WorldWideScience

Sample records for cryofixed myxococcus xanthus

  1. Phase separation like dynamics during Myxococcus xanthus fruiting body formation

    Science.gov (United States)

    Liu, Guannan; Thutupalli, Shashi; Wigbers, Manon; Shaevitz, Joshua

    2015-03-01

    Collective motion exists in many living organisms as an advantageous strategy to help the entire group with predation, forage, and survival. However, the principles of self-organization underlying such collective motions remain unclear. During various developmental stages of the soil-dwelling bacterium, Myxococcus xanthus, different types of collective motions are observed. In particular, when starved, M. xanthus cells eventually aggregate together to form 3-dimensional structures (fruiting bodies), inside which cells sporulate in response to the stress. We study the fruiting body formation process as an out of equilibrium phase separation process. As local cell density increases, the dynamics of the aggregation M. xanthus cells switch from a spatio-temporally random process, resembling nucleation and growth, to an emergent pattern formation process similar to a spinodal decomposition. By employing high-resolution microscopy and a video analysis system, we are able to track the motion of single cells within motile collective groups, while separately tuning local cell density, cell velocity and reversal frequency, probing the multi-dimensional phase space of M. xanthus development.

  2. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  3. Identification and Localization of Myxococcus xanthus Porins and Lipoproteins

    Science.gov (United States)

    Bhat, Swapna; Zhu, Xiang; Patel, Ricky P.; Orlando, Ron; Shimkets, Lawrence J.

    2011-01-01

    Myxococcus xanthus DK1622 contains inner (IM) and outer membranes (OM) separated by a peptidoglycan layer. Integral membrane, β-barrel proteins are found exclusively in the OM where they form pores allowing the passage of nutrients, waste products and signals. One porin, Oar, is required for intercellular communication of the C-signal. An oar mutant produces CsgA but is unable to ripple or stimulate csgA mutants to develop suggesting that it is the channel for C-signaling. Six prediction programs were evaluated for their ability to identify β-barrel proteins. No program was reliable unless the predicted proteins were first parsed using Signal P, Lipo P and TMHMM, after which TMBETA-SVM and TMBETADISC-RBF identified β-barrel proteins most accurately. 228 β-barrel proteins were predicted from among 7331 protein coding regions, representing 3.1% of total genes. Sucrose density gradients were used to separate vegetative cell IM and OM fractions, and LC-MS/MS of OM proteins identified 54 β-barrel proteins. Another class of membrane proteins, the lipoproteins, are anchored in the membrane via a lipid moiety at the N-terminus. 44 OM proteins identified by LC-MS/MS were predicted lipoproteins. Lipoproteins are distributed between the IM, OM and ECM according to an N-terminal sorting sequence that varies among species. Sequence analysis revealed conservation of alanine at the +7 position of mature ECM lipoproteins, lysine at the +2 position of IM lipoproteins, and no noticable conservation within the OM lipoproteins. Site directed mutagenesis and immuno transmission electron microscopy showed that alanine at the +7 position is essential for sorting of the lipoprotein FibA into the ECM. FibA appears at normal levels in the ECM even when a +2 lysine is added to the signal sequence. These results suggest that ECM proteins have a unique method of secretion. It is now possible to target lipoproteins to specific IM, OM and ECM locations by manipulating the amino acid

  4. Cell-density-dependent lysis and sporulation of Myxococcus xanthus in agarose microbeads.

    OpenAIRE

    Rosenbluh, A; Nir, R; Sahar, E; Rosenberg, E

    1989-01-01

    Vegetative cells of Myxococcus xanthus were immobilized in 25-microns-diameter agarose microbeads and incubated in either growth medium or sporulation buffer. In growth medium, the cells multiplied, glided to the periphery, and then filled the beads. In sporulation buffer, up to 90% of the cells lysed and ca. 50% of the surviving cells formed resistant spores. A strong correlation between sporulation and cell lysis was observed; both phenomena were cell density dependent. Sporulation proficie...

