCP. With a relatively high rate of success EUS-RV should be considered as an alternative to biliary drainage and surgical intervention.

Verification and Evaluation of Aquatic Contaminant Simulation Module (CSM)

Science.gov (United States)

2016-08-01

underlying sediment layer. Likewise, it was written as a dynamic link library (DLL) and compiled as CSM.dll. The CSM is independent of the dimensionality...column CT Total concentration in water µg L-1 Cion Ionic concentration in water µg L-1 Cd Concentration of dissolved phase in water µg L-1 Cdoc...CT2 Total concentration in sediment µg L-1 Cion2 Ionic concentration in water µg L-1 Cd2 Concentration of dissolved phase in pore water µg L-1

Demonstration of Autonomous Rendezvous Technology (DART) Project Summary

Science.gov (United States)

Rumford, TImothy E.

2003-01-01

Since the 1960's, NASA has performed numerous rendezvous and docking missions. The common element of all US rendezvous and docking is that the spacecraft has always been piloted by astronauts. Only the Russian Space Program has developed and demonstrated an autonomous capability. The Demonstration of Autonomous Rendezvous Technology (DART) project currently funded under NASA's Space Launch Initiative (SLI) Cycle I, provides a key step in establishing an autonomous rendezvous capability for the United States. DART's objective is to demonstrate, in space, the hardware and software necessary for autonomous rendezvous. Orbital Sciences Corporation intends to integrate an Advanced Video Guidance Sensor and Autonomous Rendezvous and Proximity Operations algorithms into a Pegasus upper stage in order to demonstrate the capability to autonomously rendezvous with a target currently in orbit. The DART mission will occur in April 2004. The launch site will be Vandenburg AFB and the launch vehicle will be a Pegasus XL equipped with a Hydrazine Auxiliary Propulsion System 4th stage. All mission objectives will be completed within a 24 hour period. The paper provides a summary of mission objectives, mission overview and a discussion on the design features of the chase and target vehicles.

Two-phase framework for optimal multi-target Lambert rendezvous

OpenAIRE

Bang, Jun; Ahn, Jaemyung

2017-01-01

This paper proposes a two-phase framework to solve an optimal multi-target Lambert rendezvous problem. The first phase solves a series of single-target rendezvous problems for all departure-arrival object pairs to generate the elementary solutions, which provides candidate rendezvous trajectories (elementary solutions). The second phase formulates a variant of traveling salesman problem (TSP) using the elementary solutions prepared in the first phase and determines the best rendezvous sequenc...

Comprehensive asynchronous symmetric rendezvous algorithm in ...

Indian Academy of Sciences (India)

Meenu Chawla

2017-11-10

Nov 10, 2017 ... Simulation results affirm that CASR algorithm performs better in terms of average time-to-rendezvous as compared ... process; neighbour discovery; symmetric rendezvous algorithm. 1. .... dezvous in finite time under the symmetric model. The CH ..... CASR algorithm in Matlab 7.11 and performed several.

Spacecraft rendezvous and docking

DEFF Research Database (Denmark)

Jørgensen, John Leif

1999-01-01

The phenomenons and problems encountered when a rendezvous manoeuvre, and possible docking, of two spacecrafts has to be performed, have been the topic for numerous studies, and, details of a variety of scenarios has been analysed. So far, all solutions that has been brought into realization has...... been based entirely on direct human supervision and control. This paper describes a vision-based system and methodology, that autonomously generates accurate guidance information that may assist a human operator in performing the tasks associated with both the rendezvous and docking navigation...

Rendezvous effects in the diffusion process on bipartite metapopulation networks.

Science.gov (United States)

Cao, Lang; Li, Xun; Wang, Bing; Aihara, Kazuyuki

2011-10-01

Epidemic outbreaks have been shown to be closely related to the rendezvous-induced transmission of infection, which is caused by casual contact with infected individuals in public gatherings. To investigate rendezvous effects in the spread of infectious diseases, we propose an epidemic model on metapopulation networks bipartite-divided into two sets of location and rendezvous nodes. At a given transition rate γ(kk')(p), each individual transfers from location k to rendezvous p (where rendezvous-induced disease incidence occurs) and thereafter moves to location k'. We find that the eigenstructure of a transition-rate-dependent matrix determines the epidemic threshold condition. Both analytical and numerical results show that rendezvous-induced transmission accelerates the progress of infectious diseases, implying the significance of outbreak control measures including prevention of public gatherings or decentralization of a large-scale rendezvous into downsized ones.

Electro-optical rendezvous and docking sensors

Science.gov (United States)

Tubbs, David J.; Kesler, Lynn O.; Sirko, Robert J.

1991-01-01

Electro-optical sensors provide unique and critical functionality for space missions requiring rendezvous, docking, and berthing. McDonnell Douglas is developing a complete rendezvous and docking system for both manned and unmanned missions. This paper examines our sensor development and the systems and missions which benefit from rendezvous and docking sensors. Simulation results quantifying system performance improvements in key areas are given, with associated sensor performance requirements. A brief review of NASA-funded development activities and the current performance of electro-optical sensors for space applications is given. We will also describe current activities at McDonnell Douglas for a fully functional demonstration to address specific NASA mission needs.

Resolving external pancreatic fistulas in patients with disconnected pancreatic duct syndrome: using rendezvous techniques to avoid surgery (with video).

Science.gov (United States)

Irani, Shayan; Gluck, Michael; Ross, Andrew; Gan, S Ian; Crane, Robert; Brandabur, John J; Hauptmann, Ellen; Fotoohi, Mehran; Kozarek, Richard A

2012-09-01

An external pancreatic fistula (EPF) generally results from an iatrogenic manipulation of a pancreatic fluid collection (PFC), such as walled-off pancreatic necrosis (WOPN). Severe necrotizing pancreatitis can lead to complete duct disruption, causing disconnected pancreatic duct syndrome (DPDS) with viable upstream pancreas draining out of a low-pressure fistula created surgically or by a percutaneous catheter. The EPF can persist for months to years, and distal pancreatectomy, often the only permanent solution, carries a high morbidity and defined mortality. To describe 3 endoscopic and percutaneous rendezvous techniques to completely resolve EPFs in the setting of DPDS. A retrospective review of a prospective database of 15 patients who underwent rendezvous internalization of EPFs. Tertiary-care pancreatic referral center. Fifteen patients between October 2002 and October 2011 with EPFs in the setting of DPDS and resolved WOPN. Three rendezvous techniques that combined endoscopic and percutaneous procedures to internalize EPFs by transgastric, transduodenal, or transpapillary methods. EPF resolution and morbidity. Fifteen patients (12 men) with a median age of 51 years (range 24-65 years) with EPFs and DPDS (cutoff/blowout of pancreatic duct, with inability to demonstrate upstream body/tail of pancreas on pancreatogram) resulting from severe necrotizing pancreatitis underwent 1 of 3 rendezvous procedures to eliminate the EPFs. All patients were either poor surgical candidates or refused surgery. At the time of the rendezvous procedure, WOPN had fully resolved, DPDS was confirmed on pancreatography, and the EPF had persisted for a median of 5 months (range 1-48 months), producing a median output of 200 mL/day (range 50-700 mL/day). The rendezvous technique in 10 patients used the existing percutaneous drainage fistula to puncture into the stomach/duodenum to deliver wires that were captured endoscopically. The transenteric fistula was dilated and two

Usefulness of combined percutaneous-endoscopic rendezvous techniques after failed therapeutic endoscopic retrograde cholangiography in the era of endoscopic ultrasound guided rendezvous.

Science.gov (United States)

Yang, Min Jae; Kim, Jin Hong; Hwang, Jae Chul; Yoo, Byung Moo; Kim, Soon Sun; Lim, Sun Gyo; Won, Je Hwan

2017-12-01

The rendezvous approach is a salvage technique after failure of endoscopic retrograde cholangiography (ERC). In certain circumstances, percutaneous-endoscopic rendezvous (PE-RV) is preferred, and endoscopic ultrasound-guided rendezvous (EUS-RV) is difficult to perform. We aimed to evaluate PE-RV outcomes, describe the PE-RV techniques, and identify potential indications for PE-RV over EUS-RV.Retrospective analysis was conducted of a prospectively designed ERC database between January 2005 and December 2016 at a tertiary referral center including cases where PE-RV was used as a salvage procedure after ERC failure.During the study period, PE-RV was performed in 42 cases after failed therapeutic ERC; 15 had a surgically altered enteric anatomy. The technical success rate of PE-RV was 92.9% (39/42), with a therapeutic success rate of 88.1% (37/42). Potential indications for PE-RV over EUS-RV were identified in 23 cases, and either PE-RV or EUS-RV could have effectively been used in 19 cases. Endoscopic bile duct access was successfully achieved with PE-RV in 39 cases with accessible biliary orifice using one of PE-RV cannulation techniques (classic, n = 11; parallel, n = 19; and adjunctive maneuvers, n = 9).PE-RV uses a unique technology and has clinical indications that distinguish it from EUS-RV. Therefore, PE-RV can still be considered a useful salvage technique for the treatment of biliary obstruction after ERC failure.

Hard rock excavation at the CSM/OCRD test site using Swedish blast design techniques

International Nuclear Information System (INIS)

Holmberg, R.

1983-09-01

This report is the third in a series describing research conducted by the Colorado School of Mines for the Office of Crystalline Repository Development (OCRD) to determine the extent of blast damage in rock surrounding an underground opening. A special room, called the CSM/OCRD room, was excavated at the CSM experimental mine for the purpose of assessing blast damage in the rock around the room. Even though this mine is not proposed as a nuclear waste repository site, the instrumentation and methods of blast damage assessment developed in this project are applicable to proposed repository sites. This report describes the application of Swedish blasting technology for the excavation of the test room. The design of the blasting patterns including the selection of explosives, hole sizes and location, explosive loading densities, and delay intervals is based upon the theories of Langefors and Kihlstrom in combination with methods used at the Swedish Detonic Research Foundation for minimizing unwanted rock damage. The practical application of the design procedures to seven rounds and the achieved results is discussed

PREDICTION BASED CHANNEL-HOPPING ALGORITHM FOR RENDEZVOUS IN COGNITIVE RADIO NETWORKS

Directory of Open Access Journals (Sweden)

Dhananjay Kumar

2012-12-01

Full Text Available Most common works for rendezvous in cognitive radio networks deal only with two user scenarios involving two secondary users and variable primary users and aim at reducing the time-to-rendezvous. A common control channel for the establishment of communication is not considered and hence the work comes under the category of ‘Blind Rendezvous’. Our work deal with multi-user scenario and provides a methodology for the users to find each other in the very first time slot spent for rendezvous or otherwise called the firstattempt- rendezvous. The secondary users make use of the history of past communications to enable them to predict the frequency channel that the user expects the rendezvous user to be. Our approach prevents greedy decision making between the users involved by the use of a cut-off time period for attempting rendezvous. Simulation results show that the time-to-rendezvous (TTR is greatly reduced upon comparison with other popular rendezvous algorithms.

Choledocholithiasis and endo-laparoscopic rendezvous. Analysis of 59 consecutive cases.

Science.gov (United States)

Del Rio, Paolo; Dell'Abate, Paolo; Labonia, Domenico; Negri, Marco; Sianesi, Nicoletta; Arcuri, Maria Francesca; Sianesi, Mario

2011-01-01

Choledocholithiasis is a real problem of major clinical importance. The incidence of cholelithiasis is 10-20%. We have examined 2907 patients treated with videolaparoscopic cholecystectomy (VLC) between January 2001 and September 2009. 214 cases (7.4%) were affected by choledocolithiasis; among these, 59 consecutive cases were treated by rendezvous, 151 cases by sequential treatment (ERCP-ES before VLC), 3 cases by extraction with Dormia's basket, and 1 case by ERCP-ES after VLC. The complications were one biliary fistula and three hemorrhages (one from the cystic artery, one from the hepatic area and one from trocar's site). The mean hospital stay was 1.38 +/- 0.83 days for the rendezvous group vs 4 53 +/- 0.74 days in the sequential treatment group (prendezvous procedure reduces hospital stay and has a greater compliance (only one treatment). We can use this option in the management of cases where preoperative ERCP-ES has failed.

Hyperbolic Rendezvous at Mars: Risk Assessments and Mitigation Strategies

Science.gov (United States)

Jedrey, Ricky; Landau, Damon; Whitley, Ryan

2015-01-01

Given the current interest in the use of flyby trajectories for human Mars exploration, a key requirement is the capability to execute hyperbolic rendezvous. Hyperbolic rendezvous is used to transport crew from a Mars centered orbit, to a transiting Earth bound habitat that does a flyby. Representative cases are taken from future potential missions of this type, and a thorough sensitivity analysis of the hyperbolic rendezvous phase is performed. This includes early engine cutoff, missed burn times, and burn misalignment. A finite burn engine model is applied that assumes the hyperbolic rendezvous phase is done with at least two burns.

SOMARC teams with private distribution firm to implement CSM program in Ghana.

Science.gov (United States)

1985-01-01

SOMARC, together with a private manufacturer and distributor of pharmaceutical products (Danafco, Limited), is launching a new contraceptive social marketing (CSM) program designed to make low cost, modern contraceptive products widely available in Ghana's cities. Danafco will directly implement the CSM program. Both the US Agency for International Development (USAID) and the government of Ghana will provide support to the program. James R. Kirland, USAID Population Officer, will assume overall responsibility for coordination and monitoring of CSM program activities. By a special amendment to the Pharmacy and Drug Act of 1961, the Ghanaian government has enabled the CSM program to conduct a demonstration project. Under the project, chemical sellers and retailers who successfully complete a special training session will be entitled to dispense oral contraceptives (OCs) without prescription. With the successful completion of this project, it is hoped that the Ghanaian government will further amend the Pharmacy Act to make contraceptives available nationwide on a nonprescription basis. Initially, the Ghana CSM program will market 3 products: a standard dosage OC; a foaming vaginal tablet; and an uncolored condom. Market research is now underway to determine product names for the OCs and vaginal tablets. The condom will be marketed under the name Panther. The project plans to conduct a retail audit to define current prices in the Ghanaian contraceptive market. Danafco will subcontract with Lintas Ghana Limited to provide advertising, package design, and promotion for the Ghana CSM program. Overall campaign efforts will focus on generating a positive climate for the program among influentials in government, religion, education, and health as well as consumers. The advertising campaign will include radio, television, print, and outdoor media. SOMARC, in collaboration with the USAID/Accra mission, hopes to establish an appropriate climate prior to the advertising launch

Trajectory control with continuous thrust applied to a rendezvous maneuver

International Nuclear Information System (INIS)

Santos, W G; Rocco, E M

2013-01-01

A rendezvous mission can be divided into the following phases: launch, phasing, far range rendezvous, close range rendezvous and mating (docking or berthing). This paper aims to present a close range rendezvous with closed loop controlled straight line trajectory. The approaching is executed on V-bar axis. A PID controller and continuous thrust are used to eliminate the residual errors in the trajectory. A comparative study about the linear and nonlinear dynamics is performed and the results showed that the linear equations become inaccurate insofar as the chaser moves away from the target

Limitations of BCC_CSM's ability to predict summer precipitation over East Asia and the Northwestern Pacific

Science.gov (United States)

Gong, Zhiqiang; Dogar, Muhammad Mubashar Ahmad; Qiao, Shaobo; Hu, Po; Feng, Guolin

2017-09-01

This study examines the ability of the Beijing Climate Center Climate System Model (BCC_CSM) to predict the meridional pattern of summer precipitation over East Asia-Northwest Pacific (EA-NWP) and its East Asia-Pacific (EAP) teleconnection. The differences of summer precipitation modes of the empirical orthogonal function and the bias of atmospheric circulations over EA-NWP are analyzed to determine the reason for the precipitation prediction errors. Results indicate that the BCC_CSM could not reproduce the positive-negative-positive meridional tripole pattern from south to north that differs markedly from that observed over the last 20 years. This failure can be attributed to the bias of the BCC_CSM hindcasts of the summer EAP teleconnection and the low predictability of 500 hPa at the mid-high latitude lobe of the EAP. Meanwhile, the BCC_CSM hindcasts' deficiencies of atmospheric responses to SST anomalies over the Indonesia maritime continent (IMC) resulted in opposite and geographically shifted geopotential anomalies at 500 hPa as well as wind and vorticity anomalies at 850 hPa, rendering the BCC_CSM unable to correctly reproduce the EAP teleconnection pattern. Understanding these two problems will help further improve BCC_CSM's summer precipitation forecasting ability over EA-NWP.

Limitations of BCC_CSM's ability to predict summer precipitation over East Asia and the Northwestern Pacific

KAUST Repository

Gong, Zhiqiang

2017-04-05

This study examines the ability of the Beijing Climate Center Climate System Model (BCC_CSM) to predict the meridional pattern of summer precipitation over East Asia-Northwest Pacific (EA-NWP) and its East Asia-Pacific (EAP) teleconnection. The differences of summer precipitation modes of the empirical orthogonal function and the bias of atmospheric circulations over EA-NWP are analyzed to determine the reason for the precipitation prediction errors. Results indicate that the BCC_CSM could not reproduce the positive-negative-positive meridional tripole pattern from south to north that differs markedly from that observed over the last 20 years. This failure can be attributed to the bias of the BCC_CSM hindcasts of the summer EAP teleconnection and the low predictability of 500 hPa at the mid-high latitude lobe of the EAP. Meanwhile, the BCC_CSM hindcasts\\' deficiencies of atmospheric responses to SST anomalies over the Indonesia maritime continent (IMC) resulted in opposite and geographically shifted geopotential anomalies at 500 hPa as well as wind and vorticity anomalies at 850 hPa, rendering the BCC_CSM unable to correctly reproduce the EAP teleconnection pattern. Understanding these two problems will help further improve BCC_CSM\\'s summer precipitation forecasting ability over EA-NWP.

Image-guided ureteral reconstruction using rendezvous technique for complex ureteric transection after gunshot injuries.

Science.gov (United States)

Arabi, Mohammad; Mat'hami, Abdulaziz; Said, Mohammad T; Bulbul, Muhammad; Haddad, Maurice; Al-Kutoubi, Aghiad

2016-01-01

Management of complex ureteric transection poses a significant clinical challenge, particularly after gunshot injuries due to marked distortion of anatomy and associated tissue loss. We report two cases of total ureteric transection due to gunshot injury successfully repaired using fluoroscopy-guided rendezvous procedure and double J stent placement. This minimally invasive approach may offer a safe and effective technique to repair complete ureteral transection and obviate the need for complex surgical procedures.

Use of automated rendezvous trajectory planning to improve spacecraft operations efficiency

Science.gov (United States)

Mulder, Tom A.

1991-01-01

The current planning process for space shuttle rendezvous with a second Earth-orbiting vehicle is time consuming and costly. It is a labor-intensive, manual process performed pre-mission with the aid of specialized maneuver processing tools. Real-time execution of a rendezvous plan must closely follow a predicted trajectory, and targeted solutions leading up to the terminal phase are computed on the ground. Despite over 25 years of Gemini, Apollo, Skylab, and shuttle vehicle-to-vehicle rendezvous missions flown to date, rendezvous in Earth orbit still requires careful monitoring and cannot be taken for granted. For example, a significant trajectory offset was experienced during terminal phase rendezvous of the STS-32 Long Duration Exposure Facility retrieval mission. Several improvements can be introduced to the present rendezvous planning process to reduce costs, produce more fuel-efficient profiles, and increase the probability of mission success.

A "rendezvous technique" for treating a pancreatic fistula after distal pancreatectomy.

Science.gov (United States)

Imai, Daisuke; Yamashita, Yo-ichi; Ikegami, Toru; Toshima, Takeo; Harimoto, Norifumi; Yoshizumi, Tomoharu; Soejima, Yuji; Shirabe, Ken; Ikeda, Tetsuo; Maehara, Yoshihiko

2015-01-01

Pancreatic fistulae are a major complication of distal pancreatectomy (DP). Some cases of severe pancreatic fistula require invasive procedures. There have been some reports concerning the effectiveness of pancreatic duct drainage through an endoscopic transpapillary approach for pancreatic fistulae. We herein present a case of a pancreatic fistula after DP that was successfully treated with percutaneous pancreatic duct drainage, which was performed using a combined percutaneous and endoscopic approach, named the "rendezvous technique". In our case, we performed distal pancreatectomy with celiac artery resection for a locally advanced pancreatic body cancer. On postoperative day (POD) 7, the drain amylase level increased up to 37,460 IU/l. Computed tomography (CT) revealed peripancreatic fluid collections. On POD 10, we placed a catheter in the main pancreatic duct using the rendezvous technique. CT on POD 14 revealed a decrease in the size of the peripancreatic fluid collection, and contrast imaging from the drains on POD 22 revealed almost complete disappearance of the fluid collection. We withdrew the pigtail catheter on POD 27 and the percutaneous pancreatic duct drain on POD 36. This patient was discharged from our hospital on POD 40. We herein report a new approach called the "rendezvous technique" for the management of pancreatic fistulae after DP that can be used instead of a stressful nasopancreatic tube.

The Evolution of the Rendezvous Profile During the Space Shuttle Program

Science.gov (United States)

Summa, William R.

2010-01-01

The rendezvous and proximity operations approach design techniques for space shuttle missions has changed significantly during the life of the program in response to new requirements that were not part of the original mission design. The flexibility of the shuttle onboard systems design and the mission planning process has allowed the program to meet these requirements. The design of the space shuttle and the shift from docking to grappling with a robotic ann prevented use of legacy Apollo rendezvous techniques. Over the life of the shuttle program the rendezvous profile has evolved due to several factors, including lowering propellant consumption and increasing flexibility in mission planning. Many of the spacecraft that the shuttle rendezvoused with had unique requirements that drove the creation of mission-unique proximity operations. The dockings to the Russian Mir space station and International Space Station (ISS) required further evolution of rendezvous and proximity operations techniques and additional sensors to enhance crew situational awareness. After the Columbia accident, a Rendezvous Pitch Maneuver (RPM) was added to allow tile photography from ISS. Lessons learned from these rendezvous design changes are applicable to future vehicle designs and operations concepts.

A Sandbox Environment for the CSM Standard and SPICE

Science.gov (United States)

Hare, T. M.; Laura, J. R.

2018-04-01

We present ongoing work USGS is undertaking to provide a programming environment for the Camera Sensor Model (CSM) standard and associated SPICE information. This allows for instrument testing and experimentation outside a given production area.

The Modular Clock Algorithm for Blind Rendezvous

Science.gov (United States)

2009-03-26

and Computer Engineering Graduate School of Engineering and Management Air Force Institute of Technology Air University Air Education and Training...capabilities in spectrum management and particularly in harvesting unused portions of pre-allocated band- width under DSA. The term “cognitive radio” was...of rendezvous and our role as the waiter . However, if the “child” refuses to move from non-common spectrum, rendezvous cannot occur. Bluetooth

Expert system isssues in automated, autonomous space vehicle rendezvous

Science.gov (United States)

Goodwin, Mary Ann; Bochsler, Daniel C.

1987-01-01

The problems involved in automated autonomous rendezvous are briefly reviewed, and the Rendezvous Expert (RENEX) expert system is discussed with reference to its goals, approach used, and knowledge structure and contents. RENEX has been developed to support streamlining operations for the Space Shuttle and Space Station program and to aid definition of mission requirements for the autonomous portions of rendezvous for the Mars Surface Sample Return and Comet Nucleus Sample return unmanned missions. The experience with REMEX to date and recommendations for further development are presented.

Laparoscopic-endoscopic rendezvous versus preoperative endoscopic sphincterotomy in people undergoing laparoscopic cholecystectomy for stones in the gallbladder and bile duct.

Science.gov (United States)

Vettoretto, Nereo; Arezzo, Alberto; Famiglietti, Federico; Cirocchi, Roberto; Moja, Lorenzo; Morino, Mario

2018-04-11

The management of gallbladder stones (lithiasis) concomitant with bile duct stones is controversial. The more frequent approach is a two-stage procedure, with endoscopic sphincterotomy and stone removal from the bile duct followed by laparoscopic cholecystectomy. The laparoscopic-endoscopic rendezvous combines the two techniques in a single-stage operation. To compare the benefits and harms of endoscopic sphincterotomy and stone removal followed by laparoscopic cholecystectomy (the single-stage rendezvous technique) versus preoperative endoscopic sphincterotomy followed by laparoscopic cholecystectomy (two stages) in people with gallbladder and common bile duct stones. We searched The Cochrane Hepato-Biliary Group Controlled Trials Register, CENTRAL, MEDLINE Ovid, Embase Ovid, Science Citation Index Expanded Web of Science, and two trials registers (February 2017). We included randomised clinical trials that enrolled people with concomitant gallbladder and common bile duct stones, regardless of clinical status or diagnostic work-up, and compared laparoscopic-endoscopic rendezvous versus preoperative endoscopic sphincterotomy procedures in people undergoing laparoscopic cholecystectomy. We excluded other endoscopic or surgical methods of intraoperative clearance of the bile duct, e.g. non-aided intraoperative endoscopic retrograde cholangiopancreatography or laparoscopic choledocholithotomy (surgical incision of the common bile duct for removal of bile duct stones). We used standard methodological procedures recommended by Cochrane. We included five randomised clinical trials with 517 participants (257 underwent a laparoscopic-endoscopic rendezvous technique versus 260 underwent a sequential approach), which fulfilled our inclusion criteria and provided data for analysis. Trial participants were scheduled for laparoscopic cholecystectomy because of suspected cholecysto-choledocholithiasis. Male/female ratio was 0.7; age of men and women ranged from 21 years to 87

On-Board Rendezvous Targeting for Orion

Science.gov (United States)

Weeks, Michael W.; DSouza, Christopher N.

2010-01-01

The Orion On-board GNC system is among the most complex ever developed for a space mission. It is designed to operate autonomously (independent of the ground). The rendezvous system in particular was designed to operate on the far side of the moon, and in the case of loss-of-communications with the ground. The vehicle GNC system is designed to retarget the rendezvous maneuvers, given a mission plan. As such, all the maneuvers which will be performed by Orion, have been designed and are being incorporated into the flight code.

Robust Parametric Control of Spacecraft Rendezvous

Directory of Open Access Journals (Sweden)

Dake Gu

2014-01-01

Full Text Available This paper proposes a method to design the robust parametric control for autonomous rendezvous of spacecrafts with the inertial information with uncertainty. We consider model uncertainty of traditional C-W equation to formulate the dynamic model of the relative motion. Based on eigenstructure assignment and model reference theory, a concise control law for spacecraft rendezvous is proposed which could be fixed through solving an optimization problem. The cost function considers the stabilization of the system and other performances. Simulation results illustrate the robustness and effectiveness of the proposed control.

Multi-Agent Rendezvousing with a Finite Set of Candidate Rendezvous Points

NARCIS (Netherlands)

Fang, J.; Morse, A. S.; Cao, M.

2008-01-01

The discrete multi-agent rendezvous problem we consider in this paper is concerned with a specified set of points in the plane, called “dwell-points,” and a set of mobile autonomous agents with limited sensing range. Each agent is initially positioned at some dwell-point, and is able to determine

The effect of gamma radiation on the ageing of sulfur cured nr/csm and nbr/csm rubber blends reinforced by carbon black

Directory of Open Access Journals (Sweden)

Gordana Marković

2009-10-01

Full Text Available In this work the effect of the γ-radiation dose on ageing of carbon black reinforced elastomeric materials was studied. The compounds based on natural rubber/chlorosulfonated rubber blend (NR/CSM and butadiene acrylonitrile rubber/chlorosulfonated rubber blend (NBR/CSM (50:50, w/w with different loadings (0, 20, 40, 50, 60, 80 and 100 phr of the filler with the average particle size of 40 nm were cured by sulfur. The obtained elastomeric composites were subjected to radiation doses (100, 200, 300 and 400 kGy in the presence of oxygen. The changes of material mechanical properties were estimated after radiation accelerated ageing. By using Fourier transform infrared measurements (ATR-FTIR it was assessed that after exposure to doses of 100 kGy alcohols, ethers, lactones, anhydrides, esters and carboxylic acids are formed in materials. The formation of shorter polyene sequences and aromatic rings in aged samples are assumed on the basis of the obtained spectra.

Automated space vehicle control for rendezvous proximity operations

Science.gov (United States)

Lea, Robert N.

1988-01-01

Rendezvous during the unmanned space exploration missions, such as a Mars Rover/Sample Return will require a completely automatic system from liftoff to docking. A conceptual design of an automated rendezvous, proximity operations, and docking system is being implemented and validated at the Johnson Space Center (JSC). The emphasis is on the progress of the development and testing of a prototype system for control of the rendezvous vehicle during proximity operations that is currently being developed at JSC. Fuzzy sets are used to model the human capability of common sense reasoning in decision making tasks and such models are integrated with the expert systems and engineering control system technology to create a system that performs comparably to a manned system.

Usefulness of the rendezvous technique for biliary stricture after adult right-lobe living-donor liver transplantation with duct-to-duct anastomosis.

Science.gov (United States)

Chang, Jae Hyuck; Lee, In Seok; Chun, Ho Jong; Choi, Jong Young; Yoon, Seung Kyoo; Kim, Dong Goo; You, Young Kyoung; Choi, Myung-Gyu; Choi, Kyu-Yong; Chung, In-Sik

2010-03-01

Replacement of a percutaneous transhepatic biliary drainage (PTBD) catheter with inside stents using endoscopic retrograde cholangiography is difficult in patients with angulated or twisted biliary anastomotic stricture after living donor liver transplantation (LDLT). We evaluated the usefulness and safety of the rendezvous technique for the management of biliary stricture after LDLT. Twenty patients with PTBD because of biliary stricture after LDLT with duct-to-duct anastomosis underwent the placement of inside stents using the rendezvous technique. Inside stents were successfully placed in the 20 patients using the rendezvous technique. The median procedure time was 29.6 (range, 7.5-71.8) minutes. The number of inside stents placed was one in 12 patients and two in eight patients. One mild acute pancreatitis and one acute cholangitis occurred, which improved within a few days. Inside stent related sludge or stone was identified in 12 patients during follow-up. Thirteen patients achieved stent-free status for a median of 281 (range, 70-1,351) days after removal of the inside stents. The rendezvous technique is a useful and safe method for the replacement of PTBD catheter with inside stent in patients with biliary stricture after LDLT with duct-to-duct anastomosis. The rendezvous technique could be recommended to patients with angulated or twisted strictures.

Design and Implementation of the Automated Rendezvous Targeting Algorithms for Orion

Science.gov (United States)

DSouza, Christopher; Weeks, Michael

2010-01-01

The Orion vehicle will be designed to perform several rendezvous missions: rendezvous with the ISS in Low Earth Orbit (LEO), rendezvous with the EDS/Altair in LEO, a contingency rendezvous with the ascent stage of the Altair in Low Lunar Orbit (LLO) and a contingency rendezvous in LLO with the ascent and descent stage in the case of an aborted lunar landing. Therefore, it is not difficult to realize that each of these scenarios imposes different operational, timing, and performance constraints on the GNC system. To this end, a suite of on-board guidance and targeting algorithms have been designed to meet the requirement to perform the rendezvous independent of communications with the ground. This capability is particularly relevant for the lunar missions, some of which may occur on the far side of the moon. This paper will describe these algorithms which are designed to be structured and arranged in such a way so as to be flexible and able to safely perform a wide variety of rendezvous trajectories. The goal of the algorithms is not to merely fly one specific type of canned rendezvous profile. Conversely, it was designed from the start to be general enough such that any type of trajectory profile can be flown.(i.e. a coelliptic profile, a stable orbit rendezvous profile, and a expedited LLO rendezvous profile, etc) all using the same rendezvous suite of algorithms. Each of these profiles makes use of maneuver types which have been designed with dual goals of robustness and performance. They are designed to converge quickly under dispersed conditions and they are designed to perform many of the functions performed on the ground today. The targeting algorithms consist of a phasing maneuver (NC), an altitude adjust maneuver (NH), and plane change maneuver (NPC), a coelliptic maneuver (NSR), a Lambert targeted maneuver, and several multiple-burn targeted maneuvers which combine one of more of these algorithms. The derivation and implementation of each of these

Gossip-based solutions for discrete rendezvous in populations of communicating agents.

Science.gov (United States)

Hollander, Christopher D; Wu, Annie S

2014-01-01

The objective of the rendezvous problem is to construct a method that enables a population of agents to agree on a spatial (and possibly temporal) meeting location. We introduce the buffered gossip algorithm as a general solution to the rendezvous problem in a discrete domain with direct communication between decentralized agents. We compare the performance of the buffered gossip algorithm against the well known uniform gossip algorithm. We believe that a buffered solution is preferable to an unbuffered solution, such as the uniform gossip algorithm, because the use of a buffer allows an agent to use multiple information sources when determining its desired rendezvous point, and that access to multiple information sources may improve agent decision making by reinforcing or contradicting an initial choice. To show that the buffered gossip algorithm is an actual solution for the rendezvous problem, we construct a theoretical proof of convergence and derive the conditions under which the buffered gossip algorithm is guaranteed to produce a consensus on rendezvous location. We use these results to verify that the uniform gossip algorithm also solves the rendezvous problem. We then use a multi-agent simulation to conduct a series of simulation experiments to compare the performance between the buffered and uniform gossip algorithms. Our results suggest that the buffered gossip algorithm can solve the rendezvous problem faster than the uniform gossip algorithm; however, the relative performance between these two solutions depends on the specific constraints of the problem and the parameters of the buffered gossip algorithm.

Gossip-based solutions for discrete rendezvous in populations of communicating agents.

Directory of Open Access Journals (Sweden)

Christopher D Hollander

Full Text Available The objective of the rendezvous problem is to construct a method that enables a population of agents to agree on a spatial (and possibly temporal meeting location. We introduce the buffered gossip algorithm as a general solution to the rendezvous problem in a discrete domain with direct communication between decentralized agents. We compare the performance of the buffered gossip algorithm against the well known uniform gossip algorithm. We believe that a buffered solution is preferable to an unbuffered solution, such as the uniform gossip algorithm, because the use of a buffer allows an agent to use multiple information sources when determining its desired rendezvous point, and that access to multiple information sources may improve agent decision making by reinforcing or contradicting an initial choice. To show that the buffered gossip algorithm is an actual solution for the rendezvous problem, we construct a theoretical proof of convergence and derive the conditions under which the buffered gossip algorithm is guaranteed to produce a consensus on rendezvous location. We use these results to verify that the uniform gossip algorithm also solves the rendezvous problem. We then use a multi-agent simulation to conduct a series of simulation experiments to compare the performance between the buffered and uniform gossip algorithms. Our results suggest that the buffered gossip algorithm can solve the rendezvous problem faster than the uniform gossip algorithm; however, the relative performance between these two solutions depends on the specific constraints of the problem and the parameters of the buffered gossip algorithm.

Multiple NEO Rendezvous Using Solar Sail Propulsion

Science.gov (United States)

Johnson, Les; Alexander, Leslie; Fabisinski, Leo; Heaton, Andy; Miernik, Janie; Stough, Rob; Wright, Roosevelt; Young, Roy

2012-01-01

The NASA Marshall Space Flight Center (MSFC) Advanced Concepts Office performed an assessment of the feasibility of using a near-term solar sail propulsion system to enable a single spacecraft to perform serial rendezvous operations at multiple Near Earth Objects (NEOs) within six years of launch on a small-to-moderate launch vehicle. The study baselined the use of the sail technology demonstrated in the mid-2000 s by the NASA In-Space Propulsion Technology Project and is scheduled to be demonstrated in space by 2014 as part of the NASA Technology Demonstration Mission Program. The study ground rules required that the solar sail be the only new technology on the flight; all other spacecraft systems and instruments must have had previous space test and qualification. The resulting mission concept uses an 80-m X 80-m 3-axis stabilized solar sail launched by an Athena-II rocket in 2017 to rendezvous with 1999 AO10, Apophis and 2001 QJ142. In each rendezvous, the spacecraft will perform proximity operations for approximately 30 days. The spacecraft science payload is simple and lightweight; it will consist of only the multispectral imager flown on the Near Earth Asteroid Rendezvous (NEAR) mission to 433 Eros and 253 Mathilde. Most non-sail spacecraft systems are based on the Messenger mission spacecraft. This paper will describe the objectives of the proposed mission, the solar sail technology to be employed, the spacecraft system and subsystems, as well as the overall mission profile.

Rendezvous endoscopic recanalization for complete esophageal obstruction.

Science.gov (United States)

Fusco, Stefano; Kratt, Thomas; Gani, Cihan; Stueker, Dietmar; Zips, Daniel; Malek, Nisar P; Goetz, Martin

2018-03-30

Complete esophageal obstruction after (chemo)radiation for head and neck cancers is rare. However, inability to swallow one's own saliva strongly inflicts upon quality of life. Techniques for endoscopic recanalization in complete obstruction are not well established. We assessed the efficacy and safety of rendezvous recanalization. We performed a retrospective review of all patients who underwent endoscopic recanalization of complete proximal esophageal obstruction after radiotherapy between January 2009 and June 2016. Technical success was defined as an ability to pass an endoscope across the recanalized lumen, clinical success by changes in the dysphagia score. Adverse events were recorded prospectively. 19 patients with complete obstruction (dysphagia IV°), all of whom had failed at least one trial of conventional dilatation, underwent recanalization by endoscopic rendezvous, a combined approach through a gastrostomy and perorally under fluoroscopic control. Conscious sedation was used in all patients. In 18/19 patients (94.7%), recanalization was technically successful. In 14/18 patients (77.8%), the post-intervention dysphagia score changed to ≤ II. Three patients had their PEG removed. Factors negatively associated with success were obstruction length of 50 mm; and tumor recurrence for long-term success. No severe complications were recorded. Rendezvous recanalization for complete esophageal obstruction is a reliable and safe method to re-establish luminal patency. Differences between technical and clinical success rates highlight the importance of additional functional factors associated with dysphagia. Given the lack of therapeutic alternatives, rendezvous recanalization is a valid option to improve dysphagia.

Model predictive control for spacecraft rendezvous in elliptical orbit

Science.gov (United States)

Li, Peng; Zhu, Zheng H.

2018-05-01

This paper studies the control of spacecraft rendezvous with attitude stable or spinning targets in an elliptical orbit. The linearized Tschauner-Hempel equation is used to describe the motion of spacecraft and the problem is formulated by model predictive control. The control objective is to maximize control accuracy and smoothness simultaneously to avoid unexpected change or overshoot of trajectory for safe rendezvous. It is achieved by minimizing the weighted summations of control errors and increments. The effects of two sets of horizons (control and predictive horizons) in the model predictive control are examined in terms of fuel consumption, rendezvous time and computational effort. The numerical results show the proposed control strategy is effective.

Mars Sample Return - Launch and Detection Strategies for Orbital Rendezvous

Science.gov (United States)

Woolley, Ryan C.; Mattingly, Richard L.; Riedel, Joseph E.; Sturm, Erick J.

2011-01-01

This study sets forth conceptual mission design strategies for the ascent and rendezvous phase of the proposed NASA/ESA joint Mars Sample Return Campaign. The current notional mission architecture calls for the launch of an acquisition/cache rover in 2018, an orbiter with an Earth return vehicle in 2022, and a fetch rover and ascent vehicle in 2024. Strategies are presented to launch the sample into a coplanar orbit with the Orbiter which facilitate robust optical detection, orbit determination, and rendezvous. Repeating ground track orbits exist at 457 and 572 km which provide multiple launch opportunities with similar geometries for detection and rendezvous.

Mars Sample Return: Launch and Detection Strategies for Orbital Rendezvous

Science.gov (United States)

Woolley, Ryan C.; Mattingly, Richard L.; Riedel, Joseph E.; Sturm, Erick J.

2011-01-01

This study sets forth conceptual mission design strategies for the ascent and rendezvous phase of the proposed NASA/ESA joint Mars Sample Return Campaign. The current notional mission architecture calls for the launch of an acquisition/ caching rover in 2018, an Earth return orbiter in 2022, and a fetch rover with ascent vehicle in 2024. Strategies are presented to launch the sample into a nearly coplanar orbit with the Orbiter which would facilitate robust optical detection, orbit determination, and rendezvous. Repeating ground track orbits existat 457 and 572 km which would provide multiple launch opportunities with similar geometries for detection and rendezvous.

Combined Sector and Channel Hopping Schemes for Efficient Rendezvous in Directional Antenna Cognitive Radio Networks

Directory of Open Access Journals (Sweden)

AbdulMajid M. Al-Mqdashi

2017-01-01

Full Text Available Rendezvous is a prerequisite and important process for secondary users (SUs to establish data communications in cognitive radio networks (CRNs. Recently, there has been a proliferation of different channel hopping- (CH- based schemes that can provide rendezvous without relying on any predetermined common control channel. However, the existing CH schemes were designed with omnidirectional antennas which can degrade their rendezvous performance when applied in CRNs that are highly crowded with primary users (PUs. In such networks, the large number of PUs may lead to the inexistence of any common available channel between neighboring SUs which result in a failure of their rendezvous process. In this paper, we consider the utilization of directional antennas in CRNs for tackling the issue. Firstly, we propose two coprimality-based sector hopping (SH schemes that can provide efficient pairwise sector rendezvous in directional antenna CRNs (DIR-CRNs. Then, we propose an efficient CH scheme that can be combined within the SH schemes for providing a simultaneous sector and channel rendezvous. The guaranteed rendezvous of our schemes are proven by deriving the theoretical upper bounds of their rendezvous delay metrics. Furthermore, extensive simulation comparisons with other related rendezvous schemes are conducted to illustrate the significant outperformance of our schemes.

Short rendezvous missions for advanced Russian human spacecraft

Science.gov (United States)

Murtazin, Rafail F.; Budylov, Sergey G.

2010-10-01

The two-day stay of crew in a limited inhabited volume of the Soyuz-TMA spacecraft till docking to ISS is one of the most stressful parts of space flight. In this paper a number of possible ways to reduce the duration of the free flight phase are considered. The duration is defined by phasing strategy that is necessary for reduction of the phase angle between the chaser and target spacecraft. Some short phasing strategies could be developed. The use of such strategies creates more comfortable flight conditions for crew thanks to short duration and additionally it allows saving spacecraft's life support resources. The transition from the methods of direct spacecraft rendezvous using one orbit phasing (first flights of " Vostok" and " Soyuz" vehicles) to the currently used methods of two-day rendezvous mission can be observed in the history of Soviet manned space program. For an advanced Russian human rated spacecraft the short phasing strategy is recommended, which can be considered as a combination between the direct and two-day rendezvous missions. The following state of the art technologies are assumed available: onboard accurate navigation; onboard computations of phasing maneuvers; launch vehicle with high accuracy injection orbit, etc. Some operational requirements and constraints for the strategies are briefly discussed. In order to provide acceptable phase angles for possible launch dates the experience of the ISS altitude profile control can be used. As examples of the short phasing strategies, the following rendezvous missions are considered: direct ascent, short mission with the phasing during 3-7 orbits depending on the launch date (nominal or backup). For each option statistical modeling of the rendezvous mission is fulfilled, as well as an admissible phase angle range, accuracy of target state vector and addition fuel consumption coming out of emergency is defined. In this paper an estimation of pros and cons of all options is conducted.

Cost/CYP: a bottom line that helps keep CSM projects cost-efficient.

Science.gov (United States)

1985-01-01

In contraceptive social marketing (CSM), the objective is social good, but project managers also need to run a tight ship, trimming costs, allocating scarce funds, and monitoring their program's progress. 1 way CSM managers remain cost-conscious is through the concept of couple-years-of-protection (CYP). Devised 2 decades ago as an administrative tool to compare the effects of different contraceptive methods, CYP's uses have multiplied to include assessing program output and cost effectiveness. Some of the factors affecting cost/CYP are a project's age, sales volume, management efficiency, and product prices and line. These factors are interconnected. The cost/CYP figures given here do not include outlays for commodities. While the Agency for International Development's commodity costs alter slightly with each new purchase contrast, the agency reports that a condom costs about 4 cents (US), an oral contraceptive (OC) cycle about 12 cents, and a spermicidal tablet about 7 cents. CSM projects have relatively high start-up costs. Within a project's first 2 years, expenses must cover such marketing activities as research, packaging, warehousing, and heavy promotion. As a project ages, sales should grow, producing revenues that gradually amortize these initial costs. The Nepal CSM project provides an example of how cost/CYP can improve as a program ages. In 1978, the year sales began, the project's cost/CYP was about $84. For some time the project struggled to get its products to its target market and gradually overcome several major hurdles. The acquisition of jeeps eased distribution and, by adding another condom brand, sales were increased still more, bringing the cost/CYP down to $8.30 in 1981. With further sales increases and resulting revenues, the cost/CYP dropped to just over $7 in 1983. When the sales volume becomes large enough, CSM projects can achieve economies of scale, which greatly improves cost-efficiency. Fixed costs shrink as a proportion of total

Assessment and correction of BCC_CSM's performance in capturing leading modes of summer precipitation over North Asia

KAUST Repository

Gong, Zhiqiang

2017-11-07

This article examines the ability of Beijing Climate Center Climate System Model (BCC_CSM) in demonstrating the prediction accuracy and the leading modes of the summer precipitation over North Asia (NA). A dynamic-statistic combined approach for improving the prediction accuracy and the prediction of the leading modes of the summer precipitation over NA is proposed. Our results show that the BCC_CSM can capture part of the spatial anomaly features of the first two leading modes of NA summer precipitation. Moreover, BCC_CSM regains relationships such that the first and second mode of the empirical orthogonal function (EOF1 and EOF2) of NA summer precipitation, respectively, corresponds to the development of the El Niño and La Niña conditions in the tropical East Pacific. Nevertheless, BCC_CSM exhibits limited prediction skill over most part of NA and presents a deficiency in reproducing the EOF1\\'s and EOF2\\'s spatial pattern over central NA and EOF2\\'s interannual variability. This can be attributed as the possible reasons why the model is unable to capture the correct relationships among the basic climate elements over the central NA, lacks in its ability to reproduce a consistent zonal atmospheric pattern over NA, and has bias in predicting the relevant Sea Surface Temperature (SST) modes over the tropical Pacific and Indian Ocean regions. Based on the proposed dynamic-statistic combined correction approach, compared with the leading modes of BCC_CSM\\'s original prediction, anomaly correlation coefficients of corrected EOF1/EOF2 with the tropical Indian Ocean SST are improved from 0.18/0.36 to 0.51/0.62. Hence, the proposed correction approach suggests that the BCC_CSM\\'s prediction skill for the summer precipitation prediction over NA and its ability to capture the dominant modes could be certainly improved by choosing proper historical analogue information.

Usage and User Experience of Communication before and during Rendezvous

Science.gov (United States)

Colbert, Martin

2005-01-01

This paper reports a field evaluation of the mobile phone as a "package" of device and services. The evaluation compares 44 university students' usage and user experience of communication before and during rendezvous. During a rendezvous (en route), students rated many aspects of the experience of phone use less favourably than before a rendezvous…

A Study of Control Laws for Microsatellite Rendezvous with a Noncooperative Target

National Research Council Canada - National Science Library

Tschirhart, Troy

2003-01-01

This study investigated the feasibility of using a microsatellite to accomplish an orbital rendezvous with a noncooperative target, with a focus on the control laws necessary for achieving such a rendezvous...

Endoscopic ultrasonography-guided rendezvous technique.

Science.gov (United States)

Tsuchiya, Takayoshi; Itoi, Takao; Sofuni, Atsushi; Tonozuka, Ryosuke; Mukai, Shuntaro

2016-04-01

Endoscopic retrograde cholangiopancreatography (ERCP) requires deep biliary cannulation. When deep biliary cannulation is failed, the endoscopic ultrasonography rendezvous technique (EUS-RV) is a useful salvage method. From the previous 15 articles that included 382 EUS-RV cases, the overall success rate of EUS-RV is 81 % with a complication rate of 10 %. In EUS-RV, the bile duct is punctured under EUS guidance and a guidewire is advanced into the duodenum via the papilla. The EUS scope is then switched to a duodenoscope and inserted into the bile duct over the guidewire exiting the papilla, or the guidewire is grasped with forceps and passed through the working channel; the catheter can then be inserted through the papilla over the wire. There are three puncture routes for EUS-RV: transgastric puncture of the intrahepatic bile duct (IHBD), transduodenal puncture of the extrahepatic bile duct (EHBD) via the proximal duodenum (D1), and transduodenal puncture of the EHBD via the second portion of the duodenum (D2). The puncture route for each patient should be selected based on the patient condition. GW selection for EUS-RV is critical, a hydrophilic GW is useful for this procedure. Although EUS-RV is now performed relatively routinely in a few high-volume centers, procedure standardization and the development of exclusive devices for EUS-RV are still underway. The development of exclusive devices for EUS-RV and prospective comparative studies with other salvage methods are needed to truly evaluate the procedure's usefulness and safety.

Fatal central venous air embolism: a rare complication of esophageal dilation by rendezvous.

Science.gov (United States)

Zald, Philip B; Andersen, Peter E

2011-03-01

Esophageal dilation by rendezvous is a useful technique for the treatment of complicated esophageal strictures. We present a case of a 74-year-old man with chronic dysphagia caused by a complete cervical esophageal stricture that developed after external beam radiotherapy for treatment of papillary thyroid carcinoma. During attempted dilation using the rendezvous technique, the patient suffered a fatal pulmonary air embolism. The technique of esophageal dilation by rendezvous, complications, and risk factors for development of venous air embolism are discussed. To the best of our knowledge, this is the first report in the literature of fatal venous air embolism after dilation by rendezvous. Copyright © 2009 Wiley Periodicals, Inc.

Test Results for the Automated Rendezvous and Capture System

Science.gov (United States)

Cruzen, Craig; Dabney, Richard; Lomas, James

1999-01-01

The Automated Rendezvous and Capture (AR&C) system was designed and tested at NASA's Marshall Space Flight Center (MSFC) to demonstrate technologies and mission strategies for automated rendezvous and docking of spacecraft in Earth orbit, The system incorporates some of the latest innovations in Global Positioning, System space navigation, laser sensor technologies and automated mission sequencing algorithms. The system's initial design and integration was completed in 1998 and has undergone testing at MSFC. This paper describes the major components of the AR&C system and presents results from the official system tests performed in MSFC's Flight Robotics Laboratory with digital simulations and hardware in the loop tests. The results show that the AR&C system can safely and reliably perform automated rendezvous and docking missions in the absence of system failures with 100 percent success. When system failures are included, the system uses its automated collision avoidance maneuver logic to recover in a safe manner. The primary objective of the AR&C project is to prove that by designing a safe and robust automated system, mission operations cost can be reduced by decreasing the personnel required for mission design, preflight planning and training required for crewed rendezvous and docking missions.

A 10-year study of rendezvous intraoperative endoscopic retrograde cholangiography during cholecystectomy and the risk of post-ERCP pancreatitis.

Science.gov (United States)

Noel, Rozh; Enochsson, Lars; Swahn, Fredrik; Löhr, Matthias; Nilsson, Magnus; Permert, Johan; Arnelo, Urban

2013-07-01

Rendezvous intraoperative endoscopic retrograde cholangiography (RV-IOERC), also called guidewire-facilitated IOERC, is one of the single-stage options available for managing common bile duct stones (CBDS) during laparoscopic cholecystectomy. The objective of this study is to investigate procedure-related complications in IOERC patients and stone clearance. All patients who underwent IOERC between January 2000 and December 2009 were identified from the local registry of Karolinska University Hospital in Huddinge. Medical charts and ERC reports were studied, and descriptive statistics were obtained. Outcomes were procedure-related complications, especially post-ERCP pancreatitis (PEP), stone clearance, and mortality. 307 patients were identified. In 264 of the patients, the rendezvous cannulation technique was successful (86 %); in the remaining 43 patients, conventional cannulation technique was necessary. In total, PEP occurred in seven patients (2.28 %). One of the PEP patients was in the rendezvous cannulated group (0.37 %), whereas six patients developed PEP in the nonrendezvous group (13.95 %, p < 0.001). The primary stone clearance rate was 88.27 % (271/307). There was no mortality within 90 days in the series. IOERC with RV cannulation technique for management of CBDS during laparoscopic cholecystectomy has a low PEP rate and a high stone clearance rate, making it a safe and feasible method for removing CBDS. However, the technique requires logistics to perform IOERC in the operating theater. The present data suggest that IOERC with RV cannulation is superior to conventional cannulation with respect to risk of PEP.

Automatic rendezvous and docking systems functional and performance requirements

Science.gov (United States)

1985-01-01

A generalized mission design scheme which utilizes a standard mission profile for all OMV rendezvous operations, recognizes typical operational constraints, and minimizes propellant penalties due to nodal regression effects was developed. This scheme has been used to demonstrate a unified guidance and navigation maneuver processor (the UMP), which supports all mission phases through station-keeping. The initial demonstration version of the Orbital Rendezvous Mission Planner (ORMP) was provided for evaluation purposes, and program operation was discussed.

Impact of the Intracoronary Rendezvous technique on coronary angioplasty for chronic total occlusion.

Science.gov (United States)

Nihei, Taro; Yamamoto, Yoshito; Kudo, Shun; Hanawa, Kenichiro; Hasebe, Yuhi; Takagi, Yusuke; Minatoya, Yutaka; Sugi, Masafumi; Shimokawa, Hiroaki

2017-10-01

The Rendezvous technique, which requires bidirectional wiring, is one of the useful methods for improving the success rate of recanalization for chronic total occlusion (CTO) in the field of peripheral intervention. Recently, advanced new devices for percutaneous coronary intervention have enabled us to perform the Rendezvous technique for peripheral as well as for coronary CTO lesions. We used the Intracoronary Rendezvous technique to perform angioplasty for coronary CTO. "Intracoronary Rendezvous" means that Rendezvous was achieved within the CTO lesion. From March 2009 to November 2015, 189 patients underwent CTO angioplasty at our institute, and we treated 10 patients with the Intracoronary Rendezvous technique. This technique involves crossing the Gaia series guidewire to the contralateral Corsair microcatheter located inside the plaque of CTO lesions. The majority of the CTO sites examined were in the proximal RCA (60 %). Lesion length of the occlusion was relatively long (64.4 ± 12.2 mm). Using the biplane imaging system, we were able to control the Gaia guidewires in a specific direction. Furthermore, if the antegrade and retrograde wires can be advanced into contiguous space inside the CTO lesion, we intentionally entered either wire into the contralateral Corsair microcatheter, followed by successful CTO crossing. CTO recanalization was completed for all patients without controlled antegrade retrograde subintimal tracking (CART) or reverse CART. No major complications occurred during hospitalization. These results indicate that the Rendezvous technique, assisted by new devices and a biplane imaging system, represents one of the primary options to achieve successful coronary CTO recanalization.

Totally percutaneous rendezvous techniques for the treatment of bile strictures and leakages.

Science.gov (United States)

De Robertis, Riccardo; Contro, Alberto; Zamboni, Giulia; Mansueto, Giancarlo

2014-04-01

Some challenging pathologic conditions of the biliary tract cannot be treated with endoscopy alone, and a combined approach with rendezvous techniques is frequently needed. Three different totally percutaneous rendezvous techniques were successfully applied in three cases. The rendezvous techniques were performed either with bilateral catheterization of bile ducts to treat a challenging type IV biliary stenosis and iatrogenic biliary damage or with biliary catheterization and percutaneous puncture of the anastomotic loop to treat a biliodigestive anastomosis failure with bile leakage. Copyright © 2014 SIR. Published by Elsevier Inc. All rights reserved.

The subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3: dynamics and interdependence.

Science.gov (United States)

Uzunova, Sonya Dimitrova; Zarkov, Alexander Stefanov; Ivanova, Anna Marianova; Stoynov, Stoyno Stefanov; Nedelcheva-Veleva, Marina Nedelcheva

2014-01-01

The S-phase checkpoint aims to prevent cells from generation of extensive single-stranded DNA that predisposes to genome instability. The S. cerevisiae complex Tof1/Csm3/Mrc1 acts to restrain the replicative MCM helicase when DNA synthesis is prohibited. Keeping the replication machinery intact allows restart of the replication fork when the block is relieved. Although the subunits of the Tof1/Csm3/Mrc1 complex are well studied, the impact of every single subunit on the triple complex formation and function needs to be established. This work studies the cellular localization and the chromatin binding of GFP-tagged subunits when the complex is intact and when a subunit is missing. We demonstrate that the complex is formed in cell nucleus, not the cytoplasm, as Tof1, Csm3 and Mrc1 enter the nucleus independently from one another. Via in situ chromatin binding assay we show that a Tof1-Csm3 dimer formation and chromatin binding is required to ensure the attachment of Mrc1 to chromatin. Our study indicates that the translocation into the nucleus is not the process to regulate the timing of chromatin association of Mrc1. We also studied the nuclear behavior of Mrc1 subunit in the process of adaptation to the presence hydroxyurea. Our results indicate that after prolonged HU incubation, cells bypass the S-phase checkpoint and proceed throughout the cell cycle. This process is accompanied by Mrc1 chromatin detachment and Rad53 dephosphorylation. In S. cerevisiae the subunits of the S-phase checkpoint complex Mrc1/Tof1/Csm3 independently enter the cell nucleus, where a Tof1-Csm3 dimer is formed to ensure the chromatin binding of Mrc1 and favor DNA replication and S-phase checkpoint fork arrest. In the process of adaptation to the presence of hydroxyurea Mrc1 is detached from chromatin and Rad53 checkpoint activity is diminished in order to allow S-phase checkpoint escape and completion of the cell cycle.

Association of bacteriochlorophyll a with the CsmA protein in chlorosomes of the photosynthetic green filamentous bacterium Chloroflexus aurantiacus

DEFF Research Database (Denmark)

Sakuragi, Y; Frigaard, N-U; Shimada, K

1999-01-01

with molecular masses of 11 and 18 kDa (CsmN and CmsM), whereas the spectral properties of BChl a and BChl c were not changed. By the new hexanol-detergent (HD) treatment, most BChl c and all of the detected proteins except CsmA were removed from the chlorosomes without changing the BChl a spectral properties....... Subsequent proteinase K treatment of these HD-treated chlorosomes caused digestion of CsmA and a simultaneous decrease of the BChl a absorption band. Based on these results, we suggest that CsmA is associated with BChl a in the chlorosomes. This suggestion was supported by the measured stoichiometric ratio...... of BChl a to CsmA in isolated chlorosomes, which was estimated to be between 1.2 and 2.7 by amino acid analysis of the SDS-PAGE-resolved protein bands....

The Rendezvous Technique for Common Bile Duct Stones: A Meta-Analysis.

