WorldWideScience

Sample records for crystal structures dna-binding

  1. Synthesis, crystal structure, DNA binding and molecular docking studies of zinc(II) carboxylates

    Science.gov (United States)

    Muhammad, Niaz; Ikram, Muhammad; Wadood, Abdul; Rehman, Sadia; Shujah, Shaukat; Erum; Ghufran, Mehreen; Rahim, Shahnaz; Shah, Muzamil; Schulzke, Carola

    2018-02-01

    New zinc(II) carboxylate complexes [Zn(3-F-C6H4CH2COO)2]n (1), [Zn3(3-F-C6H4CH2COO)6(Phen)2] (2) and [Zn3(3-F-C6H4CH2COO)6(bipy)2] (3) were synthesized and characterized by atomic absorption, single crystal structural analysis and IR studies. Complex 1 crystallizes as a coordination polymer constituting a web of μ - η1,η1 carboxylate bridged tetrahedral zinc centers. Complexes 2 and 3 comprise trinuclear zinc centers with two terminal fivefold coordinated slightly distorted square-pyramidal and central sixfold coordinated octahedral zinc centers. The complexes were also assessed for their DNA binding ability by UV/- Vis spectroscopy and their behavior rationalized theoretically by molecular docking studies. A DNA binding study has shown groove binding interactions with the complexes.

  2. DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein.

    Science.gov (United States)

    Duan, Ming-Rui; Nan, Jie; Liang, Yu-He; Mao, Peng; Lu, Lu; Li, Lanfen; Wei, Chunhong; Lai, Luhua; Li, Yi; Su, Xiao-Dong

    2007-01-01

    WRKY proteins, defined by the conserved WRKYGQK sequence, are comprised of a large superfamily of transcription factors identified specifically from the plant kingdom. This superfamily plays important roles in plant disease resistance, abiotic stress, senescence as well as in some developmental processes. In this study, the Arabidopsis WRKY1 was shown to be involved in the salicylic acid signaling pathway and partially dependent on NPR1; a C-terminal domain of WRKY1, AtWRKY1-C, was constructed for structural studies. Previous investigations showed that DNA binding of the WRKY proteins was localized at the WRKY domains and these domains may define novel zinc-binding motifs. The crystal structure of the AtWRKY1-C determined at 1.6 A resolution has revealed that this domain is composed of a globular structure with five beta strands, forming an antiparallel beta-sheet. A novel zinc-binding site is situated at one end of the beta-sheet, between strands beta4 and beta5. Based on this high-resolution crystal structure and site-directed mutagenesis, we have defined and confirmed that the DNA-binding residues of AtWRKY1-C are located at beta2 and beta3 strands. These results provided us with structural information to understand the mechanism of transcriptional control and signal transduction events of the WRKY proteins.

  3. Crystal structure of the mineralocorticoid receptor DNA binding domain in complex with DNA.

    Science.gov (United States)

    Hudson, William H; Youn, Christine; Ortlund, Eric A

    2014-01-01

    The steroid hormone receptors regulate important physiological functions such as reproduction, metabolism, immunity, and electrolyte balance. Mutations within steroid receptors result in endocrine disorders and can often drive cancer formation and progression. Despite the conserved three-dimensional structure shared among members of the steroid receptor family and their overlapping DNA binding preference, activation of individual steroid receptors drive unique effects on gene expression. Here, we present the first structure of the human mineralocorticoid receptor DNA binding domain, in complex with a canonical DNA response element. The overall structure is similar to the glucocorticoid receptor DNA binding domain, but small changes in the mode of DNA binding and lever arm conformation may begin to explain the differential effects on gene regulation by the mineralocorticoid and glucocorticoid receptors. In addition, we explore the structural effects of mineralocorticoid receptor DNA binding domain mutations found in type I pseudohypoaldosteronism and multiple types of cancer.

  4. Crystal Structure of Human SSRP1 Middle Domain Reveals a Role in DNA Binding.

    Science.gov (United States)

    Zhang, Wenjuan; Zeng, Fuxing; Liu, Yiwei; Shao, Chen; Li, Sai; Lv, Hui; Shi, Yunyu; Niu, Liwen; Teng, Maikun; Li, Xu

    2015-12-21

    SSRP1 is a subunit of the FACT complex, an important histone chaperone required for transcriptional regulation, DNA replication and damage repair. SSRP1 also plays important roles in transcriptional regulation independent of Spt16 and interacts with other proteins. Here, we report the crystal structure of the middle domain of SSRP1. It consists of tandem pleckstrin homology (PH) domains. These domains differ from the typical PH domain in that PH1 domain has an extra conserved βαβ topology. SSRP1 contains the well-characterized DNA-binding HMG-1 domain. Our studies revealed that SSRP1-M can also participate in DNA binding, and that this binding involves one positively charged patch on the surface of the structure. In addition, SSRP1-M did not bind to histones, which was assessed through pull-down assays. This aspect makes the protein different from other related proteins adopting the double PH domain structure. Our studies facilitate the understanding of SSRP1 and provide insights into the molecular mechanisms of interaction with DNA and histones of the FACT complex.

  5. Crystal structure of Arabidopsis thaliana calmodulin7 and insight into its mode of DNA binding.

    Science.gov (United States)

    Kumar, Sanjeev; Mazumder, Mohit; Gupta, Nisha; Chattopadhyay, Sudip; Gourinath, Samudrala

    2016-09-01

    Calmodulin (CaM) is a Ca(2+) sensor that participates in several cellular signaling cascades by interacting with various targets, including DNA. It has been shown that Arabidopsis thaliana CaM7 (AtCaM7) interacts with Z-box DNA and functions as a transcription factor [Kushwaha R et al. (2008) Plant Cell 20, 1747-1759; Abbas N et al. (2014) Plant Cell 26, 1036-1052]. The crystal structure of AtCaM7, and a model of the AtCAM7-Z-box complex suggest that Arg-127 determines the DNA-binding ability by forming crucial interactions with the guanine base. We validated the model using biolayer interferometry, which confirmed that AtCaM7 interacts with Z-box DNA with high affinity. In contrast, the AtCaM2/3/5 isoform does not show any binding, although it differs from AtCaM7 by only a single residue. © 2016 Federation of European Biochemical Societies.

  6. Crystal structure of the gamma-2 herpesvirus LANA DNA binding domain identifies charged surface residues which impact viral latency.

    Directory of Open Access Journals (Sweden)

    Bruno Correia

    Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.

  7. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  8. Crystal structures, metal activation, and DNA-binding properties of two-domain IdeR from Mycobacterium tuberculosis.

    Science.gov (United States)

    Wisedchaisri, Goragot; Chou, C James; Wu, Meiting; Roach, Claudia; Rice, Adrian E; Holmes, Randall K; Beeson, Craig; Hol, Wim G J

    2007-01-16

    The iron-dependent regulator IdeR is a key transcriptional regulator of iron uptake in Mycobacterium tuberculosis. In order to increase our insight into the role of the SH3-like third domain of this essential regulator, the metal-binding and DNA-binding properties of two-domain IdeR (2D-IdeR) whose SH3-like domain has been truncated were characterized. The equilibrium dissociation constants for Co2+ and Ni2+ activation of 2D-IdeR for binding to the fxbA operator and the DNA-binding affinities of 2D-IdeR in the presence of excess metal ions were estimated using fluorescence spectroscopy. 2D-IdeR binds to fxbA operator DNA with similar affinity as full-length IdeR in the presence of excess metal ion. However, the Ni2+ concentrations required to activate 2D-IdeR for DNA binding appear to be smaller than that for full-length IdeR while the concentration of Co2+ required for activation remains the same. We have determined the crystal structures of Ni2+-activated 2D-IdeR at 1.96 A resolution and its double dimer complex with the mbtA-mbtB operator DNA in two crystal forms at 2.4 A and 2.6 A, the highest resolutions for DNA complexes for any structures of iron-dependent regulator family members so far. The 2D-IdeR-DNA complex structures confirm the specificity of Ser37 and Pro39 for thymine bases and suggest preferential contacts of Gln43 to cytosine bases of the DNA. In addition, our 2D-IdeR structures reveal a remarkable property of the TEV cleavage sequence remaining after removal of the C-terminal His6. This C-terminal tail promotes crystal contacts by forming a beta-sheet with the corresponding tail of neighboring subunits in two unrelated structures of 2D-IdeR, one with and one without DNA. The contact-promoting properties of this C-terminal TEV cleavage sequence may be beneficial for crystallizing other proteins.

  9. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    ... lanthanum complex and 10-coordinated in the cerium complex. The coordination polyhedra around the lanthanum and cerium were found to have distorted icosahedron and distorted bicapped square antiprism respectively. DNA binding and nuclease activity of these complexes were also investigated in the present work.

  10. Crystal structure of an archaeal specific DNA-binding protein (Ape10b2) from Aeropyrum pernix K1.

    Science.gov (United States)

    Kumarevel, Thirumananseri; Sakamoto, Keiko; Gopinath, Subash C B; Shinkai, Akeo; Kumar, Penmetcha K R; Yokoyama, Shigeyuki

    2008-05-15

    DNA binding proteins are essential in all organisms, and they play important roles in both compacting and regulating the genetic material. All thermophilic and hyperthermophilic archaea encode one or more copies of Alba or Sso10b, which is a small, abundant, basic protein that binds DNA. Here, we present the crystal structure of Ape10b2 from Aeropyrum pernix K1 at 1.70 A. Although the overall structure resembles the known Alba protein fold, a significant conformational change was observed in the loop regions. Specifically, the L5 loop is slightly longer, as compared to those of other known proteins, and the flexibility of this loop may facilitate the interaction with double stranded DNA. In addition, we showed that Ape10b2 binds to 16 and 39 bp duplex DNAs with high affinity. On the basis of our analyses, we have created a putative protein-DNA complex model. 2007 Wiley-Liss, Inc.

  11. Corrigendum to "Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate" [J. Mol. Struct. 1093 (2015) 135-143

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2017-04-01

    The authors regret to inform that Scheme 1 in the article titled 'Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate' in vol. 1093 of the Journal of Molecular Structure is incorrect. The corrected scheme is as shown in this correction. This is purely a copy error. The error does not affect the conclusion in paper. The authors would like to apologize for any inconvenience caused.

  12. Picolinic acid based Cu(II) complexes with heterocyclic bases--crystal structure, DNA binding and cleavage studies.

    Science.gov (United States)

    Pulimamidi, Rabindra Reddy; Nomula, Raju; Pallepogu, Raghavaiah; Shaik, Hussain

    2014-05-22

    In view of the importance of picolinic acid (PA) in preventing cell growth and arresting cell cycle, new PA based metallonucleases were designed with a view to study their DNA binding and cleavage abilities. Three new Cu(II) complexes [Cu(II)(DPPA)].4H2O (1),[Cu(II)(DPPA)(bpy)].5H2O (2) and [Cu(II)(DPPA)(phen)].5H2O (3), were synthesized using a picolinic acid based bifunctional ligand (DPPA) and heterocyclic bases (where DPPA: Pyridine-2-carboxylic acid {2-phenyl-1-[(pyridin-2-ylmethyl)-carbonyl]-ethyl}-amide; bpy: 2, 2'-bipyridine and phen: 1, 10-phenanthroline). DPPA was obtained by coupling 2-picolinic acid and 2-picolyl amine with l-phenylalanine through amide bond‌‌. Complexes were structurally characterized by a single crystal X-ray crystallography. The molecular structure of 1 shows Cu(II) center essentially in a square planar coordination geometry, while complex 2 shows an approximate five coordinated square-pyramidal geometry. Eventhough we could not isolate single crystal for complex (3), its structure was established based on other techniques. The complex (3) also exhibits five coordinate square pyramidal geometry. The complexes show good binding affinity towards CT-DNA. The binding constants (Kb) decrease in the order 1.35 ± 0.01 × 10(5) (3) > 1.23 ± 0.01 × 10(5) (2) > 8.3 ± 0.01 × 10(4) (1) M(-1). They also exhibit efficient nuclease activity towards supercoiled pUC19 DNA both in the absence and presence of external agent (H2O2). The kinetic studies reveal that the hydrolytic cleavage reactions follow the pseudo first-order rate constant and the hydrolysis rates are in the range of (5.8-8.0) × 10(7) fold rate enhancement compared to non-catalyzed double stranded DNA (3.6 × 10(-8) h(-1)). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  13. Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

    Science.gov (United States)

    Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

    2017-10-01

    Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

  14. Crystal Structure of a Bacterial Topoisomerase IB in Complex with DNA Reveals a Secondary DNA Binding Site

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Asmita; Yakovleva, Lyudmila; Shuman, Stewart; Mondragón, Alfonso (NWU); (SKI)

    2010-10-22

    Type IB DNA topoisomerases (TopIB) are monomeric enzymes that relax supercoils by cleaving and resealing one strand of duplex DNA within a protein clamp that embraces a {approx}21 DNA segment. A longstanding conundrum concerns the capacity of TopIB enzymes to stabilize intramolecular duplex DNA crossovers and form protein-DNA synaptic filaments. Here we report a structure of Deinococcus radiodurans TopIB in complex with a 12 bp duplex DNA that demonstrates a secondary DNA binding site located on the surface of the C-terminal domain. It comprises a distinctive interface with one strand of the DNA duplex and is conserved in all TopIB enzymes. Modeling of a TopIB with both DNA sites suggests that the secondary site could account for DNA crossover binding, nucleation of DNA synapsis, and generation of a filamentous plectoneme. Mutations of the secondary site eliminate synaptic plectoneme formation without affecting DNA cleavage or supercoil relaxation.

  15. Crystal structures of the DNA-binding domain tetramer of the p53 tumor suppressor family member p73 bound to different full-site response elements.

    Science.gov (United States)

    Ethayathulla, Abdul S; Nguyen, H Thien; Viadiu, Hector

    2013-02-15

    How cells choose between developmental pathways remains a fundamental biological question. In the case of the p53 protein family, its three transcription factors (p73, p63, and p53) each trigger a gene expression pattern that leads to specific cellular pathways. At the same time, these transcription factors recognize the same response element (RE) consensus sequences, and their transactivation of target genes overlaps. We aimed to understand target gene selectivity at the molecular level by determining the crystal structures of the p73 DNA-binding domain (DBD) in complex with full-site REs that vary in sequence. We report two structures of the p73 DBD bound as a tetramer to 20-bp full-site REs based on two distinct quarter-sites: GAACA and GAACC. Our study confirms that the DNA-binding residues are conserved within the p53 family, whereas the dimerization and tetramerization interfaces diverge. Moreover, a conserved lysine residue in loop L1 of the DBD senses the presence of guanines in positions 2 and 3 of the quarter-site RE, whereas a conserved arginine in loop 3 adapts to changes in position 5. Sequence variations in the RE elicit a p73 conformational response that might explain target gene specificity.

  16. Crystal structure of family 4 uracil-DNA glycosylase from Sulfolobus tokodaii and a function of tyrosine 170 in DNA binding.

    Science.gov (United States)

    Kawai, Akito; Higuchi, Shigesada; Tsunoda, Masaru; Nakamura, Kazuo T; Yamagata, Yuriko; Miyamoto, Shuichi

    2015-09-14

    Uracil-DNA glycosylases (UDGs) excise uracil from DNA by catalyzing the N-glycosidic bond hydrolysis. Here we report the first crystal structures of an archaeal UDG (stoUDG). Compared with other UDGs, stoUDG has a different structure of the leucine-intercalation loop, which is important for DNA binding. The stoUDG-DNA complex model indicated that Leu169, Tyr170, and Asn171 in the loop are involved in DNA intercalation. Mutational analysis showed that Tyr170 is critical for substrate DNA recognition. These results indicate that Tyr170 occupies the intercalation site formed after the structural change of the leucine-intercalation loop required for the catalysis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  17. Crystal structure of the trithorax group protein ASH2L reveals a forkhead-like DNA binding domain

    Energy Technology Data Exchange (ETDEWEB)

    Sarvan, Sabina; Avdic, Vanja; Tremblay, Véronique; Chaturvedi, Chandra-Prakash; Zhang, Pamela; Lanouette, Sylvain; Blais, Alexandre; Brunzelle, Joseph S; Brand, Marjorie; Couture, Jean-François (Ottawa Hosp.); (Ottawa); (NWU)

    2012-05-02

    Absent, small or homeotic discs-like 2 (ASH2L) is a trithorax group (TrxG) protein and a regulatory subunit of the SET1 family of lysine methyltransferases. Here we report that ASH2L binds DNA using a forkhead-like helix-wing-helix (HWH) domain. In vivo, the ASH2L HWH domain is required for binding to the {beta}-globin locus control region, histone H3 Lys4 (H3K4) trimethylation and maximal expression of the {beta}-globin gene (Hbb-1), validating the functional importance of the ASH2L DNA binding domain.

  18. Crystal structure and DNA-binding property of the ATPase domain of bacterial mismatch repair endonuclease MutL from Aquifex aeolicus.

    Science.gov (United States)

    Fukui, Kenji; Iino, Hitoshi; Baba, Seiki; Kumasaka, Takashi; Kuramitsu, Seiki; Yano, Takato

    2017-09-01

    DNA mismatch repair (MMR) system corrects mismatched bases that are generated mainly by DNA replication errors. The repair system excises the error-containing single-stranded region and enables the re-synthesis of the strand. In the early reactions of MMR, MutL endonuclease incises the newly-synthesized/error-containing strand of the duplex to initiate the downstream excision reaction. MutL endonuclease consists of the N-terminal ATPase and C-terminal endonuclease domains. In this study, we report the crystal structure of the ATPase domain of MutL endonuclease from Aquifex aeolicus. The overall structure of the domain was similar to those of human MutL homologs and Escherichia coli MutL, although E. coli MutL has no endonuclease activity. The ATPase domain was comprised of two subdomains: the N-terminal ATP-binding subdomain and the C-terminal α-β sandwich subdomain. Site-directed mutagenesis experiment identified DNA-interacting eight basic amino acid residues, which were distributed across both the two subdomains and formed a DNA-binding cleft. Docking simulation between the structures of the ATPase and endonuclease domains generated a reliable model structure for the full-length A. aeolicus MutL, which satisfies our previous result of small-angle X-ray scattering analysis. On the basis of the model structure and further experimental results, we concluded that the two separate DNA-binding sites in the full-length A. aeolicus MutL simultaneously bind a dsDNA molecule. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites.

    Science.gov (United States)

    Liu, Ce Feng; Brandt, Gabriel S; Hoang, Quyen Q; Naumova, Natalia; Lazarevic, Vanja; Hwang, Eun Sook; Dekker, Job; Glimcher, Laurie H; Ringe, Dagmar; Petsko, Gregory A

    2016-10-25

    The transcription factor T-bet (Tbox protein expressed in T cells) is one of the master regulators of both the innate and adaptive immune responses. It plays a central role in T-cell lineage commitment, where it controls the T H 1 response, and in gene regulation in plasma B-cells and dendritic cells. T-bet is a member of the Tbox family of transcription factors; however, T-bet coordinately regulates the expression of many more genes than other Tbox proteins. A central unresolved question is how T-bet is able to simultaneously recognize distant Tbox binding sites, which may be located thousands of base pairs away. We have determined the crystal structure of the Tbox DNA binding domain (DBD) of T-bet in complex with a palindromic DNA. The structure shows a quaternary structure in which the T-bet dimer has its DNA binding regions splayed far apart, making it impossible for a single dimer to bind both sites of the DNA palindrome. In contrast to most other Tbox proteins, a single T-bet DBD dimer binds simultaneously to identical half-sites on two independent DNA. A fluorescence-based assay confirms that T-bet dimers are able to bring two independent DNA molecules into close juxtaposition. Furthermore, chromosome conformation capture assays confirm that T-bet functions in the direct formation of chromatin loops in vitro and in vivo. The data are consistent with a looping/synapsing model for transcriptional regulation by T-bet in which a single dimer of the transcription factor can recognize and coalesce distinct genetic elements, either a promoter plus a distant regulatory element, or promoters on two different genes.

  20. ST1710?DNA complex crystal structure reveals the DNA binding mechanism of the MarR family of regulators

    OpenAIRE

    Kumarevel, Thirumananseri; Tanaka, Tomoyuki; Umehara, Takashi; Yokoyama, Shigeyuki

    2009-01-01

    ST1710, a member of the multiple antibiotic resistance regulator (MarR) family of regulatory proteins in bacteria and archaea, plays important roles in development of antibiotic resistance, a global health problem. Here, we present the crystal structure of ST1710 from Sulfolobus tokodaii strain 7 complexed with salicylate, a well-known inhibitor of MarR proteins and the ST1710 complex with its promoter DNA, refined to 1.8 and 2.10 ? resolutions, respectively. The ST1710?DNA complex shares the...

  1. Structural insight into the specificity of the B3 DNA-binding domains provided by the co-crystal structure of the C-terminal fragment of BfiI restriction enzyme.

    Science.gov (United States)

    Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus

    2014-04-01

    The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5'-CCTGG-3'). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5'-ACTGGG-3') complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C-DNA and EcoRII-N-DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C-DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs.

  2. Structures of DNA-binding mutant zinc finger domains: implications for DNA binding.

    Science.gov (United States)

    Hoffman, R C; Horvath, S J; Klevit, R E

    1993-06-01

    Studies of Cys2-His2 zinc finger domains have revealed that the structures of individual finger domains in solution determined by NMR spectroscopy are strikingly similar to the structure of fingers bound to DNA determined by X-ray diffraction. Therefore, detailed structural analyses of single finger domains that contain amino acid substitutions known to affect DNA binding in the whole protein can yield information concerning the structural ramifications of such mutations. We have used this approach to study two mutants in the N-terminal finger domain of ADR1, a yeast transcription factor that contains two Cys2-His2 zinc finger sequences spanning residues 102-159. Two point mutants at position 118 in the N-terminal zinc finger (ADR1b: 102-130) that adversely affect the DNA-binding activity of ADR1 have previously been identified: H118A and H118Y. The structures of wild-type ADR1b and the two mutant zinc finger domains were determined using two-dimensional nuclear magnetic resonance spectroscopy and distance geometry and were refined using a complete relaxation matrix method approach (REPENT) to improve agreement between the models and the nuclear Overhauser effect spectroscopy data from which they were generated. The molecular architecture of the refined wild-type ADR1b domain is presented in detail. Comparisons of wild-type ADR1b and the two mutants revealed that neither mutation causes a significant structural perturbation. The structures indicate that the DNA binding properties of the His 118 mutants are dependent on the identity of the side chain at position 118, which has been postulated to make a direct DNA contact in the wild-type ADR1 protein. The results suggest that the identity of the side chain at the middle DNA contact position in Cys2-His2 zinc fingers may be changed with impunity regarding the domain structure and can affect the affinity of the protein-DNA interaction.

  3. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong (Cornell); (NWU)

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  4. Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity.

    Science.gov (United States)

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2011-09-02

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.

  5. Crystal structure of the Deinococcus radiodurans single-stranded DNA-binding protein suggests a mechanism for coping with DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Bernstein, Douglas A.; Eggington, Julie M.; Killoran, Michael P.; Misic, Ana M.; Cox, Michael M.; Keck, James L. (UW)

    2010-11-16

    Single-stranded DNA (ssDNA)-binding (SSB) proteins are uniformly required to bind and protect single-stranded intermediates in DNA metabolic pathways. All bacterial and eukaryotic SSB proteins studied to date oligomerize to assemble four copies of a conserved domain, called an oligonucleotide/oligosaccharide-binding (OB) fold, that cooperate in nonspecific ssDNA binding. The vast majority of bacterial SSB family members function as homotetramers, with each monomer contributing a single OB fold. However, SSB proteins from the Deinococcus-Thermus genera are exceptions to this rule, because they contain two OB folds per monomer. To investigate the structural consequences of this unusual arrangement, we have determined a 1.8-{angstrom}-resolution x-ray structure of Deinococcus radiodurans SSB. The structure shows that D. radiodurans SSB comprises two OB domains linked by a {beta}-hairpin motif. The protein assembles a four-OB-fold arrangement by means of symmetric dimerization. In contrast to homotetrameric SSB proteins, asymmetry exists between the two OB folds of D. radiodurans SSB because of sequence differences between the domains. These differences appear to reflect specialized roles that have evolved for each domain. Extensive crystallographic contacts link D. radiodurans SSB dimers in an arrangement that has important implications for higher-order structures of the protein bound to ssDNA. This assembly utilizes the N-terminal OB domain and the {beta}-hairpin structure that is unique to Deinococcus and Thermus species SSB proteins. We hypothesize that differences between D. radiodurans SSB and homotetrameric bacterial SSB proteins may confer a selective advantage to D. radiodurans cells that aids viability in environments that challenge genomic stability.

  6. Synthesis, characterization, X-ray crystal structure, DFT calculation, DNA binding, and antimicrobial assays of two new mixed-ligand copper(II) complexes

    Science.gov (United States)

    Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Mohamadi, Maryam; Suarez, Sebastian; Baggio, Ricardo; Khaleghi, Moj; Torkzadeh-Mahani, Masoud; Mostafavi, Ali

    2015-05-01

    Two new Cu(II) complexes, [Cu(L)(phen)] (1), [Cu(L)(bipy)] (2), where L2- = (3-methoxy-2oxidobenzylidene)benzohydrazidato, phen = 1,10 phenanthroline, and bipy = 2,2‧ bipyridine, were prepared and fully characterized using elemental analyses, FT-IR, molar conductivity, and electronic spectra. The structures of both complexes were also determined by X-ray diffraction. It was found that, both complexes possessed square pyramidal coordination environment in which, Cu(II) ions were coordinated by donor atoms of HL and two nitrogens of heterocyclic bases. Computational studies were performed using DFT calculations at B3LYP/6-311+G(d,p) level of theory. DNA binding activities of these complexes were also investigated using electronic absorption, competitive fluorescence titration and cyclic voltammetry studies. The obtained results indicated that binding of the complexes to DNA was of intercalative mode. Furthermore, antimicrobial activities of these compounds were screened against microorganisms.

  7. Predicting target DNA sequences of DNA-binding proteins based on unbound structures.

    Directory of Open Access Journals (Sweden)

    Chien-Yu Chen

    Full Text Available DNA-binding proteins such as transcription factors use DNA-binding domains (DBDs to bind to specific sequences in the genome to initiate many important biological functions. Accurate prediction of such target sequences, often represented by position weight matrices (PWMs, is an important step to understand many biological processes. Recent studies have shown that knowledge-based potential functions can be applied on protein-DNA co-crystallized structures to generate PWMs that are considerably consistent with experimental data. However, this success has not been extended to DNA-binding proteins lacking co-crystallized structures. This study aims at investigating the possibility of predicting the DNA sequences bound by DNA-binding proteins from the proteins' unbound structures (structures of the unbound state. Given an unbound query protein and a template complex, the proposed method first employs structure alignment to generate synthetic protein-DNA complexes for the query protein. Once a complex is available, an atomic-level knowledge-based potential function is employed to predict PWMs characterizing the sequences to which the query protein can bind. The evaluation of the proposed method is based on seven DNA-binding proteins, which have structures of both DNA-bound and unbound forms for prediction as well as annotated PWMs for validation. Since this work is the first attempt to predict target sequences of DNA-binding proteins from their unbound structures, three types of structural variations that presumably influence the prediction accuracy were examined and discussed. Based on the analyses conducted in this study, the conformational change of proteins upon binding DNA was shown to be the key factor. This study sheds light on the challenge of predicting the target DNA sequences of a protein lacking co-crystallized structures, which encourages more efforts on the structure alignment-based approaches in addition to docking- and homology

  8. Diorganotin(IV) derivatives of ONO tridentate Schiff base : Synthesis, crystal structure, in vitro antimicrobial, anti-leishmanial and DNA binding studies

    NARCIS (Netherlands)

    Shujha, Shaukat; Shah, Afzal; Zia-ur-Rehman, [No Value; Muhammad, Niaz; Ali, Saqib; Qureshi, Rumana; Khalid, Nasir; Meetsma, Auke

    Six new diorganotin(IV) derivatives of N'-(2-hydroxybenzylidene)formohydrazide (H2L) with general formula R2SnL, where R = Ph (1), Me (2), Bu (3), Oct (4), t-Bu (5), Et (6), and L = [OC6H4CHNNCHO] have been synthesized and characterized by different analytical techniques. Crystal structure of Me2SnL

  9. Synthesis, crystal structures, DNA binding and photoluminescence properties of [Cu(pzta)2Cl]ClṡH2O for DNA detection

    Science.gov (United States)

    Duan, Ran-ran; Wang, Lu; Huo, Wei-qiang; Chen, Shi; Zhou, Xiao-hua

    2014-07-01

    We report here the synthesis of a new copper(II) complex of 2,4-diamino-6-(2‧-pyrazin)-1,3,5-triazine [Cu(pzta)2Cl]Cl·H2O and its characterization using UV and IR spectroscopy, elemental analysis, and X-ray diffraction. Fluorescence spectroscopy revealed that the complex was sensitive to oxygen and to the polarity of nonaqueous solvents. Binding of the complex to DNA was investigated using UV spectroscopy, ethidium bromide displacement from DNA, cyclic voltammetry, and viscometry. The results revealed the DNA binding mode was intercalation together with external static-electricity. However, the complex can be also used to DNA detection as DNA fluorescence probe with a LOD of 4.21 ng mL-1 for the relative wide linear range between 0.2 and 17 μg mL-1. In conclusion, that synthetic method of the complex was easy with low expense and was relatively rapid and sensitive compared to most toxic fluorescence dyes. This finding would indicate the complex may be a potential DNA-targeted probes and optical probes for oxygen-free environments in nonaqueous form.

  10. The meloxicam complexes of Co(II) and Zn(II): Synthesis, crystal structures, photocleavage and in vitro DNA-binding

    Science.gov (United States)

    Sanatkar, Tahereh Hosseinzadeh; Hadadzadeh, Hassan; Simpson, Jim; Jannesari, Zahra

    2013-10-01

    Two neutral mononuclear complexes of Co(II) and Zn(II) with the non-steroidal anti-inflammatory drug meloxicam (H2mel, 4-hydroxy-2-methyl-N-(5-methyl-2-thiazolyl)-2H-1,2-benzothiazine-3-carboxammide-1,1-dioxide), [Co(Hmel)2(EtOH)2] (1), and [Zn(Hmel)2(EtOH)2] (2), were synthesized and characterized by elemental analysis, IR and UV-Vis spectroscopy and their solid-state structures were studied by single-crystal diffraction. The complexes have a distorted octahedral geometry around the metal atom. The experimental data indicate that the meloxicam acts as a deprotonated bidentate ligand (through the amide oxygen and the nitrogen atom of the thiazolyl ring) in the complexes, and a strong intramolecular hydrogen bond between the amide N-H function and the enolate O atom stabilizes the ZZZ conformation of meloxicam ligands. Absorption, fluorescence spectroscopy and cyclic voltammetry have been used to investigate the binding of the complexes with fish sperm DNA (FS-DNA). Additionally, the photocleavage studies have been also used to investigate the binding of the complexes with plasmid DNA. The interaction of the complexes with DNA was monitored by a blue shift and hyperchromism in the UV-Vis spectra attributed to an electrostatic binding mode. A competitive study with ethidium bromide (EB) has shown that the complexes can displace the DNA-bound EB indicating that they bind to DNA in strong competition with EB. The experimental results show that the complexes can cleave pUC57 plasmid DNA.

  11. Study on potential antitumor mechanism of a novel Schiff base copper(II) complex: synthesis, crystal structure, DNA binding, cytotoxicity and apoptosis induction activity.

    Science.gov (United States)

    Qiao, Xin; Ma, Zhong-Ying; Xie, Cheng-Zhi; Xue, Fei; Zhang, Yan-Wen; Xu, Jing-Yuan; Qiang, Zhao-Yan; Lou, Jian-Shi; Chen, Gong-Jun; Yan, Shi-Ping

    2011-05-01

    A new cytotoxic copper(II) complex with Schiff base ligand [Cu(II)(5-Cl-pap)(OAc)(H(2)O)]·2H(2)O (1) (5-Cl-pap=N-2-pyridiylmethylidene-2-hydroxy-5-chloro-phenylamine), was synthesized and structurally characterized by X-ray diffraction. Single-crystal analysis revealed that the copper atom shows a 4+1 pyramidal coordination, a water oxygen appears in the apical position, and three of the basal positions are occupied by the NNO tridentate ligand and the fourth by an acetate oxygen. The interaction of Schiff base copper(II) complex 1 with DNA was investigated by UV-visible spectra, fluorescence spectra and agarose gel electrophoresis. The apparent binding constant (K(app)) value of 6.40×10(5) M(-1) for 1 with DNA suggests moderate intercalative binding mode. This copper(II) complex displayed efficient oxidative cleavage of supercoiled DNA, which might indicate that the underlying mechanism involve hydroxyl radical, singlet oxygen-like species, and hydrogen peroxide as reactive oxygen species. In addition, our present work showed the antitumor effect of 1 on cell cycle and apoptosis. Flow cytometric analysis revealed that HeLa cells were arrested in the S phase after treatment with 1. Fluorescence microscopic observation indicated that complex 1 can induce apoptosis of HeLa cells, whose process was mediated by intrinsic mitochondrial apoptotic pathway owing to the activation of caspase-9 and caspase-3. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    Science.gov (United States)

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  13. DNA binding by the plant-specific NAC transcription factors in crystal and solution

    DEFF Research Database (Denmark)

    Welner, Ditte Hededam; Lindemose, Søren; Grossmann, J. Günter

    2012-01-01

    angle X-ray scattering on complexes with oligonucleotides, mutagenesis and (DNase I and uranyl photo-) footprinting, is combined to form a structural view of DNA-binding, and for the first time provide experimental evidence for the speculated relationship between plant-specific NAC proteins, WRKY....... The structure of the DNA-binding NAC domain of ANAC019 has previously been determined by X-ray crystallography, revealing a dimeric and predominantly ß-fold structure, but the mode of binding to cognate DNA has remained elusive. In the present study, information from low resolution X-ray structures and small...... transcription factors and the mammalian GCM (Glial cell missing) transcription factors, which all use a ß-strand motif for DNA-binding. The structure shows that the NAC domain inserts the edge of its core ß-sheet into the major groove, while leaving the DNA largely undistorted. The structure of the NAC-DNA...

  14. Structure and Cellular Dynamics of Deinococcus radiodurans Single-stranded DNA (ssDNA)-binding Protein (SSB)-DNA Complexes*

    Science.gov (United States)

    George, Nicholas P.; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Norais, Cédric A.; Battista, John R.; Cox, Michael M.; Keck, James L.

    2012-01-01

    The single-stranded DNA (ssDNA)-binding protein from the radiation-resistant bacterium Deinococcus radiodurans (DrSSB) functions as a homodimer in which each monomer contains two oligonucleotide-binding (OB) domains. This arrangement is exceedingly rare among bacterial SSBs, which typically form homotetramers of single-OB domain subunits. To better understand how this unusual structure influences the DNA binding and biological functions of DrSSB in D. radiodurans radiation resistance, we have examined the structure of DrSSB in complex with ssDNA and the DNA damage-dependent cellular dynamics of DrSSB. The x-ray crystal structure of the DrSSB-ssDNA complex shows that ssDNA binds to surfaces of DrSSB that are analogous to those mapped in homotetrameric SSBs, although there are distinct contacts in DrSSB that mediate species-specific ssDNA binding. Observations by electron microscopy reveal two salt-dependent ssDNA-binding modes for DrSSB that strongly resemble those of the homotetrameric Escherichia coli SSB, further supporting a shared overall DNA binding mechanism between the two classes of bacterial SSBs. In vivo, DrSSB levels are heavily induced following exposure to ionizing radiation. This accumulation is accompanied by dramatic time-dependent DrSSB cellular dynamics in which a single nucleoid-centric focus of DrSSB is observed within 1 h of irradiation but is dispersed by 3 h after irradiation. These kinetics parallel those of D. radiodurans postirradiation genome reconstitution, suggesting that DrSSB dynamics could play important organizational roles in DNA repair. PMID:22570477

  15. V-shaped ligand 1,3-bis(1-ethylbenzimidazol-2-yl)-2-thiapropane and manganese(II), cobalt(II) and copper(II) complexes: Synthesis, crystal structure, DNA-binding properties and antioxidant activities.

    Science.gov (United States)

    Wu, Huilu; Yang, Zaihui; Wang, Fei; Peng, Hongping; Zhang, Han; Wang, Cuiping; Wang, Kaitong

    2015-07-01

    A V-shaped ligand 1,3-bis(1-ethylbenzimidazol-2-yl)-2-thiapropane (bebt) and its transition metal complexes, [Mn(bebt)(pic)2]·CH3OH (pic=picrate) 1, [Co(bebt)2](pic)22 and [Cu(bebt)2](pic)2·2DMF 3, have been synthesized and characterized. The coordinate forms of complexes 1 and 2 are basically alike, which can be described as six-coordinated distorted octahedron. The geometric structure around Cu(II) atom can be described as distorted tetrahedral in complex 3. The DNA-binding properties of the ligand bebt and complexes have been investigated by electronic absorption, fluorescence, and viscosity measurements. The results suggest that bebt and complexes bind to DNA via an intercalative binding mode and the order of the binding affinity is 1DNA-binding properties are also discussed. Moreover, the complex 3 possess significant antioxidant activity against superoxide and hydroxyl radicals, and the scavenging effects of it are stronger than standard mannitol and vitamin C. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. 3D structure of Thermus aquaticus single-stranded DNA-binding protein gives insight into the functioning of SSB proteins

    National Research Council Canada - National Science Library

    Fedorov, Roman; Witte, Gregor; Urbanke, Claus; Manstein, Dietmar J; Curth, Ute

    2006-01-01

    .... We solved the crystal structures of the SSB protein from Thermus aquaticus (TaqSSB) and a deletion mutant of the protein and show the structure of their ssDNA binding domains to be similar to the structure of tetrameric SSBs...

  17. Structural basis of DNA recognition by PCG2 reveals a novel DNA binding mode for winged helix-turn-helix domains

    Science.gov (United States)

    Liu, Junfeng; Huang, Jinguang; Zhao, Yanxiang; Liu, Huaian; Wang, Dawei; Yang, Jun; Zhao, Wensheng; Taylor, Ian A.; Peng, You-Liang

    2015-01-01

    The MBP1 family proteins are the DNA binding subunits of MBF cell-cycle transcription factor complexes and contain an N terminal winged helix-turn-helix (wHTH) DNA binding domain (DBD). Although the DNA binding mechanism of MBP1 from Saccharomyces cerevisiae has been extensively studied, the structural framework and the DNA binding mode of other MBP1 family proteins remains to be disclosed. Here, we determined the crystal structure of the DBD of PCG2, the Magnaporthe oryzae orthologue of MBP1, bound to MCB–DNA. The structure revealed that the wing, the 20-loop, helix A and helix B in PCG2–DBD are important elements for DNA binding. Unlike previously characterized wHTH proteins, PCG2–DBD utilizes the wing and helix-B to bind the minor groove and the major groove of the MCB–DNA whilst the 20-loop and helix A interact non-specifically with DNA. Notably, two glutamines Q89 and Q82 within the wing were found to recognize the MCB core CGCG sequence through making hydrogen bond interactions. Further in vitro assays confirmed essential roles of Q89 and Q82 in the DNA binding. These data together indicate that the MBP1 homologue PCG2 employs an unusual mode of binding to target DNA and demonstrate the versatility of wHTH domains. PMID:25550425

  18. Structural characterization of the DNA-binding mechanism underlying the copper(II)-sensing MarR transcriptional regulator.

    Science.gov (United States)

    Zhu, Rongfeng; Hao, Ziyang; Lou, Hubing; Song, Yanqun; Zhao, Jingyi; Chen, Yuqing; Zhu, Jiuhe; Chen, Peng R

    2017-07-01

    Multiple antibiotic resistance regulator (MarR) family proteins are widely conserved transcription factors that control bacterial resistance to antibiotics, environmental stresses, as well as the regulation of virulence determinants. Escherichia coli MarR, the prototype member of this family, has recently been shown to undergo copper(II)-catalyzed inter-dimer disulfide bond formation via a unique cysteine residue (Cys80) residing in its DNA-binding domain. However, despite extensive structural characterization of the MarR family proteins, the structural mechanism for DNA binding of this copper(II)-sensing MarR factor remains elusive. Here, we report the crystal structures of DNA-bound forms of MarR, which revealed a unique, concerted generation of two new helix-loop-helix motifs that facilitated MarR's DNA binding. Structural analysis and electrophoretic mobility shift assays (EMSA) show that the flexibility of Gly116 in the center of helix α5 and the extensive hydrogen-bonding interactions at the N-terminus of helix α1 together assist the reorientation of the wHTH domains and stabilize MarR's DNA-bound conformation.

  19. Structure and DNA binding of alkylation response protein AidB

    Energy Technology Data Exchange (ETDEWEB)

    Bowles, Timothy; Metz, Audrey H.; O' Quin, Jami; Wawrzak, Zdzislaw; Eichman, Brandt F. (Vanderbilt); (NWU)

    2009-01-12

    Exposure of Escherichia coli to alkylating agents activates expression of AidB in addition to DNA repair proteins Ada, AlkA, and AlkB. AidB was recently shown to possess a flavin adenine dinucleotide (FAD) cofactor and to bind to dsDNA, implicating it as a flavin-dependent DNA repair enzyme. However, the molecular mechanism by which AidB acts to reduce the mutagenic effects of specific DNA alkylators is unknown. We present a 1.7-{angstrom} crystal structure of AidB, which bears superficial resemblance to the acyl-CoA dehydrogenase superfamily of flavoproteins. The structure reveals a unique quaternary organization and a distinctive FAD active site that provides a rationale for AidB's limited dehydrogenase activity. A highly electropositive C-terminal domain not present in structural homologs was identified by mutational analysis as the DNA binding site. Structural analysis of the DNA and FAD binding sites provides evidence against AidB-catalyzed DNA repair and supports a model in which AidB acts to prevent alkylation damage by protecting DNA and destroying alkylating agents that have yet to reach their DNA target.

  20. HU histone-like DNA-binding protein from Thermus thermophilus: structural and evolutionary analyses.

    Science.gov (United States)

    Papageorgiou, Anna C; Adam, Panagiotis S; Stavros, Philemon; Nounesis, George; Meijers, Rob; Petratos, Kyriacos; Vorgias, Constantinos E

    2016-09-01

    The histone-like DNA-binding proteins (HU) serve as model molecules for protein thermostability studies, as they function in different bacteria that grow in a wide range of temperatures and show sequence diversity under a common fold. In this work, we report the cloning of the hutth gene from Thermus thermophilus, the purification and crystallization of the recombinant HUTth protein, as well as its X-ray structure determination at 1.7 Å. Detailed structural and thermodynamic analyses were performed towards the understanding of the thermostability mechanism. The interaction of HUTth protein with plasmid DNA in solution has been determined for the first time with MST. Sequence conservation of an exclusively thermophilic order like Thermales, when compared to a predominantly mesophilic order (Deinococcales), should be subject, to some extent, to thermostability-related evolutionary pressure. This hypothesis was used to guide our bioinformatics and evolutionary studies. We discuss the impact of thermostability adaptation on the structure of HU proteins, based on the detailed evolutionary analysis of the Deinococcus-Thermus phylum, where HUTth belongs. Furthermore, we propose a novel method of engineering thermostable proteins, by combining consensus-based design with ancestral sequence reconstruction. Finally, through the structure of HUTth, we are able to examine the validity of these predictions. Our approach represents a significant advancement, as it explores for the first time the potential of ancestral sequence reconstruction in the divergence between a thermophilic and a mainly mesophilic taxon, combined with consensus-based engineering.

  1. Activator Protein-1: redox switch controlling structure and DNA-binding

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Zhou; Machius, Mischa; Nestler, Eric J.; Rudenko, Gabby

    2017-09-07

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a ‘redox switch’ centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the ‘OFF’ state, and show that the mid-point redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins.

  2. DNA binding and cleavage activity of a structurally characterized Ni(II)

    Indian Academy of Sciences (India)

    1375–1381. c Indian Academy of Sciences. DOI 10.1007/s12039-015-0900-4. DNA binding and cleavage activity of a structurally characterized Ni(II). Schiff base complex. SARAT CHANDRA KUMARa, ABHIJIT PALa, MERRY MITRAa,. V M MANIKANDAMATHAVANb, CHIA -HER LINc, BALACHANDRAN UNNI NAIRb,∗.

  3. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  4. Structure and DNA-binding traits of the transition state regulator AbrB.

    Science.gov (United States)

    Olson, Andrew L; Tucker, Ashley T; Bobay, Benjamin G; Soderblom, Erik J; Moseley, M Arthur; Thompson, Richele J; Cavanagh, John

    2014-11-04

    The AbrB protein from Bacillus subtilis is a DNA-binding global regulator controlling the onset of a vast array of protective functions under stressful conditions. Such functions include biofilm formation, antibiotic production, competence development, extracellular enzyme production, motility, and sporulation. AbrB orthologs are known in a variety of prokaryotic organisms, most notably in all infectious strains of Clostridia, Listeria, and Bacilli. Despite its central role in bacterial response and defense, its structure has been elusive because of its highly dynamic character. Orienting its N- and C-terminal domains with respect to one another has been especially problematic. Here, we have generated a structure of full-length, tetrameric AbrB using nuclear magnetic resonance, chemical crosslinking, and mass spectrometry. We note that AbrB possesses a strip of positive electrostatic potential encompassing its DNA-binding region and that its C-terminal domain aids in DNA binding. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. The Structure of DdrB from Deinococcus: a New Fold for Single-stranded DNA Binding Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Sugiman-Marangos, S.; Junop, M

    2010-01-01

    Deinococcus spp. are renowned for their amazing ability to recover rapidly from severe genomic fragmentation as a result of exposure to extreme levels of ionizing radiation or desiccation. Despite having been originally characterized over 50 years ago, the mechanism underlying this remarkable repair process is still poorly understood. Here, we report the 2.8 {angstrom} structure of DdrB, a single-stranded DNA (ssDNA) binding protein unique to Deinococcus spp. that is crucial for recovery following DNA damage. DdrB forms a pentameric ring capable of binding single-stranded but not double-stranded DNA. Unexpectedly, the crystal structure reveals that DdrB comprises a novel fold that is structurally and topologically distinct from all other single-stranded binding (SSB) proteins characterized to date. The need for a unique ssDNA binding function in response to severe damage, suggests a distinct role for DdrB which may encompass not only standard SSB protein function in protection of ssDNA, but also more specialized roles in protein recruitment or DNA architecture maintenance. Possible mechanisms of DdrB action in damage recovery are discussed.

  6. The structural basis for dynamic DNA binding and bridging interactions which condense the bacterial centromere.

    Science.gov (United States)

    Fisher, Gemma Lm; Pastrana, César L; Higman, Victoria A; Koh, Alan; Taylor, James A; Butterer, Annika; Craggs, Timothy; Sobott, Frank; Murray, Heath; Crump, Matthew P; Moreno-Herrero, Fernando; Dillingham, Mark S

    2017-12-15

    The ParB protein forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation. The molecular mechanism underlying the formation of these ParB networks is unclear. We show here that while the central DNA binding domain is essential for anchoring at parS , this interaction is not required for DNA condensation. Structural analysis of the C-terminal domain reveals a dimer with a lysine-rich surface that binds DNA non-specifically and is essential for DNA condensation in vitro. Mutation of either the dimerisation or the DNA binding interface eliminates ParB-GFP foci formation in vivo. Moreover, the free C-terminal domain can rapidly decondense ParB networks independently of its ability to bind DNA. Our work reveals a dual role for the C-terminal domain of ParB as both a DNA binding and bridging interface, and highlights the dynamic nature of ParB networks in Bacillus subtilis .

  7. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    Energy Technology Data Exchange (ETDEWEB)

    Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

  8. Dihydroxo-bridged dimeric Cu(II) system containing sandwiched non-coordinating phenylacetate anion: Crystal structure, spectroscopic, anti-bacterial, anti-fungal and DNA-binding studies of [(phen)(H2O)Cu(OH)2Cu(H2O)(phen)]2L.6H2O: (HL = phenylacetic acid; phen = 1,10-phenanthroline)

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Shah, Naseer Ali

    2017-09-01

    This paper reports the synthesis, X-ray crystal structure, DNA-binding, antibacterial and antifungal studies of a rare dihydroxo-bridged dinuclear copper(II) complex including 1,10-phenanthroline (Phen) ligands and phenylacetate (L) anions, [Cu2(Phen)2(OH)2(H2O)2].2L.6H2O. Structural data revealed distorted square-pyramidal geometry for each copper(II) atom with the basal plane formed by the two nitrogen atoms of the phenantroline ligand and the oxygen atoms of two bridging hydroxyl groups. The apical positions are filled by the oxygen atom from a water molecule. This forms a centrosymmetric cationic dimer where the uncoordinated phenylacetate ligands serve to balance the electrical charge. The dimers interact by means of hydrogen bonds aided by the coordinated as well as uncoordinated water molecules and phenyl-acetate moieties in the crystal lattice. The binding ability of the complex with salmon sperm DNA was determined using cyclic voltammetry and absorption spectroscopy yielding binding constants 2.426 × 104 M-1 and 1.399 × 104 M-1, respectively. The complex was screened against two Gram-positive (Micrococcus luteus and Bacillus subtilis) and one Gram-negative (Escherichia coli) bacterial strains exhibiting significant activity against all the three strains. The complex exhibited significant, moderate and no activity against fungal strains Mucor piriformis, Helminthosporium solani and Aspergillus Niger, respectively. These preliminary tests indicate the competence of the complex towards the development of a potent biological drug.

  9. Solution structure and DNA binding of the zinc-finger domain from DNA ligase IIIalpha.

    Science.gov (United States)

    Kulczyk, Arkadiusz W; Yang, Ji-Chun; Neuhaus, David

    2004-08-13

    DNA ligase IIIalpha carries out the final ligation step in the base excision repair (BER) and single strand break repair (SSBR) mechanisms of DNA repair. The enzyme recognises single-strand nicks and other damage features in double-stranded DNA, both through the catalytic domain and an N-terminal domain containing a single zinc finger. The latter is homologous to other zinc fingers that recognise damaged DNA, two in the N terminus of poly(adenosine-ribose)polymerase and three in the N terminus of the Arabidopsis thaliana nick-sensing DNA 3'-phosphoesterase. Here, we present the solution structure of the zinc-finger domain of human DNA ligase IIIalpha, the first structure of a finger from this group. It is related to that of the erythroid transcription factor GATA-1, but has an additional N-terminal beta-strand and C-terminal alpha-helix. Chemical shift mapping using a DNA ligand containing a single-stranded break showed that the DNA-binding surface of the DNA-ligase IIIalpha zinc finger is substantially different from that of GATA-1, consistent with the fact that the two proteins recognise very different features in the DNA. Likely implications for DNA binding are discussed.

  10. Synthesis, characterization, crystal structure and DNA-binding study ...

    Indian Academy of Sciences (India)

    BOLIN

    (London: John Wiley) p.207. Lippert E, Luder W and Boos H 1962 In Advances in Molecular Spectroscopy A. Mangini (Ed.) (Oxford: Pergamon) p.443. Conference Proceedings. Author name(s), Year, Conference name, Conference dates, (Place name, City,. Country) page number. Thesis. Author name, Year, Title of thesis, ...

  11. Synthesis, characterization, crystal structure and DNA-binding study ...

    Indian Academy of Sciences (India)

    Treatment of perchlorate or nitrate salt of cadmium(II) with carboxamide derivatives (L) generated four novel mononuclear metal complexes, represented as [Cd(L)₄](ClO₄)₂ (1a and 1b) and [Cd(L)₂(ONO₂)₂] (2a and 2b) in appreciable yields (L = L¹ = N-(furan-2-ylmethyl)-2-pyridine carboxamide and L = L² ...

  12. Structural insights into single-stranded DNA binding and cleavage by F factor TraI.

    Science.gov (United States)

    Datta, Saumen; Larkin, Chris; Schildbach, Joel F

    2003-11-01

    Conjugative plasmid transfer between bacteria disseminates antibiotic resistance and diversifies prokaryotic genomes. Relaxases, proteins essential for conjugation, cleave one plasmid strand sequence specifically prior to transfer. Cleavage occurs through a Mg(2+)-dependent transesterification involving a tyrosyl hydroxyl and a DNA phosphate. The structure of the F plasmid TraI relaxase domain, described here, is a five-strand beta sheet flanked by alpha helices. The protein resembles replication initiator protein AAV-5 Rep but is circularly permuted, yielding a different topology. The beta sheet forms a binding cleft lined with neutral, nonaromatic residues, unlike most single-stranded DNA binding proteins which use aromatic and charged residues. The cleft contains depressions, suggesting base recognition occurs in a knob-into-hole fashion. Unlike most nucleases, three histidines but no acidic residues coordinate a Mg(2+) located near the catalytic tyrosine. The full positive charge on the Mg(2+) and the architecture of the active site suggest multiple roles for Mg(2+) in DNA cleavage.

  13. A Structural Analysis of DNA Binding by Myelin Transcription Factor 1 Double Zinc Fingers*

    Science.gov (United States)

    Gamsjaeger, Roland; O'Connell, Mitchell R.; Cubeddu, Liza; Shepherd, Nicholas E.; Lowry, Jason A.; Kwan, Ann H.; Vandevenne, Marylene; Swanton, Michael K.; Matthews, Jacqueline M.; Mackay, Joel P.

    2013-01-01

    Myelin transcription factor 1 (MyT1/NZF2), a member of the neural zinc-finger (NZF) protein family, is a transcription factor that plays a central role in the developing central nervous system. It has also recently been shown that, in combination with two other transcription factors, the highly similar paralog MyT1L is able to direct the differentiation of murine and human stem cells into functional neurons. MyT1 contains seven zinc fingers (ZFs) that are highly conserved throughout the protein and throughout the NZF family. We recently presented a model for the interaction of the fifth ZF of MyT1 with a DNA sequence derived from the promoter of the retinoic acid receptor (RARE) gene. Here, we have used NMR spectroscopy, in combination with surface plasmon resonance and data-driven molecular docking, to delineate the mechanism of DNA binding for double ZF polypeptides derived from MyT1. Our data indicate that a two-ZF unit interacts with the major groove of the entire RARE motif and that both fingers bind in an identical manner and with overall two-fold rotational symmetry, consistent with the palindromic nature of the target DNA. Several key residues located in one of the irregular loops of the ZFs are utilized to achieve specific binding. Analysis of the human and mouse genomes based on our structural data reveals three putative MyT1 target genes involved in neuronal development. PMID:24097990

  14. Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

    Science.gov (United States)

    Chen, Chen; Gorlatova, Natalia; Kelman, Zvi; Herzberg, Osnat

    2011-04-19

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

  15. Structure of a Novel DNA-binding Domain of Helicase-like Transcription Factor (HLTF) and Its Functional Implication in DNA Damage Tolerance.

    Science.gov (United States)

    Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi

    2015-05-22

    HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Relationship of structure and function of DNA-binding domain in vitamin D receptor.

    Science.gov (United States)

    Wan, Lin-Yan; Zhang, Yan-Qiong; Chen, Meng-Di; Liu, Chang-Bai; Wu, Jiang-Feng

    2015-07-07

    While the structure of the DNA-binding domain (DBD) of the vitamin D receptor (VDR) has been determined in great detail, the roles of its domains and how to bind the motif of its target genes are still under debate. The VDR DBD consists of two zinc finger modules and a C-terminal extension (CTE), at the end of the C-terminal of each structure presenting α-helix. For the first zinc finger structure, N37 and S-box take part in forming a dimer with 9-cis retinoid X receptor (RXR), while V26, R50, P-box and S-box participate in binding with VDR response elements (VDRE). For the second zinc finger structure, P61, F62 and H75 are essential in the structure of the VDR homodimer with the residues N37, E92 and F93 of the downstream of partner VDR, which form the inter-DBD interface. T-box of the CTE, especially the F93 and I94, plays a critical role in heterodimerization and heterodimers-VDRE binding. Six essential residues (R102, K103, M106, I107, K109, and R110) of the CTE α-helix of VDR construct one interaction face, which packs against the DBD core of the adjacent symmetry mate. In 1,25(OH)2D3-activated signaling, the VDR-RXR heterodimer may bind to DR3-type VDRE and ER9-type VDREs of its target gene directly resulting in transactivation and also bind to DR3-liked nVDRE of its target gene directly resulting in transrepression. Except for this, 1α,25(OH)2D3 ligand VDR-RXR may bind to 1αnVDRE indirectly through VDIR, resulting in transrepression of the target gene. Upon binding of 1α,25(OH)2D3, VDR can transactivate and transrepress its target genes depending on the DNA motif that DBD binds.

  17. Relationship of Structure and Function of DNA-Binding Domain in Vitamin D Receptor

    Directory of Open Access Journals (Sweden)

    Lin-Yan Wan

    2015-07-01

    Full Text Available While the structure of the DNA-binding domain (DBD of the vitamin D receptor (VDR has been determined in great detail, the roles of its domains and how to bind the motif of its target genes are still under debate. The VDR DBD consists of two zinc finger modules and a C-terminal extension (CTE, at the end of the C-terminal of each structure presenting α-helix. For the first zinc finger structure, N37 and S-box take part in forming a dimer with 9-cis retinoid X receptor (RXR, while V26, R50, P-box and S-box participate in binding with VDR response elements (VDRE. For the second zinc finger structure, P61, F62 and H75 are essential in the structure of the VDR homodimer with the residues N37, E92 and F93 of the downstream of partner VDR, which form the inter-DBD interface. T-box of the CTE, especially the F93 and I94, plays a critical role in heterodimerization and heterodimers–VDRE binding. Six essential residues (R102, K103, M106, I107, K109, and R110 of the CTE α-helix of VDR construct one interaction face, which packs against the DBD core of the adjacent symmetry mate. In 1,25(OH2D3-activated signaling, the VDR-RXR heterodimer may bind to DR3-type VDRE and ER9-type VDREs of its target gene directly resulting in transactivation and also bind to DR3-liked nVDRE of its target gene directly resulting in transrepression. Except for this, 1α,25(OH2D3 ligand VDR-RXR may bind to 1αnVDRE indirectly through VDIR, resulting in transrepression of the target gene. Upon binding of 1α,25(OH2D3, VDR can transactivate and transrepress its target genes depending on the DNA motif that DBD binds.