  5. Transmission of a signal that synchronizes cell movements in swarms of Myxococcus xanthus

    OpenAIRE

    Kaiser, Dale; Warrick, Hans

    2014-01-01

    Multicellular organisms, by necessity, form highly organized structures. The mechanisms required to construct these often dynamic structures are a challenge to understand. Myxococcus xanthus, a soil bacterium, builds two large structures: growing swarms and fruiting bodies. Because the cells are genetically identical, they rely on regulating protein activity and the levels of gene expression. Moreover, the long, flexible, rod-shaped cells modify each others’ behavior when they collide. By exa...

  6. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    Science.gov (United States)

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  7. DNA builds and strengthens the extracellular matrix in Myxococcus xanthus biofilms by interacting with exopolysaccharides.

    Directory of Open Access Journals (Sweden)

    Wei Hu

    Full Text Available One intriguing discovery in modern microbiology is the extensive presence of extracellular DNA (eDNA within biofilms of various bacterial species. Although several biological functions have been suggested for eDNA, including involvement in biofilm formation, the detailed mechanism of eDNA integration into biofilm architecture is still poorly understood. In the biofilms formed by Myxococcus xanthus, a Gram-negative soil bacterium with complex morphogenesis and social behaviors, DNA was found within both extracted and native extracellular matrices (ECM. Further examination revealed that these eDNA molecules formed well organized structures that were similar in appearance to the organization of exopolysaccharides (EPS in ECM. Biochemical and image analyses confirmed that eDNA bound to and colocalized with EPS within the ECM of starvation biofilms and fruiting bodies. In addition, ECM containing eDNA exhibited greater physical strength and biological stress resistance compared to DNase I treated ECM. Taken together, these findings demonstrate that DNA interacts with EPS and strengthens biofilm structures in M. xanthus.

  8. ParABS system in chromosome partitioning in the bacterium Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Antonio A Iniesta

    Full Text Available Chromosome segregation is an essential cellular function in eukaryotic and prokaryotic cells. The ParABS system is a fundamental player for a mitosis-like process in chromosome partitioning in many bacterial species. This work shows that the social bacterium Myxococcus xanthus also uses the ParABS system for chromosome segregation. Its large prokaryotic genome of 9.1 Mb contains 22 parS sequences near the origin of replication, and it is shown here that M. xanthus ParB binds preferentially to a consensus parS sequence in vitro. ParB and ParA are essential for cell viability in M. xanthus as in Caulobacter crescentus, but unlike in many other bacteria. Absence of ParB results in anucleate cells, chromosome segregation defects and loss of viability. Analysis of ParA subcellular localization shows that it clusters at the poles in all cells, and in some, in the DNA-free cell division plane between two chromosomal DNA masses. This ParA localization pattern depends on ParB but not on FtsZ. ParB inhibits the nonspecific interaction of ParA with DNA, and ParA colocalizes with chromosomal DNA only when ParB is depleted. The subcellular localization of ParB suggests a single ParB-parS complex localized at the edge of the nucleoid, next to a polar ParA cluster, with a second ParB-parS complex migrating after the replication of parS takes place to the opposite nucleoid edge, next to the other polar ParA cluster.

  9. Competitive Interactions Between Incompatible Mutants of the Social Bacterium Myxococcus xanthus DK1622

    Directory of Open Access Journals (Sweden)

    Ya Gong

    2018-06-01

    Full Text Available Due to the high similarity in their requirements for space and food, close bacterial relatives may be each other's strongest competitors. Close bacterial relatives often form visible boundaries to separate their swarming colonies, a phenomenon termed colony-merger incompatibility. While bacterial species are known to have many incompatible strains, it is largely unclear which traits lead to multiple incompatibilities and the interactions between multiple incompatible siblings. To investigate the competitive interactions of closely related incompatible strains, we mutated Myxococcus xanthus DK1622, a predatory bacterium with complex social behavior. From 3392 random transposon mutations, we obtained 11 self-identification (SI deficient mutants that formed unmerged colony boundaries with the ancestral strain. The mutations were at nine loci with unknown functions and formed nine independent SI mutants. Compared with their ancestral strain, most of the SI mutants showed reduced growth, swarming and development abilities, but some remained unchanged from their monocultures. When pairwise mixed with their ancestral strain for co-cultivation, these mutants exhibited improved, reduced or unchanged competitive abilities compared with the ancestral strain. The sporulation efficiencies were affected by the DK1622 partner, ranging from almost complete inhibition to 360% stimulation. The differences in competitive growth between the SI mutants and DK1622 were highly correlated with the differences in their sporulation efficiencies. However, the competitive efficiencies of the mutants in mixture were inconsistent with their growth or sporulation abilities in monocultures. We propose that the colony-merger incompatibility in M. xanthus is associated with multiple independent genetic loci, and the incompatible strains hold competitive interaction abilities, which probably determine the complex relationships between multiple incompatible M. xanthus strains and