Science.gov (United States)

Huang, Long; Yu, Qing-sheng; Zhang, Qi; Liu, Ju-da; Wang, Zhen

2015-12-01

This article aimed to clarify the effectiveness and the efficiency of the rendezvous technique for patients with common bile duct stones. Four databases were searched on associations with rendezvous treatment. Six randomized controlled trials were evaluated for their success rate, stone clearance, morbidity, mortality, conversions, hospital stay, operating time, and hospitalization charges. This meta-analysis suggested no significant difference between the rendezvous group and the sequence group in the success rate and the stone clearance, but showed significant differences in the morbidity [odds ratio (OR)=0.54; 95% confidence intervals (CI), 0.30, 0.96], conversions (OR=0.40; 95% CI, 0.16, 0.97), the length of hospital stay (OR=-1.97; 95% CI, -2.29, -1.66), and the operating time (OR=12.95; 95% CI, 7.66, 18.24). The rendezvous technique is as effective as sequential endoscopic management for patients with common bile duct stones in its success rate and stone clearance, but the former is preferred in terms of morbidity, hospital stay, and hospitalization charges.

Early laparoendoscopic rendezvous for acute biliary pancreatitis: preliminary results.

Science.gov (United States)

Borzellino, G; Lombardo, F; Minicozzi, A M; Donataccio, M; Cordiano, C

2010-02-01

Early restored patency of the papilla has been hypothesized to reduce complications and mortality of acute biliary pancreatitis. The aim of this study was to evaluate the role of urgent laparoscopic cholecystectomy with intraoperative cholangiography and rendezvous when necessary in acute biliary pancreatitis natural history. Patients observed in the early stage of an acute biliary pancreatitis were included in the study. Operative risk assessment based on American Society of Anesthesiologists (ASA) score allowed the performance of urgent laparoscopic cholecystectomy within 72 h from onset of symptoms in 55 patients and a delayed intervention during the same admission in 21 patients. Intraoperative cholangiography was performed in all cases, and clearance of common bile duct was performed by flushing when possible, or rendezvous when necessary. Evolution of pancreatitis was evaluated with clinical and radiological monitoring. Urgent laparoscopic cholecystectomy was performed in all cases without conversion. At intraoperative cholangiography common bile duct was free in 25 patients, a papillary spasm was observed in 9, and common bile duct stones in 21 patients. Patency of the papilla was restored by flushing in 13 patients, while a rendezvous was necessary in 17 patients. The rate of organ failure and pancreatic necrosis was 1.8%, overall mortality was 1.8%, and overall morbidity 21.8%. No infectious complications of peripancreatic collections were observed. Urgent laparoscopic cholecystectomy with selective intraoperative rendezvous may be considered as a treatment option in the early stage of acute biliary pancreatitis.

Multiple NEO Rendezvous Using Solar Sails

Science.gov (United States)

Johnson, Les; Alexander, Leslie; Fabisinski, Leo; Heaton, Andy; Miernik, Janie; Stough, Rob; Wright, Roosevelt; Young, Roy

2012-01-01

Mission concept is to assess the feasibility of using solar sail propulsion to enable a robotic precursor that would survey multiple Near Earth Objects (NEOs) for potential future human visits. Single spacecraft will rendezvous with and image 3 NEOs within 6 years of launch

Shared control on lunar spacecraft teleoperation rendezvous operations with large time delay

Science.gov (United States)

Ya-kun, Zhang; Hai-yang, Li; Rui-xue, Huang; Jiang-hui, Liu

2017-08-01

Teleoperation could be used in space on-orbit serving missions, such as object deorbits, spacecraft approaches, and automatic rendezvous and docking back-up systems. Teleoperation rendezvous and docking in lunar orbit may encounter bottlenecks for the inherent time delay in the communication link and the limited measurement accuracy of sensors. Moreover, human intervention is unsuitable in view of the partial communication coverage problem. To solve these problems, a shared control strategy for teleoperation rendezvous and docking is detailed. The control authority in lunar orbital maneuvers that involves two spacecraft as rendezvous and docking in the final phase was discussed in this paper. The predictive display model based on the relative dynamic equations is established to overcome the influence of the large time delay in communication link. We discuss and attempt to prove via consistent, ground-based simulations the relative merits of fully autonomous control mode (i.e., onboard computer-based), fully manual control (i.e., human-driven at the ground station) and shared control mode. The simulation experiments were conducted on the nine-degrees-of-freedom teleoperation rendezvous and docking simulation platform. Simulation results indicated that the shared control methods can overcome the influence of time delay effects. In addition, the docking success probability of shared control method was enhanced compared with automatic and manual modes.

Optimal Non-Coplanar Launch to Quick Rendezvous

National Research Council Canada - National Science Library

Sears, Gregory

1997-01-01

The purpose of this study was to determine the feasibility of launching a Delta Clipper-like vehicle on an optimal, non-coplanar trajectory to rendezvous with an earth orbiting object in one orbit or less...

Flocking and rendezvous in distributed robotics

CERN Document Server

Francis, Bruce A

2016-01-01

This brief describes the coordinated control of groups of robots using only sensory input – and no direct external commands. Furthermore, each robot employs the same local strategy, i.e., there are no leaders, and the text also deals with decentralized control, allowing for cases in which no single robot can sense all the others. One can get intuition for the problem from the natural world, for example, flocking birds. How do they achieve and maintain their flying formation? Recognizing their importance as the most basic coordination tasks for mobile robot networks, the brief details flocking and rendezvous. They are shown to be physical illustrations of emergent behaviors with global consensus arising from local interactions. The authors extend the consideration of these fundamental ideas to describe their operation in flying robots and prompt readers to pursue further research in the field.  Flocking and Rendezvous in Distributed Robotics will provide graduate students a firm grounding in the subject, w...

Rendezvous maneuvers using Genetic Algorithm

International Nuclear Information System (INIS)

Dos Santos, Denílson Paulo Souza; De Almeida Prado, Antônio F Bertachini; Teodoro, Anderson Rodrigo Barretto

2013-01-01

The present paper has the goal of studying orbital maneuvers of Rendezvous, that is an orbital transfer where a spacecraft has to change its orbit to meet with another spacecraft that is travelling in another orbit. This transfer will be accomplished by using a multi-impulsive control. A genetic algorithm is used to find the transfers that have minimum fuel consumption

Tangent Orbital Rendezvous Using Linear Relative Motion with J2 Perturbations

Directory of Open Access Journals (Sweden)

Gang Zhang

2013-01-01

Full Text Available The tangent-impulse coplanar orbit rendezvous problem is studied based on the linear relative motion for J2-perturbed elliptic orbits. There are three cases: (1 only the first impulse is tangent; (2 only the second impulse is tangent; (3 both impulses are tangent. For a given initial impulse point, the first two problems can be transformed into finding all roots of a single variable function about the transfer time, which can be done by the secant method. The bitangent rendezvous problem requires the same solution for the first two problems. By considering the initial coasting time, the bitangent rendezvous solution is obtained with a difference function. A numerical example for two coplanar elliptic orbits with J2 perturbations is given to verify the efficiency of these proposed techniques.

Endo-laparoscopic rendezvous approach for pericardia with gastric posterior wall of gastrointestinal stromal tumor: analysis of 52 consecutive cases.

Science.gov (United States)

Ding, Po; Zhao, Yongjie

2014-12-01

Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor in the gastrointestinal tract and most frequently developed in the stomach, and surgical therapy is limited on removal of the tumor lesion. The aim of this study was to investigate the clinical values of endo-laparoscopic rendezvous approach for pericardial GISTs within gastric posterior wall. Surgical outcome and clinical data of 52 patients with pericardial GISTs within gastric posterior wall treated at Tianjin Peoples' Hospital from January 2004 to October 2013 were analyzed. Endo-laparoscopic rendezvous approach was used as an operative procedure for tumor resection ranged from 10 to 50 mm. Endoscopic ultrasound, computed tomography and microscopic findings all certified the gastric spindle type GIST locating in the submucosa to muscle proper. Endo-laparoscopic rendezvous approach was attempted in 52 patients (male/female: 31/21) with median age of 51 years (25-71 years). The median operating time was 80 min (range: 40-120 min) and median intra-operative blood loss was 26 ml (range: 10-50 ml). The median hospital stay was 5 days (range: 4-6 days), while the median tumor size was 25 mm (range: 7-50 mm). All operative margins were clear. There were no recurrences or metastases of all patients in a median follow-up of 24 months (range: 6-36 months). Endo-laparoscopic rendezvous approach is considered to represent the next revolution in surgery. The new technique is reliable and effective in clinical application, due to the advantages of accurate and quick localization for pericardial GIST within gastric posterior wall.

Comet rendezvous mission design using Solar Electric Propulsion

Science.gov (United States)

Sackett, L. L.; Hastrup, R. C.; Yen, C.-W. L.; Wood, L. J.

1979-01-01

A dual comet (Halley Flyby/Tempel 2 Rendezvous) mission, which is planned to be the first to use the Solar Electric Propulsion System (SEPS), is to be launched in 1985. The purpose of this paper is to describe how the mission design attempts to maximize science return while working within spacecraft and other constraints. Science requirements and desires are outlined and specific instruments are considered. Emphasis is on the strategy for operations in the vicinity of Tempel 2, for which a representative profile is described. The mission is planned to extend about one year past initial rendezvous. Because of the large uncertainty in the comet environment the Tempel 2 operations strategy must be highly adaptive.

Evaluation of a novel, hybrid model (Mumbai EUS II) for stepwise teaching and training in EUS-guided biliary drainage and rendezvous procedures.

Science.gov (United States)

Dhir, Vinay; Itoi, Takao; Pausawasdi, Nonthalee; Khashab, Mouen A; Perez-Miranda, Manuel; Sun, Siyu; Park, Do Hyun; Iwashita, Takuji; Teoh, Anthony Y B; Maydeo, Amit P; Ho, Khek Yu

2017-11-01

 EUS-guided biliary drainage (EUS-BD) and rendezvous (EUS-RV) are acceptable rescue options for patients with failed endoscopic retrograde cholangiopancreatography (ERCP). However, there are limited training opportunities at most centers owing to low case volumes. The existing models do not replicate the difficulties encountered during EUS-BD. We aimed to develop and validate a model for stepwise learning of EUS-BD and EUS-RV, which replicates the actual EUS-BD procedures.  A hybrid model was created utilizing pig esophagus and stomach, with a synthetic duodenum and biliary system. The model was objectively assessed on a grade of 1 - 4 by two experts. Twenty-eight trainees were given initial training with didactic lectures and live procedures. This was followed by hands-on training in EUS-BD and EUS-RV on the hybrid model. Trainees were assessed for objective criteria of technical difficulties.  Both the experts graded the model as very good or above for all parameters. All trainees could complete the requisite steps of EUS-BD and EUS-RV in a mean time of 11 minutes (8 - 18 minutes). Thirty-six technical difficulties were noted during the training (wrong scope position, 13; incorrect duct puncture, 12; guidewire related problems, 11). Technical difficulties peaked for EUS-RV, followed by hepaticogastrostomy (HGS) and choledochoduodenostomy (CDS) (20, 9, and 7, P  = 0.001). At 10 days follow-up, nine of 28 trainees had successfully performed three EUS-RV and seven EUS-BD procedures independently.  The Mumbai EUS II hybrid model replicates situations encountered during EUS-RV and EUS-BD. Stepwise mentoring improves the chances of success in EUS-RV and EUS-BD procedures.

Evaluation of a novel, hybrid model (Mumbai EUS II) for stepwise teaching and training in EUS-guided biliary drainage and rendezvous procedures

Science.gov (United States)

Dhir, Vinay; Itoi, Takao; Pausawasdi, Nonthalee; Khashab, Mouen A.; Perez-Miranda, Manuel; Sun, Siyu; Park, Do Hyun; Iwashita, Takuji; Teoh, Anthony Y. B.; Maydeo, Amit P.; Ho, Khek Yu

2017-01-01

Background and aims  EUS-guided biliary drainage (EUS-BD) and rendezvous (EUS-RV) are acceptable rescue options for patients with failed endoscopic retrograde cholangiopancreatography (ERCP). However, there are limited training opportunities at most centers owing to low case volumes. The existing models do not replicate the difficulties encountered during EUS-BD. We aimed to develop and validate a model for stepwise learning of EUS-BD and EUS-RV, which replicates the actual EUS-BD procedures. Methods  A hybrid model was created utilizing pig esophagus and stomach, with a synthetic duodenum and biliary system. The model was objectively assessed on a grade of 1 – 4 by two experts. Twenty-eight trainees were given initial training with didactic lectures and live procedures. This was followed by hands-on training in EUS-BD and EUS-RV on the hybrid model. Trainees were assessed for objective criteria of technical difficulties. Results  Both the experts graded the model as very good or above for all parameters. All trainees could complete the requisite steps of EUS-BD and EUS-RV in a mean time of 11 minutes (8 – 18 minutes). Thirty-six technical difficulties were noted during the training (wrong scope position, 13; incorrect duct puncture, 12; guidewire related problems, 11). Technical difficulties peaked for EUS-RV, followed by hepaticogastrostomy (HGS) and choledochoduodenostomy (CDS) (20, 9, and 7, P  = 0.001). At 10 days follow-up, nine of 28 trainees had successfully performed three EUS-RV and seven EUS-BD procedures independently. Conclusions  The Mumbai EUS II hybrid model replicates situations encountered during EUS-RV and EUS-BD. Stepwise mentoring improves the chances of success in EUS-RV and EUS-BD procedures. PMID:29250585

Methodology for Developing a Probabilistic Risk Assessment Model of Spacecraft Rendezvous and Dockings

Science.gov (United States)

Farnham, Steven J., II; Garza, Joel, Jr.; Castillo, Theresa M.; Lutomski, Michael

2011-01-01

In 2007 NASA was preparing to send two new visiting vehicles carrying logistics and propellant to the International Space Station (ISS). These new vehicles were the European Space Agency s (ESA) Automated Transfer Vehicle (ATV), the Jules Verne, and the Japanese Aerospace and Explorations Agency s (JAXA) H-II Transfer Vehicle (HTV). The ISS Program wanted to quantify the increased risk to the ISS from these visiting vehicles. At the time, only the Shuttle, the Soyuz, and the Progress vehicles rendezvoused and docked to the ISS. The increased risk to the ISS was from an increase in vehicle traffic, thereby, increasing the potential catastrophic collision during the rendezvous and the docking or berthing of the spacecraft to the ISS. A universal method of evaluating the risk of rendezvous and docking or berthing was created by the ISS s Risk Team to accommodate the increasing number of rendezvous and docking or berthing operations due to the increasing number of different spacecraft, as well as the future arrival of commercial spacecraft. Before the first docking attempt of ESA's ATV and JAXA's HTV to the ISS, a probabilistic risk model was developed to quantitatively calculate the risk of collision of each spacecraft with the ISS. The 5 rendezvous and docking risk models (Soyuz, Progress, Shuttle, ATV, and HTV) have been used to build and refine the modeling methodology for rendezvous and docking of spacecrafts. This risk modeling methodology will be NASA s basis for evaluating the addition of future ISS visiting spacecrafts hazards, including SpaceX s Dragon, Orbital Science s Cygnus, and NASA s own Orion spacecraft. This paper will describe the methodology used for developing a visiting vehicle risk model.

Optimal starting conditions for the rendezvous maneuver: Analytical and computational approach

Science.gov (United States)

Ciarcia, Marco

The three-dimensional rendezvous between two spacecraft is considered: a target spacecraft on a circular orbit around the Earth and a chaser spacecraft initially on some elliptical orbit yet to be determined. The chaser spacecraft has variable mass, limited thrust, and its trajectory is governed by three controls, one determining the thrust magnitude and two determining the thrust direction. We seek the time history of the controls in such a way that the propellant mass required to execute the rendezvous maneuver is minimized. Two cases are considered: (i) time-to-rendezvous free and (ii) time-to-rendezvous given, respectively equivalent to (i) free angular travel and (ii) fixed angular travel for the target spacecraft. The above problem has been studied by several authors under the assumption that the initial separation coordinates and the initial separation velocities are given, hence known initial conditions for the chaser spacecraft. In this paper, it is assumed that both the initial separation coordinates and initial separation velocities are free except for the requirement that the initial chaser-to-target distance is given so as to prevent the occurrence of trivial solutions. Two approaches are employed: optimal control formulation (Part A) and mathematical programming formulation (Part B). In Part A, analyses are performed with the multiple-subarc sequential gradient-restoration algorithm for optimal control problems. They show that the fuel-optimal trajectory is zero-bang, namely it is characterized by two subarcs: a long coasting zero-thrust subarc followed by a short powered max-thrust braking subarc. While the thrust direction of the powered subarc is continuously variable for the optimal trajectory, its replacement with a constant (yet optimized) thrust direction produces a very efficient guidance trajectory. Indeed, for all values of the initial distance, the fuel required by the guidance trajectory is within less than one percent of the fuel required

Interesting rendezvous location in a liver transplantation patient with anastomosis stricture.

Science.gov (United States)

Odemis, Bulent; Oztas, Erkin; Yurdakul, Mehmet; Torun, Serkan; Suna, Nuredtin; Kayacetin, Ertugrul

2014-11-14

An endoscopic or radiologic percutaneous approach may be an initial minimally invasive method for treating biliary strictures after living donor liver transplantation; however, cannulation of biliary strictures is sometimes difficult due to the presence of a sharp or twisted angle within the stricture or a complete stricture. When an angulated or twisted biliary stricture interrupts passage of a guidewire over the stricture, it is difficult to replace the percutaneous biliary drainage catheter with inside stents by endoscopic retrograde cholangiopancreatography. The rendezvous technique can be used to overcome this difficulty. In addition to the classical rendezvous method, in cases with complete transection of the common bile duct a modified technique involving the insertion of a snare into the subhepatic space has been successfully performed. Herein, we report a modified rendezvous technique in the duodenal bulb as an extraordinary location for a patient with duct-to-duct anastomotic complete stricture after liver transplantation.

Trajectory Control of Rendezvous with Maneuver Target Spacecraft

Science.gov (United States)

Zhou, Zhinqiang

2012-01-01

In this paper, a nonlinear trajectory control algorithm of rendezvous with maneuvering target spacecraft is presented. The disturbance forces on the chaser and target spacecraft and the thrust forces on the chaser spacecraft are considered in the analysis. The control algorithm developed in this paper uses the relative distance and relative velocity between the target and chaser spacecraft as the inputs. A general formula of reference relative trajectory of the chaser spacecraft to the target spacecraft is developed and applied to four different proximity maneuvers, which are in-track circling, cross-track circling, in-track spiral rendezvous and cross-track spiral rendezvous. The closed-loop differential equations of the proximity relative motion with the control algorithm are derived. It is proven in the paper that the tracking errors between the commanded relative trajectory and the actual relative trajectory are bounded within a constant region determined by the control gains. The prediction of the tracking errors is obtained. Design examples are provided to show the implementation of the control algorithm. The simulation results show that the actual relative trajectory tracks the commanded relative trajectory tightly. The predicted tracking errors match those calculated in the simulation results. The control algorithm developed in this paper can also be applied to interception of maneuver target spacecraft and relative trajectory control of spacecraft formation flying.

The endoscopic ultrasonography-guided rendezvous technique for biliary cannulation: a technical review.

Science.gov (United States)

Isayama, Hiroyuki; Nakai, Yousuke; Kawakubo, Kazumichi; Kawakami, Hiroshi; Itoi, Takao; Yamamoto, Natsuyo; Kogure, Hirofumi; Koike, Kazuhiko

2013-04-01

Steady progress is being made in endoscopic biliary intervention, especially endoscopic ultrasonography (EUS)-guided procedures. The EUS-guided rendezvous technique (EUS-RV) is a salvage method for failed selective biliary cannulation. The overall success rate of EUS-RV in 247 cases from seven published articles was 74 % and the incidence of complications was 11 %. The main cause of failed rendezvous cannulation was difficulty passing a biliary stricture or papilla due to poor guidewire (GW) manipulation. A recent large study found a 98.3 % success rate and superiority to precutting. This report suggested using a hydrophilic guidewire. Major complications were bleeding (0.8 %), bile leakage (1.2 %), peritonitis (0.4 %), pneumoperitoneum (0.2 %), and pancreatitis (1.6 %). The approach routes for EUS-RV were transgastric, transduodenal short position, and transduodenal long position. The appropriate route for each patient should be used. GW selection for EUS-RV is critical, and a hydrophilic GW might be the most useful. The catheter can be inserted through the papilla alongside or over the wire. Alongside cannulation is convenient, but difficult. The problem with the over-the-wire technique is withdrawal of the GW in the accessory channel. EUS-RV is effective and safe, but is not established. The efficacy should be confirmed in a prospective comparative trial, and the necessary specialist equipment should be developed.

An automated rendezvous and capture system design concept for the cargo transfer vehicle and Space Station Freedom

Science.gov (United States)

Fuchs, Ron; Marsh, Steven

1991-01-01

A rendezvous sensor system concept was developed for the cargo transfer vehicle (CTV) to autonomously rendezvous with and be captured by Space Station Freedom (SSF). The development of requirements, the design of a unique Lockheed developed sensor concept to meet these requirements, and the system design to place this sensor on the CTV and rendezvous with the SSF are described .

Autonomous spacecraft rendezvous and docking

Science.gov (United States)

Tietz, J. C.; Almand, B. J.

A storyboard display is presented which summarizes work done recently in design and simulation of autonomous video rendezvous and docking systems for spacecraft. This display includes: photographs of the simulation hardware, plots of chase vehicle trajectories from simulations, pictures of the docking aid including image processing interpretations, and drawings of the control system strategy. Viewgraph-style sheets on the display bulletin board summarize the simulation objectives, benefits, special considerations, approach, and results.

Observer-Based Robust Control for Spacecraft Rendezvous with Thrust Saturation

Directory of Open Access Journals (Sweden)

Neng Wan

2014-01-01

Full Text Available This paper proposes an observer-based robust guaranteed cost control method for thrust-limited rendezvous in near-circular orbits. Treating the noncircularity of the target orbit as a parametric uncertainty, a linearized motion model derived from the two-body problem is adopted as the controlled plant. Based on this model, a robust guaranteed cost observer-controller is synthesized with a less conservative saturation control law, and sufficient condition for the existence of this observer-based rendezvous controller is derived. Finally, an illustrative example with immeasurable velocity states is presented to demonstrate the advantages and effectiveness of the control scheme.

Rendezvous and Docking Technology for Space Flight%空间交会对接技术

Institute of Scientific and Technical Information of China (English)

郑永煌

2011-01-01

空间交会对接是载人航天工程非常重要的基本技术.在介绍空间交会对接技术发展历史和中国首次交会对接取得圆满成功的基础上,阐述了空间交会对接技术的基本概念、技术难点、控制方式和交会对接过程,并着重介绍了四种交会对接机构的特点.最后介绍了中国首次交会对接任务规划、天宫一号目标飞行器和神舟八号飞船的特点以及两次空间交会对接过程.%Rendezvous and Docking is a very important basic technology of Manned Space Engineering. Firstly, rendezvous and docking technology development history is provided, and the significance of China first rendezvous and docking success is presented. Secondly, the basic conception, technology difficulty, control mode and docking process of rendezvous and docking technology are explained.Thirdly, four docking mechanism characteristics are special provided. Finally, China first rendezvous and docking mission planning,characteristic of Tiangong-1 target flight vehicle and Shenzhou-8 spacecraft and two rendezvous and docking successes are presented.

Guidance and Navigation for Rendezvous and Proximity Operations with a Non-Cooperative Spacecraft at Geosynchronous Orbit

Science.gov (United States)

Barbee, Brent William; Carpenter, J. Russell; Heatwole, Scott; Markley, F. Landis; Moreau, Michael; Naasz, Bo J.; VanEepoel, John

2010-01-01

The feasibility and benefits of various spacecraft servicing concepts are currently being assessed, and all require that the servicer spacecraft perform rendezvous, proximity, and capture operations with the target spacecraft to be serviced. Many high-value spacecraft, which would be logical targets for servicing from an economic point of view, are located in geosynchronous orbit, a regime in which autonomous rendezvous and capture operations are not commonplace. Furthermore, existing GEO spacecraft were not designed to be serviced. Most do not have cooperative relative navigation sensors or docking features, and some servicing applications, such as de-orbiting of a non-functional spacecraft, entail rendezvous and capture with a spacecraft that may be non-functional or un-controlled. Several of these challenges have been explored via the design of a notional mission in which a nonfunctional satellite in geosynchronous orbit is captured by a servicer spacecraft and boosted into super-synchronous orbit for safe disposal. A strategy for autonomous rendezvous, proximity operations, and capture is developed, and the Orbit Determination Toolbox (ODTBX) is used to perform a relative navigation simulation to assess the feasibility of performing the rendezvous using a combination of angles-only and range measurements. Additionally, a method for designing efficient orbital rendezvous sequences for multiple target spacecraft is utilized to examine the capabilities of a servicer spacecraft to service multiple targets during the course of a single mission.

Combined radiologic and endoscopic treatment (using the “rendezvous technique”) of a biliary fistula following left hepatectomy

Science.gov (United States)

Gracient, Aurélien; Rebibo, Lionel; Delcenserie, Richard; Yzet, Thierry; Regimbeau, Jean-Marc

2016-01-01

Despite the ongoing decrease in the frequency of complications after hepatectomy, biliary fistulas still occur and are associated with high morbidity and mortality rates. Here, we report on an unusual technique for managing biliary fistula following left hepatectomy in a patient in whom the right posterior segmental duct joined the left hepatic duct. The biliary fistula was treated with a combined radiologic and endoscopic procedure based on the “rendezvous technique”. The clinical outcome was good, and reoperation was not required. PMID:27570431

Robust Tracking Control for Rendezvous in Near-Circular Orbits

Directory of Open Access Journals (Sweden)

Neng Wan

2013-01-01

Full Text Available This paper investigates a robust guaranteed cost tracking control problem for thrust-limited spacecraft rendezvous in near-circular orbits. Relative motion model is established based on the two-body problem with noncircularity of the target orbit described as a parameter uncertainty. A guaranteed cost tracking controller with input saturation is designed via a linear matrix inequality (LMI method, and sufficient conditions for the existence of the robust tracking controller are derived, which is more concise and less conservative compared with the previous works. Numerical examples are provided for both time-invariant and time-variant reference signals to illustrate the effectiveness of the proposed control scheme when applied to the terminal rendezvous and other astronautic missions with scheduled states signal.

Robust H∞ Control for Spacecraft Rendezvous with a Noncooperative Target

Directory of Open Access Journals (Sweden)

Shu-Nan Wu

2013-01-01

Full Text Available The robust H∞ control for spacecraft rendezvous with a noncooperative target is addressed in this paper. The relative motion of chaser and noncooperative target is firstly modeled as the uncertain system, which contains uncertain orbit parameter and mass. Then the H∞ performance and finite time performance are proposed, and a robust H∞ controller is developed to drive the chaser to rendezvous with the non-cooperative target in the presence of control input saturation, measurement error, and thrust error. The linear matrix inequality technology is used to derive the sufficient condition of the proposed controller. An illustrative example is finally provided to demonstrate the effectiveness of the controller.

The Effect of Air Drag in Optimal Power-Limited Rendezvous Between Coplanar Low-Earth Orbits

Directory of Open Access Journals (Sweden)

Gil-Young Maeng

1998-06-01

Full Text Available The effect of air drag was researched when a low-earth orbit spacecraft using power-limited thruster rendezvoused another low-earth orbit spacecraft. The air density was assumed to decrease exponentially. The radius of parking orbit was 6655.935 km and that of target orbit was 7321.529 km. From the trajectories of active vehicles, the fuel consumption and the magnitude of thrust acceleration, we could conclude that the effect of air drag had to be considered in fuel optimal rendezvous problem between low-earth orbit spacecrafts. In multiple-revolution rendezvous case, the air drag was more effective.

Thermomechanical CSM analysis of a superheater tube in transient state

Science.gov (United States)

Taler, Dawid; Madejski, Paweł

2011-12-01

The paper presents a thermomechanical computational solid mechanics analysis (CSM) of a pipe "double omega", used in the steam superheaters in circulating fluidized bed (CFB) boilers. The complex cross-section shape of the "double omega" tubes requires more precise analysis in order to prevent from failure as a result of the excessive temperature and thermal stresses. The results have been obtained using the finite volume method for transient state of superheater. The calculation was carried out for the section of pipe made of low-alloy steel.

Csm4, in collaboration with Ndj1, mediates telomere-led chromosome dynamics and recombination during yeast meiosis.

Directory of Open Access Journals (Sweden)

Jennifer J Wanat

2008-09-01

Full Text Available Chromosome movements are a general feature of mid-prophase of meiosis. In budding yeast, meiotic chromosomes exhibit dynamic movements, led by nuclear envelope (NE-associated telomeres, throughout the zygotene and pachytene stages. Zygotene motion underlies the global tendency for colocalization of NE-associated chromosome ends in a "bouquet." In this study, we identify Csm4 as a new molecular participant in these processes and show that, unlike the two previously identified components, Ndj1 and Mps3, Csm4 is not required for meiosis-specific telomere/NE association. Instead, it acts to couple telomere/NE ensembles to a force generation mechanism. Mutants lacking Csm4 and/or Ndj1 display the following closely related phenotypes: (i elevated crossover (CO frequencies and decreased CO interference without abrogation of normal pathways; (ii delayed progression of recombination, and recombination-coupled chromosome morphogenesis, with resulting delays in the MI division; and (iii nondisjunction of homologs at the MI division for some reason other than absence of (the obligatory CO(s. The recombination effects are discussed in the context of a model where the underlying defect is chromosome movement, the absence of which results in persistence of inappropriate chromosome relationships that, in turn, results in the observed mutant phenotypes.

Automated rendezvous and capture development infrastructure

Science.gov (United States)

Bryan, Thomas C.; Roe, Fred; Coker, Cynthia

1992-01-01

The facilities at Marshall Space Flight Center and JSC to be utilized to develop and test an autonomous rendezvous and capture (ARC) system are described. This includes equipment and personnel facility capabilities to devise, develop, qualify, and integrate ARC elements and subsystems into flight programs. Attention is given to the use of a LEO test facility, the current concept and unique system elements of the ARC, and the options available to develop ARC technology.

Spontaneous Rupture of Superficial Femoral Artery Repaired with Endovascular Stent-Grafting with use of Rendez-Vous Technique, Followed by Delayed Infection

International Nuclear Information System (INIS)

Fanelli, Fabrizio; Cannavale, Alessandro; Gazzetti, Marianna; Fantozzi, Cristiano; Taurino, Maurizio; Speziale, Francesco

2013-01-01

This is the case of a 72-year-old man with lower limb ischemia due to spontaneous rupture of nonaneurysmal superficial femoral artery that developed into thigh hematoma. After failure of a Fogarty revascularization, an emergency endovascular procedure was performed to restore the arterial continuity. A rendezvous procedure was performed with a double femoral and popliteal approach and two covered stent-grafts were deployed. Patient’s clinical conditions immediately improved, but 4 months later the stent-grafts were surgically removed for infection and exteriorization. A femoropopliteal bypass was performed. After 1 year follow-up, the patient is in good clinical condition.

Spontaneous Rupture of Superficial Femoral Artery Repaired with Endovascular Stent-Grafting with use of Rendez-Vous Technique, Followed by Delayed Infection

Energy Technology Data Exchange (ETDEWEB)

Fanelli, Fabrizio, E-mail: fabrizio.fanelli@uniroma1.it; Cannavale, Alessandro [University of Rome ' Sapienza,' , Department of Radiological Sciences, Vascular and Interventional Radiology Unit (Italy); Gazzetti, Marianna [Sapienza University of Rome ' Sapienza,' , Department of Surgery Paride Stefanini, Vascular Surgery Division, Policlinico Umberto I (Italy); Fantozzi, Cristiano; Taurino, Maurizio [University of Rome ' Sapienza,' , Department of Vascular Surgery (Italy); Speziale, Francesco [Sapienza University of Rome ' Sapienza,' , Department of Surgery Paride Stefanini, Vascular Surgery Division, Policlinico Umberto I (Italy)

2013-02-15

This is the case of a 72-year-old man with lower limb ischemia due to spontaneous rupture of nonaneurysmal superficial femoral artery that developed into thigh hematoma. After failure of a Fogarty revascularization, an emergency endovascular procedure was performed to restore the arterial continuity. A rendezvous procedure was performed with a double femoral and popliteal approach and two covered stent-grafts were deployed. Patient's clinical conditions immediately improved, but 4 months later the stent-grafts were surgically removed for infection and exteriorization. A femoropopliteal bypass was performed. After 1 year follow-up, the patient is in good clinical condition.

Optimal Rendezvous and Docking Simulator for Elliptical Orbits, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — It is proposed to develop and implement a simulation of spacecraft rendezvous and docking guidance, navigation, and control in elliptical orbit. The foundation of...

A Comparison Between Orion Automated and Space Shuttle Rendezvous Techniques

Science.gov (United States)

Ruiz, Jose O,; Hart, Jeremy

2010-01-01

The Orion spacecraft will replace the space shuttle and will be the first human spacecraft since the Apollo program to leave low earth orbit. This vehicle will serve as the cornerstone of a complete space transportation system with a myriad of mission requirements necessitating rendezvous to multiple vehicles in earth orbit, around the moon and eventually beyond . These goals will require a complex and robust vehicle that is, significantly different from both the space shuttle and the command module of the Apollo program. Historically, orbit operations have been accomplished with heavy reliance on ground support and manual crew reconfiguration and monitoring. One major difference with Orion is that automation will be incorporated as a key element of the man-vehicle system. The automated system will consist of software devoted to transitioning between events based on a master timeline. This effectively adds a layer of high level sequencing that moves control of the vehicle from one phase to the next. This type of automated control is not entirely new to spacecraft since the shuttle uses a version of this during ascent and entry operations. During shuttle orbit operations however many of the software modes and hardware switches must be manually configured through the use of printed procedures and instructions voiced from the ground. The goal of the automation scheme on Orion is to extend high level automation to all flight phases. The move towards automation represents a large shift from current space shuttle operations, and so these new systems will be adopted gradually via various safeguards. These include features such as authority-to-proceed, manual down modes, and functional inhibits. This paper describes the contrast between the manual and ground approach of the space shuttle and the proposed automation of the Orion vehicle. I will introduce typical orbit operations that are common to all rendezvous missions and go on to describe the current Orion automation

Robust H(∞) control for spacecraft rendezvous with a noncooperative target.

Science.gov (United States)

Wu, Shu-Nan; Zhou, Wen-Ya; Tan, Shu-Jun; Wu, Guo-Qiang

2013-01-01

The robust H(∞) control for spacecraft rendezvous with a noncooperative target is addressed in this paper. The relative motion of chaser and noncooperative target is firstly modeled as the uncertain system, which contains uncertain orbit parameter and mass. Then the H(∞) performance and finite time performance are proposed, and a robust H(∞) controller is developed to drive the chaser to rendezvous with the non-cooperative target in the presence of control input saturation, measurement error, and thrust error. The linear matrix inequality technology is used to derive the sufficient condition of the proposed controller. An illustrative example is finally provided to demonstrate the effectiveness of the controller.

AggieSat: Autonomous Rendezvous and Docking Technology Demonstrator, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Current autonomous rendezvous and docking (AR&D) capability in low Earth orbit (LEO) is constrained by sensor and effector mass, power, and accuracy limits. To...

Optimization of Spacecraft Rendezvous and Docking using Interval Analysis

NARCIS (Netherlands)

Van Kampen, E.; Chu, Q.P.; Mulder, J.A.

2010-01-01

This paper applies interval optimization to the fixed-time multiple impulse rendezvous and docking problem. Current methods for solving this type of optimization problem include for example genetic algorithms and gradient based optimization. Unlike these methods, interval methods can guarantee that

Limitations of BCC_CSM's ability to predict summer precipitation over East Asia and the Northwestern Pacific

KAUST Repository

Gong, Zhiqiang; Dogar, Muhammad Mubashar; Qiao, Shaobo; Hu, Po; Feng, Guolin

2017-01-01

This study examines the ability of the Beijing Climate Center Climate System Model (BCC_CSM) to predict the meridional pattern of summer precipitation over East Asia-Northwest Pacific (EA-NWP) and its East Asia-Pacific (EAP) teleconnection

Rendezvous and Docking Strategy for Crewed Segment of the Asteroid Redirect Mission

Science.gov (United States)

Hinkel, Heather D.; Cryan, Scott P.; D'Souza, Christopher; Dannemiller, David P.; Brazzel, Jack P.; Condon, Gerald L.; Othon, William L.; Williams, Jacob

2014-01-01

This paper will describe the overall rendezvous, proximity operations and docking (RPOD) strategy in support of the Asteroid Redirect Crewed Mission (ARCM), as part of the Asteroid Redirect Mission (ARM). The focus of the paper is on the crewed mission phase of ARM, starting with the establishment of Orion in the Distant Retrograde Orbit (DRO) and ending with docking to the Asteroid Redirect Vechicle (ARV). The paper will detail the sequence of maneuvers required to execute the rendezvous and proximity operations mission phases along with the on-board navigation strategies, including the final approach phase. The trajectories to be considered will include target vehicles in a DRO. The paper will also discuss the sensor requirements for rendezvous and docking and the various trade studies associated with the final sensor selection. Building on the sensor requirements and trade studies, the paper will include a candidate sensor concept of operations, which will drive the selection of the sensor suite; concurrently, it will be driven by higher level requirements on the system, such as crew timeline constraints and vehicle consummables. This paper will address how many of the seemingly competing requirements will have to be addressed to create a complete system and system design. The objective is to determine a sensor suite and trajectories that enable Orion to successfully rendezvous and dock with a target vehicle in trans lunar space. Finally, the paper will report on the status of a NASA action to look for synergy within RPOD, across the crewed and robotic asteroid missions.

Quorum system and random based asynchronous rendezvous protocol for cognitive radio ad hoc networks

Directory of Open Access Journals (Sweden)

Sylwia Romaszko

2013-12-01

Full Text Available This paper proposes a rendezvous protocol for cognitive radio ad hoc networks, RAC2E-gQS, which utilizes (1 the asynchronous and randomness properties of the RAC2E protocol, and (2 channel mapping protocol, based on a grid Quorum System (gQS, and taking into account channel heterogeneity and asymmetric channel views. We show that the combination of the RAC2E protocol with the grid-quorum based channel mapping can yield a powerful RAC2E-gQS rendezvous protocol for asynchronous operation in a distributed environment assuring a rapid rendezvous between the cognitive radio nodes having available both symmetric and asymmetric channel views. We also propose an enhancement of the protocol, which uses a torus QS for a slot allocation, dealing with the worst case scenario, a large number of channels with opposite ranking lists.

EUS-guided biliary drainage by using a standardized approach for malignant biliary obstruction: rendezvous versus direct transluminal techniques (with videos).

Science.gov (United States)

Khashab, Mouen A; Valeshabad, Ali Kord; Modayil, Rani; Widmer, Jessica; Saxena, Payal; Idrees, Mehak; Iqbal, Shahzad; Kalloo, Anthony N; Stavropoulos, Stavros N

2013-11-01

EUS-guided biliary drainage (EGBD) can be performed via direct transluminal or rendezvous techniques. It is unknown how both techniques compare in terms of efficacy and adverse events. To describe outcomes of EGBD performed by using a standardized approach and compare outcomes of rendezvous and transluminal techniques. Retrospective analysis of prospectively collected data. Two tertiary-care centers. Consecutive jaundiced patients with distal malignant biliary obstruction who underwent EGBD after failed ERCP between July 2006 and December 2012 were included. EGBD by using a standardized algorithm. Technical success, clinical success, and adverse events. During the study period, 35 patients underwent EGBD (rendezvous n = 13, transluminal n = 20). Technical success was achieved in 33 patients (94%), and clinical success was attained in 32 of 33 patients (97.0%). The mean postprocedure bilirubin level was 1.38 mg/dL in the rendezvous group and 1.33 mg/dL in the transluminal group (P = .88). Similarly, length of hospital stay was not different between groups (P = .23). There was no significant difference in adverse event rate between rendezvous and transluminal groups (15.4% vs 10%; P = .64). Long-term outcomes were comparable between groups, with 1 stent migration in the rendezvous group at 62 days and 1 stent occlusion in the transluminal group at 42 days after EGBD. Retrospective analysis, small number of patients, and selection bias. EGBD is safe and effective when the described standardized approach is used. Stent occlusion is not common during long-term follow-up. Both rendezvous and direct transluminal techniques seem to be equally effective and safe. The latter approach is a reasonable alternative to rendezvous EGBD. Copyright © 2013. Published by Mosby, Inc.

Analysis for orbital rendezvous of Chang'E-5 using SBI technique

Science.gov (United States)

Huang, Y.; Shan, Q.; Li, P.

2016-12-01

Chang'E-5 will be launched in later 2017/early 2018 using a new generation rocket from Wenchang satellite launch center, Hainan, China. It is a lunar sampling return mission, and it is the first time for China to carry out orbital rendezvous and docking in the Moon. How to achieve orbital rendezvous successfully in the Moon is very important in Chang'E-5 mission. Orbital rendezvous will be implemented between an orbiter and an ascender 200 km above the Moon. The ground tracking techniques include range, Doppler and VLBI, and they will be used to track the orbiter and the ascender when the ascender is about 70 km farther away from the orbiter. Later the ascender will approach the orbiter automatically. As a successful example, in Chang'E-3, the differential phase delay (delta delay) data between the rover and the lander are obtained with a random error of about 1 ps, and the relative position of the rover is determined with an accuracy of several meters by using same beam VLBI (SBI) technique. Here the application of the SBI technique for Chang'E-5 orbital rendezvous is discussed. SBI technique can be used to track the orbiter and the ascender simultaneously when they are in the same beam. Delta delay of the two probes can be derived, and the measurement accuracy is much higher than that of the traditional VLBI data because of the cancelation of common errors. Theoretically it can result in a more accurate relative orbit between the two probes. In the simulation, different strategies are discussed to analyze the contribution of SBI data to the orbit accuracy improvement especially relative orbit between the orbiter and ascender. The simulation results show that the relative position accuracy of the orbiter and ascender can reach about 1 m with delta delay data of 10 ps.

Efficacy of the Laparoendoscopic "Rendezvous" to Treat Cholecystocholedocholithiasis in 210 Consecutive Patients: A Single Center Experience.

Science.gov (United States)

La Greca, Gaetano; Pesce, Antonio; Vitale, Marco; Mannino, Maurizio; Di Marco, Federica; Di Blasi, Michele; Lombardo, Rosario; Puleo, Stefano; Russello, Domenico; Latteri, Saverio

2017-08-01

The simultaneous laparoendoscopic "rendezvous" (LERV) represents an alternative to sequential or totally laparoscopic approaches for patients affected by cholecystocholedocholithiasis. The aim of this study was to analyze the results in a large series of 210 consecutive patients. From 2002 to 2016 all patients affected by cholecystocholedocholithiasis were treated with a standardized "tailored" LERV. The relevant technical features of the procedure were recorded. An analysis of feasibility, effectiveness in stone clearance, and safety was performed. Among 214 patients with common bile duct stones, 210 were treated with LERV and 4 with open rendezvous approach. Intraoperative cholangiography confirmed common bile duct stones in 179 patients (85.2%) or sludge in 18 (8.5%) and in 98.9% stone clearance was obtained endoscopically. Endoscopic papilla cannulation was feasible in 161 patients (76.7%), whereas in 49 (23.3%) a transcystic guidewire was needed. The overall LERV feasibility was 96.6%. The conversion rate to open surgery was 3.3%. Minor morbidity was observed in 1.9% of cases, mortality in 0.47%, and the mean hospital stay was 4.3 days. These results confirm the high effectiveness of LERV. This approach to treat cholecystocholedocholithiasis should be preferred and therefore implemented where a strong collaboration between surgeons and endoscopists is possible.

Robust H ∞ Control for Spacecraft Rendezvous with a Noncooperative Target

Science.gov (United States)

Wu, Shu-Nan; Zhou, Wen-Ya; Tan, Shu-Jun; Wu, Guo-Qiang

2013-01-01

The robust H ∞ control for spacecraft rendezvous with a noncooperative target is addressed in this paper. The relative motion of chaser and noncooperative target is firstly modeled as the uncertain system, which contains uncertain orbit parameter and mass. Then the H ∞ performance and finite time performance are proposed, and a robust H ∞ controller is developed to drive the chaser to rendezvous with the non-cooperative target in the presence of control input saturation, measurement error, and thrust error. The linear matrix inequality technology is used to derive the sufficient condition of the proposed controller. An illustrative example is finally provided to demonstrate the effectiveness of the controller. PMID:24027446

Orbit Determination for a Microsatellite Rendezvous with a Non-Cooperative Target

National Research Council Canada - National Science Library

Foster, Brian

2003-01-01

This study investigated the minimum requirements to establish a satellite tracking system architecture for a hostile "parasitic microsatellite" to rendezvous with a larger, non-cooperative target satellite...

Cooperative Rendezvous and Docking for Underwater Robots Using Model Predictive Control and Dual Decomposition

DEFF Research Database (Denmark)

Nielsen, Mikkel Cornelius; Johansen, Tor Arne; Blanke, Mogens

2018-01-01

This paper considers the problem of rendezvous and docking with visual constraints in the context of underwater robots with camera-based navigation. The objective is the convergence of the vehicles to a common point while maintaining visual contact. The proposed solution includes the design of a ...... of a distributed model predictive controller based on dual decomposition, which allows for optimization in a decentralized fashion. The proposed distributed controller enables rendezvous and docking between vehicles while maintaining visual contact....

Ternary and hybrid controllers for the rendezvous of unicycles

NARCIS (Netherlands)

Jafarian, Matin

2015-01-01

This paper presents the rendezvous (consensus) of the orientations and average positions of a group of unicycles. We assume that the decentralized controllers designed for consensus of the average positions take only values in the set {-1; 0; +1}. In addition, we introduce a hybrid controller to

Nigerian CSM project ready to roll.

Science.gov (United States)

1985-01-01

Nigeria's contraceptive social marketing (CSM) project is ready to be launched. Population Services Intenational (PSI) had completed the groundwork for the project, funded primarily by a $200,000 grant from the nonpofit D.K. Tyagi Fund. The Population Crisis Committee also provided support for the new project. At presstime, PSI was negotiating for continued project funding from the US Agency for International Development (USAID) and The Futures Group. PSI already has identified suitable products, researched brand names, arranged for distribution, appointed an advertising agency, designed packaging, written a marketing plan, and taken steps to create a local, nonprofit marketing organization to manage the project. PSI has named Tim Barton as the resident manager. He will take up his post once the issue of future funding is resolved. Contraceptives now available are distributed through the private sector and by the Planned Parenthood Federation of Nigeria, the Local International Planned Parenthood Federation affiliate. Nigeria's annual rate of population growth is about 3% and the country is urbanizing rapidly. A 1983 fertility report revealed that only 14% of Nigerian women had ever used any type of contraception; 6% of married women were using a contraceptive method at the time of the survey.

Egypt site of first CSM marketing audit.

Science.gov (United States)

1982-01-01

The 1st application of the marketing audit concept to a CSM project was implemented in Egypt's Family of the Future (FOF) contraceptive social marketing program in 1982. The audit defined the basic mission of the FOF as one of assisting the government in achieving its long range family planning goals. The stated FOF objectives are as follows: to create an awareness or an increase in demand for family planning services, particularly among the lower socioeconomic strata in urban Egypt; to establish and maintain a reliable supply mechanism to make FOF products more readily acceptable and available from pharmacies; and to consolidate the CSM operations and services first in the greater Cairo area and then expand to other urban areas in Egypt. The core strategy of the FOF incorporates several elements, including intensive media based advertising and personal promotion to promote the concept of family planning and to educate the general public about contraceptive alternatives. FOF product prices are considerably lower than commercial prices. Dr. Alan R. Andreasen, who conducted the audit on behalf of the FOF technical assistance contractor, noted that the FOF is growing rapidly and stated that the audit recommendations were intended to help FOF management. Dr. Andreasen conducted interviews with all the senior personnel at FOF and met with various specialized staff members such as the Public Relations Manager. Dr. Andreasen noted that at the time of the audit the FOF could claim major accomplishments in creating an awareness of the need for family planning and in product sales. From the time products were launched in 1979 through 1981 condom sales increased 260%. Foaming tablet sales increased more than 320% and IUD sales increased nearly 330%. The introduction of the Copper 7 IUD accounted for 35% of the growth of IUD sales in 1981. Couple years of protection (CYP) provided by all products increased from 45,533 in 1979 to 190,831 in 1981, an increase over 300%. The

Endoscopic ultrasound rendezvous for bile duct access using a transduodenal approach: cumulative experience at a single center. A case series.

Science.gov (United States)

Kim, Y S; Gupta, K; Mallery, S; Li, R; Kinney, T; Freeman, M L

2010-06-01

Endoscopic ultrasound (EUS)-assisted biliary access is utilized when conventional endoscopic retrograde cholangiopancreatography (ERCP) fails. We report a 10-year experience utilizing a transduodenal EUS rendezvous via a transpapillary route without dilation of the transduodenal tract, followed by immediate ERCP access. Patients included all EUS-guided rendezvous procedures for biliary access that were performed following ERCP failure. EUS-assisted bile duct puncture was performed via a transduodenal approach and a guide wire was advanced through the papilla without any dilation or bougienage of the tract; ERCP was performed immediately afterwards. EUS-assisted biliary rendezvous was attempted in 15 patients (mean age 66 +/- 18.2 years; malignant = 10, benign = 5). Mean diameter of measured bile ducts was 14.3 +/- 5.17 mm (range 4-23 mm). The reasons for initial ERCP failure were tumor infiltration or edema (n = 9), intradiverticular papilla (n = 2), pre-existing duodenal stent (n = 1), and anatomic anomalies (n = 3). Successful EUS-guided bile duct puncture and wire passage were achieved in all 15 patients (100 %), with drainage being successful in 12 / 15 (80 %). Failures occurred in three patients due to inability to traverse the biliary stricture (n = 2) or dissection of a choledochocele with the guide wire (n = 1); all were subsequently drained via percutaneous methods. Stents placed were metallic in eight patients and plastic in four. Complications consisted of moderate pancreatitis after a difficult ERCP attempt in one patient, and bacteremia after percutaneous biliary drainage in another. There were no instances of perforation, extraluminal air or fluid collections. EUS-assisted biliary drainage utilizing a transduodenal rendezvous approach demonstated a high success rate without any complications directly attributable to the EUS access. Advantages over percutaneous biliary and other methods of EUS biliary access include performance under the same

Pneumoperitoneum Caused by Air Leakage Through the Percutaneous Puncture Tract as a Complication of Rendezvous Technique: A Case Report

Directory of Open Access Journals (Sweden)

Chiao-Hsiung Chuang

2008-11-01

Full Text Available The rendezvous technique, combining percutaneous and endoscopic procedures, is a safe and effective method to achieve biliary cannulation if an endoscopic approach fails. The two procedures in this technique can be carried out simultaneously or in stages. A simultaneous approach is reported to be associated with fewer complications, and patients undergoing this approach can recover and be discharged more rapidly. Here, we report a complication of pneumoperitoneum in a patient who underwent percutaneous and endoscopic procedures simultaneously for the removal of a common bile duct stone. It was supposed that prolonged air insufflation during endoscopy forced intestinal air to track into the peritoneal cavity through the bile ducts and the puncture tract. Accordingly, a short wait before removing the percutaneous catheter to deflate the intestinal air will be helpful to avoid such a complication.

Trajectory design for a rendezvous mission to Earth's Trojan asteroid 2010 TK7

Science.gov (United States)

Lei, Hanlun; Xu, Bo; Zhang, Lei

2017-12-01

In this paper a rendezvous mission to the Earth's Trojan asteroid 2010 TK7 is proposed, and preliminary transfer trajectories are designed. Due to the high inclination (∼ 20.9°) of the target asteroid relative to the ecliptic plane, direct transfers usually require large amounts of fuel consumption, which is beyond the capacity of current technology. As gravity assist technique could effectively change the inclination of spacecraft's trajectory, it is adopted to reduce the launch energy and rendezvous velocity maneuver. In practical computation, impulsive and low-thrust, gravity-assisted trajectories are considered. Among all the trajectories computed, the low-thrust gravity-assisted trajectory with Venus-Earth-Venus (V-E-V) swingby sequence performs the best in terms of propellant mass. For a spacecraft with initial mass of 800 kg , propellant mass of the best trajectory is 36.74 kg . Numerical results indicate that both the impulsive and low-thrust, gravity-assisted trajectories corresponding to V-E-V sequence could satisfy mission constraints, and can be applied to practical rendezvous mission.

The comet rendezvous asteroid flyby mission

International Nuclear Information System (INIS)

Morrison, D.; Neugebauer, M.; Weissman, P.R.

1989-01-01

The Comet Rendezvous Asteroid Flyby (CRAF) mission is designed to answer the many questions raised by the Halley missions by exploring a cometary nucleus in detail, following it around its orbit and studying its changing activity as it moves closer to and then away from the Sun. In addition, on its way to rendezvous with the comet, CRAF will fly by a large, primitive class main belt asteroid and will return valuable data for comparison with the comet results. The selected asteroid is 449 Hamburga with a diameter of 88 km and a surface composition of carbonaceous chondrite meteorites. The expected flyby date is January, 1998. The CRAF spacecraft will continue to make measurements in orbit around the cometary nucleus as they both move closer to the Sun, until the dust and gas hazard becomes unsafe. At that point the spacecraft will move in and out between 50 and 2,500 kilometers to study the inner coma and the cometary ionosphere, and to collect dust and gas samples for onboard analysis. Following perihelion, the spacecraft will make a 50,000 km excursion down the comet's tail, further investigating the solar wind interaction with the cometary atmosphere. The spacecraft will return to the vicinity of the nucleus about four months after perihelion to observe the changes that have taken place. If the spacecraft remains healthy and adequate fuel is still onboard, an extended mission to follow the comet nucleus out to aphelion is anticipated

Single Balloon Enteroscopy-Assisted ERCP Using Rendezvous Technique for Sharp Angulation of Roux-en-Y Limb in a Patient with Bile Duct Stones

Science.gov (United States)

Itoi, Takao; Ishii, Kentaro; Sofuni, Atsushi; Itokawa, Fumihide; Kurihara, Toshio; Tsuchiya, Takayoshi; Tsuji, Shujiro; Umeda, Junko; Moriyasu, Fuminori

2009-01-01

The acute angulation of Roux-en-Y (R-Y) limb precludes endoscopic access for endoscopic retrograde cholangiopancreatography (ERCP) even using a balloon enteroscopy. Here, we describe a case of successful single balloon enteroscopy (SBE)-assisted ERCP using a rendezvous technique in a patient with sharply angulated R-Y limb in a 79-year-old woman who had bile duct stones. Method. At first, a guidewire was passed antegradely through the major papilla after the needle puncture using percutaneous transhepatic biliary drainage technique. A hydrophilic guidewire with an ERCP catheter was antegradely advanced beyond the Roux limb. After a guidewire was firmly grasped by a snare forceps, it was pulled out of the body, resulting that the enteroscope could advance to the papilla. After papillary dilation, complete removal of bile duct stones was achieved without any procedure-related complication. In conclusion, although further study is needed, SBE-assisted ERCP using a rendezvous technique may have a potential for selected patients. PMID:20169091

Single Balloon Enteroscopy-Assisted ERCP Using Rendezvous Technique for Sharp Angulation of Roux-en-Y Limb in a Patient with Bile Duct Stones

Directory of Open Access Journals (Sweden)

Takao Itoi

2009-01-01

Full Text Available The acute angulation of Roux-en-Y (R-Y limb precludes endoscopic access for endoscopic retrograde cholangiopancreatography (ERCP even using a balloon enteroscopy. Here, we describe a case of successful single balloon enteroscopy (SBE-assisted ERCP using a rendezvous technique in a patient with sharply angulated R-Y limb in a 79-year-old woman who had bile duct stones. Method. At first, a guidewire was passed antegradely through the major papilla after the needle puncture using percutaneous transhepatic biliary drainage technique. A hydrophilic guidewire with an ERCP catheter was antegradely advanced beyond the Roux limb. After a guidewire was firmly grasped by a snare forceps, it was pulled out of the body, resulting that the enteroscope could advance to the papilla. After papillary dilation, complete removal of bile duct stones was achieved without any procedure-related complication. In conclusion, although further study is needed, SBE-assisted ERCP using a rendezvous technique may have a potential for selected patients.

Optimal planning approaches with multiple impulses for rendezvous based on hybrid genetic algorithm and control method

Directory of Open Access Journals (Sweden)

JingRui Zhang

2015-03-01

Full Text Available In this article, we focus on safe and effective completion of a rendezvous and docking task by looking at planning approaches and control with fuel-optimal rendezvous for a target spacecraft running on a near-circular reference orbit. A variety of existent practical path constraints are considered, including the constraints of field of view, impulses, and passive safety. A rendezvous approach is calculated by using a hybrid genetic algorithm with those constraints. Furthermore, a control method of trajectory tracking is adopted to overcome the external disturbances. Based on Clohessy–Wiltshire equations, we first construct the mathematical model of optimal planning approaches of multiple impulses with path constraints. Second, we introduce the principle of hybrid genetic algorithm with both stronger global searching ability and local searching ability. We additionally explain the application of this algorithm in the problem of trajectory planning. Then, we give three-impulse simulation examples to acquire an optimal rendezvous trajectory with the path constraints presented in this article. The effectiveness and applicability of the tracking control method are verified with the optimal trajectory above as control objective through the numerical simulation.

"Rendezvous technique" for intraluminal vacuum therapy of anastomotic leakage of the jejunum.

Science.gov (United States)

Krajinovic, K; Reimer, S; Kudlich, T; Germer, C T; Wiegering, A

2016-12-01

Anastomotic leakage (AL) is one of the most common and serious complications following visceral surgery. In recent years, endoluminal vacuum therapy has dramatically changed therapeutic options for AL, but its use has been limited to areas easily accessible by endoscope. We describe the first use of endoluminal vacuum therapy in the small intestine employing a combined surgical and endoscopic "rendezvous technique" in which the surgeon assists the endoscopic placement of an endoluminal vacuum therapy sponge in the jejunum by means of a pullback string. This technique led to a completely closed AL after 27 days and 7 changes of the endosponge. The combined surgical and endoscopic rendezvous technique can be useful in cases of otherwise difficult endosponge placement.

Orion Handling Qualities During ISS Rendezvous and Docking

Science.gov (United States)

Hart, Jeremy J.; Stephens, J. P.; Spehar, P.; Bilimoria, K.; Foster, C.; Gonzalex, R.; Sullivan, K.; Jackson, B.; Brazzel, J.; Hart, J.