  18. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    Science.gov (United States)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

  19. Structural modeling and DNA binding autoinhibition analysis of Ergp55, a critical transcription factor in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Shanti P Gangwar

    Full Text Available BACKGROUND: The Ergp55 protein belongs to Ets family of transcription factor. The Ets proteins are highly conserved in their DNA binding domain and involved in various development processes and regulation of cancer metabolism. To study the structure and DNA binding autoinhibition mechanism of Ergp55 protein, we have produced full length and smaller polypeptides of Ergp55 protein in E. coli and characterized using various biophysical techniques. RESULTS: The Ergp55 polypeptides contain large amount of α-helix and random coil structures as measured by circular dichorism spectroscopy. The full length Ergp55 forms a flexible and elongated molecule as revealed by molecular modeling, dynamics simulation and structural prediction algorithms. The binding analyses of Ergp55 polypeptides with target DNA sequences of E74 and cfos promoters indicate that longer fragments of Ergp55 (beyond the Ets domain showed the evidence of auto-inhibition. This study also revealed the parts of Ergp55 protein that mediate auto-inhibition. SIGNIFICANCE: The current study will aid in designing the compounds that stabilize the inhibited form of Ergp55 and inhibit its binding to promoter DNA. It will contribute in the development of drugs targeting Ergp55 for the prostate cancer treatment.

  20. A Comparative Structure/Function Analysis of Two Type IV Pilin DNA Receptors Defines a Novel Mode of DNA Binding.

    Science.gov (United States)

    Berry, Jamie-Lee; Xu, Yingqi; Ward, Philip N; Lea, Susan M; Matthews, Stephen J; Pelicic, Vladimir

    2016-06-07

    DNA transformation is a widespread process allowing bacteria to capture free DNA by using filamentous nano-machines composed of type IV pilins. These proteins can act as DNA receptors as demonstrated by the finding that Neisseria meningitidis ComP minor pilin has intrinsic DNA-binding ability. ComP binds DNA better when it contains the DNA-uptake sequence (DUS) motif abundant in this species genome, playing a role in its trademark ability to selectively take up its own DNA. Here, we report high-resolution structures for meningococcal ComP and Neisseria subflava ComPsub, which recognize different DUS motifs. We show that they are structurally identical type IV pilins that pack readily into filament models and display a unique DD region delimited by two disulfide bonds. Functional analysis of ComPsub defines a new mode of DNA binding involving the DD region, adapted for exported DNA receptors. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  1. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors

    Science.gov (United States)

    He, Gaofei; Tolic, Ana; Bashkin, James K.; Poon, Gregory M. K.

    2015-01-01

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs’ binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs. PMID:25824951

  2. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.; Swiderska, A.; McGeehan, J. E.; Kneale, G. G., E-mail: geoff.kneale@port.ac.uk [University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)

    2015-02-01

    The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class of controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.

  3. Structure elucidation and DNA binding specificity of natural compounds from Cassia siamea leaves: A biophysical approach.

    Science.gov (United States)

    Parveen, Mehtab; Ahmad, Faheem; Malla, Ali Mohammed; Khan, Mohd Sohrab; Rehman, Sayeed Ur; Tabish, Mohammad; Silva, Manuela Ramos; Silva, P S Pereira

    2016-06-01

    A novel isoflavone, 5,6,7-trimethoxy-3-(3',4',5'-trimethoxyphenyl)-4H-chromen-4-one (1) along with a known pyranocoumarin, Seselin (2) have been isolated from the ethanolic extract of the leaves of Cassia siamea (Family: Fabaceae). Compound 1 has been reported for the first time from any natural source and has not been synthesized so far. Their structures were elucidated on the basis of chemical and physical evidences viz. elemental analysis, UV, FT-IR, (1)H-NMR, (13)C-NMR and mass spectral analysis. Structure of compound (1) was further authenticated by single-crystal X-ray analysis and density functional theory (DFT) calculations. A multi-technique approach employing UV-Visible spectroscopy, fluorescence, KI quenching studies, competitive displacement assay, circular dichroism and viscosity studies have been utilized to probe the extent of interaction and possible binding modes of isolated compounds (1-2) with calf thymus DNA (CT-DNA). Both the compounds were found to interact with DNA via non-intercalative binding mode with moderate proficiencies. Groove binding was the major interaction mode in the case of compound 2 while compound 1 probably interacts with DNA through electrostatic interactions. These studies provide deeper insight in understanding of DNA-drug (natural products) interaction which could be helpful to improve their bioavailability for therapeutic purposes. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Synthesis, structural characterization, cytotoxic properties and DNA binding of a dinuclear copper(II) complex.

    Science.gov (United States)

    Ferreira, B J M Leite; Brandão, P; Meireles, M; Martel, Fátima; Correia-Branco, Ana; Fernandes, Diana M; Santos, T M; Félix, V

    2016-08-01

    In this study a novel dinuclear copper(II) complex with adenine and phenanthroline has been synthesized and its structure determined by single crystal X-ray diffraction. In the dinuclear complex [Cu₂(μ-adenine)₂(phen)₂(H2O)2](NO3)4·0.5H2O (phen=1,10-phenanthroline) (1) the two Cu(II) centres exhibit a distorted square pyramidal coordination geometry linked by two nitrogen donors from adenine bridges leading to a Cu-Cu distance of 3.242(3)Å. Intramolecular and intermolecular π⋯π interactions as well as an H-bonding network were observed. The antitumor capacity of the complex has been tested in vitro against human cancer cell lines, cervical carcinoma (HeLa) and colorectal adenocarcinoma (Caco-2), by metabolic tests, using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide as reagent. The complex 1 has remarkable low IC50 values of 0.87±0.06μM (HeLa) and 0.44±0.06μM (Caco-2), when compared with values for cisplatin against the same cell lines. The interaction of complex 1 with calf thymus DNA (CT DNA) was further investigated by absorption and fluorescence spectroscopic methods. A binding constant of 5.09×10(5)M(-1) was obtained from UV-vis absorption studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Solution structure and DNA-binding properties of the winged helix domain of the meiotic recombination HOP2 protein.

    Science.gov (United States)

    Moktan, Hem; Guiraldelli, Michel F; Eyster, Craig A; Zhao, Weixing; Lee, Chih-Ying; Mather, Timothy; Camerini-Otero, R Daniel; Sung, Patrick; Zhou, Donghua H; Pezza, Roberto J

    2014-05-23

    The HOP2 protein is required for efficient double-strand break repair which ensures the proper synapsis of homologous chromosomes and normal meiotic progression. We previously showed that in vitro HOP2 shows two distinctive activities: when it is incorporated into a HOP2-MND1 heterodimer, it stimulates DMC1 and RAD51 recombination activities, and the purified HOP2 alone is proficient in promoting strand invasion. The structural and biochemical basis of HOP2 action in recombination are poorly understood; therefore, they are the focus of this work. Herein, we present the solution structure of the amino-terminal portion of mouse HOP2, which contains a typical winged helix DNA-binding domain. Together with NMR spectral changes in the presence of double-stranded DNA, protein docking on DNA, and mutation analysis to identify the amino acids involved in DNA coordination, our results on the three-dimensional structure of HOP2 provide key information on the fundamental structural and biochemical requirements directing the interaction of HOP2 with DNA. These results, in combination with mutational experiments showing the role of a coiled-coil structural feature involved in HOP2 self-association, allow us to explain important aspects of the function of HOP2 in recombination. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Effect of pH on the Structure and DNA Binding of the FOXP2 Forkhead Domain.

    Science.gov (United States)

    Blane, Ashleigh; Fanucchi, Sylvia

    2015-06-30

    Forkhead box P2 (FOXP2) is a transcription factor expressed in cardiovascular, intestinal, and neural tissues during embryonic development and is implicated in language development. FOXP2 like other FOX proteins contains a DNA binding domain known as the forkhead domain (FHD). The FHD interacts with DNA by inserting helix 3 into the major groove. One of these DNA-protein interactions is a direct hydrogen bond that is formed with His554. FOXP2 is localized in the nuclear compartment that has a pH of 7.5. Histidine contains an imidazole side chain in which the amino group typically has a pKa of ~6.5. It seems possible that pH fluctuations around 6.5 may result in changes in the protonation state of His554 and thus the ability of the FOXP2 FHD to bind DNA. To investigate the effect of pH on the FHD, both the structure and the binding affinity were studied in the pH range of 5-9. This was done in the presence and absence of DNA. The structure was assessed using size exclusion chromatography, far-UV circular dichroism, and intrinsic and extrinsic fluorescence. The results indicated that while pH did not affect the secondary structure in the presence or absence of DNA, the tertiary structure was pH sensitive and the protein was less compact at low pH. Furthermore, the presence of DNA caused the protein to become more compact at low pH and also had the potential to increase the dimerization propensity. Fluorescence anisotropy was used to investigate the effect of pH on the FOXP2 FHD DNA binding affinity. It was found that pH had a direct effect on binding affinity. This was attributed to the altered hydrogen bonding patterns upon protonation or deprotonation of His554. These results could implicate pH as a means of regulating transcription by the FOXP2 FHD, which may also have repercussions for the behavior of this protein in cancer cells.

  7. DNABind: a hybrid algorithm for structure-based prediction of DNA-binding residues by combining machine learning- and template-based approaches.

    Science.gov (United States)

    Liu, Rong; Hu, Jianjun

    2013-11-01

    Accurate prediction of DNA-binding residues has become a problem of increasing importance in structural bioinformatics. Here, we presented DNABind, a novel hybrid algorithm for identifying these crucial residues by exploiting the complementarity between machine learning- and template-based methods. Our machine learning-based method was based on the probabilistic combination of a structure-based and a sequence-based predictor, both of which were implemented using support vector machines algorithms. The former included our well-designed structural features, such as solvent accessibility, local geometry, topological features, and relative positions, which can effectively quantify the difference between DNA-binding and nonbinding residues. The latter combined evolutionary conservation features with three other sequence attributes. Our template-based method depended on structural alignment and utilized the template structure from known protein-DNA complexes to infer DNA-binding residues. We showed that the template method had excellent performance when reliable templates were found for the query proteins but tended to be strongly influenced by the template quality as well as the conformational changes upon DNA binding. In contrast, the machine learning approach yielded better performance when high-quality templates were not available (about 1/3 cases in our dataset) or the query protein was subject to intensive transformation changes upon DNA binding. Our extensive experiments indicated that the hybrid approach can distinctly improve the performance of the individual methods for both bound and unbound structures. DNABind also significantly outperformed the state-of-art algorithms by around 10% in terms of Matthews's correlation coefficient. The proposed methodology could also have wide application in various protein functional site annotations. DNABind is freely available at http://mleg.cse.sc.edu/DNABind/. Copyright © 2013 Wiley Periodicals, Inc.

  8. New Bioactive Heteroleptic Copper(II) Carboxylates: Structure, Enzymatic and DNA-Binding Studies.

    Science.gov (United States)

    Mushtaq, Afifa; Ali, Saqib; Tahir, Muhammad; Ismail, Hammad; Mirza, Bushra; Saadiq, Muhammad; Haleem, Muhammad; Iqbal, Muhammad

    2017-06-01

    Two new binuclear O-bridged copper(II) carboxylates with chemical formulas [Cu2(3-ClC6H4CH2COO)4(phen)2] (1) and [Cu2(3-ClC6H4CH2COO)4(bipy)2] (2) where phen = 1,10-phenanthroline and bipy = 2,2'-bipyridine have been synthesized and characterized by FT-IR, UV-Visible spectroscopy, CHN analysis and single crystal XRD. The results revealed distorted square pyramidal geometry around each copper atom of 1 and 2. The DNA interaction studies showed strong binding with Kb = 5.07 × 103 and 4.62 × 103 M-1 for 1 and 2, respectively. Both complexes showed strong enzyme inhibition, i.e., 70% and 90% for α-glucosidase with IC50 = 34.6 and 30.1 μM for 1 and 2, respectively, where acarbose was employed as control. However, both the complexes were found inactive against α-amylase. Using galantamine hydrobromide as control, 1 showed moderate inhibition activity (47%) with IC50 = 179.4 μM for acetylcholine esterase whereas 2 showed strong inhibition activity (76%) with IC50 = 95.8 μM for butyrylcholine esterase. The data reflects active anti-diabetic and anti-Alzheimer's nature of the synthesized complexes.

  9. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    Science.gov (United States)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  10. An FTIR investigation of flanking sequence effects on the structure and flexibility of DNA binding sites.

    Science.gov (United States)

    Kahn, Talia R; Fong, Kimberly K; Jordan, Brian; Lek, Janista C; Levitan, Rachel; Mitchell, Patrick S; Wood, Corrina; Hatcher, Mary E

    2009-02-17

    Fourier transform infrared (FTIR) spectroscopy and a library of FTIR marker bands have been used to examine the structure and relative flexibilities conferred by different flanking sequences on the EcoRI binding site. This approach allowed us to examine unique peaks and subtle changes in the spectra of d(AAAGAATTCTTT)(2), d(TTCGAATTCGAA)(2), and d(CGCGAATTCGCG)(2) and thereby identify local changes in base pairing, base stacking, backbone conformation, glycosidic bond rotation, and sugar puckering in the studied sequences. The changes in flanking sequences induce differences in the sugar puckers, glycosidic bond rotation, and backbone conformations. Varying levels of local flexibility are observed within the sequences in agreement with previous biological activity assays. The results also provide supporting evidence for the presence of a splay in the G(4)-C(9) base pair of the EcoRI binding site and a potential pocket of flexibility at the G(4) cleavage site that have been proposed in the literature. In sum, we have demonstrated that FTIR is a powerful methodology for studying the effect of flanking sequences on DNA structure and flexibility, for it can provide information about the local structure of the nucleic acid and the overall relative flexibilities conferred by different flanking sequences.

  11. Synthesis, structure, DFT calculations, electrochemistry, fluorescence, DNA binding and molecular docking aspects of a novel oxime based ligand and its palladium(II) complex.

    Science.gov (United States)

    Bandyopadhyay, Nirmalya; Pradhan, Ankur Bikash; Das, Suman; Lu, Liping; Zhu, Miaoli; Chowdhury, Shubhamoy; Naskar, Jnan Prakash

    2016-07-01

    A novel oxime based ligand, phenyl-(pyridine-2-yl-hydrazono)-acetaldehyde oxime (LH), and its palladium(II) complex (1) have been synthesised and spectroscopically characterised. The ligand crystallizes in the monoclinic space group (P21/c). The X-ray crystal structure of the ligand shows that it forms a hydrogen bonded helical network. The ligand has been characterised by C, H and N microanalyses, (1)H and (13)C NMR, ESI-MS, FT-IR and UV-Vis spectral measurements. Geometry optimizations at the level of DFT show that the Pd(II) centre is nested in a square-planar 'N3Cl' coordination chromophore. The diamagnetic palladium complex has been characterised by C, H and N microanalyses, FAB-MS, FT-IR, UV-Vis spectra and molar electrical conductivity measurements. The observed electronic spectrum of 1 correlates with our theoretical findings as evaluated through TD-DFT. 1 displays quasi-reversible Pd(II)/Pd(III) and Pd(III)/Pd(IV) redox couples in its CV in acetonitrile. 1 is nine-fold more emissive with respect to the binding ligand. Biophysical studies have been carried out to show the DNA binding aspects of both the ligand and complex. The binding constants for the ligand and complex were found to be 3.93×10(4) and 1.38×10(3)M(-1) respectively. To have an insight into the mode of binding of LH and 1 with CT DNA a hydrodynamic study was also undertaken. The mode of binding has also been substantiated through molecular docking. A promising groove binding efficacy has been revealed for the ligand. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Zinc (II) complexes of carboxamide derivatives: Crystal structures ...

    Indian Academy of Sciences (India)

    The two complexes were characterized by physicochemical and spectroscopic tools, and by X-ray crystal structures of both ligands and the complex 1. In complex 1, zinc(II) is chelated by three ligands with a distorted octahedral geometry. The DNA-binding properties of zinc complexes 1 and 2 have been investigated by ...

  13. Solution structure of the Arabidopsis thaliana telomeric repeat-binding protein DNA binding domain: a new fold with an additional C-terminal helix.

    Science.gov (United States)

    Sue, Shih-Che; Hsiao, Hsin-Hao; Chung, Ben C-P; Cheng, Ying-Hsien; Hsueh, Kuang-Lung; Chen, Chung Mong; Ho, Chia Hsing; Huang, Tai-Huang

    2006-02-10

    The double-stranded telomeric repeat-binding protein (TRP) AtTRP1 is isolated from Arabidopsis thaliana. Using gel retardation assays, we defined the C-terminal 97 amino acid residues, Gln464 to Val560 (AtTRP1(464-560)), as the minimal structured telomeric repeat-binding domain. This region contains a typical Myb DNA-binding motif and a C-terminal extension of 40 amino acid residues. The monomeric AtTRP1(464-560) binds to a 13-mer DNA duplex containing a single repeat of an A.thaliana telomeric DNA sequence (GGTTTAG) in a 1:1 complex, with a K(D) approximately 10(-6)-10(-7) M. Nuclear magnetic resonance (NMR) examination revealed that the solution structure of AtTRP1(464-560) is a novel four-helix tetrahedron rather than the three-helix bundle structure found in typical Myb motifs and other TRPs. Binding of the 13-mer DNA duplex to AtTRP1(464-560) induced significant chemical shift perturbations of protein amide resonances, which suggests that helix 3 (H3) and the flexible loop connecting H3 and H4 are essential for telomeric DNA sequence recognition. Furthermore, similar to that in hTRF1, the N-terminal arm likely contributes to or stabilizes DNA binding. Sequence comparisons suggested that the four-helix structure and the involvement of the loop residues in DNA binding may be features unique to plant TRPs.

  14. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    Science.gov (United States)

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  15. Structural and Dynamics Studies of Pax5 Reveal Asymmetry in Stability and DNA Binding by the Paired Domain.

    Science.gov (United States)

    Perez-Borrajero, Cecilia; Okon, Mark; McIntosh, Lawrence P

    2016-06-05

    The eukaryotic transcription factor Pax5 or B-cell specific activator protein (BSAP) is central to B-cell development and has been implicated in a large number of cellular malignancies resulting from loss- or gain-of-function mutations. In this study, we characterized the DNA-binding Paired domain (PD) of Pax5 in its free and DNA-bound forms using NMR spectroscopy. In isolation, the PD folds as two independent helical bundle subdomains separated by a conformationally disordered linker. The two subdomains differ in stability, with the C-terminal subdomain (CTD) being ~10-fold more protected from amide hydrogen exchange (HX) than the N-terminal subdomain (NTD). Upon binding DNA, the linker and an induced N-terminal β-hairpin become ordered with significantly dampened motions and increased HX protection. Both subdomains of the PD contribute to specific DNA binding, resulting in an equilibrium dissociation constant more than three orders of magnitude lower than exhibited by the separate subdomains for their respective half-sites (nM versus μM). The isolated CTD binds non-specific DNA sequences with only ~10-fold weaker affinity than cognate sequences. In contrast, the NTD associates very poorly with non-specific DNA. We propose that the more stable CTD has evolved to provide relatively low affinity non-specific contacts with DNA. In contrast, the more dynamic NTD discriminates between cognate and non-specific sites. The distinct roles of the PD subdomains may enable efficient searching of genomic DNA by Pax5 while retaining specificity for functional regulatory sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Structure of the DNA-binding and RNA-polymerase-binding region of transcription antitermination factor λQ.

    Science.gov (United States)

    Vorobiev, Sergey M; Gensler, Yocheved; Vahedian-Movahed, Hanif; Seetharaman, Jayaraman; Su, Min; Huang, Janet Y; Xiao, Rong; Kornhaber, Gregory; Montelione, Gaetano T; Tong, Liang; Ebright, Richard H; Nickels, Bryce E

    2014-03-04

    The bacteriophage λ Q protein is a transcription antitermination factor that controls expression of the phage late genes as a stable component of the transcription elongation complex. To join the elongation complex, λQ binds a specific DNA sequence element and interacts with RNA polymerase that is paused during early elongation. λQ binds to the paused early-elongation complex through interactions between λQ and two regions of RNA polymerase: region 4 of the σ(70) subunit and the flap region of the β subunit. We present the 2.1 Å resolution crystal structure of a portion of λQ containing determinants for interaction with DNA, interaction with region 4 of σ(70), and interaction with the β flap. The structure provides a framework for interpreting prior genetic and biochemical analysis and sets the stage for future structural studies to elucidate the mechanism by which λQ alters the functional properties of the transcription elongation complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Embryonic neural inducing factor churchill is not a DNA-binding zinc finger protein: solution structure reveals a solvent-exposed beta-sheet and zinc binuclear cluster.

    Science.gov (United States)

    Lee, Brian M; Buck-Koehntop, Bethany A; Martinez-Yamout, Maria A; Dyson, H Jane; Wright, Peter E

    2007-08-31

    Churchill is a zinc-containing protein that is involved in neural induction during embryogenesis. At the time of its discovery, it was thought on the basis of sequence alignment to contain two zinc fingers of the C4 type. Further, binding of an N-terminal GST-Churchill fusion protein to a particular DNA sequence was demonstrated by immunoprecipitation selection assay, suggesting that Churchill may function as a transcriptional regulator by sequence-specific DNA binding. We show by NMR solution structure determination that, far from containing canonical C4 zinc fingers, the protein contains three bound zinc ions in novel coordination sites, including an unusual binuclear zinc cluster. The secondary structure of Churchill is also unusual, consisting of a highly solvent-exposed single-layer beta-sheet. Hydrogen-deuterium exchange and backbone relaxation measurements reveal that Churchill is unusually dynamic on a number of time scales, with the exception of regions surrounding the zinc coordinating sites, which serve to stabilize the otherwise unstructured N terminus and the single-layer beta-sheet. No binding of Churchill to the previously identified DNA sequence could be detected, and extensive searches using DNA sequence selection techniques could find no other DNA sequence that was bound by Churchill. Since the N-terminal amino acids of Churchill form part of the zinc-binding motif, the addition of a fusion protein at the N terminus causes loss of zinc and unfolding of Churchill. This observation most likely explains the published DNA-binding results, which would arise due to non-specific interaction of the unfolded protein in the immunoprecipitation selection assay. Since Churchill does not appear to bind DNA, we suggest that it may function in embryogenesis as a protein-interaction factor.

  20. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    activity, anti-cancer and anti-microbial activities.9 12. The design of small complexes that bind and react with DNA is one of the interesting activities of bioinor- ganic chemist. Hence it is important to investigate more efficient drugs that target DNA. In recent years,13 15 there is some interest towards synthesis, DNA interac-.

  1. Structure of the Mtb CarD/RNAP β-lobes complex reveals the molecular basis of interaction and presents a distinct DNA-binding domain for Mtb CarD.

    Science.gov (United States)

    Gulten, Gulcin; Sacchettini, James C

    2013-10-08

    CarD from Mycobacterium tuberculosis (Mtb) is an essential protein shown to be involved in stringent response through downregulation of rRNA and ribosomal protein genes. CarD interacts with the β-subunit of RNAP and this interaction is vital for Mtb's survival during the persistent infection state. We have determined the crystal structure of CarD in complex with the RNAP β-subunit β1 and β2 domains at 2.1 Å resolution. The structure reveals the molecular basis of CarD/RNAP interaction, providing a basis to further our understanding of RNAP regulation by CarD. The structural fold of the CarD N-terminal domain is conserved in RNAP interacting proteins such as TRCF-RID and CdnL, and displays similar interactions to the predicted homology model based on the TRCF/RNAP β1 structure. Interestingly, the structure of the C-terminal domain, which is required for complete CarD function in vivo, represents a distinct DNA-binding fold. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Structure of the Mtb CarD/RNAP β-lobes complex reveals the molecular basis of interaction, and presents a novel DNA binding domain for Mtb CarD

    Science.gov (United States)

    Gulten, Gulcin; Sacchettini, James C.

    2013-01-01

    SUMMARY CarD from Mycobacterium tuberculosis (Mtb) is an essential protein thought to be involved in stringent response through downregulation of rRNA and ribosomal protein genes. CarD interacts with the β-subunit of RNAP and this interaction is vital for Mtb’s survival during the persistent infection state. We have determined the crystal structure of CarD in complex with the RNAP β-subunit β1 and β2 domains at 2.1 Å resolution. The structure reveals the molecular basis of CarD/RNAP interaction, providing a basis to further our understanding of RNAP regulation by CarD. The structural fold of the CarD N-terminal domain is conserved in RNAP interacting proteins such as TRCF-RID and CdnL, and displays similar interactions to the predicted homology model based on the TRCF/RNAP β1 structure. Interestingly, the structure of the C-terminal domain, which is required for complete CarD function in vivo, represents a novel DNA binding fold. PMID:24055315

  3. Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane.

    Science.gov (United States)

    Ye, Q; Worman, H J

    1994-04-15

    We have determined the primary structure of human LBR, an integral protein of the nuclear envelope inner membrane, and examined its interactions with lamin B and DNA. Human LBR is 68% identical to the chicken lamin B receptor and has a basic nucleoplasmic amino-terminal domain of 208 amino acids followed by a hydrophobic domain with eight putative transmembrane segments. The amino-terminal domain contains a Ser-Arg-rich stretch and consensus sites for phosphorylation by protein kinase A and p34cdc2 protein kinase. A fusion protein containing the amino-terminal domain of human LBR is recognized by autoantibodies from patients with primary biliary cirrhosis, and these serum antibodies label the nuclear envelope when examined by immunofluorescence microscopy. The LBR amino-terminal domain precipitates lamin B from nuclear extracts and retards the migration of double-stranded DNA subjected to agarose gel electrophoresis. When immobilized on nitrocellulose, the amino-terminal domain of LBR also associates with DNA, and the stretch between amino acids 71 and 100, which contains the Ser-Arg-rich stretch, is necessary for DNA binding. These results demonstrate that LBR is conserved among vertebrate species and that its nucleoplasmic domain can potentially mediate the interaction of both the nuclear lamina and the chromatin with the inner nuclear membrane.

  4. DNA Binding with Acetate Bis(1,10-phenanthrolinesilver(I Monohydrate in a Solution and Metallization of Formed Structures

    Directory of Open Access Journals (Sweden)

    Nina Kasyanenko

    2017-06-01

    Full Text Available The study of DNA interaction with the acetate bis(1,10-phenanthrolinesilver(I monohydrate in a solution is of interest both for understanding the mechanism of biological activity of silver compound and for forming ordered structures (DNA fibrils that can be used to solve various problems in the field of nanotechnology. The analysis of changing the DNA conformation (secondary structure, persistent length and volume effects during the interaction by the methods of UV spectroscopy with the analysis of DNA melting, circular dichroism, viscosity, flow birefringence, AFM (atomic force microscopy and SEM (scanning electron microscopy was performed. The formation of two types of complexes was observed. At lower concentration of compound in DNA solution, silver atoms form the coordination bonds with a macromolecule, while the released phenanthroline ligands intercalate between DNA bases. When the concentration of the compound increases, the phenanthroline ligands form an ordered “layer” around the helix. The excess of silver compounds in the DNA solution (with more than five silver atoms per base pair, DNA precipitation is observed with the formation of long fibrils. It was shown that the binding of silver to DNA during the formation of complexes provides further metallization of the resulting structures with the aid of reducing agents; phenanthroline ligands influence the result of such metallization.

  5. Overproduction, purification and structural characterization of the functional N-terminal DNA-binding domain of the fru repressor from Escherichia coli K-12.

    Science.gov (United States)

    Scarabel, M; Penin, F; Bonod-Bidaud, C; Nègre, D; Cozzone, A J; Cortay, J C

    1995-02-03

    A DNA fragment encoding the DNA-binding domain (amino acids 1-60) of the Escherichia coli fru transcriptional regulator was cloned into the pGEX-KT vector and expressed in frame with the fused gene encoding glutathione S-transferase. The fusion protein was purified to homogeneity by affinity chromatography on immobilized glutathione, and then cleaved with thrombin. After separation by a cation-exchange chromatography step, the DNA-binding domain exhibited proper folding, as shown by proton NMR analysis. Furthermore, it showed specific interaction with the operator region of the ace operon, as checked by gel retardation and DNA methylation-protection experiments.

  6. Sequence-Specific DNA Binding by a Short Peptide Dimer

    Science.gov (United States)

    Talanian, Robert V.; McKnight, C. James; Kim, Peter S.

    1990-08-01

    A recently described class of DNA binding proteins is characterized by the "bZIP" motif, which consists of a basic region that contacts DNA and an adjacent "leucine zipper" that mediates protein dimerization. A peptide model for the basic region of the yeast transcriptional activator GCN4 has been developed in which the leucine zipper has been replaced by a disulfide bond. The 34-residue peptide dimer, but not the reduced monomer, binds DNA with nanomolar affinity at 4^circC. DNA binding is sequence-specific as judged by deoxyribonuclease I footprinting. Circular dichroism spectroscopy suggests that the peptide adopts a helical structure when bound to DNA. These results demonstrate directly that the GCN4 basic region is sufficient for sequence-specific DNA binding and suggest that a major function of the GCN4 leucine zipper is simply to mediate protein dimerization. Our approach provides a strategy for the design of short sequence-specific DNA binding peptides.

  7. Subunit-specific protein footprinting reveals significant structural rearrangements and a role for N-terminal Lys-14 of HIV-1 Integrase during viral DNA binding.

    Science.gov (United States)

    Zhao, Zhuojun; McKee, Christopher J; Kessl, Jacques J; Santos, Webster L; Daigle, Janet E; Engelman, Alan; Verdine, Gregory; Kvaratskhelia, Mamuka

    2008-02-29

    To identify functional contacts between HIV-1 integrase (IN) and its viral DNA substrate, we devised a new experimental strategy combining the following two methodologies. First, disulfide-mediated cross-linking was used to site-specifically link select core and C-terminal domain amino acids to respective positions in viral DNA. Next, surface topologies of free IN and IN-DNA complexes were compared using Lys- and Arg-selective small chemical modifiers and mass spectrometric analysis. This approach enabled us to dissect specific contacts made by different monomers within the multimeric complex. The foot-printing studies for the first time revealed the importance of a specific N-terminal domain residue, Lys-14, in viral DNA binding. In addition, a DNA-induced conformational change involving the connection between the core and C-terminal domains was observed. Site-directed mutagenesis experiments confirmed the importance of the identified contacts for recombinant IN activities and virus infection. These new findings provided major constraints, enabling us to identify the viral DNA binding channel in the active full-length IN multimer. The experimental approach described here has general application to mapping interactions within functional nucleoprotein complexes.

  8. The Positively Charged Surface of Herpes Simplex Virus UL42 Mediates DNA Binding*S

    Science.gov (United States)

    Komazin-Meredith, Gloria; Santos, Webster L.; Filman, David J.; Hogle, James M.; Verdine, Gregory L.; Coen, Donald M.

    2010-01-01

    Herpes simplex virus DNA polymerase is a heterodimer composed of UL30, a catalytic subunit, and UL42, a processivity subunit. Mutations that decrease DNA binding by UL42 decrease long chain DNA synthesis by the polymerase. The crystal structure of UL42 bound to the C terminus of UL30 revealed an extensive positively charged surface (“back face”). We tested two hypotheses, 1) the C terminus of UL30 affects DNA binding and 2) the positively charged back face mediates DNA binding. Addressing the first hypothesis, we found that the presence of a peptide corresponding to the UL30 C terminus did not result in altered binding of UL42 to DNA. Addressing the second hypothesis, previous work showed that substitution of four conserved arginine residues on the basic face with alanines resulted in decreased DNA affinity. We tested the affinities for DNA and the stimulation of long chain DNA synthesis of mutants in which the four conserved arginine residues were substituted individually or together with lysines and also a mutant in which a conserved glutamine residue was substituted with an arginine to increase positive charge on the back face. We also engineered cysteines onto this surface to permit disulfide cross-linking studies. Last, we assayed the effects of ionic strength on DNA binding by UL42 to estimate the number of ions released upon binding. Our results taken together strongly suggest that the basic back face of UL42 contacts DNA and that positive charge on this surface is important for this interaction. PMID:18178550

  9. Distinct Structural Features of G Protein-Coupled Receptor Kinase 5 (GRK5) Regulate Its Nuclear Localization and DNA-Binding Ability

    Science.gov (United States)

    Johnson, Laura R.; Robinson, James D.; Lester, Katrina N.; Pitcher, Julie A.

    2013-01-01

    G protein-coupled receptor kinases (GRKs) act to desensitize G protein-coupled receptors (GPCRs). In addition to this role at the plasma membrane, a nuclear function for GRK5, a member of the GRK4 subfamily of GRKs, has been reported. GRK5 phosphorylates and promotes the nuclear export of the histone deacetylase, HDAC5. Here we demonstrate that the possession of a nuclear localization sequence (NLS) is a common feature of GRK4 subfamily members (GRKs 4, 5 and 6). However, the location of the NLS and the ability of these GRKs to bind DNA in vitro are different. The NLSs of GRK5 and 6 bind DNA in vitro, whilst the NLS of GRK4 does not. Using mutants of GRK5 we identify the regions of GRK5 required for DNA-binding in vitro and nuclear localization in cells. The DNA-binding ability of GRK5 requires both the NLS and an N-terminal calmodulin (CaM)-binding site. A functional nuclear export sequence (NES), required for CaM-dependent nuclear export of the kinase, is also identified. Based on our observations we propose a model to explain how nuclear localization of GRK5 may be regulated. Notably, the nuclear localization of GRK5 and 6 is differentially regulated. These results suggest subfamily specific nuclear functions for the GRK4 subfamily members. Identification of GRK specific small molecule inhibitors of nuclear localization and/or function for the GRK4 subfamily may thus be an achievable goal. PMID:23658733

  10. Structural dynamics and ssDNA binding activity of the three N-terminal domains of the large subunit of Replication Protein A from small angle X-ray scattering

    Energy Technology Data Exchange (ETDEWEB)

    Pretto, Dalyir I.; Tsutakawa, Susan; Brosey, Chris A.; Castillo, Amalchi; Chagot, Marie-Eve; Smith, Jarrod A.; Tainer, John A.; Chazin, Walter J.

    2010-03-11

    Replication Protein A (RPA) is the primary eukaryotic ssDNA binding protein utilized in diverse DNA transactions in the cell. RPA is a heterotrimeric protein with seven globular domains connected by flexible linkers, which enable substantial inter-domain motion that is essential to its function. Small angle X-ray scattering (SAXS) experiments on two multi-domain constructs from the N-terminus of the large subunit (RPA70) were used to examine the structural dynamics of these domains and their response to the binding of ssDNA. The SAXS data combined with molecular dynamics simulations reveal substantial interdomain flexibility for both RPA70AB (the tandem high affinity ssDNA binding domains A and B connected by a 10-residue linker) and RPA70NAB (RPA70AB extended by a 70-residue linker to the RPA70N protein interaction domain). Binding of ssDNA to RPA70NAB reduces the interdomain flexibility between the A and B domains, but has no effect on RPA70N. These studies provide the first direct measurements of changes in orientation of these three RPA domains upon binding ssDNA. The results support a model in which RPA70N remains structurally independent of RPA70AB in the DNA bound state and therefore freely available to serve as a protein recruitment module.

  11. Adenovirus DNA binding protein: helix destabilising properties.

    OpenAIRE

    Monaghan, A; Webster, A; Hay, R T

    1994-01-01

    Adenovirus DNA binding protein is a multifunctional protein essential for viral DNA replication. To investigate the role of the DNA binding protein in this process its interaction with partial DNA duplexes was examined. Duplex regions of DNA, created when a short DNA strand is annealed to its complementary sequence present in the single stranded form of M13 phage DNA, were efficiently unwound by DNA binding protein in a reaction that required neither ATP nor MgCl2. The unwinding activity of D...

  12. New DNA-binding radioprotectors

    Science.gov (United States)

    Martin, Roger

    The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is

  13. Synthesis and characterization of a new zinc(II) complex with tetradentate azo-thioether ligand: X-ray structure, DNA binding study and DFT calculation

    Science.gov (United States)

    Mondal, Apurba Sau; Pramanik, Ajoy Kumar; Patra, Lakshman; Manna, Chandan Kumar; Mondal, Tapan Kumar

    2017-10-01

    A new zinc(II) complex, [Zn(L)(H2O)](ClO4) (1) with azo-thioether containing NSNO donor ligand, 3-(2-(2-((pyridin-2-ylmethyl)thio)phenyl)hydrazono)pentane-2,4-dione (HL) is synthesized and characterized by several spectroscopic techniques. The distorted square based pyramidal (DSBP) geometry is confirmed by single crystal X-ray structure. The ability of the complex to bind with CT DNA is investigated by UV-vis method and the binding constant is found to be 4.16 × 104 M-1. Competitive binding study with ethidium bromide (EB) by fluorescence method suggests that the zinc(II) complex efficiently displaces EB from EB-DNA. The Stern-Volmer dynamic quenching constant, Ksv is found to be 1.2 × 104 M-1. Theoretical calculations by DFT and TDDFT/CPCM methods are used to interpret the electronic structure and UV-vis spectrum of the complex.

  14. Comparative footprinting of DNA-binding proteins.

    Science.gov (United States)

    Contreras-Moreira, Bruno; Collado-Vides, Julio

    2006-07-15

    Comparative modelling is a computational method used to tackle a variety of problems in molecular biology and biotechnology. Traditionally it has been applied to model the structure of proteins on their own or bound to small ligands, although more recently it has also been used to model protein-protein interfaces. This work is the first to systematically analyze whether comparative models of protein-DNA complexes could be built and be useful for predicting DNA binding sites. First, we describe the structural and evolutionary conservation of protein-DNA interfaces, and the limits they impose on modelling accuracy. Second, we find that side-chains from contacting residues can be reasonably modeled and therefore used to identify contacting nucleotides. Third, the DNASITE protocol is implemented and different parameters are benchmarked on a set of 85 regulators from Escherichia coli. Results show that comparative footprinting can make useful predictions based solely on structural data, depending primarily on the interface identity with respect to the template used. DNASITE code available on request from the authors.

  15. NAD+ Modulates p53 DNA Binding Specificity and Function

    Science.gov (United States)

    McLure, Kevin G.; Takagi, Masatoshi; Kastan, Michael B.

    2004-01-01

    DNA damage induces p53 DNA binding activity, which affects tumorigenesis, tumor responses to therapies, and the toxicities of cancer therapies (B. Vogelstein, D. Lane, and A. J. Levine, Nature 408:307-310, 2000; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Both transcriptional and transcription-independent activities of p53 contribute to DNA damage-induced cell cycle arrest, apoptosis, and aneuploidy prevention (M. B. Kastan et al., Cell 71:587-597, 1992; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Small-molecule manipulation of p53 DNA binding activity has been an elusive goal, but here we show that NAD+ binds to p53 tetramers, induces a conformational change, and modulates p53 DNA binding specificity in vitro. Niacinamide (vitamin B3) increases the rate of intracellular NAD+ synthesis, alters radiation-induced p53 DNA binding specificity, and modulates activation of a subset of p53 transcriptional targets. These effects are likely due to a direct effect of NAD+ on p53, as a molecule structurally related to part of NAD+, TDP, also inhibits p53 DNA binding, and the TDP precursor, thiamine (vitamin B1), inhibits intracellular p53 activity. Niacinamide and thiamine affect two p53-regulated cellular responses to ionizing radiation: rereplication and apoptosis. Thus, niacinamide and thiamine form a novel basis for the development of small molecules that affect p53 function in vivo, and these results suggest that changes in cellular energy metabolism may regulate p53. PMID:15509798

  16. Building an automated classification of DNA-binding protein domains.

    Science.gov (United States)

    Ponomarenko, Julia V; Bourne, Philip E; Shindyalov, Ilya N

    2002-01-01

    Intensive growth in 3D structure data on DNA-protein complexes as reflected in the Protein Data Bank (PDB) demands new approaches to the annotation and characterization of these data and will lead to a new understanding of critical biological processes involving these data. These data and those from other protein structure classifications will become increasingly important for the modeling of complete proteomes. We propose a fully automated classification of DNA-binding protein domains based on existing 3D-structures from the PDB. The classification, by domain, relies on the Protein Domain Parser (PDP) and the Combinatorial Extension (CE) algorithm for structural alignment. The approach involves the analysis of 3D-interaction patterns in DNA-protein interfaces, assignment of structural domains interacting with DNA, clustering of domains based on structural similarity and DNA-interacting patterns. Comparison with existing resources on describing structural and functional classifications of DNA-binding proteins was used to validate and improve the approach proposed here. In the course of our study we defined a set of criteria and heuristics allowing us to automatically build a biologically meaningful classification and define classes of functionally related protein domains. It was shown that taking into consideration interactions between protein domains and DNA considerably improves the classification accuracy. Our approach provides a high-throughput and up-to-date annotation of DNA-binding protein families which can be found at http://spdc.sdsc.edu.

  17. An Overview of the Prediction of Protein DNA-Binding Sites

    Directory of Open Access Journals (Sweden)

    Jingna Si

    2015-03-01

    Full Text Available Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.

  18. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators.

    Science.gov (United States)

    Perera, Inoka C; Grove, Anne

    2010-10-01

    Bacteria and archaea encode members of the large multiple antibiotic resistance regulator (MarR) family of transcriptional regulators. Generally, MarR homologs regulate activity of genes involved in antibiotic resistance, stress responses, virulence or catabolism of aromatic compounds. They constitute a diverse group of transcriptional regulators that includes both repressors and activators, and the conventional mode of regulation entails a genetic locus in which the MarR homolog and a gene under its regulation are encoded divergently; binding of the MarR homolog to the intergenic region typically represses transcription of both genes, while binding of a specific ligand to the transcription factor results in attenuated DNA binding and hence activated gene expression. For many homologs, the natural ligand is unknown. Crystal structures reveal a common architecture with a characteristic winged helix domain for DNA binding, and recent structural information of homologs solved both in the absence and presence of their respective ligands, as well as biochemical data, is finally converging to illuminate the mechanisms by which ligand-binding causes attenuated DNA binding. As MarR homologs regulate pathways that are critical to bacterial physiology, including virulence, a molecular understanding of mechanisms by which ligands affect a regulation of gene activity is essential. Specifying the position of ligand-binding pockets further has the potential to aid in identifying the ligands for MarR homologs for which the ligand remains unknown.

  19. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  20. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    Science.gov (United States)

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Werner Helicase Wings DNA Binding

    OpenAIRE

    Hoadley, Kelly A.; Keck, James L.

    2010-01-01

    In this issue of Structure, Kitano et al. describe the structure of the DNA-bound winged-helix domain from the Werner helicase. This structure of a RecQ/DNA complex offers insights into the DNA unwinding mechanisms of RecQ family helicases.

  2. Werner helicase wings DNA binding.

    Science.gov (United States)

    Hoadley, Kelly A; Keck, James L

    2010-02-10

    In this issue of Structure, Kitano et al. describe the structure of the DNA-bound winged-helix domain from the Werner helicase. This structure of a RecQ/DNA complex offers insights into the DNA-unwinding mechanisms of RecQ family helicases. Copyright 2010 Elsevier Inc. All rights reserved.

  3. NMR studies of the R2 repeat and related peptide fragments of the DNA binding domain of c-Myb. New light on the structure and folding of R2.

    Science.gov (United States)

    Ségalas, I.; Desjardins, S.; Oulyadi, H.; Prigent, Y.; Tribouillard, S.; Bernardi, E.; Schoofs, A. R.; Davoust1, D.; Toma, F.

    1999-10-01

    The solution structure of the R2 repeat of the DNA binding domain of the protooncogene c-Myb contains a N-terminal structural motif comprising two antiparallel helices. The motif is stabilized by interactions involving conserved residues. The recognition region in C-terminal position is flexible. This structure differs from that of R2 of another c-Myb protein. La structure en solution de la répétition R2 du domaine de liaison à l'ADN du protooncogène c-Myb possède un motif à deux hélices antiparallèles dans la moitié N-terminale, stabilisé par des interactions entre résidus conservés. La région de reconnaissance à l'ADN en position C-terminale est flexible. Cette structure diffère de celle montrée pour la répétition R2 d'une autre protéine c-Myb.

  4. Inorganic Crystal Structure Database (ICSD)

    Science.gov (United States)

    SRD 84 FIZ/NIST Inorganic Crystal Structure Database (ICSD) (PC database for purchase)   The Inorganic Crystal Structure Database (ICSD) is produced cooperatively by the Fachinformationszentrum Karlsruhe(FIZ) and the National Institute of Standards and Technology (NIST). The ICSD is a comprehensive collection of crystal structure data of inorganic compounds containing more than 140,000 entries and covering the literature from 1915 to the present.

  5. Synthesis of mononuclear copper(II) complexes of acyclic Schiff's base ligands: spectral, structural, electrochemical, antibacterial, DNA binding and cleavage activity.

    Science.gov (United States)

    Jayamani, Arumugam; Thamilarasan, Vijayan; Sengottuvelan, Nallathambi; Manisankar, Paramasivam; Kang, Sung Kwon; Kim, Young-Inn; Ganesan, Vengatesan

    2014-03-25

    The mononuclear copper(II) complexes (1&2) of ligands L(1) [N,N'-bis(2-hydroxy-5-methylbenzyl)-1,4-bis(3-iminopropyl)piperazine] or L(2) [N,N'-bis(2-hydroxy-5-bromobenzyl)-1,4-bis(3-iminopropyl) piperazine] have been synthesized and characterised. The single crystal X-ray study had shown that ligands L(1) and L(2) crystallize in a monoclinic crystal system with P21/c space group. The mononuclear copper(II) complexes show one quasireversible cyclic voltammetric response near cathodic region (-0.77 to -0.85 V) in DMF assignable to the Cu(II)/Cu(I) couple. Binding interaction of the complexes with calf thymus DNA (CT DNA) investigated by absorption studies and fluorescence spectral studies show good binding affinity to CT DNA, which imply both the copper(II) complexes can strongly interact with DNA efficiently. The copper(II) complexes showed efficient oxidative cleavage of plasmid pBR322 DNA in the presence of 3-mercaptopropionic acid as reducing agent through a mechanistic pathway involving formation of singlet oxygen as the reactive species. The Schiff bases and their Cu(II) complexes have been screened for antibacterial activities which indicates that the complexes exhibited higher antimicrobial activity than the free ligands. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Synthesis of mononuclear copper(II) complexes of acyclic Schiff's base ligands: Spectral, structural, electrochemical, antibacterial, DNA binding and cleavage activity

    Science.gov (United States)

    Jayamani, Arumugam; Thamilarasan, Vijayan; Sengottuvelan, Nallathambi; Manisankar, Paramasivam; Kang, Sung Kwon; Kim, Young-Inn; Ganesan, Vengatesan

    2014-03-01

    The mononuclear copper(II) complexes (1&2) of ligands L1 [N,N";-bis(2-hydroxy-5-methylbenzyl)-1,4-bis(3-iminopropyl)piperazine] or L2 [N,N";-bis(2-hydroxy-5-bromobenzyl)-1,4-bis(3-iminopropyl) piperazine] have been synthesized and characterised. The single crystal X-ray study had shown that ligands L1 and L2 crystallize in a monoclinic crystal system with P21/c space group. The mononuclear copper(II) complexes show one quasireversible cyclic voltammetric response near cathodic region (-0.77 to -0.85 V) in DMF assignable to the Cu(II)/Cu(I) couple. Binding interaction of the complexes with calf thymus DNA (CT DNA) investigated by absorption studies and fluorescence spectral studies show good binding affinity to CT DNA, which imply both the copper(II) complexes can strongly interact with DNA efficiently. The copper(II) complexes showed efficient oxidative cleavage of plasmid pBR322 DNA in the presence of 3-mercaptopropionic acid as reducing agent through a mechanistic pathway involving formation of singlet oxygen as the reactive species. The Schiff bases and their Cu(II) complexes have been screened for antibacterial activities which indicates that the complexes exhibited higher antimicrobial activity than the free ligands.

  7. Roles of the human Rad51 L1 and L2 loops in DNA binding.

    Science.gov (United States)

    Matsuo, Yusuke; Sakane, Isao; Takizawa, Yoshimasa; Takahashi, Masayuki; Kurumizaka, Hitoshi

    2006-07-01

    The human Rad51 protein, a eukaryotic ortholog of the bacterial RecA protein, is a key enzyme that functions in homologous recombination and recombinational repair of double strand breaks. The Rad51 protein contains two flexible loops, L1 and L2, which are proposed to be sites for DNA binding, based on a structural comparison with RecA. In the present study, we performed mutational and fluorescent spectroscopic analyses on the L1 and L2 loops to examine their role in DNA binding. Gel retardation and DNA-dependent ATP hydrolysis measurements revealed that the substitution of the tyrosine residue at position 232 (Tyr232) within the L1 loop with alanine, a short side chain amino acid, significantly decreased the DNA-binding ability of human Rad51, without affecting the protein folding or the salt-induced, DNA-independent ATP hydrolysis. Even the conservative replacement with tryptophan affected the DNA binding, indicating that Tyr232 is involved in DNA binding. The importance of the L1 loop was confirmed by the fluorescence change of a tryptophan residue, replacing the Asp231, Ser233, or Gly236 residue, upon DNA binding. The alanine replacement of phenylalanine at position 279 (Phe279) within the L2 loop did not affect the DNA-binding ability of human Rad51, unlike the Phe203 mutation of the RecA L2 loop. The Phe279 side chain may not be directly involved in the interaction with DNA. However, the fluorescence intensity of the tryptophan replacing the Rad51-Phe279 residue was strongly reduced upon DNA binding, indicating that the L2 loop is also close to the DNA-binding site.

  8. Crystal structure of fipronil

    Directory of Open Access Journals (Sweden)

    Hyunjin Park

    2017-10-01

    Full Text Available The title compound, C12H4Cl2F6N4OS {systematic name: 5-amino-1-[2,6-dichloro-4-(trifluoromethylphenyl]-4-[(trifluoromethanesulfinyl]-1H-pyrazole-3-carbonitrile}, is a member of the phenylpyrazole group of acaricides, and one of the phenylpyrazole group of insecticides. The dihedral angle between the planes of the pyrazole and benzene rings is 89.03 (9°. The fluorine atoms of the trifluoromethyl substituent on the benzene ring are disordered over two sets of sites, with occupancy ratios 0.620 (15:0.380 (15. In the crystal, C—N...π interactions [N...ring centroid = 3.607 (4 Å] together with N—H...N and C—H...F hydrogen bonds form a looped chain structure along [10\\overline{1}]. Finally, N—H...O hydrogen bonds and C—Cl...π interactions [Cl...ring centroid = 3.5159 (16 Å] generate a three-dimensional structure. Additionally, there are a short intermolecular F... F contacts present.

  9. Identification of a Second DNA Binding Site in the Human Rad52 Protein*S⃞

    OpenAIRE

    Kagawa, Wataru; Kagawa, Ako; Saito, Kengo; Ikawa, Shukuko; Shibata, Takehiko; Kurumizaka, Hitoshi; Yokoyama, Shigeyuki

    2008-01-01

    Rad52 plays essential roles in homology-dependent double-strand break repair. Various studies have established the functions of Rad52 in Rad51-dependent and Rad51-independent repair processes. However, the precise molecular mechanisms of Rad52 in these processes remain unknown. In the present study we have identified a novel DNA binding site within Rad52 by a structure-based alanine scan mutagenesis. This site is closely aligned with the putative single-stranded DNA binding ...

  10. Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

    NARCIS (Netherlands)

    Singh, S.; Folkers, G.E.|info:eu-repo/dai/nl/162277202; Bonvin, A.M.J.J.|info:eu-repo/dai/nl/113691238; Boelens, R.|info:eu-repo/dai/nl/070151407; Wechselberger, R.W.|info:eu-repo/dai/nl/304829005; Niztayev, A.; Kaptein, R.|info:eu-repo/dai/nl/074334603

    2002-01-01

    The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5' incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix±hairpin±helix (HhH) motifs

  11. Prediction of molecular crystal structures

    CERN Document Server

    Beyer, T

    2001-01-01

    The ab initio prediction of molecular crystal structures is a scientific challenge. Reliability of first-principle prediction calculations would show a fundamental understanding of crystallisation. Crystal structure prediction is also of considerable practical importance as different crystalline arrangements of the same molecule in the solid state (polymorphs)are likely to have different physical properties. A method of crystal structure prediction based on lattice energy minimisation has been developed in this work. The choice of the intermolecular potential and of the molecular model is crucial for the results of such studies and both of these criteria have been investigated. An empirical atom-atom repulsion-dispersion potential for carboxylic acids has been derived and applied in a crystal structure prediction study of formic, benzoic and the polymorphic system of tetrolic acid. As many experimental crystal structure determinations at different temperatures are available for the polymorphic system of parac...

  12. Crystal structure of oxamyl

    Directory of Open Access Journals (Sweden)

    Eunjin Kwon

    2016-12-01

    Full Text Available The title compound, C7H13N3O3S [systematic name: (Z-methyl 2-dimethylamino-N-(methylcarbamoyloxy-2-oxoethanimidothioate], is an oxime carbamate acaride, insecticide and nematicide. The asymmetric unit comprises two independent molecules, A and B. The dihedral angles between the mean planes [r.m.s. deviations = 0.0017 (A and 0.0016 Å (B] of the acetamide and oxyimino groups are 88.80 (8° for A and 87.05 (8° for B. In the crystal, N/C—H...O hydrogen bonds link adjacent molecules, forming chains along the a axis. The chains are further linked by C—H...O hydrogen bonds, resulting in a three-dimensional network with alternating rows of A and B molecules in the bc plane stacked along the a-axis direction. The structure was refined as an inversion twin with a final BASF parameter of 0.16 (9.

  13. DNA and protein footprinting analysis of the modulation of DNA binding by the N-terminal domain of the Saccharomyces cerevisiae TATA binding protein.

    Science.gov (United States)

    Gupta, Sayan; Cheng, Huiyong; Mollah, A K M M; Jamison, Elizabeth; Morris, Stephanie; Chance, Mark R; Khrapunov, Sergei; Brenowitz, Michael

    2007-09-04

    Recombinant full-length Saccharomyces cerevisiae TATA binding protein (TBP) and its isolated C-terminal conserved core domain (TBPc) were prepared with measured high specific DNA-binding activities. Direct, quantitative comparison of TATA box binding by TBP and TBPc reveals greater affinity by TBPc for either of two high-affinity sequences at several different experimental conditions. TBPc associates more rapidly than TBP to TATA box bearing DNA and dissociates more slowly. The structural origins of the thermodynamic and kinetic effects of the N-terminal domain on DNA binding by TBP were explored in comparative studies of TBPc and TBP by "protein footprinting" with hydroxyl radical (*OH) side chain oxidation. Some residues within TBPc and the C-terminal domain of TBP are comparably protected by DNA, consistent with solvent accessibility changes calculated from core domain crystal structures. In contrast, the reactivity of some residues located on the top surface and the DNA-binding saddle of the C-terminal domain differs between TBP and TBPc in both the presence and absence of bound DNA; these results are not predicted from the crystal structures. A strikingly different pattern of side chain oxidation is observed for TBP when a nonionic detergent is present. Taken together, these results are consistent with the N-terminal domain actively modulating TATA box binding by TBP and nonionic detergent modulating the interdomain interaction.

  14. DNA and Protein Footprinting Analysis of the Modulation of DNA Binding by the N-Terminal Domain of the Saccharomyces cervisiae TATA Binding Protein

    Energy Technology Data Exchange (ETDEWEB)

    Gupta,S.; Cheng, H.; Mollah, A.; Jamison, E.; Morris, S.; Chance, M.; Khrapunov, S.; Brenowitz, M.

    2007-01-01

    Recombinant full-length Saccharomyces cerevisiae TATA binding protein (TBP) and its isolated C-terminal conserved core domain (TBPc) were prepared with measured high specific DNA-binding activities. Direct, quantitative comparison of TATA box binding by TBP and TBPc reveals greater affinity by TBPc for either of two high-affinity sequences at several different experimental conditions. TBPc associates more rapidly than TBP to TATA box bearing DNA and dissociates more slowly. The structural origins of the thermodynamic and kinetic effects of the N-terminal domain on DNA binding by TBP were explored in comparative studies of TBPc and TBP by 'protein footprinting' with hydroxyl radical ({center_dot}OH) side chain oxidation. Some residues within TBPc and the C-terminal domain of TBP are comparably protected by DNA, consistent with solvent accessibility changes calculated from core domain crystal structures. In contrast, the reactivity of some residues located on the top surface and the DNA-binding saddle of the C-terminal domain differs between TBP and TBPc in both the presence and absence of bound DNA; these results are not predicted from the crystal structures. A strikingly different pattern of side chain oxidation is observed for TBP when a nonionic detergent is present. Taken together, these results are consistent with the N-terminal domain actively modulating TATA box binding by TBP and nonionic detergent modulating the interdomain interaction.