  10. The phosphatomes of the multicellular myxobacteria Myxococcus xanthus and Sorangium cellulosum in comparison with other prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anke Treuner-Lange

    Full Text Available BACKGROUND: Analysis of the complete genomes from the multicellular myxobacteria Myxococcus xanthus and Sorangium cellulosum identified the highest number of eukaryotic-like protein kinases (ELKs compared to all other genomes analyzed. High numbers of protein phosphatases (PPs could therefore be anticipated, as reversible protein phosphorylation is a major regulation mechanism of fundamental biological processes. METHODOLOGY: Here we report an intensive analysis of the phosphatomes of M. xanthus and S. cellulosum in which we constructed phylogenetic trees to position these sequences relative to PPs from other prokaryotic organisms. PRINCIPAL FINDINGS: PREDOMINANT OBSERVATIONS WERE: (i M. xanthus and S. cellulosum possess predominantly Ser/Thr PPs; (ii S. cellulosum encodes the highest number of PP2c-type phosphatases so far reported for a prokaryotic organism; (iii in contrast to M. xanthus only S. cellulosum encodes high numbers of SpoIIE-like PPs; (iv there is a significant lack of synteny among M. xanthus and S. cellulosum, and (v the degree of co-organization between kinase and phosphatase genes is extremely low in these myxobacterial genomes. CONCLUSIONS: We conclude that there has been a greater expansion of ELKs than PPs in multicellular myxobacteria.

  11. Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage.

    Science.gov (United States)

    Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel

    2016-01-19

    Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is

  12. Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

    Directory of Open Access Journals (Sweden)

    Treuner-Lange Anke

    2010-04-01

    Full Text Available Abstract Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate

  13. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  14. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

    Directory of Open Access Journals (Sweden)

    Pintu Patra

    2016-06-01

    Full Text Available Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

  15. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

    Science.gov (United States)

    Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A

    2016-06-01

    Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

  16. The guanosine nucleotide (p)ppGpp initiates development and A-factor production in myxococcus xanthus.

    Science.gov (United States)

    Harris, B Z; Kaiser, D; Singer, M

    1998-04-01

    Guanosine 3'-di-5'-(tri)di-phosphate nucleotides [(p)ppGpp], synthesized in response to amino acid limitation, induce early gene expression leading to multicellular fruiting body formation in Myxococcus xanthus. A mutant (DK527) that fails to accumulate (p)ppGpp in response to starvation was found to be blocked in development prior to aggregation. By use of a series of developmentally regulated Tn5lac transcriptional fusion reporters, the time of developmental arrest in DK527 was narrowed to within the few hours of development, the period of starvation recognition. The mutant is also defective in the production of A-factor, an early extracellular cell-density signal. The relA gene from Escherichia coli, which encodes a ribosome-dependent (p)ppGpp synthetase, rescues this mutant. We also demonstrate that inactivation of the M. xanthus relA homolog blocks development and the accumulation of (p)ppGpp. Moreover, the wild-type allele of Myxococcus relA rescues DK527. These observations support a model in which accumulation of (p)ppGpp, in response to starvation, initiates the program of fruiting body development, including the production of A-factor.

  17. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  18. Two-Component Signal Transduction Systems That Regulate the Temporal and Spatial Expression of Myxococcus xanthus Sporulation Genes.