2011-01-01

The Orion spacecraft was designed to rendezvous with multiple vehicles in low earth orbit (LEO) and beyond. To perform the required rendezvous and docking task, Orion must provide enough control authority to perform coarse translational maneuvers while maintaining precision to perform the delicate docking corrections. While Orion has autonomous docking capabilities, it is expected that final approach and docking operations with the International Space Station (ISS) will initially be performed in a manual mode. A series of evaluations was conducted by NASA and Lockheed Martin at the Johnson Space Center to determine the handling qualities (HQ) of the Orion spacecraft during different docking and rendezvous conditions using the Cooper-Harper scale. This paper will address the specifics of the handling qualities methodology, vehicle configuration, scenarios flown, data collection tools, and subject ratings and comments. The initial Orion HQ assessment examined Orion docking to the ISS. This scenario demonstrates the Translational Hand Controller (THC) handling qualities of Orion. During this initial assessment, two different scenarios were evaluated. The first was a nominal docking approach to a stable ISS, with Orion initializing with relative position dispersions and a closing rate of approximately 0.1 ft/sec. The second docking scenario was identical to the first, except the attitude motion of the ISS was modeled to simulate a stress case ( 1 degree deadband per axis and 0.01 deg/sec rate deadband per axis). For both scenarios, subjects started each run on final approach at a docking port-to-port range of 20 ft. Subjects used the THC in pulse mode with cues from the docking camera image, window views, and range and range rate data displayed on the Orion display units. As in the actual design, the attitude of the Orion vehicle was held by the automated flight control system at 0.5 degree deadband per axis. Several error sources were modeled including Reaction

Autonomous Mars ascent and orbit rendezvous for earth return missions

Science.gov (United States)

Edwards, H. C.; Balmanno, W. F.; Cruz, Manuel I.; Ilgen, Marc R.

1991-01-01

The details of tha assessment of autonomous Mars ascent and orbit rendezvous for earth return missions are presented. Analyses addressing navigation system assessments, trajectory planning, targeting approaches, flight control guidance strategies, and performance sensitivities are included. Tradeoffs in the analysis and design process are discussed.

A Ground Testbed to Advance US Capability in Autonomous Rendezvous and Docking Project

Science.gov (United States)

D'Souza, Chris

2014-01-01

This project will advance the Autonomous Rendezvous and Docking (AR&D) GNC system by testing it on hardware, particularly in a flight processor, with a goal of testing it in IPAS with the Waypoint L2 AR&D scenario. The entire Agency supports development of a Commodity for Autonomous Rendezvous and Docking (CARD) as outlined in the Agency-wide Community of Practice whitepaper entitled: "A Strategy for the U.S. to Develop and Maintain a Mainstream Capability for Automated/Autonomous Rendezvous and Docking in Low Earth Orbit and Beyond". The whitepaper establishes that 1) the US is in a continual state of AR&D point-designs and therefore there is no US "off-the-shelf" AR&D capability in existence today, 2) the US has fallen behind our foreign counterparts particularly in the autonomy of AR&D systems, 3) development of an AR&D commodity is a national need that would benefit NASA, our commercial partners, and DoD, and 4) an initial estimate indicates that the development of a standardized AR&D capability could save the US approximately $60M for each AR&D project and cut each project's AR&D flight system implementation time in half.

Concurrent image-based visual servoing with adaptive zooming for non-cooperative rendezvous maneuvers

Science.gov (United States)

Pomares, Jorge; Felicetti, Leonard; Pérez, Javier; Emami, M. Reza

2018-02-01

An image-based servo controller for the guidance of a spacecraft during non-cooperative rendezvous is presented in this paper. The controller directly utilizes the visual features from image frames of a target spacecraft for computing both attitude and orbital maneuvers concurrently. The utilization of adaptive optics, such as zooming cameras, is also addressed through developing an invariant-image servo controller. The controller allows for performing rendezvous maneuvers independently from the adjustments of the camera focal length, improving the performance and versatility of maneuvers. The stability of the proposed control scheme is proven analytically in the invariant space, and its viability is explored through numerical simulations.

Rendezvous and docking tracker

Science.gov (United States)

Ray, Art J.; Ross, Susan E.; Deming, Douglas R.

1986-01-01

A conceptual solid-state rendezvous and docking tracker (RDT) has been devised for generating range and attitude data for a docking vehicle relative to a target vehicle. Emphasis is placed on the approach of the Orbiter to a link with the Space Station. Three laser illuminators ring the optical axis of the lens a directed toward retroreflectors on the target vehicle. Each retroreflector is equipped with a bandpass filter for a designated illumination frequency. Data are collected sequentially over a 20 deg field of view as the range closes to 100-1000 m. A fourth ranging retroreflector 0.3 m from center is employed during close-in maneuvers. The system provides tracking data on motions with 6 deg of freedom, and furnishes 500 msec updates (to be enhanced to 100 msec) to the operator at a computer console.

Hubble Servicing Challenges Drive Innovation of Shuttle Rendezvous Techniques

Science.gov (United States)

Goodman, John L.; Walker, Stephen R.

2009-01-01

Hubble Space Telescope (HST) servicing, performed by Space Shuttle crews, has contributed to what is arguably one of the most successful astronomy missions ever flown. Both nominal and contingency proximity operations techniques were developed to enable successful servicing, while lowering the risk of damage to HST systems, and improve crew safety. Influencing the development of these techniques were the challenges presented by plume impingement and HST performance anomalies. The design of both the HST and the Space Shuttle was completed before the potential of HST contamination and structural damage by shuttle RCS jet plume impingement was fully understood. Relative navigation during proximity operations has been challenging, as HST was not equipped with relative navigation aids. Since HST reached orbit in 1990, proximity operations design for servicing missions has evolved as insight into plume contamination and dynamic pressure has improved and new relative navigation tools have become available. Servicing missions have provided NASA with opportunities to gain insight into servicing mission design and development of nominal and contingency procedures. The HST servicing experiences and lessons learned are applicable to other programs that perform on-orbit servicing and rendezvous, both human and robotic.

Assessment and correction of BCC_CSM's performance in capturing leading modes of summer precipitation over North Asia

KAUST Repository

Gong, Zhiqiang; Dogar, Muhammad Mubashar; Qiao, Shaobo; Hu, Po; Feng, Guolin

2017-01-01

in the tropical East Pacific. Nevertheless, BCC_CSM exhibits limited prediction skill over most part of NA and presents a deficiency in reproducing the EOF1's and EOF2's spatial pattern over central NA and EOF2's interannual variability. This can be attributed

Conversion of Percutaneous Cholecystostomy to Endoscopic Gallbladder Stenting by Using the Rendezvous Technique.

Science.gov (United States)

Nam, Kwangwoo; Choi, Jun-Ho

2017-05-01

We report the successful conversion of percutaneous cholecystostomy (PC) to endoscopic transpapillary gallbladder stenting (ETGS) with insertion of an antegrade guidewire into the duodenum. An 84-year-old man presented with severe acute cholecystitis and septic shock. He had significant comorbidities, and emergent PC was successfully performed. Subsequent ETGS was attempted but unsuccessful owing to difficulties with cystic duct cannulation. However, via the PC tract, the guidewire was passed antegradely into the duodenum, and ETGS with a double-pigtail plastic stent was successfully performed with the rendezvous technique. The PC tube was removed, and no recurrence was reported during the 17-month follow-up period. Conversion of PC to ETGS is a viable option in patients with acute cholecystitis who are not candidates for surgery. Antegrade guidewire insertion via the PC tract may increase the success rate of conversion and decrease the risk of procedure-related complications.

Conversion of Percutaneous Cholecystostomy to Endoscopic Gallbladder Stenting by Using the Rendezvous Technique

Directory of Open Access Journals (Sweden)

Kwangwoo Nam

2017-05-01

Full Text Available We report the successful conversion of percutaneous cholecystostomy (PC to endoscopic transpapillary gallbladder stenting (ETGS with insertion of an antegrade guidewire into the duodenum. An 84-year-old man presented with severe acute cholecystitis and septic shock. He had significant comorbidities, and emergent PC was successfully performed. Subsequent ETGS was attempted but unsuccessful owing to difficulties with cystic duct cannulation. However, via the PC tract, the guidewire was passed antegradely into the duodenum, and ETGS with a double-pigtail plastic stent was successfully performed with the rendezvous technique. The PC tube was removed, and no recurrence was reported during the 17-month follow-up period. Conversion of PC to ETGS is a viable option in patients with acute cholecystitis who are not candidates for surgery. Antegrade guidewire insertion via the PC tract may increase the success rate of conversion and decrease the risk of procedure-related complications.

Rendezvous missions with minimoons from L1

Science.gov (United States)

Chyba, M.; Haberkorn, T.; Patterson, G.

2014-07-01

We propose to present asteroid capture missions with the so-called minimoons. Minimoons are small asteroids that are temporarily captured objects on orbits in the Earth-Moon system. It has been suggested that, despite their small capture probability, at any time there are one or two meter diameter minimoons, and progressively greater numbers at smaller diameters. The minimoons orbits differ significantly from elliptical orbits which renders a rendezvous mission more challenging, however they offer many advantages for such missions that overcome this fact. First, they are already on geocentric orbits which results in short duration missions with low Delta-v, this translates in cost efficiency and low-risk targets. Second, beside their close proximity to Earth, an advantage is their small size since it provides us with the luxury to retrieve the entire asteroid and not only a sample of material. Accessing the interior structure of a near-Earth satellite in its morphological context is crucial to an in-depth analysis of the structure of the asteroid. Historically, 2006 RH120 is the only minimoon that has been detected but work is ongoing to determine which modifications to current observation facilities is necessary to provide detection algorithm capabilities. In the event that detection is successful, an efficient algorithm to produce a space mission to rendezvous with the detected minimoon is highly desirable to take advantage of this opportunity. This is the main focus of our work. For the design of the mission we propose the following. The spacecraft is first placed in hibernation on a Lissajoux orbit around the liberation point L1 of the Earth-Moon system. We focus on eight-shaped Lissajoux orbits to take advantage of the stability properties of their invariant manifolds for our transfers since the cost to minimize is the spacecraft fuel consumption. Once a minimoon has been detected we must choose a point on its orbit to rendezvous (in position and velocities

Retrieval of a self-expanding metal stent after migration and incorporation in the omental bursa, using a gastroscopic-transgastric laparoscopic rendezvous technique.

Science.gov (United States)

Patrzyk, Maciej; Dierzek, Przemyslaw; Glitsch, Anne; Paul, Hartmut; Heidecke, Claus-Dieter

2015-01-01

Endoscopic drainage is a widely used treatment for pancreatic pseudocysts. Drainage-related complications may be related directly to the procedure or may occur later as stents migrate or erode into adjacent structures. Migration of a self-expanding metal stent into peritoneal cavity and incorporation in the omental bursa is rare. When endoscopic retrieval fails a combined laparoscopic-endoscopic (rendezvous technique) approach offers an alternative to open surgery. We report a case of successful gastroscopic-transgastric laparoscopic removal of a stent that was dislocated into the omental bursa after a ½ year observation period.

Randomised study on single stage laparo-endoscopic rendezvous (intra-operative ERCP) procedure versus two stage approach (Pre-operative ERCP followed by laparoscopic cholecystectomy) for the management of cholelithiasis with choledocholithiasis.

Science.gov (United States)

Sahoo, Manash Ranjan; Kumar, Anil T; Patnaik, Aashish

2014-07-01

The 'Rendezvous' technique consists of laparoscopic cholecystectomy (LC) standards with intra-operative cholangiography followed by endoscopic sphincterotomy. The sphincterotome is driven across the papilla through a guidewire inserted by the transcystic route. In this study, we intended to compare the two methods in a prospective randomised trial. From 2005 to 2012, we enrolled 83 patients with a diagnosis of cholecysto-choledocolithiasis. They were randomised into two groups. In 'group-A',41 patients were treated with two stages management, first by pre-operative endoscopic retrograde cholangiopancreatography (ERCP) and common bile duct (CBD) clearance and second by LC. In 'group-B', 42 patients were treated with LC and intra-operative cholangiography; and when diagnosis of choledocholithiasis was confirmed, patients had undergone one stage management of by Laparo-endoscopic Rendezvous technique. In arm-A and arm-B groups, complete CBD clearance was achieved in 29 and 38 patients, respectively. Failure of the treatment in arm-A was 29% and in arm-B was 9.5%. In arm-A, selective CBD cannulation was achieved in 33 cases (80.5%) and in arm-B in 39 cases (93%). In arm-Agroup, post-ERCP hyperamylasia was presented in nine patients (22%) and severe pancreatitis in five patients (12%) versus none of the patients (0%) in arm-B group, respectively. Mean post-operative hospital stay in arm-A and arm-B groups are 10.9 and 6.8 days, respectively. One stage laparo-endoscopic rendezvous approach increases selective cannulation of CBD, reduces post-ERCP pancreatitis, reduces days of hospital stay, increases patient's compliance and prevents unnecessary intervention to CBD.

Spacecraft Rendezvous Guidance in Cluttered Dynamical Environments via Extreme Learning Machines, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — DeepAnalytX, Inc. proposes to investigate a new approach to perform real-time, closed-loop optimal and robust rendezvous guidance in space environments comprising a...

Thermo-Mechanical Characterisation of In-Plane Properties for CSM E-glass Epoxy Polymer Composite Materials – Part 1

DEFF Research Database (Denmark)

Jakobsen, Johnny; Jensen, Martin; Andreasen, Jens H.

2013-01-01

The in-plane thermo-mechanical properties and residual stresses of a CSM E-glass/Epoxy material are characterised through the use of DSC and TMA. The measured data is used to generate material models which describe the mechanical behaviour as a function of conversion and temperature. The in-plane...

Integrated vision-based GNC for autonomous rendezvous and capture around Mars

Science.gov (United States)

Strippoli, L.; Novelli, G.; Gil Fernandez, J.; Colmenarejo, P.; Le Peuvedic, C.; Lanza, P.; Ankersen, F.

2015-06-01

Integrated GNC (iGNC) is an activity aimed at designing, developing and validating the GNC for autonomously performing the rendezvous and capture phase of the Mars sample return mission as defined during the Mars sample return Orbiter (MSRO) ESA study. The validation cycle includes testing in an end-to-end simulator, in a real-time avionics-representative test bench and, finally, in a dynamic HW in the loop test bench for assessing the feasibility, performances and figure of merits of the baseline approach defined during the MSRO study, for both nominal and contingency scenarios. The on-board software (OBSW) is tailored to work with the sensors, actuators and orbits baseline proposed in MSRO. The whole rendezvous is based on optical navigation, aided by RF-Doppler during the search and first orbit determination of the orbiting sample. The simulated rendezvous phase includes also the non-linear orbit synchronization, based on a dedicated non-linear guidance algorithm robust to Mars ascent vehicle (MAV) injection accuracy or MAV failures resulting in elliptic target orbits. The search phase is very demanding for the image processing (IP) due to the very high visual magnitude of the target wrt. the stellar background, and the attitude GNC requires very high pointing stability accuracies to fulfil IP constraints. A trade-off of innovative, autonomous navigation filters indicates the unscented Kalman filter (UKF) as the approach that provides the best results in terms of robustness, response to non-linearities and performances compatibly with computational load. At short range, an optimized IP based on a convex hull algorithm has been developed in order to guarantee LoS and range measurements from hundreds of metres to capture.

The mobile agent rendezvous problem in the ring

CERN Document Server

Kranakis, Evangelos; Marcou, Euripides

2010-01-01

Mobile agent computing is being used in fields as diverse as artificial intelligence, computational economics and robotics. Agents' ability to adapt dynamically and execute asynchronously and autonomously brings potential advantages in terms of fault-tolerance, flexibility and simplicity. This monograph focuses on studying mobile agents as modelled in distributed systems research and in particular within the framework of research performed in the distributed algorithms community. It studies the fundamental question of how to achieve rendezvous, the gathering of two or more agents at the same n

A modified technique reduced operative time of laparoendoscopic rendezvous endoscopic retrograde cholangiopancreatography combined with laparoscopic cholecystectomy for concomitant gallstone and common bile ductal stone.

Science.gov (United States)

Liu, Wei; Wang, Qunwei; Xiao, Jing; Zhao, Liying; Huang, Jiangsheng; Tan, Zhaohui; Li, Pengfei

2014-01-01

Laparoendoscopic rendezvous (LERV) endoscopic retrograde cholangiopancreatography (ERCP) and laparoscopic cholecystectomy (LC+ERCP/LERV) are considered an optimal approach for concomitant gallstones and common bile duct stones. The rendezvous technique is essential for the success of procedure. We applied two different LERV techniques, traditional technique and modified technique, in 60 consecutive cases from January 2011 to November 2012. 32 cases who underwent modified technique (group 1) from February 2012 to November 2012 were retrospectively compared to 28 cases (group 2) who underwent traditional technique from January 2011 to January 2012. There was no significant difference between two groups with respect to preoperative demographic features. Although the difference was not statistically significant, the procedure was successfully performed in 31 cases (96.9%) in group 1 and 24 cases (86.2%) in group 2. The mean operative time and time of endoscopic part were 82.6 ± 19.6 min and 26.5 ± 5.99 min in group 1 which were significantly shorter than those in group 2 (118.0 ± 23.1 min and 58.7 ± 13.3 min, resp.). There was no postoperative pancreatitis and mortality in both groups. The mean hospital stay, blood loss, incidence of complications, and residual stone were of no difference in both groups. This study proved that this modified technique can effectively reduce the operative time and time of endoscopic part of LC+ERCP/LERV compared with traditional technique.

The Data Transfer Kit: A geometric rendezvous-based tool for multiphysics data transfer

International Nuclear Information System (INIS)

Slattery, S. R.; Wilson, P. P. H.; Pawlowski, R. P.

2013-01-01

The Data Transfer Kit (DTK) is a software library designed to provide parallel data transfer services for arbitrary physics components based on the concept of geometric rendezvous. The rendezvous algorithm provides a means to geometrically correlate two geometric domains that may be arbitrarily decomposed in a parallel simulation. By repartitioning both domains such that they have the same geometric domain on each parallel process, efficient and load balanced search operations and data transfer can be performed at a desirable algorithmic time complexity with low communication overhead relative to other types of mapping algorithms. With the increased development efforts in multiphysics simulation and other multiple mesh and geometry problems, generating parallel topology maps for transferring fields and other data between geometric domains is a common operation. The algorithms used to generate parallel topology maps based on the concept of geometric rendezvous as implemented in DTK are described with an example using a conjugate heat transfer calculation and thermal coupling with a neutronics code. In addition, we provide the results of initial scaling studies performed on the Jaguar Cray XK6 system at Oak Ridge National Laboratory for a worse-case-scenario problem in terms of algorithmic complexity that shows good scaling on 0(1 x 104) cores for topology map generation and excellent scaling on 0(1 x 105) cores for the data transfer operation with meshes of O(1 x 109) elements. (authors)

The Data Transfer Kit: A geometric rendezvous-based tool for multiphysics data transfer

Energy Technology Data Exchange (ETDEWEB)

Slattery, S. R.; Wilson, P. P. H. [Department of Engineering Physics, University of Wisconsin - Madison, 1500 Engineering Dr., Madison, WI 53706 (United States); Pawlowski, R. P. [Sandia National Laboratories, P.O. Box 5800, Albuquerque, NM 87185 (United States)

2013-07-01

The Data Transfer Kit (DTK) is a software library designed to provide parallel data transfer services for arbitrary physics components based on the concept of geometric rendezvous. The rendezvous algorithm provides a means to geometrically correlate two geometric domains that may be arbitrarily decomposed in a parallel simulation. By repartitioning both domains such that they have the same geometric domain on each parallel process, efficient and load balanced search operations and data transfer can be performed at a desirable algorithmic time complexity with low communication overhead relative to other types of mapping algorithms. With the increased development efforts in multiphysics simulation and other multiple mesh and geometry problems, generating parallel topology maps for transferring fields and other data between geometric domains is a common operation. The algorithms used to generate parallel topology maps based on the concept of geometric rendezvous as implemented in DTK are described with an example using a conjugate heat transfer calculation and thermal coupling with a neutronics code. In addition, we provide the results of initial scaling studies performed on the Jaguar Cray XK6 system at Oak Ridge National Laboratory for a worse-case-scenario problem in terms of algorithmic complexity that shows good scaling on 0(1 x 104) cores for topology map generation and excellent scaling on 0(1 x 105) cores for the data transfer operation with meshes of O(1 x 109) elements. (authors)

Retrieval of a self-expanding metal stent after migration and incorporation in the omental bursa, using a gastroscopic-transgastric laparoscopic rendezvous technique

Directory of Open Access Journals (Sweden)

Maciej Patrzyk

2015-01-01

Full Text Available Endoscopic drainage is a widely used treatment for pancreatic pseudocysts. Drainage-related complications may be related directly to the procedure or may occur later as stents migrate or erode into adjacent structures. Migration of a self-expanding metal stent into peritoneal cavity and incorporation in the omental bursa is rare. When endoscopic retrieval fails a combined laparoscopic-endoscopic (rendezvous technique approach offers an alternative to open surgery. We report a case of successful gastroscopic-transgastric laparoscopic removal of a stent that was dislocated into the omental bursa after a ΍ year observation period.

Autonomous rendezvous and capture development infrastructure

Science.gov (United States)

Bryan, Thomas C.; Roe, Fred; Coker, Cindy; Nelson, Pam; Johnson, B.

1991-01-01

In the development of the technology for autonomous rendezvous and docking, key infrastructure capabilities must be used for effective and economical development. This involves facility capabilities, both equipment and personnel, to devise, develop, qualify, and integrate ARD elements and subsystems into flight programs. One effective way of reducing technical risks in developing ARD technology is the use of the ultimate test facility, using a Shuttle-based reusable free-flying testbed to perform a Technology Demonstration Test Flight which can be structured to include a variety of additional sensors, control schemes, and operational approaches. This conceptual testbed and flight demonstration will be used to illustrate how technologies and facilities at MSFC can be used to develop and prove an ARD system.

Rendezvous terminal phase automatic braking sequencing and targeting. [for space shuttle orbiter

Science.gov (United States)

Kachmar, P. M.

1973-01-01

The purpose of the rendezvous terminal phase braking program is to provide the means of automatically bringing the primary orbiter within desired station keeping boundaries relative to the target satellite. A detailed discussion is presented on the braking program and its navigation, targeting, and guidance functions.

Gastro-pancreaticojejunostomy for treatment of pancreatic ductal obstruction in a post-Whipple procedure patient.

Science.gov (United States)

Rodrigues-Pinto, Eduardo; Grimm, Ian S; Baron, Todd H

2015-01-01

We report a case of a woman with a medical history of classic Whipple surgery who underwent endoscopic ultrasound (EUS)-guided pancreatic drainage due to smouldering acute pancreatitis secondary to an obstructing pancreatic ductal stone. A gastro-pancreaticojejunostomy anastomosis was created anterogradely, with dilation of both the anastomoses in the same procedure, with subsequent decompression of the pancreatic duct. Endoscopic retrograde pancreatography (ERP) is often impossible to perform in patients with post-Whipple procedure anatomy due to inaccessibility to the pancreaticojejunostomy anastomosis. EUS-guided pancreatic drainage may be offered in these patients in whom the pancreatic duct cannot be accessed at ERP. It has been used as a platform for access to and drainage of the pancreatic duct either by rendezvous or transmural drainage. However, only one of four patients achieve successful completion of the rendezvous procedure. There are limited data regarding safety and long-term outcome of this procedure, as well as scant guidelines on the optimal time for leaving stents in place. We believe definitive endoscopic therapy should be attempted, whenever possible, after relief of obstruction. In our case, we expect that stent occlusion is inevitable and that long-term drainage is possible due to drainage occurring between the stent and the stone.

Critical analyses on the localized corrosion behaviour in materials of energetic interests: Inconcel 600 CSM and Deltacogne

International Nuclear Information System (INIS)

Borello, A.; Frangini, S.; Masci, D.

1989-06-01

Concerning the two commonly observed phenomena of localized corrosion of Inconel 600 in high temperature caustic environments normally encountered in steam generators of PWR nuclear reactors, the aim of this work is to investigate the intergranular and the stress corrosion cracking behaviour of two heats of Alloy 600, having different origin. In fact one heat was produced by Centro Sviluppo Materiali (CSM) in laboratory scale; the other one was manufactured by Deltacogne following conventional industrial practices. The evaluation of intergranular corrosion susceptibility has been performed by means of the modified Huey test and the Electrochemical Potentiokinetic Reactivation (EPR). The stress corrosion cracking susceptibility was determined by the slow strain rate technique. The results of the present study show that the CSM heat has a better behaviour than the Deltacogne one as for the stress corrosion cracking susceptibility. On the contrary, concerning the intergranular corrosion resistance, both used tests point out that the Deltacogne material has a lower susceptibility to this type of localized corrosion. The sensitization areas in the TTS diagram, depend, even for the same heat, on the type of the test used for the evaluation. (author)

An Application of Linear Covariance Analysis to the Design of Responsive Near-Rendezvous Missions

National Research Council Canada - National Science Library

Visser, Benjamin L

2007-01-01

This thesis investigates a new class of launch vehicles capable of being released from an aircraft which ultimately have the goal of achieving near-rendezvous conditions at orbital altitudes up to 800 km...

Robust adaptive backstepping neural networks control for spacecraft rendezvous and docking with input saturation.

Science.gov (United States)

Xia, Kewei; Huo, Wei

2016-05-01

This paper presents a robust adaptive neural networks control strategy for spacecraft rendezvous and docking with the coupled position and attitude dynamics under input saturation. Backstepping technique is applied to design a relative attitude controller and a relative position controller, respectively. The dynamics uncertainties are approximated by radial basis function neural networks (RBFNNs). A novel switching controller consists of an adaptive neural networks controller dominating in its active region combined with an extra robust controller to avoid invalidation of the RBFNNs destroying stability of the system outside the neural active region. An auxiliary signal is introduced to compensate the input saturation with anti-windup technique, and a command filter is employed to approximate derivative of the virtual control in the backstepping procedure. Globally uniformly ultimately bounded of the relative states is proved via Lyapunov theory. Simulation example demonstrates effectiveness of the proposed control scheme. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Q-Learning and p-persistent CSMA based rendezvous protocol for cognitive radio networks operating with shared spectrum activity

Science.gov (United States)

Watson, Clifton L.; Biswas, Subir

2014-06-01

With an increasing demand for spectrum, dynamic spectrum access (DSA) has been proposed as viable means for providing the flexibility and greater access to spectrum necessary to meet this demand. Within the DSA concept, unlicensed secondary users temporarily "borrow" or access licensed spectrum, while respecting the licensed primary user's rights to that spectrum. As key enablers for DSA, cognitive radios (CRs) are based on software-defined radios which allow them to sense, learn, and adapt to the spectrum environment. These radios can operate independently and rapidly switch channels. Thus, the initial setup and maintenance of cognitive radio networks are dependent upon the ability of CR nodes to find each other, in a process known as rendezvous, and create a link on a common channel for the exchange of data and control information. In this paper, we propose a novel rendezvous protocol, known as QLP, which is based on Q-learning and the p-persistent CSMA protocol. With the QLP protocol, CR nodes learn which channels are best for rendezvous and thus adapt their behavior to visit those channels more frequently. We demonstrate through simulation that the QLP protocol provides a rendevous capability for DSA environments with different dynamics of PU activity, while attempting to achieve the following performance goals: (1) minimize the average time-to-rendezvous, (2) maximize system throughput, (3) minimize primary user interference, and (4) minimize collisions among CR nodes.

Rendezvous, un juego de Lewis Carroll

Directory of Open Access Journals (Sweden)

José Manuel Sánchez Muñoz

2011-10-01

Full Text Available Todos en mayor o menor medida asociamos el nombre de Lewis Carrolla la literatura, sobre todo a la de temática infantil, con títulos a sus espaldas como Alicia en el País de las Maravillas, Alicia a través del espejo, o La Caza del Snark. Pero además de literato, Lewis Carrol fue un hombre con bastantes inquietudes en torno a la matemática, la lógica y el pensamiento filosófico. Pero no todo el mundo es conocedor de su faceta como creativo en el campo de los juegos. Rendezvous es una de sus más sorprendentes invenciones,un juego de inteligencia para todos los públicos, cuyas directrices hacen de él un entretenimiento bastante original.

An autonomous rendezvous and docking system using cruise missile technologies

Science.gov (United States)

Jones, Ruel Edwin

1991-01-01

In November 1990 the Autonomous Rendezvous & Docking (AR&D) system was first demonstrated for members of NASA's Strategic Avionics Technology Working Group. This simulation utilized prototype hardware from the Cruise Missile and Advanced Centaur Avionics systems. The object was to show that all the accuracy, reliability and operational requirements established for a space craft to dock with Space Station Freedom could be met by the proposed system. The rapid prototyping capabilities of the Advanced Avionics Systems Development Laboratory were used to evaluate the proposed system in a real time, hardware in the loop simulation of the rendezvous and docking reference mission. The simulation permits manual, supervised automatic and fully autonomous operations to be evaluated. It is also being upgraded to be able to test an Autonomous Approach and Landing (AA&L) system. The AA&L and AR&D systems are very similar. Both use inertial guidance and control systems supplemented by GPS. Both use an Image Processing System (IPS), for target recognition and tracking. The IPS includes a general purpose multiprocessor computer and a selected suite of sensors that will provide the required relative position and orientation data. Graphic displays can also be generated by the computer, providing the astronaut / operator with real-time guidance and navigation data with enhanced video or sensor imagery.

Virtual reality applications to automated rendezvous and capture

Science.gov (United States)

Hale, Joseph; Oneil, Daniel

Virtual Reality (VR) is a rapidly developing Human/Computer Interface (HCI) technology. The evolution of high-speed graphics processors and development of specialized anthropomorphic user interface devices, that more fully involve the human senses, have enabled VR technology. Recently, the maturity of this technology has reached a level where it can be used as a tool in a variety of applications. This paper provides an overview of: VR technology, VR activities at Marshall Space Flight Center (MSFC), applications of VR to Automated Rendezvous and Capture (AR&C), and identifies areas of VR technology that requires further development.

A Modified Technique Reduced Operative Time of Laparoendoscopic Rendezvous Endoscopic Retrograde Cholangiopancreatography Combined with Laparoscopic Cholecystectomy for Concomitant Gallstone and Common Bile Ductal Stone

Directory of Open Access Journals (Sweden)

Wei Liu

2014-01-01

Full Text Available Laparoendoscopic rendezvous (LERV endoscopic retrograde cholangiopancreatography (ERCP and laparoscopic cholecystectomy (LC+ERCP/LERV are considered an optimal approach for concomitant gallstones and common bile duct stones. The rendezvous technique is essential for the success of procedure. We applied two different LERV techniques, traditional technique and modified technique, in 60 consecutive cases from January 2011 to November 2012. 32 cases who underwent modified technique (group 1 from February 2012 to November 2012 were retrospectively compared to 28 cases (group 2 who underwent traditional technique from January 2011 to January 2012. There was no significant difference between two groups with respect to preoperative demographic features. Although the difference was not statistically significant, the procedure was successfully performed in 31 cases (96.9% in group 1 and 24 cases (86.2% in group 2. The mean operative time and time of endoscopic part were 82.6 ± 19.6 min and 26.5 ± 5.99 min in group 1 which were significantly shorter than those in group 2 (118.0 ± 23.1 min and 58.7 ± 13.3 min, resp.. There was no postoperative pancreatitis and mortality in both groups. The mean hospital stay, blood loss, incidence of complications, and residual stone were of no difference in both groups. This study proved that this modified technique can effectively reduce the operative time and time of endoscopic part of LC+ERCP/LERV compared with traditional technique.

Inverse simulation system for evaluating handling qualities during rendezvous and docking

Science.gov (United States)

Zhou, Wanmeng; Wang, Hua; Thomson, Douglas; Tang, Guojin; Zhang, Fan

2017-08-01

The traditional method used for handling qualities assessment of manned space vehicles is too time-consuming to meet the requirements of an increasingly fast design process. In this study, a rendezvous and docking inverse simulation system to assess the handling qualities of spacecraft is proposed using a previously developed model-predictive-control architecture. By considering the fixed discrete force of the thrusters of the system, the inverse model is constructed using the least squares estimation method with a hyper-ellipsoidal restriction, the continuous control outputs of which are subsequently dispersed by pulse width modulation with sensitivity factors introduced. The inputs in every step are deemed constant parameters, and the method could be considered as a general method for solving nominal, redundant, and insufficient inverse problems. The rendezvous and docking inverse simulation is applied to a nine-degrees-of-freedom platform, and a novel handling qualities evaluation scheme is established according to the operation precision and astronauts' workload. Finally, different nominal trajectories are scored by the inverse simulation and an established evaluation scheme. The scores can offer theoretical guidance for astronaut training and more complex operation missions.

Hard rock excavation at the CSM/OCRD test site using crater theory and current United States controlled smooth wall blasting practices, June 1982

International Nuclear Information System (INIS)

Sperry, P.E.; Chitombo, G.P.; Hustrulid, W.A.

1984-08-01

This report is the fourth in a series describing experiments conducted by the Colorado School of Mines for the Office of Crystalline Repository Development (OCRD) to determine the extent of blast damage in rock surrounding an underground opening. The report describes the application of tunnel design procedures based upon crater theory and current United States controlled smooth wall blasting practices for the excavation of the CSM/OCRD test room in the Colorado School of Mines, Experimental Mine (Edgar Mine) in Idaho Springs, Colorado. Ten blast rounds were used to excavate the test room. The first seven rounds were designed with Swedish Techniques, and described in the third report in this series, and the design of rounds eight through ten used crater theory. Crater theory is described in this document along with its application to the CSM/OCRD Room excavation. Calculation for spacing, burden, number and type of holes, explosives placement, and overall powder factor are discussed. A series of single charge cratering test shots, designed to evaluate some of the input data for the blast designs, are discussed. The input data include: Strain Energy Factor E, a dimensionless factor which varies according to the explosive and rock type; Critical Depth, N, the charge depth at which the explosive begins to fracture rock at the free face; Optimum Depth Ratio Δ 0 , which is a ratio between Optimum Charge Depth, d 0 , and Critical Charge Depth, d/sub c/; and charge Weight, W. A non-linear least squared regression method to best fit the general bell-shape curve of the crater results is discussed. Both scaled weight and scaled volume criteria are reported in the analysis of results. 10 references, 17 figures, 16 tables

An integrated autonomous rendezvous and docking system architecture using Centaur modern avionics

Science.gov (United States)

Nelson, Kurt

1991-01-01

The avionics system for the Centaur upper stage is in the process of being modernized with the current state-of-the-art in strapdown inertial guidance equipment. This equipment includes an integrated flight control processor with a ring laser gyro based inertial guidance system. This inertial navigation unit (INU) uses two MIL-STD-1750A processors and communicates over the MIL-STD-1553B data bus. Commands are translated into load activation through a Remote Control Unit (RCU) which incorporates the use of solid state relays. Also, a programmable data acquisition system replaces separate multiplexer and signal conditioning units. This modern avionics suite is currently being enhanced through independent research and development programs to provide autonomous rendezvous and docking capability using advanced cruise missile image processing technology and integrated GPS navigational aids. A system concept was developed to combine these technologies in order to achieve a fully autonomous rendezvous, docking, and autoland capability. The current system architecture and the evolution of this architecture using advanced modular avionics concepts being pursued for the National Launch System are discussed.

In-situ load-deformation characterization of the CSM/OCRD jointed test block

International Nuclear Information System (INIS)

Richardson, A.M.; Hustrulid, W.; Brown, S.; Ubbes, W.

1985-01-01

An extensive ambient-temperature test series has recently been completed on a block of Precambrian Gneiss at the Colorado School of Mines (CSM) Experimental Mine in Idaho Springs, Colorado. Block tests came into existence out of a desire to test a relatively large volume of rock and thereby minimize the scaling problems encountered when laboratory test results are used to obtain modeling parameters for full-size structures. A typical block test involves isolation of a large, approximately two-meter cube of rock by cutting slots on four sides and inserting flatjacks for loading. Much interest has recently centered around block tests as a promising method for in-situ characterization of rock-masses for licensing future commercial nuclear-waste repositories in crystalline rock. To date only a few block tests have been conducted

Lyapunov design of event-based controllers for the rendez-vous of coupled systems

NARCIS (Netherlands)

De Persis, Claudio; Postoyan, Romain

2014-01-01

The objective is to present a new type of triggering conditions together with new proof concepts for the event-based coordination of multi-agents. As a first step, we focus on the rendez-vous of two identical systems modeled as double integrators with additional damping in the velocity dynamics. The

Selective Protein Extraction from Chlorobium tepidum Chlorosomes Using Detergents. Evidence That CsmA Forms Multimers and Binds Bacteriochlorophyll a

DEFF Research Database (Denmark)

Bryant, Donald A; Vassilieva, Elena V; Frigaard, Niels-Ulrik

2002-01-01

and location of this BChl a are not yet clearly understood. Chlorosomes were treated with sodium dodecyl sulfate (SDS), Lubrol PX, or Triton X-100, separately or in combination with 1-hexanol, and the extracted components were separated from the residual chlorosomes by ultrafiltration on centrifugal filters....... When chlorosomes were treated with low concentrations of SDS, all proteins except CsmA were extracted. However, this treatment did not significantly alter the size and shape of the chlorosomes, did not extract the BChl a, and caused only minor changes in the absorption spectrum of the chlorosomes....... Cross-linking studies with SDS-treated chlorosomes revealed the presence of multimers of the major chlorosome protein, CsmA, up to homooctamers. Extraction of chlorosomes with SDS and 1-hexanol solubilized all ten chlorosome envelope proteins as well as BChl a. Although the size and shape...

Near-Earth Asteroid Rendezvous: mission overview

Science.gov (United States)

Cheng, A. F.; Santo, A. G.; Heeres, K. J.; Landshof, J. A.; Farquhar, R. W.; Gold, R. E.; Lee, S. C.

1997-10-01

The Near-Earth Asteroid Rendezvous (NEAR) mission, the first launch of NASA's Discovery Program, will be the first mission to orbit an asteroid. NEAR will make the first comprehensive scientific measurements of an asteroid's surface composition, geology, physical properties, and internal structure. NEAR launched successfully on February 17, 1996, aboard a Delta II-7925. It will orbit the 20-km-diameter near-Earth asteroid 433 Eros for about 1 year, at a minimum orbit radius of about 35 km from the center of the asteroid. The NEAR is a solar-powered, three-axis stabilized spacecraft with a launch mass including propellant of 805 kg. NEAR uses X band telemetry to the NASA Deep Space Network, with the data rates at Eros up to 8.8 kbits/s using a 34-m High Efficiency (HEF) dish, and up to 26.5 kbits/s using a 70-m dish. A solid-state recorder is accommodated with a memory capacity of 1.8 Gbytes. Attitude control is to 1.7 mrad, line-of-sight pointing stability is within 50 μrad over 1 s, and post processing attitude knowledge is within 50 μrad. NEAR accommodates 56 kg of instruments and provides them with 84 W. The instruments are a multispectral imager (MSI), a near-infrared spectrograph (NIS), an X ray/gamma ray spectrometer (XRS/GRS), a magnetometer (MAG), and a laser rangefinder (NLR), while a radio science (RS) investigation uses the coherent X band transponder. NEAR will make a flyby of the C-type asteroid 253 Mathilde in June 1997 and will rendezvous with 433 Eros in February 1999. It will execute an initial slow flyby of Eros, with a flyby speed of 5 m/s and a closest approach distance of 500 km. Subsequently, its orbit will be lowered to 35 km. The NEAR Mission Operations Center and the Science Data Center are at the Johns Hopkins Applied Physics Laboratory. The Science Data Center will maintain the entire NEAR data set on-line, and data from all instruments can be accessed by every member of the NEAR Science Team. Data, including images, are released over

Imaging Flash Lidar for Safe Landing on Solar System Bodies and Spacecraft Rendezvous and Docking

Science.gov (United States)

Amzajerdian, Farzin; Roback, Vincent E.; Bulyshev, Alexander E.; Brewster, Paul F.; Carrion, William A; Pierrottet, Diego F.; Hines, Glenn D.; Petway, Larry B.; Barnes, Bruce W.; Noe, Anna M.

2015-01-01

NASA has been pursuing flash lidar technology for autonomous, safe landing on solar system bodies and for automated rendezvous and docking. During the final stages of the landing from about 1 kilometer to 500 meters above the ground, the flash lidar can generate 3-Dimensional images of the terrain to identify hazardous features such as craters, rocks, and steep slopes. The onboard flight computer can then use the 3-D map of terrain to guide the vehicle to a safe location. As an automated rendezvous and docking sensor, the flash lidar can provide relative range, velocity, and bearing from an approaching spacecraft to another spacecraft or a space station. NASA Langley Research Center has developed and demonstrated a flash lidar sensor system capable of generating 16,000 pixels range images with 7 centimeters precision, at 20 Hertz frame rate, from a maximum slant range of 1800 m from the target area. This paper describes the lidar instrument and presents the results of recent flight tests onboard a rocket-propelled free-flyer vehicle (Morpheus) built by NASA Johnson Space Center. The flights were conducted at a simulated lunar terrain site, consisting of realistic hazard features and designated landing areas, built at NASA Kennedy Space Center specifically for this demonstration test. This paper also provides an overview of the plan for continued advancement of the flash lidar technology aimed at enhancing its performance to meet both landing and automated rendezvous and docking applications.

Determination of Eros Physical Parameters for Near Earth Asteroid Rendezvous Orbit Phase Navigation

Science.gov (United States)

Miller, J. K.; Antreasian, P. J.; Georgini, J.; Owen, W. M.; Williams, B. G.; Yeomans, D. K.

1995-01-01

Navigation of the orbit phase of the Near Earth steroid Rendezvous (NEAR) mission will re,quire determination of certain physical parameters describing the size, shape, gravity field, attitude and inertial properties of Eros. Prior to launch, little was known about Eros except for its orbit which could be determined with high precision from ground based telescope observations. Radar bounce and light curve data provided a rough estimate of Eros shape and a fairly good estimate of the pole, prime meridian and spin rate. However, the determination of the NEAR spacecraft orbit requires a high precision model of Eros's physical parameters and the ground based data provides only marginal a priori information. Eros is the principal source of perturbations of the spacecraft's trajectory and the principal source of data for determining the orbit. The initial orbit determination strategy is therefore concerned with developing a precise model of Eros. The original plan for Eros orbital operations was to execute a series of rendezvous burns beginning on December 20,1998 and insert into a close Eros orbit in January 1999. As a result of an unplanned termination of the rendezvous burn on December 20, 1998, the NEAR spacecraft continued on its high velocity approach trajectory and passed within 3900 km of Eros on December 23, 1998. The planned rendezvous burn was delayed until January 3, 1999 which resulted in the spacecraft being placed on a trajectory that slowly returns to Eros with a subsequent delay of close Eros orbital operations until February 2001. The flyby of Eros provided a brief glimpse and allowed for a crude estimate of the pole, prime meridian and mass of Eros. More importantly for navigation, orbit determination software was executed in the landmark tracking mode to determine the spacecraft orbit and a preliminary shape and landmark data base has been obtained. The flyby also provided an opportunity to test orbit determination operational procedures that will be

COMPASS Final Report: Near Earth Asteroids Rendezvous and Sample Earth Returns (NEARER)

Science.gov (United States)

Oleson, Steven R.; McGuire, Melissa L.

2009-01-01

In this study, the Collaborative Modeling for Parametric Assessment of Space Systems (COMPASS) team completed a design for a multi-asteroid (Nereus and 1996 FG3) sample return capable spacecraft for the NASA In-Space Propulsion Office. The objective of the study was to support technology development and assess the relative benefits of different electric propulsion systems on asteroid sample return design. The design uses a single, heritage Orion solar array (SA) (approx.6.5 kW at 1 AU) to power a single NASA Evolutionary Xenon Thruster ((NEXT) a spare NEXT is carried) to propel a lander to two near Earth asteroids. After landing and gathering science samples, the Solar Electric Propulsion (SEP) vehicle spirals back to Earth where it drops off the first sample s return capsule and performs an Earth flyby to assist the craft in rendezvousing with a second asteroid, which is then sampled. The second sample is returned in a similar fashion. The vehicle, dubbed Near Earth Asteroids Rendezvous and Sample Earth Returns (NEARER), easily fits in an Atlas 401 launcher and its cost estimates put the mission in the New Frontier s (NF's) class mission.

Deep Interior: Multiple-Rendezvous Prospecting of NEOs

Science.gov (United States)

Kakuda, R. Y.; Asphaug, E.; Belton, M. J. S.; Gulkis, S.; Huebner, W. F.

2000-10-01

This is an international multiple-rendezvous mission designed to prospect the deep interior and subsurface geophysical properties of diverse near-Earth objects, using reflection radar tomography, imaging, gravity, and explosions. What we learn will greatly influence future missions and guide strategies for the diversion, disruption, or utilization of potentially hazardous objects. Deep Interior. Low-frequency radar to determine internal variations of complex permittivity at resolutions approaching 20 m. Map inclusions or voids, fracture geometries, and compositional or structural boundaries. Subsurface. High-frequency radar to determine depth of regolith, existence and nature of cometary mantle, geology beneath and around craters, and subsurface expressions to surface geology. Topography and Geodesy. Stereogrammetric imaging with 1 m/pixel spatial resolution, supplemented by radar altimetry in shadowed regions, to determine detailed shape, volume, and spin state. Compare with radar sounding to learn how internal structure is manifested on the surface. Mass and Density. Total mass and lower moments of the internal mass distribution by mapping the exterior gravitational field. Look for mass concentrations. Surface microphysics and composition. Map color, albedo, and scattering properties of the surface over sunlit regions in six optical filters. Material properties. Deploy grenades to characterize the mechanics and dynamics of surface materials. Record 8 frame/sec, 20 cm/pixel videos of crater formation and ejecta dynamics, to enable simple and direct laboratory constraints on material density, cohesion and porosity. Dust. Look for dust lofted by surface waves propagating from the explosions, to constrain elastic properties and attenuation. Observe longer-term dynamics and optical properties of dust "atmosphere" generated by human activity. Cometary Activity. At comet 107P/Wilson-Harrington, look for expressions of past cometary activity, and for possible awakening

A modified Rendezvous ERCP technique in duodenal diverticulum.

Science.gov (United States)

Odabasi, Mehmet; Yildiz, Mehmet Kamil; Abuoglu, Haci Hasan; Eris, Cengiz; Ozkan, Erkan; Gunay, Emre; Aktekin, Ali; Muftuoglu, Ma Tolga

2013-11-16

To postoperative endoscopic retrograde cholangiopancreatography (ERCP) failure, we describe a modified Rendezvous technique for an ERCP in patients operated on for common bile duct stone (CBDS) having a T-tube with retained CBDSs. Five cases operated on for CBDSs and having retained stones with a T-tube were referred from other hospitals located in or around Istanbul city to the ERCP unit at the Haydarpasa Numune Education and Research Hospital. Under sedation anesthesia, a sterile guide-wire was inserted via the T-tube into the common bile duct (CBD) then to the papilla. A guide-wire was held by a loop snare and removed through the mouth. The guide-wire was inserted into the sphincterotome via the duodenoscope from the tip to the handle. The duodenoscope was inserted down to the duodenum with a sphincterotome and a guide-wire in the working channel. With the guidance of a guide-wire, the ERCP and sphincterotomy were successfully performed, the guide-wire was removed from the T-tube, the stones were removed and the CBD was reexamined for retained stones by contrast. An ERCP can be used either preoperatively or postoperatively. Although the success rate in an isolated ERCP treatment ranges from up to 87%-97%, 5%-10% of the patients require two or more ERCP treatments. If a secondary ERCP fails, the clinicians must be ready for a laparoscopic or open exploration. A duodenal diverticulum is one of the most common failures in an ERCP, especially in patients with an intradiverticular papilla. For this small group of patients, an antegrade cannulation via a T-tube can improve the success rate up to nearly 100%. The modified Rendezvous technique is a very easy method and increases the success of postoperative ERCP, especially in patients with large duodenal diverticula and with intradiverticular papilla.

Combined Radial-Pedal Access Strategy and Radial-Pedal Rendezvous in the Revascularization of Complex Total Occlusions of the Superficial Femoral Artery (the "No Femoral Access" Strategy).

Science.gov (United States)

Hanna, Elias B; Prout, Davey L

2016-04-01

To describe the combined use of radial-pedal access for recanalization of complex superficial femoral artery (SFA) occlusions unsuitable for transfemoral recanalization. Patients are selected for this strategy if they have a long (≥ 10 cm) SFA occlusion with unfavorable aortoiliac anatomy, an absent ostial stump, or severely diseased and calcified distal reconstitution. Left radial artery and distal anterior or posterior tibial artery are accessed with 6-F and 4-F sheaths, respectively. The SFA lesion is crossed retrogradely with a 0.035-inch wire system. If retrograde crossing is not immediately successful, transradial subintimal tracking and radial-pedal subintimal rendezvous are used to allow retrograde reentry. Fifteen patients (mean age 62 ± 5 years; 11 men) have been treated in this fashion, and frequently stented, through the tibiopedal access. Seven patients required radial-pedal rendezvous to facilitate retrograde reentry. Two patients underwent transradial iliac stenting during the same session, and 1 patient underwent transradial kissing angioplasty of the profunda. No major complication occurred in any patient. After the procedure, the pulse across the accessed tibial artery was palpable in all patients. In patients with long and complex SFA occlusion unsuitable for transfemoral recanalization, a radial-pedal strategy can overcome revascularization obstacles. © The Author(s) 2016.

Pancreatic duct drainage using EUS-guided rendezvous technique for stenotic pancreaticojejunostomy.

Science.gov (United States)

Takikawa, Tetsuya; Kanno, Atsushi; Masamune, Atsushi; Hamada, Shin; Nakano, Eriko; Miura, Shin; Ariga, Hiroyuki; Unno, Jun; Kume, Kiyoshi; Kikuta, Kazuhiro; Hirota, Morihisa; Yoshida, Hiroshi; Katayose, Yu; Unno, Michiaki; Shimosegawa, Tooru

2013-08-21

The patient was a 30-year-old female who had undergone excision of the extrahepatic bile duct and Roux-en-Y hepaticojejunostomy for congenital biliary dilatation at the age of 7. Thereafter, she suffered from recurrent acute pancreatitis due to pancreaticobiliary maljunction and received subtotal stomach-preserving pancreaticoduodenectomy. She developed a pancreatic fistula and an intra-abdominal abscess after the operation. These complications were improved by percutaneous abscess drainage and antibiotic therapy. However, upper abdominal discomfort and the elevation of serum pancreatic enzymes persisted due to stenosis from the pancreaticojejunostomy. Because we could not accomplish dilation of the stenosis by endoscopic retrograde cholangiopancreatography, we tried an endoscopic ultrasonography (EUS) guided rendezvous technique for pancreatic duct drainage. After transgastric puncture of the pancreatic duct using an EUS-fine needle aspiration needle, the guidewire was inserted into the pancreatic duct and finally reached to the jejunum through the stenotic anastomosis. We changed the echoendoscope to an oblique-viewing endoscope, then grasped the guidewire and withdrew it through the scope. The stenosis of the pancreaticojejunostomy was dilated up to 4 mm, and a pancreatic stent was put in place. Though the pancreatic stent was removed after three months, the patient remained symptom-free. Pancreatic duct drainage using an EUS-guided rendezvous technique was useful for the treatment of a stenotic pancreaticojejunostomy after pancreaticoduodenectomy.

A Summary of the Rendezvous, Proximity Operations, Docking, and Undocking (RPODU) Lessons Learned from the Defense Advanced Research Project Agency (DARPA) Orbital Express (OE) Demonstration System Mission

Science.gov (United States)

Dennehy, Cornelius J.; Carpenter, James R.

2011-01-01

The Guidance, Navigation, and Control (GN&C) Technical Discipline Team (TDT) sponsored Dr. J. Russell Carpenter, a Navigation and Rendezvous Subject Matter Expert (SME) from NASA's Goddard Space Flight Center (GSFC), to provide support to the Defense Advanced Research Project Agency (DARPA) Orbital Express (OE) rendezvous and docking flight test that was conducted in 2007. When that DARPA OE mission was completed, Mr. Neil Dennehy, NASA Technical Fellow for GN&C, requested Dr. Carpenter document his findings (lessons learned) and recommendations for future rendezvous missions resulting from his OE support experience. This report captures lessons specifically from anomalies that occurred during one of OE's unmated operations.

Rendezvous Protocols and Dynamic Frequency Hopping Interference Design for Anti-Jamming Satellite Communication

Science.gov (United States)

2013-11-25

previously considered this proactive approach to combat unintentional, persistent (non- reactive) interference . In this project, we plan on extending our...channel” (or code ) by chance, through public knowledge of the underlying protocol semantics , or by compromising one of the network devices. An alternative...AFRL-RV-PS- AFRL-RV-PS- TR-2013-0142 TR-2013-0142 RENDEZVOUS PROTOCOLS AND DYNAMIC FREQUENCY HOPPING INTERFERENCE DESIGN FOR ANTI-JAMMING

Space Shuttle Guidance, Navigation, and Rendezvous Knowledge Capture Reports. Revision 1

Science.gov (United States)

Goodman, John L.

2011-01-01

This document is a catalog and readers guide to lessons learned, experience, and technical history reports, as well as compilation volumes prepared by United Space Alliance personnel for the NASA/Johnson Space Center (JSC) Flight Dynamics Division.1 It is intended to make it easier for future generations of engineers to locate knowledge capture documentation from the Shuttle Program. The first chapter covers observations on documentation quality and research challenges encountered during the Space Shuttle and Orion programs. The second chapter covers the knowledge capture approach used to create many of the reports covered in this document. These chapters are intended to provide future flight programs with insight that could be used to formulate knowledge capture and management strategies. The following chapters contain descriptions of each knowledge capture report. The majority of the reports concern the Space Shuttle. Three are included that were written in support of the Orion Program. Most of the reports were written from the years 2001 to 2011. Lessons learned reports concern primarily the shuttle Global Positioning System (GPS) upgrade and the knowledge capture process. Experience reports on navigation and rendezvous provide examples of how challenges were overcome and how best practices were identified and applied. Some reports are of a more technical history nature covering navigation and rendezvous. They provide an overview of mission activities and the evolution of operations concepts and trajectory design. The lessons learned, experience, and history reports would be considered secondary sources by historians and archivists.

Guidance and navigation for rendezvous with an uncooperative target

Science.gov (United States)

Telaar, J.; Schlaile, C.; Sommer, J.

2018-06-01

This paper presents a guidance strategy for a rendezvous with an uncooperative target. In the applied design reference mission, a spiral approach is commanded ensuring a collision-free relative orbit due to e/i-vector separation. The dimensions of the relative orbit are successively reduced by Δv commands which at the same time improve the observability of the relative state. The navigation is based on line-of-sight measurements. The relative state is estimated by an extended Kalman filter (EKF). The performance of this guidance and navigation strategy is demonstrated by extensive Monte Carlo simulations taking into account all major uncertainties like measurement errors, Δv execution errors, and differential drag.

Laparoendoscopic Rendezvous for Concomitant Cholecystocholedocholithiasis: A Successful Modality Even in the Most Difficult Presentations Including Pregnancy.

Science.gov (United States)

Shirah, Bader Hamza; Mikwar, Zaher Abdulaziz; Ahmad, Akram Neyaz; Dahlan, Yaser Mohammed

2016-01-01

Background . Laparoendoscopic rendezvous (LERV) technique is emerging as an attractive treatment option for concomitant cholecystocholedocholithiasis. In this paper, we report our experience in performing the LERV technique in patients with unusual presentations in terms of anatomical difficulty, pregnancy, multiple comorbid diseases, and postlaparotomy. We aim to highlight the effectiveness of the LERV technique in some clinical situations where conventional methods would fail or carry high risks in adequately managing concomitant cholecystocholedocholithiasis. Methods . Four patients diagnosed to have concomitant cholecystocholedocholithiasis with associated difficult presentation or comorbid diseases were treated using the LERV technique. One patient presented with difficult anatomy where ERCP failed at initial attempts. Another patient was pregnant (first trimester). A third patient had complex comorbid diseases (bronchial asthma, hypertension, congestive heart failure, and end-stage renal disease on regular hemodialysis). A fourth patient had previous laparotomy and sigmoidectomy for diverticular disease and had severe hospital phobia. Results . All patients tolerated the LERV technique very well; no intraoperative occurrence was reported. The mean operative time was 86.3 ± 17.2 minutes; mean time of the endoscopic part was 29.4 ± 3.57 minutes. The mean blood loss was 44.3 ± 18.2 mL (range 20-85). Residual stone, postoperative complications, postoperative morbidity, and postoperative mortality were 0 (0%). Postoperative short hospital stay was reported in all patients, average 3 days (range 2-4). Conclusion . LERV procedure is a safe and effective treatment option for the management of concomitant cholecystocholedocholithiasis, even in difficult situations where other methods would fail or carry high risks, or in patients presenting with severe comorbid diseases or pregnancy. This procedure may emerge as an attractive alternative option for high

Endoscopic Ultrasound Guided Rendezvous Drainage of Biliary Obstruction Using a New Flexible 19-Gauge Fine Needle Aspiration Needle.

Science.gov (United States)

Tang, Zhouwen; Igbinomwanhia, Efehi; Elhanafi, Sherif; Othman, Mohamed O

2016-01-01

Background and Aim. A successful endoscopic ultrasound guided rendezvous (EUS-RV) biliary drainage is dependent on accurate puncture of the bile duct and precise guide wire manipulation across the ampulla of Vater. We aim to study the feasibility of using a flexible 19-gauge fine aspiration needle in the performance of EUS-RV biliary drainage. Method. This is a retrospective case series of EUS-RV biliary drainage procedures at a single center. Patients who failed ERCP during the same session for benign or malignant biliary obstruction underwent EUS-RV using a flexible, nitinol covered, 19-gauge needle for biliary access and guide wire manipulation. Result. 24 patients underwent EUS-RV biliary drainage via extrahepatic access while 1 attempt was via intrahepatic access. The technical success rate was 80%, including 83.3% of cases via extrahepatic access. There was no significant difference in success rate of inpatient and outpatient procedures, benign or malignant indications, or type of guide wire used. Adverse events included mild pancreatitis (3 patients) and cholangitis (1 patient). Conclusion. A flexible 19-gauge needle for biliary access can be safe and effective when used to perform EUS-RV biliary drainage. Direct comparison between the nitinol needle and conventional metal needles in the performance of EUS guided biliary drainage is needed.

Endoscopic ultrasonography-guided pancreatic duct access: techniques and literature review of pancreatography, transmural drainage and rendezvous techniques.