  15. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  16. Crystal Structure of the Human Hsmar1-Derived Transposase Domain in the DNA Repair Enzyme Metnase

    Energy Technology Data Exchange (ETDEWEB)

    Goodwin, Kristie D.; He, Hongzhen; Imasaki, Tsuyoshi; Lee, Suk-Hee; Georgiadis, Millie M. (Indiana-Med)

    2010-08-12

    Although the human genome is littered with sequences derived from the Hsmar1 transposon, the only intact Hsmar1 transposase gene exists within a chimeric SET-transposase fusion protein referred to as Metnase or SETMAR. Metnase retains many of the transposase activities including terminal inverted repeat (TIR) specific DNA-binding activity, DNA cleavage activity, albeit uncoupled from TIR-specific binding, and the ability to form a synaptic complex. However, Metnase has evolved as a DNA repair protein that is specifically involved in nonhomologous end joining. Here, we present two crystal structures of the transposase catalytic domain of Metnase revealing a dimeric enzyme with unusual active site plasticity that may be involved in modulating metal binding. We show through characterization of a dimerization mutant, F460K, that the dimeric form of the enzyme is required for its DNA cleavage, DNA-binding, and nonhomologous end joining activities. Of significance is the conservation of F460 along with residues that we propose may be involved in the modulation of metal binding in both the predicted ancestral Hsmar1 transposase sequence as well as in the modern enzyme. The Metnase transposase has been remarkably conserved through evolution; however, there is a clustering of substitutions located in alpha helices 4 and 5 within the putative DNA-binding site, consistent with loss of transposition specific DNA cleavage activity and acquisition of DNA repair specific cleavage activity.

  17. Synthesis and Structural Investigation of New Bio-Relevant Complexes of Lanthanides with 5-Hydroxyflavone: DNA Binding and Protein Interaction Studies

    Directory of Open Access Journals (Sweden)

    Alexandra-Cristina Munteanu

    2016-12-01

    Full Text Available In the present work, we attempted to develop new metal coordination complexes of the natural flavonoid 5-hydroxyflavone with Sm(III, Eu(III, Gd(III, Tb(III. The resultant hydroxo complexes have been characterized by a variety of spectroscopic techniques, including fluorescence, FT-IR, UV-Vis, EPR and mass spectral studies. The general chemical formula of the complexes is [Ln(C15H9O33(OH2(H2Ox]·nH2O, where Ln is the lanthanide cation and x = 0 for Sm(III, x = 1 for Eu(III, Gd(III, Tb(III and n = 0 for Sm(III, Gd(III, Tb(III, n = 1 for Eu(III, respectively. The proposed structures of the complexes were optimized by DFT calculations. Theoretical calculations and experimental determinations sustain the proposed structures of the hydroxo complexes, with two molecules of 5-hydroxyflavone acting as monoanionic bidentate chelate ligands. The interaction of the complexes with calf thymus DNA has been explored by fluorescence titration and UV-Vis absorption binding studies, and revealed that the synthesized complexes interact with DNA with binding constants (Kb ~ 104. Human serum albumin (HSA and transferrin (Tf binding studies have also been performed by fluorescence titration techniques (fluorescence quenching studies, synchronous fluorescence spectra. The apparent association constants (Ka and thermodynamic parameters have been calculated from the fluorescence quenching experiment at 299 K, 308 K, and 318 K. The quenching curves indicate that the complexes bind to HSA with smaller affinity than the ligand, but to Tf with higher binding affinities than the ligand.

  18. Synthesis, structure elucidation, biological screening, molecular modeling and DNA binding of some Cu(II) chelates incorporating imines derived from amino acids

    Science.gov (United States)

    Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali

    2016-01-01

    Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some

  19. Spectroscopic, molecular docking and structural activity studies of (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazide derivatives for DNA binding and their biological screening

    Science.gov (United States)

    Arshad, Nasima; Perveen, Fouzia; Saeed, Aamer; Channar, Pervaiz Ali; Farooqi, Shahid Iqbal; Larik, Fayaz Ali; Ismail, Hammad; Mirza, Bushra

    2017-07-01

    Acid catalyzed condensation of isoniazid with a number of suitably substituted aromatic and heterocyclic aldehydes was carried out in dry ethanol to afford the title (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazides (SF 1 - SF 4) in good yields. These compounds were characterized and further investigated for their binding with ds.DNA using UV- spectroscopy and molecular docking and for antitumor and antimicrobial potentials. A good correlation was found among spectroscopic, theoretical and biological results. UV- spectra in the presence of DNA concentrations and their data interpretation in terms binding constant ;Kb; and free energy change (ΔG) provided evidences for the significant and spontaneous binding of the compounds with DNA. Molecular docking studies and structural analysis further supported the UV-findings and indicated that the modes of interactions between bromo- (SF 1) and flouro- (SF 4) substituted isonicotinohydrazides is intercalation while methoxy- (SF 2) and hydroxy- (SF 3) substituted isonicotinohydrazides interact with DNA helix via groove binding. SF 1 exhibited comparatively higher Kb value (UV-; 8.07 × 103 M-1, docking; 8.11 × 103 M-1) which inferred that the respective compound muddles to DNA most powerfully. SF 1 has shown the lowest IC50 (345.3 μg/mL) value among all the compounds indicating its comparatively highest activity towards tumor inhibition. None of the compound has shown perceptible antibacterial and antifungal activities.

  20. Crystal Structure of the Human NKX2.5 Homeodomain in Complex with DNA Target

    Energy Technology Data Exchange (ETDEWEB)

    Pradhan, Lagnajeet; Genis, Caroli; Scone, Peyton; Weinberg, Ellen O.; Kasahara, Hideko; Nam, Hyun-Joo (BU-M); (Florida); (Texas)

    2012-10-16

    NKX2.5 is a homeodomain containing transcription factor regulating cardiac formation and function, and its mutations are linked to congenital heart disease. Here we provide the first report of the crystal structure of the NKX2.5 homeodomain in complex with double-stranded DNA of its endogenous target, locating within the proximal promoter -242 site of the atrial natriuretic factor gene. The crystal structure, determined at 1.8 {angstrom} resolution, demonstrates that NKX2.5 homeodomains occupy both DNA binding sites separated by five nucleotides without physical interaction between themselves. The two homeodomains show identical conformation despite the differences in the DNA sequences they bind, and no significant bending of the DNA was observed. Tyr54, absolutely conserved in NK2 family proteins, mediates sequence-specific interaction with the TAAG motif. This high resolution crystal structure of NKX2.5 protein provides a detailed picture of protein and DNA interactions, which allows us to predict DNA binding of mutants identified in human patients.

  1. [Design of artificial DNA binding proteins toward control and elucidation of cellular functions].

    Science.gov (United States)

    Imanishi, Miki

    2012-01-01

    An artificial transcription factor that can regulate the expression of specific genes at a desired time is very useful for research in chemical biology, cell biology, and future gene therapy. A C2H2 zinc finger motif, one of zinc-containing proteins, is known as the most ubiquitous DNA binding motif. The motif is attractive for designing artificial transcription factors with desired DNA binding specificities because of its characteristic DNA binding properties: (1) recognition of 3 bp per motif, (2) tandemly connected modular structure, and (3) binding to non-palindrome sequences as a monomer. Taking advantage of these properties, artificial DNA binding proteins with new DNA binding characteristics have been designed. By changing the linker region between two 3-zinc finger domains, artificial 6-zinc finger proteins were developed and shown to skip DNA sequences. Zinc-responsive transcription factors were created by altering one of the zinc ligands. An artificial zinc finger transcription factor targeting a core clock gene induced phase shifts of the cellular "circadian rhythm". Herein, I will summarize creation and function of the above-mentioned artificial zinc finger-type DNA binding proteins and transcription factors.

  2. Characterization and DNA-binding specificities of Ralstonia TAL-like effectors

    KAUST Repository

    Li, Lixin

    2013-07-01

    Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.

  3. Toxin inhibition in C. crescentus VapBC1 is mediated by a flexible pseudo-palindromic protein motif and modulated by DNA binding

    DEFF Research Database (Denmark)

    Bendtsen, Kirstine L; Xu, Kehan; Luckmann, Majbritt

    2017-01-01

    interaction with the antitoxin. Here, we determine crystal structures of the complete 90 kDa heterooctameric VapBC1 complex from Caulobacter crescentus CB15 both in isolation and bound to its cognate DNA operator sequence at 1.6 and 2.7 Å resolution, respectively. DNA binding is associated with a dramatic......Expression of bacterial type II toxin-antitoxin (TA) systems is regulated at the transcriptional level through direct binding of the antitoxin to pseudo-palindromic sequences on operator DNA. In this context, the toxin functions as a co-repressor by stimulating DNA binding through direct...... for binding and inactivation of the VapC1 toxin dimer. Sequence analysis of 4127 orthologous VapB sequences reveals that such palindromic protein sequences are widespread and unique to bacterial and archaeal VapB antitoxins suggesting a general principle governing regulation of VapBC TA systems. Finally...

  4. Prediction of molecular crystal structures

    Energy Technology Data Exchange (ETDEWEB)

    Beyer, Theresa

    2001-07-01

    The ab initio prediction of molecular crystal structures is a scientific challenge. Reliability of first-principle prediction calculations would show a fundamental understanding of crystallisation. Crystal structure prediction is also of considerable practical importance as different crystalline arrangements of the same molecule in the solid state (polymorphs)are likely to have different physical properties. A method of crystal structure prediction based on lattice energy minimisation has been developed in this work. The choice of the intermolecular potential and of the molecular model is crucial for the results of such studies and both of these criteria have been investigated. An empirical atom-atom repulsion-dispersion potential for carboxylic acids has been derived and applied in a crystal structure prediction study of formic, benzoic and the polymorphic system of tetrolic acid. As many experimental crystal structure determinations at different temperatures are available for the polymorphic system of paracetamol (acetaminophen), the influence of the variations of the molecular model on the crystal structure lattice energy minima, has also been studied. The general problem of prediction methods based on the assumption that the experimental thermodynamically stable polymorph corresponds to the global lattice energy minimum, is that more hypothetical low lattice energy structures are found within a few kJ mol{sup -1} of the global minimum than are likely to be experimentally observed polymorphs. This is illustrated by the results for molecule I, 3-oxabicyclo(3.2.0)hepta-1,4-diene, studied for the first international blindtest for small organic crystal structures organised by the Cambridge Crystallographic Data Centre (CCDC) in May 1999. To reduce the number of predicted polymorphs, additional factors to thermodynamic criteria have to be considered. Therefore the elastic constants and vapour growth morphologies have been calculated for the lowest lattice energy

  5. Crystal structure of cafenstrole

    Directory of Open Access Journals (Sweden)

    Gihaeng Kang

    2015-08-01

    Full Text Available The title compound (systematic name: N,N-diethyl-3-mesitylsulfonyl-1H-1,2,4-triazole-1-carboxamide, C16H22N4O3S, is a triazole herbicide. The dihedral angle between the planes of the triazole and benzene ring planes is 88.14 (10°. In the crystal, C—H...O hydrogen bonds and weak C—H...π interactions link adjacent molecules, forming one-dimensional chains along the a axis.

  6. Crystal structure of pyriproxyfen

    Directory of Open Access Journals (Sweden)

    Gihaeng Kang

    2015-08-01

    Full Text Available In the title compound {systematic name: 4-phenoxyphenyl (RS-2-[(pyridin-2-yloxy]propyl ether}, C20H19NO3, which is a juvenile hormone mimic and insecticide, the dihedral angles between the plane of the central benene ring and those of the pendant pyridine ring and phenyl ring are 78.09 (6 and 82.14 (8°, respectively. The conformation of the O—C—C—O linkage is gauche [torsion angle = −75.0 (2°]. In the crystal, weak aromatic π–π stacking interactions [centroid–centroid separation = 3.8436 (13 Å] and C—H...π interactions link adjacent molecules, forming a three-dimensional network.

  7. Molecular and structural considerations of TF-DNA binding for the generation of biologically meaningful and accurate phylogenetic footprinting analysis: the LysR-type transcriptional regulator family as a study model.

    Science.gov (United States)

    Oliver, Patricia; Peralta-Gil, Martín; Tabche, María-Luisa; Merino, Enrique

    2016-08-27

    The goal of most programs developed to find transcription factor binding sites (TFBSs) is the identification of discrete sequence motifs that are significantly over-represented in a given set of sequences where a transcription factor (TF) is expected to bind. These programs assume that the nucleotide conservation of a specific motif is indicative of a selective pressure required for the recognition of a TF for its corresponding TFBS. Despite their extensive use, the accuracies reached with these programs remain low. In many cases, true TFBSs are excluded from the identification process, especially when they correspond to low-affinity but important binding sites of regulatory systems. We developed a computational protocol based on molecular and structural criteria to perform biologically meaningful and accurate phylogenetic footprinting analyses. Our protocol considers fundamental aspects of the TF-DNA binding process, such as: i) the active homodimeric conformations of TFs that impose symmetric structures on the TFBSs, ii) the cooperative binding of TFs, iii) the effects of the presence or absence of co-inducers, iv) the proximity between two TFBSs or one TFBS and a promoter that leads to very long spurious motifs, v) the presence of AT-rich sequences not recognized by the TF but that are required for DNA flexibility, and vi) the dynamic order in which the different binding events take place to determine a regulatory response (i.e., activation or repression). In our protocol, the abovementioned criteria were used to analyze a profile of consensus motifs generated from canonical Phylogenetic Footprinting Analyses using a set of analysis windows of incremental sizes. To evaluate the performance of our protocol, we analyzed six members of the LysR-type TF family in Gammaproteobacteria. The identification of TFBSs based exclusively on the significance of the over-representation of motifs in a set of sequences might lead to inaccurate results. The consideration of

  8. Crystal structure refinement with SHELXL

    Energy Technology Data Exchange (ETDEWEB)

    Sheldrick, George M., E-mail: gsheldr@shelx.uni-ac.gwdg.de [Department of Structural Chemistry, Georg-August Universität Göttingen, Tammannstraße 4, Göttingen 37077 (Germany)

    2015-01-01

    New features added to the refinement program SHELXL since 2008 are described and explained. The improvements in the crystal structure refinement program SHELXL have been closely coupled with the development and increasing importance of the CIF (Crystallographic Information Framework) format for validating and archiving crystal structures. An important simplification is that now only one file in CIF format (for convenience, referred to simply as ‘a CIF’) containing embedded reflection data and SHELXL instructions is needed for a complete structure archive; the program SHREDCIF can be used to extract the .hkl and .ins files required for further refinement with SHELXL. Recent developments in SHELXL facilitate refinement against neutron diffraction data, the treatment of H atoms, the determination of absolute structure, the input of partial structure factors and the refinement of twinned and disordered structures. SHELXL is available free to academics for the Windows, Linux and Mac OS X operating systems, and is particularly suitable for multiple-core processors.

  9. Crystal structure of pymetrozine

    Directory of Open Access Journals (Sweden)

    Youngeun Jeon

    2015-07-01

    Full Text Available The title compound, C10H11N5O {systematic name: 6-methyl-4-[(E-(pyridin-3-ylmethylideneamino]-4,5-dihydro-1,2,4-triazin-3(2H-one}, C10H11N5O, is used as an antifeedant in pest control. The asymmetric unit comprises two independent molecules, A and B, in which the dihedral angles between the pyridinyl and triazinyl ring planes [r.m.s. deviations = 0.0132 and 0.0255 ] are 11.60 (6 and 18.06 (4°, respectively. In the crystal, N—H...O, N—H...N, C—H...N and C—H...O hydrogen bonds, together with weak π–π interactions [ring-centroid separations = 3.5456 (9 and 3.9142 (9 Å], link the pyridinyl and triazinyl rings of A molecules, generating a three-dimensional network.

  10. A Cationic Smart Copolymer for DNA Binding

    Directory of Open Access Journals (Sweden)

    Tânia Ribeiro

    2017-11-01

    Full Text Available A new block copolymer with a temperature-responsive block and a cationic block was prepared by reversible addition-fragmentation chain transfer (RAFT polymerization, with good control of its size and composition. The first block is composed by di(ethylene glycol methyl ether methacrylate (DEGMA and oligo(ethylene glycol methyl ether methacrylate (OEGMA, with the ratio DEGMA/OEGMA being used to choose the volume phase transition temperature of the polymer in water, tunable from ca. 25 to above 90 °C. The second block, of trimethyl-2-methacroyloxyethylammonium chloride (TMEC, is positively charged at physiological pH values and is used for DNA binding. The coacervate complexes between the block copolymer and a model single strand DNA are characterized by fluorescence correlation spectroscopy and fluorescence spectroscopy. The new materials offer good prospects for biomedical application, for example in controlled gene delivery.

  11. Crystal Structure of a Conserved Hypothetical Protein MJ0927 from Methanocaldococcus jannaschii Reveals a Novel Quaternary Assembly in the Nif3 Family

    Directory of Open Access Journals (Sweden)

    Sheng-Chia Chen

    2014-01-01

    Full Text Available A Nif3 family protein of Methanocaldococcus jannaschii, MJ0927, is highly conserved from bacteria to humans. Although several structures of bacterial Nif3 proteins are known, no structure representing archaeal Nif3 has yet been reported. The crystal structure of Methanocaldococcus jannaschii MJ0927 was determined at 2.47 Å resolution to understand the structural differences between the bacterial and archaeal Nif3 proteins. Intriguingly, MJ0927 is found to adopt an unusual assembly comprising a trimer of dimers that forms a cage-like architecture. Electrophoretic mobility-shift assays indicate that MJ0927 binds to both single-stranded and double-stranded DNA. Structural analysis of MJ0927 reveals a positively charged region that can potentially explain its DNA-binding capability. Taken together, these data suggest that MJ0927 adopts a novel quartenary architecture that could play various DNA-binding roles in Methanocaldococcus jannaschii.

  12. Artificial zinc finger DNA binding domains: versatile tools for genome engineering and modulation of gene expression.

    Science.gov (United States)

    Hossain, Mir A; Barrow, Joeva J; Shen, Yong; Haq, Md Imdadul; Bungert, Jörg

    2015-11-01

    Genome editing and alteration of gene expression by synthetic DNA binding activities gained a lot of momentum over the last decade. This is due to the development of new DNA binding molecules with enhanced binding specificity. The most commonly used DNA binding modules are zinc fingers (ZFs), TALE-domains, and the RNA component of the CRISPR/Cas9 system. These binding modules are fused or linked to either nucleases that cut the DNA and induce DNA repair processes, or to protein domains that activate or repress transcription of genes close to the targeted site in the genome. This review focuses on the structure, design, and applications of ZF DNA binding domains (ZFDBDs). ZFDBDs are relatively small and have been shown to penetrate the cell membrane without additional tags suggesting that they could be delivered to cells without a DNA or RNA intermediate. Advanced algorithms that are based on extensive knowledge of the mode of ZF/DNA interactions are used to design the amino acid composition of ZFDBDs so that they bind to unique sites in the genome. Off-target binding has been a concern for all synthetic DNA binding molecules. Thus, increasing the specificity and affinity of ZFDBDs will have a significant impact on their use in analytical or therapeutic settings. © 2015 Wiley Periodicals, Inc.

  13. SYNTHESIS, CHARACTERIZATION AND CRYSTAL STRUCTURE ...

    African Journals Online (AJOL)

    Preferred Customer

    The Mo atom in the complex is in octahedral coordination. Thermal stability of the complex has also been studied. KEY WORDS: Molybdenum complex, Hydrazone ligand, Crystal structure, X-ray diffraction, Thermal property. INTRODUCTION. Coordination chemistry of molybdenum(VI) has attracted considerable attention ...

  14. Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

    Science.gov (United States)

    Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

    2016-08-02

    MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. The interaction of membrane DNA-binding protein with DNA

    Science.gov (United States)

    Gabrielyan, A. G.; Arakhelyan, H. H.; Zakharyan, R. A.

    1994-07-01

    A 31-kDa protein specifically binding to double-stranded DNA (ds-DNA) was isolated from plasmatic membranes of rat liver cells by means of affinity chromatography and high performance liquid chromatography (HPLC). Some of the properties of this protein were determined. Judging by the UV and circular dichroism spectroscopic data, the protein forms a complex with DNA, stabilizing its native structure, mainly in the regions rich in AT pairs. The 31-kDa protein-pAO3 plasmid DNA binding constant was determined by nitrocellulose filter analysis of protein labelled DNA complexes. The results obtained correspond to cooperative binding with DNA molecules of extended interacting ligands, having AT specificity. A possible role of the 31-kDa protein in DNA transmembrane transition processes is discussed.

  16. Design of sequence-specific DNA-binding molecules.

    Science.gov (United States)

    Dervan, P B

    1986-04-25

    Base sequence information can be stored in the local structure of right-handed double-helical DNA (B-DNA). The question arises as to whether a set of rules for the three-dimensional readout of the B-DNA helix can be developed. This would allow the design of synthetic molecules that bind DNA of any specific sequence and site size. There are four stages of development for each new synthetic sequence-specific DNA-binding molecule: design, synthesis, testing for sequence specificity, and reevaluation of the design. This approach has produced bis(distamycin)fumaramide, a synthetic, crescent-shaped oligopeptide that binds nine contiguous adenine-thymine base pairs in the minor groove of double-helical DNA.

  17. nDNA-Prot: identification of DNA-binding proteins based on unbalanced classification.

    Science.gov (United States)

    Song, Li; Li, Dapeng; Zeng, Xiangxiang; Wu, Yunfeng; Guo, Li; Zou, Quan

    2014-09-08

    DNA-binding proteins are vital for the study of cellular processes. In recent genome engineering studies, the identification of proteins with certain functions has become increasingly important and needs to be performed rapidly and efficiently. In previous years, several approaches have been developed to improve the identification of DNA-binding proteins. However, the currently available resources are insufficient to accurately identify these proteins. Because of this, the previous research has been limited by the relatively unbalanced accuracy rate and the low identification success of the current methods. In this paper, we explored the practicality of modelling DNA binding identification and simultaneously employed an ensemble classifier, and a new predictor (nDNA-Prot) was designed. The presented framework is comprised of two stages: a 188-dimension feature extraction method to obtain the protein structure and an ensemble classifier designated as imDC. Experiments using different datasets showed that our method is more successful than the traditional methods in identifying DNA-binding proteins. The identification was conducted using a feature that selected the minimum Redundancy and Maximum Relevance (mRMR). An accuracy rate of 95.80% and an Area Under the Curve (AUC) value of 0.986 were obtained in a cross validation. A test dataset was tested in our method and resulted in an 86% accuracy, versus a 76% using iDNA-Prot and a 68% accuracy using DNA-Prot. Our method can help to accurately identify DNA-binding proteins, and the web server is accessible at http://datamining.xmu.edu.cn/~songli/nDNA. In addition, we also predicted possible DNA-binding protein sequences in all of the sequences from the UniProtKB/Swiss-Prot database.

  18. SUMO-1 possesses DNA binding activity

    Directory of Open Access Journals (Sweden)

    Wieruszeski Jean-Michel

    2010-05-01

    Full Text Available Abstract Background Conjugation of small ubiquitin-related modifiers (SUMOs is a frequent post-translational modification of proteins. SUMOs can also temporally associate with protein-targets via SUMO binding motifs (SBMs. Protein sumoylation has been identified as an important regulatory mechanism especially in the regulation of transcription and the maintenance of genome stability. The precise molecular mechanisms by which SUMO conjugation and association act are, however, not understood. Findings Using NMR spectroscopy and protein-DNA cross-linking experiments, we demonstrate here that SUMO-1 can specifically interact with dsDNA in a sequence-independent fashion. We also show that SUMO-1 binding to DNA can compete with other protein-DNA interactions at the example of the regulatory domain of Thymine-DNA Glycosylase and, based on these competition studies, estimate the DNA binding constant of SUMO1 in the range 1 mM. Conclusion This finding provides an important insight into how SUMO-1 might exert its activity. SUMO-1 might play a general role in destabilizing DNA bound protein complexes thereby operating in a bottle-opener way of fashion, explaining its pivotal role in regulating the activity of many central transcription and DNA repair complexes.

  19. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  20. Tuning genetic clocks employing DNA binding sites.

    Directory of Open Access Journals (Sweden)

    Shridhar Jayanthi

    Full Text Available Periodic oscillations play a key role in cell physiology from the cell cycle to circadian clocks. The interplay of positive and negative feedback loops among genes and proteins is ubiquitous in these networks. Often, delays in a negative feedback loop and/or degradation rates are a crucial mechanism to obtain sustained oscillations. How does nature control delays and kinetic rates in feedback networks? Known mechanisms include proper selection of the number of steps composing a feedback loop and alteration of protease activity, respectively. Here, we show that a remarkably simple means to control both delays and effective kinetic rates is the employment of DNA binding sites. We illustrate this design principle on a widely studied activator-repressor clock motif, which is ubiquitous in natural systems. By suitably employing DNA target sites for the activator and/or the repressor, one can switch the clock "on" and "off" and precisely tune its period to a desired value. Our study reveals a design principle to engineer dynamic behavior in biomolecular networks, which may be largely exploited by natural systems and employed for the rational design of synthetic circuits.

  1. Crystal Structures of the Reduced, Sulfenic Acid, and Mixed Disulfide Forms of SarZ, a Redox Active Global Regulator in Staphylococcus aureus

    Energy Technology Data Exchange (ETDEWEB)

    Poor, Catherine B.; Chen, Peng R.; Duguid, Erica; Rice, Phoebe A.; He, Chuan; (UC)

    2010-01-20

    SarZ is a global transcriptional regulator that uses a single cysteine residue, Cys{sup 13}, to sense peroxide stress and control metabolic switching and virulence in Staphylococcus aureus. SarZ belongs to the single-cysteine class of OhrR-MgrA proteins that play key roles in oxidative resistance and virulence regulation in various bacteria. We present the crystal structures of the reduced form, sulfenic acid form, and mixed disulfide form of SarZ. Both the sulfenic acid and mixed disulfide forms are structurally characterized for the first time for this class of proteins. The Cys{sup 13} sulfenic acid modification is stabilized through two hydrogen bonds with surrounding residues, and the overall DNA-binding conformation is retained. A further reaction of the Cys{sup 13} sulfenic acid with an external thiol leads to formation of a mixed disulfide bond, which results in an allosteric change in the DNA-binding domains, disrupting DNA binding. Thus, the crystal structures of SarZ in three different states provide molecular level pictures delineating the mechanism by which this class of redox active regulators undergoes activation. These structures help to understand redox-mediated virulence regulation in S. aureus and activation of the MarR family proteins in general.

  2. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair

    NARCIS (Netherlands)

    W.L. de Laat (Wouter); E. Appeldoorn (Esther); K. Sugasawa (Kaoru); E.P.W.C. Weterings (Eric); J.H.J. Hoeijmakers (Jan); N.G.J. Jaspers (Nicolaas)

    1998-01-01

    textabstractThe human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a

  3. DNA binding and cleavage activity by a mononuclear iron (II) Schiff ...

    Indian Academy of Sciences (India)

    DNA binding and cleavage activity by a mononuclear iron(II)Schiff base complex: Synthesis and structural characterization. Abhijit Pal Bhaskar Biswas Merry Mitra Subramaniyam Rajalakshmi Chandra Shekhar Purohit Soumitra Hazra Gopinatha Suresh Kumar Balachandran Unni Nair Rajarshi Ghosh. Volume 125 Issue 5 ...

  4. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

    2005-01-01

    . The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...

  5. Nuclear structures: Twinning and modulation in crystals

    Science.gov (United States)

    Petříček, Václav; Dušek, Michal

    2017-10-01

    Crystal structure analysis is a standard technique routinely applied to single crystals as well as powders. However the process is not so straightforward if the crystal sample is affected by twinning or if the structure is modulated. In such cases the standard procedures are not directly applicable. The main purpose of this contribution is to show how to solve and refine such difficult structures. While for twinned structures the basic property of crystal - translation symmetry in three dimensional space-remains valid, for modulated crystals a special superspace theory must be exploited in order to describe the atomic structure with crystallographic methods generalized for superspace.

  6. Prospects of nanoparticle-DNA binding and its implications in medical biotechnology.

    Science.gov (United States)

    An, Hongjie; Jin, Bo

    2012-01-01

    Bio-nanotechnology is a new interdisciplinary R&D area that integrates engineering and physical science with biology through the development of multifunctional devices and systems, focusing biology inspired processes or their applications, in particular in medical biotechnology. DNA based nanotechnology, in many ways, has been one of the most intensively studied fields in recent years that involves the use and the creation of bio-inspired materials and their technologies for highly selective biosensing, nanoarchitecture engineering and nanoelectronics. Increasing researches have been offered to a fundamental understanding how the interactions between the nanoparticles and DNA molecules could alter DNA molecular structure and its biochemical activities. This minor review describes the mechanisms of the nanoparticle-DNA binding and molecular interactions. We present recent discoveries and research progresses how the nanoparticle-DNA binding could vary DNA molecular structure, DNA detection, and gene therapy. We report a few case studies associated with the application of the nanoparticle-DNA binding devices in medical detection and biotechnology. The potential impacts of the nanoparticles via DNA binding on toxicity of the microorganisms are briefly discussed. The nanoparticle-DNA interactions and their impact on molecular and microbial functionalities have only drown attention in recent a few years. The information presented in this review can provide useful references for further studies on biomedical science and technology. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Mutational analysis of the multiple-antibiotic resistance regulator MarR reveals a ligand binding pocket at the interface between the dimerization and DNA binding domains.

    Science.gov (United States)

    Duval, Valérie; McMurry, Laura M; Foster, Kimberly; Head, James F; Levy, Stuart B

    2013-08-01

    The Escherichia coli regulator MarR represses the multiple-antibiotic resistance operon marRAB and responds to phenolic compounds, including sodium salicylate, which inhibit its activity. Crystals obtained in the presence of a high concentration of salicylate indicated two possible salicylate sites, SAL-A and SAL-B. However, it was unclear whether these sites were physiologically significant or were simply a result of the crystallization conditions. A study carried out on MarR homologue MTH313 suggested the presence of a salicylate binding site buried at the interface between the dimerization and the DNA-binding domains. Interestingly, the authors of the study indicated a similar pocket conserved in the MarR structure. Since no mutagenesis analysis had been performed to test which amino acids were essential in salicylate binding, we examined the role of residues that could potentially interact with salicylate. We demonstrated that mutations in residues shown as interacting with salicylate at SAL-A and SAL-B in the MarR-salicylate structure had no effect on salicylate binding, indicating that these sites were not the physiological regulatory sites. However, some of these residues (P57, R86, M74, and R77) were important for DNA binding. Furthermore, mutations in residues R16, D26, and K44 significantly reduced binding to both salicylate and 2,4-dinitrophenol, while a mutation in residue H19 impaired the binding to 2,4-dinitrophenol only. These findings indicate, as for MTH313, the presence of a ligand binding pocket located between the dimerization and DNA binding domains.

  9. imide, crystal structure, thermal and dielectric studies

    Indian Academy of Sciences (India)

    IR and Raman spectroscopies and its crystal structure is confirmed by single crystal X-ray diffraction method. The X-ray studies on ... Di-cationic ionic liquids; crystal structure; dielectric; thermal properties. 1. Introduction. The chemistry of ionic ... exposed in various emerging areas as solvents of high tem- perature organic ...

  10. Crystal structure of 3-(diethylaminophenol

    Directory of Open Access Journals (Sweden)

    James A. Golen

    2015-12-01

    Full Text Available The title compound, C10H15NO, has two molecules in the asymmetric unit. Each molecule has a near-planar C8NO unit excluding H atoms and the terminal methyl groups on the diethylamino groups, with mean deviations from planarity of 0.036 and 0.063 Å. In the crystal, hydrogen bonding leads to four-membered O—H...O—H...O—H·· rings. No π–π interactions were observed in the structure.

  11. Synthesis, crystal structure, theoretical study and luminescence ...

    Indian Academy of Sciences (India)

    phenanthroline) has been synthesized and characterized by elemental analysis, infrared spectroscopy, ultraviolet-visible spectroscopy, X-ray single crystal analysis and fluorescent analysis. Its crystal structure is monoclinic with space group 2/ and ...

  12. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    Science.gov (United States)

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  13. DNA binding by Corynebacterium glutamicum TetR-type transcription regulator AmtR

    Directory of Open Access Journals (Sweden)

    Sticht Heinrich

    2009-07-01

    Full Text Available Abstract Background The TetR family member AmtR is the central regulator of nitrogen starvation response in Corynebacterium glutamicum. While the AmtR regulon was physiologically characterized in great detail up to now, mechanistic questions of AmtR binding were not addressed. This study presents a characterization of functionally important amino acids in the DNA binding domain of AmtR and of crucial nucleotides in the AmtR recognition motif. Results Site-directed mutagenesis, the characterization of corresponding mutant proteins by gel retardation assays and surface plasmon resonance and molecular modelling revealed several amino acids, which are directly involved in DNA binding, while others have more structural function. Furthermore, we could show that the spacing of the binding motif half sites is crucial for repression of transcription by AmtR. Conclusion Although the DNA binding domain of TetR-type repressors is highly conserved and a core binding motif was identified for AmtR and TetR(D, the AmtR binding domain shows individual properties compared to other TetR proteins. Besides by distinct amino acids of AmtR, DNA binding is influenced by nucleotides not only of the conserved binding motif but also by spacing nucleotides in C. glutamicum.

  14. Identification of a Second DNA Binding Site in the Human Rad52 Protein*S⃞

    Science.gov (United States)

    Kagawa, Wataru; Kagawa, Ako; Saito, Kengo; Ikawa, Shukuko; Shibata, Takehiko; Kurumizaka, Hitoshi; Yokoyama, Shigeyuki

    2008-01-01

    Rad52 plays essential roles in homology-dependent double-strand break repair. Various studies have established the functions of Rad52 in Rad51-dependent and Rad51-independent repair processes. However, the precise molecular mechanisms of Rad52 in these processes remain unknown. In the present study we have identified a novel DNA binding site within Rad52 by a structure-based alanine scan mutagenesis. This site is closely aligned with the putative single-stranded DNA binding site determined previously. Mutations in this site impaired the ability of the Rad52-single-stranded DNA complex to form a ternary complex with double-stranded DNA and subsequently catalyze the formation of D-loops. We found that Rad52 introduces positive supercoils into double-stranded DNA and that the second DNA binding site is essential for this activity. Our findings suggest that Rad52 aligns two recombining DNA molecules within the first and second DNA binding sites to stimulate the homology search and strand invasion processes. PMID:18593704

  15. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    Directory of Open Access Journals (Sweden)

    Sinara Mônica Vitalino de Almeida

    2015-06-01

    Full Text Available In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide derivatives (3a–h were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z-2-(acridin-9-ylmethylene-N- (4-chlorophenyl hydrazinecarbothioamide (3f, while the most active compound in antiproliferative assay was (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide (3a. There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties.

  16. Crystal Structure of NFAT Bound to the HIV-1 LTR Tandem κB Enhancer Element

    Energy Technology Data Exchange (ETDEWEB)

    Bates, Darren L.; Barthel, Kristen K.B.; Wu, Yongqing; Kalhor, Reza; Stroud, James C.; Giffin, Michael J.; Chen, Lin (UCLA); (Colorado)

    2008-05-27

    Here, we have determined the crystal structure of the DNA binding domain of NFAT bound to the HIV-1 long terminal repeat (LTR) tandem {kappa}B enhancer element of 3.05 {angstrom} resolution. NFAT binds as a dimer to the upstream {kappa}B site (Core II), but as a monomer to the 3' end of the downstream {kappa}B site (Core I). The DNA shows a significant bend near the 5' end of Core I, where a lysine residue from NFAT bound to the 3' end of Core II inserts into the minor groove and seems to cause DNA bases to flip out. Consistent with this structural feature, the 5' end of Core I become hypersensitive to dimethylsulfate in the in vivo footprinting upon transcriptional activation of the HIV-1 LTR. Our studies provide a basis for futher investigating the functional mechanism of NFAT in HIV-1 transcription and replication.

  17. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  18. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    Science.gov (United States)

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  19. DNA binding site analysis of Burkholderia thailandensis response regulators.

    Science.gov (United States)

    Nowak-Lovato, Kristy L; Hickmott, Alexana J; Maity, Tuhin S; Bulyk, Martha L; Dunbar, John; Hong-Geller, Elizabeth

    2012-07-01

    Bacterial response regulators (RR) that function as transcription factors in two component signaling pathways are crucial for ensuring tight regulation and coordinated expression of the genome. Currently, consensus DNA binding sites in the promoter for very few bacterial RRs have been identified. A systematic method to characterize these DNA binding sites for RRs would enable prediction of specific gene expression patterns in response to extracellular stimuli. To identify RR DNA binding sites, we functionally activated RRs using beryllofluoride and applied them to a protein-binding microarray (PBM) to discover DNA binding motifs for RRs expressed in Burkholderia, a Gram-negative bacterial genus. We identified DNA binding motifs for conserved RRs in Burkholderia thailandensis, including KdpE, RisA, and NarL, as well as for a previously uncharacterized RR at locus BTH_II2335 and its ortholog in the human pathogen Burkholderia pseudomallei at locus BPSS2315. We further demonstrate RR binding of predicted genomic targets for the two orthologs using gel shift assays and reveal a pattern of RR regulation of expression of self and other two component systems. Our studies illustrate the use of PBMs to identify DNA binding specificities for bacterial RRs and enable prediction of gene regulatory networks in response to two component signaling. Published by Elsevier B.V.

  20. Evidence on How a Conserved Glycine in the Hinge Region of HapR Regulates Its DNA Binding Ability: LESSONS FROM A NATURAL VARIANT.

    Energy Technology Data Exchange (ETDEWEB)

    M Dongre; N Singh; C Dureja; N Peddada; A Solanki; F Ashish; S Raychaudhuri

    2011-12-31

    HapR has been recognized as a quorum-sensing master regulator in Vibrio cholerae. Because it controls a plethora of disparate cellular events, the absence of a functional HapR affects the physiology of V. cholerae to a great extent. In the current study, we pursued an understanding of an observation of a natural protease-deficient non-O1, non-O139 variant V. cholerae strain V2. Intriguingly, a nonfunctional HapR (henceforth designated as HapRV2) harboring a substitution of glycine to aspartate at position 39 of the N-terminal hinge region has been identified. An in vitro gel shift assay clearly suggested the inability of HapRV2 to interact with various cognate promoters. Reinstatement of glycine at position 39 restores DNA binding ability of HapRV2 (HapRV2G), thereby rescuing the protease-negative phenotype of this strain. The elution profile of HapRV2 and HapRV2G proteins in size-exclusion chromatography and their circular dichroism spectra did not reflect any significant differences to explain the functional discrepancies between the two proteins. To gain insight into the structure-function relationship of these two proteins, we acquired small/wide angle x-ray scattering data from samples of the native and G39D mutant. Although Guinier analysis and indirect Fourier transformation of scattering indicated only a slight difference in the shape parameters, structure reconstruction using dummy amino acids concluded that although HapR adopts a 'Y' shape similar to its crystal structure, the G39D mutation in hinge drastically altered the DNA binding domains by bringing them in close proximity. This altered spatial orientation of the helix-turn-helix domains in this natural variant provides the first structural evidence on the functional role of the hinge region in quorum sensing-related DNA-binding regulatory proteins of Vibrio spp.

  1. Predicting DNA-binding sites of proteins from amino acid sequence

    Directory of Open Access Journals (Sweden)

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  2. Crystal Structure of a Eukaryotic GEN1 Resolving Enzyme Bound to DNA.

    Science.gov (United States)

    Liu, Yijin; Freeman, Alasdair D J; Déclais, Anne-Cécile; Wilson, Timothy J; Gartner, Anton; Lilley, David M J

    2015-12-22

    We present the crystal structure of the junction-resolving enzyme GEN1 bound to DNA at 2.5 Å resolution. The structure of the GEN1 protein reveals it to have an elaborated FEN-XPG family fold that is modified for its role in four-way junction resolution. The functional unit in the crystal is a monomer of active GEN1 bound to the product of resolution cleavage, with an extensive DNA binding interface for both helical arms. Within the crystal lattice, a GEN1 dimer interface juxtaposes two products, whereby they can be reconnected into a four-way junction, the structure of which agrees with that determined in solution. The reconnection requires some opening of the DNA structure at the center, in agreement with permanganate probing and 2-aminopurine fluorescence. The structure shows that a relaxation of the DNA structure accompanies cleavage, suggesting how second-strand cleavage is accelerated to ensure productive resolution of the junction. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Crystal Structure of a Eukaryotic GEN1 Resolving Enzyme Bound to DNA

    Directory of Open Access Journals (Sweden)

    Yijin Liu

    2015-12-01

    Full Text Available We present the crystal structure of the junction-resolving enzyme GEN1 bound to DNA at 2.5 Å resolution. The structure of the GEN1 protein reveals it to have an elaborated FEN-XPG family fold that is modified for its role in four-way junction resolution. The functional unit in the crystal is a monomer of active GEN1 bound to the product of resolution cleavage, with an extensive DNA binding interface for both helical arms. Within the crystal lattice, a GEN1 dimer interface juxtaposes two products, whereby they can be reconnected into a four-way junction, the structure of which agrees with that determined in solution. The reconnection requires some opening of the DNA structure at the center, in agreement with permanganate probing and 2-aminopurine fluorescence. The structure shows that a relaxation of the DNA structure accompanies cleavage, suggesting how second-strand cleavage is accelerated to ensure productive resolution of the junction.

  4. Analysis and classification of DNA-binding sites in single-stranded and double-stranded DNA-binding proteins using protein information.

    Science.gov (United States)

    Wang, Wei; Liu, Juan; Xiong, Yi; Zhu, Lida; Zhou, Xionghui

    2014-08-01

    Single-stranded DNA-binding proteins (SSBs) and double-stranded DNA-binding proteins (DSBs) play different roles in biological processes when they bind to single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). However, the underlying binding mechanisms of SSBs and DSBs have not yet been fully understood. Here, the authors firstly constructed two groups of ssDNA and dsDNA specific binding sites from two non-redundant sets of SSBs and DSBs. They further analysed the relationship between the two classes of binding sites and a newly proposed set of features (residue charge distribution, secondary structure and spatial shape). To assess and utilise the predictive power of these features, they trained a classification model using support vector machine to make predictions about the ssDNA and the dsDNA binding sites. The author's analysis and prediction results indicated that the two classes of binding sites can be distinguishable by the three types of features, and the final classifier using all the features achieved satisfactory performance. In conclusion, the proposed features will deepen their understanding of the specificity of proteins which bind to ssDNA or dsDNA.

  5. Crystal Structure of the VapBC Toxin–Antitoxin Complex from Shigella flexneri Reveals a Hetero-Octameric DNA-Binding Assembly

    DEFF Research Database (Denmark)

    Dienemann, Christian; Bøggild, Andreas; Winther, Kristoffer S.

    2011-01-01

    Toxin–antitoxin (TA) loci are common in archaea and prokaryotes and allow cells to rapidly adapt to changing environmental conditions through release of active regulators of metabolism. Many toxins are endonucleases that target cellular mRNA and tRNAs, while the antitoxins tightly wrap around...

  6. Crystal Structure of Deinococcus radiodurans RecQ Helicase Catalytic Core Domain: The Interdomain Flexibility

    Directory of Open Access Journals (Sweden)

    Sheng-Chia Chen

    2014-01-01

    Full Text Available RecQ DNA helicases are key enzymes in the maintenance of genome integrity, and they have functions in DNA replication, recombination, and repair. In contrast to most RecQs, RecQ from Deinococcus radiodurans (DrRecQ possesses an unusual domain architecture that is crucial for its remarkable ability to repair DNA. Here, we determined the crystal structures of the DrRecQ helicase catalytic core and its ADP-bound form, revealing interdomain flexibility in its first RecA-like and winged-helix (WH domains. Additionally, the WH domain of DrRecQ is positioned in a different orientation from that of the E. coli RecQ (EcRecQ. These results suggest that the orientation of the protein during DNA-binding is significantly different when comparing DrRecQ and EcRecQ.

  7. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ruoxi [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Wang, Dang; Cai, Kaimei; Zhang, Huan [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Xie, Lilan; Li, Yi [College of Life Science and Technology, Wuhan Institute of Bioengineering, Wuhan 430415 (China); Chen, Huanchun; Xiao, Shaobo [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China)

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.

  8. Synthesis, crystal structure, thermal analysis and dielectric ...

    Indian Academy of Sciences (India)

    In both the materials, the crystal structure has been determined by X-ray single crystal analysis at room temperature (293 K). The compound structures consist of K + (or NH 4 + ) cations and double chains of CdCl 6 octahedra sharing one edge extending along b -axis. The mixture of KA + /NH 4 + cations are located ...

  9. Crystal structure and hydrogen bonding interactions

    Indian Academy of Sciences (India)

    Giacovazzo C, Guagliardi A, Moliteni A G G, Polidori. G and Spagna R 1997 SIR97 (Release 1.02) - A program for automatic solution and refinement of crystal structure. 10. Sheldrick G M 1997 SHELXL-97, Programs for Crystal. Structure Analysis; University of Göttingen, Germany. 11. ORTEP3 for Windows and Farrugia L J ...

  10. Photonic crystal laser-driven accelerator structures

    CERN Document Server

    Cowan, Benjamin

    2005-01-01

    We discuss simulated photonic crystal structure designs, including two- and three-dimensional planar structures and fibers. The discussion of 2D structures demonstrates guiding of a speed-of-light accelerating mode by a defect in a photonic crystal lattice and reveals design considerations and trade-offs. With a three-dimensional lattice, we introduce a candidate geometry and discuss beam dynamics, coupling, and manufacturing techniques for that structure. In addition we discuss W-band scale tests of photonic crystal structures. The computational methods are also discussed.

  11. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  12. Crystal structure of 2-pentyloxybenzamide

    Directory of Open Access Journals (Sweden)

    Bernhard Bugenhagen

    2014-10-01

    Full Text Available In the title molecule, C12H17NO2, the amide NH2 group is oriented toward the pentyloxy substituent and an intramolecular N—H...O hydrogen bond is formed with the pentyloxy O atom. The benzene ring forms dihedral angles of 2.93 (2 and 5.60 (2° with the amide group and the pentyloxy group mean planes, respectively. In the crystal, molecules are linked by pairs of N—H...O hydrogen bonds, forming inversion dimers with their molecular planes parallel, but at an offset of 0.45 (1 Å to each other. These dimers are ordered into two types of symmetry-related columns extended along the a axis, with the mean plane of one set of dimers in a column approximately parallel to (121 and the other in a column approximately parallel to (1-21. The two planes form a dihedral angle of 85.31 (2°, and are linked via C—H...O hydrogen bonds and C—H...π interactions, forming a three-dimensional framework structure.

  13. Method of fabricating patterned crystal structures

    KAUST Repository

    Yu, Liyang

    2016-12-15

    A method of manufacturing a patterned crystal structure for includes depositing an amorphous material. The amorphous material is modified such that a first portion of the amorphous thin-film layer has a first height/volume and a second portion of the amorphous thin-film layer has a second height/volume greater than the first portion. The amorphous material is annealed to induce crystallization, wherein crystallization is induced in the second portion first due to the greater height/volume of the second portion relative to the first portion to form patterned crystal structures.

  14. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    Science.gov (United States)

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  15. Cloning of two sea urchin DNA-binding proteins involved in mitochondrial DNA replication and transcription.

    Science.gov (United States)

    Loguercio Polosa, Paola; Megli, Fiammetta; Di Ponzio, Barbara; Gadaleta, Maria Nicola; Cantatore, Palmiro; Roberti, Marina

    2002-03-06

    The cloning of the cDNA for two mitochondrial proteins involved in sea urchin mtDNA replication and transcription is reported here. The cDNA for the mitochondrial D-loop binding protein (mtDBP) from the sea urchin Strongylocentrotus purpuratus has been cloned by a polymerase chain reaction-based approach. The protein displays a very high similarity with the Paracentrotus lividus homologue as it contains also the two leucine zipper-like domains which are thought to be involved in intramolecular interactions needed to expose the two DNA binding domains in the correct position for contacting DNA. The cDNA for the mitochondrial single-stranded DNA-binding protein (mtSSB) from P. lividus has been also cloned by a similar approach. The precursor protein is 146 amino acids long with a presequence of 16 residues. The deduced amino acid sequence shows the highest homology with the Xenopus laevis protein and the lowest with the Drosophila mtSSB. The computer modeling of the tertiary structure of P. lividus mtSSB shows a structure very similar to that experimentally determined for human mtSSB, with the conservation of the main residues involved in protein tetramerization and in DNA binding.

  16. Solution-state NMR investigation of DNA binding interactions in Escherichia coli formamidopyrimidine-DNA glycosylase (Fpg): a dynamic description of the DNA/protein interface.

    Science.gov (United States)

    Buchko, Garry W; McAteer, Kathleen; Wallace, Susan S; Kennedy, Michael A

    2005-03-02

    Formamidopyrimidine-DNA glycosylase (Fpg) is a base excision repair (BER) protein that removes oxidative DNA lesions. Recent crystal structures of Fpg bound to DNA revealed residues involved in damage recognition and enzyme catalysis, but failed to shed light on the dynamic nature of the processes. To examine the structural and dynamic changes that occur in solution when Fpg binds DNA, NMR spectroscopy was used to study Escherichia coli Fpg free in solution and bound to a double-stranded DNA oligomer containing 1,3-propanediol (13-PD), a non-hydrolyzable abasic-site analogue. Only 209 out of a possible 251 (83%) free-precession 15N/1H HSQC cross peaks were observed and 180 of these were assignable, indicating that approximately 30% of the residues undergo intermediate motion on the NMR timescale, broadening the resonances beyond detection or making them intractable in backbone assignment experiments. The majority of these affected residues were in the polypeptide linker region and the interface between the N- and C-terminal domains. DNA titration experiments revealed line broadening and chemical shift perturbations for backbone amides nearby and distant from the DNA binding surface, but failed to quench the intermediate timescale motion observed for free Fpg, including those residues directly involved in DNA binding, notwithstanding a nanomolar dissociation constant for 13-PD binding. Indeed, after binding to 13-PD, at least approximately 40% of the Fpg residues undergo intermediate timescale motion even though all other residues exhibit tight DNA binding characteristic of slow exchange. CPMG-HSQC experiments revealed millisecond to microsecond motion for the backbone amides of D91 and H92 that were quenched upon binding 13-PD. In free Fpg, heteronuclear 1H-15N NOE experiments detected picosecond timescale backbone motion in the alphaF-beta9 loop, the region primarily responsible for chemically discriminating 8-oxoguanine (8-oxoG) over normal guanine, that was

  17. Breakage-reunion domain of Streptococcus pneumoniae topoisomerase IV: crystal structure of a gram-positive quinolone target.

    Directory of Open Access Journals (Sweden)

    Ivan Laponogov

    2007-03-01

    Full Text Available The 2.7 A crystal structure of the 55-kDa N-terminal breakage-reunion domain of topoisomerase (topo IV subunit A (ParC from Streptococcus pneumoniae, the first for the quinolone targets from a gram-positive bacterium, has been solved and reveals a 'closed' dimer similar in fold to Escherichia coli DNA gyrase subunit A (GyrA, but distinct from the 'open' gate structure of Escherichia coli ParC. Unlike GyrA whose DNA binding groove is largely positively charged, the DNA binding site of ParC exhibits a distinct pattern of alternating positively and negatively charged regions coincident with the predicted positions of the grooves and phosphate backbone of DNA. Based on the ParC structure, a new induced-fit model for sequence-specific recognition of the gate (G segment by ParC has been proposed. These features may account for the unique DNA recognition and quinolone targeting properties of pneumococcal type II topoisomerases compared to their gram-negative counterparts.

  18. Crystal structure and morphology of syndiotactic polypropylene single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bu, J.Z. [GE Plastics, Washington, WV (United States); Cheng, S.Z.D. [Univ. of Akron, OH (United States)

    1996-12-31

    In the past several years there have been an increased interest in the crystal structure and morphology of s-PP due to the new development of homogeneous metallocene catalysts which can produce s-PP having a high stereoregularity. In this research, the crystal structure and morphology of s-PP single crystals grown from the melt were investigated. A series of ten fractions of s-PP was studied with different molecular weights ranging from 10,300 to 234,000 (g/mol). These fractions all possess narrow molecular weight distributions (around 1.1-1.2) and high syndiotacticities ([r]{approximately}95%). The main techniques employed including transmission electron microscopy (TEM), atomic force microscopy (AFM), wide-angle X-ray diffraction (WAXD), and small-angle X-ray scattering (SAXS).

  19. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  20. Investigation of the complex structure, comparative DNA-binding and DNA cleavage of two water-soluble mono-nuclear lanthanum(III) complexes and cytotoxic activity of chitosan-coated magnetic nanoparticles as drug delivery for the complexes

    Science.gov (United States)

    Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya

    2017-05-01

    Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.

  1. Spectral characterization and DNA binding properties of lanthanide(III)

    African Journals Online (AJOL)

    ... with CT-DNA was investigated using absorption spectrophotometry. Based on spectral changes, groove binding of complexes to DNA is suggested. KEY WORDS: Lanthanide(III) complexes, 2-Acetylpyridine isonicotinoylhydrazone, Spectral characterization, DNA binding. Bull. Chem. Soc. Ethiop. 2016, 30(2), 221-230.

  2. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    Six new Ru(II) and Ru(III) complexes have been synthesized and characterized by elemental analysis, LC-MS, electronic spectra, IR spectra and magnetic moment measurements. DNA-binding properties of Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements as well as ...

  3. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    Abstract. Six new Ru(II) and Ru(III) complexes have been synthesized and characterized by elemental ana- lysis, LC-MS, electronic spectra, IR spectra and magnetic moment measurements. DNA-binding properties of. Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements ...

  4. Synthesis, DNA binding and cytotoxic evaluation of aminoquinoline ...

    Indian Academy of Sciences (India)

    DNA binding studies of selected isomeric compounds showed interaction withDNA via intercalation mode with higher binding affinity of 4-substituted ... Universiti Sains Malaysia, Minden 11800, Penang, Malaysia; New Drug Discovery Research, Department of Medicinal Chemistry, Alwar Pharmacy College, Alwar, ...

  5. Prediction of DNA-binding specificity in zinc finger proteins

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Zinc finger proteins interact via their individual fingers to three base pair subsites on the target DNA. The four key ... [Roy S, Dutta S, Khanna K, Singla S and Sundar D 2012 Prediction of DNA-binding specificity in zinc finger proteins. J. Biosci. .... well as protection from HIV infection (Reynolds, et al. 2003).

  6. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods.

    Science.gov (United States)

    Qu, Kaiyang; Han, Ke; Wu, Song; Wang, Guohua; Wei, Leyi

    2017-09-22

    DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF), is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  7. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods

    Directory of Open Access Journals (Sweden)

    Kaiyang Qu

    2017-09-01

    Full Text Available DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF, is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  8. Human single-stranded DNA binding proteins are essential for maintaining genomic stability

    Science.gov (United States)

    2013-01-01

    The double-stranded conformation of cellular DNA is a central aspect of DNA stabilisation and protection. The helix preserves the genetic code against chemical and enzymatic degradation, metabolic activation, and formation of secondary structures. However, there are various instances where single-stranded DNA is exposed, such as during replication or transcription, in the synthesis of chromosome ends, and following DNA damage. In these instances, single-stranded DNA binding proteins are essential for the sequestration and processing of single-stranded DNA. In order to bind single-stranded DNA, these proteins utilise a characteristic and evolutionary conserved single-stranded DNA-binding domain, the oligonucleotide/oligosaccharide-binding (OB)-fold. In the current review we discuss a subset of these proteins involved in the direct maintenance of genomic stability, an important cellular process in the conservation of cellular viability and prevention of malignant transformation. We discuss the central roles of single-stranded DNA binding proteins from the OB-fold domain family in DNA replication, the restart of stalled replication forks, DNA damage repair, cell cycle-checkpoint activation, and telomere maintenance. PMID:23548139

  9. Thermodynamic effects of multiple protein conformations on stability and DNA binding.

    Science.gov (United States)

    Inaba, Satomi; Fukada, Harumi; Ikegami, Takahisa; Oda, Masayuki

    2013-09-15

    The side-chain conformations of amino acids in the hydrophobic core are important for protein folding and function. A previous NMR study has shown that a mutant protein of transcriptional activator c-Myb, I155L/I181L R3, has multiple conformations and increased fluctuation in comparison with the wild type. To elucidate the quantitative correlation of structural fluctuation with stability and function, we analyzed the thermodynamic effects of I155L and I181L mutations, using R2R3 that encompasses the minimum specific DNA-binding region. Circular dichroism and differential scanning calorimetry measurements showed that the mutation of I155L had little effect on stability, while the I181L mutation significantly destabilized the protein. It is noteworthy that the decreased stability resulting from the I181L mutation was mainly due to decreased enthalpy change, which is partially compensated by decreased entropy change. Isothermal titration calorimetry measurements showed that the specific DNA-binding affinity was decreased owing to the I181L mutation, which was due to decreased binding entropy change. Entropy in the folded state, which corresponds to the DNA-free state, increases due to the I181L mutation because of the increased conformational fluctuation observed in I155L/I181L mutant of R2R3 by CLEANEX-PM NMR analysis, which in turn results in decreased folding entropy and DNA-binding entropy changes. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Ryzhikov, Mikhail; Koroleva, Olga; Postnov, Dmitri; Tran, Andrew; Korolev, Sergey (St. Louis-MED)

    2011-08-25

    RecO is a recombination mediator protein (RMP) important for homologous recombination, replication repair and DNA annealing in bacteria. In all pathways, the single-stranded (ss) DNA binding protein, SSB, plays an inhibitory role by protecting ssDNA from annealing and recombinase binding. Conversely, SSB may stimulate each reaction through direct interaction with RecO. We present a crystal structure of Escherichia coli RecO bound to the conserved SSB C-terminus (SSB-Ct). SSB-Ct binds the hydrophobic pocket of RecO in a conformation similar to that observed in the ExoI/SSB-Ct complex. Hydrophobic interactions facilitate binding of SSB-Ct to RecO and RecO/RecR complex in both low and moderate ionic strength solutions. In contrast, RecO interaction with DNA is inhibited by an elevated salt concentration. The SSB mutant lacking SSB-Ct also inhibits RecO-mediated DNA annealing activity in a salt-dependent manner. Neither RecO nor RecOR dissociates SSB from ssDNA. Therefore, in E. coli, SSB recruits RMPs to ssDNA through SSB-Ct, and RMPs are likely to alter the conformation of SSB-bound ssDNA without SSB dissociation to initiate annealing or recombination. Intriguingly, Deinococcus radiodurans RecO does not bind SSB-Ct and weakly interacts with the peptide in the presence of RecR, suggesting the diverse mechanisms of DNA repair pathways mediated by RecO in different organisms.