    Science.gov (United States)

    Sarwar, Zaara; Garza, Anthony G

    2016-02-01

    When starved for nutrients, Myxococcus xanthus produces a biofilm that contains a mat of rod-shaped cells, known as peripheral rods, and aerial structures called fruiting bodies, which house thousands of dormant and stress-resistant spherical spores. Because rod-shaped cells differentiate into spherical, stress-resistant spores and spore differentiation occurs only in nascent fruiting bodies, many genes and multiple levels of regulation are required. Over the past 2 decades, many regulators of the temporal and spatial expression of M. xanthus sporulation genes have been uncovered. Of these sporulation gene regulators, two-component signal transduction circuits, which typically contain a histidine kinase sensor protein and a transcriptional regulator known as response regulator, are among the best characterized. In this review, we discuss prototypical two-component systems (Nla6S/Nla6 and Nla28S/Nla28) that regulate an early, preaggregation phase of sporulation gene expression during fruiting body development. We also discuss orphan response regulators (ActB and FruA) that regulate a later phase of sporulation gene expression, which begins during the aggregation stage of fruiting body development. In addition, we summarize the research on a complex two-component system (Esp) that is important for the spatial regulation of sporulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

    Science.gov (United States)

    Cusick, John K; Hager, Elizabeth; Gill, Ronald E

    2015-01-01

    The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

    Science.gov (United States)

    Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

    2015-07-22

    Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

  1. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    Science.gov (United States)

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  2. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    OpenAIRE

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  3. Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

    Science.gov (United States)

    Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

    2017-08-16

    The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

  4. Contact- and Protein Transfer-Dependent Stimulation of Assembly of the Gliding Motility Machinery in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Beata Jakobczak

    2015-07-01

    Full Text Available Bacteria engage in contact-dependent activities to coordinate cellular activities that aid their survival. Cells of Myxococcus xanthus move over surfaces by means of type IV pili and gliding motility. Upon direct contact, cells physically exchange outer membrane (OM lipoproteins, and this transfer can rescue motility in mutants lacking lipoproteins required for motility. The mechanism of gliding motility and its stimulation by transferred OM lipoproteins remain poorly characterized. We investigated the function of CglC, GltB, GltA and GltC, all of which are required for gliding. We demonstrate that CglC is an OM lipoprotein, GltB and GltA are integral OM β-barrel proteins, and GltC is a soluble periplasmic protein. GltB and GltA are mutually stabilizing, and both are required to stabilize GltC, whereas CglC accumulate independently of GltB, GltA and GltC. Consistently, purified GltB, GltA and GltC proteins interact in all pair-wise combinations. Using active fluorescently-tagged fusion proteins, we demonstrate that GltB, GltA and GltC are integral components of the gliding motility complex. Incorporation of GltB and GltA into this complex depends on CglC and GltC as well as on the cytoplasmic AglZ protein and the inner membrane protein AglQ, both of which are components of the gliding motility complex. Conversely, incorporation of AglZ and AglQ into the gliding motility complex depends on CglC, GltB, GltA and GltC. Remarkably, physical transfer of the OM lipoprotein CglC to a ΔcglC recipient stimulates assembly of the gliding motility complex in the recipient likely by facilitating the OM integration of GltB and GltA. These data provide evidence that the gliding motility complex in M. xanthus includes OM proteins and suggest that this complex extends from the cytoplasm across the cell envelope to the OM. These data add assembly of gliding motility complexes in M. xanthus to the growing list of contact-dependent activities in bacteria.

  5. A versatile class of cell surface directional motors gives rise to gliding motility and sporulation in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Morgane Wartel

    2013-12-01

    Full Text Available Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories.

  6. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  7. Molecular Cloning and Characterization of Two Genes for the Biotin Carboxylase and Carboxyltransferase Subunits of Acetyl Coenzyme A Carboxylase in Myxococcus xanthus

    OpenAIRE

    Kimura, Yoshio; Miyake, Rina; Tokumasu, Yushi; Sato, Masayuki

    2000-01-01

    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar t...

  8. Coupling gene expression and multicellular morphogenesis during fruiting body formation in Myxococcus xanthus

    DEFF Research Database (Denmark)

    Søgaard-Andersen, L.; Overgaard, M.; Lobedanz, S.

    2003-01-01

    xanthus illustrates this coupling in the construction of a multicellular structure. Fruiting body formation involves two stages: aggregation of cells into mounds and the position-specific sporulation of cells that have accumulated inside mounds. Developmental gene expression propels these two processes...... morphogenesis. Accumulation of the C-signal is tightly regulated and involves transcriptional activation of the csgA gene and proteolysis of the full-length CsgA protein to produce the shorter cell surface-associated 17 kDa C-signal protein. The C-signal induces aggregation, sporulation and developmental gene...