Science.gov (United States)

Itoi, Takao; Kasuya, Kazuhiko; Sofuni, Atsushi; Itokawa, Fumihide; Kurihara, Toshio; Yasuda, Ichiro; Nakai, Yousuke; Isayama, Hiroyuki; Moriyasu, Fuminori

2013-05-01

Endoscopic ultrasonography-guided (EUS)-guided pancreatic interventions have gained increasing attention. Here we review EUS-guided pancreatic duct (PD) access techniques and outcomes. EUS-guided PD intervention is divided into two types, antegrade and rendezvous techniques, following EUS-guided pancreatography. In the antegrade technique, pancreaticoenterostomy is carried out by stent placement between the PD and the stomach, duodenum, or jejunum. Transenteric antegrade PD stenting is conducted by stent placement, advancing anteriorly into the PD through the pancreatic tract. The rendezvous technique is carried out by using a guidewire through the papilla or anastomotic site for retrograde stent insertion. In terms of EUS-guided PD stenting, 11 case reports totaling 75 patients (35 normal anatomy, 40 altered anatomy) have been published. The technical success rate was greater than 70%. Early adverse events, including severe hematoma and severe pancreatitis,occurred in seven (63.6%) of 11 reports. Regarding the rendezvous technique, 12 case reports totaling 52 patients (22 normal anatomy, 30 altered anatomy) have been published. The technical success rate ranged from 25% to 100%. It was 48% in one report that involved more than 20 cases. Once stents were placed, all patients became free of symptoms. Early mild adverse events occurred in four (36.4%) of 11 reports. In conclusion, although it can be risky because of possible serious or even fatal adverse events, including pancreatic juice leakage, perforation and severe acute pancreatitis, EUS-PD access seems to be promising for treating symptomatic pancreatic diseases caused by PD stricture and pancreaticoenterostomy stricture. © 2013 The Authors. Digestive Endoscopy © 2013 Japan Gastroenterological Endoscopy Society.

Visual Control for Multirobot Organized Rendezvous.

Science.gov (United States)

Lopez-Nicolas, G; Aranda, M; Mezouar, Y; Sagues, C

2012-08-01

This paper addresses the problem of visual control of a set of mobile robots. In our framework, the perception system consists of an uncalibrated flying camera performing an unknown general motion. The robots are assumed to undergo planar motion considering nonholonomic constraints. The goal of the control task is to drive the multirobot system to a desired rendezvous configuration relying solely on visual information given by the flying camera. The desired multirobot configuration is defined with an image of the set of robots in that configuration without any additional information. We propose a homography-based framework relying on the homography induced by the multirobot system that gives a desired homography to be used to define the reference target, and a new image-based control law that drives the robots to the desired configuration by imposing a rigidity constraint. This paper extends our previous work, and the main contributions are that the motion constraints on the flying camera are removed, the control law is improved by reducing the number of required steps, the stability of the new control law is proved, and real experiments are provided to validate the proposal.

Radiation effects in the Si-PIN detector on the Near Earth Asteroid Rendezvous mission

CERN Document Server

Starr, R; Evans, L G; Floyd, S R; McClanahan, T P; Trombka, J I; Goldsten, J O; Maurer, R H; McNutt, R L; Roth, D R

1999-01-01

A Si-PIN photodiode is being used as a solar X-ray monitor on the X-ray/gamma-ray spectrometer experiment which is flying on the Near Earth Asteroid Rendezvous spacecraft. Since its launch in February 1996 this photodiode has experienced several brief failures. These anomalies and other performance characteristics will be described. Efforts to reproduce these failures in ground tests with flight spare equipment will also be discussed.

NEP for a Kuiper Belt Object rendezvous mission

International Nuclear Information System (INIS)

Lipinski, Ronald J.; Lenard, Roger X.; Wright, Steven A.; Houts, Michael G.; Patton, Bruce; Poston, David I.

2000-01-01

Kuiper Belt Objects (KBOs) are a recently-discovered set of solar system bodies which lie at about the orbit of Pluto (40 AU) out to about 100 astronomical units (AU). There are estimated to be about 100,000 KBOs with a diameter greater than 100 km. KBOs are postulated to be composed of the pristine material which formed our solar system and may even have organic materials in them. A detailed study of KBO size, orbit distribution, structure, and surface composition could shed light on the origins of the solar system and perhaps even on the origin of life in our solar system. A rendezvous mission including a lander would be needed to perform chemical analysis of the surface and sub-surface composition of KBOs. These requirements set the size of the science probe at around a ton. Mission analyses show that a fission-powered system with an electric thruster could rendezvous at 40 AU in about 13.0 years with a total DV of 46 km/s. It would deliver a 1000-kg science payload while providing ample onboard power for relaying data back to earth. The launch mass of the entire system (power, thrusters, propellant, navigation, communication, structure, science payload, etc.) would be 7984 kg if it were placed into an earth-escape trajectory (C=0). Alternatively, the system could be placed into a 700-km earth orbit with more propellant, yielding a total mass in LEO of 8618 kg, and then spiral out of earth orbit to arrive at the KBO in 14.3 years. To achieve this performance, a fission power system with 100 kW of electrical power and a total mass (reactor, shield, conversion, and radiator) of about 2350 kg. Three possible configurations are proposed: (1) a UZrH-fueled, NaK-cooled reactor with a steam Rankine conversion system, (2) a UN-fueled gas-cooled reactor with a recuperated Brayton conversion system, and (3) a UN-fueled heatpipe-cooled reactor with a recuperated Brayton conversion system. (Boiling and condensation in the Rankine system is a technical risk at present.) All

NEP for a Kuiper Belt Object Rendezvous Mission

International Nuclear Information System (INIS)

HOUTS, MICHAEL G.; LENARD, ROGER X.; LIPINSKI, RONALD J.; PATTON, BRUCE; POSTON, DAVID I.; WRIGHT, STEVEN A.

1999-01-01

Kuiper Belt Objects (KBOs) are a recently-discovered set of solar system bodies which lie at about the orbit of Pluto (40 AU) out to about 100 astronomical units (AU). There are estimated to be about 100,000 KBOS with a diameter greater than 100 km. KBOS are postulated to be composed of the pristine material which formed our solar system and may even have organic materials in them. A detailed study of KBO size, orbit distribution, structure, and surface composition could shed light on the origins of the solar system and perhaps even on the origin of life in our solar system. A rendezvous mission including a lander would be needed to perform chemical analysis of the surface and sub-surface composition of KBOS. These requirements set the size of the science probe at around a ton. Mission analyses show that a fission-powered system with an electric thruster could rendezvous at 40 AU in about 13.0 years with a total ΔV of 46 krnk. It would deliver a 1000-kg science payload while providing ample onboard power for relaying data back to earth. The launch mass of the entire system (power, thrusters, propellant, navigation, communication, structure, science payload, etc.) would be 7984 kg if it were placed into an earth-escape trajectory (C=O). Alternatively, the system could be placed into a 700-km earth orbit with more propellant,yielding a total mass in LEO of 8618 kg, and then spiral out of earth orbit to arrive at the KBO in 14.3 years. To achieve this performance, a fission power system with 100 kW of electrical power and a total mass (reactor, shield, conversion, and radiator) of about 2350 kg. Three possible configurations are proposed: (1) a UZrH-fueled, NaK-cooled reactor with a steam Rankine conversion system, (2) a UN-fueled gas-cooled reactor with a recuperated Brayton conversion system, and (3) a UN-fueled heatpipe-cooled reactor with a recuperated Brayton conversion system. (Boiling and condensation in the Rankine system is a technical risk at present.) All

Endoscopic Sphincterotomy Using the Rendezvous Technique for Choledocholithiasis during Laparoscopic Cholecystectomy: A Case Report.

Science.gov (United States)

Tanaka, Takayuki; Haraguchi, Masashi; Tokai, Hirotaka; Ito, Shinichiro; Kitajima, Masachika; Ohno, Tsuyoshi; Onizuka, Shinya; Inoue, Keiji; Motoyoshi, Yasuhide; Kuroki, Tamotsu; Kanemastu, Takashi; Eguchi, Susumu

2014-05-01

A 50-year-old male was examined at another hospital for fever, general fatigue and slight abdominal pain. He was treated with antibiotics and observed. However, his symptoms did not lessen, and laboratory tests revealed liver dysfunction, jaundice and an increased inflammatory response. He was then admitted to our hospital and underwent an abdominal computed tomography scan and magnetic resonance cholangiopancreatography (MRCP), which revealed common bile duct (CBD) stones. He was diagnosed with mild acute cholangitis. As the same time, he was admitted to our hospital and an emergency endoscopic retrograde cholangiopancreatography was performed. Vater papilla opening in the third portion of the duodenum and presence of a peripapillary duodenal diverticulum made it difficult to perform cannulation of the CBD. In addition, MRCP revealed that the CBD was extremely narrow (diameter 5 mm). We therefore performed laparoscopic cholecystectomy and endoscopic sphincterotomy using the rendezvous technique for choledocholithiasis simultaneously rather than laparoscopic CBD exploration. After the operation, the patient was discharged with no complications. Although the rendezvous technique has not been very commonly used because several experts in the technique and a large operating room are required, this technique is a very attractive and effective approach for treating choledocholithiasis, for which endoscopic treatment is difficult.

Endoscopic Sphincterotomy Using the Rendezvous Technique for Choledocholithiasis during Laparoscopic Cholecystectomy: A Case Report

Directory of Open Access Journals (Sweden)

Takayuki Tanaka

2014-08-01

Full Text Available A 50-year-old male was examined at another hospital for fever, general fatigue and slight abdominal pain. He was treated with antibiotics and observed. However, his symptoms did not lessen, and laboratory tests revealed liver dysfunction, jaundice and an increased inflammatory response. He was then admitted to our hospital and underwent an abdominal computed tomography scan and magnetic resonance cholangiopancreatography (MRCP, which revealed common bile duct (CBD stones. He was diagnosed with mild acute cholangitis. As the same time, he was admitted to our hospital and an emergency endoscopic retrograde cholangiopancreatography was performed. Vater papilla opening in the third portion of the duodenum and presence of a peripapillary duodenal diverticulum made it difficult to perform cannulation of the CBD. In addition, MRCP revealed that the CBD was extremely narrow (diameter 5 mm. We therefore performed laparoscopic cholecystectomy and endoscopic sphincterotomy using the rendezvous technique for choledocholithiasis simultaneously rather than laparoscopic CBD exploration. After the operation, the patient was discharged with no complications. Although the rendezvous technique has not been very commonly used because several experts in the technique and a large operating room are required, this technique is a very attractive and effective approach for treating choledocholithiasis, for which endoscopic treatment is difficult.

首次交会对接任务发射场加注安全保障改进%Improvement of safety assurance conditions during spacecraft propellant injection procedure for China's first rendezvous and docking mission

Institute of Scientific and Technical Information of China (English)

罗克; 冯雷

2011-01-01

载人航天器加注是航天器研制过程中安全风险最高、危险作业工序最多的环节,必须采取严密的安全防护措施,确保万无一失.通过实践探索积累经验,全面周密的设计论证,对原有加注硬件条件进行改造,工作流程进行优化,从而大幅提高本质安全度,并在首次交会对接任务中加以应用和验证,取得了良好的效果,圆满完成了“天宫一号”、“神舟八号”发射任务的加注工作.%The propellant injection for spacecraft at the launch site is the most dangerous procedure in the whole R&D process, which involves many dangerous operations. Strict protective measures must be taken to avoid any mistakes. Based on the experience of previous practices, and by adequate design and discussion aimed at improving the current hardware conditions, the operation procedures for propellant injection of spacecrafts are optimized with a great enhancement of the intrinsic safety. These approaches have been applied in China's first rendezvous and docking mission, which brings about successful accomplishment of the propellant injection of the Tiangong-Ⅰ and Shenzhou-Ⅷ spacecraft.

Endo-laparoscopic rendezvous approach for pericardia with gastric posterior wall of gastrointestinal stromal tumor: Analysis of 52 consecutive cases

Directory of Open Access Journals (Sweden)

Po Ding

2014-01-01

Conclusions: Endo-laparoscopic rendezvous approach is considered to represent the next revolution in surgery. The new technique is reliable and effective in clinical application, due to the advantages of accurate and quick localization for pericardial GIST within gastric posterior wall.

Autonomous rendezvous and docking operations of unmanned expendable cargo transfer vehicles (e.g. Centaur) with Space Station Freedom

Science.gov (United States)

Emmet, Brian R.

1991-01-01

This paper describes the results of the feasibility study using Centaur or other CTV's to deliver payloads to the Space Station Freedom (SSF). During this study was examined the requirements upon unmanned cargo transfer stages (including Centaur) for phasing, rendezvous, proximity operations and docking/berthing (capture).

Video-Guidance Design for the DART Rendezvous Mission

Science.gov (United States)

Ruth, Michael; Tracy, Chisholm

2004-01-01

NASA's Demonstration of Autonomous Rendezvous Technology (DART) mission will validate a number of different guidance technologies, including state-differenced GPS transfers and close-approach video guidance. The video guidance for DART will employ NASA/Marshall s Advanced Video Guidance Sensor (AVGS). This paper focuses on the terminal phase of the DART mission that includes close-approach maneuvers under AVGS guidance. The closed-loop video guidance design for DART is driven by a number of competing requirements, including a need for maximizing tracking bandwidths while coping with measurement noise and the need to minimize RCS firings. A range of different strategies for attitude control and docking guidance have been considered for the DART mission, and design decisions are driven by a goal of minimizing both the design complexity and the effects of video guidance lags. The DART design employs an indirect docking approach, in which the guidance position targets are defined using relative attitude information. Flight simulation results have proven the effectiveness of the video guidance design.

Thermo-mechanical Characterisation of In-plane Properties for CSM E-glass Epoxy Polymer Composite Materials

DEFF Research Database (Denmark)

Jakobsen, Johnny; Jensen, Martin; Andreasen, Jens Henrik

2013-01-01

The in-plane Young’s modulus of a CSM E-glass/epoxy material is characterised through the use of dynamic mechanical analysis (DMA). The measured data is used to generate material models which describe the property behaviour as a function of conversion and temperature. Gelation of the epoxy resin...... plays a major role in the modulus development and is measured directly on the glass/epoxy material. The Young’s modulus is described through a bi-functional model including the liquid/solid transition of the material. The evolution of Young’s modulus is modelled by decoupling modulus increments caused...... by time and temperature, and is graphically illustrated through a Modulus-Temperature- Transformation (MTT) diagram. Based on the established material models presented in this paper and models in Part-1, it is feasible to assess residual stresses and shape distortions of composite parts made from...

Robust control for constant thrust rendezvous under thrust failure

Directory of Open Access Journals (Sweden)

Qi Yongqiang

2015-04-01

Full Text Available A robust constant thrust rendezvous approach under thrust failure is proposed based on the relative motion dynamic model. Firstly, the design problem is cast into a convex optimization problem by introducing a Lyapunov function subject to linear matrix inequalities. Secondly, the robust controllers satisfying the requirements can be designed by solving this optimization problem. Then, a new algorithm of constant thrust fitting is proposed through the impulse compensation and the fuel consumption under the theoretical continuous thrust and the actual constant thrust is calculated and compared by using the method proposed in this paper. Finally, the proposed method having the advantage of saving fuel is proved and the actual constant thrust switch control laws are obtained through the isochronous interpolation method, meanwhile, an illustrative example is provided to show the effectiveness of the proposed control design method.

Laparoendoscopic Rendezvous for Concomitant Cholecystocholedocholithiasis: A Successful Modality Even in the Most Difficult Presentations Including Pregnancy

Directory of Open Access Journals (Sweden)

Bader Hamza Shirah

2016-01-01

Full Text Available Background. Laparoendoscopic rendezvous (LERV technique is emerging as an attractive treatment option for concomitant cholecystocholedocholithiasis. In this paper, we report our experience in performing the LERV technique in patients with unusual presentations in terms of anatomical difficulty, pregnancy, multiple comorbid diseases, and postlaparotomy. We aim to highlight the effectiveness of the LERV technique in some clinical situations where conventional methods would fail or carry high risks in adequately managing concomitant cholecystocholedocholithiasis. Methods. Four patients diagnosed to have concomitant cholecystocholedocholithiasis with associated difficult presentation or comorbid diseases were treated using the LERV technique. One patient presented with difficult anatomy where ERCP failed at initial attempts. Another patient was pregnant (first trimester. A third patient had complex comorbid diseases (bronchial asthma, hypertension, congestive heart failure, and end-stage renal disease on regular hemodialysis. A fourth patient had previous laparotomy and sigmoidectomy for diverticular disease and had severe hospital phobia. Results. All patients tolerated the LERV technique very well; no intraoperative occurrence was reported. The mean operative time was 86.3±17.2 minutes; mean time of the endoscopic part was 29.4±3.57 minutes. The mean blood loss was 44.3±18.2 mL (range 20–85. Residual stone, postoperative complications, postoperative morbidity, and postoperative mortality were 0 (0%. Postoperative short hospital stay was reported in all patients, average 3 days (range 2–4. Conclusion. LERV procedure is a safe and effective treatment option for the management of concomitant cholecystocholedocholithiasis, even in difficult situations where other methods would fail or carry high risks, or in patients presenting with severe comorbid diseases or pregnancy. This procedure may emerge as an attractive alternative option for high

Randomised study on single stage laparo-endoscopic rendezvous (intra-operative ERCP procedure versus two stage approach (Pre-operative ERCP followed by laparoscopic cholecystectomy for the management of cholelithiasis with choledocholithiasis

Directory of Open Access Journals (Sweden)

Manash Ranjan Sahoo

2014-01-01

Full Text Available Introduction : The ′Rendezvous′ technique consists of laparoscopic cholecystectomy (LC standards with intra-operative cholangiography followed by endoscopic sphincterotomy. The sphincterotome is driven across the papilla through a guidewire inserted by the transcystic route. In this study, we intended to compare the two methods in a prospective randomised trial. Materials And Methods: From 2005 to 2012, we enrolled 83 patients with a diagnosis of cholecysto-choledocolithiasis. They were randomised into two groups. In ′group-A′,41 patients were treated with two stages management, first by pre-operative endoscopic retrograde cholangiopancreatography (ERCP and common bile duct (CBD clearance and second by LC. In ′group-B′, 42 patients were treated with LC and intra-operative cholangiography; and when diagnosis of choledocholithiasis was confirmed, patients had undergone one stage management of by Laparo-endoscopic Rendezvous technique. Results: In arm-A and arm-B groups, complete CBD clearance was achieved in 29 and 38 patients, respectively. Failure of the treatment in arm-A was 29% and in arm-B was 9.5%. In arm-A, selective CBD cannulation was achieved in 33 cases (80.5% and in arm-B in 39 cases (93%. In arm-Agroup, post-ERCP hyperamylasia was presented in nine patients (22% and severe pancreatitis in five patients (12% versus none of the patients (0% in arm-B group, respectively. Mean post-operative hospital stay in arm-A and arm-B groups are 10.9 and 6.8 days, respectively. Conclusion: One stage laparo-endoscopic rendezvous approach increases selective cannulation of CBD, reduces post-ERCP pancreatitis, reduces days of hospital stay, increases patient′s compliance and prevents unnecessary intervention to CBD.

Endoscopic Ultrasound-Guided Rendezvous Technique for Failed Biliary Cannulation in Benign and Resectable Malignant Biliary Disorders.

Science.gov (United States)

Shiomi, Hideyuki; Yamao, Kentaro; Hoki, Noriyuki; Hisa, Takeshi; Ogura, Takeshi; Minaga, Kosuke; Masuda, Atsuhiro; Matsumoto, Kazuya; Kato, Hironari; Kamada, Hideki; Goto, Daisuke; Imai, Hajime; Takenaka, Mamoru; Noguchi, Chishio; Nishikiori, Hidefumi; Chiba, Yasutaka; Kutsumi, Hiromu; Kitano, Masayuki

2018-03-01

Endoscopic ultrasound-guided rendezvous technique (EUS-RV) has emerged as an effective salvage method for unsuccessful biliary cannulation. However, its application for benign and resectable malignant biliary disorders has not been fully evaluated. To assess the efficacy and safety of EUS-RV for benign and resectable malignant biliary disorders. This was a multicenter prospective study from 12 Japanese referral centers. Patients who underwent EUS-RV after failed biliary cannulation for biliary disorder were candidates for this study. Inclusion criteria were unsuccessful biliary cannulation for therapeutic endoscopic retrograde cholangiopancreatography with benign and potentially resectable malignant biliary obstruction. Exclusion criteria included unresectable malignant biliary obstruction, inaccessible papillae due to surgically altered upper gastrointestinal anatomy or duodenal stricture, and previous sphincterotomy and/or biliary stent placement. The primary outcome was the technical success rate of biliary cannulation; procedure time, adverse events, and clinical outcomes were secondary outcomes. Twenty patients were prospectively enrolled. The overall technical success rate and median procedure time were 85% and 33 min, respectively. Guidewire manipulation using a 4-Fr tapered tip catheter contributed to the success in advancing the guidewire into the duodenum. Adverse events were identified in 15% patients, including 2 with biliary peritonitis and 1 mild pancreatitis. EUS-RV did not affect surgical maneuvers or complications associated with surgery, or postoperative course. EUS-RV may be a safe and feasible salvage method for unsuccessful biliary cannulation for benign or resectable malignant biliary disorders. Use of a 4-Fr tapered tip catheter may improve the overall EUS-RV success rate.

The rendezvous technique involving insertion of a guidewire in a percutaneous transhepatic gallbladder drainage tube for biliary access in a case of difficult biliary cannulation.

Science.gov (United States)

Sunada, Fumiko; Morimoto, Naoki; Tsukui, Mamiko; Kurata, Hidekazu

2017-05-01

Endoscopic retrograde cholangiopancreatography (ERCP) is a diagnostic method and treatment approach for biliary diseases. However, biliary cannulation can be difficult in some cases. We performed ERCP in a 97-year-old woman with abdominal pain resulting from acute cholangitis caused by choledocholithiasis and observed difficult biliary cannulation. Eventually, the patient was successfully treated with the rendezvous technique. We could not cannulate the biliary duct during ERCP twice. Therefore, we placed a percutaneous transhepatic gallbladder drainage (PTGBD) tube without intrahepatic dilation. The rendezvous technique was performed using the PTGBD tube. The patient did not experience pancreatitis or perforation.

Laparoendoscopic rendezvous in the treatment of cholecysto-choledocholitiasis: a single series of 200 patients.

Science.gov (United States)

La Barba, Giuliano; Gardini, Andrea; Cavargini, Elena; Casadei, Alessandro; Morgagni, Paolo; Bazzocchi, Francesca; D'Acapito, Fabrizio; Cavaliere, Davide; Curti, Roberta; Tringali, Domenico; Cucchetti, Alessandro; Ercolani, Giorgio

2018-02-27

Although the ideal management of cholecysto-choledocholitiasis is controversial, the two-stage approach, namely the common bile duct (CBD) clearance through endoscopic retrograde cholangiopancreatography (ERCP) followed by laparoscopic cholecystectomy, remains the standard way of management. However, whenever feasible, the one-stage approach, using the so-called "laparoendoscopic rendezvous" (LERV) technique, offers some advantages, mainly reducing the hospital stay and the risk of post-ERCP pancreatitis. The aim of this study was to evaluate the safety and the efficacy of the one-stage approach, and to compare our results with data from available large studies. We reviewed our series of consecutive patients with cholecysto-choledocholitiasis treated by LERV from January 2003, to October 2016. Both elective and emergency cases were included. The primary end-point was the efficacy to obtain the CBD stones clearance. Secondary end-points were morbidity and mortality, operative time, conversion rate, and in-hospital stay. A total of 200 patients underwent a LERV procedure for the intra-operative diagnosis by intra-operative cholangiogram of cholecysto-choledocholitiasis. In 187 patients (93.5%), it was possible to cannulate the cystic duct with the jag-wire. Success rate was 95%. Conversion rate was 3%. The mean operative time was 135 min and the mean in-hospital stay was 4 days. 29 (14.5%) were the early complications, six mild pancreatitis. Four patients required re-operation during the hospital stay. 11 patients (5.5%) developed late complications during a median follow-up of 57.7 months. Our results confirm that LERV technique is a safe procedure with high success rates for the treatment of cholecysto-choledocholitiasis. The major advantages include the single-stage treatment, the shorter hospital stay, and the lower incidence of post-ERCP pancreatitis.

Rendezvous, proximity operations and capture quality function deployment report

Science.gov (United States)

Lamkin, Stephen L. (Editor)

1991-01-01

Rendezvous, Proximity Operations, and Capture (RPOC) is a missions operations area which is extremely important to present and future space initiatives and must be well planned and coordinated. To support this, a study team was formed to identify a specific plan of action using the Quality Function Deployment (QFD) process. This team was composed of members from a wide spectrum of engineering and operations organizations which are involved in the RPOC technology area. The key to this study's success is an understanding of the needs of potential programmatic customers and the technology base available for system implementation. To this end, the study team conducted interviews with a variety of near term and future programmatic customers and technology development sponsors. The QFD activity led to a thorough understanding of the needs of these customers in the RPOC area, as well as the relative importance of these needs.

Rendezvous, proximity operations and capture quality function deployment report

Science.gov (United States)

Lamkin, Stephen L.

1991-12-01

Rendezvous, Proximity Operations, and Capture (RPOC) is a missions operations area which is extremely important to present and future space initiatives and must be well planned and coordinated. To support this, a study team was formed to identify a specific plan of action using the Quality Function Deployment (QFD) process. This team was composed of members from a wide spectrum of engineering and operations organizations which are involved in the RPOC technology area. The key to this study's success is an understanding of the needs of potential programmatic customers and the technology base available for system implementation. To this end, the study team conducted interviews with a variety of near term and future programmatic customers and technology development sponsors. The QFD activity led to a thorough understanding of the needs of these customers in the RPOC area, as well as the relative importance of these needs.

A Review of Tiangong-1/Shenzhou-8 Rendezvous and Docking Mission%天宫一号／神舟八号交会对接任务总体评述

Institute of Scientific and Technical Information of China (English)

周建平

2012-01-01

The complete success of Tiangong-1/Shenzhou-8 rendezvous and docking mission represents a great breakthrough of China in space rendezvous and docking technology. A basic introduction of Tiangong-land Shenzhou-8 rendezvous and docking mission is presented, with the general evaluation of the mission and its main achievements being put forward.%天宫一号／神舟八号交会对接任务圆满成功，标志着我国空间交会对接技术取得重大突破。本文介绍了天宫一号目标飞行器与神舟八号飞船交会对接飞行任务的基本情况、总体评价及主要成果。

La formation continue des usagers : évaluation qualitative des rendez-vous d'évaluation post-permis pour les conducteurs novices. Thème 11. Rapport final

OpenAIRE

CHATENET, F; TORRES, S; GAUTHIER, P; PERVANCHON, M

2001-01-01

Rapport final de convention DSCR/INRETS. Le présent rapport fait état de l'évaluation qualitative des rendez-vous d'évaluation (RVE) pour les conducteurs novices, le volet des rendez-vous de perfectionnement (RVP) pour les conducteurs expérimentés sera abordé ultérieurement dans le cadre d'une convention DSCR/INRETS. La première partie développe les problématiques et les objectifs poursuivis par cette étude ainsi que la méthodologie qui a été utilisée. Les trois autres parties présentent les...

Usefulness of the 'Rendezvous' Technique in Living Related Right Liver Donors with Postoperative Biliary Leakage from Bile Duct Anastomosis

International Nuclear Information System (INIS)

Miraglia, R.; Traina, M.; Maruzzelli, L.; Caruso, S.; Di Pisa, M.; Gruttadauria, S.; Luca, A.; Gridelli, B.

2008-01-01

This is a report on two cases of large bile leak following right hepatectomy performed for living related liver transplantation, originating from the stump of the ligated right bile duct, and treated with the placement of large percutaneous biliary catheters through a combined percutaneous transhepatic and endoscopic approach (rendezvous technique).

Transluminal recanalization of chronic total occlusion of radial artery using rendezvous technique: a case report and literature review.

Science.gov (United States)

Arabi, Mohammad; Ahmed, Ishtiaq; Qattan, Nabeel

2014-01-01

Although endovascular management of lower extremity peripheral arterial disease (PAD) is well studied, little information exists regarding endovascular treatment of critical upper limb ischemia. We report a case of transluminal recanalization of right radial artery chronic total occlusion (CTO) using rendezvous technique in a patient with critical hand ischemia and dry gangrene of the right index finger.

System and Method for Automated Rendezvous, Docking and Capture of Autonomous Underwater Vehicles

Science.gov (United States)

Stone, William C. (Inventor); Clark, Evan (Inventor); Richmond, Kristof (Inventor); Paulus, Jeremy (Inventor); Kapit, Jason (Inventor); Scully, Mark (Inventor); Kimball, Peter (Inventor)

2018-01-01

A system for automated rendezvous, docking, and capture of autonomous underwater vehicles at the conclusion of a mission comprising of comprised of a docking rod having lighted, pulsating (in both frequency and light intensity) series of LED light strips thereon, with the LEDs at a known spacing, and the autonomous underwater vehicle specially designed to detect and capture the docking rod and then be lifted structurally by a spherical end strop about which the vehicle can be pivoted and hoisted up (e.g., onto a ship). The method of recovery allows for very routine and reliable automated recovery of an unmanned underwater asset.

Transluminal Recanalization of Chronic Total Occlusion of Radial Artery Using Rendezvous Technique: A Case Report and Literature Review

Directory of Open Access Journals (Sweden)

Mohammad Arabi

2014-01-01

Full Text Available Although endovascular management of lower extremity peripheral arterial disease (PAD is well studied, little information exists regarding endovascular treatment of critical upper limb ischemia. We report a case of transluminal recanalization of right radial artery chronic total occlusion (CTO using rendezvous technique in a patient with critical hand ischemia and dry gangrene of the right index finger.

"Ultra-rapid" sequential treatment in cholecystocholedocholithiasis: alternative same-day approach to laparoendoscopic rendezvous.

Science.gov (United States)

Borreca, Dario; Bona, Alberto; Bellomo, Maria Paola; Borasi, Andrea; De Paolis, Paolo

2015-12-01

There is still no consensus about timing of laparoscopic cholecystectomy after endoscopic retrograde cholangiopancreatography in the treatment of cholecystocholedocholithiasis. The aim of our retrospective study is to analyze the optimal timing of surgical treatment in patients presenting concurrent choledocholithiasis, choosing to perform a sequential endoscopic plus surgical approach, introducing a same-day two-stage alternative. All cases of cholecystocholedocholithiasis occurred between January 2007 and December 2014 in "Gradenigo" Hospital (Turin-Italy) were reviewed. Patients were divided into three groups, based on the timing of cholecystectomy after endoscopic retrograde cholangiopancreatography, and compared. Out of 2233 cholecystectomies performed in the mentioned time interval, have been identified 93 patients that fulfill the selection criteria. 36 patients were treated with a same-day approach, while 29 within first 72 h and 28 with delayed surgery. The overall length of stay was significantly lower in patients that were treated with a same-day approach (4.7 days), compared with other groups (p = 0.001), while no significant differences were found in terms of length of surgical intervention, intraoperative complications and conversions to open procedure, postoperative stay, morbidity and mortality. Patients treated with delayed surgery had a 18 % recurrency rate of biliary events, with an odds ratio of 14.13 (p = 0.018). Same-day two-stage approach should be performed in suitable patients at the index admission, reducing overall risks, improving the patients' quality-of-life, preventing recurrency, leading to a significant cost abatement; furthermore, this approach allows same outcomes of laparoendoscopic rendezvous, avoiding technical and organizational troubles.

Guidance and Control of Position and Attitude for Rendezvous and Dock/Berthing with a Noncooperative/Target Spacecraft

Directory of Open Access Journals (Sweden)

Gilberto Arantes

2014-01-01

Full Text Available Noncooperative target spacecrafts are those assets in orbit that cannot convey any information about their states (position, attitude, and velocities or facilitate rendezvous and docking/berthing (RVD/B process. Designing a guidance, navigation, and control (GNC module for the chaser in a RVD/B mission with noncooperative target should be inevitably solved for on-orbit servicing technologies. The proximity operations and the guidance for achieving rendezvous problems are addressed in this paper. The out-of-plane maneuvers of proximity operations are explored with distinct subphases, including a chaser far approach in the target’s orbit to the first hold point and a closer approach to the final berthing location. Accordingly, guidance solutions are chosen for each subphase from the standard Hill based Closhessy-Willtshire (CW solution, elliptical fly-around, and Glideslope algorithms. The control is based on a linear quadratic regulator approach (LQR. At the final berthing location, attitude tracker based on a proportional derivative (PD form is tested to synchronize the chaser and target attitudes. The paper analyzes the performance of both controllers in terms of the tracking ability and the robustness. Finally, it prescribes any restrictions that may be imposed on the guidance during any subphase which can help to improve the controllers tracking ability.

Combined Radial and Femoral Access Strategy and Radial-Femoral Rendezvous in Patients With Long and Complex Iliac Occlusions.

Science.gov (United States)

Hanna, Elias B; Mogabgab, Owen N; Baydoun, Hassan

2018-01-01

We present cases of complex, calcified iliac occlusive disease revascularized via a combined radial-femoral access strategy. Through a 6-French, 125-cm transradial guiding catheter, antegrade guidewires and catheters are advanced into the iliac occlusion, while retrograde devices are advanced transfemorally. The transradial and transfemoral channels communicate, allowing the devices to cross the occlusion into the true lumen (radial-femoral antegrade-retrograde rendezvous).

Pollinators' mating rendezvous and the evolution of floral advertisement.

Science.gov (United States)

Fishman, Michael A; Hadany, Lilach

2013-01-07

Successful cross-fertilization in plant species that rely on animal pollinators depends not just on the number of pollinator visits, but also on these visits' duration. Furthermore, in non-deceptive pollination, a visit's duration depends on the magnitude of the reward provided to the pollinator. Accordingly, plants that rely on biotic pollination have to partition their investment in cross-fertilization assurance between attracting pollinator visits - advertisement, and rewarding visitors to assure that the visit is of productive duration. Here we analyze these processes by a combination of optimality methods and game theoretical modeling. Our results indicate that the optimality in such allocation of resources depends on the types of reward offered to the pollinators. More precisely, we show that plants that offer both food reward and mating rendezvous to pollinators will evolve to allocate a higher proportion of their cross-fertilization assurance budget to advertisement than plants that offer only food reward. That is, our results indicate that pollinators' mating habits may play a role in floral evolution. Copyright © 2012 Elsevier Ltd. All rights reserved.

Rendezvous technique treatment for late-onset biliary leakage after major hepatectomy of a living donor: report of a case.

Science.gov (United States)

Kimura, Koichi; Ikegami, Toru; Yamashita, Yo-ichi; Saeki, Hiroshi; Oki, Eiji; Yoshizumi, Tomoharu; Uchiyama, Hideaki; Kawanaka, Hirofumi; Soejima, Yuji; Morita, Masaru; Shirabe, Ken; Ikeda, Tetsuo; Maehara, Yoshihiko

2013-09-01

Biliary leakage is a major complication after hepatectomy. We report the case of a living-donor liver transplantation (LDLT) donor with a late-onset bile leak from the trifurcation of the hepatic duct who was successfully treated using rendezvous technique. A 52-year-old man underwent extended left hepatectomy for donation and was discharged on postoperative day (PD) 13. However, he was rehospitalized on PD 26 with severe abdominal pain. Physical examination suggested panperitonitis, and abdominocentesis showed bilious ascites. Emergent laparotomy for biliary leakage and peritonitis was performed. There was bilious ascites in the peritoneal cavity. A biliary fistula was recognized at the trifurcation of B8a, B8b, and B5. Intraoperative transhepatic biliary drainage of each bile duct was performed. Endoscopic transpapillary drainage was performed on PD 24. Finally, external drains were removed and complete internal drainage established on PD 70. The bile leak was considered to be the result of injury from electrocautery device. Appropriate making choices of the electrocautery devices enable us to avoid over thermal injury of the liver surface. Rendezvous bidirectional drainage effectively treated late-onset bile leakage from the trifurcation of a hepatic bile duct.

Robust control for spacecraft rendezvous system with actuator unsymmetrical saturation: a gain scheduling approach

Science.gov (United States)

Wang, Qian; Xue, Anke

2018-06-01

This paper has proposed a robust control for the spacecraft rendezvous system by considering the parameter uncertainties and actuator unsymmetrical saturation based on the discrete gain scheduling approach. By changing of variables, we transform the actuator unsymmetrical saturation control problem into a symmetrical one. The main advantage of the proposed method is improving the dynamic performance of the closed-loop system with a region of attraction as large as possible. By the Lyapunov approach and the scheduling technology, the existence conditions for the admissible controller are formulated in the form of linear matrix inequalities. The numerical simulation illustrates the effectiveness of the proposed method.

Multi-Sensor Testing for Automated Rendezvous and Docking Sensor Testing at the Flight Robotics Laboratory

Science.gov (United States)

Brewster, L.; Johnston, A.; Howard, R.; Mitchell, J.; Cryan, S.

2007-01-01

The Exploration Systems Architecture defines missions that require rendezvous, proximity operations, and docking (RPOD) of two spacecraft both in Low Earth Orbit (LEO) and in Low Lunar Orbit (LLO). Uncrewed spacecraft must perform automated and/or autonomous rendezvous, proximity operations and docking operations (commonly known as AR&D). The crewed missions may also perform rendezvous and docking operations and may require different levels of automation and/or autonomy, and must provide the crew with relative navigation information for manual piloting. The capabilities of the RPOD sensors are critical to the success of the Exploration Program. NASA has the responsibility to determine whether the Crew Exploration Vehicle (CEV) contractor proposed relative navigation sensor suite will meet the requirements. The relatively low technology readiness level of AR&D relative navigation sensors has been carried as one of the CEV Project's top risks. The AR&D Sensor Technology Project seeks to reduce the risk by the testing and analysis of selected relative navigation sensor technologies through hardware-in-the-loop testing and simulation. These activities will provide the CEV Project information to assess the relative navigation sensors maturity as well as demonstrate test methods and capabilities. The first year of this project focused on a series of"pathfinder" testing tasks to develop the test plans, test facility requirements, trajectories, math model architecture, simulation platform, and processes that will be used to evaluate the Contractor-proposed sensors. Four candidate sensors were used in the first phase of the testing. The second phase of testing used four sensors simultaneously: two Marshall Space Flight Center (MSFC) Advanced Video Guidance Sensors (AVGS), a laser-based video sensor that uses retroreflectors attached to the target vehicle, and two commercial laser range finders. The multi-sensor testing was conducted at MSFC's Flight Robotics Laboratory (FRL

Multi-Sensor Testing for Automated Rendezvous and Docking Sensor Testing at the Flight Robotics Lab

Science.gov (United States)

Brewster, Linda L.; Howard, Richard T.; Johnston, A. S.; Carrington, Connie; Mitchell, Jennifer D.; Cryan, Scott P.

2008-01-01

The Exploration Systems Architecture defines missions that require rendezvous, proximity operations, and docking (RPOD) of two spacecraft both in Low Earth Orbit (LEO) and in Low Lunar Orbit (LLO). Uncrewed spacecraft must perform automated and/or autonomous rendezvous, proximity operations and docking operations (commonly known as AR&D). The crewed missions may also perform rendezvous and docking operations and may require different levels of automation and/or autonomy, and must provide the crew with relative navigation information for manual piloting. The capabilities of the RPOD sensors are critical to the success ofthe Exploration Program. NASA has the responsibility to determine whether the Crew Exploration Vehicle (CEV) contractor-proposed relative navigation sensor suite will meet the requirements. The relatively low technology readiness level of AR&D relative navigation sensors has been carried as one of the CEV Project's top risks. The AR&D Sensor Technology Project seeks to reduce the risk by the testing and analysis of selected relative navigation sensor technologies through hardware-in-the-Ioop testing and simulation. These activities will provide the CEV Project information to assess the relative navigation sensors maturity as well as demonstrate test methods and capabilities. The first year of this project focused on a series of "pathfinder" testing tasks to develop the test plans, test facility requirements, trajectories, math model architecture, simulation platform, and processes that will be used to evaluate the Contractor-proposed sensors. Four candidate sensors were used in the first phase of the testing. The second phase of testing used four sensors simultaneously: two Marshall Space Flight Center (MSFC) Advanced Video Guidance Sensors (AVGS), a laser-based video sensor that uses retroreflectors attached to the target vehicle, and two commercial laser range finders. The multi-sensor testing was conducted at MSFC's Flight Robotics Laboratory (FRL

Revision of the dosimetric parameters of the CSM11 LDR Cs-137 source.

Science.gov (United States)

Otal, Antonio; Martínez-Fernández, Juan Manuel; Granero, Domingo

2011-03-01

The clinical use of brachytherapy sources requires the existence of dosimetric data with enough of quality for the proper application of treatments in clinical practice. It has been found that the published data for the low dose rate CSM11 Cs-137 source lacks of smoothness in some regions because the data are too noisy. The purpose of this study was to calculate the dosimetric data for this source in order to provide quality dosimetric improvement of the existing dosimetric data of Ballester et al . [1]. In order to obtain the dose rate distributions Monte Carlo simulations were done using the GEANT4 code. A spherical phantom 40 cm in radius with the Cs-137 source located at the centre of the phantom was used. The results from Monte Carlo simulations were applied to derive AAPM Task Group 43 dosimetric parameters: anisotropy function, radial dose function, air kerma strength and dose rate constant. The dose rate constant obtained was 1.094 ± 0.002 cGy h -1 U -1 . The new calculated data agrees within experimental uncertainties with the existing data of Ballester et al . but without the statistical noise of that study. The obtained data presently fulfills all the requirements of the TG-43U1 update and thus it can be used in clinical practice.

Asteroid Rendezvous Mission Design Using Multiobjective Particle Swarm Optimization

Directory of Open Access Journals (Sweden)

Ya-zhong Luo

2014-01-01

Full Text Available A new preliminary trajectory design method for asteroid rendezvous mission using multiobjective optimization techniques is proposed. This method can overcome the disadvantages of the widely employed Pork-Chop method. The multiobjective integrated launch window and multi-impulse transfer trajectory design model is formulated, which employes minimum-fuel cost and minimum-time transfer as two objective functions. The multiobjective particle swarm optimization (MOPSO is employed to locate the Pareto solution. The optimization results of two different asteroid mission designs show that the proposed approach can effectively and efficiently demonstrate the relations among the mission characteristic parameters such as launch time, transfer time, propellant cost, and number of maneuvers, which will provide very useful reference for practical asteroid mission design. Compared with the PCP method, the proposed approach is demonstrated to be able to provide much more easily used results, obtain better propellant-optimal solutions, and have much better efficiency. The MOPSO shows a very competitive performance with respect to the NSGA-II and the SPEA-II; besides a proposed boundary constraint optimization strategy is testified to be able to improve its performance.

Rendezvous with connectivity preservation for multi-robot systems with an unknown leader

Science.gov (United States)

Dong, Yi

2018-02-01

This paper studies the leader-following rendezvous problem with connectivity preservation for multi-agent systems composed of uncertain multi-robot systems subject to external disturbances and an unknown leader, both of which are generated by a so-called exosystem with parametric uncertainty. By combining internal model design, potential function technique and adaptive control, two distributed control strategies are proposed to maintain the connectivity of the communication network, to achieve the asymptotic tracking of all the followers to the output of the unknown leader system, as well as to reject unknown external disturbances. It is also worth to mention that the uncertain parameters in the multi-robot systems and exosystem are further allowed to belong to unknown and unbounded sets when applying the second fully distributed control law containing a dynamic gain inspired by high-gain adaptive control or self-tuning regulator.

Surgery in biliary lithiasis: from the traditional "open" approach to laparoscopy and the "rendezvous" technique.

Science.gov (United States)

Tarantino, Giuseppe; Magistri, Paolo; Ballarin, Roberto; Assirati, Giacomo; Di Cataldo, Antonio; Di Benedetto, Fabrizio

2017-12-15

According to the current literature, biliary lithiasis is a worldwide-diffused condition that affects almost 20% of the general population. The rate of common bile duct stones (CBDS) in patients with symptomatic cholelithiasis is estimated to be 10% to 33%, depending on patient's age. Compared to stones in the gallbladder, the natural history of secondary CBDS is still not completely understood. It is not clear whether an asymptomatic choledocholithiasis requires treatment or not. For many years, open cholecystectomy with choledochotomy and/or surgical sphincterotomy and cleaning of the bile duct were the gold standard to treat both pathologies. Development of both endoscopic retrograde cholangiopancreatography (ERCP) and laparoscopic surgery, together with improvements in diagnostic procedures, influenced new approaches to the management of CBDS in association with gallstones. We decided to systematically review the literature in order to identify all the current therapeutic options for CBDS. A systematic literature search was performed independently by two authors using PubMed, EMBASE, Scopus and the Cochrane Library Central. The therapeutic approach nowadays varies greatly according to the availability of experience and expertise in each center, and includes open or laparoscopic common bile duct exploration, various combinations of laparoscopic cholecystectomy and ERCP and combined laparoendoscopic rendezvous. Although ERCP followed by laparoscopic cholecystectomy is currently preferred in the majority of hospitals worldwide, the optimal treatment for concomitant gallstones and CBDS is still under debate, and greatly varies among different centers. Copyright © 2017 The Editorial Board of Hepatobiliary & Pancreatic Diseases International. Published by Elsevier B.V. All rights reserved.

Sheath rendezvous method: a novel distal protection technique during endovascular treatment of subclavian artery occlusions.

Science.gov (United States)

Haraguchi, Takuya; Urasawa, Kazushi; Nakama, Tatsuya; Nakagawa, Yuya; Tan, Michinao; Koshida, Ryoji; Sato, Katsuhiko

2016-10-01

To describe an innovative distal protection technique, "sheath rendezvous method", during endovascular treatment for subclavian arterial occlusions. 4.5F and 6F guiding sheath were inserted from left brachial and common femoral artery, respectively. 0.014″ guidewire retrogradely passed through occlusion and into antegrade sheath to establish a pull-through system. 3.0 mm balloon was used to expand occlusion and anchor to deliver retrograde sheath into antegrade one. Both sheaths locked by balloon dilatation crossed occlusion until antegrade sheath passed over lesion. Balloon expandable stent was delivered within antegrade sheath. Sheath was removed, and stent was implanted. We obtained an excellent outcome without complications.

Interstellar rendezvous missions employing fission propulsion systems

International Nuclear Information System (INIS)

Lenard, Roger X.; Lipinski, Ronald J.

2000-01-01

There has been a conventionally held nostrum that fission system specific power and energy content is insufficient to provide the requisite high accelerations and velocities to enable interstellar rendezvous missions within a reasonable fraction of a human lifetime. As a consequence, all forms of alternative mechanisms that are not yet, and may never be technologically feasible, have been proposed, including laser light sails, fusion and antimatter propulsion systems. In previous efforts, [Lenard and Lipinski, 1999] the authors developed an architecture that employs fission power to propel two different concepts: one, an unmanned probe, the other a crewed vehicle to Alpha Centauri within mission times of 47 to 60 years. The first portion of this paper discusses employing a variant of the ''Forward Resupply Runway'' utilizing fission systems to enable both high accelerations and high final velocities necessary for this type of travel. The authors argue that such an architecture, while expensive, is considerably less expensive and technologically risky than other technologically advanced concepts, and, further, provides the ability to explore near-Earth stellar systems out to distances of 8 light years or so. This enables the ability to establish independent human societies which can later expand the domain of human exploration in roughly eight light-year increments even presuming that no further physics or technology breakthroughs or advances occur. In the second portion of the paper, a technology requirement assessment is performed. The authors argue that reasonable to extensive extensions to known technology could enable this revolutionary capability

Observer-Based Stabilization of Spacecraft Rendezvous with Variable Sampling and Sensor Nonlinearity

Directory of Open Access Journals (Sweden)

Zhuoshi Li

2013-01-01

Full Text Available This paper addresses the observer-based control problem of spacecraft rendezvous with nonuniform sampling period. The relative dynamic model is based on the classical Clohessy-Wiltshire equation, and sensor nonlinearity and sampling are considered together in a unified framework. The purpose of this paper is to perform an observer-based controller synthesis by using sampled and saturated output measurements, such that the resulting closed-loop system is exponentially stable. A time-dependent Lyapunov functional is developed which depends on time and the upper bound of the sampling period and also does not grow along the input update times. The controller design problem is solved in terms of the linear matrix inequality method, and the obtained results are less conservative than using the traditional Lyapunov functionals. Finally, a numerical simulation example is built to show the validity of the developed sampled-data control strategy.

The endoscopic ultrasound-assisted Rendez-Vous technique for treatment of recurrent pancreatitis due to pancreas divisum and ansa pancreatica

Directory of Open Access Journals (Sweden)

Sergio López-Durán

Full Text Available Endoscopic treatment of pancreatic ductal malformations causing recurrent acute pancreatitis, such as pancreas divisum or ansa pancreatica, is mainly based on the sphincterotomy of the minor papilla. However, the technical complexity of conventional endoscopic retrograde cholangiopancreatography (ERCP is increased in patients presenting anatomical variants like these and it may be unsuccessful. We report the case of a pancreas divisum combined with ansa pancreatica and describe the cannulation and sphincterotomy of the minor papilla using an ultrasound-assisted Rendez-Vous technique.

Satellite Servicing's Autonomous Rendezvous and Docking Testbed on the International Space Station

Science.gov (United States)

Naasz, Bo J.; Strube, Matthew; Van Eepoel, John; Barbee, Brent W.; Getzandanner, Kenneth M.

2011-01-01

The Space Servicing Capabilities Project (SSCP) at NASA's Goddard Space Flight Center (GSFC) has been tasked with developing systems for servicing space assets. Starting in 2009, the SSCP completed a study documenting potential customers and the business case for servicing, as well as defining several notional missions and required technologies. In 2010, SSCP moved to the implementation stage by completing several ground demonstrations and commencing development of two International Space Station (ISS) payloads-the Robotic Refueling Mission (RRM) and the Dextre Pointing Package (DPP)--to mitigate new technology risks for a robotic mission to service existing assets in geosynchronous orbit. This paper introduces the DPP, scheduled to fly in July of 2012 on the third operational SpaceX Dragon mission, and its Autonomous Rendezvous and Docking (AR&D) instruments. The combination of sensors and advanced avionics provide valuable on-orbit demonstrations of essential technologies for servicing existing vehicles, both cooperative and non-cooperative.

Maximizing the Lifetime of Wireless Sensor Networks Using Multiple Sets of Rendezvous

Directory of Open Access Journals (Sweden)

Bo Li

2015-01-01

Full Text Available In wireless sensor networks (WSNs, there is a “crowded center effect” where the energy of nodes located near a data sink drains much faster than other nodes resulting in a short network lifetime. To mitigate the “crowded center effect,” rendezvous points (RPs are used to gather data from other nodes. In order to prolong the lifetime of WSN further, we propose using multiple sets of RPs in turn to average the energy consumption of the RPs. The problem is how to select the multiple sets of RPs and how long to use each set of RPs. An optimal algorithm and a heuristic algorithm are proposed to address this problem. The optimal algorithm is highly complex and only suitable for small scale WSN. The performance of the proposed algorithms is evaluated through simulations. The simulation results indicate that the heuristic algorithm approaches the optimal one and that using multiple RP sets can significantly prolong network lifetime.

Navigation Strategies for Primitive Solar System Body Rendezvous and Proximity Operations

Science.gov (United States)

Getzandanner, Kenneth M.

2011-01-01

A wealth of scientific knowledge regarding the composition and evolution of the solar system can be gained through reconnaissance missions to primitive solar system bodies. This paper presents analysis of a baseline navigation strategy designed to address the unique challenges of primitive body navigation. Linear covariance and Monte Carlo error analysis was performed on a baseline navigation strategy using simulated data from a· design reference mission (DRM). The objective of the DRM is to approach, rendezvous, and maintain a stable orbit about the near-Earth asteroid 4660 Nereus. The outlined navigation strategy and resulting analyses, however, are not necessarily limited to this specific target asteroid as they may he applicable to a diverse range of mission scenarios. The baseline navigation strategy included simulated data from Deep Space Network (DSN) radiometric tracking and optical image processing (OpNav). Results from the linear covariance and Monte Carlo analyses suggest the DRM navigation strategy is sufficient to approach and perform proximity operations in the vicinity of the target asteroid with meter-level accuracy.

Handling Neighbor Discovery and Rendezvous Consistency with Weighted Quorum-Based Approach.

Science.gov (United States)

Own, Chung-Ming; Meng, Zhaopeng; Liu, Kehan

2015-09-03

Neighbor discovery and the power of sensors play an important role in the formation of Wireless Sensor Networks (WSNs) and mobile networks. Many asynchronous protocols based on wake-up time scheduling have been proposed to enable neighbor discovery among neighboring nodes for the energy saving, especially in the difficulty of clock synchronization. However, existing researches are divided two parts with the neighbor-discovery methods, one is the quorum-based protocols and the other is co-primality based protocols. Their distinction is on the arrangements of time slots, the former uses the quorums in the matrix, the latter adopts the numerical analysis. In our study, we propose the weighted heuristic quorum system (WQS), which is based on the quorum algorithm to eliminate redundant paths of active slots. We demonstrate the specification of our system: fewer active slots are required, the referring rate is balanced, and remaining power is considered particularly when a device maintains rendezvous with discovered neighbors. The evaluation results showed that our proposed method can effectively reschedule the active slots and save the computing time of the network system.

Handling Neighbor Discovery and Rendezvous Consistency with Weighted Quorum-Based Approach

Directory of Open Access Journals (Sweden)

Chung-Ming Own

2015-09-01

Full Text Available Neighbor discovery and the power of sensors play an important role in the formation of Wireless Sensor Networks (WSNs and mobile networks. Many asynchronous protocols based on wake-up time scheduling have been proposed to enable neighbor discovery among neighboring nodes for the energy saving, especially in the difficulty of clock synchronization. However, existing researches are divided two parts with the neighbor-discovery methods, one is the quorum-based protocols and the other is co-primality based protocols. Their distinction is on the arrangements of time slots, the former uses the quorums in the matrix, the latter adopts the numerical analysis. In our study, we propose the weighted heuristic quorum system (WQS, which is based on the quorum algorithm to eliminate redundant paths of active slots. We demonstrate the specification of our system: fewer active slots are required, the referring rate is balanced, and remaining power is considered particularly when a device maintains rendezvous with discovered neighbors. The evaluation results showed that our proposed method can effectively reschedule the active slots and save the computing time of the network system.

Leak or Fistula After Sleeve Gastrectomy: Treatment with Pigtail Drain by the Rendezvous Technique.

Science.gov (United States)

Soufron, Jacques

2015-10-01

After a sleeve gastrectomy, a leak or fistula is a serious complication. Laparoscopic drainage, drainage under US or CT scan control, or endoscopic insertion of a stent can be used, but a major re-operation is sometimes unavoidable. Endoscopic drainage with a pigtail catheter could give more success and fewer complications, but the insertion of the drain is not always possible nor does it always provide a perfect drainage. If a laparoscopic second look appears necessary, it is possible to insert a pigtail drain laparoscopically, but under endoscopic control, ensuring a correct positioning of the drain both in the peritoneal cavity and in the gastric tube. This simultaneous "rendezvous" technique could combine in this situation the advantages of purely surgical techniques and of purely endoscopic or image-guided techniques.

Laparoendoscopic rendezvous may be an effective alternative to a failed preoperative endoscopic retrograde cholangiopancreatography in patients with cholecystocholedocholithiasis.

Science.gov (United States)

Tsiopoulos, Fotios; Kapsoritakis, Andreas; Psychos, Athanassios; Manolakis, Anastasios; Oikonomou, Konstantinos; Tzovaras, George; Baloyiannis, Ioannis; Tsikrika, Alexandra; Potamianos, Spyros

2018-01-01

Endoscopic retrograde cholangiopancreatography (ERCP), followed by laparoscopic cholecystectomy (LC), remains the standard way of management for patients with cholecystocholedocholithiasis. Laparoendoscopic rendezvous (LERV), a combined procedure for removing the gallbladder laparoscopically and clearing the common bile duct (CBD) endoscopically at the same time, could be an attractive alternative. The aim of this study was to compare LERV with classic ERCP in patients with cholecystocholedocholithiasis. 886 patients with cholecystocholedocholithiasis were treated either with the LERV technique (90 patients), or with the 2-stage approach, which includes preoperative ERCP followed by LC (796 patients). The primary endpoint was any difference in the success of CBD cannulation and clearance; secondary endpoints were the detection of differences in morbidity (especially post-ERCP pancreatitis [PEP]), and the feasibility of the two approaches. Successful cannulation of the CBD was more frequent with conventional ERCP compared with the LERV technique (89.8% vs. 75.5%, P=0.0001). LERV appears to be as effective as conventional ERCP for complete CBD clearance (85.5% vs. 82.8%, P<0.1). None of the patients in the LERV group had an episode of clinical PEP, whereas in the conventional ERCP group there were 23 episodes of PEP and one death. The median amylase level was higher in patients undergoing conventional ERCP group compared to patients in LERV group. Classic ERCP has a higher rate of successful CBD cannulation and a similar rate of CBD clearance compared to LERV.

Using Information from Rendezvous Missions for Best-Case Appraisals of Impact Damage to Planet Earth Caused by Natural Objects

Science.gov (United States)

Arnold, James O.; Chodas, Paul W.; Ulamec, Stephan; Mathias, Donovan L.; Burkhard, Craig D.

2017-01-01

The Asteroid Threat Assessment Project (ATAP), a part of NASAs Planetary Defense Coordination Office (PDCO) has the responsibility to appraise the range of surface damage by potential asteroid impacts on land or water. If a threat is realized, the project will provide appraisals to officials empowered to make decisions about potential mitigation actions. This paper describes a scenario for assessment of surface damage when characterization of an asteroid had been accomplished by a rendezvous mission that would be conducted by the international planetary defense community. It is shown that the combination of data from ground and in-situ measurements on an asteroid provides knowledge that can be used to pin-point its impact location and predict the level of devastation it would cause. The hypothetical asteroid 2017 PDC with a size range of 160 to 290 m in diameter to be discussed at the PDC 2017 is used as an example. In order of importance for appraising potential damage, information required is: (1) where will the surface impact occur? (2) what is the mass, shape and size of the asteroid and what is its entry state (speed and entry angle) at the 100 km atmospheric pierce point? And (3) is the asteroid a monolith or a rubble pile? If it is a rubble pile, what is its structure and heterogeneity from the surface and throughout its interior? Item (1) is of first order importance to determine levels of devastation (loss of life and infrastructure damage) because it varies strongly on the impact location. Items (2) and (3) are used as inputs for ATAPs simulations to define the level of surface hazards: winds, overpressure, thermal exposure; all created by the deposition of energy during the objects atmospheric flight, andor cratering. Topics presented in this paper include: (i) the devastation predicted by 2017 PDCs impact on land based on initial observations using ATAPs risk assessment capability, (ii) how information corresponding to items (1) to (3) could be obtained

The impact of trauma on the psyche of the individual using the film Belleville Rendez-vous as an illustrative vehicle.