  11. Crystal structure of the RNA 2'-phosphotransferase from Aeropyrum pernix K1.

    Science.gov (United States)

    Kato-Murayama, Miyuki; Bessho, Yoshitaka; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2005-04-29

    In the final step of tRNA splicing, the 2'-phosphotransferase catalyzes the transfer of the extra 2'-phosphate from the precursor-ligated tRNA to NAD. We have determined the crystal structure of the 2'-phosphotransferase protein from Aeropyrum pernix K1 at 2.8 Angstroms resolution. The structure of the 2'-phosphotransferase contains two globular domains (N and C-domains), which form a cleft in the center. The N-domain has the winged helix motif, a subfamily of the helix-turn-helix family, which is shared by many DNA-binding proteins. The C-domain of the 2'-phosphotransferase superimposes well on the NAD-binding fold of bacterial (diphtheria) toxins, which catalyze the transfer of ADP ribose from NAD to target proteins, indicating that the mode of NAD binding by the 2'-phosphotransferase could be similar to that of the bacterial toxins. The conserved basic residues are assembled at the periphery of the cleft and could participate in the enzyme contact with the sugar-phosphate backbones of tRNA. The modes by which the two functional domains recognize the two different substrates are clarified by the present crystal structure of the 2'-phosphotransferase.

  12. Crystal structure of the multiple antibiotic resistance regulator MarR from Clostridium difficile.

    Science.gov (United States)

    Peng, J W; Yuan, H; Tan, X S

    2017-06-01

    Regulators of multiple antibiotic resistance (MarRs) are key players against toxins in prokaryotes. MarR homologues have been identified in many bacterial and archaeal species which pose daunting antibiotic resistance issues that threaten public health. The continuous prevalence of Clostridium difficile infection (CDI) throughout the world is associated with the abuse of antibiotics, and antibiotic treatments of CDI have limited effect. In the genome of C. difficile strain 630, the marR gene (ID 4913953) encodes a MarR protein. Here, MarR from C. difficile (MarRC.difficile) was subcloned and crystallized for the first time. MarRC.difficile was successfully expressed in Escherichia coli in a soluble form and was purified to near-homogeneity (>95%) by a two-step purification protocol. The structure of MarRC.difficile has been solved at 2.3 Å resolution. The crystal belonged to the monoclinic space group P43212, with unit-cell parameters a = b = 66.569, c = 83.654 Å. The structure reported reveals MarRC.difficile to be a dimer, with each subunit consisting of six α-helices and three antiparallel β-hairpins. MarRC.difficile shows high structural similarity to the MarR proteins from E. coli and Staphylococcus aureus, indicating that MarRC.difficile might be a DNA-binding protein.

  13. Lessons from crystal structures of kainate receptors

    DEFF Research Database (Denmark)

    Møllerud, Stine; Frydenvang, Karla Andrea; Pickering, Darryl S

    2017-01-01

    -length structure has been determined of GluK2 by cryo electron microscopy to 7.6 Å resolution as well as 84 high-resolution crystal structures of N-terminal domains and ligand-binding domains, including agonist and antagonist bound structures, modulatory ions and mutations. However, there are still many unanswered...

  14. Crystal structure of cyclohexylammonium thiocyanate

    OpenAIRE

    Abdulaziz A. Bagabas; Sultan B. Alhoshan; Hazem A. Ghabbour; C. S. Chidan Kumar; Hoong-Kun Fun

    2015-01-01

    In the title salt, C6H11NH3 +?SCN?, the cyclo?hexyl?ammonium ring adopts a slightly distorted chair conformation. The ammonium group occupies an equatorial position to minimize 1,3 and 1,5 diaxial inter?actions. In the crystal, the components are linked by N?H?N and N?H?S hydrogen-bonding inter?actions, resulting in a three-dimensional network.

  15. Crystal structure of cyclohexylammonium thiocyanate

    Directory of Open Access Journals (Sweden)

    Abdulaziz A. Bagabas

    2015-01-01

    Full Text Available In the title salt, C6H11NH3+·SCN−, the cyclohexylammonium ring adopts a slightly distorted chair conformation. The ammonium group occupies an equatorial position to minimize 1,3 and 1,5 diaxial interactions. In the crystal, the components are linked by N—H...N and N—H...S hydrogen-bonding interactions, resulting in a three-dimensional network.

  16. Crystal structure from one-electron theory

    DEFF Research Database (Denmark)

    Skriver, H. L.

    1985-01-01

    The authors have studied the crystal structure of all the 3d, 4d, and 5d transition metals at zero pressure and temperature by means of the linear muffin-tin orbital method and Andersen's force theorem. They find that, although the structural energy differences seem to be overestimated by the the......The authors have studied the crystal structure of all the 3d, 4d, and 5d transition metals at zero pressure and temperature by means of the linear muffin-tin orbital method and Andersen's force theorem. They find that, although the structural energy differences seem to be overestimated...

  17. Crystal structure of endonuclease G in complex with DNA reveals how it nonspecifically degrades DNA as a homodimer.

    Science.gov (United States)

    Lin, Jason L J; Wu, Chyuan-Chuan; Yang, Wei-Zen; Yuan, Hanna S

    2016-12-01

    Endonuclease G (EndoG) is an evolutionarily conserved mitochondrial protein in eukaryotes that digests nucleus chromosomal DNA during apoptosis and paternal mitochondrial DNA during embryogenesis. Under oxidative stress, homodimeric EndoG becomes oxidized and converts to monomers with diminished nuclease activity. However, it remains unclear why EndoG has to function as a homodimer in DNA degradation. Here, we report the crystal structure of the Caenorhabditis elegans EndoG homologue, CPS-6, in complex with single-stranded DNA at a resolution of 2.3 Å. Two separate DNA strands are bound at the ββα-metal motifs in the homodimer with their nucleobases pointing away from the enzyme, explaining why CPS-6 degrades DNA without sequence specificity. Two obligatory monomeric CPS-6 mutants (P207E and K131D/F132N) were constructed, and they degrade DNA with diminished activity due to poorer DNA-binding affinity as compared to wild-type CPS-6. Moreover, the P207E mutant exhibits predominantly 3'-to-5' exonuclease activity, indicating a possible endonuclease to exonuclease activity change. Thus, the dimer conformation of CPS-6 is essential for maintaining its optimal DNA-binding and endonuclease activity. Compared to other non-specific endonucleases, which are usually monomeric enzymes, EndoG is a unique dimeric endonuclease, whose activity hence can be modulated by oxidation to induce conformational changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Crystal structure of the N-terminal domain of human SIRT7 reveals a three-helical domain architecture.

    Science.gov (United States)

    Priyanka, Anu; Solanki, Vipul; Parkesh, Raman; Thakur, Krishan Gopal

    2016-10-01

    Human SIRT7 is an NAD(+) dependent deacetylase, which belongs to sirtuin family of proteins. SIRT7, like other sirtuins has conserved catalytic domain and is flanked by N- and C-terminal domains reported to play vital functional roles. Here, we report the crystal structure of the N-terminal domain of human SIRT7 (SIRT7(NTD) ) at 2.3 Å resolution as MBP-SIRT7(NTD) fusion protein. SIRT7(NTD) adopts three-helical domain architecture and comparative structural analyses suggest similarities to some DNA binding motifs and transcription regulators. We also report here the importance of N- and C-terminal domains in soluble expression of SIRT7. Proteins 2016; 84:1558-1563. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Crystal structure of archaeal chromatin protein Alba2-double-stranded DNA complex from Aeropyrum pernix K1.

    Science.gov (United States)

    Tanaka, Tomoyuki; Padavattan, Sivaraman; Kumarevel, Thirumananseri

    2012-03-23

    All thermophilic and hyperthermophilic archaea encode homologs of dimeric Alba (Sac10b) proteins that bind cooperatively at high density to DNA. Here, we report the 2.0 Å resolution crystal structure of an Alba2 (Ape10b2)-dsDNA complex from Aeropyrum pernix K1. A rectangular tube-like structure encompassing duplex DNA reveals the positively charged residues in the monomer-monomer interface of each dimer packing on either side of the bound dsDNA in successive minor grooves. The extended hairpin loop connecting strands β3 and β4 undergoes significant conformational changes upon DNA binding to accommodate the other Alba2 dimer during oligomerization. Mutational analysis of key interacting residues confirmed the specificity of Alba2-dsDNA interactions.

  20. Crystal Structure of Archaeal Chromatin Protein Alba2-Double-stranded DNA Complex from Aeropyrum pernix K1*

    Science.gov (United States)

    Tanaka, Tomoyuki; Padavattan, Sivaraman; Kumarevel, Thirumananseri

    2012-01-01

    All thermophilic and hyperthermophilic archaea encode homologs of dimeric Alba (Sac10b) proteins that bind cooperatively at high density to DNA. Here, we report the 2.0 Å resolution crystal structure of an Alba2 (Ape10b2)-dsDNA complex from Aeropyrum pernix K1. A rectangular tube-like structure encompassing duplex DNA reveals the positively charged residues in the monomer-monomer interface of each dimer packing on either side of the bound dsDNA in successive minor grooves. The extended hairpin loop connecting strands β3 and β4 undergoes significant conformational changes upon DNA binding to accommodate the other Alba2 dimer during oligomerization. Mutational analysis of key interacting residues confirmed the specificity of Alba2-dsDNA interactions. PMID:22334696

  1. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  2. Unexpected regiospecific formation and DNA binding of new 3 ...

    Indian Academy of Sciences (India)

    DOI 10.1007/s12039-015-1023-7. Unexpected regiospecific formation and DNA binding of new. 3-(acridin-9-yl)methyl-2-iminothiazolidin-4-ones. JÁN IMRICHa∗, DANICA SABOLOVÁb, MÁRIA VILKOVÁa and JÚLIA KUDLÁ ˇCOVÁb. aDepartment of Organic Chemistry bDepartment of Biochemistry, Institute of Chemistry,.

  3. Retinoblastoma-binding Protein 1 Has an Interdigitated Double Tudor Domain with DNA Binding Activity*

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-01-01

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10–100 μm; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1. PMID:24379399

  4. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  5. Tailoring quantum structures for active photonic crystals

    DEFF Research Database (Denmark)

    Kuznetsova, Nadezda

    This work is dedicated to the tailoring of quantum structures, with particular attention to the integration of selective area grown (SAG) active material into photonic crystal (PhC) slabs. The platform based on active PhC is vital to the realization of highly efficient elements with low energy......; in particular, the emission control of SAG QW matched the operating wavelength of photonic crystals. A strong photoluminescence signal in the slow light regime with the group index of 18 was demonstrated....

  6. The crystal structures of apo and cAMP-bound GlxR from Corynebacterium glutamicum reveal structural and dynamic changes upon cAMP binding in CRP/FNR family transcription factors.

    Science.gov (United States)

    Townsend, Philip D; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A; Cole, Stewart T; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J; Pohl, Ehmke

    2014-01-01

    The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition.

  7. The crystal structures of apo and cAMP-bound GlxR from Corynebacterium glutamicum reveal structural and dynamic changes upon cAMP binding in CRP/FNR family transcription factors.

    Directory of Open Access Journals (Sweden)

    Philip D Townsend

    Full Text Available The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition.

  8. Two-dimensional photonic crystal accelerator structures

    Directory of Open Access Journals (Sweden)

    Benjamin M. Cowan

    2003-10-01

    Full Text Available Photonic crystals provide a method of confining a synchronous speed-of-light mode in an all-dielectric structure, likely a necessary feature in any optical accelerator. We explore computationally a class of photonic crystal structures with translational symmetry in a direction transverse to the electron beam. We demonstrate synchronous waveguide modes and discuss relevant parameters of such modes. We then explore how accelerator parameters vary as the geometry of the structure is changed and consider trade-offs inherent in the design of an accelerator of this type.

  9. Crystal structure of enolase from Drosophila melanogaster.

    Science.gov (United States)

    Sun, Congcong; Xu, Baokui; Liu, Xueyan; Zhang, Zhen; Su, Zhongliang

    2017-04-01

    Enolase is an important enzyme in glycolysis and various biological processes. Its dysfunction is closely associated with diseases. Here, the enolase from Drosophila melanogaster (DmENO) was purified and crystallized. A crystal of DmENO diffracted to 2.0 Å resolution and belonged to space group R32. The structure was solved by molecular replacement. Like most enolases, DmENO forms a homodimer with conserved residues in the dimer interface. DmENO possesses an open conformation in this structure and contains conserved elements for catalytic activity. This work provides a structural basis for further functional and evolutionary studies of enolase.

  10. Predicting DNA-binding amino acid residues from electrostatic stabilization upon mutation to Asp/Glu and evolutionary conservation.

    Science.gov (United States)

    Chen, Yao Chi; Wu, Chih Yuan; Lim, Carmay

    2007-05-15

    Binding of polyanionic DNA depends on the cluster of electropositive atoms in the binding site of a DNA-binding protein. Such a cluster of electropositive protein atoms would be electrostatically unfavorable without stabilizing interactions from the respective electronegative DNA atoms and would likely be evolutionary conserved due to its critical biological role. Consequently, our strategy for predicting DNA-binding residues is based on detecting a cluster of evolutionary conserved surface residues that are electrostatically stabilized upon mutation to negatively charged Asp/Glu residues. The method requires as input the protein structure and sufficient sequence homologs to define each residue's relative conservation, and it yields as output experimentally testable residues that are predicted to bind DNA. By incorporating characteristic DNA-binding site features (i.e., electrostatic strain and amino acid conservation), the new method yields a prediction accuracy of 83%, which is much higher than methods based on only electrostatic strain (57%) or conservation alone (50%). It is also less sensitive to protein conformational changes upon DNA binding than methods that mainly depend on the 3D protein structure. 2007 Wiley-Liss, Inc.

  11. A New Design Strategy and Diagnostic to Tailor the DNA-Binding Mechanism of Small Organic Molecules and Drugs.

    Science.gov (United States)

    Doan, Phi; Pitter, Demar R G; Kocher, Andrea; Wilson, James N; Goodson, Theodore

    2016-11-18

    The classical model for DNA groove binding states that groove binding molecules should adopt a crescent shape that closely matches the helical groove of DNA. Here, we present a new design strategy that does not obey this classical model. The DNA-binding mechanism of small organic molecules was investigated by synthesizing and examining a series of novel compounds that bind with DNA. This study has led to the emergence of structure-property relationships for DNA-binding molecules and/or drugs, which reveals that the structure can be designed to either intercalate or groove bind with calf thymus dsDNA by modifying the electron acceptor properties of the central heterocyclic core. This suggests that the electron accepting abilities of the central core play a key role in the DNA-binding mechanism. These small molecules were characterized by steady-state and ultrafast nonlinear spectroscopies. Bioimaging experiments were performed in live cells to evaluate cellular uptake and localization of the novel small molecules. This report paves a new route for the design and development of small organic molecules, such as therapeutics, targeted at DNA as their performance and specificity is dependent on the DNA-binding mechanism.

  12. Crystal structure of levomepromazine maleate

    Directory of Open Access Journals (Sweden)

    Gyula Tamás Gál

    2016-05-01

    Full Text Available The asymmetric unit of the title salt, C19H25N2OS+·C4H3O4− [systematic name: (S-3-(2-methoxyphenothiazin-10-yl-N,N,2-trimethylpropanaminium hydrogen maleate], comprises two (S-levomepromazine cations and two hydrogen maleate anions. The conformations of the two cations are similar. The major difference relates to the orientation of the methoxy substituent at the phenothiazine ring system. The crystal components form a three-dimensional supramolecular network via N—H...O, C—H...O and C—H...π interactions. A comparison of the conformations of the levomepromazine cations with those of the neutral molecule and similar protonated molecules reveals significant conformational flexibility of the phenothiazine ring system and the substituent at the phenothiazine N atom.

  13. Cyclodextrin-peptide conjugates for sequence specific DNA binding

    Czech Academy of Sciences Publication Activity Database

    García, Y. R.; Zelenka, Jan; Pabon, Y. V.; Iyer, A.; Buděšínský, Miloš; Kraus, Tomáš; Smith, C. I. E.; Madder, A.

    2015-01-01

    Roč. 13, č. 18 (2015), s. 5273-5278 ISSN 1477-0520 R&D Projects: GA MŠk LD12019 Institutional support: RVO:61388963 Keywords : crystal structure * inclusion complex * click chemistry Subject RIV: CC - Organic Chemistry Impact factor: 3.559, year: 2015

  14. DNA binding, DNA cleavage, antioxidant and cytotoxicity studies on ruthenium(II) complexes of benzaldehyde 4-methyl-3-thiosemicarbazones

    Science.gov (United States)

    Sampath, Krishnan; Sathiyaraj, Subbaiyan; Jayabalakrishnan, Chinnasamy

    2013-03-01

    Four new ruthenium(II) complexes with N(4)-methyl thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-methylhydrazinecarbothioamide (HL1) and (E)-N-methyl-2-(2-nitrobenzylidene)hydrazinecarbothioamide (HL2), were prepared and fully characterized by various spectro-analytical techniques. The Schiff bases act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the compounds was investigated by absorption spectroscopy which indicated that the complexes bind to DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant studies of the ligands and complexes showed the significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes against MCF-7 cell line was assayed which showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  15. Crystal structure of enterococcus faecalis sly A-like transcriptional factor.

    Energy Technology Data Exchange (ETDEWEB)

    Wu, R.; Zhang, R.; Zagnitko, O.; Dementieva, I.; Maltsev, N.; Watson, J. D.; Laskowski, R.; Gornicki, P.; Joachimiak, A.; Univ. of Chicago; European Bioinformatics Inst.

    2003-05-30

    The crystal structure of a SlyA transcriptional regulator at 1.6 {angstrom} resolution is presented, and structural relationships between members of the MarR/SlyA family are discussed. The SlyA family, which includes SlyA, Rap, Hor, and RovA proteins, is widely distributed in bacterial and archaeal genomes. Current evidence suggests that SlyA-like factors act as repressors, activators, and modulators of gene transcription. These proteins have been shown to up-regulate the expression of molecular chaperones, acid-resistance proteins, and cytolysin, and down-regulate several biosynthetic enzymes. The structure of SlyA from Enterococcus faecalis, determined as a part of an ongoing structural genomics initiative (www.mcsg.anl.gov), revealed the same winged helix DNA-binding motif that was recently found in the MarR repressor from Escherichia coli and the MexR repressor from Pseudomonas aeruginosa, a sequence homologue of MarR. Phylogenetic analysis of the MarR/SlyA family suggests that Sly is placed between the SlyA and MarR subfamilies and shows significant sequence similarity to members of both subfamilies.

  16. Synthesis, characterization, DNA binding and in vitro antimicrobial studies of a novel tetra-substituted N-isopropyl-N-(4-ferrocenylphenyl)-N‧-(2,6-diethylphenyl)-N″-benzoylguanidine: Crystallographic structure and quantum chemical computations

    Science.gov (United States)

    Rauf, Muhammad Khawar; Gul, Rukhsana; Rashid, Zahid; Badshah, Amin; Tahir, Muhammad Nawaz; Shahid, Muhammad; Khan, Azim

    2015-02-01

    A novel tetra-substituted guanidine, N-isopropyl-N-(4-ferrocenylphenyl)-N‧-(2,6-diethylphenyl)-N″-benzoylguanidine (1), [(CH3)2CH)(C5H5FeC5H4C6H4)NC(NHCOC6H5)(NHC6H3(CH2CH3)2] has been synthesized and characterized by elemental analysis, FT-IR, multinuclear (1H, 13C) NMR spectroscopy, single crystal X-rays diffraction analysis and density functional theory based quantum chemical calculations. The torsion angles indicating that the guanidine moiety and carbonyl group are almost co-planar, due to the pseudo hexagonal ring formed by intramolecular Nsbnd H⋯O hydrogen bonds. The DNA interaction studies performed by cyclic voltammetry and UV-visible spectroscopy are in close agreement with the binding constants (K) 1.4 × 104 and 1.2 × 104 respectively. The shift in peak potential, current and absorption maxima of the studied ferrocenyl guanidine in the presence of DNA discovered that CV coupled with UV-vis spectroscopy could provide an opportunity to elaborate DNA interaction mechanism, a prerequisite for the design of new drug like agents and understanding the molecular basis of their action. The synthesized compound (1) has also been screened for their antibacterial and antifungal.

  17. Mutational Dissection of Telomeric DNA Binding Requirements of G4 Resolvase 1 Shows that G4-Structure and Certain 3'-Tail Sequences Are Sufficient for Tight and Complete Binding.

    Science.gov (United States)

    Smaldino, Philip J; Routh, Eric D; Kim, Jung H; Giri, Banabihari; Creacy, Steven D; Hantgan, Roy R; Akman, Steven A; Vaughn, James P

    2015-01-01

    Ends of human chromosomes consist of the six nucleotide repeat d[pTTAGGG]n known as telomeric DNA, which protects chromosomes. We have previously shown that the DHX36 gene product, G4 Resolvase 1 (G4R1), binds parallel G-quadruplex (G4) DNA with an unusually tight apparent Kd. Recent work associates G4R1 with the telomerase holoenzyme, which may allow it to access telomeric G4-DNA. Here we show that G4R1 can tightly bind telomeric G4-DNA, and in the context of the telomeric sequence, we determine length, sequence, and structural requirements sufficient for tight G4R1 telomeric binding. Specifically, G4R1 binds telomeric DNA in the K+-induced "3+1" G4-topology with an apparent Kd = 10 ± 1.9 pM, a value similar as previously found for binding to unimolecular parallel G4-DNA. G4R1 binds to the Na+-induced "2+2" basket G4-structure formed by the same DNA sequence with an apparent Kd = 71 ± 2.2 pM. While the minimal G4-structure is not sufficient for G4R1 binding, a 5' G4-structure with a 3' unstructured tail containing a guanine flanked by adenine(s) is sufficient for maximal binding. Mutations directed to disrupt G4-structure similarly disrupt G4R1 binding; secondary mutations that restore G4-structure also restore G4R1 binding. We present a model showing that a replication fork disrupting a T-loop could create a 5' quadruplex with an opened 3'tail structure that is recognized by G4R1.

  18. Mutational Dissection of Telomeric DNA Binding Requirements of G4 Resolvase 1 Shows that G4-Structure and Certain 3’-Tail Sequences Are Sufficient for Tight and Complete Binding

    Science.gov (United States)

    Smaldino, Philip J.; Routh, Eric D.; Kim, Jung H.; Giri, Banabihari; Creacy, Steven D.; Hantgan, Roy R.; Akman, Steven A.; Vaughn, James P.

    2015-01-01

    Ends of human chromosomes consist of the six nucleotide repeat d[pTTAGGG]n known as telomeric DNA, which protects chromosomes. We have previously shown that the DHX36 gene product, G4 Resolvase 1 (G4R1), binds parallel G-quadruplex (G4) DNA with an unusually tight apparent Kd. Recent work associates G4R1 with the telomerase holoenzyme, which may allow it to access telomeric G4-DNA. Here we show that G4R1 can tightly bind telomeric G4-DNA, and in the context of the telomeric sequence, we determine length, sequence, and structural requirements sufficient for tight G4R1 telomeric binding. Specifically, G4R1 binds telomeric DNA in the K+-induced “3+1” G4-topology with an apparent Kd = 10 ±1.9 pM, a value similar as previously found for binding to unimolecular parallel G4-DNA. G4R1 binds to the Na+-induced “2+2” basket G4-structure formed by the same DNA sequence with an apparent Kd = 71 ± 2.2 pM. While the minimal G4-structure is not sufficient for G4R1 binding, a 5’ G4-structure with a 3’ unstructured tail containing a guanine flanked by adenine(s) is sufficient for maximal binding. Mutations directed to disrupt G4-structure similarly disrupt G4R1 binding; secondary mutations that restore G4-structure also restore G4R1 binding. We present a model showing that a replication fork disrupting a T-loop could create a 5’ quadruplex with an opened 3’tail structure that is recognized by G4R1. PMID:26172836

  19. Shear induced structures in crystallizing cocoa butter

    Science.gov (United States)

    Mazzanti, Gianfranco; Guthrie, Sarah E.; Sirota, Eric B.; Marangoni, Alejandro G.; Idziak, Stefan H. J.

    2004-03-01

    Cocoa butter is the main structural component of chocolate and many cosmetics. It crystallizes in several polymorphs, called phases I to VI. We used Synchrotron X-ray diffraction to study the effect of shear on its crystallization. A previously unreported phase (phase X) was found and a crystallization path through phase IV under shear was observed. Samples were crystallized under shear from the melt in temperature controlled Couette cells, at final crystallization temperatures of 17.5^oC, 20^oC and 22.5^oC in Beamline X10A of NSLS. The formation of phase X was observed at low shear rates (90 s-1) and low crystallization temperature (17.5^oC), but was absent at high shear (720 s-1) and high temperature (20^oC). The d-spacing and melting point suggest that this new phase is a mixture rich on two of the three major components of cocoa butter. We also found that, contrary to previous reports, the transition from phase II to phase V can happen through the intermediate phase IV, at high shear rates and temperature.

  20. Molecular and crystal structure of ivalin

    Energy Technology Data Exchange (ETDEWEB)

    Coetzer, J. (Council for Scientific and Industrial Research, Pretoria (South Africa). National Physical Research Lab.); Kruger, G.J.; Levendis, D.C. (Council for Scientific and Industrial Research, Pretoria (South Africa). National Chemical Research Lab.)

    1982-01-01

    The bromoacetate derivative of ivalin, which is a sesquiterpene lactone, crystallizes in the space group P2/sub 1/, with two molecules in the unit cell. Its structure was solved by standard X-ray methods. Full-matrix least-squares refinement converged at R=0,052. The proposed stereochemistry has been confirmed.

  1. Hydrothermal synthesis, crystal structure and luminescence property ...

    Indian Academy of Sciences (India)

    Hydrothermal synthesis, crystal structure and luminescence property of a three dimensional Sm(III) coordination polymer with. 2,5-pyridinedicarboxylic acid. KRANTHI KUMAR GANGU, ANIMA S DADHICH and. SARATCHANDRA BABU MUKKAMALA. ∗. Department of Chemistry, GITAM University, Visakhapatnam 530 045, ...

  2. Hydrothermal synthesis, crystal structure and luminescence property ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Hydrothermal synthesis, crystal structure and luminescence property of a three dimensional Sm(III) coordination polymer with 2,5-pyridinedicarboxylic acid. Kranthi Kumar Gangu Anima S Dadhich Saratchandra Babu Mukkamala. Volume 127 Issue 12 ...

  3. Synthesis, crystal structure, theoretical study and luminescence ...

    Indian Academy of Sciences (India)

    Synthesis, crystal structure, theoretical study and luminescence property of a butterfly-like W/Cu/S cluster with 1,10-phenanthroline. AI-HUA CHENa,b, SU-CI MENGc,d, JIN-FANG ZHANGb,c and CHI ZHANGb,c,∗. aSchool of Chemical & Chemical Engineering, Yancheng Institute of Technology, Yancheng 224051,.

  4. Theoretical investigation on crystal structure, detonation ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 125; Issue 4. Theoretical investigation on crystal structure, detonation ... The bond dissociation energies and bond orders for the weakest bonds were analysed to investigate the thermal stability of the title compound. The detonation and pressure were evaluated by ...

  5. Solvothermal syntheses, crystal structures, optical and thermal ...

    Indian Academy of Sciences (India)

    Keywords. Selenidogermanates; nickel; solvothermal syntheses; crystal structures; optical properties ... The different coordination environments of Ni²⁺ ions indicate the influence of the denticity of ethylene polyamines on the formation of selenidogermanates in the presence of transition metal ions. Thecompounds 1–3 ...

  6. Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.

    Science.gov (United States)

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M

    2012-06-22

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.

  7. Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*

    Science.gov (United States)

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.

    2012-01-01

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803

  8. Modular crystals as modulated structures

    DEFF Research Database (Denmark)

    Elcoro, L.; Perez-Mato, J.M.; Friese, K.

    2008-01-01

    The use of the superspace formalism is extended to the description and refinement of the homologous series of modular structures with two symmetry-related modules with different orientations. The lillianite homologous series has been taken as a study case. Starting from a commensurate modulated...... and introduce in the starting model the two orientations of the underlying module sublattices. We show that a composite approach with this type of function, which treats the cations and anions as two separate subsystems forming a misfit compound, is the most appropriate and robust method for the refinements....

  9. In vitro selection of zinc fingers with altered DNA-binding specificity.

    Science.gov (United States)

    Jamieson, A C; Kim, S H; Wells, J A

    1994-05-17

    We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Molecular mechanism of DNA association with single-stranded DNA binding protein.

    Science.gov (United States)

    Maffeo, Christopher; Aksimentiev, Aleksei

    2017-12-01

    During DNA replication, the single-stranded DNA binding protein (SSB) wraps single-stranded DNA (ssDNA) with high affinity to protect it from degradation and prevent secondary structure formation. Although SSB binds ssDNA tightly, it can be repositioned along ssDNA to follow the advancement of the replication fork. Using all-atom molecular dynamics simulations, we characterized the molecular mechanism of ssDNA association with SSB. Placed in solution, ssDNA-SSB assemblies were observed to change their structure spontaneously; such structural changes were suppressed in the crystallographic environment. Repeat simulations of the SSB-ssDNA complex under mechanical tension revealed a multitude of possible pathways for ssDNA to come off SSB punctuated by prolonged arrests at reproducible sites at the SSB surface. Ensemble simulations of spontaneous association of short ssDNA fragments with SSB detailed a three-dimensional map of local affinity to DNA; the equilibrium amount of ssDNA bound to SSB was found to depend on the electrolyte concentration but not on the presence of the acidic tips of the SSB tails. Spontaneous formation of ssDNA bulges and their diffusive motion along SSB surface was directly observed in multiple 10-µs-long simulations. Such reptation-like motion was confined by DNA binding to high-affinity spots, suggesting a two-step mechanism for SSB diffusion. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Role of Structure-Based Changes due to Somatic Mutation in Highly Homologous DNA-Binding and DNA-Hydrolyzing Autoantibodies Exemplified by A23P Substitution in the VH Domain

    OpenAIRE

    Kozyr, A. V.; Kolesnikov, A. V.; Khlyntseva, A. E.; A. G. Bogun; Savchenko, G. A.; I. G. Shemyakin; A G Gabibov

    2012-01-01

    Anti-DNA autoantibodies are responsible for tissue injury in lupus. A subset of DNA-specific antibodies capable of DNA cleavage can be even more harmful after entering the living cells by destroying nuclear DNA. Origins of anti-DNA autoantibodies are not fully understood, and the mechanism of induction of DNA-cleaving activity remains speculative. The autoantibody BV04-01 derived from lupus-prone mouse is the only DNA-hydrolyzing immunoglobulin with known 3D structure. Identification and ana...

  12. Photonic Crystal Laser-Driven Accelerator Structures

    Energy Technology Data Exchange (ETDEWEB)

    Cowan, Benjamin M

    2007-08-22

    Laser-driven acceleration holds great promise for significantly improving accelerating gradient. However, scaling the conventional process of structure-based acceleration in vacuum down to optical wavelengths requires a substantially different kind of structure. We require an optical waveguide that (1) is constructed out of dielectric materials, (2) has transverse size on the order of a wavelength, and (3) supports a mode with speed-of-light phase velocity in vacuum. Photonic crystals---structures whose electromagnetic properties are spatially periodic---can meet these requirements. We discuss simulated photonic crystal accelerator structures and describe their properties. We begin with a class of two-dimensional structures which serves to illustrate the design considerations and trade-offs involved. We then present a three-dimensional structure, and describe its performance in terms of accelerating gradient and efficiency. We discuss particle beam dynamics in this structure, demonstrating a method for keeping a beam confined to the waveguide. We also discuss material and fabrication considerations. Since accelerating gradient is limited by optical damage to the structure, the damage threshold of the dielectric is a critical parameter. We experimentally measure the damage threshold of silicon for picosecond pulses in the infrared, and determine that our structure is capable of sustaining an accelerating gradient of 300 MV/m at 1550 nm. Finally, we discuss possibilities for manufacturing these structures using common microfabrication techniques.

  13. Nonlinear coherent structures in granular crystals

    Science.gov (United States)

    Chong, C.; Porter, Mason A.; Kevrekidis, P. G.; Daraio, C.

    2017-10-01

    The study of granular crystals, which are nonlinear metamaterials that consist of closely packed arrays of particles that interact elastically, is a vibrant area of research that combines ideas from disciplines such as materials science, nonlinear dynamics, and condensed-matter physics. Granular crystals exploit geometrical nonlinearities in their constitutive microstructure to produce properties (such as tunability and energy localization) that are not conventional to engineering materials and linear devices. In this topical review, we focus on recent experimental, computational, and theoretical results on nonlinear coherent structures in granular crystals. Such structures—which include traveling solitary waves, dispersive shock waves, and discrete breathers—have fascinating dynamics, including a diversity of both transient features and robust, long-lived patterns that emerge from broad classes of initial data. In our review, we primarily discuss phenomena in one-dimensional crystals, as most research to date has focused on such scenarios, but we also present some extensions to two-dimensional settings. Throughout the review, we highlight open problems and discuss a variety of potential engineering applications that arise from the rich dynamic response of granular crystals.

  14. 9-Hydroxyellipticine alters the conformation and DNA binding characteristics of mutated p53 protein.

    Science.gov (United States)

    Sugikawa, E; Tsunoda, S; Nakanishi, N; Ohashi, M

    2001-01-01

    The tumor suppressor protein p53 is a phosphoprotein which shows growth and transformation suppression functions. Mutational loss of p53 function is the most frequently detected genetic event in human cancers. We examined whether 9-hydroxyellipticine (9HE), a cytotoxic agent, affected the tertiary structure of mutant p53 and DNA binding characteristics. Although several types of p53 mutants were resistant to degradation by calpain, the p53 mutants treated with 9HE were markedly sensitive to calpain as well as wild-type p53. Furthermore, mutant p53 proteins isolated from 9HE-treated cells regained the ability to bind a wild-type-specific p53 DNA consensus sequence. Wild-type p53 proteins prepared from both untreated and 9HE-treated cells bound the p53 consensus sequence and were degradaded by calpain equally well. These results suggest that 9HE affects the tertiary structure of mutated p53, which results in the restoration of DNA binding characteristics.

  15. Understanding the effect of polylysine architecture on DNA binding using molecular dynamics simulations.

    Science.gov (United States)

    Elder, Robert M; Emrick, Todd; Jayaraman, Arthi

    2011-11-14

    Polycations with varying chemistries and architectures have been synthesized and used in DNA transfection. In this paper we connect poly-L-lysine (PLL) architecture to DNA-binding strength, and in turn transfection efficiency, since experiments have shown that graft-type oligolysine architectures [e.g., poly(cyclooctene-g-oligolysine)] exhibit higher transfection efficiency than linear PLL. We use atomistic molecular dynamics simulations to study structural and thermodynamic effects of polycation-DNA binding for linear PLL and grafted oligolysines of varying graft lengths. Structurally, linear PLL binds in a concerted manner, while each oligolysine graft binds independently of its neighbors in the grafted architecture. Additionally, the presence of a hydrophobic backbone in the grafted architecture weakens binding to DNA compared to linear PLL. The binding free energy varies nonmonotonically with the graft length primarily due to entropic contributions. The binding free energy normalized to the number of bound amines is similar between the grafted and linear architectures at the largest (Poly5) and smallest (Poly2) graft length and stronger than the intermediate graft lengths (Poly3 and Poly4). These trends agree with experimental results that show higher transfection efficiency for Poly3 and Poly4 grafted oligolysines than for Poly5, Poly2, and linear PLL.

  16. Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification.

    Directory of Open Access Journals (Sweden)

    Elisson A C Romanel

    Full Text Available BACKGROUND: The B3 DNA binding domain includes five families: auxin response factor (ARF, abscisic acid-insensitive3 (ABI3, high level expression of sugar inducible (HSI, related to ABI3/VP1 (RAV and reproductive meristem (REM. The release of the complete genomes of the angiosperm eudicots Arabidopsis thaliana and Populus trichocarpa, the monocot Orysa sativa, the bryophyte Physcomitrella patens,the green algae Chlamydomonas reinhardtii and Volvox carteri and the red algae Cyanidioschyzon melorae provided an exceptional opportunity to study the evolution of this superfamily. METHODOLOGY: In order to better understand the origin and the diversification of B3 domains in plants, we combined comparative phylogenetic analysis with exon/intron structure and duplication events. In addition, we investigated the conservation and divergence of the B3 domain during the origin and evolution of each family. CONCLUSIONS: Our data indicate that showed that the B3 containing genes have undergone extensive duplication events, and that the REM family B3 domain has a highly diverged DNA binding. Our results also indicate that the founding member of the B3 gene family is likely to be similar to the ABI3/HSI genes found in C. reinhardtii and V. carteri. Among the B3 families, ABI3, HSI, RAV and ARF are most structurally conserved, whereas the REM family has experienced a rapid divergence. These results are discussed in light of their functional and evolutionary roles in plant development.

  17. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Crystal structure of the R-protein of the multisubunit ATP-dependent restriction endonuclease NgoAVII.

    Science.gov (United States)

    Tamulaitiene, Giedre; Silanskas, Arunas; Grazulis, Saulius; Zaremba, Mindaugas; Siksnys, Virginijus

    2014-12-16

    The restriction endonuclease (REase) NgoAVII is composed of two proteins, R.NgoAVII and N.NgoAVII, and shares features of both Type II restriction enzymes and Type I/III ATP-dependent restriction enzymes (see accompanying paper Zaremba et al., 2014). Here we present crystal structures of the R.NgoAVII apo-protein and the R.NgoAVII C-terminal domain bound to a specific DNA. R.NgoAVII is composed of two domains: an N-terminal nucleolytic PLD domain; and a C-terminal B3-like DNA-binding domain identified previously in BfiI and EcoRII REases, and in plant transcription factors. Structural comparison of the B3-like domains of R.NgoAVII, EcoRII, BfiI and the plant transcription factors revealed a conserved DNA-binding surface comprised of N- and C-arms that together grip the DNA. The C-arms of R.NgoAVII, EcoRII, BfiI and plant B3 domains are similar in size, but the R.NgoAVII N-arm which makes the majority of the contacts to the target site is much longer. The overall structures of R.NgoAVII and BfiI are similar; however, whilst BfiI has stand-alone catalytic activity, R.NgoAVII requires an auxiliary cognate N.NgoAVII protein and ATP hydrolysis in order to cleave DNA at the target site. The structures we present will help formulate future experiments to explore the molecular mechanisms of intersubunit crosstalk that control DNA cleavage by R.NgoAVII and related endonucleases. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Crystal Structure of Tetrameric Arabidopsis MYC2 Reveals the Mechanism of Enhanced Interaction with DNA

    Directory of Open Access Journals (Sweden)

    Teng-fei Lian

    2017-05-01

    Full Text Available Jasmonates (JAs are essential plant hormones that play important roles in the regulation of plant growth and the response to environmental stress. In the JA signaling pathway, the core transcription factors are a class of basic helix-loop-helix (bHLH proteins, including MYC2, MYC3, and MYC4, that have different regulatory capacities. Here, we report the 2.7 Å crystal structure of the MYC2 bHLH domain complexed with G-box DNA, showing a cis-tetrameric structure. Biochemical assays confirmed that full-length MYC2 forms a stable homo-tetramer both in solution and in DNA-bound states, whereas MYC3 forms only a homodimer. Isothermal titration calorimetry (ITC assays demonstrated that tetramerization enhanced DNA binding affinity, and fluorescence resonance energy transfer (FRET assay indicated DNA looping potential of tetrameric MYC2. Luciferase assay further confirmed the importance of tetramerization in transcriptional regulation. Our studies provide a mechanistic explanation for the regulatory differences of MYC transcription factors.

  20. Ligand-binding pocket bridges DNA-binding and dimerization domains of the urate-responsive MarR homologue MftR from Burkholderia thailandensis.

    Science.gov (United States)

    Gupta, Ashish; Grove, Anne

    2014-07-15

    Members of the multiple antibiotic resistance regulator (MarR) family often regulate gene activity by responding to a specific ligand. In the absence of ligand, most MarR proteins function as repressors, while ligand binding causes attenuated DNA binding and therefore increased gene expression. Previously, we have shown that urate is a ligand for MftR (major facilitator transport regulator), which is encoded by the soil bacterium Burkholderia thailandensis. We show here that both mftR and the divergently oriented gene mftP encoding a major facilitator transport protein are upregulated in the presence of urate. MftR binds two cognate sites in the mftR-mftP intergenic region with equivalent affinity and sensitivity to urate. Mutagenesis of four conserved residues previously reported to be involved in urate binding to Deinococcus radiodurans HucR and Rhizobium radiobacter PecS significantly reduced protein stability and DNA binding affinity but not ligand binding. These data suggest that residues equivalent to those implicated in ligand binding to HucR and PecS serve structural roles and that MftR relies on distinct residues for ligand binding. MftR exhibits a two-step melting transition suggesting independent unfolding of the dimerization and DNA-binding regions; urate binding or mutations in the predicted ligand-binding sites result in one-step unfolding transitions. We suggest that MftR binds the ligand in a cleft between the DNA-binding lobes and the dimer interface but that the mechanism of ligand-mediated attenuation of DNA binding differs from that proposed for other urate-responsive MarR homologues. Since DNA binding by MftR is attenuated at 37 °C, our data also suggest that MftR responds to both ligand and a thermal upshift by attenuated DNA binding and upregulation of the genes under its control.

  1. Crystal structure of tris(hydroxylammonium orthophosphate

    Directory of Open Access Journals (Sweden)

    Malte Leinemann

    2015-11-01

    Full Text Available The crystal structure of the title salt, ([H3NOH]+3·[PO4]3−, consists of discrete hydroxylammonium cations and orthophosphate anions. The atoms of the cation occupy general positions, whereas the anion is located on a threefold rotation axis that runs through the phosphorus atom and one of the phosphate O atoms. In the crystal structure, cations and anions are linked by intermolecular O—H...O and N—H...O hydrogen bonds into a three-dimensional network. Altogether, one very strong O—H...O, two N—H...O hydrogen bonds of medium strength and two weaker bifurcated N—H...O interactions are observed.

  2. Characterization and DNA binding studies of unexplored imidazolidines by electronic absorption spectroscopy and cyclic voltammetry.

    Science.gov (United States)

    Shah, Afzal; Nosheen, Erum; Munir, Shamsa; Badshah, Amin; Qureshi, Rumana; Rehman, Zia-Ur-; Muhammad, Niaz; Hussain, Hidayat

    2013-03-05

    UV-Vis spectroscopic behavior of four imidazolidine derivatives i.e., [5-benzylideneimidazolidine-2,4-dione (NBI), 5-(2-hydroxybenzylidene)imidazolidine-2,4-dione (HBI), 5-(4-methoxybenzylidene)imidazolidine-2,4-dione (MBI) and 5-(3,4-di-methoxybenzylidene)imidazolidine-2,4-dione (DBI)] was studied in a wide pH range. Spectroscopic response of the studied compounds was found sensitive to pH and the attached substituents. Incited by anti-tumor activity, structural miscellany and biological applications of imidazolidines, the DNA binding affinity of some novel derivatives of this class of compounds was examined by cyclic voltammetry (CV) and UV-Vis spectroscopy at pH values of blood (7.4) and lysosomes (4.5). The CV results showed the following order of binding strength: KNBI (6.40×10(6)M(-1))>KHBI (1.77×10(5)M(-1))>KMBI (2.06×10(4)M(-1))>KDBI (1.01×10(4)M(-1)) at pH 7.4. The same order was also obtained from UV-Vis spectroscopy. The greater affinity of NBI justified its preferred candidature as an effective anti-cancer drug. The DNA binding propensity of these compounds was found comparable or greater than most of the clinically used anticancer drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Synthesis, crystal structure, thermal analysis and dielectric ...

    Indian Academy of Sciences (India)

    providing information about the complete crystal structure at room temperature of the new compounds. These materi- ... Data collection instrument. Kappa-APEX II. Kappa-APEX II. Radiation, graphite ..... graphic method of the mixed compounds K0.57(NH4)0.43CdCl3 and K0.25(NH4)0.75CdCl3. This study is restricted to ...

  4. Optically induced structural phase transitions in ion Coulomb crystals

    DEFF Research Database (Denmark)

    Horak, Peter; Dantan, Aurelien Romain; Drewsen, Michael

    2012-01-01

    We investigate numerically the structural dynamics of ion Coulomb crystals confined in a three-dimensional harmonic trap when influenced by an additional one-dimensional optically induced periodical potential. We demonstrate that transitions between thermally excited crystal structures, such as b......We investigate numerically the structural dynamics of ion Coulomb crystals confined in a three-dimensional harmonic trap when influenced by an additional one-dimensional optically induced periodical potential. We demonstrate that transitions between thermally excited crystal structures...

  5. Structural, vibrational, NMR, quantum chemical, DNA binding and ...

    Indian Academy of Sciences (India)

    Smith B C 1996 In Infrared Spectral Interpretation. (Boca Raton, FL: CRC Press). 31. Green J H S, Harrison D J and Kynaston W 1971. Spectrochim. Acta A 27 2199. 32. Varsanyi G 1974 In Assignments for Vibrational Spectra of Seven Hundred Benzene Derivatives. Vols. 1 and 2. (Budapest: Adam Hilger). 33. Lutz E T G ...

  6. Structural, vibrational, NMR, quantum chemical, DNA binding and ...

    Indian Academy of Sciences (India)

    -one oxime (HL¹) and 3-(pyridin-2-ylmethylimino)-pentan-2-one oxime (HL²) have been synthesized and characterized by elemental analysis, IR and NMR techniques. The conformational behavior was investigated using the density functional ...

  7. DNA binding and cleavage activity of a structurally characterized Ni ...

    Indian Academy of Sciences (India)

    The binding constant (Kb) and the linear Stern-Volmer quenching constant (Ksv) of the complex have been determined as 9.23 × 10 4 M−1 and 2.0 × 10 4 M−1, respectively. Spectroscopic and hydrodynamic investigations revealed groove or electrostatic nature of binding of 1 with DNA. 1 is also found to induce oxidative ...

  8. ssDNA Binding Reveals the Atomic Structure of Graphene

    OpenAIRE

    Husale S; Sahoo S; Radenovic A; Traversi F; Annibale P; Kis A

    2010-01-01

    We used AFM to investigate the interaction of polyelectrolytes such as ssDNA and dsDNA molecules with graphene as a substrate. Graphene is an appropriate substrate due to its planarity, relatively large surfaces that are detectable via an optical microscope, and straightforward identification of the number of layers. We observe that in the absence of the screening ions deposited ssDNA will bind only to the graphene and not to the SiO2 substrate, confirming that the binding energy is mainly du...

  9. Damage-specific DNA-binding proteins from human cells

    Energy Technology Data Exchange (ETDEWEB)

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1

  10. Flux growth and crystal structure of pyromorphite.

    Science.gov (United States)

    Akao, A; Aoki, H; Innami, Y; Minamikata, S; Yamada, T

    1989-01-01

    Single crystals of pyromorphite, Pb5(PO4)3Cl, were grown by standard flux growth technique with excess lead chloride used as the flux. Pyromorphite was first prepared by heating an intimate mixture of lead hydrogen phosphate and lead chloride in the molar ratio 6:4 at 100 degrees C for 1 h. A mixture of 60 wt% of pyromorphite and 40 wt% of lead chloride was heated at 850 degrees C for 15 h and then cooled at the rate of 3.4 degrees C/h. Hexagonal prismatic crystals of length 1 mm were obtained. The chemical composition has close to the theoretical value. The crystal is hexagonal, space group P6(3)/m with a = 9.9981(8), c = 7.344(1) A and Z = 2. The structure was refined to R = 0.058 and Rw = 0.053 with 502 independent reflections. The structure is in principal the same as that of barium chlorapatite; the chlorine ions occupy the (0, 0, 0) position.

  11. Crystal structure of natural phaeosphaeride A

    Directory of Open Access Journals (Sweden)

    Victoria V. Abzianidze

    2015-08-01

    Full Text Available The asymmetric unit of the title compound, C15H23NO5, contains two independent molecules. Phaeosphaeride A contains two primary sections, an alkyl chain consisting of five C atoms and a cyclic system consisting of fused five- and six-membered rings with attached substituents. In the crystal, the molecules form layered structures. Nearly planar sheets, parallel to the (001 plane, form bilayers of two-dimensional hydrogen-bonded networks with the hydroxy groups located on the interior of the bilayer sheets. The network is constructed primarily of four O—H...O hydrogen bonds, which form a zigzag pattern in the (001 plane. The butyl chains interdigitate with the butyl chains on adjacent sheets. The crystal was twinned by a twofold rotation about the c axis, with refined major–minor occupancy fractions of 0.718 (6:0.282 (6.

  12. Determining crystal structures through crowdsourcing and coursework

    Science.gov (United States)

    Horowitz, Scott; Koepnick, Brian; Martin, Raoul; Tymieniecki, Agnes; Winburn, Amanda A.; Cooper, Seth; Flatten, Jeff; Rogawski, David S.; Koropatkin, Nicole M.; Hailu, Tsinatkeab T.; Jain, Neha; Koldewey, Philipp; Ahlstrom, Logan S.; Chapman, Matthew R.; Sikkema, Andrew P.; Skiba, Meredith A.; Maloney, Finn P.; Beinlich, Felix R. M.; Caglar, Ahmet; Coral, Alan; Jensen, Alice Elizabeth; Lubow, Allen; Boitano, Amanda; Lisle, Amy Elizabeth; Maxwell, Andrew T.; Failer, Barb; Kaszubowski, Bartosz; Hrytsiv, Bohdan; Vincenzo, Brancaccio; de Melo Cruz, Breno Renan; McManus, Brian Joseph; Kestemont, Bruno; Vardeman, Carl; Comisky, Casey; Neilson, Catherine; Landers, Catherine R.; Ince, Christopher; Buske, Daniel Jon; Totonjian, Daniel; Copeland, David Marshall; Murray, David; Jagieła, Dawid; Janz, Dietmar; Wheeler, Douglas C.; Cali, Elie; Croze, Emmanuel; Rezae, Farah; Martin, Floyd Orville; Beecher, Gil; de Jong, Guido Alexander; Ykman, Guy; Feldmann, Harald; Chan, Hugo Paul Perez; Kovanecz, Istvan; Vasilchenko, Ivan; Connellan, James C.; Borman, Jami Lynne; Norrgard, Jane; Kanfer, Jebbie; Canfield, Jeffrey M.; Slone, Jesse David; Oh, Jimmy; Mitchell, Joanne; Bishop, John; Kroeger, John Douglas; Schinkler, Jonas; McLaughlin, Joseph; Brownlee, June M.; Bell, Justin; Fellbaum, Karl Willem; Harper, Kathleen; Abbey, Kirk J.; Isaksson, Lennart E.; Wei, Linda; Cummins, Lisa N.; Miller, Lori Anne; Bain, Lyn; Carpenter, Lynn; Desnouck, Maarten; Sharma, Manasa G.; Belcastro, Marcus; Szew, Martin; Szew, Martin; Britton, Matthew; Gaebel, Matthias; Power, Max; Cassidy, Michael; Pfützenreuter, Michael; Minett, Michele; Wesselingh, Michiel; Yi, Minjune; Cameron, Neil Haydn Tormey; Bolibruch, Nicholas I.; Benevides, Noah; Kathleen Kerr, Norah; Barlow, Nova; Crevits, Nykole Krystyne; Dunn, Paul; Roque, Paulo Sergio Silveira Belo Nascimento; Riber, Peter; Pikkanen, Petri; Shehzad, Raafay; Viosca, Randy; James Fraser, Robert; Leduc, Robert; Madala, Roman; Shnider, Scott; de Boisblanc, Sharon; Butkovich, Slava; Bliven, Spencer; Hettler, Stephen; Telehany, Stephen; Schwegmann, Steven A.; Parkes, Steven; Kleinfelter, Susan C.; Michael Holst, Sven; van der Laan, T. J. A.; Bausewein, Thomas; Simon, Vera; Pulley, Warwick; Hull, William; Kim, Annes Yukyung; Lawton, Alexis; Ruesch, Amanda; Sundar, Anjali; Lawrence, Anna-Lisa; Afrin, Antara; Maheshwer, Bhargavi; Turfe, Bilal; Huebner, Christian; Killeen, Courtney Elizabeth; Antebi-Lerrman, Dalia; Luan, Danny; Wolfe, Derek; Pham, Duc; Michewicz, Elaina; Hull, Elizabeth; Pardington, Emily; Galal, Galal Osama; Sun, Grace; Chen, Grace; Anderson, Halie E.; Chang, Jane; Hewlett, Jeffrey Thomas; Sterbenz, Jennifer; Lim, Jiho; Morof, Joshua; Lee, Junho; Inn, Juyoung Samuel; Hahm, Kaitlin; Roth, Kaitlin; Nair, Karun; Markin, Katherine; Schramm, Katie; Toni Eid, Kevin; Gam, Kristina; Murphy, Lisha; Yuan, Lucy; Kana, Lulia; Daboul, Lynn; Shammas, Mario Karam; Chason, Max; Sinan, Moaz; Andrew Tooley, Nicholas; Korakavi, Nisha; Comer, Patrick; Magur, Pragya; Savliwala, Quresh; Davison, Reid Michael; Sankaran, Roshun Rajiv; Lewe, Sam; Tamkus, Saule; Chen, Shirley; Harvey, Sho; Hwang, Sin Ye; Vatsia, Sohrab; Withrow, Stefan; Luther, Tahra K; Manett, Taylor; Johnson, Thomas James; Ryan Brash, Timothy; Kuhlman, Wyatt; Park, Yeonjung; Popović, Zoran; Baker, David; Khatib, Firas; Bardwell, James C. A.

    2016-01-01

    We show here that computer game players can build high-quality crystal structures. Introduction of a new feature into the computer game Foldit allows players to build and real-space refine structures into electron density maps. To assess the usefulness of this feature, we held a crystallographic model-building competition between trained crystallographers, undergraduate students, Foldit players and automatic model-building algorithms. After removal of disordered residues, a team of Foldit players achieved the most accurate structure. Analysing the target protein of the competition, YPL067C, uncovered a new family of histidine triad proteins apparently involved in the prevention of amyloid toxicity. From this study, we conclude that crystallographers can utilize crowdsourcing to interpret electron density information and to produce structure solutions of the highest quality. PMID:27633552

  13. Determining crystal structures through crowdsourcing and coursework

    Science.gov (United States)

    Horowitz, Scott; Koepnick, Brian; Martin, Raoul; Tymieniecki, Agnes; Winburn, Amanda A.; Cooper, Seth; Flatten, Jeff; Rogawski, David S.; Koropatkin, Nicole M.; Hailu, Tsinatkeab T.; Jain, Neha; Koldewey, Philipp; Ahlstrom, Logan S.; Chapman, Matthew R.; Sikkema, Andrew P.; Skiba, Meredith A.; Maloney, Finn P.; Beinlich, Felix R. M.; Caglar, Ahmet; Coral, Alan; Jensen, Alice Elizabeth; Lubow, Allen; Boitano, Amanda; Lisle, Amy Elizabeth; Maxwell, Andrew T.; Failer, Barb; Kaszubowski, Bartosz; Hrytsiv, Bohdan; Vincenzo, Brancaccio; de Melo Cruz, Breno Renan; McManus, Brian Joseph; Kestemont, Bruno; Vardeman, Carl; Comisky, Casey; Neilson, Catherine; Landers, Catherine R.; Ince, Christopher; Buske, Daniel Jon; Totonjian, Daniel; Copeland, David Marshall; Murray, David; Jagieła, Dawid; Janz, Dietmar; Wheeler, Douglas C.; Cali, Elie; Croze, Emmanuel; Rezae, Farah; Martin, Floyd Orville; Beecher, Gil; de Jong, Guido Alexander; Ykman, Guy; Feldmann, Harald; Chan, Hugo Paul Perez; Kovanecz, Istvan; Vasilchenko, Ivan; Connellan, James C.; Borman, Jami Lynne; Norrgard, Jane; Kanfer, Jebbie; Canfield, Jeffrey M.; Slone, Jesse David; Oh, Jimmy; Mitchell, Joanne; Bishop, John; Kroeger, John Douglas; Schinkler, Jonas; McLaughlin, Joseph; Brownlee, June M.; Bell, Justin; Fellbaum, Karl Willem; Harper, Kathleen; Abbey, Kirk J.; Isaksson, Lennart E.; Wei, Linda; Cummins, Lisa N.; Miller, Lori Anne; Bain, Lyn; Carpenter, Lynn; Desnouck, Maarten; Sharma, Manasa G.; Belcastro, Marcus; Szew, Martin; Szew, Martin; Britton, Matthew; Gaebel, Matthias; Power, Max; Cassidy, Michael; Pfützenreuter, Michael; Minett, Michele; Wesselingh, Michiel; Yi, Minjune; Cameron, Neil Haydn Tormey; Bolibruch, Nicholas I.; Benevides, Noah; Kathleen Kerr, Norah; Barlow, Nova; Crevits, Nykole Krystyne; Dunn, Paul; Silveira Belo Nascimento Roque, Paulo Sergio; Riber, Peter; Pikkanen, Petri; Shehzad, Raafay; Viosca, Randy; James Fraser, Robert; Leduc, Robert; Madala, Roman; Shnider, Scott; de Boisblanc, Sharon; Butkovich, Slava; Bliven, Spencer; Hettler, Stephen; Telehany, Stephen; Schwegmann, Steven A.; Parkes, Steven; Kleinfelter, Susan C.; Michael Holst, Sven; van der Laan, T. J. A.; Bausewein, Thomas; Simon, Vera; Pulley, Warwick; Hull, William; Kim, Annes Yukyung; Lawton, Alexis; Ruesch, Amanda; Sundar, Anjali; Lawrence, Anna-Lisa; Afrin, Antara; Maheshwer, Bhargavi; Turfe, Bilal; Huebner, Christian; Killeen, Courtney Elizabeth; Antebi-Lerrman, Dalia; Luan, Danny; Wolfe, Derek; Pham, Duc; Michewicz, Elaina; Hull, Elizabeth; Pardington, Emily; Galal, Galal Osama; Sun, Grace; Chen, Grace; Anderson, Halie E.; Chang, Jane; Hewlett, Jeffrey Thomas; Sterbenz, Jennifer; Lim, Jiho; Morof, Joshua; Lee, Junho; Inn, Juyoung Samuel; Hahm, Kaitlin; Roth, Kaitlin; Nair, Karun; Markin, Katherine; Schramm, Katie; Toni Eid, Kevin; Gam, Kristina; Murphy, Lisha; Yuan, Lucy; Kana, Lulia; Daboul, Lynn; Shammas, Mario Karam; Chason, Max; Sinan, Moaz; Andrew Tooley, Nicholas; Korakavi, Nisha; Comer, Patrick; Magur, Pragya; Savliwala, Quresh; Davison, Reid Michael; Sankaran, Roshun Rajiv; Lewe, Sam; Tamkus, Saule; Chen, Shirley; Harvey, Sho; Hwang, Sin Ye; Vatsia, Sohrab; Withrow, Stefan; Luther, Tahra K.; Manett, Taylor; Johnson, Thomas James; Ryan Brash, Timothy; Kuhlman, Wyatt; Park, Yeonjung; Popović, Zoran; Baker, David; Khatib, Firas; Bardwell, James C. A.