  9. A genetic screen in Myxococcus xanthus identifies mutants that uncouple outer membrane exchange from a downstream cellular response.

    Science.gov (United States)

    Dey, Arup; Wall, Daniel

    2014-12-01

    Upon physical contact with sibling cells, myxobacteria transiently fuse their outer membranes (OMs) and exchange OM proteins and lipids. From previous work, TraA and TraB were identified to be essential factors for OM exchange (OME) in donor and recipient cells. To define the genetic complexity of OME, we carried out a comprehensive forward genetic screen. The screen was based on the observation that Myxococcus xanthus nonmotile cells, by a Tra-dependent mechanism, block swarm expansion of motile cells when mixed. Thus, mutants defective in OME or a downstream responsive pathway were readily identified as escape flares from mixed inocula seeded on agar. This screen was surprisingly powerful, as we found >50 mutants defective in OME. Importantly, all of the mutations mapped to the traAB operon, suggesting that there may be few, if any, proteins besides TraA and TraB directly required for OME. We also found a second and phenotypically different class of mutants that exhibited wild-type OME but were defective in a responsive pathway. This pathway is postulated to control inner membrane homeostasis by covalently attaching amino acids to phospholipids. The identified proteins are homologous to the Staphylococcus aureus MprF protein, which is involved in membrane adaptation and antibiotic resistance. Interestingly, we also found that a small number of nonmotile cells were sufficient to block the swarming behavior of a large gliding-proficient population. This result suggests that an OME-derived signal could be amplified from a few nonmotile producers to act on many responder cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  11. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    Science.gov (United States)

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  12. Profiling the outer membrane proteome during growth and development of the social bacterium Myxococcus xanthus by selective biotinylation and analyses of outer membrane vesicles.

    Science.gov (United States)

    Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner

    2010-10-01

    Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.

  13. A response regulator interfaces between the Frz chemosensory system and the MglA/MglB GTPase/GAP module to regulate polarity in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Daniela Keilberg

    2012-09-01

    Full Text Available How cells establish and dynamically change polarity are general questions in cell biology. Cells of the rod-shaped bacterium Myxococcus xanthus move on surfaces with defined leading and lagging cell poles. Occasionally, cells undergo reversals, which correspond to an inversion of the leading-lagging pole polarity axis. Reversals are induced by the Frz chemosensory system and depend on relocalization of motility proteins between the poles. The Ras-like GTPase MglA localizes to and defines the leading cell pole in the GTP-bound form. MglB, the cognate MglA GTPase activating protein, localizes to and defines the lagging pole. During reversals, MglA-GTP and MglB switch poles and, therefore, dynamically localized motility proteins switch poles. We identified the RomR response regulator, which localizes in a bipolar asymmetric pattern with a large cluster at the lagging pole, as important for motility and reversals. We show that RomR interacts directly with MglA and MglB in vitro. Furthermore, RomR, MglA, and MglB affect the localization of each other in all pair-wise directions, suggesting that RomR stimulates motility by promoting correct localization of MglA and MglB in MglA/RomR and MglB/RomR complexes at opposite poles. Moreover, localization analyses suggest that the two RomR complexes mutually exclude each other from their respective poles. We further show that RomR interfaces with FrzZ, the output response regulator of the Frz chemosensory system, to regulate reversals. Thus, RomR serves at the functional interface to connect a classic bacterial signalling module (Frz to a classic eukaryotic polarity module (MglA/MglB. This modular design is paralleled by the phylogenetic distribution of the proteins, suggesting an evolutionary scheme in which RomR was incorporated into the MglA/MglB module to regulate cell polarity followed by the addition of the Frz system to dynamically regulate cell polarity.

  14. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  15. Enhancer-binding proteins with a forkhead-associated domain and the sigma(54) regulon in Myxococcus xanthus fruiting body development

    DEFF Research Database (Denmark)

    Jelsbak, Lars; Givskov, Michael Christian; Kaiser, D.