Science.gov (United States)

Waldron, Sharn

2008-09-01

Using the film Belleville Rendez-vous as a vehicle for discussion, this paper argues that whilst a traumatic complex may bring about dissociation of the psyche, this is not the only possibility, nor is dissociation necessarily to be seen solely as a difficulty to be overcome. If trauma is experienced within the context of support and validation, the experience of trauma may generate integration not only of the trauma but also of the growth potential that the trauma has previously inhibited.

Cost analysis of laparoendoscopic rendezvous versus preoperative ERCP and laparoscopic cholecystectomy in the management of cholecystocholedocholithiasis.

Science.gov (United States)

Garbarini, Aldo; Reggio, Dario; Arolfo, Simone; Bruno, Marco; Passera, Roberto; Catalano, Giorgia; Barletti, Claudio; Salizzoni, Mauro; Morino, Mario; Petruzzelli, Luca; Arezzo, Alberto

2017-08-01

Evidence from controlled trials and meta-analyses suggests that laparoendoscopic rendezvous (LERV) is preferable to sequential treatment in the management of common bile duct stones. With this retrospective analysis of a prospective database that included consecutive patients treated for cholecystocholedocholithiasis at our institution between January 2007 and July 2015, we compared LERV with sequential treatment. The primary endpoint was global cost, defined as the cost/patient/hospital stay, and the secondary end points were efficacy and morbidity. Fisher's exact test or Mann-Whitney test was used. Of a total of 249 consecutive patients, 143 underwent LERV (group A) and 106 a two-stage procedure (group B). Based on an average cost of €613 for 1 day of hospital stay in the General Surgery Department, the overall median cost of treatment was €6403 for group A and €8194 for group B (p < 0.001). Operative time was significantly shorter (p < 0.001), and length of hospital stay was significantly longer for group B (p < 0.001). No mortality in either group was observed. The postoperative complications rate was significantly higher in group B than in group A (24.5 vs. 10.5%; p = 0.003). No significant difference in the postoperative pancreatitis rate or the number of patients with increased serum amylase at 24 h was observed in either group. Our study suggests that LERV is preferable to sequential treatment not only in terms of less morbidity, but also of lower costs accrued by a shorter hospital stay. However, the longer operative time raises multiple organizational issues in the coordination of surgery and endoscopy services.

A new duodenal rendezvous technique for biliary cannulation in patients with T-tube after orthotopic liver transplantation (with video).

Science.gov (United States)

Cantù, Paolo; Parzanese, Ilaria; Melada, Ernesto; Rossi, Giorgio; Conte, Dario; Penagini, Roberto

2016-01-01

Because a traditional rendezvous (RV) technique implies stretching of the papilla, possibly leading to post-ERCP pancreatitis, an alternative duodenal RV technique was evaluated. The aim was to assess the effectiveness, safety, and amount of time spent performing duodenal RV versus traditional RV cannulation in orthotopic liver transplantation patients with a T-tube. We retrospectively reviewed data from a prospective ERCP database held by our university hospital. Twenty patients with a T-tube who had undergone ERCP for biliary adverse events after orthotopic liver transplantation were included. The successful cannulation rate, the amount of time spent performing cannulation, the post-ERCP pancreatitis rate, and hyperamylasemia 24 hours after the procedure were recorded. Successful cannulation was achieved by the duodenal RV technique in 9 of 10 patients (90%), taking 146 seconds (interquartile range 63-341 seconds) with a short learning curve effect. An unsuccessful duodenal RV procedure occurred because of the angulation of the hydrophilic tip of the guidewire while crossing the papilla, thus preventing cannulation. Successful cannulation was achieved by the traditional RV technique in all cases (N = 11), including the failed duodenal RV technique, taking 374 seconds (interquartile range 320-410 seconds) (P < .05 vs duodenal RV). However, no post-ERCP pancreatitis occurred after using the duodenal RV technique compared with 2 episodes of mild pancreatitis after using the traditional RV technique. Twenty-four hours after the procedure, the median amylasemia level was 84 IU/L (interquartile range 49-105 IU/L) and 265 IU/L (interquartile range 73-2945 IU/L) for the duodenal versus traditional RV techniques, respectively (P = not significant). In patients with a T-tube after liver transplantation, the duodenal RV technique was not associated with post-ERCP pancreatitis, presumably because of the reduction of stress on the major papilla. Cannulation by using the

Gunshot Injury of Pelvi-Ureteric Junction: Management by the Rendezvous Technique.

Science.gov (United States)

Sekhon, Virender; Suryavanshi, Manav

2017-01-01

Background: Gunshot injury of ureter is common, but isolated injury of pelvi-ureteric junction (PUJ) has not been reported. Moreover, its management is evolving from the traditional urinary diversion, stenting followed later by definitive surgical repair to a more upfront minimally invasive endourologic approach. Case Presentation: An adolescent boy presented with gunshot laceration injury of left PUJ with associated small intestinal injury. Radiological investigations confirmed a contained urinary leak. Retrograde stenting was not effective. The same guidewire was retained into the urinoma and an antegrade percutaneous access was obtained. A snare was used to retrieve the guidewire and obtain a through and through access. A ureteropelvic drainage catheter was inserted over this guidewire and secured in the upper ureter, bypassing the region of injury. Three weeks later, the drainage tube was removed and the same tract was used for antegrade stenting. A retrograde pyelogram done 3 months later during stent removal demonstrated no leak. The patient is asymptomatic for urinary symptoms on 6 months of follow-up. Conclusion: Rendezvous technique is a feasible alternative to open repair of gunshot pelvi-ureteric junction injury. Long-term follow-up is awaited.

Coherent Doppler lidar for automated space vehicle rendezvous, stationkeeping and capture

Science.gov (United States)

Bilbro, James A.

1991-01-01

The inherent spatial resolution of laser radar makes ladar or lidar an attractive candidate for Automated Rendezvous and Capture application. Previous applications were based on incoherent lidar techniques, requiring retro-reflectors on the target vehicle. Technology improvements (reduced size, no cryogenic cooling requirement) have greatly enhanced the construction of coherent lidar systems. Coherent lidar permits the acquisition of non-cooperative targets at ranges that are limited by the detection capability rather than by the signal-to-noise ratio (SNR) requirements. The sensor can provide translational state information (range, velocity, and angle) by direct measurement and, when used with any array detector, also can provide attitude information by Doppler imaging techniques. Identification of the target is accomplished by scanning with a high pulse repetition frequency (dependent on the SNR). The system performance is independent of range and should not be constrained by sun angle. An initial effort to characterize a multi-element detection system has resulted in a system that is expected to work to a minimum range of 1 meter. The system size, weight and power requirements are dependent on the operating range; 10 km range requires a diameter of 3 centimeters with overall size at 3 x 3 x 15 to 30 cm, while 100 km range requires a 30 cm diameter.

A proposal for seismic evaluation index of mid-rise existing RC buildings in Afghanistan

Science.gov (United States)

Naqi, Ahmad; Saito, Taiki

2017-10-01

Mid-rise RC buildings gradually rise in Kabul and entire Afghanistan since 2001 due to rapid increase of population. To protect the safety of resident, Afghan Structure Code was issued in 2012. But the building constructed before 2012 failed to conform the code requirements. In Japan, new sets of rules and law for seismic design of buildings had been issued in 1981 and severe earthquake damage was disclosed for the buildings designed before 1981. Hence, the Standard for Seismic Evaluation of RC Building published in 1977 has been widely used in Japan to evaluate the seismic capacity of existing buildings designed before 1981. Currently similar problem existed in Afghanistan, therefore, this research examined the seismic capacity of six RC buildings which were built before 2012 in Kabul by applying the seismic screening procedure presented by Japanese standard. Among three screening procedures with different capability, the less detailed screening procedure, the first level of screening, is applied. The study founds an average seismic index (IS-average=0.21) of target buildings. Then, the results were compared with those of more accurate seismic evaluation procedures of Capacity Spectrum Method (CSM) and Time History Analysis (THA). The results for CSM and THA show poor seismic performance of target buildings not able to satisfy the safety design limit (1/100) of the maximum story drift. The target buildings are then improved by installing RC shear walls. The seismic indices of these retrofitted buildings were recalculated and the maximum story drifts were analyzed by CSM and THA. The seismic indices and CSM and THA results are compared and found that building with seismic index larger than (IS-average =0.4) are able to satisfy the safety design limit. Finally, to screen and minimize the earthquake damage over the existing buildings, the judgement seismic index (IS-Judgment=0.5) for the first level of screening is proposed.

Nuclear wastes management: the lessons from the C.S.M. disposal site (Centre de Stockage de la Manche). Memory-less Centre, Future-less Centre?; Gestion des dechets radioactifs: les lecons du Centre de Stockage de la Manche (C.S.M.). Centre Sans Memoire, Centre Sans Avenir?

Energy Technology Data Exchange (ETDEWEB)

NONE

2006-05-15

With its 527 217 m{sup 3} of low and medium activity wastes put in storage between 1969 and 1994, the C.S.M.( center of storage of Manche) is and remains to this day a necessary element to understand the problems posed by the eternal storage of nuclear materials and the limits of the notion of reversibility. There are therefore teachings to be drawn. We cannot repeat past mistakes in particular with high activity wastes which we wish to bury deep underground. This report is based on the analysis of the existing bibliography, of the internal A.N.D.R.A. documents which we released to the public, of the lessons drawn from our participation in the official concerting and work groups, and finally of the data obtained after inquiries were done in the region in the framework of R.I.V.I.E;R.E. (citizens network of radioecological surveillance, information and evaluation). In spite of all efforts produced, many questions remain unanswered regarding this site so it is sometimes difficult to be more precise. (N.C.)

Manned maneuvering unit applications for automated rendezvous and capture

Science.gov (United States)

Brehm, Donald L.; Cuseo, John A.; Lenda, Joseph A.; Ray, Lex; Whitsett, C. Edward

Automated Rendezvous and Capture (AR&C) is an important technology to multiple National Aeronautics and Space Administration (NASA) programs and centers. The recent Johnson Spacecraft Center (JSC) AR&C Quality Function Deployment (QFD) has listed on-orbit demonstration of related technologies as a near term priority. Martin Marietta has been evaluating use of the Manned Maneuvering Unit (MMU) for a low cost near term on-orbit demonstration of AR&C technologies such as control algorithms, sensors, and processors as well as system level performance. The MMU Program began in 1979 as the method of repairing the Space Shuttle (STS) Thermal Protection System (the tiles). The units were not needed for this task, but were successfully employed during three Shuttle flights in 1984: a test flight was flown in in February as proof of concept, in April the MMU participated in the Solar Max Repair Mission, and in November the MMU's returned to space to successfully rescue the two errant satellites, Westar and Palapa. In the intervening years, the MMU simulator and MMU Qualification Test Unit (QTU) have been used for Astronaut training and experimental evaluations. The Extra-Vehicular Activities (EVA) Retriever has used the QTU, in an unmanned form, as a free-flyer on the Johnson Space Center (JSC) Precision Air Bearing Floor (PABF). Currently, the MMU is undergoing recertification for flight. The two flight units were removed from storage in September, 1991 and evaluation tests were performed. The tests demonstrated that the units are in good shape with no discrepancies that would preclude further use. The Return to Flight effort is currently clearing up recertification issues and evaluating the design against the present Shuttle environments.

Spacecraft Actuator Diagnosis with Principal Component Analysis: Application to the Rendez-Vous Phase of the Mars Sample Return Mission

Directory of Open Access Journals (Sweden)

Othman Nasri

2015-01-01

Full Text Available This paper presents a fault detection and isolation (FDI approach in order to detect and isolate actuators (thrusters and reaction wheels faults of an autonomous spacecraft involved in the rendez-vous phase of the Mars Sample Return (MSR mission. The principal component analysis (PCA has been adopted to estimate the relationships between the various variables of the process. To ensure the feasibility of the proposed FDI approach, a set of data provided by the industrial “high-fidelity” simulator of the MSR and representing the opening (resp., the rotation rates of the spacecraft thrusters (resp., reaction wheels has been considered. The test results demonstrate that the fault detection and isolation are successfully accomplished.

The influence of spatial ability and experience on performance during spaceship rendezvous and docking.

Science.gov (United States)

Du, Xiaoping; Zhang, Yijing; Tian, Yu; Huang, Weifen; Wu, Bin; Zhang, Jingyu

2015-01-01

Manual rendezvous and docking (manual RVD) is a challenging space task for astronauts. Previous research showed a correlation between spatial ability and manual RVD skills among participants at early stages of training, but paid less attention to experts. Therefore, this study tried to explore the role of spatial ability in manual RVD skills in two groups of trainees, one relatively inexperienced and the other experienced operators. Additionally, mental rotation has been proven essential in RVD and was tested in this study among 27 male participants, 15 novices, and 12 experts. The participants performed manual RVD tasks in a high fidelity simulator. Results showed that experience moderated the relation between mental rotation ability and manual RVD performance. On one hand, novices with high mental rotation ability tended to perform that RVD task more successfully; on the other hand, experts with high mental rotation ability showed not only no performance advantage in the final stage of the RVD task, but had certain disadvantages in their earlier processes. Both theoretical and practical implications were discussed.

The Influence of Spatial Ability and Experience on Spacecraft Rendezvous and Docking Operation Performance

Directory of Open Access Journals (Sweden)

Xiaoping eDu

2015-07-01

Full Text Available Manual rendezvous and docking (manual RVD is a challenging space task for astronauts. Previous research showed a correlation between spatial ability and manual RVD skills among participants at early stages of training, but paid less attention to experts. Therefore, this study tried to explore the role of spatial ability in manual RVD skills in two groups of trainees, one relatively inexperienced and the other experienced operators. Additionally, mental rotation has been proven essential in RVD and was tested in this study among 27 male participants, 15 novices and 12 experts. The participants performed manual RVD tasks in a high fidelity simulator. Results showed that experience moderated the relation between mental rotation ability and manual RVD performance. On one hand, novices with high mental rotation ability tended to perform that RVD task more successfully; on the other hand, experts with high mental rotation ability showed not only no performance advantage in the final stage of the RVD task, but had certain disadvantages in their earlier processes. Both theoretical and practical implications were discussed.

The influence of spatial ability and experience on performance during spaceship rendezvous and docking

Science.gov (United States)

Du, Xiaoping; Zhang, Yijing; Tian, Yu; Huang, Weifen; Wu, Bin; Zhang, Jingyu

2015-01-01

Manual rendezvous and docking (manual RVD) is a challenging space task for astronauts. Previous research showed a correlation between spatial ability and manual RVD skills among participants at early stages of training, but paid less attention to experts. Therefore, this study tried to explore the role of spatial ability in manual RVD skills in two groups of trainees, one relatively inexperienced and the other experienced operators. Additionally, mental rotation has been proven essential in RVD and was tested in this study among 27 male participants, 15 novices, and 12 experts. The participants performed manual RVD tasks in a high fidelity simulator. Results showed that experience moderated the relation between mental rotation ability and manual RVD performance. On one hand, novices with high mental rotation ability tended to perform that RVD task more successfully; on the other hand, experts with high mental rotation ability showed not only no performance advantage in the final stage of the RVD task, but had certain disadvantages in their earlier processes. Both theoretical and practical implications were discussed. PMID:26236252

Laparoscopic and robotic nephroureterectomy

DEFF Research Database (Denmark)

Azawi, Nessn H; Berg, Kasper Drimer; Thamsborg, Andreas Key Milan

2017-01-01

nephroureterectomy between January 2008 and December 2014 was conducted. Outcome measures were OS and CSM. RESULTS: In total, 298 patients underwent robot-assisted or laparoscopic radical nephroureterectomy with a final histological diagnosis of UTUC. LND was performed in 46 (15.4%). One hundred and seventy...... in the selection of patients undergoing LND. CONCLUSIONS: Five-year OS and CSM are comparable between patients with N1 and N0 MID. This evidence may support the use of the LND procedure in patients with muscle-invasive UTUC....

Basic targeting strategies for rendezvous and flyby missions to the near-Earth asteroids

Science.gov (United States)

Perozzi, Ettore; Rossi, Alessandro; Valsecchi, Giovanni B.

2001-01-01

Missions to asteroids and comets are becoming increasingly feasible both from a technical and a financial point of view. In particular, those directed towards the Near-Earth Asteroids have proven suitable for a low-cost approach, thus attracting the major space agencies as well as private companies. The choice of a suitable target involves both scientific relevance and mission design considerations, being often a difficult task to accomplish due to the limited energy budget at disposal. The aim of this paper is to provide an approach to basic trajectory design which allows to account for both aspects of the problem, taking into account scientific and technical information. A global characterization of the Near-Earth Asteroids population carried out on the basis of their dynamics, physical properties and flight dynamics considerations, allows to identify a group of candidates which satisfy both, the scientific and engineering requirements. The feasibility of rendezvous and flyby missions towards them is then discussed and the possibility of repeated encounters with the same object is investigated, as an intermediate scenario. Within this framework, the capability of present and near future launch and propulsion systems for interplanetary missions is also addressed.

Time and Covariance Threshold Triggered Optimal Uncooperative Rendezvous Using Angles-Only Navigation

Directory of Open Access Journals (Sweden)

Yue You

2017-01-01

Full Text Available A time and covariance threshold triggered optimal maneuver planning method is proposed for orbital rendezvous using angles-only navigation (AON. In the context of Yamanaka-Ankersen orbital relative motion equations, the square root unscented Kalman filter (SRUKF AON algorithm is developed to compute the relative state estimations from a low-volume/mass, power saving, and low-cost optical/infrared camera’s observations. Multi-impulsive Hill guidance law is employed in closed-loop linear covariance analysis model, based on which the quantitative relative position robustness and relative velocity robustness index are defined. By balancing fuel consumption, relative position robustness, and relative velocity robustness, we developed a time and covariance threshold triggered two-level optimal maneuver planning method, showing how these results correlate to past methods and missions and how they could potentially influence future ones. Numerical simulation proved that it is feasible to control the spacecraft with a two-line element- (TLE- level uncertain, 34.6% of range, initial relative state to a 100 m v-bar relative station keeping point, at where the trajectory dispersion reduces to 3.5% of range, under a 30% data gap per revolution on account of the eclipse. Comparing with the traditional time triggered maneuver planning method, the final relative position accuracy is improved by one order and the relative trajectory robustness and collision probability are obviously improved and reduced, respectively.

Dynamical analysis of rendezvous and docking with very large space infrastructures in non-Keplerian orbits

Science.gov (United States)

Colagrossi, Andrea; Lavagna, Michèle

2018-03-01

A space station in the vicinity of the Moon can be exploited as a gateway for future human and robotic exploration of the solar system. The natural location for a space system of this kind is about one of the Earth-Moon libration points. The study addresses the dynamics during rendezvous and docking operations with a very large space infrastructure in an EML2 Halo orbit. The model takes into account the coupling effects between the orbital and the attitude motion in a circular restricted three-body problem environment. The flexibility of the system is included, and the interaction between the modes of the structure and those related with the orbital motion is investigated. A lumped parameter technique is used to represents the flexible dynamics. The parameters of the space station are maintained as generic as possible, in a way to delineate a global scenario of the mission. However, the developed model can be tuned and updated according to the information that will be available in the future, when the whole system will be defined with a higher level of precision.

A case of biliary stones and anastomotic biliary stricture after liver transplant treated with the rendez - vous technique and electrokinetic lithotritor

Institute of Scientific and Technical Information of China (English)

Marta Di Pisa; Mario Traina; Roberto Miraglia; Luigi Maruzzelli; Riccardo Volpes; Salvatore Piazza; Angelo Luca; Bruno Gridelli

2008-01-01

The paper studies the combined radiologic and endoscopic approach (rendezvous technique) to the treatment of the biliary complications following liver transplant. The "rendez-vous" technique was used with an electrokinetic lithotripter, in the treatment of a biliary anastomotic stricture with multiple biliary stones in a patient who underwent orthotopic liver transplant. In this patient, endoscopic or percutaneous transhepatic management of the biliary complication failed. The combined approach, percutaneous transhepatic and endoscopic treatment (rendez-vous technique) with the use of an electrokinetic lithotritor, was used to solve the biliary stenosis and to remove the stones.Technical success, defined as disappearance of the biliary stenosis and stone removal, was obtained in just one session, which definitively solved the complications.The combined approach of percutaneous transhepatic and endoscopic (rendez-vous technique) treatment, in association with an electrokinetic lithotritor, is a safe and feasible alternative treatment, especially after the failure of endoscopic and/or percutaneous trans-hepatic isolated procedures.

A comparison between endoscopic ultrasound-guided rendezvous and percutaneous biliary drainage after failed ERCP for malignant distal biliary obstruction.

Science.gov (United States)

Bill, Jason G; Darcy, Michael; Fujii-Lau, Larissa L; Mullady, Daniel K; Gaddam, Srinivas; Murad, Faris M; Early, Dayna S; Edmundowicz, Steven A; Kushnir, Vladimir M

2016-09-01

Selective biliary cannulation is unsuccessful in 5 % to 10 % of patients undergoing endoscopic retrograde cholangiopancreatography (ERCP) for malignant distal biliary obstruction (MDBO). Percutaneous biliary drainage (PBD) has been the gold standard, but endoscopic ultrasound guided rendezvous (EUSr) have been increasingly used for biliary decompression in this patient population. Our aim was to compare the initial success rate, long-term efficacy, and safety of PBD and EUSr in relieving MDBO after failed ERC Patients and methods: A retrospective study involving 50 consecutive patients who had an initial failed ERCP for MDBO. Twenty-five patients undergoing EUSr between 2008 - 2014 were compared to 25 patients who underwent PBD immediately prior to the introduction of EUSr at our center (2002 - 2008). Comparisons were made between the two groups with regard to technical success, duration of hospital stay and adverse event rates after biliary decompression. The mean age at presentation was 66.5 (± 12.6 years), 28 patients (54.9 %) were female. The etiology of MDBO was pancreaticobiliary malignancy in 44 (88 %) and metastatic disease in 6 (12 %) cases. Biliary drainage was technically successful by EUSr in 19 (76 %) cases and by PBD in 25 (100 %) (P = 0.002). Median length of hospital stay after initial drainage was 1 day in the EUSr group vs 5 days in PBD group (P = 0.02). Repeat biliary intervention was required for 4 patients in the EUSr group and 15 in the PBD group (P = 0.001). Initial technical success with EUSr was significantly lower than with PBD, however when EUSr was successful, patients had a significantly shorter post-procedure hospital stay and required fewer follow-up biliary interventions. Meeting presentations: Annual Digestive Diseases Week 2015.

Multi-pentad prediction of precipitation variability over Southeast Asia during boreal summer using BCC_CSM1.2

Science.gov (United States)

Li, Chengcheng; Ren, Hong-Li; Zhou, Fang; Li, Shuanglin; Fu, Joshua-Xiouhua; Li, Guoping

2018-06-01

Precipitation is highly variable in space and discontinuous in time, which makes it challenging for models to predict on subseasonal scales (10-30 days). We analyze multi-pentad predictions from the Beijing Climate Center Climate System Model version 1.2 (BCC_CSM1.2), which are based on hindcasts from 1997 to 2014. The analysis focus on the skill of the model to predict precipitation variability over Southeast Asia from May to September, as well as its connections with intraseasonal oscillation (ISO). The effective precipitation prediction length is about two pentads (10 days), during which the skill measured by anomaly correlation is greater than 0.1. In order to further evaluate the performance of the precipitation prediction, the diagnosis results of the skills of two related circulation fields show that the prediction skills for the circulation fields exceed that of precipitation. Moreover, the prediction skills tend to be higher when the amplitude of ISO is large, especially for a boreal summer intraseasonal oscillation. The skills associated with phases 2 and 5 are higher, but that of phase 3 is relatively lower. Even so, different initial phases reflect the same spatial characteristics, which shows higher skill of precipitation prediction in the northwest Pacific Ocean. Finally, filter analysis is used on the prediction skills of total and subseasonal anomalies. The results of the two anomaly sets are comparable during the first two lead pentads, but thereafter the skill of the total anomalies is significantly higher than that of the subseasonal anomalies. This paper should help advance research in subseasonal precipitation prediction.

Bundled payment reimbursement for anterior and posterior approaches for cervical spondylotic myelopathy: an analysis of private payer and Medicare databases.

Science.gov (United States)

Virk, Sohrab S; Phillips, Frank M; Khan, Safdar N

2018-03-01

OBJECTIVE Cervical spondylotic myelopathy (CSM) is a progressive spinal condition that often requires surgery. Studies have shown the clinical equivalency of anterior versus posterior approaches for CSM surgery. The purpose of this study was to determine the amount and type of resources used for anterior and posterior surgical treatment of CSM by using large national databases of clinical and financial information from patients. METHODS This study consists of 2 large cohorts of patients who underwent either an anterior or posterior approach for treatment of CSM. These patients were selected from the Medicare 5% National Sample Administrative Database (SAF5) and the Humana orthopedic database (HORTHO), which is a database of patients with private payer health insurance. The outcome measures were the cost of a 90-day episode of care, as well as a breakdown of the cost components for each surgical procedure between 2005 and 2014. RESULTS A total of 16,444 patients were included in this analysis. In HORTHO, there were 10,332 and 1556 patients treated with an anterior or posterior approach for CSM, respectively. In SAF5, there were 3851 and 705 patients who were treated by an anterior or posterior approach for CSM, respectively. The mean ± SD reimbursements for anterior and posterior approaches in the HORTHO database were $20,863 ± $2014 and $23,813 ± $4258, respectively (p = 0.048). The mean ± SD reimbursements for anterior and posterior approaches in the SAF5 database were $18,219 ± $1053 and $25,598 ± $1686, respectively (p reimbursements for a rehabilitation/skilled nursing facility and hospital/inpatient care for patients who underwent a posterior approach in both the private payer and Medicare databases. In all cohorts in this study, the hospital-related reimbursement was more than double the surgeon-related reimbursement. CONCLUSIONS This study provides resource utilization information for a 90-day episode of care for both anterior and posterior approaches

The Space Operations Simulation Center (SOSC) and Closed-Loop Hardware Testing for Orion Rendezvous System Design

Science.gov (United States)

Milenkovic, Zoran; DSouza, Christopher; Huish, David; Bendle, John; Kibler, Angela

2012-01-01

The exploration goals of Orion / MPCV Project will require a mature Rendezvous, Proximity Operations and Docking (RPOD) capability. Ground testing autonomous docking with a next-generation sensor such as the Vision Navigation Sensor (VNS) is a critical step along the path of ensuring successful execution of autonomous RPOD for Orion. This paper will discuss the testing rationale, the test configuration, the test limitations and the results obtained from tests that have been performed at the Lockheed Martin Space Operations Simulation Center (SOSC) to evaluate and mature the Orion RPOD system. We will show that these tests have greatly increased the confidence in the maturity of the Orion RPOD design, reduced some of the latent risks and in doing so validated the design philosophy of the Orion RPOD system. This paper is organized as follows: first, the objectives of the test are given. Descriptions of the SOSC facility, and the Orion RPOD system and associated components follow. The details of the test configuration of the components in question are presented prior to discussing preliminary results of the tests. The paper concludes with closing comments.

Nuclear wastes management: the lessons from the C.S.M. disposal site (Centre de Stockage de la Manche. Memory-less Centre, Future-less Centre?

International Nuclear Information System (INIS)

2006-05-01

With its 527 217 m 3 of low and medium activity wastes put in storage between 1969 and 1994, the C.S.M.( center of storage of Manche) is and remains to this day a necessary element to understand the problems posed by the eternal storage of nuclear materials and the limits of the notion of reversibility. There are therefore teachings to be drawn. We cannot repeat past mistakes in particular with high activity wastes which we wish to bury deep underground. This report is based on the analysis of the existing bibliography, of the internal A.N.D.R.A. documents which we released to the public, of the lessons drawn from our participation in the official concerting and work groups, and finally of the data obtained after inquiries were done in the region in the framework of R.I.V.I.E;R.E. (citizens network of radioecological surveillance, information and evaluation). In spite of all efforts produced, many questions remain unanswered regarding this site so it is sometimes difficult to be more precise. (N.C.)

Applying CSM-CERES-Maize to define a sowing window for irrigated maize crop - The Riacho´s Farm case study

Directory of Open Access Journals (Sweden)

Denise Freitas Silva

2011-08-01

Full Text Available Irrigation use constitutes an alternative to improve maize production in Central Minas Gerais State, Brazil. However, even under adequate water supply conditions, other environmental factors may influence maize crop growth and development and may, ultimately, affect grain yield. This study aimed to establish a sowing window for irrigated maize crop, based on simulation results obtained with the decision support model CSM-CERES-Maize. Simulations were made for crop management conditions of Riacho´s Farm, located in Matozinhos, Minas Gerais State, Brazil. It was employed the model´s seasonal tool, along with a data set containing 46 years of weather data records, to simulate maize yield for weekly sowing scenarios, starting on August 1st and ending on July 24th of each year. One defined an irrigated maize sowing window, taking into account the yield break risk that a farmer would be willing to take. The model proved to be an interesting tool to assist in decision making, regarding crop and irrigation management, for an irrigated maize production system. Assuming a 10% yield break in the expected average maximum maize yield, it was defined as sowing window, the period from January 23rd to March 6th, with February 20th as the best sowing date. Other sowing windows may be established according to the risk that the farmer would be willing to take.

Regional strategy tested in Caribbean.

Science.gov (United States)

1984-01-01

Barbados, St. Vincent, and St. Lucia have joined forces in the world's 1st regional Contraceptive Social Marketing (CSM) effort -- the Caribbean CSM. The Barbados Family Planning Association (BFPS) is overseeing the operation, which begins selling 2 contraceptive pills and a condom in early February. Costs and start-up times were shaved by adopting brand names and advertising materials from Jamaica's highly successful CSM project. Jamaica's popular "Panther" condom and "Perle" oral contraceptive (OC) are being used by the Caribbean CSM project. Perle's 9-year-old package has been redesigned and the Caribbean CSM project also is selling a 2nd, low-dose version called "Perle-LD." The products are manufactured in the US by Syntex as Noriday and Norminest, respectively. But the regional approach's financial gains also had a debit side, most notably a tripling of bureaucratic procedures. Part of project difficulties stem from differences among the 3 Caribbean countries. While sharing a common cultural heritage, St. Lucians speak a patois dialect in addition to the English prevalent on the other islands. The biggest hurdle was overcoming an economic disparity between Barbados and its less affluent neighbors, St. Vincent and St. Lucia. The CSM project decided to try a 2-tier product pricing strategy. In US currency, prices run $1.75 per cycle for both OCs on Barbados, but $1.26 on St. Vincent and St. Lucia. A Panther 3-pack costs 75 cents on Barbados and 42 cents on the othe 2 islands. The project is being promoted with generic family planning media advertisements. The project also has held physician orientation seminars on each island. The pilot program will be accompanied by retailer training seminars. In addition the project may introduce a spermicidal foaming tablet, once the US Food and Drug Administration approvs a new American-made product. The unique Caribbean CSM project may spread an idea as potent as the family planning message. Its success could transmit the

Coherent Doppler lidar for automated space vehicle, rendezvous, station-keeping and capture

Science.gov (United States)

Dunkin, James A.

1991-01-01

Recent advances in eye-safe, short wavelength solid-state lasers offer real potential for the development of compact, reliable, light-weight, efficient coherent lidar. Laser diode pumping of these devices has been demonstrated, thereby eliminating the need for flash lamp pumping, which has been a major drawback to the use of these lasers in space based applications. Also these lasers now have the frequency stability required to make them useful in coherent lidar, which offers all of the advantages of non-coherent lidar, but with the additional advantage that direct determination of target velocity is possible by measurement of the Doppler shift. By combining the Doppler velocity measurement capability with the inherent high angular resolution and range accuracy of lidar it is possible to construct Doppler images of targets for target motion assessment. A coherent lidar based on a Tm,Ho:YAG 2-micrometer wavelength laser was constructed and successfully field tested on atmospheric targets in 1990. This lidar incorporated an all solid state (laser diode pumped) master oscillator, in conjunction with a flash lamp pumped slave oscillator. Solid-state laser technology is rapidly advancing, and with the advent of high efficiency, high power, semiconductor laser diodes as pump sources, all-solid-state, coherent lidars are a real possibility in the near future. MSFC currently has a feasibility demonstration effort under way which will involve component testing, and preliminary design of an all-solid-state, coherent lidar for automatic rendezvous, and capture. This two year effort, funded by the Director's Discretionary Fund is due for completion in 1992.

Spectral analysis and compositing techniques for the Near Earth Asteroid Rendezvous (NEAR Shoemaker), X-ray and Gamma-Ray Spectrometers (XGRS)

CERN Document Server

McClanahan, T P; Nittler, L R; Boynton, W V; Bruckner, J; Squyres, S W; Evans, L G; Bhangoo, J S; Clark, P E; Floyd, S R; McCartney, E; Mikheeva, I; Starr, R D

2001-01-01

An X-ray and Gamma-Ray Spectrometer (XGRS) is on board the Near Earth Asteroid Rendezvous (NEAR) spacecraft to determine the elemental composition of the surface of the asteroid 433 Eros. The Eros asteroid is highly oblate and irregular in shape. As a result, analysis methodologies are in many ways a divergence from comparable techniques. Complex temporal, spatial and instrument performance relationships must be accounted for during the analysis process. Field of view and asteroid surface geometry measurements must be modeled and then combined with real measurements of solar, spectral and instrument calibration information to derive scientific results. NEAR is currently orbiting 433 Eros and is in the initial phases of its primary data integration and mapping phases. Initial results have been obtained and bulk chemistry assessments have been obtained through specialized background assessment and data reduction techniques.

Investigation of Nitro-Organic Compounds in Diesel Engine Exhaust: Final Report, February 2007 - April 2008

Energy Technology Data Exchange (ETDEWEB)

Dane, J.; Voorhees, K. J.

2010-06-01

The National Renewable Energy Laboratory upgraded its ReFUEL engine and vehicle testing facility to speciate unregulated gas-phase emissions. To complement this capability, the laboratory contracted with the Colorado School of Mines (CSM) to study the effects of soy biodiesel fuel and a diesel particle filter (DPF) on emissions of polycyclic aromatic hydrocarbons (PAH) and nitro-polycyclic aromatic hydrocarbons (NPAH). CSM developed procedures to sample diesel particulate matter (PM) emissions from raw and diluted exhaust, with and without a DPF. They also developed improved procedures for extracting PAH and NPAH from the PM and quantifying them with a gas chromatograph-electron monochromator mass spectrometer. The study found the DPF generally reduced PAH emissions by 1 to 3 orders of magnitude. PAH conversion was lowest for B100, suggesting that PAHs were forming in the DPF. Orders of magnitude reductions were also found for NPAH emissions exiting the DPF.

Endoscopic dilation of complete oesophageal obstructions with a combined antegrade-retrograde rendezvous technique.

Science.gov (United States)

Bertolini, Reto; Meyenberger, Christa; Putora, Paul Martin; Albrecht, Franziska; Broglie, Martina Anja; Stoeckli, Sandro J; Sulz, Michael Christian

2016-02-21

To investigate the combined antegrade-retrograde endoscopic rendezvous technique for complete oesophageal obstruction and the swallowing outcome. This single-centre case series includes consecutive patients who were unable to swallow due to complete oesophageal obstruction and underwent combined antegrade-retrograde endoscopic dilation (CARD) within the last 10 years. The patients' demographic characteristics, clinical parameters, endoscopic therapy, adverse events, and outcomes were obtained retrospectively. Technical success was defined as effective restoration of oesophageal patency. Swallowing success was defined as either percutaneous endoscopic gastrostomy (PEG)-tube independency and/or relevant improvement of oral food intake, as assessed by the functional oral intake scale (FOIS) (≥ level 3). The cohort consisted of six patients [five males; mean age 71 years (range, 54-74)]. All but one patient had undergone radiotherapy for head and neck or oesophageal cancer. Technical success was achieved in five out of six patients. After discharge, repeated dilations were performed in all five patients. During follow-up (median 27 mo, range, 2-115), three patients remained PEG-tube dependent. Three of four patients achieved relevant improvement of swallowing (two patients: FOIS 6, one patient: FOIS 7). One patient developed mediastinal emphysema following CARD, without a need for surgery. The CARD technique is safe and a viable alternative to high-risk blind antegrade dilation in patients with complete proximal oesophageal obstruction. Although only half of the patients remained PEG-tube independent, the majority improved their ability to swallow.

Rumen Degradability and Post-ruminal Digestion of Dry Matter, Nitrogen and Amino Acids of Three Protein Supplements.

Science.gov (United States)

Gao, Wei; Chen, Aodong; Zhang, Bowen; Kong, Ping; Liu, Chenli; Zhao, Jie

2015-04-01

This study evaluated the in situ ruminal degradability, and subsequent small intestinal digestibility (SID) of dry matter, crude protein (CP), and amino acids (AA) of cottonseed meal (CSM), sunflower seed meal (SFSM) and distillers dried grains with solubles (DDGS) by using the modified three-step in vitro procedure. The ruminal degradability and subsequent SID of AA in rumen-undegradable protein (RUP-AA) varied among three protein supplements. The result show that the effective degradability of DM for SFSM, CSM, and DDGS was 60.8%, 56.4%, and 41.0% and their ruminal fermentable organic matter was 60.0%, 55.9%, and 39.9%, respectively. The ruminal degradable protein (RDP) content in CP for SFSM, CSM, and DDGS was 68.3%, 39.0%, and 32.9%, respectively, at the ruminal solid passage rate of 1.84%/h. The SFSM is a good source of RDP for rumen micro-organisms; however, the SID of RUP of SFSM was lower. The DDGS and CSM are good sources of RUP for lambs to digest in the small intestine to complement ruminal microbial AA of growing lambs. Individual RUP-AA from each protein source was selectively removed by the rumen micro-organisms, especially for Trp, Arg, His, and Lys (p<0.01). The SID of individual RUP-AA was different within specific RUP origin (p<0.01). Limiting amino acid was Leu for RUP of CSM and Lys for both RUP of SFSM and DDGS, respectively. Therefore, different protein supplements with specific limitations should be selected and combined carefully in growing lambs ration to optimize AA balance.

A New Path-Constrained Rendezvous Planning Approach for Large-Scale Event-Driven Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

Ahmadreza Vajdi

2018-05-01

Full Text Available We study the problem of employing a mobile-sink into a large-scale Event-Driven Wireless Sensor Networks (EWSNs for the purpose of data harvesting from sensor-nodes. Generally, this employment improves the main weakness of WSNs that is about energy-consumption in battery-driven sensor-nodes. The main motivation of our work is to address challenges which are related to a network’s topology by adopting a mobile-sink that moves in a predefined trajectory in the environment. Since, in this fashion, it is not possible to gather data from sensor-nodes individually, we adopt the approach of defining some of the sensor-nodes as Rendezvous Points (RPs in the network. We argue that RP-planning in this case is a tradeoff between minimizing the number of RPs while decreasing the number of hops for a sensor-node that needs data transformation to the related RP which leads to minimizing average energy consumption in the network. We address the problem by formulating the challenges and expectations as a Mixed Integer Linear Programming (MILP. Henceforth, by proving the NP-hardness of the problem, we propose three effective and distributed heuristics for RP-planning, identifying sojourn locations, and constructing routing trees. Finally, experimental results prove the effectiveness of our approach.

A New Path-Constrained Rendezvous Planning Approach for Large-Scale Event-Driven Wireless Sensor Networks.

Science.gov (United States)

Vajdi, Ahmadreza; Zhang, Gongxuan; Zhou, Junlong; Wei, Tongquan; Wang, Yongli; Wang, Tianshu

2018-05-04

We study the problem of employing a mobile-sink into a large-scale Event-Driven Wireless Sensor Networks (EWSNs) for the purpose of data harvesting from sensor-nodes. Generally, this employment improves the main weakness of WSNs that is about energy-consumption in battery-driven sensor-nodes. The main motivation of our work is to address challenges which are related to a network’s topology by adopting a mobile-sink that moves in a predefined trajectory in the environment. Since, in this fashion, it is not possible to gather data from sensor-nodes individually, we adopt the approach of defining some of the sensor-nodes as Rendezvous Points (RPs) in the network. We argue that RP-planning in this case is a tradeoff between minimizing the number of RPs while decreasing the number of hops for a sensor-node that needs data transformation to the related RP which leads to minimizing average energy consumption in the network. We address the problem by formulating the challenges and expectations as a Mixed Integer Linear Programming (MILP). Henceforth, by proving the NP-hardness of the problem, we propose three effective and distributed heuristics for RP-planning, identifying sojourn locations, and constructing routing trees. Finally, experimental results prove the effectiveness of our approach.

A New Path-Constrained Rendezvous Planning Approach for Large-Scale Event-Driven Wireless Sensor Networks

Science.gov (United States)

Zhang, Gongxuan; Wang, Yongli; Wang, Tianshu

2018-01-01

We study the problem of employing a mobile-sink into a large-scale Event-Driven Wireless Sensor Networks (EWSNs) for the purpose of data harvesting from sensor-nodes. Generally, this employment improves the main weakness of WSNs that is about energy-consumption in battery-driven sensor-nodes. The main motivation of our work is to address challenges which are related to a network’s topology by adopting a mobile-sink that moves in a predefined trajectory in the environment. Since, in this fashion, it is not possible to gather data from sensor-nodes individually, we adopt the approach of defining some of the sensor-nodes as Rendezvous Points (RPs) in the network. We argue that RP-planning in this case is a tradeoff between minimizing the number of RPs while decreasing the number of hops for a sensor-node that needs data transformation to the related RP which leads to minimizing average energy consumption in the network. We address the problem by formulating the challenges and expectations as a Mixed Integer Linear Programming (MILP). Henceforth, by proving the NP-hardness of the problem, we propose three effective and distributed heuristics for RP-planning, identifying sojourn locations, and constructing routing trees. Finally, experimental results prove the effectiveness of our approach. PMID:29734718

Anterior fusion technique for multilevel cervical spondylotic myelopathy: a retrospective analysis of surgical outcome of patients with different number of levels fused.

Directory of Open Access Journals (Sweden)

Shunzhi Yu

Full Text Available OBJECTIVE: The anterior approach for multilevel CSM has been developed and obtained favorable outcomes. However, the operation difficulty, invasiveness and operative risks increase when multi-level involved. This study was to assess surgical parameters, complications, clinical and radiological outcomes in the treatment of 2-, 3- and 4-level CSM. METHODS: A total of 248 patients with 2-, 3- or 4-level CSM who underwent anterior decompression and fusion procedures between October 2005 and June 2011 were divided into three groups, the 2-level group (106 patients, the 3-level group (98 patients and the 4-level group (44 patients. The clinical and Radiographic outcomes including Japanese Orthopedic Association (JOA score, Neck Disability Index (NDI score, Odom's Scale, hospital stay, blood loss, operation time, fusion rate, cervical lordosis, cervical range of motion (ROM, and complications were compared. RESULTS: At a minimum of 2-year follow-up, no statistical differences in JOA score, NDI score, Odom's Scale, hospital stay, fusion rate and cervical lordosis were found among the 3 groups. However, the mean postoperative NDI score of the 4-level group was significantly higher than that in the other two groups (P<0.05, and in terms of postoperative total ROM, the 3-level group was superior to the 4-level group and inferior to 2-level group (P<0.05. The decrease rate of ROM in the 3-level group was significantly higher than that in the 2-level group, and lower than that in the 4-level group (P<0.05. CONCLUSIONS: As the number of involved levels increased, surgical results become worse in terms of operative time, blood loss, NDI score, cervical ROM and complication rates postoperatively. An appropriate surgical procedure for multilevel CSM should be chosen according to comprehensive clinical evaluation before operation, thus reducing fusion and decompression levels if possible.

Pharmacological characterization of the relaxant effect induced by adrenomedullin in rat cavernosal smooth muscle

Energy Technology Data Exchange (ETDEWEB)

Leite, L.N. [Programa de Pós-Graduação em Farmacologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Laboratório de Farmacologia, Departamento de Enfermagem Psiquiátrica e Ciências Humanas, Escola de Enfermagem de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Gonzaga, N.A. [Programa de Pós-Graduação em Farmacologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Tirapelli, D.P.C.; Tirapelli, L.F. [Departamento de Cirurgia e Anatomia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Tirapelli, C.R. [Laboratório de Farmacologia, Departamento de Enfermagem Psiquiátrica e Ciências Humanas, Escola de Enfermagem de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

2014-08-15

The aim of the present study was to determine the mechanisms underlying the relaxant effect of adrenomedullin (AM) in rat cavernosal smooth muscle (CSM) and the expression of AM system components in this tissue. Functional assays using standard muscle bath procedures were performed in CSM isolated from male Wistar rats. Protein and mRNA levels of pre-pro-AM, calcitonin receptor-like receptor (CRLR), and Subtypes 1, 2 and 3 of the receptor activity-modifying protein (RAMP) family were assessed by Western immunoblotting and quantitative real-time polymerase chain reaction, respectively. Nitrate and 6-keto-prostaglandin F{sub 1α} (6-keto-PGF{sub 1α}; a stable product of prostacyclin) levels were determined using commercially available kits. Protein and mRNA of AM, CRLR, and RAMP 1, -2, and -3 were detected in rat CSM. Immunohistochemical assays demonstrated that AM and CRLR were expressed in rat CSM. AM relaxed CSM strips in a concentration-dependent manner. AM{sub 22-52}, a selective antagonist for AM receptors, reduced the relaxation induced by AM. Conversely, CGRP{sub 8-37}, a selective antagonist for calcitonin gene-related peptide receptors, did not affect AM-induced relaxation. Preincubation of CSM strips with N{sup G}-nitro-L-arginine-methyl-ester (L-NAME, nitric oxide synthase inhibitor), 1H-(1,2,4)oxadiazolo[4,3-a]quinoxalin-1-one (ODQ, quanylyl cyclase inhibitor), Rp-8-Br-PET-cGMPS (cGMP-dependent protein kinase inhibitor), SC560 [5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-trifluoromethyl pyrazole, selective cyclooxygenase-1 inhibitor], and 4-aminopyridine (voltage-dependent K{sup +} channel blocker) reduced AM-induced relaxation. On the other hand, 7-nitroindazole (selective neuronal nitric oxide synthase inhibitor), wortmannin (phosphatidylinositol 3-kinase inhibitor), H89 (protein kinase A inhibitor), SQ22536 [9-(tetrahydro-2-furanyl)-9H-purin-6-amine, adenylate cyclase inhibitor], glibenclamide (selective blocker of ATP-sensitive K{sup +} channels), and

Pharmacological characterization of the relaxant effect induced by adrenomedullin in rat cavernosal smooth muscle

International Nuclear Information System (INIS)

Leite, L.N.; Gonzaga, N.A.; Tirapelli, D.P.C.; Tirapelli, L.F.; Tirapelli, C.R.

2014-01-01

The aim of the present study was to determine the mechanisms underlying the relaxant effect of adrenomedullin (AM) in rat cavernosal smooth muscle (CSM) and the expression of AM system components in this tissue. Functional assays using standard muscle bath procedures were performed in CSM isolated from male Wistar rats. Protein and mRNA levels of pre-pro-AM, calcitonin receptor-like receptor (CRLR), and Subtypes 1, 2 and 3 of the receptor activity-modifying protein (RAMP) family were assessed by Western immunoblotting and quantitative real-time polymerase chain reaction, respectively. Nitrate and 6-keto-prostaglandin F 1α (6-keto-PGF 1α ; a stable product of prostacyclin) levels were determined using commercially available kits. Protein and mRNA of AM, CRLR, and RAMP 1, -2, and -3 were detected in rat CSM. Immunohistochemical assays demonstrated that AM and CRLR were expressed in rat CSM. AM relaxed CSM strips in a concentration-dependent manner. AM 22-52 , a selective antagonist for AM receptors, reduced the relaxation induced by AM. Conversely, CGRP 8-37 , a selective antagonist for calcitonin gene-related peptide receptors, did not affect AM-induced relaxation. Preincubation of CSM strips with N G -nitro-L-arginine-methyl-ester (L-NAME, nitric oxide synthase inhibitor), 1H-(1,2,4)oxadiazolo[4,3-a]quinoxalin-1-one (ODQ, quanylyl cyclase inhibitor), Rp-8-Br-PET-cGMPS (cGMP-dependent protein kinase inhibitor), SC560 [5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-trifluoromethyl pyrazole, selective cyclooxygenase-1 inhibitor], and 4-aminopyridine (voltage-dependent K + channel blocker) reduced AM-induced relaxation. On the other hand, 7-nitroindazole (selective neuronal nitric oxide synthase inhibitor), wortmannin (phosphatidylinositol 3-kinase inhibitor), H89 (protein kinase A inhibitor), SQ22536 [9-(tetrahydro-2-furanyl)-9H-purin-6-amine, adenylate cyclase inhibitor], glibenclamide (selective blocker of ATP-sensitive K + channels), and apamin (Ca 2+ -activated

Comparison of Functional and Radiological Outcomes Between Two Posterior Approaches in the Treatment of Multilevel Cervical Spondylotic Myelopathy.

Science.gov (United States)

Ren, Da-Jiang; Li, Fang; Zhang, Zhi-Cheng; Kai, Guan; Shan, Jian-Lin; Zhao, Guang-Min; Sun, Tian-Sheng

2015-08-05

Posterior cervical decompression is an accepted treatment for multilevel cervical spondylotic myelopathy (CSM). Each posterior technique has its own advantages and disadvantages. In the present study, we compared the functional and radiological outcomes of expansive hemilaminectomy and laminoplasty with mini titanium plate in the treatment of multilevel CSM. Forty-four patients with multilevel CSM treated with posterior cervical surgery in Department of Orthopedic Surgery, Beijing Army General Hospital from March 2011 to June 2012 were enrolled in this retrospective study. Patients were divided into two groups by surgical procedure: Laminoplasty (Group L) and hemilaminectomy (Group H). Perioperative parameters including age, sex, duration of symptoms, operative duration, and intraoperative blood loss were recorded and compared. Spinal canal area, calculated using AutoCAD ® software(Autodesk Inc., San Rafael, CA, USA), and neurological improvement, evaluated with Japanese Orthopedic Association score, were also compared. Neurological improvement did not differ significantly between groups. Group H had a significantly shorter operative duration and significantly less blood loss. Mean expansion ratio was significantly greater in Group L (77.83 ± 6.41%) than in Group H (62.72 ± 3.86%) (P < 0.01). Both surgical approaches are safe and effective in treating multilevel CSM. Laminoplasty provides a greater degree of enlargement of the spinal canal, whereas expansive hemilaminectomy has the advantages of shorter operative duration and less intraoperative blood loss.

Vegetation cover and long-term conservation of radioactive waste packages: the case study of the CSM waste disposal facility (Manche District, France).

Science.gov (United States)

Petit-Berghem, Yves; Lemperiere, Guy

2012-03-01

The CSM is the first French waste disposal facility for radioactive waste. Waste material is buried several meters deep and protected by a multi-layer cover, and equipped with a drainage system. On the surface, the plant cover is a grassland vegetation type. A scientific assessment has been carried out by the Géophen laboratory, University of Caen, in order to better characterize the plant cover (ecological groups and associated soils) and to observe its medium and long term evolution. Field assessments made on 10 plots were complemented by laboratory analyses carried out over a period of 1 year. The results indicate scenarios and alternative solutions which could arise, in order to passively ensure the long-term safety of the waste disposal system. Several proposals for a blanket solution are currently being studied and discussed, under the auspices of international research institutions in order to determine the most appropriate materials for the storage conditions. One proposal is an increased thickness of these materials associated with a geotechnical barrier since it is well adapted to the forest plants which are likely to colonize the site. The current experiments that are carried out will allow to select the best option and could provide feedback for other waste disposal facility sites already being operated in France (CSFMA waste disposal facility, Aube district) or in other countries.

Mining technology development for hard rock excavation

International Nuclear Information System (INIS)

Hustrulid, W.; Cudnick, R.; Trent, R.; Holmberg, R.

1980-01-01

A research facility has been established in the granitic gneiss of the CSM Experimental Mine at Idaho Springs, Colorado, for the purpose of evaluating/developing mining, geologic and geotechnical procedures appropriate for use in establishing nuclear waste repositories in hard rock. An experimental room has been excavated using careful blasting procedures. The extent and magnitude of blast damage is being evaluated. Structural geology is being mapped to assess continuity

Rumen Degradability and Post-ruminal Digestion of Dry Matter, Nitrogen and Amino Acids of Three Protein Supplements

Directory of Open Access Journals (Sweden)

Wei Gao

2015-04-01

Full Text Available This study evaluated the in situ ruminal degradability, and subsequent small intestinal digestibility (SID of dry matter, crude protein (CP, and amino acids (AA of cottonseed meal (CSM, sunflower seed meal (SFSM and distillers dried grains with solubles (DDGS by using the modified three-step in vitro procedure. The ruminal degradability and subsequent SID of AA in rumen-undegradable protein (RUP-AA varied among three protein supplements. The result show that the effective degradability of DM for SFSM, CSM, and DDGS was 60.8%, 56.4%, and 41.0% and their ruminal fermentable organic matter was 60.0%, 55.9%, and 39.9%, respectively. The ruminal degradable protein (RDP content in CP for SFSM, CSM, and DDGS was 68.3%, 39.0%, and 32.9%, respectively, at the ruminal solid passage rate of 1.84%/h. The SFSM is a good source of RDP for rumen micro-organisms; however, the SID of RUP of SFSM was lower. The DDGS and CSM are good sources of RUP for lambs to digest in the small intestine to complement ruminal microbial AA of growing lambs. Individual RUP-AA from each protein source was selectively removed by the rumen micro-organisms, especially for Trp, Arg, His, and Lys (p<0.01. The SID of individual RUP-AA was different within specific RUP origin (p<0.01. Limiting amino acid was Leu for RUP of CSM and Lys for both RUP of SFSM and DDGS, respectively. Therefore, different protein supplements with specific limitations should be selected and combined carefully in growing lambs ration to optimize AA balance.

Endoscopic Ultrasound-guided Rendezvous Technique after Failed Endoscopic Retrograde Cholangiopancreatography: Which Approach Route Is the Best?

Science.gov (United States)

Okuno, Nozomi; Hara, Kazuo; Mizuno, Nobumasa; Hijioka, Susumu; Tajika, Masahiro; Tanaka, Tsutomu; Ishihara, Makoto; Hirayama, Yutaka; Onishi, Sachiyo; Niwa, Yasumasa; Yamao, Kenji

2017-12-01

Objective The endoscopic ultrasound-guided rendezvous technique (EUS-RV) is a salvage method for failed selective biliary cannulation. Three puncture routes have been reported, with many comparisons between the intra-hepatic and extra-hepatic biliary ducts. We used the trans-esophagus (TE) and trans-jejunum (TJ) routes. In the present study, the utility of EUS-RV for biliary access was evaluated, focusing on the approach routes. Methods and Patients In 39 patients, 42 puncture routes were evaluated in detail. EUS-RV was performed between January 2010 and December 2014. The patients were prospectively enrolled, and their clinical data were retrospectively collected. Results The patients' median age was 71 (range 29-84) years. The indications for endoscopic retrograde cholangiopancreatography (ERCP) were malignant biliary obstruction in 24 patients and benign biliary disease in 15. The technical success rate was 78.6% (33/42) and was similar among approach routes (p=0.377). The overall complication rate was 16.7% (7/42) and was similar among approach routes (p=0.489). However, mediastinal emphysema occurred in 2 TE route EUS-RV patients. No EUS-RV-related deaths occurred. Conclusion EUS-RV proved reliable after failed ERCP. The selection of the appropriate route based on the patient's condition is crucial.

[Social marketers' lack of success in using CSM discipline to harness commercial resources and increase contraceptive prevalence].

Science.gov (United States)

Davies, J

1984-01-01

Social marketers have certainly shown that the CSM discipline can quickly and cost-effectively harness commercial resources to increase contraceptive prevalence. But why hasn't the social marketing idea caught on in more countries? According to Social Marketing Forum, only a tiny number of countries have active programs after more than a decade of effort. The most likely reason for this lack of success is doubt and fear on the part of both developing countries' officials and donor agencies about allowing marketing enthusiasts--with our very noticeable advertising methods--to join the family planning fight. And what has our answer been? Usually, a head-on retort such as, "But look at all the condoms we've sold]" And that gets us nowhere, because the successful peddling of 1 not-so-impressive method doesn't begin to balance the fears of a possible backlash that brash condom promotions could bring down on official heads. The lesson we should be learning is that social marketers possess to narrow an outlook and promote a small range of products that don't enthuse decisionmakers. Hence, we are often perceived as condom salesmen--and not much more. What should we be doing? We should be selling the idea of using private sector experience to assist national development. That means social development, particularly improved health, family planning and women's education. These 3 activities have proven effective in reducing fertility and would add up to a marketing opportunity--a longterm challenge that should enthuse dicisionmakers, private sector entrepreneurs and donor agencies alike. Further, our model--the commercial sector--is renowned for branching out and secceeding in a broad range of endeavors. As an example, Procter and Gamble uses separate divisions to market different products. Initiatives already exist in many countries to harness the private sector as a development tool. Social marketers should be leading the initiative--and benefitting from it, too. full text

Rendezvous with Toutatis from the Moon: The Chang'e-2 mission

Science.gov (United States)

Huang, J.; Tang, X.; Meng, L.

2014-07-01

Chang'e-2 probe was the second lunar probe of China, with the main objectives to demonstrate some key features of the new lunar soft landing technology, and its applications to future exploration missions. After completing the planned mission successfully, Chang'e-2 flew away from the Moon and entered into the interplanetary space. Later, at a distance of 7 million km from the Earth, Chang'e-2 encountered asteroid (4179) Toutatis with a very close fly-by distance and obtained colorful images with a 3-m resolution. Given some surplus velocity increment as well as the promotion of autonomous flight ability and improvement of control, propulsion, and thermal systems in the initial design, Chang'e-2 had the capabilities necessary for escaping from the Moon. By taking advantage of the unique features of the Lagrangian point, the first close fly-by of asteroid Toutatis was realized despite the tight constraints of propellant allocation, spacecraft-Earth communication, and coordination of execution sequences. Chang'e-2 realized the Toutatis flyby with a km-level distance at closest approach. In the absence of direct measurement method, based on the principle of relative navigation and through the use of the sequence of target images, we calculated the rendezvous parameters such as relative distance and image resolution. With the help of these parameters, some fine and new scientific discoveries about the asteroid were obtained by techniques of optical measurements and image processing. Starting with an innovative design, followed by high-fidelity testing and demonstration, elaborative implementation, and optimal usage of residual propellant, Chang'e-2 has for the first time successfully explored the Moon, L2 point and an asteroid, while achieving the purpose of 'faster, better, cheaper'. What Chang'e-2 has accomplished was far beyond our expectations. *J. Huang is the chief designer (PI) of Chang'e-2 probe, planned Chang'e-2's multi-objective and multitasking exploration

Replacing soybean meal for cottonseed meal on performance of lactating dairy cows.