    2016-09-01

    We show here that computer game players can build high-quality crystal structures. Introduction of a new feature into the computer game Foldit allows players to build and real-space refine structures into electron density maps. To assess the usefulness of this feature, we held a crystallographic model-building competition between trained crystallographers, undergraduate students, Foldit players and automatic model-building algorithms. After removal of disordered residues, a team of Foldit players achieved the most accurate structure. Analysing the target protein of the competition, YPL067C, uncovered a new family of histidine triad proteins apparently involved in the prevention of amyloid toxicity. From this study, we conclude that crystallographers can utilize crowdsourcing to interpret electron density information and to produce structure solutions of the highest quality.

  14. Crystal structure of Cryptosporidium parvum pyruvate kinase.

    Directory of Open Access Journals (Sweden)

    William J Cook

    Full Text Available Pyruvate kinase plays a critical role in cellular metabolism of glucose by serving as a major regulator of glycolysis. This tetrameric enzyme is allosterically regulated by different effector molecules, mainly phosphosugars. In response to binding of effector molecules and substrates, significant structural changes have been identified in various pyruvate kinase structures. Pyruvate kinase of Cryptosporidium parvum is exceptional among known enzymes of protozoan origin in that it exhibits no allosteric property in the presence of commonly known effector molecules. The crystal structure of pyruvate kinase from C. parvum has been solved by molecular replacement techniques and refined to 2.5 Å resolution. In the active site a glycerol molecule is located near the γ-phosphate site of ATP, and the protein structure displays a partially closed active site. However, unlike other structures where the active site is closed, the α6' helix in C. parvum pyruvate kinase unwinds and assumes an extended conformation. In the crystal structure a sulfate ion is found at a site that is occupied by a phosphate of the effector molecule in many pyruvate kinase structures. A new feature of the C. parvum pyruvate kinase structure is the presence of a disulfide bond cross-linking the two monomers in the asymmetric unit. The disulfide bond is formed between cysteine residue 26 in the short N-helix of one monomer with cysteine residue 312 in a long helix (residues 303-320 of the second monomer at the interface of these monomers. Both cysteine residues are unique to C. parvum, and the disulfide bond remained intact in a reduced environment. However, the significance of this bond, if any, remains unknown at this time.

  15. Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

    Science.gov (United States)

    Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

    2016-10-01

    Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Diterbium heptanickel: a crystal structure redetermination

    Directory of Open Access Journals (Sweden)

    Volodymyr Levytskyy

    2014-08-01

    Full Text Available The crystal structure of the title compound, Tb2Ni7, was redetermined from single-crystal X-ray diffraction data. In comparison with previous studies based on powder X-ray diffraction data [Lemaire et al. (1967. C. R. Acad. Sci. Ser. B, 265, 1280–1282; Lemaire & Paccard (1969. Bull. Soc. Fr. Mineral. Cristallogr. 92, 9–16; Buschow & van der Goot (1970. J. Less-Common Met. 22, 419–428], the present redetermination affords refined coordinates and anisotropic displacement parameters for all atoms. A partial occupation for one Tb atom results in the non-stoichiometric composition Tb1.962 (4Ni7. The title compound adopts the Ce2Ni7 structure type and can also be derived from the CaCu5 structure type as an intergrowth structure. The asymmetric unit contains two Tb sites (both site symmetries 3m. and five Ni sites (.m., mm2, 3m., 3m., -3m.. The two different coordination polyhedra of Tb are a Frank–Kasper polyhedron formed by four Tb and 12 Ni atoms and a pseudo Frank–Kasper polyhedron formed by two Tb and 18 Ni atoms. The four different coordination polyhedra of Ni are Frank–Kasper icosahedra formed by five Tb and seven Ni atoms, four Tb and eight Ni atoms, three Tb and nine Ni atoms, and six Tb and six Ni atoms, respectively.

  17. Crystal Structure of the 30S Ribosomal Subunit from Thermus Thermophilus. Purification, Crystallization and Structure Determination

    Energy Technology Data Exchange (ETDEWEB)

    Clemons, William M.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki (MRC); (Utah); (MRC)

    2009-10-07

    We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 {angstrom} resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 {angstrom} resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.

  18. Waveguide structures in anisotropic nonlinear crystals

    Science.gov (United States)

    Li, Da; Hong, Pengda; Meissner, Helmuth E.

    2017-02-01

    We report on the design and manufacturing parameters of waveguiding structures of anisotropic nonlinear crystals that are employed for harmonic conversions, using Adhesive-Free Bonding (AFB®). This technology enables a full range of predetermined refractive index differences that are essential for the design of single mode or low-mode propagation with high efficiency in anisotropic nonlinear crystals which in turn results in compact frequency conversion systems. Examples of nonlinear optical waveguides include periodically bonded walk-off corrected nonlinear optical waveguides and periodically poled waveguide components, such as lithium triborate (LBO), beta barium borate (β-BBO), lithium niobate (LN), potassium titanyl phosphate (KTP), zinc germanium phosphide (ZGP) and silver selenogallate (AGSE). Simulation of planar LN waveguide shows that when the electric field vector E lies in the k-c plane, the power flow is directed precisely along the propagation direction, demonstrating waveguiding effect in the planar waveguide. Employment of anisotropic nonlinear optical waveguides, for example in combination with AFB® crystalline fiber waveguides (CFW), provides access to the design of a number of novel high power and high efficiency light sources spanning the range of wavelengths from deep ultraviolet (as short as 200 nm) to mid-infrared (as long as about 18 μm). To our knowledge, the technique is the only generally applicable one because most often there are no compatible cladding crystals available to nonlinear optical cores, especially not with an engineer-able refractive index difference and large mode area.

  19. Topological complexity of crystal structures: quantitative approach.

    Science.gov (United States)

    Krivovichev, Sergey

    2012-05-01

    The topological complexity of a crystal structure can be quantitatively evaluated using complexity measures of its quotient graph, which is defined as a projection of a periodic network of atoms and bonds onto a finite graph. The Shannon information-based measures of complexity such as topological information content, I(G), and information content of the vertex-degree distribution of a quotient graph, I(vd), are shown to be efficient for comparison of the topological complexity of polymorphs and chemically related structures. The I(G) measure is sensitive to the symmetry of the structure, whereas the I(vd) measure better describes the complexity of the bonding network. © 2012 International Union of Crystallography

  20. Crystal structure of (ferrocenylmethyldimethylammonium hydrogen oxalate

    Directory of Open Access Journals (Sweden)

    Mamadou Ndiaye

    2015-08-01

    Full Text Available The crystal structure of the title salt, [Fe(C5H5(C8H13N](HC2O4, consists of discrete (ferrocenylmethyldimethylammonium cations and hydrogen oxalate anions. The anions are connected through a strong O—H...O hydrogen bond, forming linear chains running parallel to [100]. The cations are linked to the anions through bifurcated N—H...(O,O′ hydrogen bonds. Weak C—H...π interactions between neighbouring ferrocenyl moieties are also observed.

  1. Crystal structure of Staphylococcus aureus Cas9

    OpenAIRE

    Nishimasu, Hiroshi; Cong, Le; Yan, Winston X.; Ran, F. Ann; Zetsche, Bernd; Li, Yinqing; Kurabayashi, Arisa; Ishitani, Ryuichiro; Zhang, Feng; Nureki, Osamu

    2015-01-01

    The RNA-guided DNA endonuclease Cas9 cleaves double-stranded DNA targets with a protospacer adjacent motif (PAM) and complementarity to the guide RNA. Recently, we harnessed Staphylococcus aureus Cas9 (SaCas9), which is significantly smaller than Streptococcus pyogenes Cas9 (SpCas9), to facilitate efficient in vivo genome editing. Here, we report the crystal structures of SaCas9 in complex with a single guide RNA (sgRNA) and its double-stranded DNA targets, containing the 5′-TTGAAT-3′ PAM and...

  2. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family

    Directory of Open Access Journals (Sweden)

    Miller M Clarke

    2009-07-01

    Full Text Available Abstract Background Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Results Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Conclusion Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  3. Crystal structure of yeast Sco1

    Energy Technology Data Exchange (ETDEWEB)

    Abajian, Carnie; Rosenzweig, Amy C. (NWU)

    2010-03-05

    The Sco family of proteins are involved in the assembly of the dinuclear CuA site in cytochrome c oxidase (COX), the terminal enzyme in aerobic respiration. These proteins, which are found in both eukaryotes and prokaryotes, are characterized by a conserved CXXXC sequence motif that binds copper ions and that has also been proposed to perform a thiol:disulfide oxidoreductase function. The crystal structures of Saccharomyces cerevisiae apo Sco1 (apo-ySco1) and Sco1 in the presence of copper ions (Cu-ySco1) were determined to 1.8- and 2.3-{angstrom} resolutions, respectively. Yeast Sco1 exhibits a thioredoxin-like fold, similar to that observed for human Sco1 and a homolog from Bacillus subtilis. The Cu-ySco1 structure, obtained by soaking apo-ySco1 crystals in copper ions, reveals an unexpected copper-binding site involving Cys181 and Cys216, cysteine residues present in ySco1 but not in other homologs. The conserved CXXXC cysteines, Cys148 and Cys152, can undergo redox chemistry in the crystal. An essential histidine residue, His239, is located on a highly flexible loop, denoted the Sco loop, and can adopt positions proximal to both pairs of cysteines. Interactions between ySco1 and its partner proteins yeast Cox17 and yeast COX2 are likely to occur via complementary electrostatic surfaces. This high-resolution model of a eukaryotic Sco protein provides new insight into Sco copper binding and function.

  4. Simulating complex crystal structures using the phase-field crystal model

    Science.gov (United States)

    Alster, Eli; Montiel, David; Thornton, Katsuyo; Voorhees, Peter W.

    2017-11-01

    We introduce a phase-field crystal model that creates an array of complex three- and two-dimensional crystal structures via a numerically tractable three-point correlation function. The three-point correlation function is designed in order to energetically favor the principal interplanar angles of a target crystal structure. This is achieved via an analysis performed by examining the crystal's structure factor. This approach successfully yields energetically stable simple cubic, diamond cubic, simple hexagonal, graphene layers, and CaF2 crystals. To illustrate the ability of the method to yield a particularly complex and technologically important crystal structure, we show how this three-point correlation function method can be used to generate perovskite crystals.

  5. Association of condensin with chromosomes depends on DNA binding by its HEAT-repeat subunits.

    Science.gov (United States)

    Piazza, Ilaria; Rutkowska, Anna; Ori, Alessandro; Walczak, Marta; Metz, Jutta; Pelechano, Vicent; Beck, Martin; Haering, Christian H

    2014-06-01

    Condensin complexes have central roles in the three-dimensional organization of chromosomes during cell divisions, but how they interact with chromatin to promote chromosome segregation is largely unknown. Previous work has suggested that condensin, in addition to encircling chromatin fibers topologically within the ring-shaped structure formed by its SMC and kleisin subunits, contacts DNA directly. Here we describe the discovery of a binding domain for double-stranded DNA formed by the two HEAT-repeat subunits of the Saccharomyces cerevisiae condensin complex. From detailed mapping data of the interfaces between the HEAT-repeat and kleisin subunits, we generated condensin complexes that lack one of the HEAT-repeat subunits and consequently fail to associate with chromosomes in yeast and human cells. The finding that DNA binding by condensin's HEAT-repeat subunits stimulates the SMC ATPase activity suggests a multistep mechanism for the loading of condensin onto chromosomes.

  6. Steps in the process of DNA binding and entry in transformation. [Pneumococcus

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S

    1978-01-01

    The DNA uptake phase of genetic transformation in S. pheumoniae is reviewed with emphasis on molecular interactions at each step. An initial, reversible binding appears to be dependent on the molecular concentration of donor DNA. Subsequent irreversible binding, limited to the numbr of molecules corresponding to a fixed number of receptor sites, requires potassium ions and energy. Competition of different DNAs for uptake occurs at the initial step, but depends on the size of the DNA as well as its molecular concentration. Single-strand breakage accompanies irreversible binding of DNA. The frequency of breaks does not appear to depend on DNA concentration. Entry of DNA follows irreversible binding. The entry step, in which donor DNA is converted to single strands, requires action of a membrane nuclease. In the membrane this nuclease is part ofa specific multiprotein structure, which may function as a unit in DNA binding and entry.

  7. Crystal Structure of Human Nicotinamide Riboside Kinase

    Energy Technology Data Exchange (ETDEWEB)

    Khan,J.; Xiang, S.; Tong, L.

    2007-01-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD{sup +} as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 {angstrom} resolution and in a ternary complex with ADP and tiazofurin at 2.7 {angstrom} resolution. The active site is located in a groove between the central parallel {beta} sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  8. Crystal structure of human nicotinamide riboside kinase.

    Science.gov (United States)

    Khan, Javed A; Xiang, Song; Tong, Liang

    2007-08-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD(+) as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 A resolution and in a ternary complex with ADP and tiazofurin at 2.7 A resolution. The active site is located in a groove between the central parallel beta sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  9. Syntheses and Crystal Structures of Ferrocenoindenes

    Directory of Open Access Journals (Sweden)

    Gerhard Laus

    2013-02-01

    Full Text Available Ferrocenoindenes display planar chirality and thus represent valuable ligands for asymmetric catalysis. Here, we report on the synthesis of novel 3-(1,1-dibromomethyleneferroceno[1,2-a]indene, (Z-3-(1-bromomethylene-6-iodoferroceno[1,2-a]indene, and benzo[5,6-f]ferroceno[2,3,a]inden-1-one. Any application-oriented design of chiral catalysts requires fundamental knowledge about the ligands involved, not only in terms of atom-connectivity, but also in terms of their three-dimensional structure and steric demand. Therefore, the crystal structures of 2-ferrocenylbenzoic acid, ferroceno[1,2-a]indene, and (Z-3-(1-bromomethylene-6-iodoferroceno[1,2-a]indene have been determined. The bond-lengths that can be retrieved therefrom also allow for an estimation of the reactivity of the aryl-iodo, bromo-methylidene and dibromomethylidene moieties.

  10. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA*

    Science.gov (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric

    2015-01-01

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  11. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Science.gov (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The function of DNA binding protein nucleophosmin in AAV replication.

    Science.gov (United States)

    Satkunanathan, Stifani; Thorpe, Robin; Zhao, Yuan

    2017-10-01

    Adeno-associated viruses (AAV) contain minimal viral proteins necessary for their replication. During virus assembly, AAV acquire, inherently and submissively, various cellular proteins. Our previous studies identified the association of AAV vectors with the DNA binding protein nucleophosmin (NPM1). Nucleophosmin has been reported to enhance AAV infection by mobilizing AAV capsids into and out of the nucleolus, indicating the importance of NPM1 in the AAV life cycle; however the role of NPM1 in AAV production remains unknown. In this study, we systematically investigated NPM1 function on AAV production using NPM1 knockdown cells and revealing for the first time the presence of G-quadruplex DNA sequences (GQRS) in the AAV genome, the synergistic NPM1-GQRS function in AAV production and the significant enhancement of NPM1 gene knockdown on AAV vector production. Understanding the role of cellular proteins in the AAV life cycle will greatly facilitate high titre production of AAV vectors for clinical use. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  13. Structural Transitions in Cholesteric Liquid Crystal Droplets

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Ye; Bukusoglu, Emre; Martínez-González, José A.; Rahimi, Mohammad; Roberts, Tyler F.; Zhang, Rui; Wang, Xiaoguang; Abbott, Nicholas L.; de Pablo, Juan J.

    2016-07-26

    Confinement of cholesteric liquid crystals (ChLC) into droplets leads to a delicate interplay between elasticity, chirality, and surface energy. In this work, we rely on a combination of theory and experiments to understand the rich morphological behavior that arises from that balance. More specifically, a systematic study of micrometer-sized ChLC droplets is presented as a function of chirality and surface energy (or anchoring). With increasing chirality, a continuous transition is observed from a twisted bipolar structure to a radial spherical structure, all within a narrow range of chirality. During such a transition, a bent structure is predicted by simulations and confirmed by experimental observations. Simulations are also able to capture the dynamics of the quenching process observed in experiments. Consistent with published work, it is found that nanoparticles are attracted to defect regions on the surface of the droplets. For weak anchoring conditions at the nanoparticle surface, ChLC droplets adopt a morphology similar to that of the equilibrium helical phase observed for ChLCs in the bulk. As the anchoring strength increases, a planar bipolar structure arises, followed by a morphological transition to a bent structure. The influence of chirality and surface interactions are discussed in the context of the potential use of ChLC droplets as stimuli-responsive materials for reporting molecular adsorbates.

  14. Crystal structures of five 6-mercaptopurine derivatives

    Directory of Open Access Journals (Sweden)

    Lígia R. Gomes

    2016-03-01

    Full Text Available The crystal structures of five 6-mercaptopurine derivatives, viz. 2-[(9-acetyl-9H-purin-6-ylsulfanyl]-1-(3-methoxyphenylethan-1-one (1, C16H14N4O3S, 2-[(9-acetyl-9H-purin-6-ylsulfanyl]-1-(4-methoxyphenylethan-1-one (2, C16H14N4O3S, 2-[(9-acetyl-9H-purin-6-ylsulfanyl]-1-(4-chlorophenylethan-1-one (3, C15H11ClN4O2S, 2-[(9-acetyl-9H-purin-6-ylsulfanyl]-1-(4-bromophenylethan-1-one (4, C15H11BrN4O2S, and 1-(3-methoxyphenyl-2-[(9H-purin-6-ylsulfanyl]ethan-1-one (5, C14H12N4O2S. Compounds (2, (3 and (4 are isomorphous and accordingly their molecular and supramolecular structures are similar. An analysis of the dihedral angles between the purine and exocyclic phenyl rings show that the molecules of (1 and (5 are essentially planar but that in the case of the three isomorphous compounds (2, (3 and (4, these rings are twisted by a dihedral angle of approximately 38°. With the exception of (1 all molecules are linked by weak C—H...O hydrogen bonds in their crystals. There is π–π stacking in all compounds. A Cambridge Structural Database search revealed the existence of 11 deposited compounds containing the 1-phenyl-2-sulfanylethanone scaffold; of these, only eight have a cyclic ring as substituent, the majority of these being heterocycles.

  15. Crystal structure of strontium dinickel iron orthophosphate

    Directory of Open Access Journals (Sweden)

    Said Ouaatta

    2015-10-01

    Full Text Available The title compound, SrNi2Fe(PO43, synthesized by solid-state reaction, crystallizes in an ordered variant of the α-CrPO4 structure. In the asymmetric unit, two O atoms are in general positions, whereas all others atoms are in special positions of the space group Imma: the Sr cation and one P atom occupy the Wyckoff position 4e (mm2, Fe is on 4b (2/m, Ni and the other P atom are on 8g (2, one O atom is on 8h (m and the other on 8i (m. The three-dimensional framework of the crystal structure is built up by [PO4] tetrahedra, [FeO6] octahedra and [Ni2O10] dimers of edge-sharing octahedra, linked through common corners or edges. This structure comprises two types of layers stacked alternately along the [100] direction. The first layer is formed by edge-sharing octahedra ([Ni2O10] dimer linked to [PO4] tetrahedra via common edges while the second layer is built up from a strontium row followed by infinite chains of alternating [PO4] tetrahedra and FeO6 octahedra sharing apices. The layers are held together through vertices of [PO4] tetrahedra and [FeO6] octahedra, leading to the appearance of two types of tunnels parallel to the a- and b-axis directions in which the Sr cations are located. Each Sr cation is surrounded by eight O atoms.

  16. Crystal structure of N-deacetyllappaconitine

    Directory of Open Access Journals (Sweden)

    Xin-Wei Shi

    2015-08-01

    Full Text Available The title compound, C30H42N2O7 [systematic name: (1S,4S,5S,7S,8S,9S,10S,11S,13R,14S,16S,17R-20-ethyl-4,8,9-trihydroxy-1,14,16-trimethoxyaconitan-4-yl 2-aminobenzoate], isolated from roots of Aconitum sinomontanum Nakai, is a typical aconitane-type C19-diterpenoid alkaloid, which crystallizes with two independent molecules in the asymmetric unit. The conformations of the two independent molecules are closely similar. Each molecule comprises four six-membered rings (A, B, D and E including one six-membered N-containing heterocyclic ring (E, and two five-membered rings (C and F. Rings A, B and E adopt chair conformations, while ring D displays a boat conformation. Five-membered rings C and F exhibit envelope conformations. IntramolecularN—H...O hydrogen bonds between the amino group and carbonyl O atom help to stabilize molecular structure. In the crystal, O—H...O hydrogen bonds link the molecules into zigzag chains propagating in [010].

  17. Crystal Structures of Respiratory Pathogen Neuraminidases

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Y.; Parker, D; Ratner, A; Prince, A; Tong, L

    2009-01-01

    Currently there is pressing need to develop novel therapeutic agents for the treatment of infections by the human respiratory pathogens Pseudomonas aeruginosa and Streptococcus pneumoniae. The neuraminidases of these pathogens are important for host colonization in animal models of infection and are attractive targets for drug discovery. To aid in the development of inhibitors against these neuraminidases, we have determined the crystal structures of the P. aeruginosa enzyme NanPs and S. pneumoniae enzyme NanA at 1.6 and 1.7 {angstrom} resolution, respectively. In situ proteolysis with trypsin was essential for the crystallization of our recombinant NanA. The active site regions of the two enzymes are strikingly different. NanA contains a deep pocket that is similar to that in canonical neuraminidases, while the NanPs active site is much more open. The comparative studies suggest that NanPs may not be a classical neuraminidase, and may have distinct natural substrates and physiological functions. This work represents an important step in the development of drugs to prevent respiratory tract colonization by these two pathogens.

  18. Crystal structure prediction supported with diffraction data

    Science.gov (United States)

    Tsujimoto, Naoto; Adachi, Daiki; Todo, Synge; Akashi, Ryosuke; Tsuneyuki, Shinji

    Atomistic computer simulation is of growing importance in the study of unidentified crystals, although prediction or determination of complicated structure is still a challenging problem due to its many degrees of freedom. Here we propose to utilize experimentally available data of powder diffraction to support and accelerate the structure simulation. In so-called direct-space methods for structure determination from powder diffraction, simplified interatomic potential energy or some other physical constraints are often used in combination with the cost function defined by diffraction data. On the other hand, we formulate a cost function called ``crystallinity'' to support simulation with accurate interatomic potential energy. Since the crystallinity here is defined as the sum of the diffraction intensities only at the peak positions detected in experiments, this method is applicable to low-quality diffraction data such as those obtained at high pressures. We apply this method to well-known polymorphs of SiO2 with up to 96 atoms in the simulation cell to find that it reproduces the correct structures efficiently with information of a very limited number of diffraction peaks.

  19. Nonequilibrium synthesis and assembly of hybrid inorganic-protein nanostructures using an engineered DNA binding protein.

    Science.gov (United States)

    Dai, Haixia; Choe, Woo-Seok; Thai, Corrine K; Sarikaya, Mehmet; Traxler, Beth A; Baneyx, François; Schwartz, Daniel T

    2005-11-09

    We show that a protein with no intrinsic inorganic synthesis activity can be endowed with the ability to control the formation of inorganic nanostructures under thermodynamically unfavorable (nonequilibrium) conditions, reproducing a key feature of biological hard-tissue growth and assembly. The nonequilibrium synthesis of Cu(2)O nanoparticles is accomplished using an engineered derivative of the DNA-binding protein TraI in a room-temperature precursor electrolyte. The functional TraI derivative (TraIi1753::CN225) is engineered to possess a cysteine-constrained 12-residue Cu(2)O binding sequence, designated CN225, that is inserted into a permissive site in TraI. When TraIi1753::CN225 is included in the precursor electrolyte, stable Cu(2)O nanoparticles form, even though the concentrations of [Cu(+)] and [OH(-)] are at 5% of the solubility product (K(sp,Cu2O)). Negative control experiments verify that Cu(2)O formation is controlled by inclusion of the CN225 binding sequence. Transmission electron microscopy and electron diffraction reveal a core-shell structure for the nonequilibrium nanoparticles: a 2 nm Cu(2)O core is surrounded by an adsorbed protein shell. Quantitative protein adsorption studies show that the unexpected stability of Cu(2)O is imparted by the nanomolar surface binding affinity of TraIi1753::CN225 for Cu(2)O (K(d) = 1.2 x 10(-)(8) M), which provides favorable interfacial energetics (-45 kJ/mol) for the core-shell configuration. The protein shell retains the DNA-binding traits of TraI, as evidenced by the spontaneous organization of nanoparticles onto circular double-stranded DNA.

  20. Multiple DNA-binding modes for the ETS family transcription factor PU.1.

    Science.gov (United States)

    Esaki, Shingo; Evich, Marina G; Erlitzki, Noa; Germann, Markus W; Poon, Gregory M K

    2017-09-29

    The eponymous DNA-binding domain of ETS ( E 26 t ransformation- s pecific) transcription factors binds a single sequence-specific site as a monomer over a single helical turn. Following our previous observation by titration calorimetry that the ETS member PU.1 dimerizes sequentially at a single sequence-specific DNA-binding site to form a 2:1 complex, we have carried out an extensive spectroscopic and biochemical characterization of site-specific PU.1 ETS complexes. Whereas 10 bp of DNA was sufficient to support PU.1 binding as a monomer, additional flanking bases were required to invoke sequential dimerization of the bound protein. NMR spectroscopy revealed a marked loss of signal intensity in the 2:1 complex, and mutational analysis implicated the distal surface away from the bound DNA as the dimerization interface. Hydroxyl radical DNA footprinting indicated that the site-specifically bound PU.1 dimers occupied an extended DNA interface downstream from the 5'-GGAA-3' core consensus relative to its 1:1 counterpart, thus explaining the apparent site size requirement for sequential dimerization. The site-specifically bound PU.1 dimer resisted competition from nonspecific DNA and showed affinities similar to other functionally significant PU.1 interactions. As sequential dimerization did not occur with the ETS domain of Ets-1, a close structural homolog of PU.1, 2:1 complex formation may represent an alternative autoinhibitory mechanism in the ETS family at the protein-DNA level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Crystal structure of a snake venom cardiotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Rees, B.; Samama, J.P.; Thierry, J.C.; Gilibert, M.; Fischer, J.; Schweitz, H.; Lazdunski, M.; Moras, D.

    1987-05-01

    Cardiotoxin V/sup II/4 from Naja mossambica crystallizes in space group P6/sub 1/ (a = b = 73.9 A; c = 59.0 A) with two molecules of toxin (molecular mass = 6715 Da) in the asymmetric unit. The structure was solved by using a combination of multiple isomorphous replacement and density modification methods. Model building and least-squares refinement led to an agreement factor of 27% for a data set to 3-A resolution prior to any inclusion of solvent molecules. The topology of the molecule is similar to that found in short and long snake neurotoxins, which block the nicotinic acetylcholine receptor. Major differences occur in the conformation of the central loop, resulting in a change in the concavity of the molecule. Hydrophobic residues are clustered in two distinct areas. The existence of stable dimeric entities in the crystalline state, with the formation of a six-stranded antiparallel ..beta.. sheet, may be functionally relevant.

  2. Crystal structure of 4-(trimethylgermylbenzoic acid

    Directory of Open Access Journals (Sweden)

    Lena Knauer

    2015-06-01

    Full Text Available The title compound, [Ge(CH33(C7H5O2], was obtained as a by-product in the synthesis of the corresponding aldehyde. Two slightly different molecules are present in the asymmetric unit. In both molecules, the geometry of the aromatic ring plane is distorted by varying intensities. Additionally, the Ge atoms deviate from the mean aromatic ring planes. Whereas the distance of the Ge atom to the ring plane is only 0.101 (4 Å in the first molecule, this distance is increased to 0.210 (4 Å in the second. In the crystal structure, centrosymmetric O—H...O hydrogen-bonded dimers are formed. The title compound is isostructural with the Si analogue [Haberecht et al. (2004. Acta Cryst. E60, o329–0330].

  3. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    Energy Technology Data Exchange (ETDEWEB)

    Sweeney, C.; Cutroneo, K.R.

    1987-05-01

    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with /sup 32/P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of /sup 32/P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined.

  4. The molecular basis of conformational instability of the ecdysone receptor DNA binding domain studied by in silico and in vitro experiments.

    Directory of Open Access Journals (Sweden)

    Agnieszka Szamborska-Gbur

    Full Text Available The heterodimer of the ecdysone receptor (EcR and ultraspiracle (Usp, members of the nuclear receptors superfamily, regulates gene expression associated with molting and metamorphosis in insects. The DNA binding domains (DBDs of the Usp and EcR play an important role in their DNA-dependent heterodimerization. Analysis of the crystal structure of the UspDBD/EcRDBD heterocomplex from Drosophila melanogaster on the hsp27 gene response element, suggested an appreciable similarity between both DBDs. However, the chemical denaturation experiments showed a categorically lower stability for the EcRDBD in contrast to the UspDBD. The aim of our study was an elucidation of the molecular basis of this intriguing instability. Toward this end, we mapped the EcRDBD amino acid sequence positions which have an impact on the stability of the EcRDBD. The computational protein design and in vitro analyses of the EcRDBD mutants indicate that non-conserved residues within the α-helix 2, forming the EcRDBD hydrophobic core, represent a specific structural element that contributes to instability. In particular, the L58 appears to be a key residue which differentiates the hydrophobic cores of UspDBD and EcRDBD and is the main reason for the low stability of the EcRDBD. Our results might serve as a benchmark for further studies of the intricate nature of the EcR molecule.

  5. Tuning DNA binding affinity and cleavage specificity of an engineered gene-targeting nuclease via surface display, flow cytometry and cellular analyses.

    Science.gov (United States)

    Niyonzima, Nixon; Lambert, Abigail R; Werther, Rachel; De Silva Feelixge, Harshana; Roychoudhury, Pavitra; Greninger, Alexander L; Stone, Daniel; Stoddard, Barry L; Jerome, Keith R

    2017-07-01

    The combination of yeast surface display and flow cytometric analyses and selections is being used with increasing frequency to alter specificity of macromolecular recognition, including both protein-protein and protein-nucleic acid interactions. Here we describe the use of yeast surface display and cleavage-dependent flow cytometric assays to increase the specificity of an engineered meganuclease. The re-engineered meganuclease displays a significantly tightened specificity profile, while binding its cognate target site with a slightly lower, but still sub-nanomolar affinity. When incorporated into otherwise identical megaTAL protein scaffolds, these two nucleases display significantly different activity and toxicity profiles in cellulo. The structural basis for reprogrammed DNA cleavage specificity was further examined via high-resolution X-ray crystal structures of both enzymes. This analysis illustrated the altered protein-DNA contacts produced by mutagenesis and selection, that resulted both in altered readout of those based and a necessary reduction in DNA binding affinity that were necessary to improve specificity across the target site. The results of this study provide an illustrative example of the potential (and the challenges) associated with the use of surface display and flow cytometry for the retargeting and optimization of enzymes that act on nucleic acid substrates in a sequence-specific manner. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors.

    Science.gov (United States)

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; Kim, Youngchang; Rastinejad, Fraydoon

    2016-10-26

    The neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the wider mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.

  7. Crystal structure of Deep Vent DNA polymerase.

    Science.gov (United States)

    Hikida, Yasushi; Kimoto, Michiko; Hirao, Ichiro; Yokoyama, Shigeyuki

    2017-01-29

    DNA polymerases are useful tools in various biochemical experiments. We have focused on the DNA polymerases involved in DNA replication including the unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px). Many reports have described the different combinations between unnatural base pairs and DNA polymerases. As an example, for the replication of the Ds-Px pair, Deep Vent DNA polymerase exhibits high efficiency and fidelity, but Taq DNA polymerase shows much lower efficiency and fidelity. In the present study, we determined the crystal structure of Deep Vent DNA polymerase in the apo form at 2.5 Å resolution. Using this structure, we constructed structural models of Deep Vent DNA polymerase complexes with DNA containing an unnatural or natural base in the replication position. The models revealed that the unnatural Ds base in the template-strand DNA clashes with the side-chain oxygen of Thr664 in Taq DNA polymerase, but not in Deep Vent DNA polymerase. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

    Science.gov (United States)

    Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

    2015-11-01

    Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

  9. DNA binding, BSA interaction and SOD activity of two new nickel(II) complexes with glutamine Schiff base ligands.

    Science.gov (United States)

    Wei, Qiang; Dong, Jianfang; Zhao, Peiran; Li, Manman; Cheng, Fengling; Kong, Jinming; Li, Lianzhi

    2016-08-01

    Two hexacoordinated octahedral nickel(II) complexes, [Ni(o-van-gln)(phen)(H2O)](1) and [Ni(sal-gln)(phen)(H2O)](2) [o-van-gln=a Schiff base derived from o-vanillin and glutamine, sal-gln=a Schiff base derived from salicylaldehyde and glutamine, phen=1,10-phenanthroline], have been synthesized and characterized by elemental analysis, IR spectra and single crystal X-ray diffraction. X-ray studies showed that nickel atoms of both 1 and 2 exhibit distorted NiN3O3 octahedral geometry. In each crystal, intermolecular hydrogen bonds form a two-dimensional network structure. DNA-binding properties of these two nickel(II) complexes were investigated by using UV-Vis absorption, fluorescence, circular dichroism (CD) spectroscopies and viscosity measurements. Results indicated that the two complexes can bind to calf thymus DNA (CT-DNA) via an intercalative mode, and complex 1 exhibits higher interaction with CT-DNA than complex 2. Furthermore, the interactions between the nickel(II) complexes with bovine serum albumin (BSA) have been studied by spectroscopies. The results indicated that both complexes could quench the intrinsic fluorescence of BSA in a static quenching process. The binding constants (Kb) and the numbers of binding sites (n) obtained are 1.10×10(5)M(-1) and 1.05 for complex 1 and 5.05×10(4)M(-1) and 0.997 for complex 2, respectively. Site-selective competitive binding investigation indicated that the binding sites of both the complexes are located in site I of sub-domains IIA of BSA. Assay of superoxide dismutase (SOD) activity of the nickel(II) complexes revealed that they exhibit significant superoxide scavenging activity with IC50=3.4×10(-5)M for complex 1 and 4.3×10(-5)M for complex 2, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Formamidinium iodide: crystal structure and phase transitions

    Directory of Open Access Journals (Sweden)

    Andrey A. Petrov

    2017-04-01

    Full Text Available At a temperature of 100 K, CH5N2+·I− (I, crystallizes in the monoclinic space group P21/c. The formamidinium cation adopts a planar symmetrical structure [the r.m.s. deviation is 0.002 Å, and the C—N bond lengths are 1.301 (7 and 1.309 (8 Å]. The iodide anion does not lie within the cation plane, but deviates from it by 0.643 (10 Å. The cation and anion of I form a tight ionic pair by a strong N—H...I hydrogen bond. In the crystal of I, the tight ionic pairs form hydrogen-bonded zigzag-like chains propagating toward [20-1] via strong N—H...I hydrogen bonds. The hydrogen-bonded chains are further packed in stacks along [100]. The thermal behaviour of I was studied by different physicochemical methods (thermogravimetry, differential scanning calorimetry and powder diffraction. Differential scanning calorimetry revealed three narrow endothermic peaks at 346, 387 and 525 K, and one broad endothermic peak at ∼605 K. The first and second peaks are related to solid–solid phase transitions, while the third and fourth peaks are attributed to the melting and decomposition of I. The enthalpies of the phase transitions at 346 and 387 K are estimated as 2.60 and 2.75 kJ mol−1, respectively. The X-ray powder diffraction data collected at different temperatures indicate the existence of I as the monoclinic (100–346 K, orthorhombic (346–387 K and cubic (387–525 K polymorphic modifications.

  11. Crystal structure and functional characterization of the human RBM25 PWI domain and its flanking basic region.

    Science.gov (United States)

    Gong, Deshun; Yang, Fan; Li, Fudong; Qian, Dandan; Wu, Minhao; Shao, Zhenhua; Wu, Mian; Wu, Jihui; Shi, Yunyu

    2013-02-15

    Human RBM25 (RNA-binding motif protein 25) is a novel splicing factor that contains a PWI domain, a newly identified RNA/DNA-binding domain, and regulates Bcl-x pre-mRNA alternative splicing. The flanking basic region has been suggested to serve as a co-operative partner of the PWI domain in the binding of nucleic acids, but the structure of this basic region is unknown. In the present paper, we report the crystal structure of the RBM25 PWI domain and its flanking basic region. The PWI domain is revealed to comprise a conserved four-helix bundle, and the flanking basic region forms two α-helices and associates with helix H4 of the PWI domain. These interactions promote directly the formation of an enlarged nucleic-acid-binding platform. Structure-guided mutagenesis reveals a positively charged nucleic-acid-binding surface in the RBM25 PWI domain that is entirely different from that in the SRm160 PWI domain. Furthermore, we show that the promotion of the pro-apoptotic Bcl-xS isoform expression by RBM25 is facilitated by the PWI domain in vivo. Thus the present study suggests that the PWI domain plays an important role in the regulation of Bcl-x pre-mRNA alternative splicing.

  12. CCDC 1416891: Experimental Crystal Structure Determination : Methyl-triphenyl-germanium

    KAUST Repository

    Bernatowicz, Piotr

    2015-01-01

    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  13. CCDC 1408042: Experimental Crystal Structure Determination : 6,13-dimesitylpentacene

    KAUST Repository

    Shi, Xueliang

    2015-01-01

    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  14. Crystal structure and elastic constants of Dharwar cotton fibre using ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 30; Issue 5. Crystal structure and elastic constants of Dharwar cotton fibre using WAXS data. O M Samir R ... Using this data and employing linked atom least squares (LALS) method, we report here the molecular and crystal structure of these cotton fibres. Employing ...

  15. Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis

    National Research Council Canada - National Science Library

    Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W

    2005-01-01

    A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...

  16. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    Science.gov (United States)

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH 2 groups (CONH 2 -SWNT) exhibited very strong interactions between the CONH 2 -SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  17. Methylated DNA-binding protein is present in various mammalian cell types

    Energy Technology Data Exchange (ETDEWEB)

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. (Tulane Medical School, New Orleans, LA (USA)); Ehrlich, K.C. (Department of Agriculture, New Orleans, LA (USA))

    1988-08-25

    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  18. Identification, cloning and expression of p25, an AT-rich DNA-binding protein from the extreme thermophile, Thermus aquaticus YT-1.

    Science.gov (United States)

    Du, X; Pène, J J

    1999-01-01

    Although the G+C content of Thermus aquaticus YT-1 chromosomal DNA is 67.4%, regions with lower G+C content have also been observed. AT-rich DNA-binding proteins may contribute to the thermostability and biological functions of these DNA regions at Thermus growth temperatures. Using double-stranded DNA (dsDNA)-cellulose chromatography, a T.aquaticus YT-1 protein, designated as p25, was identified to bind preferentially to AT-rich DNA. The gene encoding p25 was cloned and sequenced after immunoscreening T.aquaticus YT-1 expression libraries. The deduced primary structure of p25 is 211 amino acids in length with a molecular weight of 23 225 Da. Native p25 was purified and characterized as a homodimer with modification possibly at lysine and arginine residues. Its preferential and temperature-dependent binding to AT-rich DNA was confirmed with mobility-shift DNA-binding assays. The protein was demonstrated to bind preferentially to dsDNA instead of single-stranded DNA. The binding of p25 to dsDNA also improved the thermotolerence of this protein. Overexpression study of fusion p25 suggested that the N-terminus of the protein might form the DNA-binding domain or be closely involved in DNA-binding activity. PMID:10076001

  19. The effect of metal and substituent on DNA binding, cleavage activity, and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex

    Science.gov (United States)

    Asadi, Zahra; Nasrollahi, Neda

    2017-11-01

    New water soluble Schiff base ligands [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol] (L1) and [N,Nʹ-bis(salicylidine)-1,3-diamino-2-propanol] (L2) and zinc (II) complex of L1: [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol]Zn(II) were synthesized and characterized by elemental analysis, FT-IR, 1HNMR and UV-Vis spectroscopy. In vitro DNA binding of the compounds were investigated by UV-Vis absorption spectroscopy, viscosity measurement, cyclic voltammetry, fluorescence spectroscopy, and gel electrophoresis. The present study aimed to investigate the effect of metal and substituent on DNA binding, cleavage activity and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex. The order of DNA binding affinity (Kb) calculated from the absorption spectroscopy was: ZnL1 > L2 > L1. Molecular docking studies explore more details on the mode of binding and binding energies. Although the compounds revealed strong DNA binding affinity but electrophoresis studies don't show any effects on the DNA structure and single or double strand breaks. The cytotoxicity experiments against human Hepatoma (HepG2) showed the order: L1 > ZnL1 > L2.

  20. Crystal structure of human IRAK1.

    Science.gov (United States)

    Wang, Li; Qiao, Qi; Ferrao, Ryan; Shen, Chen; Hatcher, John M; Buhrlage, Sara J; Gray, Nathanael S; Wu, Hao

    2017-12-19

    Interleukin 1 (IL-1) receptor-associated kinases (IRAKs) are serine/threonine kinases that play critical roles in initiating innate immune responses against foreign pathogens and other types of dangers through their role in Toll-like receptor (TLR) and interleukin 1 receptor (IL-1R) mediated signaling pathways. Upon ligand binding, TLRs and IL-1Rs recruit adaptor proteins, such as myeloid differentiation primary response gene 88 (MyD88), to the membrane, which in turn recruit IRAKs via the death domains in these proteins to form the Myddosome complex, leading to IRAK kinase activation. Despite their biological and clinical significance, only the IRAK4 kinase domain structure has been determined among the four IRAK family members. Here, we report the crystal structure of the human IRAK1 kinase domain in complex with a small molecule inhibitor. The structure reveals both similarities and differences between IRAK1 and IRAK4 and is suggestive of approaches to develop IRAK1- or IRAK4-specific inhibitors for potential therapeutic applications. While the IRAK4 kinase domain is capable of homodimerization in the unphosphorylated state, we found that the IRAK1 kinase domain is constitutively monomeric regardless of its phosphorylation state. Additionally, the IRAK1 kinase domain forms heterodimers with the phosphorylated, but not unphosphorylated, IRAK4 kinase domain. Collectively, these data indicate a two-step kinase activation process in which the IRAK4 kinase domain first homodimerizes in the Myddosome, leading to its trans-autophosphorylation and activation. The phosphorylated IRAK4 kinase domain then forms heterodimers with the IRAK1 kinase domain within the Myddosome, leading to its subsequent phosphorylation and activation.

  1. Evaluation of DNA-binding, DNA cleavage, antioxidant and cytotoxic activity of mononuclear ruthenium(II) carbonyl complexes of benzaldehyde 4-phenyl-3-thiosemicarbazones

    Science.gov (United States)

    Sampath, Krishnan; Sathiyaraj, Subbaiyan; Jayabalakrishnan, Chinnasamy

    2013-11-01

    Two 4-phenyl-3-thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-phenylhydrazinecarbothioamide (HL1) and (E)-2-(2-nitrobenzylidene)-N-phenylhydrazinecarbothioamide (HL2), and its ruthenium(II) complexes were synthesized and characterized by physico-chemical and spectroscopic methods. The Schiff bases act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the compounds was investigated by absorption spectroscopy which indicated that the compounds bind to DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant study of the ligands and complexes showed significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes assayed against HeLa and MCF-7 cell lines showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  2. Mixed ligand ruthenium(III) complexes of benzaldehyde 4-methyl-3-thiosemicarbazones with triphenylphosphine/triphenylarsine co-ligands: Synthesis, DNA binding, DNA cleavage, antioxidative and cytotoxic activity

    Science.gov (United States)

    Sampath, K.; Sathiyaraj, S.; Raja, G.; Jayabalakrishnan, C.

    2013-08-01

    The new ruthenium(III) complexes with 4-methyl-3-thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-methylhydrazinecarbothioamide (HL1) and (E)-2-(2-nitrobenzylidene)-N-methylhydrazinecarbothioamide (HL2), were prepared and characterized by various physico-chemical and spectroscopic methods. The title compounds act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the ligands and complexes were investigated by absorption spectroscopy and IR spectroscopy. It reveals that the compounds bind to nitrogenous bases of DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant study of the ligands and complexes showed the significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes against MCF-7 cell line was assayed which showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  3. Identification of DNA-binding proteins using support vector machines and evolutionary profiles

    Directory of Open Access Journals (Sweden)

    Gromiha Michael M

    2007-11-01

    Full Text Available Abstract Background Identification of DNA-binding proteins is one of the major challenges in the field of genome annotation, as these proteins play a crucial role in gene-regulation. In this paper, we developed various SVM modules for predicting DNA-binding domains and proteins. All models were trained and tested on multiple datasets of non-redundant proteins. Results SVM models have been developed on DNAaset, which consists of 1153 DNA-binding and equal number of non DNA-binding proteins, and achieved the maximum accuracy of 72.42% and 71.59% using amino acid and dipeptide compositions, respectively. The performance of SVM model improved from 72.42% to 74.22%, when evolutionary information in form of PSSM profiles was used as input instead of amino acid composition. In addition, SVM models have been developed on DNAset, which consists of 146 DNA-binding and 250 non-binding chains/domains, and achieved the maximum accuracy of 79.80% and 86.62% using amino acid composition and PSSM profiles. The SVM models developed in this study perform better than existing methods on a blind dataset. Conclusion A highly accurate method has been developed for predicting DNA-binding proteins using SVM and PSSM profiles. This is the first study in which evolutionary information in form of PSSM profiles has been used successfully for predicting DNA-binding proteins. A web-server DNAbinder has been developed for identifying DNA-binding proteins and domains from query amino acid sequences http://www.imtech.res.in/raghava/dnabinder/.

  4. The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chung-ke [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Wu, Tzong-Huah [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Chemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, Institute of Biochemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu 300, Taiwan (China); Wu, Chu-Ya [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Graduate Institute of Engineering, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Chiang, Ming-hui; Toh, Elsie Khai-Woon [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Hsu, Yin-Chih; Lin, Ku-Feng [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Liao, Yu-heng [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Huang, Tai-huang, E-mail: bmthh@gate.sinica.edu.tw [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Department of Physics, National Taiwan Normal University, Taipei 106, Taiwan (China); Huang, Joseph Jen-Tse, E-mail: jthuang@chem.sinica.edu.tw [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

  5. Structural derivation and crystal chemistry of apatites.

    Science.gov (United States)

    White, T J; ZhiLi, Dong

    2003-02-01

    The crystal structures of the [A(1)(2)][A(2)(3)](BO(4))(3)X apatites and the related compounds [A(1)(2)][A(2)(3)](BO(5))(3)X and [A(1)(2)][A(2)(3)](BO(3))(3)X are collated and reviewed. The structural aristotype for this family is Mn(5)Si(3) (D8(8) type, P6(3)/mcm symmetry), whose cation array approximates that of all derivatives and from which related structures arise through the systematic insertion of anions into tetrahedral, triangular or linear interstices. The construction of a hierarchy of space-groups leads to three apatite families whose high-symmetry members are P6(3)/m, Cmcm and P6(3)cm. Alternatively, systematic crystallographic changes in apatite solid-solution series may be practically described as deviations from regular anion nets, with particular focus on the O(1)-A(1)-O(2) twist angle phi projected on (001) of the A(1)O(6) metaprism. For apatites that contain the same A cation, it is shown that phi decreases linearly as a function of increasing average ionic radius of the formula unit. Large deviations from this simple relationship may indicate departures from P6(3)/m symmetry or cation ordering. The inclusion of A(1)O(6) metaprisms in structure drawings is useful for comparing apatites and condensed-apatites such as Sr(5)(BO(3))(3)Br. The most common symmetry for the 74 chemically distinct [A(1)(2)][A(2)(3)](BO(4))(3)X apatites that were surveyed was P6(3)/m (57%), with progressively more complex chemistries adopting P6(3) (21%), P3; (9%), P6 (4.3%), P2(1)/m (4.3%) and P2(1) (4.3%). In chemically complex apatites, charge balance is usually maintained through charge-coupled cation substitutions, or through appropriate mixing of monovalent and divalent X anions or X-site vacancies. More rarely, charge compensation is achieved through insertion/removal of oxygen to produce BO(5) square pyramidal units (as in ReO(5)) or BO(3) triangular coordination (as in AsO(3)). Polysomatism arises through the ordered filling of [001] BO(4) tetrahedral strings to

  6. Mapping arm-DNA-binding domain interactions in AraC.

    Science.gov (United States)

    Wu, M; Schleif, R

    2001-04-06

    AraC protein, the regulator of the l-arabinose operon in Escherichia coli has been postulated to function by a light switch mechanism. According to this mechanism, it should be possible to find mutations in the DNA-binding domain of AraC that result in weaker arm-DNA-binding domain interactions and which make the protein constitutive, that is, it no longer requires arabinose to activate transcription. We isolated such mutations by randomizing three contiguous leucine residues in the DNA-binding domain, and then by systematically scanning surface residues of the DNA-binding domain with alanine and glutamic acid. As a result, a total of 20 constitutive mutations were found at ten different positions. They form a contiguous trail on the DNA-distal face of the DNA-binding domain, and likely define the region where the N-terminal arm that extends from the N-terminal dimerization domain contacts the C-terminal DNA-binding domain. Copyright 2001 Academic Press.

  7. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    Directory of Open Access Journals (Sweden)

    Long Qian

    2016-10-01

    Full Text Available The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  8. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Crystal structure of Clostridium difficile toxin A

    Energy Technology Data Exchange (ETDEWEB)

    Chumbler, Nicole M.; Rutherford, Stacey A.; Zhang, Zhifen; Farrow, Melissa A.; Lisher, John P.; Farquhar, Erik; Giedroc, David P.; Spiller, Benjamin W.; Melnyk, Roman A.; Lacy, D. Borden

    2016-01-11

    Clostridium difficile infection is the leading cause of hospital-acquired diarrhoea and pseudomembranous colitis. Disease is mediated by the actions of two toxins, TcdA and TcdB, which cause the diarrhoea, as well as inflammation and necrosis within the colon. The toxins are large (308 and 270 kDa, respectively), homologous (47% amino acid identity) glucosyltransferases that target small GTPases within the host. The multidomain toxins enter cells by receptor-mediated endocytosis and, upon exposure to the low pH of the endosome, insert into and deliver two enzymatic domains across the membrane. Eukaryotic inositol-hexakisphosphate (InsP6) binds an autoprocessing domain to activate a proteolysis event that releases the N-terminal glucosyltransferase domain into the cytosol. Here, we report the crystal structure of a 1,832-amino-acid fragment of TcdA (TcdA1832), which reveals a requirement for zinc in the mechanism of toxin autoprocessing and an extended delivery domain that serves as a scaffold for the hydrophobic α-helices involved in pH-dependent pore formation. A surface loop of the delivery domain whose sequence is strictly conserved among all large clostridial toxins is shown to be functionally important, and is highlighted for future efforts in the development of vaccines and novel therapeutics.

  10. The Crystal Structure of PF-8, the DNA Polymerase Accessory Subunit from Kaposi's Sarcoma-Associated Herpesvirus

    Energy Technology Data Exchange (ETDEWEB)

    Baltz, Jennifer L.; Filman, David J.; Ciustea, Mihai; Silverman, Janice Elaine Y.; Lautenschlager, Catherine L.; Coen, Donald M.; Ricciardi, Robert P.; Hogle, James M.; (UPENN)

    2009-12-01

    Kaposi's sarcoma-associated herpesvirus is an emerging pathogen whose mechanism of replication is poorly understood. PF-8, the presumed processivity factor of Kaposi's sarcoma-associated herpesvirus DNA polymerase, acts in combination with the catalytic subunit, Pol-8, to synthesize viral DNA. We have solved the crystal structure of residues 1 to 304 of PF-8 at a resolution of 2.8 {angstrom}. This structure reveals that each monomer of PF-8 shares a fold common to processivity factors. Like human cytomegalovirus UL44, PF-8 forms a head-to-head dimer in the form of a C clamp, with its concave face containing a number of basic residues that are predicted to be important for DNA binding. However, there are several differences with related proteins, especially in loops that extend from each monomer into the center of the C clamp and in the loops that connect the two subdomains of each protein, which may be important for determining PF-8's mode of binding to DNA and to Pol-8. Using the crystal structures of PF-8, the herpes simplex virus catalytic subunit, and RB69 bacteriophage DNA polymerase in complex with DNA and initial experiments testing the effects of inhibition of PF-8-stimulated DNA synthesis by peptides derived from Pol-8, we suggest a model for how PF-8 might form a ternary complex with Pol-8 and DNA. The structure and the model suggest interesting similarities and differences in how PF-8 functions relative to structurally similar proteins.

  11. The Crystal Structure of PF-8, the DNA Polymerase Accessory Subunit from Kaposi's Sarcoma-Associated Herpesvirus▿

    Science.gov (United States)

    Baltz, Jennifer L.; Filman, David J.; Ciustea, Mihai; Silverman, Janice Elaine Y.; Lautenschlager, Catherine L.; Coen, Donald M.; Ricciardi, Robert P.; Hogle, James M.

    2009-01-01

    Kaposi's sarcoma-associated herpesvirus is an emerging pathogen whose mechanism of replication is poorly understood. PF-8, the presumed processivity factor of Kaposi's sarcoma-associated herpesvirus DNA polymerase, acts in combination with the catalytic subunit, Pol-8, to synthesize viral DNA. We have solved the crystal structure of residues 1 to 304 of PF-8 at a resolution of 2.8 Å. This structure reveals that each monomer of PF-8 shares a fold common to processivity factors. Like human cytomegalovirus UL44, PF-8 forms a head-to-head dimer in the form of a C clamp, with its concave face containing a number of basic residues that are predicted to be important for DNA binding. However, there are several differences with related proteins, especially in loops that extend from each monomer into the center of the C clamp and in the loops that connect the two subdomains of each protein, which may be important for determining PF-8's mode of binding to DNA and to Pol-8. Using the crystal structures of PF-8, the herpes simplex virus catalytic subunit, and RB69 bacteriophage DNA polymerase in complex with DNA and initial experiments testing the effects of inhibition of PF-8-stimulated DNA synthesis by peptides derived from Pol-8, we suggest a model for how PF-8 might form a ternary complex with Pol-8 and DNA. The structure and the model suggest interesting similarities and differences in how PF-8 functions relative to structurally similar proteins. PMID:19759157

  12. Crystallization and Characterization of Galdieria sulphuraria RUBISCO in Two Crystal Forms: Structural Phase Transition Observed in P21 Crystal Form

    Directory of Open Access Journals (Sweden)

    Boguslaw Stec

    2007-10-01

    Full Text Available We have isolated ribulose-1,5-bisphosphate-carboxylase/oxygenase (RUBISCOfrom the red algae Galdieria Sulphuraria. The protein crystallized in two different crystalforms, the I422 crystal form being obtained from high salt and the P21 crystal form beingobtained from lower concentration of salt and PEG. We report here the crystallization,preliminary stages of structure determination and the detection of the structural phasetransition in the P21 crystal form of G. sulphuraria RUBISCO. This red algae enzymebelongs to the hexadecameric class (L8S8 with an approximate molecular weight 0.6MDa.The phase transition in G. sulphuraria RUBISCO leads from two hexadecamers to a singlehexadecamer per asymmetric unit. The preservation of diffraction power in a phasetransition for such a large macromolecule is rare.

  13. Ordering of crystal structure by ionizing radiation

    Science.gov (United States)

    Chernov, I. P.; Momontov, A. P.; Cherdantsev, P. A.; Chakhlov, B. V.