Science.gov (United States)

Imaizumi, Hugo; De Souza, Jonas; Batistel, Fernanda; Santos, Flávio Augusto Portela

2016-01-01

Cottonseed meal (CSM) is an alternative source of protein, and previous studies have been shown that it can replace soybean meal (SBM) without decrease animal performance. However, Brazilian CSM has a different chemical composition compared with the usual CSM reported in the literature. The objective of this experiment was to evaluate the effects of replacing SBM for Brazilian CSM on performance and energy balance of mid-lactating dairy cows. Forty-two Holstein cows were used in a replicate 3 × 3 Latin square design. Increasing contents of CSM (0, 15, and 30% of dry matter (DM)) were fed in diets to replace SBM. Milk yield and feed efficiency were linearly reduced with the replacement of CSM for SBM (P = 0.001). Milk fat content tended to increase quadratically (P = 0.07) with CSM addition. Replacing SBM for CSM affected milk protein content quadratically (P = 0.05). Milk urea nitrogen and plasma urea nitrogen (PUN) tended to respond quadratically (P = 0.06 and 0.10) when CSM replaced SBM to the diets. Variation in body weight (BW) also responded quadratically as CSM replaced SBM (P = 0.05). Altogether, the findings suggest better performance when cows receive SBM diet compared with the Brazilian CSM diet.

SN 2010jl: Optical to Hard X-ray Observations Reveal an Explosion Embedded In a Ten Solar Mass Cocoon

DEFF Research Database (Denmark)

Ofek, Eran O.; Zoglauer, Andreas; Boggs, Steven E.

2014-01-01

Some supernovae (SNe) may be powered by the interaction of the SN ejecta with a large amount of circumstellar matter (CSM). However, quantitative estimates of the CSM mass around such SNe are missing when the CSM material is optically thick. Specifically, current estimators are sensitive to uncer......Some supernovae (SNe) may be powered by the interaction of the SN ejecta with a large amount of circumstellar matter (CSM). However, quantitative estimates of the CSM mass around such SNe are missing when the CSM material is optically thick. Specifically, current estimators are sensitive...

Cross-cultural adaptation and psychometric properties of an Arabic ...

African Journals Online (AJOL)

2016-06-08

Jun 8, 2016 ... Model of Self-Regulation (CSM) developed by Leventhal et al. (6). It addresses how .... also recorded. Fig. 1. Procedure and stages of the assessment of the validity and reproducibility of the Arabic version of the Brief Illness ..... coping style and illness perception on anxiety and depression in patients with ...

Comparison of Functional and Radiological Outcomes Between Two Posterior Approaches in the Treatment of Multilevel Cervical Spondylotic Myelopathy

Directory of Open Access Journals (Sweden)

Da-Jiang Ren

2015-01-01

Full Text Available Background: Posterior cervical decompression is an accepted treatment for multilevel cervical spondylotic myelopathy (CSM. Each posterior technique has its own advantages and disadvantages. In the present study, we compared the functional and radiological outcomes of expansive hemilaminectomy and laminoplasty with mini titanium plate in the treatment of multilevel CSM. Methods: Forty-four patients with multilevel CSM treated with posterior cervical surgery in Department of Orthopedic Surgery, Beijing Army General Hospital from March 2011 to June 2012 were enrolled in this retrospective study. Patients were divided into two groups by surgical procedure: Laminoplasty (Group L and hemilaminectomy (Group H. Perioperative parameters including age, sex, duration of symptoms, operative duration, and intraoperative blood loss were recorded and compared. Spinal canal area, calculated using AutoCAD ® software(Autodesk Inc., San Rafael, CA, USA, and neurological improvement, evaluated with Japanese Orthopedic Association score, were also compared. Results: Neurological improvement did not differ significantly between groups. Group H had a significantly shorter operative duration and significantly less blood loss. Mean expansion ratio was significantly greater in Group L (77.83 ± 6.41% than in Group H (62.72 ± 3.86% (P < 0.01. Conclusions: Both surgical approaches are safe and effective in treating multilevel CSM. Laminoplasty provides a greater degree of enlargement of the spinal canal, whereas expansive hemilaminectomy has the advantages of shorter operative duration and less intraoperative blood loss.

A novel "hitch-and-ride" deep biliary cannulation method during rendezvous endoscopic ultrasound-guided ERCP technique.

Science.gov (United States)

Nakai, Yousuke; Isayama, Hiroyuki; Matsubara, Saburo; Kogure, Hirofumi; Mizuno, Suguru; Hamada, Tsuyoshi; Takahara, Naminatsu; Nakamura, Tomoka; Sato, Tatsuya; Takeda, Tsuyoshi; Hakuta, Ryunosuke; Ishigaki, Kazunaga; Saito, Kei; Tada, Minoru; Koike, Kazuhiko

2017-10-01

Background and study aim Endoscopic ultrasound-guided rendezvous (EUS-RV) is increasingly reported as a treatment option after failed endoscopic retrograde cholangiopancreatography. We developed a novel "hitch-and-ride" catheter for biliary cannulation to reduce the risk of guidewire loss during EUS-RV. Patients and methods We retrospectively evaluated safety and technical success of EUS-RV between June 2011 and May 2016. Biliary cannulation during EUS-RV using three methods - over-the-wire, along-the-wire, and hitch-and-ride - were compared. Results A total of 30 EUS-RVs were attempted and the technical success rate was 93.3 %, with two failures (one bile duct puncture and one guidewire insertion). After 28 cases of successful guidewire passage, cannulation was attempted by the over-the-wire (n = 13), along-the-wire (n = 4) or hitch-and-ride (n = 11) method. Only the hitch-and-ride method achieved biliary cannulation without guidewire loss or conversion to the other methods. Time to cannulation was shorter with the hitch-and-ride method (4 minutes) than with over-the-wire and along-the-wire methods (9 and 13 minutes, respectively). The adverse event rate of EUS-RV was 23.3 %. Conclusion A novel hitch-and-ride catheter was feasible for biliary cannulation after EUS-RV. © Georg Thieme Verlag KG Stuttgart · New York.

Omnidirectional angle constraint based dynamic six-degree-of-freedom measurement for spacecraft rendezvous and docking simulation

Science.gov (United States)

Shi, Shendong; Yang, Linghui; Lin, Jiarui; Ren, Yongjie; Guo, Siyang; Zhu, Jigui

2018-04-01

In this paper we present a novel omnidirectional angle constraint based method for dynamic 6-DOF (six-degree-of-freedom) measurement. A photoelectric scanning measurement network is employed whose photoelectric receivers are fixed on the measured target. They are in a loop distribution and receive signals from rotating transmitters. Each receiver indicates an angle constraint direction. Therefore, omnidirectional angle constraints can be constructed in each rotation cycle. By solving the constrained optimization problem, 6-DOF information can be obtained, which is independent of traditional rigid coordinate system transformation. For the dynamic error caused by the measurement principle, we present an interpolation method for error reduction. Accuracy testing is performed in an 8  ×  8 m measurement area with four transmitters. The experimental results show that the dynamic orientation RMSEs (root-mean-square errors) are reduced from 0.077° to 0.044°, 0.040° to 0.030° and 0.032° to 0.015° in the X, Y, and Z axes, respectively. The dynamic position RMSE is reduced from 0.65 mm to 0.24 mm. This method is applied during the final approach phase in the rendezvous and docking simulation. Experiments under different conditions are performed in a 40  ×  30 m area, and the method is verified to be effective.

Cervical spondylotic myelopathy: the clinical phenomenon and the current pathobiology of an increasingly prevalent and devastating disorder.

Science.gov (United States)

Kalsi-Ryan, Sukhvinder; Karadimas, Spyridon K; Fehlings, Michael G

2013-08-01

Cervical spondylotic myelopathy (CSM) is a common disorder involving chronic progressive compression of the cervical spinal cord due to degenerative disc disease, spondylosis, or other degenerative pathology. CSM is the most common form of spinal cord impairment and causes functional decline leading to reduced independence and quality of life. Despite a sound understanding of the disease process, clinical presentation and management, a universal definition of CSM and a standardized index of severity are not currently used universally. Work is required to develop a definition and establish clinical predictors of progression to improve management of CSM. Despite advances in decompressive and reconstructive surgery, patients are often left with residual disability. Gaps in knowledge of the pathobiology of CSM have limited therapeutic advances to complement surgery. Although the histopathologic and pathophysiologic similarities between CSM and traumatic spinal cord injury have long been acknowledged, the unique pathomechanisms of CSM remain unexplored. Increased efforts to elucidate CSM pathobiology could lead to the discovery of novel therapeutic targets for human CSM and other spinal cord diseases. Here, the natural history of CSM, epidemiology, clinical presentation, and current methods of clinical management are reported, along with the current state of basic scientific research in the field.

Corporate Sustainability Management and Its Market Benefits

Directory of Open Access Journals (Sweden)

Joonhyun Kim

2018-05-01

Full Text Available An increasing number of firms around the world are applying corporate sustainability management (CSM to their business operations, and the research interest on the effect of CSM in terms of the capital market benefit has grown rapidly under the different research settings across various countries. This study investigates whether CSM contributes to increasing firm value and improving the market response to earnings disclosure, using Korean firms as the sample. The test results show that firms with CSM reporting outperform the other firms in terms of Tobin’s Q and the market-adjusted stock returns over a year. Further, investors respond more strongly to the earnings announcement events of the CSM firms than the non-CSM firms, which is more likely to be attributed to the enhanced corporate disclosure practice of the CSM firms than an improvement in earnings quality. Our findings indicate that the shareholders of firms with CSM reporting can enjoy relatively higher market valuations and enhanced information content of earnings disclosures. In conclusion, the results show that the CSM activities in pursuit of a harmonious relationship with the various stakeholders bring different forms of market benefits to shareholders as well.

Quantum mechanics as a natural generalization of classical statistical mechanics

International Nuclear Information System (INIS)

Xu Laizi; Qian Shangwu

1994-01-01

By comparison between equations of motion of geometrical optics (GO) and that of classical statistical mechanics (CSM), it is found that there should be an analogy between GO and CSM instead of GO and classical mechanics (CM). Furthermore, by comparison between the classical limit (CL) of quantum mechanics (QM) and CSM, the authors find that CL of QM is CSM not CM, hence they demonstrated that QM is a natural generalization of CSM instead of CM

China Accomplished Its First Space Rendezvous and Docking

Institute of Scientific and Technical Information of China (English)

Chen Xiaoli

2011-01-01

At 1:36 am on November 3,China's Shenzhou 8 unmanned spaceship and Tiangong 1 space lab spacecraft accomplished the country's first space docking procedure and coupling in space at more than 343km above Earth's surface,marking a great leap in China's space program.

Facility design, construction, and operation

International Nuclear Information System (INIS)

1995-04-01

France has been disposing of low-level radioactive waste (LLW) at the Centre de Stockage de la Manche (CSM) since 1969 and now at the Centre de Stockage de l'Aube (CSA) since 1992. In France, several agencies and companies are involved in the development and implementation of LLW technology. The Commissariat a l'Energie Atomic (CEA), is responsible for research and development of new technologies. The Agence National pour la Gestion des Dechets Radioactifs is the agency responsible for the construction and operation of disposal facilities and for wastes acceptance for these facilities. Compagnie Generale des Matieres Nucleaires provides fuel services, including uranium enrichment, fuel fabrication, and fuel reprocessing, and is thus one generator of LLW. Societe pour les Techniques Nouvelles is an engineering company responsible for commercializing CEA waste management technology and for engineering and design support for the facilities. Numatec, Inc. is a US company representing these French companies and agencies in the US. In Task 1.1 of Numatec's contract with Martin Marietta Energy Systems, Numatec provides details on the design, construction and operation of the LLW disposal facilities at CSM and CSA. Lessons learned from operation of CSM and incorporated into the design, construction and operating procedures at CSA are identified and discussed. The process used by the French for identification, selection, and evaluation of disposal technologies is provided. Specifically, the decisionmaking process resulting in the change in disposal facility design for the CSA versus the CSM is discussed. This report provides' all of the basic information in these areas and reflects actual experience to date

Cellulose/soy protein isolate composite membranes: evaluations of in vitro cytocompatibility with Schwann cells and in vivo toxicity to animals.

Science.gov (United States)

Luo, Lihua; Gong, Wenrong; Zhou, Yi; Yang, Lin; Li, Daokun; Huselstein, Celine; Wang, Xiong; He, Xiaohua; Li, Yinping; Chen, Yun

2015-01-01

To evaluate the in vitro cytocompatibility of cellulose/soy protein isolate composite membranes (CSM) with Schwann cells and in vivo toxicity to animals. A series of cellulose/soy protein isolate composite membranes (CSM) were prepared by blending, solution casting and coagulation process. The cytocompatibility of the CSM to Schwann cells were evaluated by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and by direct cells culture of Schwann cells on the surfaces of the CSM, respectively. The in vivo toxicity of the CSM to animals were also evaluated by acute toxicity testing, skin sensitization testing, pyrogen testing and intracutaneous stimulation testing, respectively, according to the ISO 10993 standard. The MTT assay showed that the cell viability of Schwann cells cultured in extracts from the CSM was higher than that from the neat cellulose membrane without containing SPI component. The direct cells culture indicated that the Schwann cells could attach and grow well on the surface of the CSM and the incorporation of SPI into cellulose contributed to improvement of cell adhesion and proliferation. The evaluations of in vivo biological safety suggested that the CSM showed no acute toxicity, no skin sensitization and no intracutaneous stimulation to the experimental animals. The CSM had in vitro cytocompatibility with Schwann cells and biological safety to animals, suggesting potential for the applications as nerve conduit for the repair of nerve defect.

Dicty_cDB: VFK143 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Q) /CSM/SL/SLC3-C/SLC352Q.Seq.d/ 1336 0.0 SFE831 (SFE831Q) /CSM/SF/SFE8-B/SFE831Q.Seq.d/ 1336 0.0 AHD492 (AHD492...Q) /CSM/AH/AHD4-D/AHD492Q.Seq.d/ 1336 0.0 AFG189 (AFG189Q) /CSM/AF/AFG1-D/AFG

Strong late-time circumstellar interaction in the peculiar supernova iPTF14hls

Science.gov (United States)

Andrews, Jennifer E.; Smith, Nathan

2018-06-01

We present a moderate-resolution spectrum of the peculiar Type II supernova (SN) iPTF14hls taken on day 1153 after discovery. This spectrum reveals the clear signature of shock interaction with dense circumstellar material (CSM). We suggest that this CSM interaction may be an important clue for understanding the extremely unusual photometric and spectroscopic evolution seen over the first 600 d of iPTF14hls. The late-time spectrum shows a double-peaked intermediate-width H α line indicative of expansion speeds around 1000 km s-1, with the double-peaked shape hinting at a disc-like geometry in the CSM. If the CSM were highly asymmetric, perhaps in a disc or torus that was ejected from the star 3-6 yr prior to explosion, the CSM interaction could have been overrun and hidden below the SN ejecta photosphere from a wide range of viewing angles. In that case, CSM interaction luminosity would have been thermalized well below the photosphere, potentially sustaining the high luminosity without exhibiting the traditional observational signatures of strong CSM interaction (narrow H α emission and X-rays). Variations in density structure of the CSM could account for the multiple rebrightenings of the light curve. We propose that a canonical 1 × 1051 erg explosion energy with enveloped CSM interaction as seen in some recent SNe, rather than an entirely new explosion mechanism, may be adequate to explain the peculiar evolution of iPTF14hls.

SN 2017dio: A Type-Ic Supernova Exploding in a Hydrogen-rich Circumstellar Medium

Science.gov (United States)

Kuncarayakti, Hanindyo; Maeda, Keiichi; Ashall, Christopher J.; Prentice, Simon J.; Mattila, Seppo; Kankare, Erkki; Fransson, Claes; Lundqvist, Peter; Pastorello, Andrea; Leloudas, Giorgos; Anderson, Joseph P.; Benetti, Stefano; Bersten, Melina C.; Cappellaro, Enrico; Cartier, Régis; Denneau, Larry; Della Valle, Massimo; Elias-Rosa, Nancy; Folatelli, Gastón; Fraser, Morgan; Galbany, Lluís; Gall, Christa; Gal-Yam, Avishay; Gutiérrez, Claudia P.; Hamanowicz, Aleksandra; Heinze, Ari; Inserra, Cosimo; Kangas, Tuomas; Mazzali, Paolo; Melandri, Andrea; Pignata, Giuliano; Rest, Armin; Reynolds, Thomas; Roy, Rupak; Smartt, Stephen J.; Smith, Ken W.; Sollerman, Jesper; Somero, Auni; Stalder, Brian; Stritzinger, Maximilian; Taddia, Francesco; Tomasella, Lina; Tonry, John; Weiland, Henry; Young, David R.

2018-02-01

SN 2017dio shows both spectral characteristics of a type-Ic supernova (SN) and signs of a hydrogen-rich circumstellar medium (CSM). Prominent, narrow emission lines of H and He are superposed on the continuum. Subsequent evolution revealed that the SN ejecta are interacting with the CSM. The initial SN Ic identification was confirmed by removing the CSM interaction component from the spectrum and comparing with known SNe Ic and, reversely, adding a CSM interaction component to the spectra of known SNe Ic and comparing them to SN 2017dio. Excellent agreement was obtained with both procedures, reinforcing the SN Ic classification. The light curve constrains the pre-interaction SN Ic peak absolute magnitude to be around {M}g=-17.6 mag. No evidence of significant extinction is found, ruling out a brighter luminosity required by an SN Ia classification. These pieces of evidence support the view that SN 2017dio is an SN Ic, and therefore the first firm case of an SN Ic with signatures of hydrogen-rich CSM in the early spectrum. The CSM is unlikely to have been shaped by steady-state stellar winds. The mass loss of the progenitor star must have been intense, \\dot{M}∼ 0.02{({ε }{{H}α }/0.01)}-1 ({v}{wind}/500 km s‑1) ({v}{shock}/10,000 km s‑1)‑3 M ⊙ yr‑1, peaking at a few decades before the SN. Such a high mass-loss rate might have been experienced by the progenitor through eruptions or binary stripping. Based on observations made with the NOT, operated by the Nordic Optical Telescope Scientific Association at the Observatorio del Roque de los Muchachos, La Palma, Spain, of the Instituto de Astrofisica de Canarias. This work is based (in part) on observations collected at the European Organisation for Astronomical Research in the Southern Hemisphere, Chile as part of PESSTO, (the Public ESO Spectroscopic Survey for Transient Objects Survey) ESO program 188.D-3003, 191.D-0935, 197.D-1075. Based on observations made with the Liverpool Telescope operated on the

Pose estimation and tracking of non-cooperative rocket bodies using Time-of-Flight cameras

Science.gov (United States)

Gómez Martínez, Harvey; Giorgi, Gabriele; Eissfeller, Bernd

2017-10-01

This paper presents a methodology for estimating the position and orientation of a rocket body in orbit - the target - undergoing a roto-translational motion, with respect to a chaser spacecraft, whose task is to match the target dynamics for a safe rendezvous. During the rendezvous maneuver the chaser employs a Time-of-Flight camera that acquires a point cloud of 3D coordinates mapping the sensed target surface. Once the system identifies the target, it initializes the chaser-to-target relative position and orientation. After initialization, a tracking procedure enables the system to sense the evolution of the target's pose between frames. The proposed algorithm is evaluated using simulated point clouds, generated with a CAD model of the Cosmos-3M upper stage and the PMD CamCube 3.0 camera specifications.

Partners in Physics with Colorado School of Mines' Society of Physics Students

Science.gov (United States)

Moore, Shirley; Stilwell, Matthew; Boerner, Zach

2011-04-01

The Colorado School of Mines (CSM) Society of Physics Students (SPS) revitalized in 2008 and has since blown up with outreach activity, incorporating all age levels into our programs. In Spring 2010, CSM SPS launched a new program called Partners in Physics. Students from Golden High School came to CSM where they had a college-level lesson on standing waves and their applications. These students then joined volunteers from CSM in teaching local elementary school students about standing waves beginning with a science show. The CSM and high school students then helped the children to build make-and-take demonstrations incorporating waves. This year, rockets are the theme for Partners in Physics and we began with demonstrations with local middle school students. In Spring 2011, CSM SPS will be teaching elementary school students about projectile motion and model rockets along with these middle school students. Colorado School of Mines Department of Physics

Relationship between automation trust and operator performance for the novice and expert in spacecraft rendezvous and docking (RVD).

Science.gov (United States)

Niu, Jianwei; Geng, He; Zhang, Yijing; Du, Xiaoping

2018-09-01

Operator trust in automation is a crucial factor influencing its use and operational performance. However, the relationship between automation trust and performance remains poorly understood and requires further investigation. The objective of this paper is to explore the difference in trust and performance on automation-aided spacecraft rendezvous and docking (RVD) between the novice and the expert and to investigate the relationship between automation trust and performance as well. We employed a two-factor mixed design, with training skill (novice and expert) and automation mode (manual RVD and automation aided RVD) serving as the two factors. Twenty participants, 10 novices and 10 experts, were recruited to conduct six RVD tasks for two automation levels. After the tasks, operator performance was recorded by the desktop hand-held docking training equipment. Operator trust was also measured by a 12-items questionnaire at the beginning and end of each trial. As a result, automation narrowed the performance gap significantly between the novice and the expert, and the automation trust showed a marginally significant difference between the novice and the expert. Furthermore, the result demonstrated that the attitude angle control error of the expert was related to the total trust score, whereas other automation performance indicators were not related to the total score of trust. However, automation performance was related to the dimensions of trust, such as entrust, harmful, and dependable. Copyright © 2018 Elsevier Ltd. All rights reserved.

NASA's Automated Rendezvous and Docking/Capture Sensor Development and Its Applicability to the GER

Science.gov (United States)

Hinkel, Heather; Cryan, Scott; DSouza, Christopher; Strube, Matthew

2014-01-01

This paper will address how a common Automated Rendezvous and Docking/Capture (AR&D/C) sensor suite can support Global Exploration Roadmap (GER) missions, and discuss how the model of common capability development to support multiple missions can enable system capability level partnerships and further GER objectives. NASA has initiated efforts to develop AR&D/C sensors, that are directly applicable to GER. NASA needs AR&D/C sensors for both the robotic and crewed segments of the Asteroid Redirect Mission (ARM). NASA recently conducted a commonality assessment of the concept of operations for the robotic Asteroid Redirect Vehicle (ARV) and the crewed mission segment using the Orion crew vehicle. The commonality assessment also considered several future exploration and science missions requiring an AR&D/C capability. Missions considered were asteroid sample return, satellite servicing, and planetary entry, descent, and landing. This assessment determined that a common sensor suite consisting of one or more visible wavelength cameras, a three-dimensional LIDAR along with long-wavelength infrared cameras for robustness and situational awareness could be used on each mission to eliminate the cost of multiple sensor developments and qualifications. By choosing sensor parameters at build time instead of at design time and, without having to requalify flight hardware, a specific mission can design overlapping bearing, range, relative attitude, and position measurement availability to suit their mission requirements with minimal nonrecurring engineering costs. The resulting common sensor specification provides the union of all performance requirements for each mission and represents an improvement over the current systems used for AR&D/C today. NASA's AR&D/C sensor development path could benefit the International Exploration Coordination Group (ISECG) and support the GER mission scenario by providing a common sensor suite upon which GER objectives could be achieved while

Source-term development for a contaminant plume for use by multimedia risk assessment models

International Nuclear Information System (INIS)

Whelan, Gene; McDonald, John P.; Taira, Randal Y.; Gnanapragasam, Emmanuel K.; Yu, Charley; Lew, Christine S.; Mills, William B.

1999-01-01

Multimedia modelers from the U.S. Environmental Protection Agency (EPA) and the U.S. Department of Energy (DOE) are collaborating to conduct a comprehensive and quantitative benchmarking analysis of four intermedia models: DOE's Multimedia Environmental Pollutant Assessment System (MEPAS), EPA's MMSOILS, EPA's PRESTO, and DOE's RESidual RADioactivity (RESRAD). These models represent typical analytically, semi-analytically, and empirically based tools that are utilized in human risk and endangerment assessments for use at installations containing radioactive and/or hazardous contaminants. Although the benchmarking exercise traditionally emphasizes the application and comparison of these models, the establishment of a Conceptual Site Model (CSM) should be viewed with equal importance. This paper reviews an approach for developing a CSM of an existing, real-world, Sr-90 plume at DOE's Hanford installation in Richland, Washington, for use in a multimedia-based benchmarking exercise bet ween MEPAS, MMSOILS, PRESTO, and RESRAD. In an unconventional move for analytically based modeling, the benchmarking exercise will begin with the plume as the source of contamination. The source and release mechanism are developed and described within the context of performing a preliminary risk assessment utilizing these analytical models. By beginning with the plume as the source term, this paper reviews a typical process and procedure an analyst would follow in developing a CSM for use in a preliminary assessment using this class of analytical tool

Modeling Type II-P/II-L Supernovae Interacting with Recent Episodic Mass Ejections from Their Presupernova Stars with MESA and SNEC

Science.gov (United States)

Das, Sanskriti; Ray, Alak

2017-12-01

We show how dense, compact, discrete shells of circumstellar gas immediately outside of red supergiants affect the optical light curves of Type II-P/II-L supernovae (SNe), using the example of SN 2013ej. Earlier efforts in the literature had used an artificial circumstellar medium (CSM) stitched to the surface of an evolved star that had not gone through a phase of late-stage heavy mass loss, which, in essence, is the original source of the CSM. In contrast, we allow enhanced mass-loss rate from the modeled star during the 16O and 28Si burning stages and construct the CSM from the resulting mass-loss history in a self-consistent way. Once such evolved pre-SN stars are exploded, we find that the models with early interaction between the shock and the dense CSM reproduce light curves far better than those without that mass loss and, hence, having no nearby dense CSM. The required explosion energy for the progenitors with a dense CSM is reduced by almost a factor of two compared to those without the CSM. Our model, with a more realistic CSM profile and presupernova and explosion parameters, fits observed data much better throughout the rise, plateau, and radioactive tail phases as compared to previous studies. This points to an intermediate class of supernovae between Type II-P/II-L and Type II-n SNe with the characteristics of simultaneous UV and optical peak, slow decline after peak, and a longer plateau.

Proteomic comparison by iTRAQ combined with mass spectrometry of egg white proteins in laying hens (Gallus gallus) fed with soybean meal and cottonseed meal

Science.gov (United States)

He, Tao; Zhang, Haijun; Wang, Jing; Wu, Shugeng; Yue, Hongyuan; Qi, Guanghai

2017-01-01

Cottonseed meal (CSM) is commonly used in hens’ diets to replace soybean meal (SBM). However, the molecular consequences of this substitution remains unclear. To investigate the impact of this substitution at the molecular level, iTRAQ combined with biochemical analysis was performed in Hy-Line W-36 hens supplemented with a mixed diet of CSM and SBM. Egg weight, albumen height, and Haugh unit were significantly reduced in the CSM100 group (100% crude protein of SBM replaced by CSM) compared with the SBM group (Phen diet. PMID:28813468

Isolation and characterization of cobalt-sensitive mutant of Neurospora crassa

Directory of Open Access Journals (Sweden)

Krishnapuram Rashmi

2014-12-01

Full Text Available Objective: To isolate and demonstrate the mechanism of metal transport in cobalt-sensitive mutant (CSM of Neurospora crassa (N. crassa. Methods: Isolation of CSM of N. crassa, I50 determination, growth measurements, metal ion uptake studies and sexual crosses were performed to determine the mechanism of sensitivity and locus. Results: CSMs of N. crassa were isolated by mutagenesis with diethyl sulfate. More than 500 isolates were screened and out of these isolates, CSM-I was 5-fold and CSM-II was 10-fold sensitive to Co on liquid medium as compared to the wild type. Compositional analysis of cell wall revealed the decrease in total phosphate content. N. crassa CSM bound much less cobalt to cell wall fraction than wild type. The data indicated closer linkage between resistance and mating type locus (mat, which is, located on LG I. Conclusions: A CSM of N. crassa is 5-fold more sensitive than wild type and cross sensitive to nickel and copper and hyper-accumulates 2-4 fold more toxic metal ions over wild type. The mechanism for sensitivity is decreased in cobalt-binding to cell wall fraction and increased intracellular uptake. N. crassa-acon-3 morphologically resembles the CSM, cobalt-sensitive and maps to similar locus.

Predicting prostate cancer-specific outcome after radical prostatectomy among men with very high-risk cT3b/4 PCa: a multi-institutional outcome study of 266 patients.

Science.gov (United States)

Moltzahn, F; Karnes, J; Gontero, P; Kneitz, B; Tombal, B; Bader, P; Briganti, A; Montorsi, F; Van Poppel, H; Joniau, S; Spahn, M

2015-03-01

The value of radical prostatectomy (RP) as an approach for very high-risk prostate cancer (PCa) patients is controversial. To examine the risk of 10-year cancer-specific mortality (CSM) and other-cause mortality (OCM) according to clinical and pathological characteristics of very high-risk cT3b/4 PCa patients treated with RP as the primary treatment option. In a multi-institutional cohort, 266 patients with very high-risk cT3b/4 PCa treated with RP were identified. All patients underwent RP and pelvic lymph-node dissection. Competing-risk analyses assessed 10-year CSM and OCM before and after stratification for age and Charlson comorbidity index (CCI). Overall, 34 (13%) patients died from PCa and 73 (28%) from OCM. Ten-year CSM and OCM rates ranged from 5.6% to 12.9% and from 10% to 38%, respectively. OCM was the leading cause of death in all subgroups. Age and comorbidities were the main determinants of OCM. In healthy men, CSM rate did not differ among age groups (10-year CSM rate for ⩽64, 65-69 and ⩾70 years: 16.2%, 11.5% and 17.1%, respectively). Men with a CCI ⩾1 showed a very low risk of CSM irrespective of age (10-year CSM: 5.6-6.1%), whereas the 10-year OCM rates increased with age up to 38% in men ⩾70 years. Very high-risk cT3b/4 PCa represents a heterogeneous group. We revealed overall low CSM rates despite the highly unfavorable clinical disease. For healthy men, CSM was independent of age, supporting RP even for older men. Conversely, less healthy patients had the highest risk of dying from OCM while sharing very low risk of CSM, indicating that this group might not benefit from an aggressive surgical treatment. Outcome after RP as the primary treatment option in cT3b/4 PCa patients is related to age and comorbidity status.

Dicty_cDB: SLH287 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH287 (Link to dictyBase) - - - Contig-U16243-1 SLH287Z (Link... to Original site) - - SLH287Z 614 - - - - Show SLH287 Library SL (Link to library) Clone ID SLH287 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH287Q.Seq.d/ Representative seq. ID SLH28...7Z (Link to Original site) Representative DNA sequence >SLH287 (SLH287Q) /CSM/SL/SLH2-D/SLH287Q.Seq.d/ XXXXX...6Q) /CSM/SS/SSJ6-B/SSJ636Q.Seq.d/ 1217 0.0 SLH575 (SLH575Q) /CSM/SL/SLH5-D/SLH575Q.Seq.d/ 1217 0.0 SLH287 (SLH287Q) /CSM/SL/SLH2

Dicty_cDB: SLH218 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH218 (Link to dictyBase) - - - Contig-U16325-1 SLH218F (Link to Original site) SLH2...18F 419 - - - - - - Show SLH218 Library SL (Link to library) Clone ID SLH218 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH218Q.Seq.d/ Representative seq. ID SLH21...8F (Link to Original site) Representative DNA sequence >SLH218 (SLH218Q) /CSM/SL/SLH2-A/SLH218Q.Seq.d/ CCATG...) /CSM/SL/SLI3-C/SLI370Q.Seq.d/ 831 0.0 SLI170 (SLI170Q) /CSM/SL/SLI1-C/SLI170Q.Seq.d/ 831 0.0 SLH218 (SLH218Q) /CSM/SL/SLH2-A/SLH2

RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

Directory of Open Access Journals (Sweden)

Tina Y Liu

Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

Science.gov (United States)

Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

2017-01-01

CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

Dicty_cDB: Contig-U03367-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U03367-1 no gap 323 - - - - 2 1 U03367 0 0 0 0 0 0 0 0 0 0 0 0 1 1 Show Contig-U03367-1 Contig... ID Contig-U03367-1 Contig update 2001. 8.29 Contig sequence >Contig-U03367-1 (Contig-U03367-1Q) /CSM_Contig/Contig...TTGCGGGTTGGCAGGACTGTNGGNAGGCATGGNCATCGGTATNNTTGGAG ATGCTNGTGTGAGGGCGAATGCT Gap no gap Contig length 323 Chro...HLXXGLXCGLAGLXXGMXIGXXGDAXVRANA own update 2004. 6. 9 Homology vs CSM-cDNA Query= Contig-U03367-1 (Contig...-U03367-1Q) /CSM_Contig/Contig-U03367-1Q.Seq.d (323 letters) Database: CSM 6905 sequ

Exploring the Physics of Unstable Nuclei

Science.gov (United States)

Volya, Alexander

In this presentation the Continuum Shell Model (CSM) approach is advertised as a powerful theoretical tool for studying physics of unstable nuclei. The approach is illustrated using 17O as an example, which is followed by a brief presentation of the general CSM formalism. The successes of the CSM are highlighted and references are provided throughout the text. As an example, the CSM is applied perturbatively to 20O allowing one to explore the effects of continuum on positions of weakly bound states and low-lying resonances, as well as to discern some effects of threshold discontinuity.

The effect of carotid sinus massage is independent of posture in patients with heart disease

DEFF Research Database (Denmark)

Mickley, H; Hansen, K N; Oxhøj, H

1989-01-01

unilateral right- and left-sided CSM performed in the supine and in the sitting position, while heart rate and systolic blood pressure were monitored. No statistically significant differences in the CSM-induced response in systolic blood pressure or heart rate were found between the two postures....... In the supine position the drop in heart rate was significantly greater after right-sided than after left-sided CSM (P less than 0.05). In only one patient (1%) was a significant carotid sinus reflex evoked. The response was cardioinhibitory with asystole for 3700 ms during right-sided, supine CSM...

Exploring the physics of unstable nuclei

International Nuclear Information System (INIS)

Volya, Alexander

2015-01-01

In this presentation the Continuum Shell Model (CSM) approach is advertised as a powerful theoretical tool for studying physics of unstable nuclei. The approach is illustrated using 17 O as an example, which is followed by a brief presentation of the general CSM formalism. The successes of the CSM are highlighted and references are provided throughout the text. As an example, the CSM is applied perturbatively to 20 O allowing one to explore the effects of continuum on positions of weakly bound states and low-lying resonances, as well as to discern some effects of threshold discontinuity. (author)

Command and Service Module Communications

Science.gov (United States)

Interbartolo, Michael

2009-01-01

This viewgraph presentation examines Command and Service Module (CSM) Communications. The communication system's capabilities are defined, including CSM-Earth, CSM-Lunar Module and CSM-Extravehicular crewman communications. An overview is provided for S-band communications, including data transmission and receiving rates, operating frequencies and major system components (pre-modulation processors, unified S-band electronics, S-band power amplifier and S-band antennas). Additionally, data transmission rates, operating frequencies and the capabilities of VHF communications are described. Major VHF components, including transmitters and receivers, and the VHF multiplexer and antennas are also highlighted. Finally, communications during pre-launch, ascent, in-flight and entry are discussed. Overall, the CSM communication system was rated highly by flight controllers and crew. The system was mostly autonomous for both crew and flight controllers and no major issues were encountered during flight.

Physico-chemical study of flavonoids from different matureness corn silk material

OpenAIRE

Li, Peng; Lapčík, Lubomír; Lapčíková, Barbora; Kalytchuk, Sergii

2018-01-01

There was tested a simple extraction procedure of flavonoids separation from the original corn silk (CS) material. It was found, that the total flavonoids content differs with the extraction time and extraction temperature. There were found different flavonoids contents in extracts prepared from different maturity stages of the original corn silk material (silking stage (CS-S), milky stage (CS-M)). Extracted flavonoids content was quantified by the lutin standardization method by means of col...

AGAINST THE WIND: RADIO LIGHT CURVES OF TYPE IA SUPERNOVAE INTERACTING WITH LOW-DENSITY CIRCUMSTELLAR SHELLS

Energy Technology Data Exchange (ETDEWEB)

Harris, Chelsea E.; Nugent, Peter E.; Kasen, Daniel N., E-mail: chelseaharris@berkeley.edu [Astronomy Department, University of California Berkeley, Berkeley, CA (United States)

2016-06-01

For decades a wide variety of observations spanning the radio through optical and on to the X-ray have attempted to uncover signs of type Ia supernovae (SNe Ia) interacting with a circumstellar medium (CSM). The goal of these studies is to constrain the nature of the hypothesized SN Ia mass-donor companion. A continuous CSM is typically assumed when interpreting observations of interaction. However, while such models have been successfully applied to core-collapse SNe, the assumption of continuity may not be accurate for SNe Ia, because shells of CSM could be formed by pre-supernova eruptions (novae). In this work, we model the interaction of SNe with a spherical, low-density, finite-extent CSM and create a suite of synthetic radio synchrotron light curves. We find that CSM shells produce sharply peaked light curves. We also identify a fiducial set of models that obey a common evolution and can be used to generate radio light curves for an interaction with an arbitrary shell. The relations obeyed by the fiducial models can be used to deduce CSM properties from radio observations; we demonstrate this by applying them to the nondetections of SN 2011fe and SN 2014J. Finally, we explore a multiple shell CSM configuration and describe its more complicated dynamics and the resultant radio light curves.

Comparisons Between Experimental and Semi-theoretical Cutting Forces of CCS Disc Cutters

Science.gov (United States)

Xia, Yimin; Guo, Ben; Tan, Qing; Zhang, Xuhui; Lan, Hao; Ji, Zhiyong

2018-05-01

This paper focuses on comparisons between the experimental and semi-theoretical forces of CCS disc cutters acting on different rocks. The experimental forces obtained from LCM tests were used to evaluate the prediction accuracy of a semi-theoretical CSM model. The results show that the CSM model reliably predicts the normal forces acting on red sandstone and granite, but underestimates the normal forces acting on marble. Some additional LCM test data from the literature were collected to further explore the ability of the CSM model to predict the normal forces acting on rocks of different strengths. The CSM model underestimates the normal forces acting on soft rocks, semi-hard rocks and hard rocks by approximately 38, 38 and 10%, respectively, but very accurately predicts those acting on very hard and extremely hard rocks. A calibration factor is introduced to modify the normal forces estimated by the CSM model. The overall trend of the calibration factor is characterized by an exponential decrease with increasing rock uniaxial compressive strength. The mean fitting ratios between the normal forces estimated by the modified CSM model and the experimental normal forces acting on soft rocks, semi-hard rocks and hard rocks are 1.076, 0.879 and 1.013, respectively. The results indicate that the prediction accuracy and the reliability of the CSM model have been improved.

Chitin Synthases with a Myosin Motor-Like Domain Control the Resistance of Aspergillus fumigatus to Echinocandins

Science.gov (United States)

Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.

2012-01-01

Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252

Spectrum structure and coherent state of the two-particle Calogero-Sutherland model: an application of the pseudo-angular-momentum operator method

International Nuclear Information System (INIS)

Li Wenbo; Li Mishan; Li Yaling; Wen Xiaoyang; Yuan Guangjun; Zhang Chi; Yang Tao

2005-01-01

The generality of the Calogero-Sutherland model (CSM) is studied with the aid of its several variations. The CSM is then solved by a new approach, the pseudo-angular-momentum operator method. The symmetry in spectrum space and valid region of the parameter are discussed. Analytic expressions of the eigenstate are obtained. The coherent states of the CSM are also discussed

Effect of fillers on parameters of dry and swollen polymer matrix networks

Directory of Open Access Journals (Sweden)

Stojčeva-Radovanović Blaga

2002-01-01

Full Text Available The effect of nano- and micro- particle size of SiO2 on dry and swollen parameter network of the polymer matrix blends of acrylontrile-butadiene (NBR and chlorosulphonated polyethylene (CSM such as: volume and mass degree of swelling Rv and Rw; volume fraction of NBR-CSM polymer matrix in swollen gel V2 elasticity modulus G; interaction parameter between NBR-CSM polymer matrix and solvent λ and crossiinking density ν, was tested. The influence of nano-and micro- particle size of SiO2 on physical and mechanical properties, as well as effectiveness volume ratio of filiers in NBR-CSM polymer matrix at 300% elongation was tested using Einstein-Quth-Gold equation. The Kraus equation for swelling test of NBR-CSM polymer matrix containing nano- and micro- particle size of SiO2. Test results have shown that a greater interaction of nano-particie size of SiO2 with NBR-CSM polymer matrix, and possible chemical bonding, than the one of micro-silica was a consequence of a greater contact area. This results in better physical and mechanical properties.

Free harmonic oscillators, Jack polynomials, and Calogero-Sutherland systems

International Nuclear Information System (INIS)

Gurappa, N.; Panigrahi, Prasanta K.

2000-01-01

The algebraic structure and the relationships between the eigenspaces of the Calogero-Sutherland model (CSM) and the Sutherland model (SM) on a circle are investigated through the Cherednik operators. We find an exact connection between the simultaneous nonsymmetric eigenfunctions of the A N-1 Cherednik operators, from which the eigenfunctions of the CSM and SM are constructed, and the monomials. This construction allows us to simultaneously diagonalize both CSM and SM (after gauging away the Hamiltonians by suitable measures) and also enables us to write down a harmonic oscillator algebra involving the Cherednik operators, which yields the raising and lowering operators for both of these models. The connections of the CSM with free oscillators and the SM with free particles on a circle are established in a novel way. We also point out the subtle differences between the excitations of the CSM and the SM

Dicty_cDB: Contig-U01997-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U01997-1 gap included 886 2 1683026 1682230 MINUS 3 4 U01997 1 0 0 0 0 0 2 0 0 0 0 0 0 0 Show Contig...-U01997-1 Contig ID Contig-U01997-1 Contig update 2001. 8.29 Contig sequence >Contig-U01997-1 (Contig-U01997-1Q) /CSM_Contig/Contig-U01997...ATTGAAATAATATTTATTTATTTTTTTAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Gap gap included Contig...nfkvfgieiifiyffkkkkkkkkkkkkkkkkkkk own update 2004. 6. 9 Homology vs CSM-cDNA Query= Contig-U01997-1 (Contig-U01997-1Q) /CSM_Contig.../Contig-U01997-1Q.Seq.d (896 letters) Database: CSM 6905 sequences; 5,674,871 total l

Dicty_cDB: Contig-U12545-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U12545-1 gap included 1165 3 3275272 3276395 PLUS 1 2 U12545 0 1 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U12545-1 Contig ID Contig-U12545-1 Contig update 2002.12.18 Contig sequence >Contig-U12545-1 (Contig-U12545-1Q) /CSM_Contig/Contig-U12545...CGTTCTAAATCACTCATTAAAAGATTAAAAATTAAANAAGGTAATATC TCACGACNGCTNNCTCATACACACN Gap gap included Contig length 11...vliknlskrkerkis*klyqlkriqlsl vknwlklvlnhslkd*klxkvishdxxliht own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig...-U12545-1 (Contig-U12545-1Q) /CSM_Contig/Contig-U12545-1Q.Seq.d (1175 letters) Database: CSM 6905 s

Dicty_cDB: VHD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHD492 (Link to dictyBase) - - - Contig-U15308-1 - (Link to Original site) - - VHD492...Z 675 - - - - Show VHD492 Library VH (Link to library) Clone ID VHD492 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHD4-D/VHD492Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492Q.Seq.d/ XXXXXXXXXXCTTCATC...xkiipink Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Ancillary outcome measures for assessment of individuals with cervical spondylotic myelopathy.

Science.gov (United States)

Kalsi-Ryan, Sukhvinder; Singh, Anoushka; Massicotte, Eric M; Arnold, Paul M; Brodke, Darrel S; Norvell, Daniel C; Hermsmeyer, Jeffrey T; Fehlings, Michael G

2013-10-15

Narrative review. To identify suitable outcome measures that can be used to quantify neurological and functional impairment in the management of cervical spondylotic myelopathy (CSM). CSM is the leading cause of acquired spinal cord disability, causing varying degrees of neurological impairment which impact on independence and quality of life. Because this impairment can have a heterogeneous presentation, a single outcome measure cannot define the broad range of deficits seen in this population. Therefore, it is necessary to define outcome measures that characterize the deficits with greater validity and sensitivity. This review was conducted in 3 stages. Stage I: To evaluate the current use of outcome measures in CSM, PubMed was searched using the name of the outcome measure and the common abbreviation combined with "CSM" or "myelopathy." Stage II: Having identified a lack of appropriate outcome measures, we constructed criteria by which measures appropriate for assessing the various aspects of CSM could be identified. Stage III: A second literature search was then conducted looking at specified outcomes that met these criteria. All literature was reviewed to determine specificity and psychometric properties of outcomes for CSM. Nurick grade, modified Japanese Orthopaedic Association Scale, visual analogue scale (VAS) for pain, Short Form (36) Health Survey (SF-36), and Neck Disability Index were the most commonly cited measures. The Short-Form 36 Health Survey and Myelopathy Disability Index have been validated in the CSM population with multiple studies, whereas the modified Japanese Orthopaedic Association Scale score, Nurick grade, and European Myelopathy Scale each had only one study assessing psychometric characteristics. No validity, reliability, or responsiveness studies were found for the VAS or Neck Disability Index in the CSM population. We recommend that the modified Japanese Orthopaedic Association Scale, Nurick grade, Myelopathy Disability Index

Dicty_cDB: SLG376 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 572Q) /CSM/SS/SSD5-C/SSD572Q.Seq.d/ 555 e-157 CHB571 (CHB571Q) /CSM/CH/CHB5-C/CHB571Q.Seq.d/ 494 e-139 CFD492 (CFD492...Q) /CSM/CF/CFD4-D/CFD492Q.Seq.d/ 474 e-133 own update 2003.10.30 Homology vs DNA Score E Sequences

Management tools for distributed control system in KSTAR

International Nuclear Information System (INIS)

Sangil Lee; Jinseop Park; Jaesic Hong; Mikyung Park; Sangwon Yun

2012-01-01

The integrated control system of the Korea Superconducting Tokamak Advanced Research (KSTAR) has been developed with distributed control systems based on Experimental Physics and Industrial Control System (EPICS) middle-ware. It has the essential role of remote operation, supervising of tokamak device and conducting of plasma experiments without any interruption. Therefore, the availability of the control system directly impacts on the entire device performance. For the non-interrupted operation of the KSTAR control system, we have developed a tool named as Control System Monitoring (CSM) to monitor the resources of EPICS Input/Output Controller (IOC) servers (utilization of memory, cpu, disk, network, user-defined process and system-defined process), the soundness of storage systems (storage utilization, storage status), the status of network switches using Simple Network Management Protocol (SNMP), the network connection status of every local control sever using Internet Control Message Protocol (ICMP), and the operation environment of the main control room and the computer room (temperature, humidity, electricity) in real time. When abnormal conditions or faults are detected by the CSM, it alerts abnormal or fault alarms to operators. Especially, if critical fault related to the data storage occurs, the CSM sends the simple messages to operator's mobile phone. The operators then quickly restored the problems according to the emergency procedure. As a result of this process, KSTAR was able to perform continuous operation and experiment without interruption for 4 months

Data-driven risk identification in phase III clinical trials using central statistical monitoring.

Science.gov (United States)

Timmermans, Catherine; Venet, David; Burzykowski, Tomasz

2016-02-01

Our interest lies in quality control for clinical trials, in the context of risk-based monitoring (RBM). We specifically study the use of central statistical monitoring (CSM) to support RBM. Under an RBM paradigm, we claim that CSM has a key role to play in identifying the "risks to the most critical data elements and processes" that will drive targeted oversight. In order to support this claim, we first see how to characterize the risks that may affect clinical trials. We then discuss how CSM can be understood as a tool for providing a set of data-driven key risk indicators (KRIs), which help to organize adaptive targeted monitoring. Several case studies are provided where issues in a clinical trial have been identified thanks to targeted investigation after the identification of a risk using CSM. Using CSM to build data-driven KRIs helps to identify different kinds of issues in clinical trials. This ability is directly linked with the exhaustiveness of the CSM approach and its flexibility in the definition of the risks that are searched for when identifying the KRIs. In practice, a CSM assessment of the clinical database seems essential to ensure data quality. The atypical data patterns found in some centers and variables are seen as KRIs under a RBM approach. Targeted monitoring or data management queries can be used to confirm whether the KRIs point to an actual issue or not.

Evaluation of energy digestibility and prediction of digestible and metabolizable energy from chemical composition of different cottonseed meal sources fed to growing pigs.

Science.gov (United States)

Li, J T; Li, D F; Zang, J J; Yang, W J; Zhang, W J; Zhang, L Y

2012-10-01

The present experiment was conducted to determine the digestible energy (DE), metabolizable energy (ME) content, and the apparent total tract digestibility (ATTD) of energy in growing pigs fed diets containing one of ten cottonseed meals (CSM) collected from different provinces of China and to develop in vitro prediction equations for DE and ME content from chemical composition of the CSM samples. Twelve growing barrows with an initial body weight of 35.2±1.7 kg were allotted to two 6×6 Latin square designs, with six barrows and six periods and six diets for each. A corn-dehulled soybean meal diet was used as the basal diet, and the other ten diets were formulated with corn, dehulled soybean meal and 19.20% CSM. The DE, ME and ATTD of gross energy among different CSM sources varied largely and ranged from 1,856 to 2,730 kcal/kg dry matter (DM), 1,778 to 2,534 kcal/kg DM, and 42.08 to 60.47%, respectively. Several chemical parameters were identified to predict the DE and ME values of CSM, and the accuracy of prediction models were also tested. The best fit equations were: DE, kcal/kg DM = 670.14+31.12 CP+659.15 EE with R(2) = 0.82, RSD = 172.02, penergy varied substantially among different CSM sources, and that some prediction equations can be applied to predict DE and ME in CSM with an acceptable accuracy.

Characteristics of combustion flame sprayed nickel aluminum using a Coanda Assisted Spray Manipulation collar for off-normal deposits

Science.gov (United States)

Archibald, Reid S.

A novel flame spray collar called the Coanda Assisted Spray Manipulation collar (CSM) has been tested for use on the Sulzer Metco 5P II combustion flame spray gun. A comparison study of the stock nozzle and the CSM has been performed by evaluating the porosity, surface roughness, microhardness, tensile strength and microscopy of normal and off-normal sprayed NiAl deposits. The use of the CSM collar resulted in the need to position the sprayed coupons closer to the gun, which in turn affected the particle impact energy and particle temperatures of the NiAl powder. For the CSM, porosities had a larger scatterband, surface roughness was comparably the same, microhardness was lower, and tensile strength was higher. The microscopy analysis revealed a greater presence of unmelted particles and steeper intersplat boundaries for the CSM. For both processes, the porosity and surface roughness increased and the microhardness decreased as the spray angle decreased.

Studies of chemical interactions between chlorosulphonated polyethylene and nit rile rubber

Directory of Open Access Journals (Sweden)

Marković Gordana

2005-01-01

Full Text Available Highly polar rubbers interact with each other through their active functional groups via condensation or substitution reactions at high temperature. Chlorosulphonated polyethylene (CSM rubber is a highly reactive rubber, the reactivity of with is due to the -SO2CI groups. When CSM reacts with nit rile rubber (NBR, a chemical reaction takes place between the two rubbers at high temperature. Fourier transform infrared (FTIR studies support that CSM/NBR (50/50 w/w isothermally induces a self cross-linking blend, when cross-linking takes place via the acrylonitrile groups of NBR and the SO2CI groups or the insitu generated allyl chloride moieties of CSM. There is a loss of some -CN groups during cross-linking. This may be due to an attack on the -CN groups by HCI (produced during the heating of CSM in the presence of inherent moisture in the polymers. Amid type of linkage is formed due to cross-linking.

The structure and emerging trends of construction safety management research: a bibliometric review.

Science.gov (United States)

Liang, Huakang; Zhang, Shoujian; Su, Yikun

2018-03-29

Recently, construction safety management (CSM) practices and systems have become important topics for stakeholders to take care of human resources. However, few studies have attempted to map the global research on CSM. A comprehensive bibliometric review was conducted in this study based on multiple methods. In total, 1172 CSM-related papers from the Web of Science Core Collection database were examined. The analyses focused on publication year, country-institute, publication source, author and research topics. The results indicated that the USA, China, Australia and the UK took leading positions in CSM research. Two branches of journals were identified, namely the branch of engineering science and that of safety science and social science. Additionally, seven themes together with 28 specific topics were detected to allow researchers to track the main structure and temporal evolution of CSM research. Finally, the main research trends and potential research directions were discussed to guide the future research.

Porous carbon with small mesoporesas an ultra-high capacity adsorption medium

Science.gov (United States)

Gao, Biaofeng; Zhou, Haitao; Chen, De; Yang, Jianhong

2017-10-01

Resins (732-type), abundant and inexpensive resources were used to prepare porous carbon with small mesopores (CSM) by carbonization and post-chemical-activation with potassium hydroxide (KOH). The N2 adsorption measurements revealed that CSM had high surface areas (1776.5 m2 g-1), large pore volumes (1.10 cm3 g-1), and nearly optimal narrow small mesopore sizes ranging from 2 to 7 nm. CSM was used as adsorbent to investigate the adsorption behavior for Rhodamine B (RhB). Due to the optimal pore size distributions (PSD), intensive-stacking interaction, S-doped, and electrostatic attraction, the CSM exhibited an ultra-high-capacity of 1590 mg g-1 for RhB in aqueous solutions.

Dicty_cDB: VHK246 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK246 (Link to dictyBase) - - - Contig-U16440-1 VHK246P (Link to Original site) VHK2...46F 617 VHK246Z 760 VHK246P 1357 - - Show VHK246 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-B/VHK246Q.Seq.d/ Representative seq. ID VHK2...46P (Link to Original site) Representative DNA sequence >VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2

Dicty_cDB: SLH247 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH247 (Link to dictyBase) - - - Contig-U16280-1 SLH247Z (Link... to Original site) - - SLH247Z 632 - - - - Show SLH247 Library SL (Link to library) Clone ID SLH247 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH247Q.Seq.d/ Representative seq. ID SLH24...7Z (Link to Original site) Representative DNA sequence >SLH247 (SLH247Q) /CSM/SL/SLH2-B/SLH247Q.Seq.d/ XXXXX...ant alignments: (bits) Value SLH247 (SLH247Q) /CSM/SL/SLH2-B/SLH247Q.Seq.d/ 1253 0.0 SLA487 (SLA487Q) /CSM/S

Dicty_cDB: SLH265 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH265 (Link to dictyBase) - - - Contig-U13901-1 SLH265Z (Link... to Original site) - - SLH265Z 631 - - - - Show SLH265 Library SL (Link to library) Clone ID SLH265 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH265Q.Seq.d/ Representative seq. ID SLH26...5Z (Link to Original site) Representative DNA sequence >SLH265 (SLH265Q) /CSM/SL/SLH2-C/SLH265Q.Seq.d/ XXXXX... alignments: (bits) Value SLH265 (SLH265Q) /CSM/SL/SLH2-C/SLH265Q.Seq.d/ 1059 0.0 VFL442 (VFL442Q) /CSM/VF/V

Dicty_cDB: SLH207 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH207 (Link to dictyBase) - - - Contig-U11514-1 SLH207P (Link to Original site) SLH2...07F 689 SLH207Z 675 SLH207P 1364 - - Show SLH207 Library SL (Link to library) Clone ID SLH2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH207Q.Seq.d/ Representative seq. ID SLH2...07P (Link to Original site) Representative DNA sequence >SLH207 (SLH207Q) /CSM/SL/SLH2-A/SLH2...**yi Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLH207 (SLH207Q) /CSM/SL/SLH2-A/SLH2

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

A Proposed Strategy for the U.S. to Develop and Maintain a Mainstream Capability Suite ("Warehouse") for Automated/Autonomous Rendezvous and Docking in Low Earth Orbit and Beyond

Science.gov (United States)

Krishnakumar, Kalmanje S.; Stillwater, Ryan A.; Babula, Maria; Moreau, Michael C.; Riedel, J. Ed; Mrozinski, Richard B.; Bradley, Arthur; Bryan, Thomas C.

2012-01-01

The ability of space assets to rendezvous and dock/capture/berth is a fundamental enabler for numerous classes of NASA fs missions, and is therefore an essential capability for the future of NASA. Mission classes include: ISS crew rotation, crewed exploration beyond low-Earth-orbit (LEO), on-orbit assembly, ISS cargo supply, crewed satellite servicing, robotic satellite servicing / debris mitigation, robotic sample return, and robotic small body (e.g. near-Earth object, NEO) proximity operations. For a variety of reasons to be described, NASA programs requiring Automated/Autonomous Rendezvous and Docking/Capture/Berthing (AR&D) capabilities are currently spending an order-of-magnitude more than necessary and taking twice as long as necessary to achieve their AR&D capability, "reinventing the wheel" for each program, and have fallen behind all of our foreign counterparts in AR&D technology (especially autonomy) in the process. To ensure future missions' reliability and crew safety (when applicable), to achieve the noted cost and schedule savings by eliminate costs of continually "reinventing the wheel ", the NASA AR&D Community of Practice (CoP) recommends NASA develop an AR&D Warehouse, detailed herein, which does not exist today. The term "warehouse" is used herein to refer to a toolbox or capability suite that has pre-integrated selectable supply-chain hardware and reusable software components that are considered ready-to-fly, low-risk, reliable, versatile, scalable, cost-effective, architecture and destination independent, that can be confidently utilized operationally on human spaceflight and robotic vehicles over a variety of mission classes and design reference missions, especially beyond LEO. The CoP also believes that it is imperative that NASA coordinate and integrate all current and proposed technology development activities into a cohesive cross-Agency strategy to produce and utilize this AR&D warehouse. An initial estimate indicates that if NASA

THE MORPHOLOGY AND DYNAMICS OF JET-DRIVEN SUPERNOVA REMNANTS: THE CASE OF W49B

Energy Technology Data Exchange (ETDEWEB)

González-Casanova, Diego F.; De Colle, Fabio [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, A. P. 70-543, 04510 D. F. (Mexico); Ramirez-Ruiz, Enrico [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Lopez, Laura A. [MIT-Kavli Institute for Astrophysics and Space Research, 77 Massachusetts Avenue, 37-664H, Cambridge, MA 02139 (United States)

2014-02-01

The circumstellar medium (CSM) of a massive star is modified by its winds before a supernova (SN) explosion occurs, and thus the evolution of the resulting supernova remnant (SNR) is influenced by both the geometry of the explosion as well as the complex structure of the CSM. Motivated by recent work suggesting the SNR W49B was a jet-driven SN expanding in a complex CSM, we explore how the dynamics and the metal distributions in a jet-driven explosion are modified by the interaction with the surrounding environment. In particular, we perform hydrodynamical calculations to study the dynamics and explosive nucleosynthesis of a jet-driven SN triggered by the collapse of a 25 M {sub ☉} Wolf-Rayet star and its subsequent interaction with the CSM up to several hundred years following the explosion. We find that although the CSM has small-scale effects on the structure of the SNR, the overall morphology and abundance patterns are reflective of the initial asymmetry of the SN explosion. Thus, we predict that jet-driven SNRs, such as W49B, should be identifiable based on morphology and abundance patterns at ages up to several hundred years, even if they expand into a complex CSM environment.

CIRCUMSTELLAR SHELL FORMATION IN SYMBIOTIC RECURRENT NOVAE

Energy Technology Data Exchange (ETDEWEB)

Moore, Kevin; Bildsten, Lars [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106 (United States)

2012-12-20

We present models of spherically symmetric recurrent nova shells interacting with circumstellar material (CSM) in a symbiotic system composed of a red giant (RG) expelling a wind and a white dwarf accreting from this material. Recurrent nova eruptions periodically eject material at high velocities ({approx}> 10{sup 3} km s{sup -1}) into the RG wind profile, creating a decelerating shock wave as CSM is swept up. High CSM densities cause the shocked wind and ejecta to have very short cooling times of days to weeks. Thus, the late-time evolution of the shell is determined by momentum conservation instead of energy conservation. We compute and show evolutionary tracks of shell deceleration, as well as post-shock structure. After sweeping up all the RG wind, the shell coasts at a velocity {approx}100 km s{sup -1}, depending on system parameters. These velocities are similar to those measured in blueshifted CSM from the symbiotic nova RS Oph, as well as a few Type Ia supernovae that show evidence of CSM, such as 2006X, 2007le, and PTF 11kx. Supernovae occurring in such systems may not show CSM interaction until the inner nova shell gets hit by the supernova ejecta, days to months after the explosion.

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

Dicty_cDB: Contig-U09694-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U09694-1 gap included 1129 1 4027135 4026071 MINUS 3 4 U09694 2 0 1 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U09694-1 Contig ID Contig-U09694-1 Contig update 2002. 9.13 Contig sequence >Contig-U09694-1 (Contig-U09694-1Q) /CSM_Contig/Contig-U0969...TTAAATTAAAACAACAACAATTTCATAATATAAATAAT Gap gap included Contig length 1129 Chromosome number (1..6, M) 1 Chr...iklkqqqfklkqqqfhninn own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U09694-1 (Contig-U09694-1Q) /CSM_Contig/Contig...E Sequences producing significant alignments: (bits) Value Contig-U09694-1 (Contig-U09694-1Q) /CSM_Contig

Dicty_cDB: Contig-U12086-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U12086-1 gap included 1101 3 5710254 5711336 PLUS 1 2 U12086 0 0 0 0 0 0 0 1 0 0 0 0 0 0 Show Contig...-U12086-1 Contig ID Contig-U12086-1 Contig update 2002.12.18 Contig sequence >Contig-U12086-1 (Contig-U12086-1Q) /CSM_Contig/Contig-U12086...ATCGGATTA Gap gap included Contig length 1101 Chromosome number (1..6, M) 3 Chromosome length 6358359 Start ...te 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U12086-1 (Contig-U12086-1Q) /CSM_Contig/Contig...Sequences producing significant alignments: (bits) Value Contig-U12086-1 (Contig-U12086-1Q) /CSM_Contig/Conti... 404 e-113 Contig

Dicty_cDB: SHD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SH (Link to library) SHD492 (Link to dictyBase) - - - Contig-U16471-1 SHD492P (Link to Original site) SHD492...F 121 SHD492Z 819 SHD492P 920 - - Show SHD492 Library SH (Link to library) Clone ID SHD492... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHD4-D/SHD492Q.Seq.d/ Representative seq. ID SHD492...P (Link to Original site) Representative DNA sequence >SHD492 (SHD492Q) /CSM/SH/SHD4-D/SHD492....Seq.d/ 805 0.0 SHD613 (SHD613Q) /CSM/SH/SHD6-A/SHD613Q.Seq.d/ 805 0.0 SHD492 (SHD492Q) /CSM/SH/SHD4-D/SHD492

Dicty_cDB: AFK258 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available AF (Link to library) AFK258 (Link to dictyBase) - - - Contig-U15883-1 AFK258Z (Link... to Original site) - - AFK258Z 705 - - - - Show AFK258 Library AF (Link to library) Clone ID AFK258 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/AF/AFK2-C/AFK258Q.Seq.d/ Representative seq. ID AFK25...8Z (Link to Original site) Representative DNA sequence >AFK258 (AFK258Q) /CSM/AF/AFK2-C/AFK258Q.Seq.d/ XXXXX...its) Value CFC754 (CFC754Q) /CSM/CF/CFC7-C/CFC754Q.Seq.d/ 656 0.0 AFM846 (AFM846Q) /CSM/AF/AFM8-B/AFM846Q.Seq.d/ 656 0.0 AFK2

Dicty_cDB: SLH242 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH242 (Link to dictyBase) - - - Contig-U16343-1 SLH242Z (Link... to Original site) - - SLH242Z 476 - - - - Show SLH242 Library SL (Link to library) Clone ID SLH242 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH242Q.Seq.d/ Representative seq. ID SLH24...2Z (Link to Original site) Representative DNA sequence >SLH242 (SLH242Q) /CSM/SL/SLH2-B/SLH242Q.Seq.d/ XXXXX...d/ 910 0.0 SLI231 (SLI231Q) /CSM/SL/SLI2-B/SLI231Q.Seq.d/ 910 0.0 SLH242 (SLH242Q) /CSM/SL/SLH2-B/SLH2

Dicty_cDB: SLH222 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH222 (Link to dictyBase) - - - Contig-U16475-1 SLH222Z (Link... to Original site) - - SLH222Z 433 - - - - Show SLH222 Library SL (Link to library) Clone ID SLH222 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH222Q.Seq.d/ Representative seq. ID SLH22...2Z (Link to Original site) Representative DNA sequence >SLH222 (SLH222Q) /CSM/SL/SLH2-A/SLH222Q.Seq.d/ XXXXX...603Q.Seq.d/ 728 0.0 SLI537 (SLI537Q) /CSM/SL/SLI5-B/SLI537Q.Seq.d/ 728 0.0 SLH222 (SLH222Q) /CSM/SL/SLH2

Dicty_cDB: SLH241 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH241 (Link to dictyBase) - - - Contig-U15835-1 SLH241E (Link... to Original site) - - - - - - SLH241E 371 Show SLH241 Library SL (Link to library) Clone ID SLH241 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH241Q.Seq.d/ Representative seq. ID SLH24...1E (Link to Original site) Representative DNA sequence >SLH241 (SLH241Q) /CSM/SL/SLH2-B/SLH241Q.Seq.d/ GAAGT....Seq.d/ 638 0.0 VFE160 (VFE160Q) /CSM/VF/VFE1-C/VFE160Q.Seq.d/ 638 0.0 SLH241 (SLH241Q) /CSM/SL/SLH2-B/SLH24

Dicty_cDB: SLH278 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH278 (Link to dictyBase) - - - Contig-U16382-1 SLH278Z (Link... to Original site) - - SLH278Z 528 - - - - Show SLH278 Library SL (Link to library) Clone ID SLH278 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH278Q.Seq.d/ Representative seq. ID SLH27...8Z (Link to Original site) Representative DNA sequence >SLH278 (SLH278Q) /CSM/SL/SLH2-D/SLH278Q.Seq.d/ XXXXX...75 (SLH375Q) /CSM/SL/SLH3-D/SLH375Q.Seq.d/ 1047 0.0 SLH278 (SLH278Q) /CSM/SL/SLH2-D/SLH278Q.Seq.d/ 1047 0.0

Dicty_cDB: SLH221 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH221 (Link to dictyBase) - - - Contig-U16381-1 SLH221Z (Link... to Original site) - - SLH221Z 595 - - - - Show SLH221 Library SL (Link to library) Clone ID SLH221 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH221Q.Seq.d/ Representative seq. ID SLH22...1Z (Link to Original site) Representative DNA sequence >SLH221 (SLH221Q) /CSM/SL/SLH2-A/SLH221Q.Seq.d/ XXXXX...LH722 (SLH722Q) /CSM/SL/SLH7-A/SLH722Q.Seq.d/ 559 e-158 SLH221 (SLH221Q) /CSM/SL/SLH2-A/SLH221Q.Seq.d/ 559 e

Dicty_cDB: SSF460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SS (Link to library) SSF460 (Link to dictyBase) - - - Contig-U03803-1 SSF460Z (Link... to Original site) - - SSF460Z 453 - - - - Show SSF460 Library SS (Link to library) Clone ID SSF460 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSF4-C/SSF460Q.Seq.d/ Representative seq. ID SSF46...0Z (Link to Original site) Representative DNA sequence >SSF460 (SSF460Q) /CSM/SS/SSF4-C/SSF460Q.Seq.d/ XXXXX...s) Value SSM309 (SSM309Q) /CSM/SS/SSM3-A/SSM309Q.Seq.d/ 424 e-118 SSH196 (SSH196Q) /CSM/SS/SSH1-D/SSH196Q.Seq.d/ 424 e-118 SSF4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Developing a conceptual model for the internal data source to measure customer satisfaction

OpenAIRE

Al-Mutawa, T; Eldabi, T; Brinkman, WP

2006-01-01

Traditional CSM approach is performed at certain frequencies. The gap between such events can be termed as a ‘blind period’, because customer satisfaction is left unobserved and unmanaged. The blind period may sometimes accelerate the growth of customer dissatisfaction. One way to eliminate the impact of the blind period is to reduce the gap between CSM events. The initial assessment indicates that conducting CSM more frequently, may weaken the accuracy of measurement, and increase the cost o...

Administrative Procedure Act and mass procedures (illustrated by the nuclear licensing procedure)

International Nuclear Information System (INIS)

Naumann, R.

1977-01-01

The report deals with the administrative procedure law of 25.5.76 of the Fed. Government, esp. with its meaning for the administrative procedures for the permission for nuclear power plants, as fas ar so-called mass procedures are concerned. (UN) [de

EUS-guided rendezvous for difficult biliary cannulation using a standardized algorithm: a multicenter prospective pilot study (with videos).

Science.gov (United States)

Iwashita, Takuji; Yasuda, Ichiro; Mukai, Tsuyoshi; Iwata, Keisuke; Ando, Nobuhiro; Doi, Shinpei; Nakashima, Masanori; Uemura, Shinya; Mabuchi, Masatoshi; Shimizu, Masahito

2016-02-01

Biliary cannulation is necessary in therapeutic ERCP for biliary disorders. EUS-guided rendezvous (EUS-RV) can salvage failed cannulation. Our aim was to determine the safety and efficacy of EUS-RV by using a standardized algorithm with regard to the endoscope position in a prospective study. EUS-RV was attempted after failed cannulation in 20 patients. In a standardized approach, extrahepatic bile duct (EHBD) cannulation was preferentially attempted from the second portion of the duodenum (D2) followed by additional approaches to the EHBD from the duodenal bulb (D1) or to the intrahepatic bile duct from the stomach, if necessary. A guidewire was placed in an antegrade fashion into the duodenum. After the guidewire was placed, the endoscope was exchanged for a duodenoscope to complete the cannulation. The bile duct was accessed from the D2 in 10 patients, but from the D1 in 5 patients and the stomach in 4 patients because of no dilation or tumor invasion at the distal EHBD. In the remaining patient, biliary puncture was not attempted due to the presence of collateral vessels. The guidewire was successfully manipulated in 80% of patients: 100% (10/10) with the D2 approach and 66.7% (6/9) with other approaches. The overall success rate was 80% (16/20). Failed EUS-RV was salvaged with a percutaneous approach in 2 patients, repeat ERCP in 1 patient, and conservative management in 1 patient. Minor adverse events occurred in 15% of patients (3/20). EUS-RV is a safe and effective salvage method. Using EUS-RV to approach the EHBD from the D2 may improve success rates. Copyright © 2016 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.

Technology Development of Automated Rendezvous and Docking/Capture Sensors and Docking Mechanism for the Asteroid Redirect Crewed Mission

Science.gov (United States)

Hinkel, Heather; Strube, Matthew; Zipay, John J.; Cryan, Scott

2016-01-01

This paper will describe the technology development efforts NASA has underway for Automated Rendezvous and Docking/Capture (AR&D/C) sensors and a docking mechanism and the challenges involved. The paper will additionally address how these technologies will be extended to other missions requiring AR&D/C whether robotic or manned. NASA needs AR&D/C sensors for both the robotic and crewed segments of the Asteroid Redirect Mission (ARM). NASA recently conducted a commonality assessment of the concept of operations for the robotic Asteroid Redirect Vehicle (ARV) and the crewed mission segment using the Orion spacecraft. The commonality assessment also considered several future exploration and science missions requiring an AR&D/C capability. Missions considered were asteroid sample return, satellite servicing, and planetary entry, descent, and landing. This assessment determined that a common sensor suite consisting of one or more visible wavelength cameras, a three-dimensional LIDAR along with long-wavelength infrared cameras for robustness and situational awareness could be used on each mission to eliminate the cost of multiple sensor developments and qualifications. By choosing sensor parameters at build-time instead of at design-time and, without having to requalify flight hardware, a specific mission can design overlapping bearing, range, relative attitude, and position measurement availability to suit their mission requirements with minimal non-recurring engineering costs. The resulting common sensor specification provides the union of all performance requirements for each mission and represents an improvement over the current systems used for AR&D/C today. These sensor specifications are tightly coupled to the docking system capabilities and requirements for final docking conditions. The paper will describe NASA's efforts to develop a standard docking system for use across NASA human spaceflight missions to multiple destinations. It will describe the current

Study of cover source mismatch in steganalysis and ways to mitigate its impact

Science.gov (United States)

Kodovský, Jan; Sedighi, Vahid; Fridrich, Jessica

2014-02-01

When a steganalysis detector trained on one cover source is applied to images from a different source, generally the detection error increases due to the mismatch between both sources. In steganography, this situation is recognized as the so-called cover source mismatch (CSM). The drop in detection accuracy depends on many factors, including the properties of both sources, the detector construction, the feature space used to represent the covers, and the steganographic algorithm. Although well recognized as the single most important factor negatively affecting the performance of steganalyzers in practice, the CSM received surprisingly little attention from researchers. One of the reasons for this is the diversity with which the CSM can manifest. On a series of experiments in the spatial and JPEG domains, we refute some of the common misconceptions that the severity of the CSM is tied to the feature dimensionality or their "fragility." The CSM impact on detection appears too difficult to predict due to the effect of complex dependencies among the features. We also investigate ways to mitigate the negative effect of the CSM using simple measures, such as by enlarging the diversity of the training set (training on a mixture of sources) and by employing a bank of detectors trained on multiple different sources and testing on a detector trained on the closest source.

The Origin and Evolution of the Infrared Light Curve of SN2010jl

Science.gov (United States)

Dwek, Eli; Sarangi, Arkaprabha; Arendt, Richard; Fox, Ori; Kallman, Timothy; Kazanas, Demosthenes

2018-01-01

SN2010jl is a luminous core-collapse supernova (CCSN) of Type IIn that is surrounded by a dense circumstellar medium (CSM). The supernova (SN) luminosity vastly exceeds the available power from radiactive elements in the ejecta, and is powered by the interaction of the SN shock wave with the ambient medium. Upper limits on the UV and near-IR (NIR) emission from pre-explosion images of the region suggest that any progenitor star was hidden by pre-existing CSM dust. After day ~80, the SN spectrum shows the development of an IR excess above the extrapolated UVO emission arising from the shocked CSM. This IR component is attributed to thermal emission from dust.After day ~300, the light curve exhibits a rise in the NIR luminosity, concurrent with a steep decline at UVO wavelengths. Ruling out any possible contribution of SN-condensed dust to the IR light curve, we show that the early IR emission arises from the pre-existing CSM dust that survived the flash of radiation from the shock breakout. The late IR emission arises from newly-formed CSM dust that condensed in the cooling dust-free postshock gas of the advancing SN shock wave. Our analysis presents the first detailed modeling of dust formation in a cooling postshock environment, and provides important insights into the interaction of the SN shock wave with the CSM.

Favourable outcome of posterior decompression and stabilization in lordosis for cervical spondylotic myelopathy: the spinal cord "back shift" concept.

Science.gov (United States)

Denaro, Vincenzo; Longo, Umile Giuseppe; Berton, Alessandra; Salvatore, Giuseppe; Denaro, Luca

2015-11-01

Surgical management of patients with multilevel CSM aims to decompress the spinal cord and restore the normal sagittal alignment. The literature lacks of high level evidences about the best surgical approach. Posterior decompression and stabilization in lordosis allows spinal cord back shift, leading to indirect decompression of the anterior spinal cord. The purpose of this study was to investigate the efficacy of posterior decompression and stabilization in lordosis for multilevel CSM. 36 out of 40 patients were clinically assessed at a mean follow-up of 5, 7 years. Outcome measures included EMS, mJOA Score, NDI and SF-12. Patients were asked whether surgery met their expectations and if they would undergo the same surgery again. Bone graft fusion, instrumental failure and cervical curvature were evaluated. Spinal cord back shift was measured and correlation with EMS and mJOA score recovery rate was analyzed. All scores showed a significative improvement (p 0.05). Ninety percent of patients would undergo the same surgery again. There was no deterioration of the cervical alignment, posterior grafted bones had completely fused and there were no instrument failures. The mean spinal cord back shift was 3.9 mm (range 2.5-4.5 mm). EMS and mJOA recovery rates were significantly correlated with the postoperative posterior cord migration (P lordosis is a valuable procedure for patients affected by multilevel CSM, leading to significant clinical improvement thanks to the spinal cord back shift. Postoperative lordotic alignment of the cervical spine is a key factor for successful treatment.

Human papillomavirus (HPV) information needs: a theoretical framework

Science.gov (United States)

Marlow, Laura A V; Wardle, Jane; Waller, Jo; Grant, Nina

2009-01-01

Background With the introduction of human papillomavirus (HPV) testing and vaccination in the UK, health professionals will start to receive questions about the virus from their patients. This study aimed to identify the key questions about HPV that British women will ask when considering having an HPV test or vaccination. Methods Face-to-face interviews were carried out with 21 women to discover what they wanted to know about HPV. A thematic framework approach was used to analyse the data and identify key themes in women's HPV knowledge requirements. Results Women's questions about HPV fell into six areas: identity (e.g. What are the symptoms?), cause (e.g. How do you get HPV?), timeline (e.g. How long does it last?), consequences (e.g. Does it always cause cervical cancer?) and control-cure (e.g. Can you prevent infection?). In addition, they asked procedural questions about testing and vaccination (e.g. Where do I get an HPV test?). These mapped well onto the dimensions identified in Leventhal's description of lay models of illness, called the 'Common Sense Model' (CSM). Discussion and conclusions These results indicated that the majority of the questions women asked about HPV fitted well into the CSM, which therefore provides a structure for women's information needs. The findings could help health professionals understand what questions they may be expected to answer. Framing educational materials using the CSM themes may also help health educators achieve a good fit with what the public want to know. PMID:19126314

Evaluasi penggunaan tepung cangkang rajungan sebagai bahan baku pakan juwana udang windu Penaeus monodon

Directory of Open Access Journals (Sweden)

Agus Kurnia

2016-12-01

Full Text Available ABSTRACT Feeding trial was conducted to determine the optimum dietary level of the crab shell meal (CSM for replacement of fish meal (FM for growth and survival rate of black tiger shrimp larvae. The shrimp (initial weight: 0,0134±0,02 g were fed with six experimental diet for six weeks which were formulated to replace FM protein by with CSM at various substitution levels: diet A (0% CSM substitution level, diet B (25% CSM substitution level, diet C (50% CSM substitution level, diet D (75% CSM substitution level, diet E (100% CSM substitution level, diet F (commercial diet. Results from the feeding trial indicates that the shrimp fed with all treatment diet were not significantly different in weight gain and FCR. However, survival rate on the shrimp fed with diet F was significantly different to the other groups. The present study conclude that CSM could be used as protein ingredient in the diet of monodon shrimp juvenile. Keywords: replacement, crabs shell meal, fish meal, black tiger shrimp, survival rate  ABSTRAK Penelitian pakan dilakukan untuk menentukan dosis optimum tepung cangkang rajungan (TCR untuk mengganti tepung ikan (TI dalam pakan terhadap pertumbuhan dan kelangsungan hidup larva udang windu. Udang windu (berat awal: 0,00134±0,02 g diberi pakan uji selama enam minggu yang diformulasi untuk mengganti TI dengan tingkat persentasi penggantian TCR dengan desain formulasi pakan A (0% substitusi TCR, pakan B (25% substitusi TCR, pakan C (50% substitusi TCR, pakan D (75% substitusi TCR, pakan E (100% substitusi TCR, dan pakan F (pakan komersial sebagai pakan kontrol. Hasil dari penelitian ini menunjukkan bahwa udang yang diberi pakan untuk semua perlakuan tidak memberikan pengaruh nyata terhadap pertumbuhan dan laju pertumbuhan harian. Akan tetapi kelompok udang yang diberi pakan F berpengaruh nyata terhadap kelangsungan hidup dibanding dengan perlakuan lainnya. Hasil penelitian ini menyimpulkan bahwa tepung cangkang rajungan

Emergency procedures

International Nuclear Information System (INIS)

Abd Nasir Ibrahim; Azali Muhammad; Ab Razak Hamzah; Abd Aziz Mohamed; Mohammad Pauzi Ismail

2004-01-01

The following subjects are discussed - Emergency Procedures: emergency equipment, emergency procedures; emergency procedure involving X-Ray equipment; emergency procedure involving radioactive sources

Dicty_cDB: FC-BR23 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BR23 (Link to dictyBase) - - - Contig-U15008-1 FC-BR23Z (Li...nk to Original site) - - FC-BR23Z 641 - - - - Show FC-BR23 Library FC (Link to library) Clone ID FC-BR23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BR/FC-BR23Q.Seq.d/ Representative seq. ID FC-BR2...3Z (Link to Original site) Representative DNA sequence >FC-BR23 (FC-BR23Q) /CSM/FC/FC-BR/FC-BR23Q.Seq....9 0.0 SLA211 (SLA211Q) /CSM/SL/SLA2-A/SLA211Q.Seq.d/ 1029 0.0 FC-BR23 (FC-BR23Q) /CSM/FC/FC-BR/FC-BR2

Dicty_cDB: SLH286 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH286 (Link to dictyBase) - - - Contig-U16366-1 SLH286Z (Link... to Original site) - - SLH286Z 386 - - - - Show SLH286 Library SL (Link to library) Clone ID SLH286 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH286Q.Seq.d/ Representative seq. ID SLH28...6Z (Link to Original site) Representative DNA sequence >SLH286 (SLH286Q) /CSM/SL/SLH2-D/SLH286Q.Seq.d/ XXXXX...Seq.d/ 646 0.0 SLK513 (SLK513Q) /CSM/SL/SLK5-A/SLK513Q.Seq.d/ 646 0.0 SLI160 (SLI160Q) /CSM/SL/SLI1-C/SLI160Q.Seq.d/ 646 0.0 SLH2

Dicty_cDB: SLH224 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH224 (Link to dictyBase) - - - Contig-U16287-1 SLH224F (Link to Original site) SLH2...24F 565 - - - - - - Show SLH224 Library SL (Link to library) Clone ID SLH224 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH224Q.Seq.d/ Representative seq. ID SLH22...4F (Link to Original site) Representative DNA sequence >SLH224 (SLH224Q) /CSM/SL/SLH2-A/SLH224Q.Seq.d/ AAAAA.../SS/SSF8-A/SSF805Q.Seq.d/ 1033 0.0 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 1033 0.0 SLH224 (SLH224Q) /CSM/SL/SLH2-A/SLH2

Dicty_cDB: SLH285 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH285 (Link to dictyBase) - - - Contig-U16287-1 SLH285F (Link to Original site) SLH2...85F 326 - - - - - - Show SLH285 Library SL (Link to library) Clone ID SLH285 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH285Q.Seq.d/ Representative seq. ID SLH28...5F (Link to Original site) Representative DNA sequence >SLH285 (SLH285Q) /CSM/SL/SLH2-D/SLH285Q.Seq.d/ AAAAA...ue SSF805 (SSF805Q) /CSM/SS/SSF8-A/SSF805Q.Seq.d/ 617 e-176 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 617 e-176 SLH285 (SLH2

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

First regional CSM program planned.

Science.gov (United States)

1982-09-01

6 countries in the English-speaking Caribbean (Antigua, Barbados, Dominica, St. Kitts/Nevis, St. Lucia, and St. Vincent) are scheduled to form the 1st regional contraceptive social marketing program. The program will be under the auspices of the Barbados Family Planning Association. By combining resources, contraceptive social marketing should be able to effectively augment family planning activities in smaller countries where individual programs wuld be too costly. The regional program will also determine whether program elements from 1 country in a region are relevant in other countries. The Caribbean region as a whole has experienced a general decline in both crude birth rates and fertility rates during the past 15 years; however, adolescent fertility rates remain high and an average of 46% of the populations of Caribbean countries are under 15 years of age. Although heavy emigration has traditionally curbed population increases, new restrictive immigration laws are expected. Further increases in the working age population will contribute to already high unemployment rates and hinder economic development. The 6 countries selected for the social marketing program are receptive to innovative family planning approaches and have the basic marketing infrastructure required. Community-based distribution programs already in operation in these countries distribute condoms, oral contraceptives, and barrier methods. The success of these programs has plateaued, and there is a need for delivery systems capable of reaching broader segments of the population. The social marketing program will be phased in to ensure local acceptance among national leaders and consumers. The regional program hopes to borrow elements from Jamaica's contraceptive social marketing program to avoid the costs involved in starting a program from scratch. A major innovation will be the use of mass media advertising for contraceptives.

CSM a success in Bangladesh.

Science.gov (United States)

1983-01-01

The Bangladesh Social Marketing Project (SMP), providing contraceptives at an annual rate of 931,000 couple years of protection (CYP) as of June 1983, is a success. This figure has grown markedly since the start of the program in late 1975, when the SMP provided 80,000 CYPs, or 8% of nonclinical protection provided. The SMP has contributed to the steadily increasing national nonclinical contraceptive distribution. Currently, SMP distribution accounts for as much as the government and nongovernment programs combined. When clinical methods (including sterilizations) are added to national distribution, the SMP share represents about 28% of total contraceptive use. The SMP does not provide clinical methods, but the entire increase in nonclinical protection provided by the national program since 1975 has been the result of SMP product sales. The SMP utilizes the available mass media for promotion, including print, radio, television, as well as outdoor media and point of purchase materials. Mobile Film Units (MFUs) are an innovative promotional method employed by the SMP. Approximately 80 night time outdoor showings are organized each month in rural areas by SMP promoters. Typically, several short films, usually a popular story with a family planning theme, are run. Between each film the SMP products are of advertised. Products are often sold during and after the films. Retail outlets for SMP products include general stores, pharmacies, and other small shops. When products were introduced in 1975 retail outlets totaled 7500. By August 1983 the number of country wide retailers carrying SMP products had grown to nearly 100,000. In 1982 a marketing strategy emphasizing the role of doctors and rural medical practitioners (RMPs) was introduced. There are between 70,00-100,000 RMPs in Bangladesh. They are well known and respected "doctors" in their villages and add an extensive family planning outreach to the SMP system. The most important advantage of using the RMPs is their personal contact with OC users. Since October 1981 the SMP has detailed approximately 30,000 RMPs; 15,000 have attended conferences and 6600 have purchased OCs. Consumers targeted by the SMP have annual incomes ranging from US$200-$400. A well defined organizational system has evolved that delineates the roles of government, the contractor, and the project personnel regarding specific policy, enterprise, management, and operational functions. The project staff of nearly 300 includes managers for the sales, development, marketing, and finance and administration departments.

Detection of sequential activation of left atrium and coronary sinus musculature in the general population

Directory of Open Access Journals (Sweden)

Masaki Ota, MD

2016-12-01

Conclusions: Far-field LA potentials are often recorded in the CS during sequential LA and CSM activation in the general population. The timing of LA potentials in CS recordings reflected the direction of conduction across the CSM.

Effect of feeding cottonseed meal on some hematological and serum biochemical parameters in broiler birds

Directory of Open Access Journals (Sweden)

G. Thirumalaisamy

2016-07-01

Full Text Available Aim: The study was undertaken to find out the effect of feeding cottonseed meal (CSM on performance of hematological and serum biochemical parameters in broiler birds. Materials and Methods: A 6-week biological trial was carried out with 432-day-old Cobb 400 broiler chicks distributed to nine experimental diets with six replicates, each containing eight chicks. The experimental diets were formulated based on total amino acids (BTAA or based on digestible amino acids (BDAA with or without iron supplementation with two levels of CSM (2% and 4% and control diet based on maize – soybean. The whole blood was subjected to hematological studies. The serum samples were analyzed for protein fractions and lipid profiles. Results: The packed cell volume (PCV value, red blood cell (RBC numbers, and hemoglobin (Hb were lower in iron unsupplemented CSM BTAA or BDAA diets than the control (33.86-35.54 vs. 36.41%, 2.78-2.87 vs. 2.98 × 106/μl, and 10.30-10.70 vs. 10.88%. Supplementation of iron in CSM diets improved the PCV, RBC numbers, and Hb, and the values were comparable to the control. White blood cell numbers, mean corpuscular volume, mean corpuscular Hb (MCH, and MCH concentration values were comparable to the control. The erythrocyte osmotic fragility (EOF was poor in birds fed diets containing up to 4% CSM BTAA or CSM BDAA without iron supplementation (32.02-32.57 vs. 28.77%. Supplementation of iron improved the EOF. The serum cholesterol level did not change with or without iron supplementation. Conclusion: This study suggested that feeding of CSM BTAA or BDAA up to 4% level voiding iron supplementation lowers the hematological parameters, whereas supplementation of iron did not alter serum protein fractions and cholesterol profile; however, it had lowered some hematological parameters, which was rectified by iron supplementation.

Balance of Autonomic Nervous System Predicts Who Benefits from a Self-management Intervention Program for Irritable Bowel Syndrome.

Science.gov (United States)

Jarrett, Monica E; Cain, Kevin C; Barney, Pamela G; Burr, Robert L; Naliboff, Bruce D; Shulman, Robert; Zia, Jasmine; Heitkemper, Margaret M

2016-01-31

To determine if potential biomarkers can be used to identify subgroups of people with irritable bowel syndrome (IBS) who will benefit the most or the least from a comprehensive self-management (CSM) intervention. In a two-armed randomized controlled trial a CSM (n = 46) was compared to a usual care (n = 46) group with follow-up at 3 and 6 months post randomization. Biomarkers obtained at baseline included heart rate variability, salivary cortisol, interleukin-10 produced by unstimulated peripheral blood mononuclear cells, and lactulose/mannitol ratio. Linear mixed models were used to test whether these biomarkers predicted improvements in the primary outcomes including daily abdominal pain, Gastrointestinal Symptom score and IBS-specific quality of life. The nurse-delivered 8-session CSM intervention is more effective than usual care in reducing abdominal pain, reducing Gastrointestinal Symptom score, and enhancing quality of life. Participants with lower nighttime high frequency heart rate variability (vagal modulation) and increased low frequency/high frequency ratio (sympathovagal balance) had less benefit from CSM on abdominal pain. Salivary cortisol, IL-10, and lactulose/mannitol ratio were not statistically significant in predicting CSM benefit. Baseline symptom severity interacts with treatment, namely the benefit of CSM is greater in those with higher baseline symptoms. Cognitively-focused therapies may be less effective in reducing abdominal pain in IBS patients with higher sympathetic tone. Whether this a centrally-mediated patient characteristic or related to heightened arousal remains to be determined.

The influence of irradiation treatment on gossypol and protein digestibility of decorticated cottonseed meal for Broiler chicks

International Nuclear Information System (INIS)

Farag, M.D.H.

2000-01-01

The Effect of gamma irradiation (5-20 kGy) on the chemical composition, soluble protein, available lysine, gossypol, in-vitro and in vivo digestibility of decorticated cottonseed meal (CSM) and the performance of broilers fed processed CSM were investigated. Radiation treatment of CSM at dose levels of 5, 10, 15 and 20 kGy did not affect moisture, crude protein, ether extract, crude fiber, ash and NFW content. However, the treatment reduced soluble protein by 4.18, 7.82, 10.91, 13.46%, respectively. Fluorodinitrobenzene-available lysine concentration reduced by 4.48, 8.12, 17.65 and 21.29% respectively. The concentrations of total gossypol decreased by 7.97, 15.78, 19.92 and 25.39% and free gossypol by 3.74, 7.85, 18.43 and 28.01%, respectively. The digestibility of CSM protein was increased by 5.3, 9.0, 16.6 and 17.2%, for in-vitro digestibility and by 4.8, 7.3, 9.4 and 12.9% for in-vivo due to treatment with 5,10, 15 and 20 kGy, respectively. From 7 to 42 days, arbor acres broilers were freely given iso energetic and iso nitrogenous : corn-soy control diet or diets containing 300 g kg -1 raw or irradiated CSM at 4, 15 or 20 kGy. Intake of raw CSM affected growth, feed intake and feed conversion as compared with birds receiving the control diet

Language mapping using high gamma electrocorticography, fMRI, and TMS versus electrocortical stimulation.

Science.gov (United States)

Babajani-Feremi, Abbas; Narayana, Shalini; Rezaie, Roozbeh; Choudhri, Asim F; Fulton, Stephen P; Boop, Frederick A; Wheless, James W; Papanicolaou, Andrew C

2016-03-01

The aim of the present study was to compare localization of the language cortex using cortical stimulation mapping (CSM), high gamma electrocorticography (hgECoG), functional magnetic resonance imaging (fMRI), and transcranial magnetic stimulation (TMS). Language mapping using CSM, hgECoG, fMRI, and TMS were compared in nine patients with epilepsy. Considering CSM as reference, we compared language mapping approaches based on hgECoG, fMRI, and TMS using their sensitivity, specificity, and the results of receiver operating characteristic (ROC) analyses. Our results show that areas involved in language processing can be identified by hgECoG, fMRI, and TMS. The average sensitivity/specificity of hgECoG, fMRI, and TMS across all patients was 100%/85%, 50%/80%, and 67%/66%, respectively. The average area under the ROC curve of hgECoG, fMRI, and TMS across CSM-positive patients was 0.98, 0.76, and 0.68, respectively. There is considerable concordance between CSM, hgECoG, fMRI, and TMS language mapping. Our results reveal that hgECoG, fMRI, and TMS are valuable tools for presurgical language mapping. Language mapping on the basis of hgECoG, fMRI, and TMS can provide important additional information, therefore, these methods can be used in conjunction with CSM or as an alternative, when the latter is deemed impractical. Copyright © 2015 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Replacing cottonseed meal with ground Prosopis juliflora pods; effect on intake, weight gain and carcass parameters of Afar sheep fed pasture hay basal diet.

Science.gov (United States)

Yasin, Mohammed; Animut, Getachew

2014-08-01

The experiment was conducted to determine the supplementary feeding value of ground Prosopis juliflora pod (Pjp) and cottonseed meal (CSM) and their mixtures on feed intake, body weight gain and carcass parameters of Afar sheep fed a basal diet of pasture hay. Twenty-five yearling fat-tailed Afar rams with mean initial live weight 17.24 ± 1.76 kg (mean ± SD) were used in a randomized complete block design. Animals were blocked on their initial body weight. The experiment was conducted for 12 weeks and carcass evaluation followed. Treatments were hay alone ad libitum (T 1) or with 300 g CSM (T 2), 300 g Pjp (T 5), 2:1 ratio (T 3) and 1:2 ratio of CSM : Pjp (T 4). The CP contents of the hay, CSM and Pjp were 10.5, 44.5 and 16.7 %, respectively. Hay DM intake was higher (P < 0.05) for non-supplemented and total DM intake was lower in non-supplemented. Average daily weight gain (ADG) was lower (P < 0.05) for T 1 compared to all supplemented treatments except T 5. Hot carcass weight and rib-eye muscle area also followed the same trend like that of ADG. Compared with feeding hay alone, supplementing with CSM or a mixture of CSM and Pjp appeared to be a better feeding strategy, biologically, for yearling Afar rams.

The incoming global technological and industrial revolution towards competitive sustainable manufacturing

DEFF Research Database (Denmark)

Jovane, F.; Yoshikawa, H.; Alting, Leo

2008-01-01

, knowledge-based, competitive sustainable manufacturing (CSM) has been widely considered as main enabler. This paper presents the necessary steps from economic growth to sustainable development. The reference model for proactive action (RMfPA) is proposed to develop and implement CSM, at national and global...... levels. Furthermore, we also review strategies to pursue CSM at the macro-meso-field level in addition to ongoing national initiatives in different countries and by international organizations. A case study concerning the European Manufuture initiative is cited. The overall results conclude that RMf...

Strategic Sustainability Management for Enhancing Corporate Value: in the context of Korean Business Circles

NARCIS (Netherlands)

Y-G. Ahn

2007-01-01

textabstractIn line with the growing importance of Corporate Sustainability Management (CSM) in business circles, the linkages between CSM, corporate values and performance is becoming increasingly higher on the agenda both for internal corporate management purposes and for external relations for

Adverse events after cervical spinal manipulative therapy: consensus based classification and definitions

NARCIS (Netherlands)

Dr. C.P. van der Schans; M. Schmitt; dr. S.E. Lakke; H.A. Kranenburg

2015-01-01

Cervical spinal manipulations (CSM) are frequently employed techniques to alleviate neck pain and headache. Minor and major complications following CSM have been described, though clear consensus on definition and the classification of the complications had not yet been achieved. As a result,

Continuum Level Density in Complex Scaling Method

International Nuclear Information System (INIS)

Suzuki, R.; Myo, T.; Kato, K.

2005-01-01

A new calculational method of continuum level density (CLD) at unbound energies is studied in the complex scaling method (CSM). It is shown that the CLD can be calculated by employing the discretization of continuum states in the CSM without any smoothing technique

Adverse events after cervical spinal manipulative therapy: consensus based classification and definitions

NARCIS (Netherlands)

Kranenburg, Rik; Jorna-Lakke, Sandra; Schmitt, M.A.; van der Schans, Cees

2016-01-01

Cervical spinal manipulations (CSM) are frequently employed techniques to alleviate neck pain and headache. Minor and major complications following CSM have been described, though clear consensus on definition and the classification of the complications had not yet been achieved. As a result,

The Incredibly Long-Lived SN 2005ip

Science.gov (United States)

Fox, Ori

2016-10-01

Type IIn supernovae (SNe IIn) are defined by their relatively narrow spectral line features associated with a dense circumstellar medium (CSM) formed by the progenitor star. The nature of the progenitor and mass loss remains relatively unknown. Shock interaction with the dense CSM can often result in significant UV emission for several years post-explosion, thereby probing the CSM characteristics, progenitor mass loss history and, ultimately, the progenitor itself. The Type IIn SN 2005ip proves to be one of the most interesting and well-studied targets within this subclass. Compared to all other supernovae, SN 2005ip is the most luminous for its age. Now more than 11 years post-explosion, the SN has released >10^51 erg throughout its lifetime as the forward shock continues to collide with a dense CSM. Here we propose HST/STIS-MAMA UV observations of SN 2005ip to investigate the massive CSM. When accounting for the shock travel time, these observations will probe material lost from the progenitor more than 1000 years prior to the explosion. We already have a single HST/STIS spectrum of SN 2005ip from 2014, which was obtained while the shock was still within a higher mass regime. With just 5 orbits, a second spectrum will allow us to directly trace the evolution of the CSM and produce new constraints on the pre-SN mass-loss history. Coinciding with Cycle 24's UV Initiative, this program offers new insight regarding both the progenitor and explosion characteristics of the SN IIn subclass.

Family Access to a Dentist Study (FADS): A Multi-Center Randomized Controlled Trial

Science.gov (United States)

Nelson, Suchitra; Riedy, Christine; Albert, Jeffrey M; Lee, Wonik; Slusar, Mary Beth; Curtan, Shelley; Ferretti, Gerald; Cunha-Cruz, Joana; Milgrom, Peter

2015-01-01

Introduction Many low-income parent/caregivers do not understand the importance of cavity-free primary (baby) teeth and the chronic nature of dental caries (tooth decay). As a consequence, dental preventive and treatment utilization is low even when children are screened in schools and referred for care. This study aims to test a referral letter and Dental Information Guide (DIG) designed using the Common-Sense Model of Self-Regulation (CSM) framework to improve caregivers’ illness perception of dental caries and increase utilization of care by children with restorative dental needs. Methods A multi-site randomized controlled trial with caregivers of Kindergarten to 4th grade children in urban Ohio and rural Washington State will compare five arms: (1) CSM referral letter alone; (2) CSM referral letter + DIG; (3) reduced CSM referral letter alone; (4) reduced CSM referral letter + DIG; (5) standard (control) referral. At baseline, children will be screened at school to determine restorative dental needs. If in need of treatment, caregivers will be randomized to study arms and an intervention packet will be sent home. The primary outcome will be dental care based on a change in oral health status by clinical examination 7 months post-screening (ICDAS sealant codes 1 and 2; restoration codes 3–8; extraction). Enrollment commenced summer 2015 with results in summer 2016. Conclusion This study uses the CSM framework to develop and test behavioral interventions to increase dental utilization among low-income caregivers. If effective this simple intervention has broad applicability in clinical and community-based settings. PMID:26500170

Intake, selection, digesta retention, digestion and gut fill of two coprophageous species, rabbits (Oryctolagus cuniculus) and guinea pigs (Cavia porcellus), on a hay-only diet.

Science.gov (United States)

Franz, R; Kreuzer, M; Hummel, J; Hatt, J-M; Clauss, M

2011-10-01

A colonic separation mechanism (CSM) is the prerequisite for the digestive strategy of coprophagy. Two different CSM are known in small herbivores, the 'wash-back' CSM of lagomorphs and the 'mucous-trap' CSM of rodents. Differences between these groups in their digestive pattern when fed exclusively hay were investigated in six rabbits (Oryctolagus cuniculus) and six guinea pigs (Cavia porcellus). Intake, digestibility (by total faecal collection), solute and particle mean retention times (MRT, using Co-EDTA and Cr-mordanted fibres) were measured. Rabbits selected less fibrous parts of the hay than guinea pigs, leaving orts with higher content of neutral detergent fibre [NDF; 721 ± 21 vs. 642 ± 31 g/kg dry matter (DM) in guinea pigs]. They also expressed a lower NDF digestibility (0.44 ± 0.10 vs. 0.55 ± 0.05 of total), a similar particle MRT (15 ± 3 vs. 18 ± 6 h), a longer solute MRT (51 ± 9 vs. 16 ± 4 h), and a lower calculated dry matter gut fill (19.6 ± 4.7 vs. 29.7 ± 4.1 g DM/kg body mass) than guinea pigs (p bacterial matter from the colonic digesta plug than the 'mucous-trap' CSM found in the guinea pigs. Related to metabolic body mass, rabbits therefore need a less capacious colon for their CSM where a more efficient bacteria wash-out is reflected in the lower fibre digestibility. A lighter digestive tract could contribute to a peculiarity of lagomorphs: their ability to run faster than other similar-sized mammals. © 2010 Blackwell Verlag GmbH.

Surgical Treatment of Cervical Spondylotic Myelopathy Associated Hypertension--A Retrospective Study of 309 Patients.

Directory of Open Access Journals (Sweden)

Ze-qun Li

Full Text Available Hypertension is the most prevalent cardiovascular disease, and various risk factors are known to be involved in it. Cervical spondylotic myelopathy (CSM is the most common non-traumatic cause of myelopathy, which displays neurological symptoms and may induce systemic symptoms. To date, it is still unknown whether CSM is associated with hypertension, and if so, whether the decompression operations can attenuate CSM associated hypertension. Here, a total of 309 patients with CSM who received anterior or posterior decompression surgery were enrolled as subjects. Blood pressure measurements were performed before and within one week after the surgery. Among the 309 subjects, 144 (46.6% of them exhibited hypertension before surgery, a significantly higher ratio than that of the whole population. One week after surgery, blood pressure of 106 (73.6% patients turned back to normal. Blood pressure of another 37(25.7% patients decreased with different degrees, although still higher than normal. Moreover, it appears that both approaches were effective in improving blood pressure, while the posterior approach was more effective in decreasing systolic blood pressure. We speculate this type of hypertension might result from hyperactivity of sympathetic nervous system as the heart rate of these patients decreased after surgery as well. Collectively, compression of spinal cord in CSM patients might be associated with hypertension, and decompression surgery largely attenuated this type of hypertension. These findings prove CSM to be a potential associated factor of high blood pressure and may shed light on therapies of hypertension in clinics.

Analysis of insecticide resistance-related genes of the Carmine spider mite Tetranychus cinnabarinus based on a de novo assembled transcriptome.

Directory of Open Access Journals (Sweden)

Zhifeng Xu

Full Text Available The carmine spider mite (CSM, Tetranychus cinnabarinus, is an important pest mite in agriculture, because it can develop insecticide resistance easily. To gain valuable gene information and molecular basis for the future insecticide resistance study of CSM, the first transcriptome analysis of CSM was conducted. A total of 45,016 contigs and 25,519 unigenes were generated from the de novo transcriptome assembly, and 15,167 unigenes were annotated via BLAST querying against current databases, including nr, SwissProt, the Clusters of Orthologous Groups (COGs, Kyoto Encyclopedia of Genes and Genomes (KEGG and Gene Ontology (GO. Aligning the transcript to Tetranychus urticae genome, the 19255 (75.45% of the transcripts had significant (e-value <10-5 matches to T. urticae DNA genome, 19111 sequences matched to T. urticae proteome with an average protein length coverage of 42.55%. Core Eukaryotic Genes Mapping Approach (CEGMA analysis identified 435 core eukaryotic genes (CEGs in the CSM dataset corresponding to 95% coverage. Ten gene categories that relate to insecticide resistance in arthropod were generated from CSM transcriptome, including 53 P450-, 22 GSTs-, 23 CarEs-, 1 AChE-, 7 GluCls-, 9 nAChRs-, 8 GABA receptor-, 1 sodium channel-, 6 ATPase- and 12 Cyt b genes. We developed significant molecular resources for T. cinnabarinus putatively involved in insecticide resistance. The transcriptome assembly analysis will significantly facilitate our study on the mechanism of adapting environmental stress (including insecticide in CSM at the molecular level, and will be very important for developing new control strategies against this pest mite.

Optimization of the composition of the powdered cereal sprouts mixtures

Directory of Open Access Journals (Sweden)

Tumbas-Šaponjac Vesna T.

2016-01-01

Full Text Available Sprouts of cereals have received significant attention as functional food due to their nutritional and functional value. Consumption of sprouts has become increasingly popular among people interested in improving and maintaining their health status by changing dietary habits. Cereal grains contain several classes of phytochemicals, i.e. phenolics, chlorophylls, and carotenoids. However, their nutritional and chemical profile is altered and improved during germination. The purpose of this study was to find the best ratio of the powdered wheat (WS, oat (OS and barley (BS sprouts for designing the cereal sprout mixture (CSM with the highest total phenolic content (TPh and antioxidant capacity (AC, using Simplex-Centroid experimental design and response surface methodology (RSM. Single- and multi-response optimizations showed that OS did not contribute to TPh or AC values of CSM and, therefore, was not included in any of the compositions of the optimized CSM. Single-response optimizations showed that the highest TPh was found for CSM containing 82% BS and 18% WS, while the best AC was found for pure BS. The predicted ratio of cereal sprout powders in CSM obtained by multi-response optimization was: 96% BS and 4% WS. This mixture possessed the highest predicted TPh and AC (372.32 mg GAE/100 g, 549.99 μmol TE/100 g, respectively, which was confirmed to be in accordance with the experimental values. Based on the results obtained in this study, a designed CSM is proposed as a convenient ingredient of functional food products, dietary supplements and nutraceuticals.

Biochemical recurrence after radical prostatectomy: what does it mean?

Science.gov (United States)

Tourinho-Barbosa, Rafael; Srougi, Victor; Nunes-Silva, Igor; Baghdadi, Mohammed; Rembeyo, Gregory; Eiffel, Sophie S.; Barret, Eric; Rozet, Francois; Galiano, Marc; Cathelineau, Xavier; Sanchez-Salas, Rafael

2018-01-01

ABSTRACT Background Radical prostatectomy (RP) has been used as the main primary treatment for prostate cancer (PCa) for many years with excellent oncologic results. However, approximately 20-40% of those patients has failed to RP and presented biochemical recurrence (BCR). Prostatic specific antigen (PSA) has been the pivotal tool for recurrence diagnosis, but there is no consensus about the best PSA threshold to define BCR until this moment. The natural history of BCR after surgical procedure is highly variable, but it is important to distinguish biochemical and clinical recurrence and to find the correct timing to start multimodal treatment strategy. Also, it is important to understand the role of each clinical and pathological feature of prostate cancer in BCR, progression to metastatic disease and cancer specific mortality (CSM). Review design A simple review was made in Medline for articles written in English language about biochemical recurrence after radical prostatectomy. Objective To provide an updated assessment of BCR definition, its meaning, PCa natural history after BCR and the weight of each clinical/pathological feature and risk group classifications in BCR, metastatic disease and CSM. PMID:29039897

Dicty_cDB: Contig-U13065-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U13065-1 no gap 718 1 3561021 3561729 PLUS 1 1 U13065 0 0 0 0 0 0 0 0 0 1 0 0 0 0 Show Contig...-U13065-1 Contig ID Contig-U13065-1 Contig update 2002.12.18 Contig sequence >Contig-U13065-1 (Contig...-U13065-1Q) /CSM_Contig/Contig-U13065-1Q.Seq.d NNNNNNNNNNCAATCAAAGCAATCAATGGTAAATTAACTTTGTTACCATT ...TGATTCAACTCTCTCTG TTTCAAATTTACAACTTGCTTTAGATGAATCCTTTGAAGTTGATTTTGTA TTATATTAAAAATTATCA Gap no gap Contig...kny own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U13065-1 (Contig-U13065-1Q) /CSM_Contig

Dicty_cDB: Contig-U15058-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U15058-1 no gap 1987 4 4423139 4424727 PLUS 2 4 U15058 0 0 0 0 0 0 0 0 1 0 1 0 0 0 Show Contig...-U15058-1 Contig ID Contig-U15058-1 Contig update 2004. 6.11 Contig sequence >Contig-U15058-1 (Contig...-U15058-1Q) /CSM_Contig/Contig-U15058-1Q.Seq.d AAAAAAGGTTACTCACAAAGTTAAAGAAATCAATGAAAGATTTACCACCC...ACTCAAGGGGGTAGGAGAATAAAATCAACCGATTATCCAGGCNTTAAG CGACCTTTTTCCCAAAAAAAAAAGATGTTCAGAAAAT Gap no gap Contig len...srx*atffpkkkdvq k own update 2004. 6.23 Homology vs CSM-cDNA Query= Contig-U15058-1 (Contig-U15058-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U09640-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U09640-1 gap included 1368 2 219988 218635 MINUS 4 5 U09640 0 0 2 0 0 0 0 0 0 0 0 0 1 1 Show Contig...-U09640-1 Contig ID Contig-U09640-1 Contig update 2002. 9.13 Contig sequence >Contig-U09640-1 (Contig...-U09640-1Q) /CSM_Contig/Contig-U09640-1Q.Seq.d ACTGTTGGCCTACTGGNAAAAAATAGTGTAATAATAACCAACAAT...AACAACAACAACAAAAACAAAAACAAATTTTAATT AAATAAAATAATAATATAAAATATAATA Gap gap included Contig...ate 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U09640-1 (Contig-U09640-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U14745-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U14745-1 no gap 1780 6 3063854 3065579 PLUS 2 4 U14745 1 0 1 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U14745-1 Contig ID Contig-U14745-1 Contig update 2002.12.18 Contig sequence >Contig-U14745-1 (Contig...-U14745-1Q) /CSM_Contig/Contig-U14745-1Q.Seq.d GCGTCCGGACAATTTCAATAAAACAAATTTAAAAATAAATAATTTTTAAT...AATAAAATA ATTTAAATAAAAAAATATTTATTTTATTTTAAGATTAACAAAATAAAATA ATTTAAATAAAAAAATATTTATTTTAAAGA Gap no gap Contig...k*kniyfk own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U14745-1 (Contig-U14745-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U16086-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U16086-1 gap included 1018 - - - - 3 4 U16086 0 0 0 0 0 1 1 0 0 0 1 0 0 0 Show Contig-U16086-1 Contig... ID Contig-U16086-1 Contig update 2004. 6.11 Contig sequence >Contig-U16086-1 (Contig-U16086-1Q) /CSM_Contig.../Contig-U16086-1Q.Seq.d AATTTGATGAAGTAGTAGTAGAGGTAAAACATGTATCAAAACATTATAAG ATTGCAGG...ACTTGGATATAAATGAAG GTAGCTCATCAAATTTTTCAAATAATGATAATTTTAAATCGGTAGATCAA ATTACCAATGACCTTAGCCGTATTTTAT Gap gap included Contig...KSVDQI TNDLSRIL own update 2004. 6.23 Homology vs CSM-cDNA Query= Contig-U16086-1 (Contig-U16086-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U13737-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U13737-1 no gap 672 6 1762420 1761754 MINUS 1 1 U13737 0 1 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U13737-1 Contig ID Contig-U13737-1 Contig update 2002.12.18 Contig sequence >Contig-U13737-1 (Contig...-U13737-1Q) /CSM_Contig/Contig-U13737-1Q.Seq.d NNNNNNNNNNAAAATTAGAAAATGGTACAATTGTTTTTAGAGATATTTCA...AGAATAGAAGGAAAATAT AGATCAATGGGGTGGCACAACA Gap no gap Contig length 672 Chromosome...gwhn own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U13737-1 (Contig-U13737-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U06307-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U06307-1 no gap 637 6 29174 29801 PLUS 4 5 U06307 4 0 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U06307-1 Contig ID Contig-U06307-1 Contig update 2002. 9.13 Contig sequence >Contig-U06307-1 (Contig...-U06307-1Q) /CSM_Contig/Contig-U06307-1Q.Seq.d CCCGCGTCCGAATGCCTCGTATTTTACACACTATGCTCCGTGTGGGTAAT TTAG...ATAGTATTTTTATTTTATT CTTTTTCTTTTAAAAATTTTTTATATTGTCAACAATATAATCAAATAAAT GTATTTAATTATCGGGTATTAAAAAAAAAAAAAAAAA Gap no gap Contig...own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U06307-1 (Contig-U06307-1Q) /CSM_Contig/Contig-U063

Dicty_cDB: Contig-U15541-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U15541-1 gap included 2750 - - - - 634 1127 U15541 1 129 1 375 19 0 2 32 4 69 1 0 1 0 Show Contig...-U15541-1 Contig ID Contig-U15541-1 Contig update 2004. 6.11 Contig sequence >Contig-U15541-1 (Contig...-U15541-1Q) /CSM_Contig/Contig-U15541-1Q.Seq.d ATAATAAACGGTGAATACCTCGACTCCTAAATCGATGAAGACCGTAG...AAAAAT AAAAATAAAAATAAATAAATAATCATTTCATATTAATATTTTTTTTTATT TTTAAAAAAA Gap gap included Contig...ffyf*k own update 2004. 6.23 Homology vs CSM-cDNA Query= Contig-U15541-1 (Contig-U15541-1Q) /CSM_Contig/Contig

Effects of dietary gossypol concentration on growth performance, blood profiles, and hepatic histopathology in meat ducks.

Science.gov (United States)

Zeng, Q F; Yang, G L; Liu, G N; Wang, J P; Bai, S P; Ding, X M; Luo, Y H; Zhang, K Y

2014-08-01

The objective of this study was to determine the effects of gossypol from cottonseed meal (CSM) on growth performance, blood biochemical profiles, and liver histopathology of ducks. A total of 900 1-d-old ducks were randomly allocated to 5 treatments with 12 pens/treatment and 15 ducks/pen. The 5 experimental diets were formulated in such a way that 0% (a corn-soybean meal basal diet, diet 1), 25% (diet 2), 50% (diet 3), 75% (diet 4), and 100% (diet 5) of protein from soybean meal were replaced with that from CSM. All diets were formulated on a digestible amino acid basis. The experiment included 2 phases, the starter phase (1 to 3 wk) where the test diets contained graded levels of CSM and the growth phase (4 to 5 wk) where birds were fed a corn-soybean basal diet to examine the recovery of ducks after CSM withdrawal. Dietary CSM and gossypol linearly (P ducks among all treatments. These results suggest that meat ducks' dietary TG and FG concentration should be lower than 928.9 and 77.2 mg/kg, respectively, during d 1 to 21 of age and that a 2-wk withdrawal of diets containing gossypol should be considered. © Poultry Science Association Inc.

Microwave synthesis and adsorption performance of a novel crosslinked starch microsphere

Energy Technology Data Exchange (ETDEWEB)

Lin, Qintie, E-mail: qintlin@163.com [School of Environmental Science and Engineering, Guangdong University of Technology, Guangzhou 510006 (China); National Engineering Laboratory for Rice and By-Product Deep Processing, Center South University of Forestry and Technology, Changsha 41004 (China); Pan, Jianxin [School of Environmental Science and Engineering, Guangdong University of Technology, Guangzhou 510006 (China); Lin, Qinlu [National Engineering Laboratory for Rice and By-Product Deep Processing, Center South University of Forestry and Technology, Changsha 41004 (China); Liu, Qianjun [School of Environmental Science and Engineering, Guangdong University of Technology, Guangzhou 510006 (China)

2013-12-15

Highlights: • CSM was synthesized in a microwave-assisted inversed emulsion system. • The adsorption of methyl violet on CSM was exothermic and spontaneous. • The adsorption process followed the pseudo-second-order kinetics. • The isothermal data obeyed the Langmuir model. • pH variations did not significantly affect the adsorption of methyl violet onto CSM. -- Abstract: A new crosslinked starch microsphere (CSM) was synthesized in a microwave-assisted inversed emulsion system with soluble starch (ST) as a raw material, MBAA as a crosslinker, and K{sub 2}S{sub 2}O{sub 8}–NaHSO{sub 3} as an initiator. The synthesized starch microsphere was characterized and examined by scanning electron microscope (SEM), FTIR spectroscopy and adsorption isotherms of N{sub 2} at 77 K. Adsorption performance was investigated in methyl violet solution. The results showed that the maximum adsorption capacity for MV was 99.3 mg/g at 298 K, and the adsorption fitted pseudo-second-order kinetic model well with correlation coefficients greater than 0.99. The isothermal data obeyed the Langmuir model better compared to Freundlich model and Tempkin model, and the adsorption was exothermic and spontaneous. pH variations (2.0–10.0) did not significantly affect the adsorption of MV onto CSM.