    1994-12-01

    We have studied the action of ionizing radiation on defect-containing semiconductor crystals, metals, and alloys. Using modern methods for investigation of solids, Rutherford back scattering of channeled charged particles, x-ray diffraction, electron microscopy, and also calorimetric methods, we have established: a) irradiation (by x-ray beams, gamma rays, and electrons) of metals and alloys with an equivalent radiation dose less than 105 J/kg and of semiconductor crystals with a dose less than 103 J/kg does not lead to additional accumulation of defects but conversely leads to elimination of defects and transition of the crystal to a more equilibrium state; b) ionization processes play a determining role in rearrangment of defects in crystals exhibiting both semiconductor and metallic conductivity. We show that rearrangment of the crystal occurs as a result of stored energy in the crystal which is liberated due to chain reactions of annihilation of defects, initiated by ionization. Transition of the crystal to the equilibrium state is accompanied by improvement of its physical properties.

  14. Rotations of the 2B Sub-domain of E. coli UvrD Helicase/Translocase Coupled to Nucleotide and DNA Binding

    Science.gov (United States)

    Jia, Haifeng; Korolev, Sergey; Niedziela-Majka, Anita; Maluf, Nasib K.; Gauss, George H.; Myong, Sua; Ha, Taekjip; Waksman, Gabriel; Lohman, Timothy M.

    2011-01-01

    E. coli UvrD is a superfamily 1 (SF1) DNA helicase and single stranded (ss) DNA translocase that functions in DNA repair, plasmid replication and as an anti-recombinase by removing RecA protein from ssDNA. UvrD couples ATP binding and hydrolysis to unwind double-stranded DNA (dsDNA) and translocate along ssDNA with 3′ to 5′ directionality. Although a UvrD monomer is able to translocate along ssDNA rapidly and processively, DNA helicase activity in vitro requires a minimum of a UvrD dimer. Previous crystal structures of UvrD bound to a ss-duplex DNA junction show that its 2B sub-domain exists in a “closed” state and interacts with the duplex DNA. Here we report a crystal structure of an apo form of UvrD in which the 2B sub-domain is in an “open” state that differs by a ~160° rotation of the 2B sub-domain. To study the rotational conformational states of the 2B sub-domain in various ligation states, a series of double cysteine UvrD mutants were constructed and labeled with fluorophores such that rotation of the 2B sub-domain results in changes in fluorescence resonance energy transfer (FRET). These studies show that the open and closed forms can interconvert in solution with low salt favoring the closed conformation and high salt favoring the open conformation in the absence of DNA. Binding of UvrD to DNA as well as ATP binding and hydrolysis also affect the rotational conformational state of the 2B sub-domain suggesting that 2B sub-domain rotation is coupled to the function of this nucleic acid motor enzyme. PMID:21704638

  15. The individual and common repertoire of DNA-binding transcriptional regulators of Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium diphtheriae and Corynebacterium jeikeium deduced from the complete genome sequences

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2005-06-01

    Full Text Available Abstract Background The genus Corynebacterium includes Gram-positive microorganisms of great biotechnologically importance, such as Corynebacterium glutamicum and Corynebacterium efficiens, as well as serious human pathogens, such as Corynebacterium diphtheriae and Corynebacterium jeikeium. Although genome sequences of the respective species have been determined recently, the knowledge about the repertoire of transcriptional regulators and the architecture of global regulatory networks is scarce. Here, we apply a combination of bioinformatic tools and a comparative genomic approach to identify and characterize a set of conserved DNA-binding transcriptional regulators in the four corynebacterial genomes. Results A collection of 127 DNA-binding transcriptional regulators was identified in the C. glutamicum ATCC 13032 genome, whereas 103 regulators were detected in C. efficiens YS-314, 63 in C. diphtheriae NCTC 13129 and 55 in C. jeikeium K411. According to amino acid sequence similarities and protein structure predictions, the DNA-binding transcriptional regulators were grouped into 25 regulatory protein families. The common set of DNA-binding transcriptional regulators present in the four corynebacterial genomes consists of 28 proteins that are apparently involved in the regulation of cell division and septation, SOS and stress response, carbohydrate metabolism and macroelement and metal homeostasis. Conclusion This work describes characteristic features of a set of conserved DNA-binding transcriptional regulators present within the corynebacterial core genome. The knowledge on the physiological function of these proteins should not only contribute to our understanding of the regulation of gene expression but will also provide the basis for comprehensive modeling of transcriptional regulatory networks of these species.

  16. Crystal structure and characterization of pyrroloquinoline quinone disodium trihydrate

    Directory of Open Access Journals (Sweden)

    Ikemoto Kazuto

    2012-06-01

    Full Text Available Abstract Background Pyrroloquinoline quinone (PQQ, a tricarboxylic acid, has attracted attention as a growth factor, and its application to supplements and cosmetics is underway. The product used for these purposes is a water-soluble salt of PQQ disodium. Although in the past, PQQ disodiumpentahydrates with a high water concentration were used, currently, low hydration crystals of PQQ disodiumpentahydrates are preferred. Results We prepared a crystal of PQQ disodium trihydrate in a solution of ethanol and water, studied its structure, and analyzed its properties. In the prepared crystal, the sodium atom interacted with the oxygen atom of two carboxylic acids as well as two quinones of the PQQ disodium trihydrate. In addition, the hydration water of the prepared crystal was less than that of the conventional PQQ disodium crystal. From the results of this study, it was found that the color and the near-infrared (NIR spectrum of the prepared crystal changed depending on the water content in the dried samples. Conclusions The water content in the dried samples was restored to that in the trihydrate crystal by placing the samples in a humid environment. In addition, the results of X-ray diffraction (XRD and X-ray diffraction-differential calorimetry (XRD-DSC analyses show that the phase of the trihydrate crystal changed when the crystallization water was eliminated. The dried crystal has two crystalline forms that are restored to the original trihydrate crystals in 20% relative humidity (RH. This crystalline (PQQ disodium trihydrate is stable under normal environment.

  17. Novel approach for selecting the best predictor for identifying the binding sites in DNA binding proteins.

    Science.gov (United States)

    Nagarajan, R; Ahmad, Shandar; Gromiha, M Michael

    2013-09-01

    Protein-DNA complexes play vital roles in many cellular processes by the interactions of amino acids with DNA. Several computational methods have been developed for predicting the interacting residues in DNA-binding proteins using sequence and/or structural information. These methods showed different levels of accuracies, which may depend on the choice of data sets used in training, the feature sets selected for developing a predictive model, the ability of the models to capture information useful for prediction or a combination of these factors. In many cases, different methods are likely to produce similar results, whereas in others, the predictors may return contradictory predictions. In this situation, a priori estimates of prediction performance applicable to the system being investigated would be helpful for biologists to choose the best method for designing their experiments. In this work, we have constructed unbiased, stringent and diverse data sets for DNA-binding proteins based on various biologically relevant considerations: (i) seven structural classes, (ii) 86 folds, (iii) 106 superfamilies, (iv) 194 families, (v) 15 binding motifs, (vi) single/double-stranded DNA, (vii) DNA conformation (A, B, Z, etc.), (viii) three functions and (ix) disordered regions. These data sets were culled as non-redundant with sequence identities of 25 and 40% and used to evaluate the performance of 11 different methods in which online services or standalone programs are available. We observed that the best performing methods for each of the data sets showed significant biases toward the data sets selected for their benchmark. Our analysis revealed important data set features, which could be used to estimate these context-specific biases and hence suggest the best method to be used for a given problem. We have developed a web server, which considers these features on demand and displays the best method that the investigator should use. The web server is freely available at

  18. Synthesis, Crystal Structure, Density Function Theory, Molecular ...

    African Journals Online (AJOL)

    isoindoline-1,3-dione, was characterized by proton nuclear magnetic resonance spectroscopy (NMR) and single crystal x-ray diffraction method. The target compound was tested for its antimicrobial activities and computational studies including density ...

  19. Structure and Properties of Liquid Crystals

    CERN Document Server

    Blinov, Lev M

    2011-01-01

    This book by Lev M. Blinov is ideal to guide researchers from their very first encounter with liquid crystals to the level where they can perform independent experiments on liquid crystals with a thorough understanding of their behaviour also in relation to the theoretical framework. Liquid crystals can be found everywhere around us. They are used in virtually every display device, whether it is for domestic appliances of for specialized technological instruments. Their finely tunable optical properties make them suitable also for thermo-sensing and laser technologies. There are many monographs written by prominent scholars on the subject of liquid crystals. The majority of them presents the subject in great depth, sometimes focusing on a particular research aspect, and in general they require a significant level of prior knowledge. In contrast, this books aims at an audience of advanced undergraduate and graduate students in physics, chemistry and materials science. The book consists of three parts: the firs...

  20. Studies on growth, crystal structure and characterization of novel organic nicotinium trifluoroacetate single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Dhanaraj, P.V. [Centre for Crystal Growth, SSN College of Engineering, Kalavakkam 603 110 (India); Rajesh, N.P., E-mail: rajeshnp@hotmail.com [Centre for Crystal Growth, SSN College of Engineering, Kalavakkam 603 110 (India); Sundar, J. Kalyana; Natarajan, S. [Department of Physics, Madurai Kamaraj University, Madurai 625 021 (India); Vinitha, G. [Department of Physics, Crescent Engineering College, Chennai 600 048 (India)

    2011-09-15

    Highlights: {yields} Good quality crystals of nicotinium trifluoroacetate in monoclinic system were grown for first time. {yields} Nicotinium trifluoroacetate crystal exhibits third order nonlinear optical properties. {yields} The optical spectrum of nicotinium trifluoroacetate crystal reveals the wide transmission in the entire range with cutoff wavelength at 286 nm. {yields} Nicotinium trifluoroacetate is a low dielectric constant material. - Abstract: An organic material, nicotinium trifluoroacetate (NTF) was synthesized and single crystals in monoclinic system were grown from aqueous solution for the first time. Its solubility and metastable zone width were estimated. The crystal structure of NTF was analyzed to reveal the molecular arrangements and the formation of hydrogen bonds in the crystal. High-resolution X-ray diffraction rocking curve measurements were performed to analyze the structural perfection of the grown crystals. Functional groups in NTF were identified by Fourier transform infrared spectral analysis. Thermal behaviour and stability of NTF were studied by thermogravimetric and differential thermal analysis and differential scanning calorimetry. Mechanical and dielectric properties of NTF crystals were analyzed. Optical studies reveal that NTF crystals are transparent in the wavelength range 286-1100 nm. The third order nonlinear optical parameters of NTF were derived by the Z-scan technique.

  1. Conformational changes in DNA-binding proteins: relationships with precomplex features and contributions to specificity and stability.

    Science.gov (United States)

    Andrabi, Munazah; Mizuguchi, Kenji; Ahmad, Shandar

    2014-05-01

    Both Proteins and DNA undergo conformational changes in order to form functional complexes and also to facilitate interactions with other molecules. These changes have direct implications for the stability and specificity of the complex, as well as the cooperativity of interactions between multiple entities. In this work, we have extensively analyzed conformational changes in DNA-binding proteins by superimposing DNA-bound and unbound pairs of protein structures in a curated database of 90 proteins. We manually examined each of these pairs, unified the authors' annotations, and summarized our observations by classifying conformational changes into six structural categories. We explored a relationship between conformational changes and functional classes, binding motifs, target specificity, biophysical features of unbound proteins, and stability of the complex. In addition, we have also investigated the degree to which the intrinsic flexibility can explain conformational changes in a subset of 52 proteins with high quality coordinate data. Our results indicate that conformational changes in DNA-binding proteins contribute significantly to both the stability of the complex and the specificity of targets recognized by them. We also conclude that most conformational changes occur in proteins interacting with specific DNA targets, even though unbound protein structures may have sufficient information to interact with DNA in a nonspecific manner. Copyright © 2013 Wiley Periodicals, Inc.

  2. PLANAR OPTICAL WAVEGUIDES WITH PHOTONIC CRYSTAL STRUCTURE

    DEFF Research Database (Denmark)

    2003-01-01

    Planar optical waveguide comprising a core region and a cladding region comprising a photonic crystal material, said photonic crystal material having a lattice of column elements, wherein at least a number of said column elements are elongated substantially in an axial direction for said core...... region. The invention also relates to optical devices comprising planar optical waveguides and methods of making waveguides and optical devices....

  3. The crystal structure of some rhenium and technetium dichalcogenides

    NARCIS (Netherlands)

    Lamfers, H.J; Meetsma, A.; Wiegers, G.A; deBoer, J.L.

    1996-01-01

    The crystal structures of ReSe2,ReS2, ReSSe and TcS2 are determined using single crystal X-ray diffraction. The compounds are triclinic with space group P (1) over bar. ReSe2, Res(2) and ReSSe have a distorted CdCl2-type structure; TcS2 has a distorted Cd(OH)(2)-type structure. In the case of Res,

  4. Structural distortion in thiourea-mixed ADP crystals

    Energy Technology Data Exchange (ETDEWEB)

    Jayarama, A. [Department of Physics, Mangalore University, Mangalagangotri 574199 (India)]. E-mail: jrmarasalike@yahoo.co.in; Dharmaprakash, S.M. [Department of Physics, Mangalore University, Mangalagangotri 574199 (India)

    2006-11-15

    Single crystals of ammonium dihydrogen phosphate (ADP) mixed with different mole concentrations of thiourea were grown using slow evaporation solution technique at 30deg. C. In order to study the effect of mixing thiourea on the structural characteristics of ADP, X-ray diffraction studies were carried out on the crystals using Shimadzu X-ray diffractometer with Cu K{alpha} radiation. X-ray study revealed that the structures of the thiourea-mixed ADP are slightly distorted compared to the pure ADP crystal structure. Inclusion of thiourea enhances the growth of (1-bar 00) plane of the ADP crystal. Thiourea-mixed ADP crystals were found to have maximum inclusion, as the thiourea concentration was 10mol%.

  5. Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes

    Science.gov (United States)

    Banerjee, Ankan; Herman, Elena; Serif, Manuel; Maestre-Reyna, Manuel; Hepp, Sebastian; Pokorny, Richard; Kroth, Peter G.; Essen, Lars-Oliver; Kottke, Tilman

    2016-01-01

    The modular architecture of aureochrome blue light receptors, found in several algal groups including diatoms, is unique by having the LOV-type photoreceptor domain fused to the C-terminus of its putative effector, an N-terminal DNA-binding bZIP module. The structural and functional understanding of aureochromes’ light-dependent signaling mechanism is limited, despite their promise as an optogenetic tool. We show that class I aureochromes 1a and 1c from the diatom Phaeodactylum tricornutum are regulated in a light-independent circadian rhythm. These aureochromes are capable to form functional homo- and heterodimers, which recognize the ACGT core sequence within the canonical ‘aureo box’, TGACGT, in a light-independent manner. The bZIP domain holds a more folded and less flexible but extended conformation in the duplex DNA-bound state. FT-IR spectroscopy in the absence and the presence of DNA shows light-dependent helix unfolding in the LOV domain, which leads to conformational changes in the bZIP region. The solution structure of DNA bound to aureochrome points to a tilted orientation that was further validated by molecular dynamics simulations. We propose that aureochrome signaling relies on an allosteric pathway from LOV to bZIP that results in conformational changes near the bZIP-DNA interface without major effects on the binding affinity. PMID:27179025

  6. Photonic Crystal Structures with Tunable Structure Color as Colorimetric Sensors

    Directory of Open Access Journals (Sweden)

    Ke-Qin Zhang

    2013-03-01

    Full Text Available Colorimetric sensing, which transduces environmental changes into visible color changes, provides a simple yet powerful detection mechanism that is well-suited to the development of low-cost and low-power sensors. A new approach in colorimetric sensing exploits the structural color of photonic crystals (PCs to create environmentally-influenced color-changeable materials. PCs are composed of periodic dielectrics or metallo-dielectric nanostructures that affect the propagation of electromagnetic waves (EM by defining the allowed and forbidden photonic bands. Simultaneously, an amazing variety of naturally occurring biological systems exhibit iridescent color due to the presence of PC structures throughout multi-dimensional space. In particular, some kinds of the structural colors in living organisms can be reversibly changed in reaction to external stimuli. Based on the lessons learned from natural photonic structures, some specific examples of PCs-based colorimetric sensors are presented in detail to demonstrate their unprecedented potential in practical applications, such as the detections of temperature, pH, ionic species, solvents, vapor, humidity, pressure and biomolecules. The combination of the nanofabrication technique, useful design methodologies inspired by biological systems and colorimetric sensing will lead to substantial developments in low-cost, miniaturized and widely deployable optical sensors.

  7. Structure of Zeste-DNA Complex Reveals a New Modality of DNA Recognition by Homeodomain-Like Proteins.

    Science.gov (United States)

    Gao, Guan-Nan; Wang, Mingzhu; Yang, Na; Huang, Ying; Xu, Rui-Ming

    2015-12-04

    Drosophila Zeste is a DNA binding protein important for chromatin-targeted regulation of gene expression. It is best studied in the context of transvection-a mechanism of interallelic gene regulation involving paired chromosomes-and repression of the expression of white by Zeste mutants. Both of these functions depend on the DNA binding and self-association properties of Zeste, but the underlying structural basis remains unknown. Here we report the crystal structure of the DNA binding domain of Zeste in complex with a 19-bp DNA duplex containing the consensus recognition sequence motif. The structure reveals a helix-turn-helix Myb/homeodomain-like fold with the Zeste-specific insertion sequence forming a short helix and a long loop. Direct base contacts by the major groove binding helix principally account for the sequence-specific recognition, and backbone contacts via the Zeste-specific insertion are mainly responsible for the length requirement and the orientation of DNA. Our structural and biochemical characterizations of the DNA binding property of Zeste uncover an altered DNA binding modality of homeodomain-like proteins, and the structural information should facilitate the unraveling of the intricate mechanism of Zeste in regulation of gene expression. Copyright © 2015. Published by Elsevier Ltd.

  8. [Validation of the crystal structure of medicinal realgar in China].

    Science.gov (United States)

    Zhang, Zhi-Jie; Zhou, Qun; Wei, Jing-Zhi; Zhang, Yan-Ling; Sun, Su-Qin; Huang, Lu-Qi; Yuan, Si-Tong

    2011-02-01

    The crystal structure of medicated realgar in China was validated as alpha-As4 S4 by X-ray diffraction and Raman spectroscopy in the present paper. Ten batches of medicinal realgar were analyzed including realgar ore, medicinal realgar powder, and prepared Chinese medicine. Identification of two As4 S4 polymorphs confirmed that the crystal structure of medicated realgar in China is alpha-As4 S4. Studies on 18 batches of preparative realgar powder showed that processing of realgar can not change the crystal structure of realgar.

  9. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    Science.gov (United States)

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. X-Ray structural investigation of VAS-393 crystals

    CERN Document Server

    Martirosian, A H; Harurtjunian, V S

    2001-01-01

    X-ray structural study of VAS-393 crystals was performed. Investigations were carried out with the use of the Weissenberg rotating and powder (employing the Bjornstrem diagrams) methods. The lattice constants ''c'' and ''a''are calculated. The crystal is shown to belong to the trigonal syngony (medium category)

  11. Synthesis, characterization and crystal structure of new nickel ...

    Indian Academy of Sciences (India)

    Abstract. A novel nickel molybdenum complex with the 2,6-pyridine dicarboxylic acid ligand was successfully synthesized and characterized by thermogravimetric analysis and single crystal X-ray crystallography. The single-crystal X-ray data revealed that the structure is a hydrated 1-D polymer with two different Ni sites.

  12. Zinc-regulated DNA binding of the yeast Zap1 zinc-responsive activator.

    Directory of Open Access Journals (Sweden)

    Avery G Frey

    Full Text Available The Zap1 transcription factor of Saccharomyces cerevisiae plays a central role in zinc homeostasis by controlling the expression of genes involved in zinc metabolism. Zap1 is active in zinc-limited cells and repressed in replete cells. At the transcriptional level, Zap1 controls its own expression via positive autoregulation. In addition, Zap1's two activation domains are regulated independently of each other by zinc binding directly to those regions and repressing activation function. In this report, we show that Zap1 DNA binding is also inhibited by zinc. DMS footprinting showed that Zap1 target gene promoter occupancy is regulated with or without transcriptional autoregulation. These results were confirmed using chromatin immunoprecipitation. Zinc regulation of DNA binding activity mapped to the DNA binding domain indicating other parts of Zap1 are unnecessary for this control. Overexpression of Zap1 overrode DNA binding regulation and resulted in constitutive promoter occupancy. Under these conditions of constitutive binding, both the zinc dose response of Zap1 activity and cellular zinc accumulation were altered suggesting the importance of DNA binding control to zinc homeostasis. Thus, our results indicated that zinc regulates Zap1 activity post-translationally via three independent mechanisms, all of which contribute to the overall zinc responsiveness of Zap1.

  13. Zinc-Regulated DNA Binding of the Yeast Zap1 Zinc-Responsive Activator

    Science.gov (United States)

    Frey, Avery G.; Bird, Amanda J.; Evans-Galea, Marguerite V.; Blankman, Elizabeth; Winge, Dennis R.; Eide, David J.

    2011-01-01

    The Zap1 transcription factor of Saccharomyces cerevisiae plays a central role in zinc homeostasis by controlling the expression of genes involved in zinc metabolism. Zap1 is active in zinc-limited cells and repressed in replete cells. At the transcriptional level, Zap1 controls its own expression via positive autoregulation. In addition, Zap1's two activation domains are regulated independently of each other by zinc binding directly to those regions and repressing activation function. In this report, we show that Zap1 DNA binding is also inhibited by zinc. DMS footprinting showed that Zap1 target gene promoter occupancy is regulated with or without transcriptional autoregulation. These results were confirmed using chromatin immunoprecipitation. Zinc regulation of DNA binding activity mapped to the DNA binding domain indicating other parts of Zap1 are unnecessary for this control. Overexpression of Zap1 overrode DNA binding regulation and resulted in constitutive promoter occupancy. Under these conditions of constitutive binding, both the zinc dose response of Zap1 activity and cellular zinc accumulation were altered suggesting the importance of DNA binding control to zinc homeostasis. Thus, our results indicated that zinc regulates Zap1 activity post-translationally via three independent mechanisms, all of which contribute to the overall zinc responsiveness of Zap1. PMID:21799889

  14. Crystal Structure of Triosephosphate Isomerase from Trypanosoma cruzi in Hexane

    National Research Council Canada - National Science Library

    Xiu-Gong Gao; Ernesto Maldonado; Ruy Perez-Montfort; Georgina Garza-Ramos; Marietta Tuena de Gomez-Puyou; Armando Gomez-Puyou; Adela Rodriguez-Romero

    1999-01-01

    ... the starting point for drug design. Here, a crystal of the dimeric enzyme triosephosphate isomerase from the pathogenic parasite Trypanosoma cruzi was soaked and diffracted in hexane and its structure solved at 2- angstrom resolution...

  15. Allophycocyanin and phycocyanin crystal structures reveal facets of phycobilisome assembly

    National Research Council Canada - National Science Library

    Marx, Ailie; Adir, Noam

    2013-01-01

    ... of complexity and detail. The linker-independent assembly of trimers into hexamers in crystal lattices of previously determined structures has been observed in almost all of the phycocyanin (PC...

  16. Improving nanocavity switching using Fano resonances in photonic crystal structures

    DEFF Research Database (Denmark)

    Heuck, Mikkel; Kristensen, Philip Trøst; Elesin, Yuriy

    2013-01-01

    We present a simple design for achieving Fano resonances in photonic crystal coupled waveguide-cavity structures. A coupled mode theory analysis shows an order of magnitude reduction in switching energy compared to conventional Lorentz resonances....

  17. Construction of crystal structure prototype database: methods and applications.

    Science.gov (United States)

    Su, Chuanxun; Lv, Jian; Li, Quan; Wang, Hui; Zhang, Lijun; Wang, Yanchao; Ma, Yanming

    2017-04-26

    Crystal structure prototype data have become a useful source of information for materials discovery in the fields of crystallography, chemistry, physics, and materials science. This work reports the development of a robust and efficient method for assessing the similarity of structures on the basis of their interatomic distances. Using this method, we proposed a simple and unambiguous definition of crystal structure prototype based on hierarchical clustering theory, and constructed the crystal structure prototype database (CSPD) by filtering the known crystallographic structures in a database. With similar method, a program structure prototype analysis package (SPAP) was developed to remove similar structures in CALYPSO prediction results and extract predicted low energy structures for a separate theoretical structure database. A series of statistics describing the distribution of crystal structure prototypes in the CSPD was compiled to provide an important insight for structure prediction and high-throughput calculations. Illustrative examples of the application of the proposed database are given, including the generation of initial structures for structure prediction and determination of the prototype structure in databases. These examples demonstrate the CSPD to be a generally applicable and useful tool for materials discovery.

  18. Construction of crystal structure prototype database: methods and applications

    Science.gov (United States)

    Su, Chuanxun; Lv, Jian; Li, Quan; Wang, Hui; Zhang, Lijun; Wang, Yanchao; Ma, Yanming

    2017-04-01

    Crystal structure prototype data have become a useful source of information for materials discovery in the fields of crystallography, chemistry, physics, and materials science. This work reports the development of a robust and efficient method for assessing the similarity of structures on the basis of their interatomic distances. Using this method, we proposed a simple and unambiguous definition of crystal structure prototype based on hierarchical clustering theory, and constructed the crystal structure prototype database (CSPD) by filtering the known crystallographic structures in a database. With similar method, a program structure prototype analysis package (SPAP) was developed to remove similar structures in CALYPSO prediction results and extract predicted low energy structures for a separate theoretical structure database. A series of statistics describing the distribution of crystal structure prototypes in the CSPD was compiled to provide an important insight for structure prediction and high-throughput calculations. Illustrative examples of the application of the proposed database are given, including the generation of initial structures for structure prediction and determination of the prototype structure in databases. These examples demonstrate the CSPD to be a generally applicable and useful tool for materials discovery.

  19. DNA binding of sunitinib: Spectroscopic evidence via circular dichroism and nuclear magnetic resonance.

    Science.gov (United States)

    Kiss, Eszter; Mirzahosseini, Arash; Hubert, Ágnes; Ambrus, Attila; Őrfi, László; Horváth, Péter

    2018-02-20

    Sunitinib is a non-selective tyrosine kinase inhibitor, but in its chemical structure there can be discovered certain features, which suggest the ability to bind to DNA. These elements are the planar aromatic system and the tertiary amine function, which is protonated at the pH of the organism. In this study, the binding of the drug sunitinib to DNA was investigated using circular dichroism (CD), 1 H NMR and UV spectroscopies, along with CD melting. For these studies DNA was isolated from calf thymus (CT), salmon fish sperm (SS), and chicken erythrocyte (CE), however for our purposes an artificially constructed and highly purified plasmid DNA (pUC18) preparation proved to be the most suitable. DNA binding of the drug was confirmed by shifts in the characteristic CD bands of the DNA, the appearance of an induced CD (ICD) signal in the upper absorption region of sunitinib (300 nm-500 nm), and the evidence from CD melting studies and the NMR. Based on the CD and NMR measurements, it can be assumed that sunitinib has a multiple-step binding mechanism. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. New silver(I) complex with diazafluorene based ligand: Synthesis, characterization, investigation of in vitro DNA binding and antimicrobial studies

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2017-07-01

    A novel diazafluorene based complex with silver, [Ag(dian)2 ] NO3 , where dian is N-(4,5-diazafluoren-9-ylidene)aniline, has been prepared and characterized by elemental analysis, IR spectroscopy, 1HNMR, UV-Vis spectroscopy and cyclic voltammetry. In order to explore the relationship between the structure and biological properties, DNA binding propensity and in vitro antibacterial property have also been studied. The mode of DNA-complex interaction has been investigated by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation, circular dichroism spectroscopy and cyclic voltammetry. The results reveal that the complex binds to CT-DNA in a moderate intercalation capability with the partial insertion of a planar dian ligand between the base stacks of double-stranded DNA with binding constant (Kb) of 2.4 × 105 M-1. The viscosities and CD spectra of the DNA provide strong evidence for the intercalation. An in vitro antibacterial efficacy of the Ag(I) complex on a series of Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) indicates that the complex exhibits a marked antibacterial activity. The minimum inhibitory concentrations of the complex indicate that it exhibits much higher antibacterial effect on standard bacterial strains of Escherichia coli and Staphylococcus aureus than those of silver nitrate, silver sulfadiazine. The bacterial inhibitions of the silver(I) complex are closely agreed to its DNA binding affinities.

  1. Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF.

    Science.gov (United States)

    Lee, Sin Yi; Lim, Ci Ji; Dröge, Peter; Yan, Jie

    2015-12-14

    The bacterial nucleoid, a bacterial genome packed by nucleoid binding proteins, forms the physical basis for cellular processes such as gene transcription and DNA replication. Bacteria need to dynamically modulate their nucleoid structures at different growth phases and in response to environmental changes. At the nutrients deficient stationary phase, DNA-binding proteins from starved cells (Dps) and Integration host factors (IHF) are the two most abundant nucleoid associated proteins in E. coli. Yet, it remains unclear how the nucleoid architecture is controlled by the interplay between these two proteins, as well as the nucleoid's response to environmental changes. This question is addressed here using single DNA manipulation approach. Our results reveal that the two proteins are differentially selected for DNA binding, which can be tuned by changing environmental factors over physiological ranges including KCl (50-300 mM), MgCl2 (0-10 mM), pH (6.5-8.5) and temperature (23-37 °C). Increasing pH and MgCl2 concentrations switch from Dps-binding to IHF-binding. Stable Dps-DNA and IHF-DNA complexes are insensitive to temperature changes for the range tested. The environment dependent selection between IHF and Dps results in different physical organizations of DNA. Overall, our findings provide important insights into E. coli nucleoid architecture.

  2. Crystal structure of the inactive state of the receiver domain of Spo0A from Paenisporosarcina sp. TG-14, a psychrophilic bacterium isolated from an Antarctic glacier.

    Science.gov (United States)

    Lee, Chang Woo; Park, Sun-Ha; Lee, Sung Gu; Shin, Seung Chul; Han, Se Jong; Kim, Han-Woo; Park, Hyun Ho; Kim, Sunghwan; Kim, Hak Jun; Park, Hyun; Park, HaJeung; Lee, Jun Hyuck

    2017-06-01

    The two-component phosphorelay system is the most prevalent mechanism for sensing and transducing environmental signals in bacteria. Spore formation, which relies on the two-component phosphorelay system, enables the long-term survival of the glacial bacterium Paenisporosarcina sp. TG-14 in the extreme cold environment. Spo0A is a key response regulator of the phosphorelay system in the early stage of spore formation. The protein is composed of a regulatory N-terminal phospho-receiver domain and a DNA-binding C-terminal activator domain. We solved the three-dimensional structure of the unphosphorylated (inactive) form of the receiver domain of Spo0A (PaSpo0A-R) from Paenisporosarcina sp. TG-14. A structural comparison with phosphorylated (active form) Spo0A from Bacillus stearothermophilus (BsSpo0A) showed minor notable differences. A molecular dynamics study of a model of the active form and the crystal structures revealed significant differences in the α4 helix and the preceding loop region where phosphorylation occurs. Although an oligomerization study of PaSpo0A-R by analytical ultracentrifugation (AUC) has shown that the protein is in a monomeric state in solution, both crosslinking and crystal-packing analyses indicate the possibility of weak dimer formation by a previously undocumented mechanism. Collectively, these observations provide insight into the mechanism of phosphorylation-dependent activation unique to Spo0A.

  3. Membrane protein structures without crystals, by single particle electron cryomicroscopy.

    Science.gov (United States)

    Vinothkumar, Kutti R

    2015-08-01

    It is an exciting period in membrane protein structural biology with a number of medically important protein structures determined at a rapid pace. However, two major hurdles still remain in the structural biology of membrane proteins. One is the inability to obtain large amounts of protein for crystallization and the other is the failure to get well-diffracting crystals. With single particle electron cryomicroscopy, both these problems can be overcome and high-resolution structures of membrane proteins and other labile protein complexes can be obtained with very little protein and without the need for crystals. In this review, I highlight recent advances in electron microscopy, detectors and software, which have allowed determination of medium to high-resolution structures of membrane proteins and complexes that have been difficult to study by other structural biological techniques. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Quantitative crystal structure descriptors from multiplicative congruential generators.

    Science.gov (United States)

    Hornfeck, Wolfgang

    2012-03-01

    Special types of number-theoretic relations, termed multiplicative congruential generators (MCGs), exhibit an intrinsic sublattice structure. This has considerable implications within the crystallographic realm, namely for the coordinate description of crystal structures for which MCGs allow for a concise way of encoding the numerical structural information. Thus, a conceptual framework is established, with some focus on layered superstructures, which proposes the use of MCGs as a tool for the quantitative description of crystal structures. The multiplicative congruential method eventually affords an algorithmic generation of three-dimensional crystal structures with a near-uniform distribution of atoms, whereas a linearization procedure facilitates their combinatorial enumeration and classification. The outlook for homometric structures and dual-space crystallography is given. Some generalizations and extensions are formulated in addition, revealing the connections of MCGs with geometric algebra, discrete dynamical systems (iterative maps), as well as certain quasicrystal approximants.

  5. Lack of Ligand-Selective Binding of the Aryl Hydrocarbon Receptor to Putative DNA Binding Sites Regulating Expression of Bax and Paraoxonase 1 Genes

    OpenAIRE

    DeGroot, Danica E.; Hayashi, Ai; Michael S Denison

    2013-01-01

    The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that mediates the biological and toxicological effects of structurally diverse chemicals through its ability to bind specific DNA recognition sites (dioxin responsive elements (DREs)), and activate transcription of adjacent genes. While the DRE has a highly conserved consensus sequence, it has been suggested that the nucleotide specificity of AhR DNA binding may be ligand-dependent. The upstream regulatory regions ...

  6. Effect of domains configuration on crystal structure in ferroelectric ...

    Indian Academy of Sciences (India)

    2017-09-09

    Sep 9, 2017 ... structure in ferroelectric ceramics. Keywords. Electronic ceramics; ferroelectricity; piezoelectricity. 1. Introduction. It is well known that ferroelectric domains and crystal structure control the physical properties of ferroelectrics. [1–5]. Therefore, intensive studies have focused on domain structures and the ...

  7. Protein dynamics derived from clusters of crystal structures

    NARCIS (Netherlands)

    van Aalten, D.M.F.; Conn, D.A.; de Groot, B.L.; Berendsen, H.J.C.; Findlay, J.B.C.; Amadei, A

    1997-01-01

    A method is presented to mathematically extract concerted structural transitions in proteins from collections of crystal structures. The ''essential dynamics'' procedure is used to filter out small-amplitude fluctuations from such a set of structures; the remaining large conformational changes

  8. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  9. Three supramolecular compounds of 1,4-benzeneditetrazole (H2BDT): Syntheses, crystal structures, and crystal to crystal transformation

    Science.gov (United States)

    Deng, Ji-Hua; Wen, Ya-Qiong; Luo, Jie; Huang, Zhi-Qiang; Zhong, Di-Chang

    2017-08-01

    Three supramolecular compounds based on 1,4-benzeneditetrazole (H2BDT), (NH4)2(BDT) (1), [Mg(H2O)6](HBDT)2·2H2O (2), and [Mg(CH3OH)4(H2O)2](HBDT)2·2CH3OH (3) have been solvothermally synthesized and structurally characterized by single-crystal/powder X-ray diffraction. Structural analyses indicated that these compounds are 3D supramolecular structures stabilized by electrostatic interactions and intermolecular hydrogen bonds. The crystal to crystal transformation between 2 and 3 were investigated. The result showed that 2 is readily transform to 3 after immersed in methanol solution, while 3 can not be converted to 2 after immersed in distilled water solution.

  10. Improved Synthesis and Crystal Structure of Dalcetrapib

    Directory of Open Access Journals (Sweden)

    Frank Richter

    2012-10-01

    Full Text Available An improved synthesis of the Cholesteryl Ester Transfer Protein inhibitor dalcetrapib is reported. The precursor disulfide was reduced (a by Mg/MeOH or (b by EtSH/DBU/THF. The resulting thiol was acylated (a by a known procedure or (b in a one-pot process. Impurities were removed (a by dithiothreitol (DTT or (b by oxidation using H2O2. Dalcetrapib crystallized in space group P21/c.

  11. Crystal structures of the transcriptional repressor RolR reveals a novel recognition mechanism between inducer and regulator.

    Directory of Open Access Journals (Sweden)

    De-Feng Li

    Full Text Available Many members of the TetR family control the transcription of genes involved in multidrug resistance and pathogenicity. RolR (ResorcinolRegulator, the recently reported TetR-type regulator for aromatic catabolism from Corynebacterium glutamicum, distinguishes itself by low sequence similarities and different regulation from the previously known members of the TetR family. Here we report the crystal structures of RolR in its effector-bound (with resorcinol and aop- forms at 2.5 Å and 3.6 Å, respectively. The structure of resorcinol-RolR complex reveal that the hydrogen-bonded network mediated by the four-residue motif (Asp94- Arg145- Arg148- Asp149 with two water molecules and the hydrophobic interaction via five residues (Phe107, Leu111, Leu114, Leu142, and Phe172 are the key factors for the recognition and binding between the resorcinol and RolR molecules. The center-to-center separation of the recognition helices h3-h3' is decreased upon effector-binding from 34.9 Å to 30.4 Å. This structural change results in that RolR was unsuitable for DNA binding. Those observations are distinct from that in other TetR members. Structure-based mutagenesis on RolR was carried out and the results confirmed the critical roles of the above mentioned residues for effector-binding specificity and affinity. Similar sequence searches and sequence alignments identified 29 RolR homologues from GenBank, and all the above mentioned residues are highly conserved in the homologues. Based on these structural and other functional investigations, it is proposed that RolR may represent a new subfamily of TetR proteins that are invovled in aromatic degradation and sharing common recognition mode as for RolR.

  12. Binding mode and affinity studies of DNA-binding agents using topoisomerase I DNA unwinding assay.

    Science.gov (United States)

    McKnight, Ruel E; Gleason, Aaron B; Keyes, James A; Sahabi, Sadia

    2007-02-15

    A topoisomerase I DNA unwinding assay has been used to determine the relative DNA-binding affinities of a model pair of homologous naphthalene diimides. Binding affinity data were corroborated using calorimetric (ITC) and spectrophotometric (titration and T(m)) studies, with substituent size playing a significant role in binding. The assay was also used to investigate the mode of binding adopted by several known DNA-binding agents, including SYBR Green and PicoGreen. Some of the compounds exhibited unexpected binding modes.

  13. Effects of Temperature on the p53-DNA Binding Interactions and Their Dynamical Behavior: Comparing the Wild Type to the R248Q Mutant

    Science.gov (United States)

    Barakat, Khaled; Issack, Bilkiss B.; Stepanova, Maria; Tuszynski, Jack

    2011-01-01

    Background The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298–306 K). Methodology/Principal Findings This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. Conclusions The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure. PMID:22110706

  14. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  15. Sequence based prediction of DNA-binding proteins based on hybrid feature selection using random forest and Gaussian naïve Bayes.

    Directory of Open Access Journals (Sweden)

    Wangchao Lou

    Full Text Available Developing an efficient method for determination of the DNA-binding proteins, due to their vital roles in gene regulation, is becoming highly desired since it would be invaluable to advance our understanding of protein functions. In this study, we proposed a new method for the prediction of the DNA-binding proteins, by performing the feature rank using random forest and the wrapper-based feature selection using forward best-first search strategy. The features comprise information from primary sequence, predicted secondary structure, predicted relative solvent accessibility, and position specific scoring matrix. The proposed method, called DBPPred, used Gaussian naïve Bayes as the underlying classifier since it outperformed five other classifiers, including decision tree, logistic regression, k-nearest neighbor, support vector machine with polynomial kernel, and support vector machine with radial basis function. As a result, the proposed DBPPred yields the highest average accuracy of 0.791 and average MCC of 0.583 according to the five-fold cross validation with ten runs on the training benchmark dataset PDB594. Subsequently, blind tests on the independent dataset PDB186 by the proposed model trained on the entire PDB594 dataset and by other five existing methods (including iDNA-Prot, DNA-Prot, DNAbinder, DNABIND and DBD-Threader were performed, resulting in that the proposed DBPPred yielded the highest accuracy of 0.769, MCC of 0.538, and AUC of 0.790. The independent tests performed by the proposed DBPPred on completely a large non-DNA binding protein dataset and two RNA binding protein datasets also showed improved or comparable quality when compared with the relevant prediction methods. Moreover, we observed that majority of the selected features by the proposed method are statistically significantly different between the mean feature values of the DNA-binding and the non DNA-binding proteins. All of the experimental results indicate that

  16. Predicting and analyzing DNA-binding domains using a systematic approach to identifying a set of informative physicochemical and biochemical properties

    Science.gov (United States)

    2011-01-01

    Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der

  17. Datamining protein structure databanks for crystallization patterns of proteins.

    Science.gov (United States)

    Valafar, Homayoun; Prestegard, James H; Valafar, Faramarz

    2002-12-01

    A study of 345 protein structures selected among 1,500 structures determined by nuclear magnetic resonance (NMR) methods, revealed useful correlations between crystallization properties and several parameters for the studied proteins. NMR methods of structure determination do not require the growth of protein crystals, and hence allow comparison of properties of proteins that have or have not been the subject of crystallographic approaches. One- and two-dimensional statistical analyses of the data confirmed a hypothesized relation between the size of the molecule and its crystallization potential. Furthermore, two-dimensional Bayesian analysis revealed a significant relationship between relative ratio of different secondary structures and the likelihood of success for crystallization trials. The most immediate result is an apparent correlation of crystallization potential with protein size. Further analysis of the data revealed a relationship between the unstructured fraction of proteins and the success of its crystallization. Utilization of Bayesian analysis on the latter correlation resulted in a prediction performance of about 64%, whereas a two-dimensional Bayesian analysis succeeded with a performance of about 75%.

  18. Synthesis, in vitro antitumor evaluation and DNA-binding study of novel tetrahydroquinolines and some derived tricyclic and tetracyclic ring systems.

    Science.gov (United States)

    Faidallah, Hassan M; Rostom, Sherif A F

    2013-05-01

    The synthesis of some new tetrahydroquinolines, tetrahydropyrimido[4,5-b]quinolines, and tetrahydropentaazacyclopenta[a]anthracenes structurally related to some DNA intercalators is described. Fifteen compounds were evaluated for their antitumor activity by the National Cancer Institute (NCI), in vitro disease oriented antitumor screening. The most active tricyclic pyrimido[4,5-b]quinolines 3b, 6b, 7b and 8b were further subjected to DNA-binding investigation in an attempt to rationalize their activity. Compound 8b proved to be the most active member in this study as evidenced from its remarkable growth inhibitory potential against some individual cell lines, and its broad spectrum of antitumor activity (GI50, TGI and LC50 values 46.9, 85.3 and 97.4, respectively), together with a good DNA-binding affinity. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. Assessment of microarchitecture and crystal structure of hydroxyapatite in osteoporosis

    Directory of Open Access Journals (Sweden)

    Zairin Noor

    2016-02-01

    Full Text Available Osteoporosis is characterized by lower bone mineral density (BMD and microarchitectural degeneration, which tends to increase bone fragility and fracture risk. Bone microstructure depends on interactions between the mineral atoms, which may perform substitution or incorporation into bone crystals, and may dynamically take over the function of calcium or may become a complementary part. The mineral atoms may also become a composite in the hydroxyapatite crystals. The aim of this study was to find an association between the bone microstructure and hydoxyapatite crystal structure in osteoporosis, in comparison to normal bone. The subjects of this study were surgery patients at the Department of Orthopedics of Ulin General Hospital in Banjarmasin and other centers. Inclusion criteria consisted of the presence of fracture of trabecular bone, normal or osteoporotic BMD values, and no past history of chronic disease. Bone was obtained from fracture patients during surgery. The characteristics of the hydroxyapatite crystals were analyzed by X-ray diffraction (XRD and the microarchitecture by scanning electron microscopy (SEM. SEM showed degeneration of the microarchitecture of osteoporotic bone, in comparison with normal bone. On XRD there was a peak of hydoxyapatite crystals only and no other crystal phases. Diffraction patterns showed a larger crystal size in osteoporotic bone as compared to normal bone, indicating higher porosity. It may be concluded that there is a difference in crystal size and morphologic distribution of hydoxyapatite in osteoporotic bone, determining bone microarchitecture.

  20. Assessment of microarchitecture and crystal structure of hydroxyapatite in osteoporosis

    Directory of Open Access Journals (Sweden)

    Zairin Noor

    2011-04-01

    Full Text Available Osteoporosis is characterized by lower bone mineral density (BMD and microarchitectural degeneration, which tends to increase bone fragility and fracture risk. Bone microstructure depends on interactions between the mineral atoms, which may perform substitution or incorporation into bone crystals, and may dynamically take over the function of calcium or may become a complementary part. The mineral atoms may also become a composite in the hydroxyapatite crystals. The aim of this study was to find an association between the bone microstructure and hydoxyapatite crystal structure in osteoporosis, in comparison to normal bone. The subjects of this study were surgery patients at the Department of Orthopedics of Ulin General Hospital in Banjarmasin and other centers. Inclusion criteria consisted of the presence of fracture of trabecular bone, normal or osteoporotic BMD values, and no past history of chronic disease. Bone was obtained from fracture patients during surgery. The characteristics of the hydroxyapatite crystals were analyzed by X-ray diffraction (XRD and the microarchitecture by scanning electron microscopy (SEM. SEM showed degeneration of the microarchitecture of osteoporotic bone, in comparison with normal bone. On XRD there was a peak of hydoxyapatite crystals only and no other crystal phases. Diffraction patterns showed a larger crystal size in osteoporotic bone as compared to normal bone, indicating higher porosity. It may be concluded that there is a difference in crystal size and morphologic distribution of hydoxyapatite in osteoporotic bone, determining bone microarchitecture.

  1. Semi-automated high-throughput fluorescent intercalator displacement-based discovery of cytotoxic DNA binding agents from a large compound library.

    Science.gov (United States)

    Glass, Lateca S; Bapat, Aditi; Kelley, Mark R; Georgiadis, Millie M; Long, Eric C

    2010-03-01

    High-throughput fluorescent intercalator displacement (HT-FID) was adapted to the semi-automated screening of a commercial compound library containing 60,000 molecules resulting in the discovery of cytotoxic DNA-targeted agents. Although commercial libraries are routinely screened in drug discovery efforts, the DNA binding potential of the compounds they contain has largely been overlooked. HT-FID led to the rapid identification of a number of compounds for which DNA binding properties were validated through demonstration of concentration-dependent DNA binding and increased thermal melting of A/T- or G/C-rich DNA sequences. Selected compounds were assayed further for cell proliferation inhibition in glioblastoma cells. Seven distinct compounds emerged from this screening procedure that represent structures unknown previously to be capable of targeting DNA leading to cell death. These agents may represent structures worthy of further modification to optimally explore their potential as cytotoxic anti-cancer agents. In addition, the general screening strategy described may find broader impact toward the rapid discovery of DNA targeted agents with biological activity. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. short communication synthesis and crystal structure of a polymeric ...

    African Journals Online (AJOL)

    Preferred Customer

    of zinc sulfate, 4-nitrophenylacetic acid, and propane-1,3-diamine (PDA) in water. Structure of the complex has been characterized by single-crystal X-ray diffraction. The complex crystallizes as orthorhombic space group Pnma, with unit cell dimensions a = 15.732(1) Å, b = 23.912(1) Å, c = 5.5565(3) Å, V = 2090.2(2) Å3, ...

  3. The crystal and molecular structure of ammonium titanyl oxalate

    NARCIS (Netherlands)

    van de Velde, G.M.H.; Harkema, Sybolt; Gellings, P.J.

    1974-01-01

    Ammonium titanyl oxalate monohydrate, (NH4)2 TiO(C2O4)2·H2O, is monoclinic with cell parameters A = 13.473(2), B = 11.329(1), C = 17.646(2) Å, β = 126.66(1)°. The space group is P21/c with Z = 8, dc = 1.808 g cm−3 and dm = 1.80 g cm−3. The crystal structure was determined from single-crystal

  4. Designing, structural elucidation, comparison of DNA binding, cleavage, radical scavenging activity and anticancer activity of copper(I) complex with 5-dimethyl-2-phenyl-4-[(pyridin-2-ylmethylene)-amino]-1,2-dihydro-pyrazol-3-one Schiff base ligand.

    Science.gov (United States)

    Sathiyaraj, Subbaiyan; Sampath, Krishnan; Butcher, Ray J; Pallepogu, Raghavaiah; Jayabalakrishnan, Chinnasamy

    2013-06-01

    A novel copper(I) Schiff base complex has been synthesized and fully characterized by spectral, analytical and structural modes. Single crystal X-ray diffraction studies revealed that the copper(I) complex [CuCl(PPh3)L] has a distorted tetrahedral geometry around the central copper(I) ion. The interaction of the ligand and the complex with CT-DNA has been explored by absorption titration method which revealed that the compounds could interact with CT-DNA through intercalation. A gel electrophoresis assay demonstrated the ability of the complex to cleave the pBR322 DNA. The antioxidative properties showed that the copper(I) complex has a strong radical-scavenging potency than ligands. Further the cytotoxic effect of the compounds examined on cancerous cell lines showed that the complex exhibited substantial anticancer activity. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. Hydrothermal syntheses and single crystal structural ...

    Indian Academy of Sciences (India)

    ), and Zn(II); OPTA = 1-oxopyridinium-2-thioacetato) was prepared from the appropriate metal acetates, 1-oxopyridinium-2-thioacetic acid (OPTAH), and potassium hydroxide in hydrothermal media and structurally characterized. The structure ...

  6. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  7. Benzimidazole derivatives related to 2,3-acrylonitriles, benzimidazo[1,2-a]quinolines and fluorenes: synthesis, antitumor evaluation in vitro and crystal structure determination.

    Science.gov (United States)

    Hranjec, Marijana; Pavlović, Gordana; Marjanović, Marko; Kralj, Marijeta; Karminski-Zamola, Grace

    2010-06-01

    A synthesis and biological evaluation of new benzimidazole derivatives, related to 2,3-disubstituted acrylonitriles, benzimidazo[1,2-a]quinoline-6-carbonitriles and heteroaromatic fluorenes was described. The molecular and crystal structures of three compounds 4, 16 and 17 reveal that non-fused fluoro derivative, 4, deviates from planarity by 13.11(2) degrees, while fused methyl, 16, and fluoro, 17, derivatives are planar within 4 degrees exhibiting a planar aromatic surface capable to intercalate into double-stranded DNA. Compound 4 exists as E-isomer. The crystal structures confirmed that hydrogen bonding patterns are characterized dominantly by the weak C-H...N(F) bonds, except in the case of 4 where the presence of ethanol molecule of crystallization resulted in the N-H...O and O-H...N hydrogen bonds formation. In the crystal structures of 16 and 17 cyano group participates in hydrogen bonding formation, while in 4 this is not the case. All compounds, except 16 and 14 exerted pronounced antiproliferative activity on five tumor cell lines, whereby 2-benzimidazolyl-3-N-methylpyrolyl-acrylonitrile 13 and its fused analogue 23 exerted the highest activity on all cell lines (IC50=0.8-30 microM) and showed a special selectivity toward HeLa cells. There is no major difference in the biological activity between non-fused and fused analogues. Similarly, all compounds showed significant interaction with ct-DNA, supporting the fact that their antitumor activity could partially be the consequence of DNA-binding. The cyano moiety is important for the activity, but not the selectivity of tested compounds. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  8. Characterization of DNA-binding proteins from pea mitochondria

    DEFF Research Database (Denmark)

    Hatzack, F.A.; Dombrowski, S.; Brennicke, A.

    1998-01-01

    We studied transcription initiation in the mitochondria of higher plants, with particular respect to promoter structures. Conserved elements of these promoters have been successfully identified by in vitro transcription systems in different species, whereas the involved protein components are still...

  9. Crystal structures of unsymmetrically mixed β-pyrrole substituted ...

    Indian Academy of Sciences (India)

    Normal-coordinate structural decomposition (NSD) analysis of the heme in various heme proteins feature interesting trend in distortion of the macrocycle.30. Numerous crystal structure reports are available on variety of substituted porphyrins and metallopor- phyrins.31–38 Systematic analyses of the change in con-.

  10. Synthesis, crystal structure and Thermogravimetry of ortho-phthalic ...

    Indian Academy of Sciences (India)

    Coordination polymer of Cu(II) bridged by o-phthalic acid alone is not known. The reaction of C u C l 2 .2 H 2 O with (2-butoxycarbonyl)benzoic acid yielded three dimensional coordination polymer bridged byo-phthalic acid. X-ray crystal structure shows structure with monoclinic P21/c space group. o-Phthalic acidmolecules ...

  11. Crystal structure and elastic constants of Dharwar cotton fibre using ...

    Indian Academy of Sciences (India)

    WINTEC

    Abstract. Wide-angle X-ray scattering (WAXS) recordings were carried out on raw Dharwar cotton fibres available in Karnataka. Using this data and employing linked atom least squares (LALS) method, we report here the molecular and crystal structure of these cotton fibres. Employing structural data, we have computed.

  12. Structural basis of Ets1 cooperative binding to widely separated sites on promoter DNA.

    Directory of Open Access Journals (Sweden)

    Nigar D Babayeva

    Full Text Available Ets1 is a member of the Ets family of transcription factors. Ets1 is expressed in autoinhibited form and its DNA binding depends on partner proteins bound to adjacent sequences or the relative positioning of a second Ets-binding site (EBS. The autoinhibition of Ets1 is mediated by structural coupling of regions flanking the DNA-binding domain. The NMR structure of Ets1 revealed that the inhibitory regions comprised of helices HI1 and HI2 and H4 are packed together on the Ets domain to form an inhibitory module. The crystal structure of Ets1 unexpectedly revealed a homodimer in which homodimerisation occurs via swapping of HI1 helices. Modeling of DNA binding indicates that the Ets1 dimer can bind to two antiparallel pieces of DNA. To verify this, we crystallized and solved the structure of the complex comprised of Ets1 dimer and two pieces of DNA. DNA binding by Ets1 dimer resulted in formation of additional intermolecular protein•DNA interactions, implying that the complex formation is cooperative.

  13. Structural basis of Ets1 cooperative binding to widely separated sites on promoter DNA.

    Science.gov (United States)

    Babayeva, Nigar D; Baranovskaya, Oxana I; Tahirov, Tahir H

    2012-01-01

    Ets1 is a member of the Ets family of transcription factors. Ets1 is expressed in autoinhibited form and its DNA binding depends on partner proteins bound to adjacent sequences or the relative positioning of a second Ets-binding site (EBS). The autoinhibition of Ets1 is mediated by structural coupling of regions flanking the DNA-binding domain. The NMR structure of Ets1 revealed that the inhibitory regions comprised of helices HI1 and HI2 and H4 are packed together on the Ets domain to form an inhibitory module. The crystal structure of Ets1 unexpectedly revealed a homodimer in which homodimerisation occurs via swapping of HI1 helices. Modeling of DNA binding indicates that the Ets1 dimer can bind to two antiparallel pieces of DNA. To verify this, we crystallized and solved the structure of the complex comprised of Ets1 dimer and two pieces of DNA. DNA binding by Ets1 dimer resulted in formation of additional intermolecular protein•DNA interactions, implying that the complex formation is cooperative.

  14. Regulation of DNA Metabolism by DNA-Binding Proteins Probed by Single Molecule Spectroscopy

    Science.gov (United States)

    2006-12-05

    Recent advances in single - molecule force spectroscopy of DNA make it possible to study the thermodynamics and kinetics of DNA binding proteins under...to transient single-stranded DNA regions due to thermal fluctuations. The model is used to analyze recent single - molecule spectroscopy data of this system.

  15. CRITERIA FOR AN UPDATED CLASSIFICATION OF HUMAN TRANSCRIPTION FACTOR DNA-BINDING DOMAINS

    NARCIS (Netherlands)

    Wingender, Edgar

    By binding to cis-regulatory elements in a sequence-specific manner, transcription factors regulate the activity of nearby genes. Here, we discuss the criteria for a comprehensive classification of human TFs based on their DNA-binding domains. In particular, classification of basic leucine zipper

  16. New non detrimental DNA binding mutants of the Escherichia coli initiator protein DnaA

    DEFF Research Database (Denmark)

    Asklund, Marlene; Atlung, Tove

    2004-01-01

    gave rise to 30 single amino acid substitutions and, including double substitutions, more than 100 mutants functional in initiation of chromosome replication were characterized. The analysis indicated that all regions of the DNA-binding domain are involved in DNA binding, but the most important amino......The initiator protein DnaA has several unique DNA-binding features. It binds with high affinity as a monomer to the nonamer DnaA box. In the ATP form, DnaA binds cooperatively to the low-affinity ATP-DnaA boxes, and to single-stranded DNA in the 13mer region of the origin. We have carried out...... an extensive mutational analysis of the DNA-binding domain of the Escherichia coli DnaA protein using mutagenic PCR. We analyzed mutants exhibiting more or less partial activity by selecting for complementation of a dnaA(Ts) mutant strain at different expression levels of the new mutant proteins. The selection...

  17. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    Single-stranded DNA-binding proteins (SSBs) are required for repair, recombination and replication in all organisms. Eukaryotic SSBs are regulated by phosphorylation on serine and threonine residues. To our knowledge, phosphorylation of SSBs in bacteria has not been reported. A systematic search ...... of SSBs is a conserved process of post-translational modification in taxonomically distant bacteria....

  18. Differential Expression of Two Paralogous Genes of Bacillus subtilis Encoding Single-Stranded DNA Binding Protein

    NARCIS (Netherlands)

    Lindner, Cordula; Nijland, Reindert; Hartskamp, Mariska van; Bron, Sierd; Hamoen, Leendert W.; Kuipers, Oscar P.

    The Bacillus subtilis genome comprises two paralogous single-stranded DNA binding protein (SSB) genes, ssb and ywpH, which show distinct expression patterns. The main ssb gene is strongly expressed during exponential growth and is coregulated with genes encoding the ribosomal proteins S6 and S18.