Spatio-temporal evaluation of plant height in corn via unmanned aerial systems

Science.gov (United States)

Varela, Sebastian; Assefa, Yared; Vara Prasad, P. V.; Peralta, Nahuel R.; Griffin, Terry W.; Sharda, Ajay; Ferguson, Allison; Ciampitti, Ignacio A.

2017-07-01

Detailed spatial and temporal data on plant growth are critical to guide crop management. Conventional methods to determine field plant traits are intensive, time-consuming, expensive, and limited to small areas. The objective of this study was to examine the integration of data collected via unmanned aerial systems (UAS) at critical corn (Zea mays L.) developmental stages for plant height and its relation to plant biomass. The main steps followed in this research were (1) workflow development for an ultrahigh resolution crop surface model (CSM) with the goal of determining plant height (CSM-estimated plant height) using data gathered from the UAS missions; (2) validation of CSM-estimated plant height with ground-truthing plant height (measured plant height); and (3) final estimation of plant biomass via integration of CSM-estimated plant height with ground-truthing stem diameter data. Results indicated a correlation between CSM-estimated plant height and ground-truthing plant height data at two weeks prior to flowering and at flowering stage, but high predictability at the later growth stage. Log-log analysis on the temporal data confirmed that these relationships are stable, presenting equal slopes for both crop stages evaluated. Concluding, data collected from low-altitude and with a low-cost sensor could be useful in estimating plant height.

The Monopolin Complex Crosslinks Kinetochore Components to Regulate Chromosome-Microtubule Attachments

Energy Technology Data Exchange (ETDEWEB)

Corbett, Kevin D.; Yip, Calvin K.; Ee, Ly-Sha; Walz, Thomas; Amon, Angelika; Harrison, Stephen C. (Harvard-Med); (MIT)

2010-09-27

The monopolin complex regulates different types of kinetochore-microtubule attachments in fungi, ensuring sister chromatid co-orientation in Saccharomyces cerevisiae meiosis I and inhibiting merotelic attachment in Schizosaccharomyces pombe mitosis. In addition, the monopolin complex maintains the integrity and silencing of ribosomal DNA (rDNA) repeats in the nucleolus. We show here that the S. cerevisiae Csm1/Lrs4 monopolin subcomplex has a distinctive V-shaped structure, with two pairs of protein-protein interaction domains positioned {approx}10 nm apart. Csm1 presents a conserved hydrophobic surface patch that binds two kinetochore proteins: Dsn1, a subunit of the outer-kinetochore MIND/Mis12 complex, and Mif2/CENP-C. Csm1 point-mutations that disrupt kinetochore-subunit binding also disrupt sister chromatid co-orientation in S. cerevisiae meiosis I. We further show that the same Csm1 point-mutations affect rDNA silencing, probably by disrupting binding to the rDNA-associated protein Tof2. We propose that Csm1/Lrs4 functions as a molecular clamp, crosslinking kinetochore components to enforce sister chromatid co-orientation in S. cerevisiae meiosis I and to suppress merotelic attachment in S. pombe mitosis, and crosslinking rDNA repeats to aid rDNA silencing.

Pair production of heavy quarkonium and Bc(*) mesons at hadron colliders

International Nuclear Information System (INIS)

Li Rong; Zhang Yujie; Chao Kuangta

2009-01-01

We investigate the pair production of S-wave heavy quarkonium at the LHC in the color-singlet mechanism (CSM) and estimate the contribution from the gluon fragmentation process in the color-octet mechanism (COM) for comparison. With the matrix elements extracted previously in the leading-order calculations, the numerical results show that the production rates are quite large for the pair production processes at the LHC. The p t distribution of double J/ψ production in the CSM is dominant over that in the COM when p t is smaller than about 10 GeV. For the production of double Υ, the contribution of the COM is always larger than that in the CSM. The large differences in the theoretical predictions between the CSM and COM for the p t distributions in the large p t region are useful in clarifying the effects of COM on the quarkonium production. We also investigate the pair production of S-wave B c and B c * mesons, and the measurement of these processes is useful to test the CSM and extract the long-distance matrix elements for the B c and B c * mesons. Aside from numerical calculations, analytical expressions for the production differential cross sections of all these processes are also given.

Analysis of insecticide resistance-related genes of the Carmine spider mite Tetranychus cinnabarinus based on a de novo assembled transcriptome.

Science.gov (United States)

Xu, Zhifeng; Zhu, Wenyi; Liu, Yanchao; Liu, Xing; Chen, Qiushuang; Peng, Miao; Wang, Xiangzun; Shen, Guangmao; He, Lin

2014-01-01

The carmine spider mite (CSM), Tetranychus cinnabarinus, is an important pest mite in agriculture, because it can develop insecticide resistance easily. To gain valuable gene information and molecular basis for the future insecticide resistance study of CSM, the first transcriptome analysis of CSM was conducted. A total of 45,016 contigs and 25,519 unigenes were generated from the de novo transcriptome assembly, and 15,167 unigenes were annotated via BLAST querying against current databases, including nr, SwissProt, the Clusters of Orthologous Groups (COGs), Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO). Aligning the transcript to Tetranychus urticae genome, the 19255 (75.45%) of the transcripts had significant (e-value insecticide resistance in arthropod were generated from CSM transcriptome, including 53 P450-, 22 GSTs-, 23 CarEs-, 1 AChE-, 7 GluCls-, 9 nAChRs-, 8 GABA receptor-, 1 sodium channel-, 6 ATPase- and 12 Cyt b genes. We developed significant molecular resources for T. cinnabarinus putatively involved in insecticide resistance. The transcriptome assembly analysis will significantly facilitate our study on the mechanism of adapting environmental stress (including insecticide) in CSM at the molecular level, and will be very important for developing new control strategies against this pest mite.

Conceptual Site Model for Newark Bay—Hydrodynamics and Sediment Transport

Directory of Open Access Journals (Sweden)

Parmeshwar L. Shrestha

2014-02-01

Full Text Available A conceptual site model (CSM has been developed for the Newark Bay Study Area (NBSA as part of the Remedial Investigation/Feasibility Study (RI/FS for this New Jersey site. The CSM is an evolving document that describes the influence of physical, chemical and biological processes on contaminant fate and transport. The CSM is initiated at the start of a project, updated during site activities, and used to inform sampling and remediation planning. This paper describes the hydrodynamic and sediment transport components of the CSM for the NBSA. Hydrodynamic processes are influenced by freshwater inflows, astronomical forcing through two tidal straits, meteorological conditions, and anthropogenic activities such as navigational dredging. Sediment dynamics are driven by hydrodynamics, waves, sediment loading from freshwater sources and the tidal straits, sediment size gradation, sediment bed properties, and particle-to-particle interactions. Cohesive sediment transport is governed by advection, dispersion, aggregation, settling, consolidation, and erosion. Noncohesive sediment transport is governed by advection, dispersion, settling, armoring, and transport in suspension and along the bed. The CSM will inform the development and application of a numerical model that accounts for all key variables to adequately describe the NBSA’s historical, current, and future physical conditions.

On the relative merits of invasive and non-invasive pre-surgical brain mapping: New tools in ablative epilepsy surgery.

Science.gov (United States)

Papanicolaou, Andrew C; Rezaie, Roozbeh; Narayana, Shalini; Choudhri, Asim F; Abbas-Babajani-Feremi; Boop, Frederick A; Wheless, James W

2018-05-01

Cortical Stimulation Mapping (CSM) and the Wada procedure have long been considered the gold standard for localizing motor and language-related cortical areas and for determining the language and memory-dominant hemisphere, respectively. In recent years, however, non-invasive methods such as magnetoencephalography (MEG), functional magnetic resonance imaging (fMRI), and transcranial magnetic stimulation (TMS) have emerged as promising alternatives to the aforementioned procedures, particularly in cases where the invasive localization of eloquent cortex has proven to be challenging. To illustrate this point, we will first introduce the evidence of the compatibility of invasive and non-invasive methods and subsequently outline the rationale and the conditions where the latter methods are applicable. Copyright © 2017 Elsevier B.V. All rights reserved.

Contraceptive social marketing and community-based distribution systems in Colombia.

Science.gov (United States)

Vernon, R; Ojeda, G; Townsend, M C

1988-01-01

Three operations research experiments were carried out in three provinces of Colombia to improve the cost-effectiveness of Profamilia's nonclinic-based programs. The experiments tested: (a) whether a contraceptive social marketing (CSM) strategy can replace a community-based distribution (CBD) program in a high contraceptive use area; (b) if wage incentives for salaried CBD instructors will increase contraceptive sales; and (c) whether a specially equipped information, education, and communication (IEC) team can replace a cadre of rural promoters to expand family planning coverage. All three strategies proved to be effective, but only the CSM system yielded a profit. Despite this, Profamilia discontinued its CSM program soon after the experiment was completed. Unexpected government controls regulating the price and sale of contraceptives in Colombia made the program unprofitable. As a result, family planning agencies are cautioned against replacing CBD programs with CSM. Instead, CBD programs might adopt a more commercial approach to become more efficient.

Structure and properties of electron-doped Ca1-xSmxMnO3 nanoparticles

International Nuclear Information System (INIS)

Sanmathi, C.S.; Retoux, R.; Singh, M.P.; Noudem, J.

2009-01-01

In this paper, we report the structural and magnetic properties of electron-doped Ca 1-x Sm x MnO 3 (CSM) nanoparticles. The samarium's composition 'x' was varied from 0 to 0.2 with the special attention up to 0.05. Spherical 60-70 nm polycrystalline CSM nanoparticles were synthesised by chemical co-precipitation technique. Doping of Sm 3+ in antiferromagnetic CaMnO 3 has drastically altered its magnetic behavior due to the formation of ferromagnetic clusters. For example, the CSM powder with x = 0.04 displays about 115 K magnetic Curie temperature and about 0.1 emu/mole saturation magnetization. Physical properties of our nano-CSM powders are also compared with identical bulk-samples. To understand the differences, we invoked the intra-grain and inter-grain magnetic coupling process that facilitates to enhance their ferromagnetic behaviors. Unlike the bulk samples, such magnetic couplings in nanoparticles are favored by the presence of low-level crystal and interfacial defects

Molecular Architecture of the Yeast Monopolin Complex

Energy Technology Data Exchange (ETDEWEB)

Corbett, Kevin D.; Harrison, Stephen C. (Harvard-Med); (UCSD)

2012-07-30

The Saccharomyces cerevisiae monopolin complex directs proper chromosome segregation in meiosis I by mediating co-orientation of sister kinetochores on the meiosis I spindle. The monopolin subunits Csm1 and Lrs4 form a V-shaped complex that may directly crosslink sister kinetochores. We report here biochemical characterization of the monopolin complex subunits Mam1 and Hrr25 and of the complete four-protein monopolin complex. By purifying monopolin subcomplexes with different subunit combinations, we have determined the stoichiometry and overall architecture of the full monopolin complex. We have determined the crystal structure of Csm1 bound to a Mam1 fragment, showing how Mam1 wraps around the Csm1 dimer and alters the stoichiometry of kinetochore-protein binding by Csm1. We further show that the kinase activity of Hrr25 is altered by Mam1 binding, and we identify Hrr25 phosphorylation sites on Mam1 that may affect monopolin complex stability and/or kinetochore binding in meiosis.

AGREED-UPON PROCEDURES, PROCEDURES FOR AUDITING EUROPEAN GRANTS

Directory of Open Access Journals (Sweden)

Daniel Petru VARTEIU

2016-12-01

The audit of EU-funded projects is an audit based on agreed-upon procedures, which are established by the Managing Authority or the Intermediate Body. Agreed-upon procedures can be defined as engagements made in accordance with ISRS 4400, applicable to agreed-upon procedures, where the auditor undertakes to carry out the agreed-upon procedures and issue a report on factual findings. The report provided by the auditor does not express any assurance. It allows users to form their own opinions about the conformity of the expenses with the project budget as well as the eligibility of the expenses.

SN 2010jl: Optical to hard X-ray observations reveal an explosion embedded in a ten solar mass cocoon

International Nuclear Information System (INIS)

Ofek, Eran O.; Gal-Yam, Avishay; Arcavi, Iair; Zoglauer, Andreas; Boggs, Steven E.; Barriére, Nicolas M.; Reynolds, Stephen P.; Fryer, Chris L.; Even, Wesley; Harrison, Fiona A.; Kulkarni, Shrinivas R.; Bellm, Eric; Grefenstette, Brian; Cenko, S. Bradley; Bloom, Joshua S.; Filippenko, Alexei V.; Christensen, Finn; Craig, William W.; Hailey, Charles J.; Laher, Russ

2014-01-01

Some supernovae (SNe) may be powered by the interaction of the SN ejecta with a large amount of circumstellar matter (CSM). However, quantitative estimates of the CSM mass around such SNe are missing when the CSM material is optically thick. Specifically, current estimators are sensitive to uncertainties regarding the CSM density profile and the ejecta velocity. Here we outline a method to measure the mass of the optically thick CSM around such SNe. We present new visible-light and X-ray observations of SN 2010jl (PTF 10aaxf), including the first detection of an SN in the hard X-ray band using NuSTAR. The total radiated luminosity of SN 2010jl is extreme—at least 9 × 10 50 erg. By modeling the visible-light data, we robustly show that the mass of the circumstellar material within ∼10 16 cm of the progenitor of SN 2010jl was in excess of 10 M ☉ . This mass was likely ejected tens of years prior to the SN explosion. Our modeling suggests that the shock velocity during shock breakout was ∼6000 km s –1 , decelerating to ∼2600 km s –1 about 2 yr after maximum light. Furthermore, our late-time NuSTAR and XMM spectra of the SN presumably provide the first direct measurement of SN shock velocity 2 yr after the SN maximum light—measured to be in the range of 2000-4500 km s –1 if the ions and electrons are in equilibrium, and ≳ 2000 km s –1 if they are not in equilibrium. This measurement is in agreement with the shock velocity predicted by our modeling of the visible-light data. Our observations also show that the average radial density distribution of the CSM roughly follows an r –2 law. A possible explanation for the ≳ 10 M ☉ of CSM and the wind-like profile is that they are the result of multiple pulsational pair instability events prior to the SN explosion, separated from each other by years.

X-RAY EMISSION FROM SUPERNOVAE IN DENSE CIRCUMSTELLAR MATTER ENVIRONMENTS: A SEARCH FOR COLLISIONLESS SHOCKS

International Nuclear Information System (INIS)

Ofek, E. O.; Gal-Yam, A.; Yaron, O.; Arcavi, I.; Fox, D.; Cenko, S. B.; Filippenko, A. V.; Bloom, J. S.; Sullivan, M.; Gnat, O.; Frail, D. A.; Horesh, A.; Kulkarni, S. R.; Corsi, A.; Quimby, R. M.; Gehrels, N.; Nugent, P. E.; Kasliwal, M. M.; Bildsten, L.; Poznanski, D.

2013-01-01

The optical light curve of some supernovae (SNe) may be powered by the outward diffusion of the energy deposited by the explosion shock (the so-called shock breakout) in optically thick (τ ∼> 30) circumstellar matter (CSM). Recently, it was shown that the radiation-mediated and radiation-dominated shock in an optically thick wind must transform into a collisionless shock and can produce hard X-rays. The X-rays are expected to peak at late times, relative to maximum visible light. Here we report on a search, using Swift/XRT and Chandra, for X-ray emission from 28 SNe that belong to classes whose progenitors are suspected to be embedded in dense CSM. Our sample includes 19 Type IIn SNe, one Type Ibn SN, and eight hydrogen-poor superluminous SNe (SLSN-I such as SN 2005ap). Two SNe (SN 2006jc and SN 2010jl) have X-ray properties that are roughly consistent with the expectation for X-rays from a collisionless shock in optically thick CSM. However, the X-ray emission from SN 2006jc can also be explained as originating in an optically thin region. Thus, we propose that the optical light curve of SN 2010jl is powered by shock breakout in CSM. We suggest that two other events (SN 2010al and SN 2011ht) were too X-ray bright during the SN maximum optical light to be explained by the shock-breakout model. We conclude that the light curves of some, but not all, SNe IIn/Ibn are powered by shock breakout in CSM. For the rest of the SNe in our sample, including all of the SLSN-I events, our X-ray limits are not deep enough and were typically obtained too early (i.e., near the SN maximum light) for definitive conclusions about their nature. Late-time X-ray observations are required in order to further test whether these SNe are indeed embedded in dense CSM. We review the conditions required for a shock breakout in a wind profile. We argue that the timescale, relative to maximum light, for the SN to peak in X-rays is a probe of the column density and the density profile above the

Quantization Procedures

International Nuclear Information System (INIS)

Cabrera, J. A.; Martin, R.

1976-01-01

We present in this work a review of the conventional quantization procedure, the proposed by I.E. Segal and a new quantization procedure similar to this one for use in non linear problems. We apply this quantization procedures to different potentials and we obtain the appropriate equations of motion. It is shown that for the linear case the three procedures exposed are equivalent but for the non linear cases we obtain different equations of motion and different energy spectra. (Author) 16 refs

Efficiency of performing pulmonary procedures in a shared endoscopy unit: procedure time, turnaround time, delays, and procedure waiting time.

Science.gov (United States)

Verma, Akash; Lee, Mui Yok; Wang, Chunhong; Hussein, Nurmalah B M; Selvi, Kalai; Tee, Augustine

2014-04-01

The purpose of this study was to assess the efficiency of performing pulmonary procedures in the endoscopy unit in a large teaching hospital. A prospective study from May 20 to July 19, 2013, was designed. The main outcome measures were procedure delays and their reasons, duration of procedural steps starting from patient's arrival to endoscopy unit, turnaround time, total case durations, and procedure wait time. A total of 65 procedures were observed. The most common procedure was BAL (61%) followed by TBLB (31%). Overall procedures for 35 (53.8%) of 65 patients were delayed by ≥ 30 minutes, 21/35 (60%) because of "spillover" of the gastrointestinal and surgical cases into the time block of pulmonary procedure. Time elapsed between end of pulmonary procedure and start of the next procedure was ≥ 30 minutes in 8/51 (16%) of cases. In 18/51 (35%) patients there was no next case in the room after completion of the pulmonary procedure. The average idle time of the room after the end of pulmonary procedure and start of next case or end of shift at 5:00 PM if no next case was 58 ± 53 minutes. In 17/51 (33%) patients the room's idle time was >60 minutes. A total of 52.3% of patients had the wait time >2 days and 11% had it ≥ 6 days, reason in 15/21 (71%) being unavailability of the slot. Most pulmonary procedures were delayed due to spillover of the gastrointestinal and surgical cases into the block time allocated to pulmonary procedures. The most common reason for difficulty encountered in scheduling the pulmonary procedure was slot unavailability. This caused increased procedure waiting time. The strategies to reduce procedure delays and turnaround times, along with improved scheduling methods, may have a favorable impact on the volume of procedures performed in the unit thereby optimizing the existing resources.

Stripped-envelope supernova SN 2004dk is now interacting with hydrogen-rich circumstellar material

Science.gov (United States)

Mauerhan, Jon C.; Filippenko, Alexei V.; Zheng, WeiKang; Brink, Thomas; Graham, Melissa L.; Shivvers, Isaac; Clubb, Kelsey

2018-05-01

The dominant mechanism and time scales over which stripped-envelope supernovae (SNe) progenitor stars shed their hydrogen envelopes are uncertain. Observations of Type Ib and Ic SNe at late phases could reveal the optical signatures of interaction with distant circumstellar material (CSM) providing important clues on the origin of the necessary pre-SN mass loss. We report deep late-time optical spectroscopy of the Type Ib explosion SN 2004dk 4684 days (13 years) after discovery. We detect strong Hα emission with an intermediate line width of ˜400 km s-1 and luminosity ˜2.5 × 1039 erg s-1, signaling that the SN blast wave has caught up with the hydrogen-rich CSM lost by the progenitor system. The line luminosity is the highest ever reported for a SN at this late stage. Prominent emission features of He I, Fe, and Ca are also detected. The spectral characteristics are consistent with CSM energized by the forward shock, and resemble the late-time spectra of the persistently interacting Type IIn SNe 2005ip and 1988Z. We suggest that the onset of interaction with H-rich CSM was associated with a previously reported radio rebrightening at ˜1700 days. The data indicate that the mode of pre-SN mass loss was a relatively slow dense wind that persisted millennia before the SN, followed by a short-lived Wolf-Rayet phase that preceded core-collapse and created a cavity within an extended distribution of CSM. We also present new spectra of SNe 2014C, PTF11iqb, and 2009ip, all of which also exhibit continued interaction with extended CSM distributions.

Proteomic analysis of cerebrospinal fluid in canine cervical spondylomyelopathy.

Science.gov (United States)

Martin-Vaquero, Paula; da Costa, Ronaldo C; Allen, Matthew J; Moore, Sarah A; Keirsey, Jeremy K; Green, Kari B

2015-05-01

Prospective study. To identify proteins with differential expression in the cerebrospinal fluid (CSF) from 15 clinically normal (control) dogs and 15 dogs with cervical spondylomyelopathy (CSM). Canine CSM is a spontaneous, chronic, compressive cervical myelopathy similar to human cervical spondylotic myelopathy. There is a limited knowledge of the molecular mechanisms underlying these conditions. Differentially expressed CSF proteins may contribute with novel information about the disease pathogenesis in both dogs and humans. Protein separation was performed with 2-dimensional electrophoresis. A Student t test was used to detect significant differences between groups (P liquid chromatography tandem mass spectrometry. A total of 96 spots had a significant average change of at least 1.25-fold in 1 of the 3 comparisons. Compared with the CSF of control dogs, CSM-affected dogs demonstrated increased CSF expression of 8 proteins including vitamin D-binding protein, gelsolin, creatine kinase B-type, angiotensinogen, α-2-HS-glycoprotein, SPARC (secreted protein, acidic, rich in cysteine), calsyntenin-1, and complement C3, and decreased expression of pigment epithelium-derived factor, prostaglandin-H2 D-isomerase, apolipoprotein E, and clusterin. In the CSF of CSM-affected dogs, corticosteroid treatment increased the expression of haptoglobin, transthyretin isoform 2, cystatin C-like, apolipoprotein E, and clusterin, and decreased the expression of angiotensinogen, α-2-HS-glycoprotein, and gelsolin. Many of the differentially expressed proteins are associated with damaged neural tissue, bone turnover, and/or compromised blood-spinal cord barrier. The knowledge of the protein changes that occur in CSM and upon corticosteroid treatment of CSM-affected patients will aid in further understanding the pathomechanisms underlying this disease. N/A.

Dicty_cDB: FC-BS11 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS11 (Link to dictyBase) - - - Contig-U16517-1 FC-BS11Z (Li...nk to Original site) - - FC-BS11Z 683 - - - - Show FC-BS11 Library FC (Link to library) Clone ID FC-BS11 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS11Q.Seq.d/ Representative seq. ID FC-BS...11Z (Link to Original site) Representative DNA sequence >FC-BS11 (FC-BS11Q) /CSM/FC/FC-BS/FC-BS11Q.Seq....s producing significant alignments: (bits) Value FC-BS11 (FC-BS11Q) /CSM/FC/FC-BS/FC-BS

Dicty_cDB: FC-BS14 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS14 (Link to dictyBase) - - - Contig-U16399-1 FC-BS14E (Li...nk to Original site) - - - - - - FC-BS14E 534 Show FC-BS14 Library FC (Link to library) Clone ID FC-BS14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS14Q.Seq.d/ Representative seq. ID FC-BS...14E (Link to Original site) Representative DNA sequence >FC-BS14 (FC-BS14Q) /CSM/FC/FC-BS/FC-BS14Q.Seq.... vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FC-BS14 (FC-BS

Dicty_cDB: Contig-U06822-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U06822-1 no gap 468 3 438742 439211 PLUS 1 1 U06822 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U06822-1 Contig ID Contig-U06822-1 Contig update 2001. 8.30 Contig sequence >Contig-U06822-1 (Contig...-U06822-1Q) /CSM_Contig/Contig-U06822-1Q.Seq.d ATATTATTCTATTCACTCGTAATAATACATATAAATTGATATCAATCAGA AA...TGCTATTAAGACTTTGGAGCAAAAAAC TAACAAATCAATTCAAAA Gap no gap Contig length 468 Chromosome number (1..6, M) 3 Ch...*mmlklkeikllvllrlwskkltnqfk own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U06822-1 (Contig-U06822-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U13254-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U13254-1 no gap 575 5 203798 203233 MINUS 1 1 U13254 0 0 0 0 0 0 0 1 0 0 0 0 0 0 Show Contig...-U13254-1 Contig ID Contig-U13254-1 Contig update 2002.12.18 Contig sequence >Contig-U13254-1 (Contig...-U13254-1Q) /CSM_Contig/Contig-U13254-1Q.Seq.d AAATAATTTATTTAATTTTAAAATTAATAGATAAAAAGATGGAAATGATA A...CATTTTAACATTATTGGATAAT GTCAATGATTGGCCAANNNNNNNNN Gap no gap Contig length 575 Chromosome number (1..6, M) 5 ...2004. 6.10 Homology vs CSM-cDNA Query= Contig-U13254-1 (Contig-U13254-1Q) /CSM_Contig/Contig-U13254-1Q.Seq.d

Dicty_cDB: Contig-U13891-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U13891-1 no gap 1355 6 799802 798446 MINUS 4 4 U13891 0 0 0 0 1 1 1 0 0 0 1 0 0 0 Show Contig...-U13891-1 Contig ID Contig-U13891-1 Contig update 2002.12.18 Contig sequence >Contig-U13891-1 (Contig...-U13891-1Q) /CSM_Contig/Contig-U13891-1Q.Seq.d TTTTAAAATATTTCAAAATTAGCGAGCACGCATTCGCATATAAATATATT ...ACAAATAAAAAAAAAAAATAAAAAAAATA ATTTA Gap no gap Contig length 1355 Chromosome numb...own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U13891-1 (Contig-U13891-1Q) /CSM_Contig/Contig-U138

Dicty_cDB: Contig-U16093-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U16093-1 gap included 1020 2 4899973 4899063 MINUS 29 31 U16093 7 0 0 0 0 2 ...18 0 0 0 0 0 2 0 Show Contig-U16093-1 Contig ID Contig-U16093-1 Contig update 2004. 6.11 Contig sequence >Contig-U16093-1 (Contig...-U16093-1Q) /CSM_Contig/Contig-U16093-1Q.Seq.d TTTTTTTTTTTTTTTTTAATTTTTTTTTTTCATAAAACTT...AAAATTAAATT Gap gap included Contig length 1020 Chromosome number (1..6, M) 2 Chr...pdate 2004. 6.23 Homology vs CSM-cDNA Query= Contig-U16093-1 (Contig-U16093-1Q) /CSM_Contig/Contig-U16093-1Q

Dicty_cDB: Contig-U06384-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U06384-1 no gap 660 5 3008439 3007779 MINUS 2 2 U06384 2 0 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U06384-1 Contig ID Contig-U06384-1 Contig update 2001. 8.30 Contig sequence >Contig-U06384-1 (Contig...-U06384-1Q) /CSM_Contig/Contig-U06384-1Q.Seq.d TGAAAAAATTAGAGACAACAAGTGGATCAGCACGTAAAGTATGGCGTTTA...AAATAAAAATTAATTTCC AAAAATAAAA Gap no gap Contig length 660 Chromosome number (1.....own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U06384-1 (Contig-U06384-1Q) /CSM_Contig/Contig-U063

Dicty_cDB: Contig-U10823-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U10823-1 gap included 1750 1 3559501 3561234 PLUS 85 124 U10823 0 5 0 30 1 0... 0 20 0 29 0 0 0 0 Show Contig-U10823-1 Contig ID Contig-U10823-1 Contig update 2002.12.18 Contig sequence >Contig-U10823-1 (Contig...-U10823-1Q) /CSM_Contig/Contig-U10823-1Q.Seq.d ACTGTTGGCCTACTGGTATTTTTGGTAGTGTGTTAAAA...CAACAAATAAAATTAAAATTA GTTATATTTTTTTTAAATTAAAAAAAAAAATAAAAAAAATAAATTATTTA TTAAATTTTT Gap gap included Contig ...4. 6.10 Homology vs CSM-cDNA Query= Contig-U10823-1 (Contig-U10823-1Q) /CSM_Contig/Contig-U10823-1Q.Seq.d (1

Dicty_cDB: CHD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available CH (Link to library) CHD492 (Link to dictyBase) - - - - CHD492P (Link to Original site) CHD492F 531 CHD492...Z 728 CHD492P 1239 - - Show CHD492 Library CH (Link to library) Clone ID CHD492 (Link...sukuba.ac.jp/CSM/CH/CHD4-D/CHD492Q.Seq.d/ Representative seq. ID CHD492P (Link to... Original site) Representative DNA sequence >CHD492 (CHD492Q) /CSM/CH/CHD4-D/CHD492Q.Seq.d/ ATATACAATTTAATTT...A Score E Sequences producing significant alignments: (bits) Value CHD492 (CHD492Q) /CSM/CH/CHD4-D/CHD492

Dicty_cDB: SLD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLD492 (Link to dictyBase) - - - Contig-U11049-1 SLD492P (Link to Original site) SLD492...F 347 SLD492Z 454 SLD492P 801 - - Show SLD492 Library SL (Link to library) Clone ID SLD492... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLD4-D/SLD492Q.Seq.d/ Representative seq. ID SLD492...P (Link to Original site) Representative DNA sequence >SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492...nces producing significant alignments: (bits) Value SLD492 (SLD492Q) /CSM/SL/SLD4-D/SLD492

Dicty_cDB: CFD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available CF (Link to library) CFD492 (Link to dictyBase) - - - Contig-U10808-1 CFD492P (Link to Original site) CFD492...F 583 CFD492Z 527 CFD492P 1110 - - Show CFD492 Library CF (Link to library) Clone ID CFD492...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CF/CFD4-D/CFD492Q.Seq.d/ Representative seq. ID CFD492...P (Link to Original site) Representative DNA sequence >CFD492 (CFD492Q) /CSM/CF/CFD4-D/CFD492...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFD492 (CFD492

Dicty_cDB: SFK294 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SF (Link to library) SFK294 (Link to dictyBase) - - - Contig-U16528-1 SFK294F (Link to Original site) SFK2...94F 643 - - - - - - Show SFK294 Library SF (Link to library) Clone ID SFK294 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SF/SFK2-D/SFK294Q.Seq.d/ Representative seq. ID SFK29...4F (Link to Original site) Representative DNA sequence >SFK294 (SFK294Q) /CSM/SF/SFK2-D/SFK294Q.Seq.d/ AATAA...quences producing significant alignments: (bits) Value SFK294 (SFK294Q) /CSM/SF/SFK2-D/SFK294Q.Seq.d/ 1275 0

Dicty_cDB: AFK241 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available AF (Link to library) AFK241 (Link to dictyBase) - - - Contig-U16322-1 AFK241Z (Link... to Original site) - - AFK241Z 753 - - - - Show AFK241 Library AF (Link to library) Clone ID AFK241 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/AF/AFK2-B/AFK241Q.Seq.d/ Representative seq. ID AFK24...1Z (Link to Original site) Representative DNA sequence >AFK241 (AFK241Q) /CSM/AF/AFK2-B/AFK241Q.Seq.d/ XXXXX...llhfsmkilvpfkrkdqpqlvsklkqv lxinkalsqxhhi Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFK2

Dicty_cDB: SLH220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/

Dicty_cDB: SLH229 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH229 (Link to dictyBase) - - - Contig-U15799-1 SLH229Z (Link... to Original site) - - SLH229Z 269 - - - - Show SLH229 Library SL (Link to library) Clone ID SLH229 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH229Q.Seq.d/ Representative seq. ID SLH22...9Z (Link to Original site) Representative DNA sequence >SLH229 (SLH229Q) /CSM/SL/SLH2-B/SLH229Q.Seq.d/ XXXXX...E Sequences producing significant alignments: (bits) Value SLH229 (SLH229Q) /CSM/SL/SLH2-B/SLH2

Dicty_cDB: SLH234 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH234 (Link to dictyBase) - - - Contig-U08154-1 SLH234F (Link to Original site) SLH2...34F 535 - - - - - - Show SLH234 Library SL (Link to library) Clone ID SLH234 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH234Q.Seq.d/ Representative seq. ID SLH23...4F (Link to Original site) Representative DNA sequence >SLH234 (SLH234Q) /CSM/SL/SLH2-B/SLH234Q.Seq.d/ ACAAA...DCTTV--- Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLH2

Dicty_cDB: SLH249 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH249 (Link to dictyBase) - G24226 DDB0215670 Contig-U04170-1 SLH2...49E (Link to Original site) - - - - - - SLH249E 689 Show SLH249 Library SL (Link to library) Clone ID SLH2...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH249Q.Seq.d/ ...Representative seq. ID SLH249E (Link to Original site) Representative DNA sequence >SLH249 (SLH249Q) /CSM/SL/SLH2-C/SLH2...re E Sequences producing significant alignments: (bits) Value SLH249 (SLH249Q) /CSM/SL/SLH2-C/SLH2

Dicty_cDB: SLH231 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH231 (Link to dictyBase) - - - Contig-U16382-1 SLH231F (Link to Original site) SLH2...31F 431 - - - - - - Show SLH231 Library SL (Link to library) Clone ID SLH231 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH231Q.Seq.d/ Representative seq. ID SLH23...1F (Link to Original site) Representative DNA sequence >SLH231 (SLH231Q) /CSM/SL/SLH2-B/SLH231Q.Seq.d/ AAAAA...Score E Sequences producing significant alignments: (bits) Value SLH231 (SLH231Q) /CSM/SL/SLH2-B/SLH231Q.Seq

Dicty_cDB: SLH274 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH274 (Link to dictyBase) - G22493 DDB0218769 Contig-U04171-1 SLH2...74F (Link to Original site) SLH274F 340 - - - - - - Show SLH274 Library SL (Link to library) Clone ID SLH2...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH274Q.Seq.d/ ...Representative seq. ID SLH274F (Link to Original site) Representative DNA sequence >SLH274 (SLH274Q) /CSM/SL/SLH2-D/SLH2...core E Sequences producing significant alignments: (bits) Value SLH274 (SLH274Q) /CSM/SL/SLH2-D/SLH274Q.Seq.

Dicty_cDB: SLH238 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH238 (Link to dictyBase) - G22491 DDB0188118 Contig-U04168-1 SLH2...38F (Link to Original site) SLH238F 383 - - - - - - Show SLH238 Library SL (Link to library) Clone ID SLH2...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH238Q.Seq.d/ ...Representative seq. ID SLH238F (Link to Original site) Representative DNA sequence >SLH238 (SLH238Q) /CSM/SL/SLH2-B/SLH2...e E Sequences producing significant alignments: (bits) Value SLH238 (SLH238Q) /CSM/SL/SLH2-B/SLH2

Dicty_cDB: SLH223 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH223 (Link to dictyBase) - - - Contig-U16450-1 SLH223Z (Link... to Original site) - - SLH223Z 404 - - - - Show SLH223 Library SL (Link to library) Clone ID SLH223 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH223Q.Seq.d/ Representative seq. ID SLH22...3Z (Link to Original site) Representative DNA sequence >SLH223 (SLH223Q) /CSM/SL/SLH2-A/SLH223Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLH223 (SLH2

Dicty_cDB: SLH203 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH203 (Link to dictyBase) - - - Contig-U10734-1 SLH203Z (Link... to Original site) - - SLH203Z 683 - - - - Show SLH203 Library SL (Link to library) Clone ID SLH203 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH203Q.Seq.d/ Representative seq. ID SLH20...3Z (Link to Original site) Representative DNA sequence >SLH203 (SLH203Q) /CSM/SL/SLH2-A/SLH203Q.Seq.d/ XXXXX...ing significant alignments: (bits) Value SLH203 (SLH203Q) /CSM/SL/SLH2-A/SLH203Q.

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

What Is Commercial Social Marketing?

DEFF Research Database (Denmark)

Anker, Thomas Boysen; Stead, Martine

The aim of this paper is to introduce the concept of commercial social marketing (CSM) and discuss some major ethical aspects of CSM. In the first section, we introduce 6 social marketing benchmark criteria. Against this background, we demonstrate Dove’s ‘Campaign for Real Beauty’ to be an instance...

Application of csm- ceres-maize model for seasonal and multi-decadal predictions of maize yield in under subtropical condition of Chitwan, Nepal

Directory of Open Access Journals (Sweden)

Lal Prasad Amgain

2015-12-01

Full Text Available The average maize yield of 2.5 t/ha in sub-tropical terai and inner terai of Nepal has been very less than its potential yield of about 5.0 t/ha, for which changing climatic scenarios have been reported the critical factors. Cropping system Model (CSM-Crop Estimation through Resource and Environment Synthesis (CERES-Maize, embedded under Decision Support System for Agro-technology Transfer (DSSAT ver. 4.2 was evaluated from a datasets of field experimentation by growing four diverse maize genotypes viz. full season OPV (Rampur Composite, Quality Protein Maize (Posilo Makai-1, Hybrid (Gaurav and Pop corn (Pool-12 under three different planting dates (September 1, October 1 and November 1 in 2009-10 at Rampur Campus, Chitwan. The experiment was laid out in two factor factorial randomized complete block design (RCBD with three replications in slightly acidic (pH 6.7 sandy loam soil having low soil available N( 0.49% and K (148 kg/ha and medium P (16.3 kg/ha status. The ancillary and yield data obtaining from field experiment was analyzed from the M-Stat C software and recorded that Gaurav hybrid produced significantly higher yield under September 1 planting (5.86 t/ha followed by Posilo Makai 1 (5.55 t/ha, Rampur Composite (5.1t/ha and the least with Pool-12 (3.45 t/ha. Further, the heat use efficiency of diverse maize genotypes were also calculated by using the mean temperature based accumulative heat unit system and found the stable yields only with Rampur Composite for all planting dates and the rest genotypes were suitable only to the early winter plantings. Model calibration was done by using September 1 planting date for all 4 maize genotypes while validation was accomplished by using the remaining treatments for predicting growth and yield of different maize genotypes. The year 2006- 07 was found 13, 18, 23 and 7% higher in producing the maize yield than the standard year 2009-10 for Rampur Composite, Posilo Makai-1, Gaurav and Pool-12

Asynchronous Channel-Hopping Scheme under Jamming Attacks

Directory of Open Access Journals (Sweden)

Yongchul Kim

2018-01-01

Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

Lunar Flight Study Series: Volume 8. Earth-Moon Transit Studies Based on Ephemeris Data and Using Best Available Computer Program. Part 3: Analysis of Some Lunar Landing Site Problems Utilizing Two Fundamental Principles

Science.gov (United States)

Tucker, W. B.; Hooper, H. L.

1963-01-01

This report presents two fundamental properties of lunar trajectories and makes use of these properties to solve various lunar landing site problems. Not only are various problems treated and solved but the properties and methods are established for use in the solution of other problems. This report presents an analysis of lunar landing site problems utilizing the direct mission mode as well as the orbital mission mode. A particular landing site is then specified and different flight profiles are analyzed for getting an exploration vehicle to that landing site. Rendezvous compatible lunar orbits for various stay-times at the landing site are treated. Launch opportunities are discussed for establishing rendezvous compatible lunar orbits without powered plane changes. Then, the minimum required plane changes for rendezvous in the lunar orbit are discussed for launching from earth on any day. On days that afford rendezvous compatible opportunities, there are no powered plane change requirements in the operations from launch at AMR through the rendezvous in lunar orbit, after the stay at the lunar site.

Computerized procedures system

Science.gov (United States)

Lipner, Melvin H.; Mundy, Roger A.; Franusich, Michael D.

2010-10-12

An online data driven computerized procedures system that guides an operator through a complex process facility's operating procedures. The system monitors plant data, processes the data and then, based upon this processing, presents the status of the current procedure step and/or substep to the operator. The system supports multiple users and a single procedure definition supports several interface formats that can be tailored to the individual user. Layered security controls access privileges and revisions are version controlled. The procedures run on a server that is platform independent of the user workstations that the server interfaces with and the user interface supports diverse procedural views.

Measuring the Progenitor Masses and Dense Circumstellar Material of Type II Supernovae

Science.gov (United States)

Morozova, Viktoriya; Piro, Anthony L.; Valenti, Stefano

2018-05-01

Recent modeling of hydrogen-rich Type II supernova (SN II) light curves suggests the presence of dense circumstellar material (CSM) surrounding the exploding progenitor stars. This has important implications for the activity and structure of massive stars near the end of their lives. Since previous work focused on just a few events, here we expand to a larger sample of 20 well-observed SNe II. For each event we are able to constrain the progenitor zero-age main-sequence (ZAMS) mass, explosion energy, and the mass and radial extent of the dense CSM. We then study the distribution of each of these properties across the full sample of SNe. The inferred ZAMS masses are found to be largely consistent with a Salpeter distribution with minimum and maximum masses of 10.4 and 22.9 M ⊙, respectively. We also compare the individual ZAMS masses we measure with specific SNe II that have pre-explosion imaging to check their consistency. Our masses are generally comparable to or higher than the pre-explosion imaging masses, potentially helping ease the red supergiant problem. The explosion energies vary from (0.1–1.3) × 1051 erg, and for ∼70% of the SNe we obtain CSM masses in the range between 0.18 and 0.83 M ⊙. We see a potential correlation between the CSM mass and explosion energy, which suggests that pre-explosion activity has a strong impact on the structure of the star. This may be important to take into account in future studies of the ability of the neutrino mechanism to explode stars. We also see a possible correlation between the CSM radial extent and ZAMS mass, which could be related to the time with respect to explosion when the CSM is first generated.

A Bayesian belief network approach for assessing uncertainty in conceptual site models at contaminated sites

Science.gov (United States)

Thomsen, Nanna I.; Binning, Philip J.; McKnight, Ursula S.; Tuxen, Nina; Bjerg, Poul L.; Troldborg, Mads

2016-05-01

A key component in risk assessment of contaminated sites is in the formulation of a conceptual site model (CSM). A CSM is a simplified representation of reality and forms the basis for the mathematical modeling of contaminant fate and transport at the site. The CSM should therefore identify the most important site-specific features and processes that may affect the contaminant transport behavior at the site. However, the development of a CSM will always be associated with uncertainties due to limited data and lack of understanding of the site conditions. CSM uncertainty is often found to be a major source of model error and it should therefore be accounted for when evaluating uncertainties in risk assessments. We present a Bayesian belief network (BBN) approach for constructing CSMs and assessing their uncertainty at contaminated sites. BBNs are graphical probabilistic models that are effective for integrating quantitative and qualitative information, and thus can strengthen decisions when empirical data are lacking. The proposed BBN approach facilitates a systematic construction of multiple CSMs, and then determines the belief in each CSM using a variety of data types and/or expert opinion at different knowledge levels. The developed BBNs combine data from desktop studies and initial site investigations with expert opinion to assess which of the CSMs are more likely to reflect the actual site conditions. The method is demonstrated on a Danish field site, contaminated with chlorinated ethenes. Four different CSMs are developed by combining two contaminant source zone interpretations (presence or absence of a separate phase contamination) and two geological interpretations (fractured or unfractured clay till). The beliefs in each of the CSMs are assessed sequentially based on data from three investigation stages (a screening investigation, a more detailed investigation, and an expert consultation) to demonstrate that the belief can be updated as more information

HIGH-DENSITY CIRCUMSTELLAR INTERACTION IN THE LUMINOUS TYPE IIn SN 2010jl: THE FIRST 1100 DAYS

International Nuclear Information System (INIS)

Fransson, Claes; Ergon, Mattias; Sollerman, Jesper; Challis, Peter J.; Kirshner, Robert P.; Marion, G. H.; Milisavljevic, Dan; Friedman, Andrew S.; Chornock, Ryan; Czekala, Ian; Soderberg, Alicia; Chevalier, Roger A.; France, Kevin; Smith, Nathan; Bufano, Filomena; Kangas, Tuomas; Larsson, Josefin; Mattila, Seppo; Benetti, Stefano

2014-01-01

Hubble Space Telescope and ground-based observations of the Type IIn supernova (SN) 2010jl are analyzed, including photometry and spectroscopy in the ultraviolet, optical, and near-IR bands, 26-1128 days after first detection. At maximum, the bolometric luminosity was ∼3 × 10 43 erg s –1 and even at 850 days exceeds 10 42 erg s –1 . A near-IR excess, dominating after 400 days, probably originates in dust in the circumstellar medium (CSM). The total radiated energy is ≳ 6.5 × 10 50 erg, excluding the dust component. The spectral lines can be separated into one broad component that is due to electron scattering and one narrow with expansion velocity ∼100 km s –1 from the CSM. The broad component is initially symmetric around zero velocity but becomes blueshifted after ∼50 days, while remaining symmetric about a shifted centroid velocity. Dust absorption in the ejecta is unlikely to explain the line shifts, and we attribute the shift instead to acceleration by the SN radiation. From the optical lines and the X-ray and dust properties, there is strong evidence for large-scale asymmetries in the CSM. The ultraviolet lines indicate CNO processing in the progenitor, while the optical shows a number of narrow coronal lines excited by the X-rays. The bolometric light curve is consistent with a radiative shock in an r –2 CSM with a mass-loss rate of M-dot ∼0.1  M ⊙ yr −1 . The total mass lost is ≳ 3 M ☉ . These properties are consistent with the SN expanding into a CSM characteristic of a luminous blue variable progenitor with a bipolar geometry. The apparent absence of nuclear processing is attributed to a CSM that is still opaque to electron scattering

Pricing products: juxtaposing affordability with quality appeal.

Science.gov (United States)

1984-01-01

Choosing appropriate product prices is 1 of the most crucial steps in creating an effective contraceptive social marketing (CSM) sales campaign. The Social Marketing Forum conducted an informal survey of social marketing project managers, international contractors, and marketing consultants to determine how CSM programs cope with pricing problems and ways to circumvent some obstacles. According to Diana Altman, a family planning consultant, low prices that make products available to needy individuals are more important than the program's self sufficiency, yet if prices are too low, consumers think the products were unusable in the US and thus were dumped on local markets. Other key factors include commercial competition, spiraling inflation rates, and problems with rising prices and retailer/distributor margins. A sampling of per capita gross national products indicates the poverty level of most CSM projects' target market. Consequently, CSM projects must set low pices, regardless of program operating costs. The goal often is to increase the demand and availability for contraceptives. The fact that social marketing products must pass through retail networks to reach consumers complicates the pricing equation. To deal with the problem, India's Nirodh program gives a 25% margin to distributors/wholesalers, compared to 6% offered on most other goods. Retailers also receive a 25% margin, more than double the commercial rate. Once prices are set, increases pose hazards. Local government approval often is a prerequisite and can require lengthy negotiations. Market studies remain a valuable approach to effective pricing, according to PNA's Mallamad and other research consultants. They cite such effective research strategies as test marketing products and asking consumers how prices affect buying habits. Further, CSM projects can jump over some pricing hurdles through creative marketing. An effective pricing strategy alone cannot produce a successful CSM program. Pricing

SN 2013fs and SN 2013fr: exploring the circumstellar-material diversity in Type II supernovae

Science.gov (United States)

Bullivant, Christopher; Smith, Nathan; Williams, G. Grant; Mauerhan, Jon C.; Andrews, Jennifer E.; Fong, Wen-Fai; Bilinski, Christopher; Kilpatrick, Charles D.; Milne, Peter A.; Fox, Ori D.; Cenko, S. Bradley; Filippenko, Alexei V.; Zheng, WeiKang; Kelly, Patrick L.; Clubb, Kelsey I.

2018-05-01

We present photometry and spectroscopy of SN 2013fs and SN 2013fr in the first ˜100 d post-explosion. Both objects showed transient, relatively narrow H α emission lines characteristic of SNe IIn, but later resembled normal SNe II-P or SNe II-L, indicative of fleeting interaction with circumstellar material (CSM). SN 2013fs was discovered within 8 h of explosion; one of the earliest SNe discovered thus far. Its light curve exhibits a plateau, with spectra revealing strong CSM interaction at early times. It is a less luminous version of the transitional SN IIn PTF11iqb, further demonstrating a continuum of CSM interaction intensity between SNe II-P and SNe IIn. It requires dense CSM within 6.5 × 1014 cm of the progenitor, from a phase of advanced pre-SN mass loss beginning shortly before explosion. Spectropolarimetry of SN 2013fs shows little continuum polarization (˜0.5 per cent, consistent with zero), but noticeable line polarization during the plateau phase. SN 2013fr morphed from an SN IIn at early times to an SN II-L. After the first epoch, its narrow lines probably arose from host-galaxy emission, but the bright, narrow H α emission at early times may be intrinsic to the SN. As for SN 2013fs, this would point to a short-lived phase of strong CSM interaction if proven to be intrinsic, suggesting a continuum between SNe IIn and SNe II-L. It is a low-velocity SN II-L like SN 2009kr, but more luminous. SN 2013fr also developed an infrared excess at later times, due to warm CSM dust that requires a more sustained phase of strong pre-SN mass loss.

Dynamic changes in the dural space and spinal cord cross-sectional area during flexion and extension in patients with cervical spondylotic myelopathy

International Nuclear Information System (INIS)

Machino, Masaaki; Yukawa, Yasutsugu; Ito, Keigo; Nakashima, Hiroaki; Kato, Fumihiko

2009-01-01

The number of patients with cervical spondylotic myelopathy (CSM) is increasing with the aging of the population. The patients' during spinal cord tends to be compressed neck extension, because the yellow ligaments and intervertebral discs protrude into the spinal canal during neck extension (pincer mechanism). A total of 100 patients with CSM were prospectively enrolled in this study. After preoperative myelography, multi-detector-row CT (MDCT) scans were acquired in flexion and extension, and the dural space and spinal cord cross-sectional area at each disc level from C2/3 to C7/Th1 were measured by using Scion imaging software. The average dural space and average spinal cord cross-sectional area were smaller in extension than in flexion from the C3/4 to C7/Th1 disc level, and the greatest dynamic changes were seen at the C5/6 level. MDCT demonstrated dynamic factors in patients with CSM. The spinal cord cross-sectional area became narrower during extension in patients with CSM. (author)

Determination of the CD performance and carbon contamination of an EUV mask by using a coherent scattering microscopy/in-situ contamination system

International Nuclear Information System (INIS)

Doh, Jonggul; Jeong, Changyoung; Lee, Sangsul; Lee, Jaeuk; Cha, Hansun; Ahn, Jinho; Lee, Donggun; Kim, Seongsue; Cho, Hanku; Rah, Seungyu

2010-01-01

The impact of carbon contamination on imaging performance was analyzed using an in-situ accelerated contamination system (ICS) combined with coherent scattering microscopy (CSM) at the 11B extreme ultraviolet lithography (EUVL) beamline of the Pohang Accelerator Laboratory (PAL). The CSM/ICS is composed of the CSM for measuring imaging properties and the ICS for accelerating the carbon contamination. The CD (critical dimension) and the reflectivity of the mask were compared before and after carbon contamination through acceleration exposure. The reflectivity degradation was 1.3%, 2.1%, and 2.5% after 1-, 2-, and 3-hour exposures, respectively, due to carbon contamination of 5, 10, and 20 nm as measured by using a Zygo interferometer. The mask CD change of an 88-nm line and space pattern was analyzed using CSM and CD SEM (scanning electron microscope), and the result showed a similar trend, but a different absolute value. This difference confirmed the importance of the actinic inspection technique, which employs exactly the same imaging condition as the exposure tool.

Détection précoce du cancer de la prostate chez des apparentés de ...

African Journals Online (AJOL)

B. Fall

de consentement éclairé leur a été remis et le dépistage effectué. Les apparentés qui n'avaient pas respecté le rendez-vous étaient recon- tactés par téléphone pour fixer un autre rendez-vous. Si après 3 tentatives l'apparenté ne se présentait pas au rendez-vous nous arrê- tions de l'appeler. Sur les 145 cas de cancer de ...

Dicty_cDB: FC-BS10 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS10 (Link to dictyBase) - - - Contig-U16283-1 FC-BS10Z (Li...nk to Original site) - - FC-BS10Z 720 - - - - Show FC-BS10 Library FC (Link to library) Clone ID FC-BS10 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS10Q.Seq.d/ Representative seq. ID FC-BS...10Z (Link to Original site) Representative DNA sequence >FC-BS10 (FC-BS10Q) /CSM/FC/FC-BS/FC-BS10Q.Seq....E Sequences producing significant alignments: (bits) Value FC-BS10 (FC-BS10Q) /CSM/FC/FC-BS/FC-BS10Q.Seq.d/

Dicty_cDB: FC-BS21 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS21 (Link to dictyBase) - - - Contig-U15764-1 FC-BS21Z (Li...nk to Original site) - - FC-BS21Z 723 - - - - Show FC-BS21 Library FC (Link to library) Clone ID FC-BS21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS21Q.Seq.d/ Representative seq. ID FC-BS...21Z (Link to Original site) Representative DNA sequence >FC-BS21 (FC-BS21Q) /CSM/FC/FC-BS/FC-BS21Q.Seq.... Score E Sequences producing significant alignments: (bits) Value FC-BS21 (FC-BS21Q) /CSM/FC/FC-BS/FC-BS21Q.

Dicty_cDB: FC-BS19 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS19 (Link to dictyBase) - - - Contig-U16583-1 FC-BS19E (Li...nk to Original site) - - - - - - FC-BS19E 604 Show FC-BS19 Library FC (Link to library) Clone ID FC-BS19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS19Q.Seq.d/ Representative seq. ID FC-BS...19E (Link to Original site) Representative DNA sequence >FC-BS19 (FC-BS19Q) /CSM/FC/FC-BS/FC-BS19Q.Seq....E Sequences producing significant alignments: (bits) Value FC-BS19 (FC-BS19Q) /CSM/FC/FC-BS/FC-BS19Q.Seq.d/

Dicty_cDB: Contig-U08861-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U08861-1 gap included 1295 5 2877914 2879217 PLUS 1 2 U08861 0 0 0 0 1 0 0 0 0 0 0 0 0 0 Show Contig...-U08861-1 Contig ID Contig-U08861-1 Contig update 2002. 9.13 Contig sequence >Contig-U08861-1 (Contig-U08861-1Q) /CSM_Contig/Contig-U08861...CACATTATAAAGTACCAAATAAGTTATTAATTTTAGAAAATA AATTCCAAAGAATGCAATGTCTAAAGTTAATAAAAAAGAATACTAAAATA TTTTC Gap gap included Contig...k**iwsryccnhcl*kkqkttnef*r i*nql*tkistl*stk*vinfrk*ipknamskvnkkey*nif own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig...-U08861-1 (Contig-U08861-1Q) /CSM_Contig/Contig-U08861-1Q.Seq.d (1305 letters) Database: C

Dicty_cDB: Contig-U06829-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U06829-1 no gap 449 5 4394444 4394893 PLUS 1 1 U06829 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U06829-1 Contig ID Contig-U06829-1 Contig update 2001. 8.30 Contig sequence >Contig-U06829-1 (Contig...-U06829-1Q) /CSM_Contig/Contig-U06829-1Q.Seq.d GTAAAAGAATGTAATGAAAATGAAAAAATTAATTTTATAATAAAATTATT ...ATGATTTAGAATTGGTACAATTAGTTTA Gap no gap Contig length 449 Chromosome number (1..6, M) 5 Chromosome length 50...04. 6.10 Homology vs CSM-cDNA Query= Contig-U06829-1 (Contig-U06829-1Q) /CSM_Contig/Contig-U06829-1Q.Seq.d (

Dicty_cDB: Contig-U12073-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U12073-1 gap included 912 2 2118980 2119867 PLUS 4 5 U12073 0 0 0 2 0 0 0 1 0 1 0 0 0 0 Show Contig...-U12073-1 Contig ID Contig-U12073-1 Contig update 2002.12.18 Contig sequence >Contig-U12073-1 (Contig...-U12073-1Q) /CSM_Contig/Contig-U12073-1Q.Seq.d CTGTTGGCCTACTGGNAATTGAAACAATTGTTTCAGCAAATATTA...AAGA Gap gap included Contig length 912 Chromosome number (1..6, M) 2 Chromosome length 8467578 Start point ...GPXSXDY*r own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U12073-1 (Contig-U12073-1Q) /CSM_Contig/Contig

Dicty_cDB: Contig-U09615-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U09615-1 gap included 1134 3 4459395 4458259 MINUS 1 2 U09615 0 0 1 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U09615-1 Contig ID Contig-U09615-1 Contig update 2002. 9.13 Contig sequence >Contig-U09615-1 (Contig-U09615-1Q) /CSM_Contig/Contig-U0961...TGCAAGATTAGAAAGATTAGAAAAAGATGCTATGCTAAAAATA Gap gap included Contig length 1134 Chromosome number (1..6, M) ...*wcnlyfrcre*emgkcn iefhiintrfkiwphrcidtighnvgicw**fnfecsfisleiqyrv**mgirfkyw*ww s*c*irpyfnnhafqyydyiwwskfwh*...4. 6.10 Homology vs CSM-cDNA Query= Contig-U09615-1 (Contig-U09615-1Q) /CSM_Contig/Contig-U09615-1Q.Seq.d (1

Dicty_cDB: SSD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SS (Link to library) SSD492 (Link to dictyBase) - - - Contig-U11368-1 SSD492E (Link... to Original site) - - - - - - SSD492E 768 Show SSD492 Library SS (Link to library) Clone ID SSD492 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSD4-D/SSD492Q.Seq.d/ Representative seq. ID SSD492...E (Link to Original site) Representative DNA sequence >SSD492 (SSD492Q) /CSM/SS/SSD4-D/SSD492Q.Seq.d/ CTGAA...nificant alignments: (bits) Value SSD492 (SSD492Q) /CSM/SS/SSD4-D/SSD492Q.Seq.d/ 1481 0.0 AHH144 (AHH144Q) /

Dicty_cDB: VFK250 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFK250 (Link to dictyBase) - - - Contig-U13825-1 VFK250P (Link to Original site) VFK2...50F 647 VFK250Z 679 VFK250P 1306 - - Show VFK250 Library VF (Link to library) Clone ID VFK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-C/VFK250Q.Seq.d/ Representative seq. ID VFK2...50P (Link to Original site) Representative DNA sequence >VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK2...re E Sequences producing significant alignments: (bits) Value VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK250Q.Seq.d/

Dicty_cDB: VHK294 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK294 (Link to dictyBase) - - - Contig-U15304-1 VHK294P (Link to Original site) VHK2...94F 611 VHK294Z 780 VHK294P 1371 - - Show VHK294 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK294Q.Seq.d/ Representative seq. ID VHK2...94P (Link to Original site) Representative DNA sequence >VHK294 (VHK294Q) /CSM/VH/VHK2-D/VHK2...yscfyw ns*i*ngsgyf**tfttti Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK294 (VHK2