  19. DNA binding of centromere protein C (CENPC is stabilized by single-stranded RNA.

    Directory of Open Access Journals (Sweden)

    Yaqing Du

    2010-02-01

    Full Text Available Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically. It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics.

  20. Crystal structure of 1-bromo-2-(phenylselenylbenzene

    Directory of Open Access Journals (Sweden)

    Bronte J. Charette

    2015-03-01

    Full Text Available In the title compound, C12H9BrSe, the Se atom exhibits a bent geometry, with a C—Se—C bond angle of 99.19 (6°. The ortho Se and Br atoms are slightly displaced from opposite faces of the mean plane of the benzene ring [by 0.129 (2 and 0.052 (2 Å, respectively]. The planes of the benzene and phenyl rings form a dihedral angle of 72.69 (5°. In the crystal, π-stacking interactions between inversion-related phenyl rings are observed, with a centroid–centroid distance of 3.630 (1 Å.

  1. Crystal structure of 4-methylsulfanyl-2-phenylquinazoline

    Directory of Open Access Journals (Sweden)

    Mohammed B. Alshammari

    2014-08-01

    Full Text Available In the title compound, C15H12N2S, the methylthioquinazoline group is planar with the methyl C displaced by only 0.116 (3 Å from the plane of the quinazoline moiety. The dihedral angle between the phenyl ring and the quinazoline ring system is 13.95 (5°. In the crystal, each molecule is linked by π–π stacking between to two adjacent inversion-related molecules. On one side, the inverted quinazoline groups interact with a centroid–centroid distance of 3.7105 (9 Å. On the other side, the quinazoline group interacts with the pyrimidine and phenyl rings of the second neighbour with centroid–centroid distances of 3.5287 (8 and 3.8601 (9 Å, respectively.

  2. Band structure peculiarities of magnetic photonic crystals

    Science.gov (United States)

    Gevorgyan, A. H.; Golik, S. S.

    2017-10-01

    In this work we studied light diffraction in magneto-photonic crystals (MPC) having large magneto-optical activity and modulation large depth. The case of arbitrary angles between the direction of the external static magnetic field and the normal to the border of the MPC layer is considered. The problem is solved by Ambartsumian's modified layer addition method. It is found that there is a new type of non-reciprocity, namely, the relation R (α) ≠ R (- α) takes place, where R is the reflection coefficient, and α is the incidence angle. It is shown the formation of new photonic band gap (PBG) at oblique incidence of light, which is not selective for the polarization of the incident light, in the case when the external magnetic field is directed along the medium axis. Such a system can be used as: a tunable polarization filter, polarization mirror, circular (elliptical) polarizer, tunable optical diode, etc.

  3. Crystal structure of 2-aminopyridinium 6-chloronicotinate

    Directory of Open Access Journals (Sweden)

    N. Jeeva Jasmine

    2015-09-01

    Full Text Available In the title salt, C5H7N+·C6H3ClNO−, the 2-aminopyridinium cation interacts with the carboxylate group of the 6-chloronicotinate anion through a pair of independent N—H...O hydrogen bonds, forming an R22(8 ring motif. In the crystal, these dimeric units are connected further via N—H...O hydrogen bonds, forming chains along [001]. In addition, weak C—H...N and C—H...O hydrogen bonds, together with weak π–π interactions, with centroid–centroid distances of 3.6560 (5 and 3.6295 (5 Å, connect the chains, forming a two-dimensional network parallel to (100.

  4. Novel de novo variant in EBF3 is likely to impact DNA binding in a patient with a neurodevelopmental disorder and expanded phenotypes: patient report, in silico functional assessment, and review of published cases

    OpenAIRE

    Blackburn, Patrick; Barnett, Sarah S.; Zimmermann, Michael T.; Cousin, Margot A.; Kaiwar, Charu; Pinto e Vairo,Filippo; Niu, Zhiyv; Ferber, Matthew J.; Urrutia, Raul A.; Selcen, Duygu; Eric W. Klee; Pichurin, Pavel N.

    2017-01-01

    Pathogenic variants in EBF3 were recently described in three back-to-back publications in association with a novel neurodevelopmental disorder characterized by intellectual disability, speech delay, ataxia, and facial dysmorphisms. In this report, we describe an additional patient carrying a de novo missense variant in EBF3 (c.487C>T, p.(Arg163Trp)) that falls within a conserved residue in the zinc knuckle motif of the DNA binding domain. Without a solved structure of the DNA binding domain, ...

  5. Structure and properties of MTiOXO sub 4 crystals

    CERN Document Server

    Latham, T J

    2000-01-01

    linked to chains of particular atoms along the three crystallographic axes. Dielectric measurements of a series of arsenate crystals and various doped phosphate crystals demonstrate that MTiOXO sub 4 isomorphs exhibit dielectric relaxation of a non-Debye type and appear to conform to the hopping charge-carrier and low frequency dispersion response models. A reduction in the ionic conductivity is observed in the arsenate crystals and phosphate crystals doped with trivalent ions. Arrhenius plots indicate that the activation energies of the mixed cation arsenate crystals are significantly higher than the other KTiOPO sub 4 isomorphs. This observation suggests that the modified oxygen framework in these mixed arsenate crystals contributes intrinsically to the large activation energies required for ionic conduction. This thesis is a study of the structural, optical and electrical properties of MTiOXO sub 4 crystals, where M is a monovalent cation such as K, Rb etc and X is P or As. Low and high-temperature single-...

  6. Crystal Structure of a Bacterial Type IB DNA Topoisomerase Reveals a Preassembled Active Site in the Absence of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Asmita; Shuman, Stewart; Mondragon, Alfonso (NWU); (SKI)

    2010-03-08

    Type IB DNA topoisomerases are found in all eukarya, two families of eukaryotic viruses (poxviruses and mimivirus), and many genera of bacteria. They alter DNA topology by cleaving and resealing one strand of duplex DNA via a covalent DNA-(3-phosphotyrosyl)-enzyme intermediate. Bacterial type IB enzymes were discovered recently and are described as poxvirus-like with respect to their small size, primary structures, and bipartite domain organization. Here we report the 1.75-{angstrom} crystal structure of Deinococcus radiodurans topoisomerase IB (DraTopIB), a prototype of the bacterial clade. DraTopIB consists of an amino-terminal (N) {beta}-sheet domain (amino acids 1-90) and a predominantly {alpha}-helical carboxyl-terminal (C) domain (amino acids 91-346) that closely resemble the corresponding domains of vaccinia virus topoisomerase IB. The five amino acids of DraTopIB that comprise the catalytic pentad (Arg-137, Lys-174, Arg-239, Asn-280, and Tyr-289) are preassembled into the active site in the absence of DNA in a manner nearly identical to the pentad configuration in human topoisomerase I bound to DNA. This contrasts with the apoenzyme of vaccinia topoisomerase, in which three of the active site constituents are either displaced or disordered. The N and C domains of DraTopIB are splayed apart in an 'open' conformation, in which the surface of the catalytic domain containing the active site is exposed for DNA binding. A comparison with the human topoisomerase I-DNA cocrystal structure suggests how viral and bacterial topoisomerase IB enzymes might bind DNA circumferentially via movement of the N domain into the major groove and clamping of a disordered loop of the C domain around the helix.

  7. Characterization of a Single-Stranded DNA-Binding-Like Protein from Nanoarchaeum equitans--A Nucleic Acid Binding Protein with Broad Substrate Specificity.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available SSB (single-stranded DNA-binding proteins play an essential role in all living cells and viruses, as they are involved in processes connected with ssDNA metabolism. There has recently been an increasing interest in SSBs, since they can be applied in molecular biology techniques and analytical methods. Nanoarchaeum equitans, the only known representative of Archaea phylum Nanoarchaeota, is a hyperthermophilic, nanosized, obligatory parasite/symbiont of Ignicoccus hospitalis.This paper reports on the ssb-like gene cloning, gene expression and characterization of a novel nucleic acid binding protein from Nanoarchaeum equitans archaeon (NeqSSB-like protein. This protein consists of 243 amino acid residues and one OB fold per monomer. It is biologically active as a monomer like as SSBs from some viruses. The NeqSSB-like protein displays a low sequence similarity to the Escherichia coli SSB, namely 10% identity and 29% similarity, and is the most similar to the Sulfolobus solfataricus SSB (14% identity and 32% similarity. The NeqSSB-like protein binds to ssDNA, although it can also bind mRNA and, surprisingly, various dsDNA forms, with no structure-dependent preferences as evidenced by gel mobility shift assays. The size of the ssDNA binding site, which was estimated using fluorescence spectroscopy, is 7 ± 1 nt. No salt-dependent binding mode transition was observed. NeqSSB-like protein probably utilizes a different model for ssDNA binding than the SSB proteins studied so far. This protein is highly thermostable; the half-life of the ssDNA binding activity is 5 min at 100 °C and melting temperature (T(m is 100.2 °C as shown by differential scanning calorimetry (DSC analysis.NeqSSB-like protein is a novel highly thermostable protein which possesses a unique broad substrate specificity and is able to bind all types of nucleic acids.

  8. Characterization of in vivo DNA-binding events of plant transcription factors by ChIP-seq

    NARCIS (Netherlands)

    Mourik, Van Hilda; Muiño, J.M.; Pajoro, Alice; Angenent, G.C.; Kaufmann, Kerstin

    2015-01-01

    Chromatin immunoprecipitation followed by next-generation sequencing (ChIP-seq) is a powerful technique for genome-wide identification of in vivo binding sites of DNA-binding proteins. The technique had been used to study many DNA-binding proteins in a broad variety of species. The basis of the

  9. Synthesis, Crystal Structure, Density Function Theory, Molecular ...

    African Journals Online (AJOL)

    Conclusion: The test compound has a moderate antimicrobial activity and the optimized molecular structure of the studied compound using B3LYP/6-31G (d,p) method showed good agreement with the reported x-ray structure. Keywords: Isoindoline-1, 3-dione, X-ray analysis, Density function theory, Antimicrobial, Molecular ...

  10. A crystal structure prediction enigma solved

    DEFF Research Database (Denmark)

    Hoser, Anna Agnieszka; Sovago, Ioana; Lanzac, A.

    2017-01-01

    The seemingly unpredictable structure of gallic acid monohydrate form IV has been investigated using accurate X-ray diffraction measurements at temperatures of 10 and 123 K. The measurements demonstrate that the structure is commensurately modulated at 10 K and disordered at higher temperatures. ...

  11. The crystal structure of urea nitrate

    NARCIS (Netherlands)

    Harkema, Sybolt; Feil, D.

    1969-01-01

    The structure of urea nitrate has been solved, by the use of three-dimensional X-ray data. Data were collected using Cu Ke and Mo K0~ radiations. The structure consists of layers with urea and nitrate groups held together by hydrogen bonds. The positions of all hydrogen atoms were found. The final R

  12. ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain of a novel class of DIRS1-type retroposons

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2012-11-01

    Full Text Available Abstract Members of the Arabidopsis LSH1 and Oryza G1 (ALOG family of proteins have been shown to function as key developmental regulators in land plants. However, their precise mode of action remains unclear. Using sensitive sequence and structure analysis, we show that the ALOG domains are a distinct version of the N-terminal DNA-binding domain shared by the XerC/D-like, protelomerase, topoisomerase-IA, and Flp tyrosine recombinases. ALOG domains are distinguished by the insertion of an additional zinc ribbon into this DNA-binding domain. In particular, we show that the ALOG domain is derived from the XerC/D-like recombinases of a novel class of DIRS-1-like retroposons. Copies of this element, which have been recently inactivated, are present in several marine metazoan lineages, whereas the stramenopile Ectocarpus, retains an active copy of the same. Thus, we predict that ALOG domains help establish organ identity and differentiation by binding specific DNA sequences and acting as transcription factors or recruiters of repressive chromatin. They are also found in certain plant defense proteins, where they are predicted to function as DNA sensors. The evolutionary history of the ALOG domain represents a unique instance of a domain, otherwise exclusively found in retroelements, being recruited as a specific transcription factor in the streptophyte lineage of plants. Hence, they add to the growing evidence for derivation of DNA-binding domains of eukaryotic specific TFs from mobile and selfish elements.

  13. Autoinhibition of ETV6 DNA Binding Is Established by the Stability of Its Inhibitory Helix.

    Science.gov (United States)

    De, Soumya; Okon, Mark; Graves, Barbara J; McIntosh, Lawrence P

    2016-04-24

    The ETS transcriptional repressor ETV6 (or TEL) is autoinhibited by an α-helix that sterically blocks its DNA-binding ETS domain. The inhibitory helix is marginally stable and unfolds when ETV6 binds to either specific or non-specific DNA. Using NMR spectroscopy, we show that folding of the inhibitory helix requires a buried charge-dipole interaction with helix H1 of the ETS domain. This interaction also contributes directly to autoinhibition by precluding a highly conserved dipole-enhanced hydrogen bond between the phosphodiester backbone of bound DNA and the N terminus of helix H1. To probe further the thermodynamic basis of autoinhibition, ETV6 variants were generated with amino acid substitutions introduced along the solvent exposed surface of the inhibitory helix. These changes were designed to increase the intrinsic helical propensity of the inhibitory helix without perturbing its packing interactions with the ETS domain. NMR-monitored amide hydrogen exchange measurements confirmed that the stability of the folded inhibitory helix increases progressively with added helix-promoting substitutions. This also results in progressively reinforced autoinhibition and decreased DNA-binding affinity. Surprisingly, locking the inhibitory helix onto the ETS domain by a disulfide bridge severely impairs, but does not abolish DNA binding. Weak interactions still occur via an interface displaced from the canonical ETS domain DNA-binding surface. Collectively, these studies establish a direct thermodynamic linkage between inhibitory helix stability and ETV6 autoinhibition, and demonstrate that helix unfolding does not strictly precede DNA binding. Modulating inhibitory helix stability provides a potential route for the in vivo regulation of ETV6 activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Solving Crystal Structures from Powder Diffraction Data

    DEFF Research Database (Denmark)

    Christensen, A. Nørlund; Lehmann, M. S.; Nielsen, Mogens

    1985-01-01

    High resolution powder data from both neutron and X-ray (synchrotron) sources have been used to estimate the possibility of direct structure determination from powder data. Two known structures were resolved by direct methods with neutron and X-ray data. With synchrotron X-ray data, the measured...... range of data was insufficient for a structure analysis, but the R-factor calculations showed the intensities extracted from the profile data to be of acceptable quality. The results were used to estimate the largest structure that might be solved using routine techniques. It was found that the limit...... would be near twenty atoms in the asymmetric part of a centro-symmetric structure....

  15. NMR elucidation of monomer-dimer transition and conformational heterogeneity in histone-like DNA binding protein of Helicobacter pylori.

    Science.gov (United States)

    Jaiswal, Nancy; Raikwal, Nisha; Pandey, Himanshu; Agarwal, Nipanshu; Arora, Ashish; Poluri, Krishna Mohan; Kumar, Dinesh

    2017-12-14

    Helicobacter pylori (H. pylori) colonizes under harsh acidic/oxidative stress conditions of human gastrointestinal tract and can survive there for infinitely longer durations of host life. The bacterium expresses several harbinger proteins to facilitate its persistent colonization under such conditions. One such protein in H. pylori is histone-like DNA binding protein (Hup), which in its homo-dimeric form binds to DNA to perform various DNA dependent cellular activities. Further, it also plays an important role in protecting the genomic DNA from oxidative stress and acidic denaturation. Legitimately, if the binding of Hup to DNA is suppressed, it will directly impact on the survival of the bacterium, thus making Hup a potential therapeutic target for developing new anti-H. pylori agents. However, to inhibit the binding of Hup to DNA, it is necessary to gain detailed insights into the molecular and structural basis of Hup-dimerization and its binding mechanism to DNA. As a first step in this direction, we report here the nuclear magnetic resonance (NMR) assignments and structural features of Hup at pH 6.0. The study revealed the occurrence of dynamic equilibrium between its monomer and dimer conformations. The dynamic equilibrium was found to shifting towards dimer both at low temperature and low pH; whereas DNA binding studies evidenced that the protein binds to DNA in its dimeric form. These preliminary investigations correlate very well with the diverse functionality of protein and will form the basis for future studies aiming to develop novel anti-H. pylori agents employing structure-based-rational drug discovery approach. Copyright © 2017 John Wiley & Sons, Ltd.

  16. Crystal-Size-Dependent Structural Transitions in Nanoporous Crystals: Adsorption-Induced Transitions in ZIF-8

    KAUST Repository

    Zhang, Chen

    2014-09-04

    © 2014 American Chemical Society. Understanding the crystal-size dependence of both guest adsorption and structural transitions of nanoporous solids is crucial to the development of these materials. We find that nano-sized metal-organic framework (MOF) crystals have significantly different guest adsorption properties compared to the bulk material. A new methodology is developed to simulate the adsorption and transition behavior of entire MOF nanoparticles. Our simulations predict that the transition pressure significantly increases with decreasing particle size, in agreement with crystal-size-dependent experimental measurements of the N2-ZIF-8 system. We also propose a simple core-shell model to examine this effect on length scales that are inaccessible to simulations and again find good agreement with experiments. This study is the first to examine particle size effects on structural transitions in ZIFs and provides a thermodynamic framework for understanding the underlying mechanism.

  17. Crystal structure of aspartame anhydrate from powder diffraction data. Structural aspects of the dehydration process of aspartame

    NARCIS (Netherlands)

    Guguta, C.; Meekes, H.L.M.; Gelder, R. de

    2006-01-01

    Aspartame has three pseudo-polymorphic forms, two hydrates and a hemi-hydrate, for which crystal structures were determined from single-crystal diffraction data. This paper presents the crystal structure of the anhydrate, which was obtained by dehydrating the hemi-hydrate. The crystal structure of

  18. Synthesis, crystal structure and biological activity of novel diester cyclophanes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Pengfei; Yang, Bingqin; Fang, Xianwen; Cheng, Zhao; Yang, Meipan, E-mail: yangbq@nwu.edu.cn [Department of Chemistry, Key Laboratory of Synthetic and Natural Functional Molecule Chemistry, Northwest University, Shaanxi (China)

    2012-10-15

    A series of novel diester cyclophanes was synthesized by esterification of 1,2-benzenedicarbonyl chloride with eight different diols under high dilution conditions. The structures of the compounds were verified by elemental analysis, {sup 1}H nuclear magnetic resonance (NMR), IR spectroscopy and high resolution mass spectrometry (HRMS). The crystal structures of two compounds were characterized by single crystal X-ray diffractometry (XRD). All the new cyclophanes were evaluated for biological activities and the results showed that some of these compounds have low antibacterial or antifungal activities (author)

  19. Crystal structure of 2-methoxy-1-nitronaphthalene

    Directory of Open Access Journals (Sweden)

    Hasna Yassine

    2015-10-01

    Full Text Available The asymmetric unit of the title compound, C11H9NO3, contains two molecules, A and B. In molecule A, the dihedral angle between the planes of the naphthalene ring system (r.m.s. deviation = 0.003 Å and the nitro group is 89.9 (2°, and the C atom of the methoxy group deviates from the naphthyl plane by 0.022 (2 Å. Equivalent data for molecule B are 0.008 Å, 65.9 (2° and −0.198 (2 Å, respectively. In the crystal, molecules are linked by weak C—H...O interactions, forming [100] chains of alternating A and B molecules. Weak aromatic π–π stacking contacts, with a range of centroid–centroid distances from 3.5863 (9 to 3.8048 (9 Å, are also observed.

  20. Utilization of Protein Crystal Structures in Industry

    Science.gov (United States)

    Ishikawa, Kohki

    In industry, protein crystallography is used in mainly two technologies. One is structure-based drug design, and the other is structure-based enzyme engineering. Some successful cases together with recent advances are presented in this article. The cases include the development of an anti-influenza drug, and the introduction of engineered acid phosphatase to the manufacturing process of nucleotides used as umami seasoning.

  1. Photonics of liquid-crystal structures: A review

    Energy Technology Data Exchange (ETDEWEB)

    Palto, S. P., E-mail: palto@online.ru; Blinov, L. M.; Barnik, M. I.; Lazarev, V. V.; Umanskii, B. A.; Shtykov, N. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2011-07-15

    The original results of studies of the electro-optical and laser effects which have been performed at the Laboratory of Liquid Crystals of the Institute of Crystallography, Russian Academy of Sciences, over the last few years are reviewed. Cholesteric liquid crystals as vivid representatives of photonic structures and their behavior in an electric field are considered in detail. The formation of higher harmonics in the periodic distribution of the director field in a helical liquid crystal structure and, correspondingly, the new (anharmonic) mode of electro-optical effects are discussed. Another group of studies is devoted to bistable light switching by an electric field in chiral nematics. Polarization diffraction gratings controlled by an electric field are also considered. The results of studies devoted to microlasers on various photonic structures with cholesteric and nematic liquid crystals are considered in detail. Particular attention is given to the new regime: leaky-mode lasing. Designs of liquid crystal light amplifiers and their polarization, field, and spectral characteristics are considered in the last section.

  2. Synthesis and crystal structure of copper (II) uracil ternary polymeric complex with 1,10-phenanthroline along with the Hirshfeld surface analysis of the metal binding sites for the uracil ligand

    Science.gov (United States)

    Patil, Yogesh Prakash; Nethaji, Munirathinam

    2015-02-01

    The study of models for "metal-enzyme-substrate" interaction has been a proactive area of research owing to its biological and pharmacological importance. In this regard the ternary copper uracil complex with 1,10-phenanthroline represents metal-enzyme-substrate system for DNA binding enzymes. The synthesis of the complex, followed by slow evaporation of the reaction mixture forms two concomitant solvatomorph crystals viz., {[Cu(phen)(μ-ura)(H2O)]n·H2O (1a)} and {[Cu(phen)(μ-ura)(H2O)]n·CH3OH (1b)}. Both complexes are structurally characterized, while elemental analysis, IR and EPR spectra were recorded for 1b (major product). In both complexes, uracil coordinates uniquely via N1 and N3 nitrogen atom acting as a bidentate bridging ligand forming a 1-D polymer. The two solvatomorphs were quantitatively analyzed for the differences with the aid of Hirshfeld surface analysis.

  3. Crystallation, X-Ray Structure Determination and Structure-Based Drug Design for Targeted Malarial Enzymes

    National Research Council Canada - National Science Library

    DeLucas, Lawrence

    1997-01-01

    .... This structure is currently being used for designing lead inhibitors. We have also purified PFPK-DHPS bifunctional enzyme for structure analysis and are presently screening for crystallization conditions...

  4. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    Energy Technology Data Exchange (ETDEWEB)

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  5. Crystal engineering of ibuprofen compounds: From molecule to crystal structure to morphology prediction by computational simulation and experimental study

    Science.gov (United States)

    Zhang, Min; Liang, Zuozhong; Wu, Fei; Chen, Jian-Feng; Xue, Chunyu; Zhao, Hong

    2017-06-01

    We selected the crystal structures of ibuprofen with seven common space groups (Cc, P21/c, P212121, P21, Pbca, Pna21, and Pbcn), which was generated from ibuprofen molecule by molecular simulation. The predicted crystal structures of ibuprofen with space group P21/c has the lowest total energy and the largest density, which is nearly indistinguishable with experimental result. In addition, the XRD patterns for predicted crystal structure are highly consistent with recrystallization from solvent of ibuprofen. That indicates that the simulation can accurately predict the crystal structure of ibuprofen from the molecule. Furthermore, based on this crystal structure, we predicted the crystal habit in vacuum using the attachment energy (AE) method and considered solvent effects in a systematic way using the modified attachment energy (MAE) model. The simulation can accurately construct a complete process from molecule to crystal structure to morphology prediction. Experimentally, we observed crystal morphologies in four different polarity solvents compounds (ethanol, acetonitrile, ethyl acetate, and toluene). We found that the aspect ratio decreases of crystal habits in this ibuprofen system were found to vary with increasing solvent relative polarity. Besides, the modified crystal morphologies are in good agreement with the observed experimental morphologies. Finally, this work may guide computer-aided design of the desirable crystal morphology.

  6. Flow cytometric fluorescence lifetime analysis of DNA binding fluorochromes

    Energy Technology Data Exchange (ETDEWEB)

    Crissman, Harry A.; Cui, H. H. (H. Helen); Steinkamp, J. A.

    2002-01-01

    Most flow cytometry (FCM) applications monitor fluorescence intensity to quantitate the various cellular parameters; however, the fluorescence emission also contains information relative to the fluorescence lifetime. Recent developments in FCM (Pinsky et al., 1993; Steinkamp & Crissman, 1993; Steinkamp et al., 1993), provide for the measurement of fluorescence lifetime which is also commonly referred to as fluorescence decay, or the time interval in which a fluorochrome remains in the excited state. Many unbound fluorochromes have characteristic lifetime values that are determined by their molecular structure; however, when the probe becomes bound, the lifetime value is influenced by a number of factors that affect the probe interaction with a target molecule. Monitoring the changes in the lifetime of the probe yields information relating to the molecular conformation, the functional state or activity of the molecular target. In addition, the lifetime values can be used as signatures to resolve the emissions of multiple fluorochrome labels with overlapping emission spectra that cannot be resolved by conventional FCM methodology. Such strategies can increase the number of fluorochrome combinations used in a flow cytometer with a single excitation source. Our studies demonstrate various applications of lifetime measurements for the analysis of the binding of different fluorochromes to DNA in single cells. Data presented in this session will show the utility of lifetime measurements for monitoring changes in chromatin structure associated with cell cycle progression, cellular differentiation, or DNA damage, such as induced during apoptosis. Several studies show that dyes with specificity for nucleic acids display different lifetime values when bound to DNA or to dsRNA. The Phase Sensitive Flow Cytometer is a multiparameter instrument, capable of performing lifetime measurements in conjunction with all the conventional FCM measurements. Future modifications of this

  7. Diamond-Structured Photonic Crystals with Graded Air Spheres Radii

    Directory of Open Access Journals (Sweden)

    Dichen Li

    2012-05-01

    Full Text Available A diamond-structured photonic crystal (PC with graded air spheres radii was fabricated successfully by stereolithography (SL and gel-casting process. The graded radii in photonic crystal were formed by uniting different radii in photonic crystals with a uniform radius together along the Г‑Х direction. The stop band was observed between 26.1 GHz and 34.3 GHz by reflection and transmission measurements in the direction. The result agreed well with the simulation attained by the Finite Integration Technique (FIT. The stop band width was 8.2 GHz and the resulting gap/midgap ratio was 27.2%, which became respectively 141.4% and 161.9% of the perfect PC. The results indicate that the stop band width of the diamond-structured PC can be expanded by graded air spheres radii along the Г‑Х direction, which is beneficial to develop a multi bandpass filter.

  8. Crystal Structure Representation for Neural Networks using Topological Approach.

    Science.gov (United States)

    Fedorov, Aleksandr V; Shamanaev, Ivan V

    2017-08-01

    In the present work we describe a new approach, which uses topology of crystals for physicochemical properties prediction using artificial neural networks (ANN). The topologies of 268 crystal structures were determined using ToposPro software. Quotient graphs were used to identify topological centers and their neighbors. The topological approach was illustrated by training ANN to predict molar heat capacity, standard molar entropy and lattice energy of 268 crystals with different compositions and structures (metals, inorganic salts, oxides, etc.). ANN was trained using Broyden-Fletcher-Goldfarb-Shanno (BFGS) algorithm. Mean absolute percentage error of predicted properties was ≤8 %. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A monoclonal antibody to triplex DNA binds to eucaryotic chromosomes.

    Science.gov (United States)

    Lee, J S; Burkholder, G D; Latimer, L J; Haug, B L; Braun, R P

    1987-01-01

    A monoclonal antibody (Jel 318) was produced by immunizing mice with poly[d(TmC)].poly[d(GA)].poly[d(mCT) which forms a stable triplex at neutral pH. Jel 318 did not bind to calf thymus DNA or other non pyrimidine.purine DNAs such as poly[d(TG)].poly[d(CA)]. In addition the antibody did not recognize pyrimidine.purine DNAs containing mA (e.g. poly[d(TC)].poly[d(GmA)]) which cannot form a triplex since the methyl group blocks Hoogsteen base-pairing. The binding of Jel 318 to chromosomes was assessed by immunofluorescent microscopy of mouse myeloma cells which had been fixed in methanol/acetic acid. An antibody specific for duplex DNA (Jel 239) served as a control. The fluorescence due to Jel 318 was much weaker than that of Jel 239 but binding to metaphase chromosomes and interphase nuclei was observed. The staining by Jel 318 was unaffected by addition of E. coli DNA but it was obliterated in the presence of triplex. Since an acid pH favours triplex formation, nuclei were also prepared from mouse melanoma cells by fixation in cold acetone. Again Jel 318 showed weak but consistent staining of the nuclei. Therefore it seems likely that triplexes are an inherent feature of the structure of eucaryotic DNA. Images PMID:2434928

  10. Synthesis and crystal structure analysis of uranyl triple acetates

    Energy Technology Data Exchange (ETDEWEB)

    Klepov, Vladislav V., E-mail: vladislavklepov@gmail.com [Institute for Energy and Climate Research (IEK-6), Forschungszentrum Jülich GmbH, 52428 Jülich (Germany); Department of Chemistry, Samara National Research University, 443086 Samara (Russian Federation); Serezhkina, Larisa B.; Serezhkin, Victor N. [Department of Chemistry, Samara National Research University, 443086 Samara (Russian Federation); Alekseev, Evgeny V., E-mail: e.alekseev@fz-juelich.de [Institute for Energy and Climate Research (IEK-6), Forschungszentrum Jülich GmbH, 52428 Jülich (Germany); Institut für Kristallographie, RWTH Aachen University, 52066 Aachen (Germany)

    2016-12-15

    Single crystals of triple acetates NaR[UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 3}·6H{sub 2}O (R=Mg, Co, Ni, Zn), well-known for their use as reagents for sodium determination, were grown from aqueous solutions and their structural and spectroscopic properties were studied. Crystal structures of the mentioned phases are based upon (Na[UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 3}){sup 2–} clusters and [R(H{sub 2}O){sub 6}]{sup 2+} aqua-complexes. The cooling of a single crystal of NaMg[UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 3}·6H{sub 2}O from 300 to 100 K leads to a phase transition from trigonal to monoclinic crystal system. Intermolecular interactions between the structural units and their mutual packing were studied and compared from the point of view of the stereoatomic model of crystal structures based on Voronoi-Dirichlet tessellation. Using this method we compared the crystal structures of the triple acetates with Na[UO{sub 2}(CH{sub 3}COO){sub 3}] and [R(H{sub 2}O){sub 6}][UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 2} and proposed reasons of triple acetates stability. Infrared and Raman spectra were collected and their bands were assigned. - Graphical abstract: Single crystals of uranium based triple acetates, analytical reagents for sodium determination, were synthesized and structurally, spectroscopically and topologically characterized. The structures were compared with the structures of compounds from preceding families [M(H{sub 2}O){sub 6})][UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 2} (M = Mg, Co, Ni, Zn) and Na[UO{sub 2}(CH{sub 3}COO){sub 3}]. Analysis was performed with the method of molecular Voronoi-Dirichlet polyhedra to reveal a large contribution of the hydrogen bonds into intermolecular interactions which can be a reason of low solubility of studied complexes.

  11. Crystal structure of thermally reversible maltodextrin gels

    Energy Technology Data Exchange (ETDEWEB)

    Reuther, F.; Schierbaum, F. (Akademie der Wissenschaften der DDR, Potsdam. Zentralinstitut fuer Ernaehrung); Gernat, C.; Damaschun, G. (Akademie der Wissenschaften der DDR, Berlin. Zentralinstitut fuer Molekularbiologie)

    1983-10-05

    Aqueous solutions of starch solidify at room temperature to form thermally irreversible gels. These gels exhibit the wide angle X-ray pattern of B-starch. In thermally reversible gels of a special digestion product of starch the B-pattern of starch is also observed. The property of thermal reversibility therefore is not due to amorphous or different crystalline structures, but is a consequence of smaller macromolecules.

  12. Synthesis, crystal structure and EPR spectra of tetraaquabis(methylisonicotinate) copper(II) disaccharinate single crystal

    Science.gov (United States)

    Çelik, Yunus; Bozkurt, Esat; Uçar, İbrahim; Karabulut, Bünyamin

    2011-10-01

    The crystal structure of the [Cu(mein)2(H2O)4]·(sac)2 complex (mein: methylisonicotinate, sac: saccharine) was investigated by single crystal X-ray diffraction technique. The vibrational spectrum was also discussed in relation with the other compounds containing methylisonicotinate and saccharinate complexes. The EPR spectra of [Cu(mein)2(H2O)4]·(sac)2 single crystal have been studied in the temperature range between 113 and 300 K in three mutually perpendicular planes and exhibit two sets of four hyperfine lines of Cu2+ ion. The ground state wave function of the Cu2+ ion is an admixture of dx2-y2 and dz2 states.

  13. Ultrafast investigations of slow light in photonic crystal structures

    NARCIS (Netherlands)

    Engelen, Rob Jacques Paul

    2008-01-01

    Optical structures with dimensions down to nanometer length scales have been a topic for investigation for an increasing number of researchers, due to their intriguing physical properties and their possible new optical applications. In this thesis, waveguides in two-dimensional photonic crystals are

  14. Effect of domains configuration on crystal structure in ferroelectric ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 40; Issue 6. Effect of domains configuration on crystal structure in ferroelectric ceramics as revealed by XRD and dielectric spectrum. JIWEN XU WEIDONG ZENG QINGNING LI LING YANG CHANGRONG ZHOU. Volume 40 Issue 6 October 2017 pp 1159-1163 ...

  15. synthesis and crystal structure of trinuclear potassium(i)

    African Journals Online (AJOL)

    water molecule. In the crystal structure, intra- and intermolecular hydrogen bonding interactions as well as weak ... high nitrogen content, high energy density, good thermal stability, and low melting point [1–6]. ... as, nitramine or tetrazole-functionalized based furazan had been investigated and were found to have shown.

  16. Crystal structure, characterization and magnetic properties of a 1D ...

    Indian Academy of Sciences (India)

    A new 1D polymeric copper(II) complex [{Cu(L)(CF3COO)}2]n has been synthesized using a potentially tetradentate Schiff base ... 1D copper(II) polymer; Schiff base; crystal structure; electrochemistry; EPR; magnetic properties. 1. Introduction ... number of copper(II) poly-clusters/assemblies may be mentioned in this regard ...

  17. synthesis, crystal structure and antimicrobial activity of a hetero ...

    African Journals Online (AJOL)

    B. S. Chandravanshi

    cyanide N atom. The effects of the complex on the antimicrobial activity against Staphylococcus aureus,. Escherichia coli, and Candida albicans were studied. KEY WORDS: Schiff base, Manganese(III) complex, Iron(II) complex, Heteronuclear, Crystal structure. INTRODUCTION. Schiff bases are a kind of important ligands ...

  18. Synthesis, characterization, X-ray crystal structure, electrochemical ...

    Indian Academy of Sciences (India)

    DOI 10.1007/s12039-015-0978-8. Synthesis, characterization, X-ray crystal structure, electrochemical evaluation and anti-cancer studies of a mixed ligand Cu(II) complex of (E)-N -((2-hydroxynaphthalen-1-yl)methylene)acetohydrazide. IRAN SHEIKHSHOAIEa, S YOUSEF EBRAHIMIPOURa,∗, MAHDIEH SHEIKHSHOAIEa,.

  19. Theoretical study on the molecular and crystal structures of nitrogen ...

    Indian Academy of Sciences (India)

    mainly contributed by the p orbital of N atom and the valence band (HOCO) from the p orbital of F atom. Keywords. Molecular; crystal; structure; property; theoretical study. 1. Introduction ... the global search was confined to these groups only. By analyzing the simulation trajectory of molecular packing within seven space ...

  20. Structural stability and theoretical strength of Cu crystal under equal ...

    Indian Academy of Sciences (India)

    Thus, the Cu film becomes unstable and even changes its morphologies which affects the device manufacturing yield and ultimate reliability. The structural stability and theoretical strength of Cu crystal under equal biaxial loading have been investigated by combining the MAEAM with Milstein-modified Born stability criteria.

  1. Synthesis and Crystal Structures of New 5,5'-Azotetrazolates

    Directory of Open Access Journals (Sweden)

    Gerhard Laus

    2012-03-01

    Full Text Available Five new 5,5'-azotetrazolate salts (amminsilver, trimethylsulfonium, tetramethyl-phosphonium, trimethylsulfoxonium, 2-(hydroxyethyltrimethylammonium were prepared and characterized. The crystal structures were determined by X-ray diffraction. Interactions between the ions are identified and discussed. The sensitivities of the highly energetic silver salt were measured by BAM (Bundesanstalt für Materialforschung und-prüfung methods.

  2. A new method to reconstruct the structure from crystal images

    NARCIS (Netherlands)

    Li, Y

    2017-01-01

    Biological molecules, especially the proteins, have a special and important function. We study their structure to understand their functions, and further make application, like the medical research. The routine method is diffraction, but not work for molecules which cannot grow into crystal and

  3. Crystal structures and atomic model of NADPH oxidase

    NARCIS (Netherlands)

    Magnani, Francesca; Nenci, Simone; Fananas, Elisa Millana; Ceccon, Marta; Romero, Elvira; Fraaije, Marco W.; Mattevi, Andrea

    2017-01-01

    NADPH oxidases (NOXs) are the only enzymes exclusively dedicated to reactive oxygen species (ROS) generation. Dysregulation of these polytopic membrane proteins impacts the redox signaling cascades that control cell proliferation and death. We describe the atomic crystal structures of the catalytic

  4. Crystal structure of the sodium-potassium pump

    DEFF Research Database (Denmark)

    Morth, J Preben; Pedersen, Bjørn Panyella; Toustrup-Jensen, Mads S

    2007-01-01

    The Na+,K+-ATPase generates electrochemical gradients for sodium and potassium that are vital to animal cells, exchanging three sodium ions for two potassium ions across the plasma membrane during each cycle of ATP hydrolysis. Here we present the X-ray crystal structure at 3.5 A resolution of the...

  5. Synthesis, crystal structure and catecholase activity of a Ni (II ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 126; Issue 6. Synthesis, crystal structure and ... The title complex 1 behaves as an effective catalyst towards oxidation of 3,5-ditertiarybutyl catechol (3,5-DTBC) in acetonitrile to its corresponding quinone derivative in air. The reaction follows first-order reaction kinetics ...

  6. Crystal structure, characterization and magnetic properties of a 1D ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 128; Issue 6. Crystal structure, characterization and magnetic properties of a 1D copper(II) polymer incorporating a Schiff base with carboxylate side arm. SHYAMAPADA SHIT MADHUSUDAN NANDY CORRADO RIZZOLI CÉDRIC DESPLANCHES SAMIRAN MITRA.

  7. Syntheses, characterization and crystal structures of potassium and ...

    Indian Academy of Sciences (India)

    Syntheses, characterization and crystal structures of potassium and barium complexes of a Schiff base ligand with different anions. Bhavesh Parmar Kamal Kumar Bisht Pratyush Maiti Parimal Paul Eringathodi Suresh. Special issue on Chemical Crystallography Volume 126 Issue 5 September 2014 pp 1373-1384 ...

  8. Synthesis and crystal structure of trinuclear potassium(I) complex ...

    African Journals Online (AJOL)

    A furazan-based trinuclear potassium(I) complex derived from the oxy-bridged bis(gem-dinitro)furazan (OBNF) and triaminoguanidinium (TGA) units was synthesized and characterized by elemental analyses, nuclear magnetic resonance (NMR) and infrared (IR) spectroscopy. The single crystal X-ray structure of the ...

  9. Syntheses, characterization and crystal structures of potassium and ...

    Indian Academy of Sciences (India)

    Syntheses, characterization and crystal structures of potassium and barium complexes of a Schiff base ligand with different anions. BHAVESH PARMARa, KAMAL KUMAR BISHTa,b, PRATYUSH MAITIc, PARIMAL PAULa,b, and ERINGATHODI SURESHa,b,∗. aAnalytical Discipline and Centralized Instrument Facility, ...

  10. Coefficient of crystal lattice matching as a parameter of substrate - crystal structure compatibility in silumins

    Directory of Open Access Journals (Sweden)

    J. Piątkowski

    2009-07-01

    Full Text Available Adding high-melting point elements (Mo, Nb, Ni, Ti, W to complex silumins results in hardening of the latter ones, owing to the formation of new intermetallic phases of the AlxMey type, with refinement of dendrites in α solution and crystals in β phase. The hardening is also due to the effect of various inoculants. An addition of the inoculant is expected to form substrates, the crystal lattice of which, or some (privileged lattice planes and interatomic spaces should bear a strong resemblance to the crystal nucleus. To verify this statement, using binary phase equilibria systems, the coefficient of crystal lattice matching, being one of the measures of the crystallographic similarity, was calculated. A compatibility of this parameter (up to 20% may decide about the structure compatibility between the substrate and crystal which, in turn, is responsible for the effectiveness of alloy modification. Investigations have proved that, given the temperature range of their formation, the density, the lattice type, and the lattice parameter, some intermetallic phases of the AlxMey type can act as substrates for the crystallisation of aluminium and silicon, and some of the silumin hardening phases.

  11. Domain Structures in Nematic Liquid Crystals on a Polycarbonate Surface

    Directory of Open Access Journals (Sweden)

    Vasily F. Shabanov

    2013-08-01

    Full Text Available Alignment of nematic liquid crystals on polycarbonate films obtained with the use of solvents with different solvations is studied. Domain structures occurring during the growth on the polymer surface against the background of the initial thread-like or schlieren texture are demonstrated. It is established by optical methods that the domains are stable formations visualizing the polymer surface structures. In nematic droplets, the temperature-induced transition from the domain structure with two extinction bands to the structure with four bands is observed. This transition is shown to be caused by reorientation of the nematic director in the liquid crystal volume from the planar alignment to the homeotropic state with the pronounced radial configuration of nematic molecules on the surface. The observed textures are compared with different combinations of the volume LC orientations and the radial distribution of the director field and the disclination lines at the polycarbonate surface.

  12. Band structures in Sierpinski triangle fractal porous phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kai; Liu, Ying, E-mail: yliu5@bjtu.edu.cn; Liang, Tianshu

    2016-10-01

    In this paper, the band structures in Sierpinski triangle fractal porous phononic crystals (FPPCs) are studied with the aim to clarify the effect of fractal hierarchy on the band structures. Firstly, one kind of FPPCs based on Sierpinski triangle routine is proposed. Then the influence of the porosity on the elastic wave dispersion in Sierpinski triangle FPPCs is investigated. The sensitivity of the band structures to the fractal hierarchy is discussed in detail. The results show that the increase of the hierarchy increases the sensitivity of ABG (Absolute band gap) central frequency to the porosity. But further increase of the fractal hierarchy weakens this sensitivity. On the same hierarchy, wider ABGs could be opened in Sierpinski equilateral triangle FPPC; whilst, a lower ABG could be opened at lower porosity in Sierpinski right-angled isosceles FPPCs. These results will provide a meaningful guidance in tuning band structures in porous phononic crystals by fractal design.

  13. The genes encoding the DNA binding protein and the 23K protease of adenovirus types 40 and 41.

    Science.gov (United States)

    Vos, H L; van der Lee, F M; Reemst, A M; van Loon, A E; Sussenbach, J S

    1988-03-01

    The adenovirus (Ad) single-stranded DNA binding protein (DBP) is a multifunctional protein. It is thought to consist of two domains, the amino-terminal domain involved in host-range determination and the carboxyl-terminal domain functioning in DNA replication and DNA binding. We have determined the nucleotide sequences of the DBP genes of Ad40 and Ad41, two human adenoviral serotypes that differ significantly from other adenoviruses. Regions of structural and functional importance in the corresponding proteins could be identified by comparison of the amino acid sequences with those of other known DBPs. In addition, the nucleotide sequences of the DBP early promoters, of the 23K protease genes, and of parts of the hexon and 100K protein genes have been determined. It can be deduced from the nucleotide sequences, that the Ad40 and Ad41 DBPs are relatively small (473 and 474 amino acids (a.a.), respectively, versus 529 a.a. for the Ad5 DBP). This is caused by the presence of very small amino-terminal domains of 119 a.a. (Ad40) and 120 a.a. (Ad41), as compared to 173 a.a. for the corresponding Ad5 domain. Only a few amino acids in this domain have been conserved in all known DBPs. The carboxyl-terminal domains show a higher degree of sequence conservation. In this domain, four strongly conserved regions can be identified, one of which might form a metal-binding site. The 23K proteases of both Ad40 and Ad41 show a strong homology to the Ad2 and Ad5 proteins, with the exception of the carboxyl-terminal end of the proteins. The 23K protease gene of Ad41 has an open reading frame that extends beyond the polyadenylation signal, in contrast to the Ad40 gene that ends well in front of the signal.

  14. Structural evolution in the crystallization of rapid cooling silver melt

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Z.A., E-mail: ze.tian@gmail.com [School of Physics and Electronics, Hunan University, Changsha 410082 (China); Laboratory for Simulation and Modelling of Particulate Systems School of Materials Science and Engineering, University of New South Wales, Sydney, NSW 2052 (Australia); Dong, K.J.; Yu, A.B. [Laboratory for Simulation and Modelling of Particulate Systems School of Materials Science and Engineering, University of New South Wales, Sydney, NSW 2052 (Australia)

    2015-03-15

    The structural evolution in a rapid cooling process of silver melt has been investigated at different scales by adopting several analysis methods. The results testify Ostwald’s rule of stages and Frank conjecture upon icosahedron with many specific details. In particular, the cluster-scale analysis by a recent developed method called LSCA (the Largest Standard Cluster Analysis) clarified the complex structural evolution occurred in crystallization: different kinds of local clusters (such as ico-like (ico is the abbreviation of icosahedron), ico-bcc like (bcc, body-centred cubic), bcc, bcc-like structures) in turn have their maximal numbers as temperature decreases. And in a rather wide temperature range the icosahedral short-range order (ISRO) demonstrates a saturated stage (where the amount of ico-like structures keeps stable) that breeds metastable bcc clusters. As the precursor of crystallization, after reaching the maximal number bcc clusters finally decrease, resulting in the final solid being a mixture mainly composed of fcc/hcp (face-centred cubic and hexagonal-closed packed) clusters and to a less degree, bcc clusters. This detailed geometric picture for crystallization of liquid metal is believed to be useful to improve the fundamental understanding of liquid–solid phase transition. - Highlights: • A comprehensive structural analysis is conducted focusing on crystallization. • The involved atoms in our analysis are more than 90% for all samples concerned. • A series of distinct intermediate states are found in crystallization of silver melt. • A novelty icosahedron-saturated state breeds the metastable bcc state.

  15. Crystal structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Meiying; Cooper, David; Grossoehmerb, Nickolas; Yu, Minmin; Hung, Li-Wei; Cieslik, Murcin; Derewendaro, Urszula; Lesley, Scott; Wilson, Ian; Giedrocb, David; Derewenda, Zygmunt

    2009-06-06

    The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged helix (WH) DNA-binding domains and diverse C-terminal, regulatory domains, which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all a-helical regulatory domains classified into two related Pfam families: FadR{_}C and FCD. Only two crystal structures of the FadR family members, i.e. the E. coli FadR protein and the LldR from C. glutamicum, have been described to date in literature. Here we describe the crystal structure of TM0439, a GntR regulator with an FCD domain, found in the Thermotoga maritima genome. The FCD domain is similar to that of the LldR regulator, and contains a buried metal binding site. Using atomic absorption spectroscopy and Trp fluorescence, we show that the recombinant protein contains bound Ni{sup 2+} ions, but it is able to bind Zn{sup 2+} with K{sub D} < 70 nM . We conclude that Zn{sup 2+} is the likely physiological metal, where it may perform either or both structural and regulatory roles. Finally, we compare the TM0439 structure to two other FadR family structures recently deposited by Structural Genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.

  16. Crystal structure of 1-methylimidazole 3-oxide monohydrate

    Directory of Open Access Journals (Sweden)

    Christopher S. Frampton

    2017-03-01

    Full Text Available 1-Methylimidazole 3-N-oxide (NMI-O crystallizes as a monohydrate, C4H6N2O·H2O, in the monoclinic space group P21 with Z′ = 2 (molecules A and B. The imidazole rings display a planar geometry (r.m.s. deviations = 0.0008 and 0.0002 Å and are linked in the crystal structure into infinite zigzag strands of ...NMI-O(A...OH2...NMI-O(B...OH2... units by O—H...O hydrogen bonds. These chains propagate along the b-axis direction of the unit cell.

  17. A novel structure of gel grown strontium cyanurate crystal and its structural, optical, electrical characterization

    Science.gov (United States)

    Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Gopakumar, N.; Babu, K. Rajendra

    2017-12-01

    Strontium cyanurate crystals with novel structure and unique optical property like mechanoluminescence have been grown by conventional gel method. Transparent crystals were obtained. The single crystal X-ray diffraction analysis reveals the exquisite structure of the grown crystal. The crystal is centrosymmetric and has a three dimensional polymeric structure. The powder X ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal were identified by Fourier transform infrared spectroscopy. Elemental analysis confirmed the composition of the complex. A study of thermal properties was done by thermo gravimetric analysis and differential thermal analysis. The optical properties like band gap, refractive index and extinction coefficient were evaluated from the UV visible spectral analysis. The etching study was done to reveal the dislocations in the crystal which in turn explains mechanoluminescence emission. The mechanoluminescence property exhibited by the crystal makes it suitable for stress sensing applications. Besides being a centrosymmetric crystal, it also exhibits NLO behavior. Dielectric properties were studied and theoretical calculations of Fermi energy, valence electron plasma energy, penn gap and polarisability have been done.

  18. Crystal Structure of Triosephosphate Isomerase from Trypanosoma cruzi in Hexane

    Science.gov (United States)

    Gao, Xiu-Gong; Maldonado, Ernesto; Perez-Montfort, Ruy; Garza-Ramos, Georgina; Tuena de Gomez-Puyou, Marietta; Gomez-Puyou, Armando; Rodriguez-Romero, Adela

    1999-08-01

    To gain insight into the mechanisms of enzyme catalysis in organic solvents, the x-ray structure of some monomeric enzymes in organic solvents was determined. However, it remained to be explored whether the structure of oligomeric proteins is also amenable to such analysis. The field acquired new perspectives when it was proposed that the x-ray structure of enzymes in nonaqueous media could reveal binding sites for organic solvents that in principle could represent the starting point for drug design. Here, a crystal of the dimeric enzyme triosephosphate isomerase from the pathogenic parasite Trypanosoma cruzi was soaked and diffracted in hexane and its structure solved at 2- angstrom resolution. Its overall structure and the dimer interface were not altered by hexane. However, there were differences in the orientation of the side chains of several amino acids, including that of the catalytic Glu-168 in one of the monomers. No hexane molecules were detected in the active site or in the dimer interface. However, three hexane molecules were identified on the surface of the protein at sites, which in the native crystal did not have water molecules. The number of water molecules in the hexane structure was higher than in the native crystal. Two hexanes localized at <4 angstrom from residues that form the dimer interface; they were in close proximity to a site that has been considered a potential target for drug design.

  19. Crystal structure and magnetism of UOsAl

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, A.V., E-mail: andreev@fzu.cz [Institute of Physics, Academy of Sciences, Na Slovance 2, 182 21 Prague (Czech Republic); Daniš, S. [Department of Condensed Matter Physics, Charles University, Ke Karlovu 5, 121 16 Prague (Czech Republic); Šebek, J.; Henriques, M.S.; Vejpravová, J. [Institute of Physics, Academy of Sciences, Na Slovance 2, 182 21 Prague (Czech Republic); Gorbunov, D.I. [Institute of Physics, Academy of Sciences, Na Slovance 2, 182 21 Prague (Czech Republic); Dresden High Magnetic Field Laboratory (HLD-EMFL), Helmholtz-Zentrum, Dresden-Rossendorf, D-01314 Dresden (Germany); Havela, L. [Department of Condensed Matter Physics, Charles University, Ke Karlovu 5, 121 16 Prague (Czech Republic)

    2017-04-15

    Crystal structure, magnetization, and specific heat were studied on single crystal of uranium intermetallic compound UOsAl. It is a hexagonal Laves phase of MgZn{sub 2} type, space group P6{sub 3}/mmc, with lattice parameters a=536.4 pm, c=845.3 pm. Shortest inter-uranium distance 313 pm (along the c-axis) is considerably smaller than the Hill limit (340 pm). The compound is a weakly temperature-dependent paramagnet with magnetic susceptibility of ≈1.5*10{sup −8} m{sup 3} mol{sup −1} (at T=2 K), which is slightly higher with magnetic field along the a-axis compared to the c-axis. The Sommerfeld coefficient of electronic specific heat has moderate value of γ=36 mJ mol{sup −1} K{sup −2}. - Highlights: • Crystal structure and magnetic properties were studied on single crystal of UOsAl with hexagonal structure of MgZn{sub 2} type. • Shortest inter-uranium distance 313 pm (along the c-axis) is considerably smaller than the Hill limit (340 pm). • UOsAl has paramagnetic ground state as the compounds with T=Fe and Ru, i.e. 3d and 4d analogues of Os.

  20. Icosahedral symmetry described by an incommensurately modulated crystal structure model

    DEFF Research Database (Denmark)

    Wolny, Janusz; Lebech, Bente

    1986-01-01

    A crystal structure model of an incommensurately modulated structure is presented. Although six different reciprocal vectors are used to describe the model, all calculations are done in three dimensions making calculation of the real-space structure trivial. Using this model, it is shown that both...... the positions of the bragg reflections and information about the relative intensities of these reflections are in full accordance with the diffraction patterns reported for microcrystals of the rapidly quenched Al86Mn14 alloy. It is also shown that at least the local structure possesses full icosahedral...

  1. Intermetallic crystal structures as foams. Beyond Frank-Kasper.

    Science.gov (United States)

    Bonneau, Charlotte; O'Keeffe, Michael

    2015-02-02

    In many intermetallic structures, the atoms and bonds divide space into tilings by tetrahedra. The well-known Frank-Kasper phases are examples. The dual tilings divide space into a tiling by polyhedra that is topologically a foam. The number of faces of the dual polyhedron corresponds to the atom coordination number in the direct structure, and face sharing by adjacent polyhedra corresponds to bonds in the direct structure. A number of commonly occurring intermetallic crystal structures are shown as their duals. A major advantage of this alternative mode of depiction is that coordination of all of the atoms can be seen simultaneously.

  2. Statistical-mechanical lattice models for protein-DNA binding in chromatin

    CERN Document Server

    Teif, Vladimir B

    2010-01-01

    Statistical-mechanical lattice models for protein-DNA binding are well established as a method to describe complex ligand binding equilibriums measured in vitro with purified DNA and protein components. Recently, a new field of applications has opened up for this approach since it has become possible to experimentally quantify genome-wide protein occupancies in relation to the DNA sequence. In particular, the organization of the eukaryotic genome by histone proteins into a nucleoprotein complex termed chromatin has been recognized as a key parameter that controls the access of transcription factors to the DNA sequence. New approaches have to be developed to derive statistical mechanical lattice descriptions of chromatin-associated protein-DNA interactions. Here, we present the theoretical framework for lattice models of histone-DNA interactions in chromatin and investigate the (competitive) DNA binding of other chromosomal proteins and transcription factors. The results have a number of applications for quant...

  3. Twinning structures in near-stoichiometric lithium niobate single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Shuhua; Chen, Yanfeng [Nanjing Univ. (China). Dept. of Materials Science and Engineering; Hu, Xiaobo; Yan, Tan; Liu, Hong; Wang, Jiyang [Shandong Univ., Jinan (China). State Key Lab. of Crystal Materials; Qin, Xiaoyong [Deqing Huaying Electronics Co. (China)

    2010-04-15

    A near-stoichiometric lithium niobate single crystal has been grown by the Czochralski method in a hanging double crucible with a continuous powder supply system. Twins were found at one of the three characteristic growth ridges of the as-grown crystal. The twin structure was observed and analyzed by transmission synchrotron topography. The image shifts {delta}X and {delta}Y in the transmission synchrotron topograph were calculated for the 3 anti 2 anti 12 and 0 anti 222 reflections based on results from high-resolution X-ray diffractometry. It is confirmed that one of the {l_brace}01 anti 1 anti 2{r_brace}{sub m} planes is the composition face of the twin and matrix crystals. The formation mechanism of these twins is discussed. (orig.)

  4. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    Energy Technology Data Exchange (ETDEWEB)

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  5. Delineation of Methyl-DNA Binding Protein Interactions in the Prostate Cancer Genome (PC110091)

    Science.gov (United States)

    2014-03-01

    association regions or sites for each protein. The genes that overlap these common sites were identified and the genes among these with increased or decreased...regions, a major difference from “typical” DNA-binding proteins such as CREB or C/EBP which bind relatively small and discrete recognition sites ...from three matched sets of malignant prostate cancer and normal/benign prostate tissue were sequenced using the Ion Torrent (Life Technologies

  6. BRCA1 DNA-binding activity is stimulated by BARD1.

    Science.gov (United States)

    Simons, Amanda M; Horwitz, Andrew A; Starita, Lea M; Griffin, Karen; Williams, R Scott; Glover, J N Mark; Parvin, Jeffrey D

    2006-02-15

    The breast- and ovarian-specific tumor suppressor BRCA1 has been implicated in numerous cellular processes, including transcription, ubiquitination, and DNA repair. Its tumor suppression activity is tightly linked to that of BARD1, a protein that heterodimerizes with BRCA1. It has been previously shown that BRCA1 binds to DNA, an interesting functional observation in light of the genetic data linking BRCA1 to DNA repair pathways. In this work, we reexamine the DNA-binding properties of BRCA1, comparing them with the DNA-binding properties of the BRCA1/BARD1 heterodimer. Because nuclear BRCA1 exists as a heterodimer with BARD1, it is likely that in vitro studies of the heterodimer will provide a more accurate model of physiologic conditions. Our results indicate that whereas BARD1 cannot directly bind DNA, it does enhance DNA binding by BRCA1. This is a surprising observation as both DNA-binding domains are distal to the BARD1-interacting RING domain of BRCA1. Further analysis of the dimerization reveals that the BRCA1/BARD1 interaction is not limited to the amino-terminal RING domains of each protein. The carboxyl terminus of BRCA1 contributes significantly to the stability of the heterodimer. We also show that the presence of BARD1 has a secondary effect, as autoubiquitination of BRCA1/BARD1 heterodimers additionally enhances the affinity of BRCA1 for DNA. Together, these data suggest that BRCA1 and BARD1 heterodimerization is stabilized via domains not previously thought to interact and that BARD1 acts in both ubiquitination-dependent and ubiquitination-independent ways to influence the role of BRCA1 in DNA repair.

  7. Is the methanation reaction over Ru single crystals structure dependent?

    Science.gov (United States)

    Vendelbo, Søren B; Johansson, Martin; Nielsen, Jane H; Chorkendorff, Ib

    2011-03-14

    The influence of monoatomic steps and defects on the methanation reaction over ruthenium has been investigated. The experiments are performed on a Ru(0 1 54) ruthenium single crystal, which contains one monoatomic step atom for each 27 terrace atoms. The methanation activity is measured at one bar of hydrogen and CO in a high pressure cell, which enables simultaneous measurements of the local reactivity of the well defined single crystal surface and the global reactivity of the entire crystal and its auxiliary support. By adding sulfur we observe that the measured activity from the well defined stepped front-side of the crystal is poisoned faster than the entire crystal containing more defects. We also observe that additional sputtering of the well-defined front-side increases the reactivity measured on the surface. Based on this, we conclude that the methanation reaction takes place on undercoordinated sites, such as steps and kinks, and that the methanation reaction is extremely structure dependent. Simulations of the flow, temperature, and product distributions in the high pressure cell are furthermore presented as supplementary information.

  8. Two new bismuth thiourea bromides: crystal structure, growth, and characterization.

    Science.gov (United States)

    Li, Ming; Li, R K

    2014-02-14

    Crystals of two new bismuth thiourea bromides, bismuth trithiourea bromide (Bi[CS(NH2)2]3Br3, BTB) and bismuth protonated-hexathiourea bromide (Bi[CS(NH2)2H]6Br9, BHB), have been successfully grown from hydrobromic acid solution with different pH values by slow evaporation. Single crystal X-ray diffraction reveals that BTB is isostructural to its Cl-analog crystallizing in a monoclinic space group Cc with unit cell dimensions of a = 8.6238(7) Å, b = 12.2506(11) Å, c = 15.5040(13) Å, β = 90.7810(10)° and Z = 4. In contrast, BHB crystallizes in a trigonal space group R3[combining macron]c with unit cell dimensions of a = b = 12.748(17) Å, c = 40.45(11) Å, and Z = 6. The protonation of the thiourea in BHB is confirmed by the structure solution, IR and Raman spectroscopy. The UV diffuse reflection spectra clearly indicate that both of the two crystals have good optical transparency in the range below 2000 nm. Both compounds decompose above 190 °C, and BHB melts at around 140 °C while BTB possesses a phase transition at 145 °C as indicated by thermogravimetric (TG) and differential thermal analysis (DTA).

  9. Crystal structure and mechanistic investigation of the twister ribozyme.

    Science.gov (United States)

    Liu, Yijin; Wilson, Timothy J; McPhee, Scott A; Lilley, David M J

    2014-09-01

    We present a crystal structure at 2.3-Å resolution of the recently described nucleolytic ribozyme twister. The RNA adopts a previously uncharacterized compact fold based on a double-pseudoknot structure, with the active site at its center. Eight highly conserved nucleobases stabilize the core of the ribozyme through the formation of one Watson-Crick and three noncanonical base pairs, and the highly conserved adenine 3' of the scissile phosphate is bound in the major groove of an adjacent pseudoknot. A strongly conserved guanine nucleobase directs its Watson-Crick edge toward the scissile phosphate in the crystal structure, and mechanistic evidence supports a role for this guanine as either a general base or acid in a concerted, general acid-base-catalyzed cleavage reaction.

  10. Discovering protein–DNA binding sequence patterns using association rule mining

    Science.gov (United States)

    Wong, Ka-Chun; Chan, Tak-Ming; Wong, Man-Hon; Lee, Kin-Hong; Lau, Chi-Kong; Tsui, Stephen K. W.

    2010-01-01

    Protein–DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play an essential role in transcriptional regulation. Over the past decades, significant efforts have been made to study the principles for protein–DNA bindings. However, it is considered that there are no simple one-to-one rules between amino acids and nucleotides. Many methods impose complicated features beyond sequence patterns. Protein-DNA bindings are formed from associated amino acid and nucleotide sequence pairs, which determine many functional characteristics. Therefore, it is desirable to investigate associated sequence patterns between TFs and TFBSs. With increasing computational power, availability of massive experimental databases on DNA and proteins, and mature data mining techniques, we propose a framework to discover associated TF–TFBS binding sequence patterns in the most explicit and interpretable form from TRANSFAC. The framework is based on association rule mining with Apriori algorithm. The patterns found are evaluated by quantitative measurements at several levels on TRANSFAC. With further independent verifications from literatures, Protein Data Bank and homology modeling, there are strong evidences that the patterns discovered reveal real TF–TFBS bindings across different TFs and TFBSs, which can drive for further knowledge to better understand TF–TFBS bindings. PMID:20529874

  11. Functional importance of the DNA binding activity of Candida albicans Czf1p.

    Directory of Open Access Journals (Sweden)

    Ivana Petrovska

    Full Text Available The human opportunistic pathogen Candida albicans undergoes a reversible morphological transition between the yeast and hyphal states in response to a variety of signals. One such environmental trigger is growth within a semisolid matrix such as agar medium. This growth condition is of interest because it may mimic the growth of C. albicans in contact with host tissue during infection. During growth within a semisolid matrix, hyphal growth is positively regulated by the transcriptional regulator Czf1p and negatively by a second key transcriptional regulator, Efg1p. Genetic studies indicate that Czf1p, a member of the zinc-cluster family of transcriptional regulators, exerts its function by opposing the inhibitory influence of Efg1p on matrix-induced filamentous growth. We examined the importance of the two known activities of Czf1p, DNA-binding and interaction with Efg1p. We found that the two activities were separable by mutation allowing us to demonstrate that the DNA-binding activity of Czf1p was essential for its role as a positive regulator of morphogenesis. Surprisingly, however, interactions with Efg1p appeared to be largely dispensable. Our studies provide the first evidence of a key role for the DNA-binding activity of Czf1p in the morphological yeast-to-hyphal transition triggered by matrix-embedded growth.

  12. Halenaquinone, a chemical compound that specifically inhibits the secondary DNA binding of RAD51.

    Science.gov (United States)

    Takaku, Motoki; Kainuma, Takashi; Ishida-Takaku, Takako; Ishigami, Shintaro; Suzuki, Hidekazu; Tashiro, Satoshi; van Soest, Rob W M; Nakao, Yoichi; Kurumizaka, Hitoshi

    2011-04-01

    Mutations and single-nucleotide polymorphisms affecting RAD51 gene function have been identified in several tumors, suggesting that the inappropriate expression of RAD51 activity may cause tumorigenesis. RAD51 is an essential enzyme for the homologous recombinational repair (HRR) of DNA double-strand breaks. In the HRR pathway, RAD51 catalyzes the homologous pairing between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), which is the central step of the HRR pathway. To identify a chemical compound that regulates the homologous-pairing activity of RAD51, in the present study, we screened crude extract fractions from marine sponges by the RAD51-mediated homologous-pairing assay. Halenaquinone was identified as an inhibitor of the RAD51 homologous-pairing activity. A surface plasmon resonance analysis indicated that halenaquinone directly bound to RAD51. Intriguingly, halenaquinone specifically inhibited dsDNA binding by RAD51 alone or the RAD51-ssDNA complex, but only weakly affected the RAD51-ssDNA binding. In vivo, halenaquinone significantly inhibited the retention of RAD51 at double-strand break sites. Therefore, halenaquinone is a novel type of RAD51 inhibitor that specifically inhibits the RAD51-dsDNA binding. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  13. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  14. Effects of copper ions on DNA binding and cytotoxic activity of a chiral salicylidene Schiff base.

    Science.gov (United States)

    Fei, Bao-Li; Xu, Wu-Shuang; Tao, Hui-Wen; Li, Wen; Zhang, Yu; Long, Jian-Ying; Liu, Qing-Bo; Xia, Bing; Sun, Wei-Yin

    2014-03-05

    A chiral Schiff base HL N-(5-bromo-salicylaldehyde)dehydroabietylamine (1) and its chiral dinuclear copper complex [Cu2L4]·4DMF (2) have been synthesized and fully characterized. The interactions of 1 and 2 with salmon sperm DNA have been investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral (Kb=3.30 × 10(5)M(-)(1) (1), 6.63 × 10(5)M(-)(1)(2)), emission spectral (Ksv=7.58 × 10(3)M(-)(1) (1), 1.52 × 10(4)M(-)(1) (2)), and viscosity measurements reveal that 1 and 2 interact with DNA through intercalation and 2 exhibits a higher DNA binding ability. In addition, CD study indicates 2 cause a more evident perturbation on the base stacking and helicity of B-DNA upon binding to it. In fluorimetric studies, the enthalpy (ΔH>0) and entropy (ΔS>0) changes of the reactions between the compounds with DNA demonstrate hydrophobic interactions. 1 and 2 were also screened for their cytotoxic ability and 2 demonstrates higher growth inhibition of the selected cancer cells at concentration of 50 μM, this result is identical with their DNA binding ability order. All the experimental results show that the involvement of Cu (II) centers has some interesting effect on DNA binding ability and cytotoxicity of the chiral Schiff base. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Multiple DNA binding proteins contribute to timing of chromosome replication in E. coli

    DEFF Research Database (Denmark)

    Riber, Leise; Frimodt-Møller, Jakob; Charbon, Godefroid

    2016-01-01

    Chromosome replication in Escherichia coli is initiated from a single origin, oriC. Initiation involves a number of DNA binding proteins, but only DnaA is essential and specific for the initiation process. DnaA is an AAA+ protein that binds both ATP and ADP with similar high affinities. Dna...... replication is initiated, or the time window in which all origins present in a single cell are initiated, i.e. initiation synchrony, or both. Overall, these DNA binding proteins modulate the initiation frequency from oriC by: (i) binding directly to oriC to affect DnaA binding, (ii) altering the DNA topology...... in or around oriC, (iii) altering the nucleotide bound status of DnaA by interacting with non-coding chromosomal sequences, distant from oriC, that are important for DnaA activity. Thus, although DnaA is the key protein for initiation of replication, other DNA-binding proteins act not only on ori...

  16. Determination of organic crystal structures by X ray powder diffraction

    CERN Document Server

    McBride, L

    2000-01-01

    The crystal structure of Ibuprofen has been solved from synchrotron X-ray powder diffraction data using a genetic algorithm (GA). The performance of the GA is improved by incorporating prior chemical information in the form of hard limits on the values that can be taken by the flexible torsion angles within the molecule. Powder X-ray diffraction data were collected for the anti-convulsant compounds remacemide, remacemide nitrate and remacemide acetate at 130 K on BM 16 at the X-ray European Synchrotron Radiation Facility (ESRF) at Grenoble. High quality crystal structures were obtained using data collected to a resolution of typically 1.5 A. The structure determinations were performed using a simulated annealing (SA) method and constrained Rietveld refinements for the structures converged to chi sup 2 values of 1.64, 1.84 and 1.76 for the free base, nitrate and acetate respectively. The previously unknown crystal structure of the drug famotidine Form B has been solved using X-ray powder diffraction data colle...

  17. Intermolecular force field development and crystal structure prediction

    Science.gov (United States)

    Gao, Daquan

    1998-11-01

    Chapter 1 is a general introduction for the following chapters that include three journal articles. Chapter 2 deals with force field development about a particular compound, Cl2. The crystal structure of Cl2 has been simulated by an isotropic force field that includes polar flattening of the Cl atom and a 5-center distributed monopole model. Polar flattening is achieved by moving the repulsion center toward the molecular center, which induces the short contact. The 5- center distributed monopole represents the molecular electrical potential that dictates the molecular orientation in the cell. This intermolecular force field can approximate the correct space group symmetry of solid state chlorine. Chapter 3 reports the implementation of a systematic way of developing intermolecular force field parameters. Intermolecular atom-atom force field parameters of the (exp-6-1) type for boron and hydrogen atoms in boron hydrides were determined. Using the resulting force field, minimum energy crystal structures were found with structural parameter values close to those of the observed structures. Chapter 4 discusses the new finding on space groups. Relationships between space groups, molecular symmetry and site symmetry, and molecular packing groups are treated. The number of molecules in the cell, Z, is the same as the order of the molecular packing group. The order of the space group is equal to or greater than Z depending upon the site symmetry of the molecular position. Several examples of application of this packing group treatment to ab initio crystal structure predictions are given.

  18. Rigidity analysis of protein biological assemblies and periodic crystal structures

    Science.gov (United States)

    2013-01-01

    Background We initiate in silico rigidity-theoretical studies of biological assemblies and small crystals for protein structures. The goal is to determine if, and how, the interactions among neighboring cells and subchains affect the flexibility of a molecule in its crystallized state. We use experimental X-ray crystallography data from the Protein Data Bank (PDB). The analysis relies on an effcient graph-based algorithm. Computational experiments were performed using new protein rigidity analysis tools available in the new release of our KINARI-Web server http://kinari.cs.umass.edu. Results We provide two types of results: on biological assemblies and on crystals. We found that when only isolated subchains are considered, structural and functional information may be missed. Indeed, the rigidity of biological assemblies is sometimes dependent on the count and placement of hydrogen bonds and other interactions among the individual subchains of the biological unit. Similarly, the rigidity of small crystals may be affected by the interactions between atoms belonging to different unit cells. We have analyzed a dataset of approximately 300 proteins, from which we generated 982 crystals (some of which are biological assemblies). We identified two types of behaviors. (a) Some crystals and/or biological assemblies will aggregate into rigid bodies that span multiple unit cells/asymmetric units. Some of them create substantially larger rigid cluster in the crystal/biological assembly form, while in other cases, the aggregation has a smaller effect just at the interface between the units. (b) In other cases, the rigidity properties of the asymmetric units are retained, because the rigid bodies did not combine. We also identified two interesting cases where rigidity analysis may be correlated with the functional behavior of the protein. This type of information, identified here for the first time, depends critically on the ability to create crystals and biological assemblies

  19. Crystal structure of 8-hydroxyquinoline: a new monoclinic polymorph

    Directory of Open Access Journals (Sweden)

    Raúl Castañeda

    2014-09-01

    Full Text Available In an attempt to grow 8-hydroxyquinoline–acetaminophen co-crystals from equimolar amounts of conformers in a chloroform–ethanol solvent mixture at room temperature, the title compound, C9H7NO, was obtained. The molecule is planar, with the hydroxy H atom forming an intramolecular O—H...N hydrogen bond. In the crystal, molecules form centrosymmetric dimers via two O—H...N hydrogen bonds. Thus, the hydroxy H atoms are involved in bifurcated O—H...N hydrogen bonds, leading to the formation of a central planar four-membered N2H2 ring. The dimers are bound by intermolecular π–π stacking [the shortest C...C distance is 3.2997 (17 Å] and C—H...π interactions into a three-dimensional framework. The crystal grown represents a new monoclinic polymorph in the space group P21/n. The molecular structure of the present monoclinic polymorph is very similar to that of the orthorhombic polymorph (space group Fdd2 studied previously [Roychowdhury et al. (1978. Acta Cryst. B34, 1047–1048; Banerjee & Saha (1986. Acta Cryst. C42, 1408–1411]. The structures of the two polymorphs are distinguished by the different geometries of the hydrogen-bonded dimers, which in the crystal of the orthorhombic polymorph possess twofold axis symmetry, with the central N2H2 ring adopting a butterfly conformation.

  20. Crystal growth, crystal structure, vibrational spectroscopy, linear and nonlinear optical properties of guanidinium phosphates

    Science.gov (United States)

    Němec, Ivan; Matulková, Irena; Held, Peter; Kroupa, Jan; Němec, Petr; Li, Dongxu; Bohatý, Ladislav; Becker, Petra

    2017-07-01

    Of the three guanidinium phosphates GuH2PO4 (space group P21/c), Gu2HPO4·H2O (space group P 4 bar 21 c) and Gu3PO4· 3/2 H2O (space group Cc) crystal structures and a vibrational spectroscopy study are presented. Large single crystals of GuH2PO4 and Gu2HPO4·H2O are grown. Refractive indices and their dispersion in the wavelength range 365 nm - 1083 nm are determined and used for the analysis of phase matching conditions for collinear SHG in the case of the non-centrosymmetric crystals of Gu2HPO4·H2O. The crystals are not phase-matchable within their transmission range. Both independent components of the SHG tensor of Gu2HPO4·H2O, determined by the Maker fringe method, are given, with d14 = 0.23 pm/V and d36 = 0.22 pm/V. In addition, the thermal stability and the anisotropy of thermal expansion of GuH2PO4 and Gu2HPO4·H2O is reported.

  1. Crystal structure of four-stranded Oxytricha telomeric DNA

    Science.gov (United States)

    Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A.

    1992-01-01

    The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.

  2. Crystal structure optimisation using an auxiliary equation of state

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Adam J.; Skelton, Jonathan M.; Hendon, Christopher H.; Butler, Keith T. [Centre for Sustainable Chemical Technologies and Department of Chemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom); Walsh, Aron, E-mail: a.walsh@bath.ac.uk [Centre for Sustainable Chemical Technologies and Department of Chemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom); Global E" 3 Institute and Department of Materials Science and Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2015-11-14

    Standard procedures for local crystal-structure optimisation involve numerous energy and force calculations. It is common to calculate an energy–volume curve, fitting an equation of state around the equilibrium cell volume. This is a computationally intensive process, in particular, for low-symmetry crystal structures where each isochoric optimisation involves energy minimisation over many degrees of freedom. Such procedures can be prohibitive for non-local exchange-correlation functionals or other “beyond” density functional theory electronic structure techniques, particularly where analytical gradients are not available. We present a simple approach for efficient optimisation of crystal structures based on a known equation of state. The equilibrium volume can be predicted from one single-point calculation and refined with successive calculations if required. The approach is validated for PbS, PbTe, ZnS, and ZnTe using nine density functionals and applied to the quaternary semiconductor Cu{sub 2}ZnSnS{sub 4} and the magnetic metal-organic framework HKUST-1.

  3. Crystal structure optimisation using an auxiliary equation of state.

    Science.gov (United States)

    Jackson, Adam J; Skelton, Jonathan M; Hendon, Christopher H; Butler, Keith T; Walsh, Aron

    2015-11-14

    Standard procedures for local crystal-structure optimisation involve numerous energy and force calculations. It is common to calculate an energy-volume curve, fitting an equation of state around the equilibrium cell volume. This is a computationally intensive process, in particular, for low-symmetry crystal structures where each isochoric optimisation involves energy minimisation over many degrees of freedom. Such procedures can be prohibitive for non-local exchange-correlation functionals or other "beyond" density functional theory electronic structure techniques, particularly where analytical gradients are not available. We present a simple approach for efficient optimisation of crystal structures based on a known equation of state. The equilibrium volume can be predicted from one single-point calculation and refined with successive calculations if required. The approach is validated for PbS, PbTe, ZnS, and ZnTe using nine density functionals and applied to the quaternary semiconductor Cu2ZnSnS4 and the magnetic metal-organic framework HKUST-1.

  4. Crystal structure optimisation using an auxiliary equation of state

    Science.gov (United States)

    Jackson, Adam J.; Skelton, Jonathan M.; Hendon, Christopher H.; Butler, Keith T.; Walsh, Aron

    2015-11-01

    Standard procedures for local crystal-structure optimisation involve numerous energy and force calculations. It is common to calculate an energy-volume curve, fitting an equation of state around the equilibrium cell volume. This is a computationally intensive process, in particular, for low-symmetry crystal structures where each isochoric optimisation involves energy minimisation over many degrees of freedom. Such procedures can be prohibitive for non-local exchange-correlation functionals or other "beyond" density functional theory electronic structure techniques, particularly where analytical gradients are not available. We present a simple approach for efficient optimisation of crystal structures based on a known equation of state. The equilibrium volume can be predicted from one single-point calculation and refined with successive calculations if required. The approach is validated for PbS, PbTe, ZnS, and ZnTe using nine density functionals and applied to the quaternary semiconductor Cu2ZnSnS4 and the magnetic metal-organic framework HKUST-1.

  5. Structural evolution in the crystallization of rapid cooling silver melt

    Science.gov (United States)

    Tian, Z. A.; Dong, K. J.; Yu, A. B.

    2015-03-01

    The structural evolution in a rapid cooling process of silver melt has been investigated at different scales by adopting several analysis methods. The results testify Ostwald's rule of stages and Frank conjecture upon icosahedron with many specific details. In particular, the cluster-scale analysis by a recent developed method called LSCA (the Largest Standard Cluster Analysis) clarified the complex structural evolution occurred in crystallization: different kinds of local clusters (such as ico-like (ico is the abbreviation of icosahedron), ico-bcc like (bcc, body-centred cubic), bcc, bcc-like structures) in turn have their maximal numbers as temperature decreases. And in a rather wide temperature range the icosahedral short-range order (ISRO) demonstrates a saturated stage (where the amount of ico-like structures keeps stable) that breeds metastable bcc clusters. As the precursor of crystallization, after reaching the maximal number bcc clusters finally decrease, resulting in the final solid being a mixture mainly composed of fcc/hcp (face-centred cubic and hexagonal-closed packed) clusters and to a less degree, bcc clusters. This detailed geometric picture for crystallization of liquid metal is believed to be useful to improve the fundamental understanding of liquid-solid phase transition.

  6. Crystal structure of N′-hydroxypyrimidine-2-carboximidamide

    Directory of Open Access Journals (Sweden)

    Nithianantham Jeeva Jasmine

    2014-10-01

    Full Text Available The title compound, C5H6N4O, is approximately planar, with an angle of 11.04 (15° between the planes of the pyrimidine ring and the non-H atoms of the carboximidamide unit. The molecule adopts an E configuration about the C=N double bond. In the crystal, adjacent molecules are linked by pairs of N—H...O hydrogen bonds, forming inversion dimers with an R22(10 ring motif. The dimers are further linked via N—H...N and O—H...N hydrogen bonds into a sheet structure parallel to the ac plane. The crystal structure also features N—H...O and weak C—H...O hydrogen bonds and offset π–π stacking interactions between adjacent pyrimidine rings [centroid–centroid distance = 3.622 (1 Å].

  7. Structural investigation of cooperite (PtS) crystals

    Energy Technology Data Exchange (ETDEWEB)

    Rozhdestvina, V. I., E-mail: veronika@ascnet.ru [Russian Academy of Sciences, Institute of Geology and Nature Management, Far East Branch (Russian Federation); Udovenko, A. A. [Russian Academy of Sciences, Institute of Chemistry, Far East Branch (Russian Federation); Rubanov, S. V. [University of Melbourne, Bio21 Institute (Australia); Mudrovskaya, N. V. [Russian Academy of Sciences, Institute of Geology and Nature Management, Far East Branch (Russian Federation)

    2016-03-15

    The single-crystal structure of cooperite, a natural platinum sulfide PtS, is studied by X-ray diffraction supported by high-resolution scanning transmission electron microscopy and X-ray spectrum microanalysis. It is found that, in addition to the main reflections corresponding to the known tetragonal cell (a = 3.47 and c = 6.11 Å; space group P4{sub 2}/mmc), many weak reflections with intensities I ≤ 60σ(I) are clearly observed. These reflections fit the tetragonal cell (space group I4/mmm) with doubled parameters. In structures with small (P4{sub 2}/mmc) and large (I4/mmm) cells, the S atoms occupy statistically two special positions. It is shown that the chemical composition of the cooperite crystals deviates from the stoichiometric composition: sulfur-deficient specimens predominate.

  8. Evidence for an Important Role of WRKY DNA Binding Proteins in the Regulation of NPR1 Gene Expression

    National Research Council Canada - National Science Library

    Yu, Diqiu; Chen, Chunhong; Chen, Zhixiang

    2001-01-01

    .... In the present study, we report the identification of W-box sequences in the promoter region of the NPR1 gene that are recognized specifically by SA-induced WRKY DNA binding proteins from Arabidopsis...

  9. DNA Bending is Induced in an Enhancer by the DNA-Binding Domain of the Bovine Papillomavirus E2 Protein

    Science.gov (United States)

    Moskaluk, Christopher; Bastia, Deepak

    1988-03-01

    The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer. We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame. The DNA-binding domain has been expressed in Escherichia coli and partially purified. Gel retardation and DNase I ``footprinting'' on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site. Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending.

  10. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  11. Crystal structure of B acillus anthracis virulence regulator AtxA and effects of phosphorylated histidines on multimerization and activity: AtxA multimerization, phosphorylation and activity

    Energy Technology Data Exchange (ETDEWEB)

    Hammerstrom, Troy G.; Lori, Horton B.; Swick, Michelle C.; Joachimiak, Andrzej; Osipiuk, Jerzy; Koehler, Theresa M.

    2014-12-30

    The Bacillus anthracis virulence regulator AtxA controls transcription of the anthrax toxin genes and capsule biosynthetic operon. AtxA activity is elevated during growth in media containing glucose and CO2/bicarbonate, and there is a positive correlation between the CO2/bicarbonate signal, AtxA activity and homomultimerization. AtxA activity is also affected by phosphorylation at specific histidines. We show that AtxA crystallizes as a dimer. Distinct folds associated with predicted DNA-binding domains (HTH1 and HTH2) and phosphoenolpyruvate: carbohydrate phosphotransferase system-regulated domains (PRD1 and PRD2) are apparent. We tested AtxA variants containing single and double phosphomimetic (HisAsp) and phosphoablative (HisAla) amino acid changes for activity in B.anthracis cultures and for protein-protein interactions in cell lysates. Reduced activity of AtxA H199A, lack of multimerization and activity of AtxAH379D variants, and predicted structural changes associated with phosphorylation support a model for control of AtxA function. We propose that (i) in the AtxA dimer, phosphorylation of H199 in PRD1 affects HTH2 positioning, influencing DNA-binding; and (ii) phosphorylation of H379 in PRD2 disrupts dimer formation. The AtxA structure is the first reported high-resolution full-length structure of a PRD-containing regulator, and can serve as a model for proteins of this family, especially those that link virulence to bacterial metabolism.

  12. Crystal structure of dichloridobis(dimethyl N-cyanodithioiminocarbonatezinc

    Directory of Open Access Journals (Sweden)

    Mouhamadou Birame Diop

    2016-03-01

    Full Text Available The ZnII atom in the title complex, [ZnCl2(C4H6N2S22], is coordinated in a distorted tetrahedral manner by two Cl atoms and two terminal N atoms of two dimethyl N-cyanodithioiminocarbonate ligands. In the crystal, the complex molecules are connected through C—H...Cl hydrogen bonds and Cl...S contacts, leading to a two-dimensional structure extending parallel to the ab plane.

  13. Synthesis, crystal structure and Thermogravimetry of ortho-phthalic ...

    Indian Academy of Sciences (India)

    acid bridged coordination polymer of Copper(II) ... Keywords. o-Phthalic acid; coordination polymer; X-ray crystal structure; Copper(II); EPR; TGA. 1. .... 3.2 EPR spectrum of. [{Cu(O2C-μ2-C6H5-μ1-CO2)2}.2H2O]n. The EPR spectrum of the complex was recorded as polycrystalline solid and has been shown in figure 1.

  14. Crystal Structure of the Human Laminin Receptor Precursor

    Energy Technology Data Exchange (ETDEWEB)

    Jamieson,K.; Wu, J.; Hubbard, S.; Meruelo, D.

    2008-01-01

    The human laminin receptor (LamR) interacts with many ligands, including laminin, prions, Sindbis virus, and the polyphenol (-)-epigallocatechin-3-gallate (EGCG), and has been implicated in a number of diseases. LamR is overexpressed on tumor cells, and targeting LamR elicits anti-cancer effects. Here, we report the crystal structure of human LamR, which provides insights into its function and should facilitate the design of novel therapeutics targeting LamR.

  15. Synthesis and crystal structure of a trihydrate of dinuclear ...

    African Journals Online (AJOL)

    A new compound, [Cd2(C7H6N2)3(C6H4O2N)4]·3H2O (1), has been prepared under mild hydrothermal conditions and structurally characterized by single crystal X-ray diffraction. The two cadmium(II) ions are bridged by a carboxyl group from one 2-pyridinecarboxylate ligand. The thermal gravimetry (TG) data indicate ...

  16. Programmatic conversion of crystal structures into 3D printable files using Jmol

    OpenAIRE

    Scalfani, Vincent F.; Williams, Antony J.; Tkachenko, Valery; Karapetyan, Karen; Pshenichnov, Alexey; Hanson, Robert M.; Liddie, Jahred M.; Bara, Jason E.

    2016-01-01

    Background Three-dimensional (3D) printed crystal structures are useful for chemistry teaching and research. Current manual methods of converting crystal structures into 3D printable files are time-consuming and tedious. To overcome this limitation, we developed a programmatic method that allows for facile conversion of thousands of crystal structures directly into 3D printable files. Results A collection of over 30,000 crystal structures in crystallographic information file (CIF) format from...

  17. Crystal Structures of the β2-Adrenergic Receptor

    Science.gov (United States)

    Weis, William I.; Rosenbaum, Daniel M.; Rasmussen, Søren G. F.; Choi, Hee-Jung; Thian, Foon Sun; Kobilka, Tong Sun; Yao, Xiao-Jie; Day, Peter W.; Parnot, Charles; Fung, Juan J.; Ratnala, Venkata R. P.; Kobilka, Brian K.; Cherezov, Vadim; Hanson, Michael A.; Kuhn, Peter; Stevens, Raymond C.; Edwards, Patricia C.; Schertler, Gebhard F. X.; Burghammer, Manfred; Sanishvili, Ruslan; Fischetti, Robert F.; Masood, Asna; Rohrer, Daniel K.

    G protein coupled receptors (GPCRs) constitute the largest family of membrane proteins in the human genome, and are responsible for the majority of signal transduction events involving hormones and neuro-transmitters across the cell membrane. GPCRs that bind to diffusible ligands have low natural abundance, are relatively unstable in detergents, and display basal G protein activation even in the absence of ligands. To overcome these problems two approaches were taken to obtain crystal structures of the β2-adrenergic receptor (β2AR), a well-characterized GPCR that binds cate-cholamine hormones. The receptor was bound to the partial inverse agonist carazolol and co-crystallized with a Fab made to a three-dimensional epitope formed by the third intracellular loop (ICL3), or by replacement of ICL3 with T4 lysozyme. Small crystals were obtained in lipid bicelles (β2AR-Fab) or lipidic cubic phase (β2AR-T4 lysozyme), and diffraction data were obtained using microfocus technology. The structures provide insights into the basal activity of the receptor, the structural features that enable binding of diffusible ligands, and the coupling between ligand binding and G-protein activation.

  18. Crystal structures of two (±-exo-N-isobornylacetamides

    Directory of Open Access Journals (Sweden)

    Dmitrijs Stepanovs

    2015-10-01

    Full Text Available The title compounds consist of a bornane skeleton with attached acetamide, C12H21NO (±-(1 {systematic name: (±-N-[(1RS,2RS,4RS-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl]acetamide}, and chloroacetamide, C12H20ClNO (±-(2 {systematic name: (±-2-chloro-N-[(1RS,2RS,4RS-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl]acetamide}, functionalities to the 2-exo-position. The crystal structure of the first monoclinic polymorph of (±-(1 has been reported previously [Ung et al. (2014. Monatsh. Chem. 145, 983–992]. Compound (±-(1 crystallizes in the space group P21/n with two independent molecules in the asymmetric unit, in contrast to the above-mentioned polymorph which crystallized in the space group C2/c with one molecule in the asymmetric unit. In the title compounds, the bicyclic bornane moieties have normal geometries. In the crystals of both compounds, molecules are linked by N—H...O hydrogen bonds, reinforced by C—H...O contacts, forming trans-amide chains propagating along the a-axis direction. In the case of compound (±-(1, neighbouring chains are linked by further C—H...O contacts, forming double-chain ribbons along [100].

  19. Crystal structures of two (±)-exo-N-isobornyl-acetamides.

    Science.gov (United States)

    Stepanovs, Dmitrijs; Posevins, Daniels; Turks, Maris

    2015-10-01

    The title compounds consist of a bornane skeleton with attached acetamide, C12H21NO (±)-(1) {systematic name: (±)-N-[(1RS,2RS,4RS)-1,7,7-tri-methylbi-cyclo-[2.2.1]heptan-2-yl]acetamide}, and chloro-acetamide, C12H20ClNO (±)-(2) {systematic name: (±)-2-chloro-N-[(1RS,2RS,4RS)-1,7,7-tri-methylbi-cyclo-[2.2.1]heptan-2-yl]-acetamide}, functionalities to the 2-exo-position. The crystal structure of the first monoclinic polymorph of (±)-(1) has been reported previously [Ung et al. (2014 ▸). Monatsh. Chem. 145, 983-992]. Compound (±)-(1) crystallizes in the space group P21/n with two independent mol-ecules in the asymmetric unit, in contrast to the above-mentioned polymorph which crystallized in the space group C2/c with one mol-ecule in the asymmetric unit. In the title compounds, the bicyclic bornane moieties have normal geometries. In the crystals of both compounds, mol-ecules are linked by N-H⋯O hydrogen bonds, reinforced by C-H⋯O contacts, forming trans-amide chains propagating along the a-axis direction. In the case of compound (±)-(1), neighbouring chains are linked by further C-H⋯O contacts, forming double-chain ribbons along [100].

  20. Crystal structure of human cytochrome P450 2D6.

    Science.gov (United States)

    Rowland, Paul; Blaney, Frank E; Smyth, Martin G; Jones, Jo J; Leydon, Vaughan R; Oxbrow, Amanda K; Lewis, Ceri J; Tennant, Mike G; Modi, Sandeep; Eggleston, Drake S; Chenery, Richard J; Bridges, Angela M

    2006-03-17

    Cytochrome P450 2D6 is a heme-containing enzyme that is responsible for the metabolism of at least 20% of known drugs. Substrates of 2D6 typically contain a basic nitrogen and a planar aromatic ring. The crystal structure of human 2D6 has been solved and refined to 3.0A resolution. The structure shows the characteristic P450 fold as seen in other members of the family, with the lengths and orientations of the individual secondary structural elements being very similar to those seen in 2C9. There are, however, several important differences, the most notable involving the F helix, the F-G loop, the B'helix, beta sheet 4, and part of beta sheet 1, all of which are situated on the distal face of the protein. The 2D6 structure has a well defined active site cavity above the heme group, containing many important residues that have been implicated in substrate recognition and binding, including Asp-301, Glu-216, Phe-483, and Phe-120. The crystal structure helps to explain how Asp-301, Glu-216, and Phe-483 can act as substrate binding residues and suggests that the role of Phe-120 is to control the orientation of the aromatic ring found in most substrates with respect to the heme. The structure has been compared with published homology models and has been used to explain much of the reported site-directed mutagenesis data and help understand the metabolism of several compounds.

  1. Folding thermodynamics of c-Myb DNA-binding domain in correlation with its α-helical contents.

    Science.gov (United States)

    Inaba, Satomi; Fukada, Harumi; Oda, Masayuki

    2016-01-01

    The conformational and thermal stabilities of the minimum functional unit for c-Myb DNA-binding domain, tandem repeat 2 and 3 (R2R3), were analyzed under different pH conditions, ranging from 4.0 to 7.5, using circular dichroism and differential scanning calorimetry. Secondary structure analysis showed that the solution pH largely affects the conformational stability of the protein domain. Of all conditions analyzed, the α-helical content was maximal at pH 6.5, and the thermal stability was highest at pH 5.0. Thermodynamic parameters for thermal unfolding of R2R3 were determined using differential scanning calorimetry, and the origin of folding thermodynamics at the different pHs and its correlation with the α-helical content were further analyzed. It should be noted that the α-helical content correlates well with the enthalpy change in the pH range from 4.5 to 7.5, suggesting that the strength of hydrogen bonds and salt bridges needed for maintenance of helical structure is related to enthalpy in the native state. Under physiological pH conditions, c-Myb R2R3 exists in the enthalpically unstable but entropically stable state. Due to loss of rigid structure and high stability, the protein can now obtain structural flexibility, befitting its function. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Identification and characterization of C106R, a novel mutation in the DNA-binding domain of GCMB, in a family with autosomal-dominant hypoparathyroidism.

    Science.gov (United States)

    Yi, Hyon-Seung; Eom, Young Sil; Park, Ie Byung; Lee, Sangho; Hong, Suntaek; Jüppner, Harald; Mannstadt, Michael; Lee, Sihoon

    2012-05-01

    Glial cells missing B (GCMB) is a transcription factor that is expressed in the parathyroid hormone (PTH)-secreting cells of the parathyroid glands. Several mutations in GCMB have been reported to cause hypoparathyroidism (HP). We identified a family with two individuals in two generations (mother and son), who are affected by autosomal-dominant hypoparathyroidism (AD-HP). A novel heterozygous mutation in exon 2 of GCMB was identified in both affected individuals that changes cysteine at position 106 of the putative DNA-binding domain of GCMB to arginine (C106R). We performed mutational analysis of the genes encoding GCMB, pre-pro PTH, GATA3 and CaSR using polymerase chain reaction (PCR)-amplified genomic DNA. The identified GCMB mutant was characterized by functional studies including nuclear localization, electrophoretic mobility shift assays (EMSA) and luciferase reporter assays, and homology modelling was performed to generate a three-dimensional structural model for the DNA-binding domain of GCMB to predict the structural consequences of the identified mutation. The C106R mutant of GCMB failed to interact with the DNA consensus recognition motif, as determined by EMSA. Furthermore, in comparison with wild-type GCMB, the C106R mutant demonstrated reduced transactivation in luciferase reporter assays; however, the mutant GCMB failed to reduce the activity of the wild-type protein. Consistent with the EMSA findings, homology modelling analysis suggested that replacement of cysteine 106 with arginine would interfere with DNA binding. We have identified a novel GCMB mutation that may explain AD-HP in our family. However, the exact mechanism by which this heterozygous mutation leads to the disease in the described family remains to be elucidated. © 2012 Blackwell Publishing Ltd.

  3. Crystal structure, thermal behavior and enzymatic degradation of poly(tetramethylene adipate) solution-grown chain-folded lamellar crystals.

    Science.gov (United States)

    Iwata, Tadahisa; Kobayashi, Shiomi; Tabata, Kenji; Yonezawa, Noriyuki; Doi, Yoshiharu

    2004-03-15

    Solution-grown chain-folded lamellar single crystals of poly(tetramethylene adipate) (PTMA) were prepared from a dilute solution of 2-methyl-1-propanol by isothermal crystallization. PTMA crystals were hexagonal-shaped and polyethylene decoration of the crystals resulted in a "six cross-sector" surface morphology and showed that the average direction of chain folding is parallel to the crystal growth planes of [110] and [010]. Chain-folded lamellar crystals gave well-resolved electron diffraction diagrams corresponding to all the equatorial reflections of the X-ray fiber diagram obtained from stretched PTMA melt-quenched film (beta structure). The unit cell parameters of the beta structure of PTMA were determined as a = 0.503 nm, b = 0.732 nm and c (fiber axis) = 1.442 nm with an orthorhombic crystal system. The fiber repeat distance is appropriate for an all-trans backbone conformation for the straight stems. The setting angle, with respect to the a axis, is +/-46 degrees for the corner and center chains. Thermal behavior of lamellar crystals has been investigated by means of transmission electron microscopy (TEM) and atomic force microscopy (AFM). The lamellar thickness at the edges of the crystal increased after thermal treatment with taking the molecular chains into recrystallization parts; the holes then opened up at the thickening front of the crystal. The morphological changes of lamellar crystals after enzymatic degradation by Lipase type XIII from Pseudomonas sp. and water-soluble products were characterized by TEM, AFM, gel permeation chromatography, high performance liquid chromatography and fast atom bombardment mass spectrometry. The degradation progressed mainly from the edges of the lamellar crystals without decreasing the molecular weights and the lamellar thicknesses. The central portion of single crystals was often degraded by enzymatic attacks. This result combined with thermal behavior indicates that the loosely chain-packing region exists

  4. Facile synthesis of gold nanomaterials with unusual crystal structures.

    Science.gov (United States)

    Fan, Zhanxi; Huang, Xiao; Chen, Ye; Huang, Wei; Zhang, Hua

    2017-11-01

    Gold (Au) nanomaterials have attracted wide research attention, owing to their high chemical stability, promising catalytic properties, excellent biocompatibility, unique electronic structure and outstanding localized surface plasmon resonance (LSPR) absorption properties; all of which are closely related to their size and shape. Recently, crystal-phase-controlled synthesis of noble metal nanomaterials has emerged as a promising strategy to tune their physicochemical properties. This protocol describes the detailed experimental procedures for the crystal-phase-controlled syntheses of Au nanomaterials with unusual crystal structures under mild conditions. Briefly, pure hexagonal close-packed (hcp) Au square sheets (AuSSs) with a thickness of ∼2.4 nm are synthesized using a graphene-oxide-assisted method in which HAuCl 4 is reduced by oleylamine in a mixture of hexane and ethanol. By using pure hexane as the solvent, well-dispersed ultrathin hcp/face-centered cubic (fcc) Au nanowires with a diameter of ∼1.6 nm on graphene oxide can be obtained. Meanwhile, hcp/fcc Au square-like plates with a side length of 200-400 nm are prepared via the secondary growth of Au on the hcp AuSSs. Remarkably, hexagonal (4H) Au nanoribbons with a thickness of 2.0-6.0 nm can be synthesized with a one-pot colloidal method in which HAuCl 4 is reduced by oleylamine in a mixed solvent of hexane and 1,2-dichloropropane. It takes 17-37 h for the synthesis of these Au nanomaterials with unusual crystal structures. Transmission electron microscopy (TEM) and atomic force microscopy (AFM) are used to characterize the resultant Au nanomaterials, which could have many promising applications, such as biosensing, near-IR photothermal therapy, catalysis and surface-enhanced Raman scattering (SERS).

  5. Iron-Ion Implantation into the Structure of Rock Crystal

    Directory of Open Access Journals (Sweden)

    A.V. Mukhametshin

    2017-03-01

    Full Text Available Iron ions with the energy of 40 keV have been implanted into colorless natural rock crystals to high fluencies of 1.0∙1017 and 1.5∙1017 ion/cm2. These crystals were selected from Svetlinsky deposits of the Southern Urals, which are well-known as minerals with high quality and low content of impurities. A radical change in the color of the crystals after iron-ion implantation and subsequent high-temperature annealing in air has been revealed. The origin of color changes has been studied by using optical methods, as well as Mössbauer and X-ray photoelectron spectroscopy. It has been established that the high-dose and high-energy flow of ions results in the formation of various kinds of structural defects on the surface layer of the matrix, such as electron-hole centers, as well as in the formation at a specific depth of the irradiated matrix of the ultrafine iron-containing phases with a structure, which is non-coherent to the structure of the original matrix. The subsequent high-temperature annealing of the implanted quartz has changed the color of the samples to orange-yellow. This color is similar to the color of natural citrine. The orange color richness of the heat-treated samples grew with increasing amounts of embedded iron impurity in the crystal. The nature of orange-yellow coloration of the implanted and annealed quartz plates can be explained by the formation of ultrafine hematite nanoparticles located in a layer at a depth of ~15 nm. The possibility of refining the color of minerals by ion-beam exposure has been discussed.

  6. crystal and magnetic structure of substituted lanthanum cobaltites

    NARCIS (Netherlands)

    Sonntag, R.; Neov, S.; Kozhukharov, V.; Neov, D.; ten Elshof, Johan E.

    1999-01-01

    The crystal and magnetic structures of the lanthanum cobaltites La0.6Sr0.4CoO3, La0.6Sr0.4Co0.9Fe0.1O3 and La0.6Ba0.4Co0.9Fe0.1O3 have been studied by neutron powder diffraction at temperatures of 2, 300 and 900 K. All compounds undergo a phase transition from cubic to rhombohedral structure. Below

  7. Fusion proteins as alternate crystallization paths to difficult structure problems

    Science.gov (United States)

    Carter, Daniel C.; Rueker, Florian; Ho, Joseph X.; Lim, Kap; Keeling, Kim; Gilliland, Gary; Ji, Xinhua

    1994-01-01

    The three-dimensional structure of a peptide fusion product with glutathione transferase from Schistosoma japonicum (SjGST) has been solved by crystallographic methods to 2.5 A resolution. Peptides or proteins can be fused to SjGST and expressed in a plasmid for rapid synthesis in Escherichia coli. Fusion proteins created by this commercial method can be purified rapidly by chromatography on immobilized glutathione. The potential utility of using SjGST fusion proteins as alternate paths to the crystallization and structure determination of proteins is demonstrated.

  8. Advances in Nanophotonics: Active Photonic Crystal Structures and Devices

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher

    The nanostructuring of optical materials may significantly alter their optical and optoelectronic properties. Structuring on a length scale well below the wavelength of light may create new artificial atoms (quantum dots) or new effective media (metamaterials) that may be designed to have (optical......) properties that do not exist in nature. Periodic structuring on the length scale of the wavelength of light as in photonic crystals, on the other hand, dramatically influences the propagation of light as well as the fundamental interaction between light and matter. In this talk, I shall discuss some...... important consequences on spontaneous emission and lasing as well as some aspects of slow light and nonlinear interactions....

  9. Band structures in the nematic elastomers phononic crystals

    Science.gov (United States)

    Yang, Shuai; Liu, Ying; Liang, Tianshu

    2017-02-01

    As one kind of new intelligent materials, nematic elastomers (NEs) represent an exciting physical system that combines the local orientational symmetry breaking and the entropic rubber elasticity, producing a number of unique physical phenomena. In this paper, the potential application of NEs in the band tuning is explored. The band structures in two kinds of NE phononic crystals (PCs) are investigated. Through changing NE intrinsic parameters, the influence of the porosity, director rotation and relaxation on the band structures in NE PCs are analyzed. This work is a meaningful try for application of NEs in acoustic field and proposes a new intelligent strategy in band turning.

  10. Crystal structure of the UvrB dimer: insights into the nature and functioning of the UvrAB damage engagement and UvrB–DNA complexes

    Science.gov (United States)

    Webster, Matthew P. J.; Jukes, Rachael; Zamfir, Vlad S.; Kay, Christopher W. M.; Bagnéris, Claire; Barrett, Tracey

    2012-01-01

    UvrB has a central role in the highly conserved UvrABC pathway functioning not only as a damage recognition element but also as an essential component of the lesion tracking machinery. While it has been recently confirmed that the tracking assembly comprises a UvrA2B2 heterotetramer, the configurations of the damage engagement and UvrB–DNA handover complexes remain obscure. Here, we present the first crystal structure of a UvrB dimer whose biological significance has been verified using both chemical cross-linking and electron paramagnetic resonance spectroscopy. We demonstrate that this dimeric species stably associates with UvrA and forms a UvrA2B2–DNA complex. Our studies also illustrate how signals are transduced between the ATP and DNA binding sites to generate the helicase activity pivotal to handover and formation of the UvrB2–DNA complex, providing key insights into the configurations of these important repair intermediates. PMID:22753105

  11. Increased Stability and DNA Site Discrimination of Single Chain Variants of the Dimeric beta-Barrel DNA Binding Domain of the Human Papillomavirus E2 Transcriptional Regulator

    Energy Technology Data Exchange (ETDEWEB)

    Dellarole,M.; Sanchez, I.; Freire, E.; de Prat-Gay, G.

    2007-01-01

    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric {beta}-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  12. Crystal chemistry and electrical properties of the delafossite structure

    Energy Technology Data Exchange (ETDEWEB)

    Marquardt, Meagen A. [Materials Science and Engineering Department, Iowa State University, 2220 Hoover Hall Ames, IA 50011 (United States); Ashmore, Nathan A. [Materials Science and Engineering Department, Iowa State University, 2220 Hoover Hall Ames, IA 50011 (United States); Cann, David P. [Materials Science and Engineering Department, Iowa State University, 2220 Hoover Hall Ames, IA 50011 (United States)]. E-mail: BaTiO3@iastate.edu

    2006-02-01

    Over the past few decades, the field of transparent conducting oxides has undergone tremendous advances. With the rapid growth of optoelectronic applications related to display technologies, traditional materials such as Sn-doped indium oxide (ITO) are now widely used as transparent electrodes. In addition, with the advent of p-type transparent conductors, through the transparent pn-junction building block, a wide range of functional transparent optoelectronic devices have been demonstrated including UV-emitting diodes, UV-detectors, and transparent thin film transistors. This paper will highlight the unique characteristics of oxide materials based on the delafossite structure with a focus on the interrelationship between the chemistry, crystal structure, process conditions, and electrical and optical properties. The delafossite structure (ABO{sub 2}) is characterized by a layer of linearly coordinated A cations stacked between edge-shared octahedral layers (BO{sub 6}). The A-site cation is comprised of Pt, Pd, Ag, or Cu ions nominally in a monovalent state. The B-site cation can consist of most trivalent transition metals, group III elements, rare earths, or charge compensated pairs (e.g. B{sup 2+}/B{sup 4+}). This layered structure leads to highly anisotropic physical properties. The crystal chemistry of the delafossite structure will be discussed in reference to phase stability, the stability of dopants, and the important physical properties such as the conductivity and optical transparency.

  13. Crystal structure of the Fe-member of usovite

    Directory of Open Access Journals (Sweden)

    Matthias Weil

    2015-06-01

    Full Text Available Crystals of the title compound, with the idealized composition Ba2CaFeAl2F14, dibarium calcium iron(II dialuminium tetradecafluoride, were obtained serendipitously by reacting a mixture of the binary fluorides BaF2, CaF2 and AlF3 in a leaky steel reactor. The compound crystallizes in the usovite structure type (Ba2CaMgAl2F14, with Fe2+ cations replacing the Mg2+ cations. The principal building units are distorted [CaF8] square-antiprisms (point group symmetry 2, [FeF6] octahedra (point group symmetry -1 and [AlF6] octahedra that are condensed into undulating 2∞[CaFeAl2F14]4− layers parallel (100. The Ba2+ cations separate the layers and exhibit a coordination number of 12. Two crystal structure models with a different treatment of the disordered Fe site [mixed Fe/Ca occupation, model (I, versus underoccupation of Fe, model (II], are discussed, leading to different refined formulae Ba2Ca1.310 (15Fe0.690 (15Al2F14 [model (I] and Ba2CaFe0.90 (1Al2F14 [model (II].

  14. Identifying duplicate crystal structures: XTALCOMP, an open-source solution

    Science.gov (United States)

    Lonie, David C.; Zurek, Eva

    2012-03-01

    We describe the implementation of XTALCOMP, an efficient, reliable, and open-source library that tests if two crystal descriptions describe the same underlying structure. The algorithm has been tested and found to correctly identify duplicate structures in spite of the "real-world" difficulties that arise from working with numeric crystal representations: degenerate unit cell lattices, numerical noise, periodic boundaries, and the lack of a canonical coordinate origin. The library is portable, open, and not dependent on any external packages. A web interface to the algorithm is publicly accessible at http://xtalopt.openmolecules.net/xtalcomp/xtalcomp.html. Program summaryProgram title: XtalComp Catalogue identifier: AEKV_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEKV_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: "New" (3-clause) BSD [1] No. of lines in distributed program, including test data, etc.: 3148 No. of bytes in distributed program, including test data, etc.: 21 860 Distribution format: tar.gz Programming language: C++ Computer: No restrictions Operating system: All operating systems with a compliant C++ compiler. Classification: 7.8 Nature of problem: Computationally identifying duplicate crystal structures taken from the output of modern solid state calculations is a non-trivial exercise for many reasons. The translation vectors in the description are not unique — they may be transformed into linear combinations of themselves and continue to describe the same extended structure. The coordinates and cell parameters contain numerical noise. The periodic boundary conditions at the unit cell faces, edges, and corners can cause very small displacements of atomic coordinates to result in very different representations. The positions of all atoms may be uniformly translated by an arbitrary vector without modifying the underlying structure. Additionally, certain

  15. SYNTHESIS, CHARACTERIZATION AND CRYSTAL STRUCTURE OF BIS-(2-HYDROXYBENZALDEHYDEDIAMINOGUANIZONE

    Directory of Open Access Journals (Sweden)

    Diana Dragancea, Vladimir B. Arion, Sergiu Shova

    2008-12-01

    Full Text Available The new ligand, bis(2-hydroxybenzaldehydediaminoguanizone (1 has been synthesized and characterized by elemental analysis, IR and 1H NMR spectroscopies. The crystal structure of the compound was determined by X-ray diffraction. The ligand C15H15N5O2·C2H5OH crystallizes in the monoclinic space group P21/c with unit cell parameters a = 8.9102(3, b = 10.0357(3, c = 19.7618(6 Å, β = 98.385(2°, Z = 4, V = 1748.21(9 Å3, R1 = 0.040. The amino form of the ligand adopts a planar conformation stabilized by two intramolecular hydrogen bonds of the type O–H···N, in which the H atoms of the central amino group are directed to the lone-pair regions of the azomethine nitrogen atoms.

  16. Crystal structure and magnetism of UOsAl

    Science.gov (United States)

    Andreev, A. V.; Daniš, S.; Šebek, J.; Henriques, M. S.; Vejpravová, J.; Gorbunov, D. I.; Havela, L.

    2017-04-01

    Crystal structure, magnetization, and specific heat were studied on single crystal of uranium intermetallic compound UOsAl. It is a hexagonal Laves phase of MgZn2 type, space group P63/mmc, with lattice parameters a=536.4 pm, c=845.3 pm. Shortest inter-uranium distance 313 pm (along the c-axis) is considerably smaller than the Hill limit (340 pm). The compound is a weakly temperature-dependent paramagnet with magnetic susceptibility of ≈1.5*10-8 m3 mol-1 (at T=2 K), which is slightly higher with magnetic field along the a-axis compared to the c-axis. The Sommerfeld coefficient of electronic specific heat has moderate value of γ=36 mJ mol-1 K-2.

  17. Crystal structure of 2,5-dimethylanilinium hydrogen maleate

    Directory of Open Access Journals (Sweden)

    Maha Mathlouthi

    2014-11-01

    Full Text Available The crystal structure of the title salt, C8H12N+·C4H3O4−, consists of a 2,5-dimethylanilinium cation and an hydrogen maleate anion. In the anion, a strong intramolecular O—H...O hydrogen bond is observed, leading to an S(7 graph-set motif. In the crystal, the cations and anions pack in alternating layers parallel to (001. The ammonium group undergoes intermolecular N—H...O hydrogen-bonding interactions with the O atoms of three different hydrogen maleate anions. This results in the formation of ribbons extending parallel to [010] with hydrogen-bonding motifs of the types R44(12 and R44(18.

  18. Crystal structure of dichloridobis(dimethyl N-cyanodithioiminocarbonatecobalt(II

    Directory of Open Access Journals (Sweden)

    Mouhamadou Birame Diop

    2016-01-01

    Full Text Available The structure of the mononuclear title complex, [{(H3CS2C=NC[triple-bond] N}2CoCl2], consists of a CoII atom coordinated in a distorted tetrahedral manner by two Cl− ligands and the terminal N atoms of two dimethyl N-cyanodithioiminocarbonate ligands. The two organic ligands are almost coplanar, with a dihedral angle of 5.99 (6° between their least-squares planes. The crystal packing features pairs of inversion-related complexes that are held together through C—H...Cl and C—H...S interactions and π–π stacking [centroid-to-centroid distance = 3.515 (su? Å]. Additional C—H...Cl and C—H...S interactions, as well as Cl...S contacts < 3.6 Å, consolidate the crystal packing.

  19. Crystal structures and conformers of CyMe4-BTBP

    Directory of Open Access Journals (Sweden)

    Lyczko Krzysztof

    2015-12-01

    Full Text Available The crystal structure of new conformation of the CyMe4-BTBP ligand (ttc has been presented. The ttt conformer of this compound in a form of THF solvate has been also crystallized. The geometries of six possible conformations (ttt, ttc, tct, tcc, ctc and ccc of the CyMe4-BTBP ligand have been modeled in the gas phase and in solutions (MeOH and H2O by DFT calculations using B3LYP/6-31G(d,p method. According to the calculations, in the three different media the conformers with trans orientation of the N atoms in the bipyridyl moiety are the most stable.

  20. Crystal Structure and Carbonate Species into Structure of Hydroxyapatite

    OpenAIRE

    元上, 康孝; 管野, 亨; 小林, 正義; 赤澤, 敏之; MOTOGAMI, Yasutaka; KANNO, Tohru; Kobayashi, Masayoshi; Akazawa, Toshiyuki

    1998-01-01

    The morphology of hydroxyapatite (HAp) had a significant effect on carbonates incorporated into HAp structures. A cattle bone-originated HAp (r-HAp) had two carbonates, OH-substituted and P04- substituted, and chemically synthesized HAp (s-HAp) had only the latter carbonate. This difference was ascribed to the increased calcium deficiency of r-HAp. Partial substitution of Sr for Ca caused expansion of the P-O bond and subjected the HAp structure to stress. This stress decreased the decomposit...