    2005-01-01

    -binding proteins. Here we report the finding of an unusual group of 12 genes encoding sigma(54)-dependent enhancer-binding proteins containing a forkhead-associated (FHA) domain as their N-terminal sensory domain. FHA domains in other proteins recognize phosphothreonine residues. An insertion mutation in one...... donor cell. Because FHA domains respond to phosphothreonine-containing proteins, these results suggest a regulatory link to the abundant Ser/Thr protein kinases in M. xanthus....

  16. The Type IV Pilus Assembly ATPase PilB of Myxococcus xanthus Interacts with the Inner Membrane Platform Protein PilC and the Nucleotide-binding Protein PilM.

    Science.gov (United States)

    Bischof, Lisa Franziska; Friedrich, Carmen; Harms, Andrea; Søgaard-Andersen, Lotte; van der Does, Chris

    2016-03-25

    Type IV pili (T4P) are ubiquitous bacterial cell surface structures, involved in processes such as twitching motility, biofilm formation, bacteriophage infection, surface attachment, virulence, and natural transformation. T4P are assembled by machinery that can be divided into the outer membrane pore complex, the alignment complex that connects components in the inner and outer membrane, and the motor complex in the inner membrane and cytoplasm. Here, we characterize the inner membrane platform protein PilC, the cytosolic assembly ATPase PilB of the motor complex, and the cytosolic nucleotide-binding protein PilM of the alignment complex of the T4P machinery ofMyxococcus xanthus PilC was purified as a dimer and reconstituted into liposomes. PilB was isolated as a monomer and bound ATP in a non-cooperative manner, but PilB fused to Hcp1 ofPseudomonas aeruginosaformed a hexamer and bound ATP in a cooperative manner. Hexameric but not monomeric PilB bound to PilC reconstituted in liposomes, and this binding stimulated PilB ATPase activity. PilM could only be purified when it was stabilized by a fusion with a peptide corresponding to the first 16 amino acids of PilN, supporting an interaction between PilM and PilN(1-16). PilM-N(1-16) was isolated as a monomer that bound but did not hydrolyze ATP. PilM interacted directly with PilB, but only with PilC in the presence of PilB, suggesting an indirect interaction. We propose that PilB interacts with PilC and with PilM, thus establishing the connection between the alignment and the motor complex. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿

    Science.gov (United States)

    Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.

    2010-01-01

    New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

  18. Growth responses of Escherichia coli and Myxococcus xanthus on ...

    African Journals Online (AJOL)

    Bacteria colonize surfaces responding to the physicochemical properties of substrates. A systematic study was carried out with growing single bacterial colonies on the surface of agar media to decipher the interaction between bacterial growth and substrate stiffness. We investigated the growth kinetics of wild-type ...

  19. Myxococcus CsgA, Drosophila Sniffer, and human HSD10 are cardiolipin phospholipases.

    Science.gov (United States)

    Boynton, Tye O'Hara; Shimkets, Lawrence Joseph

    2015-09-15

    Myxococcus xanthus development requires CsgA, a member of the short-chain alcohol dehydrogenase (SCAD) family of proteins. We show that CsgA and SocA, a protein that can replace CsgA function in vivo, oxidize the 2'-OH glycerol moiety on cardiolipin and phosphatidylglycerol to produce diacylglycerol (DAG), dihydroxyacetone, and orthophosphate. A lipid extract enriched in DAGs from wild-type cells initiates development and lipid body production in a csgA mutant to bypass the mutational block. This novel phospholipase C-like reaction is widespread. SCADs that prevent neurodegenerative disorders, such as Drosophila Sniffer and human HSD10, oxidize cardiolipin with similar kinetic parameters. HSD10 exhibits a strong preference for cardiolipin with oxidized fatty acids. This activity is inhibited in the presence of the amyloid β peptide. Three HSD10 variants associated with neurodegenerative disorders are inactive with cardiolipin. We suggest that HSD10 protects humans from reactive oxygen species by removing damaged cardiolipin before it induces apoptosis. © 2015 Boynton and Shimkets; Published by Cold Spring Harbor Laboratory Press.

  20. Efficient expression and characterization of a cold-active endo-1, 4-β-glucanase from Citrobacter farmeri by co-expression of Myxococcus xanthus protein S

    Directory of Open Access Journals (Sweden)

    Xi Bai

    2016-11-01

    Conclusions: The ProS-EglC is promising in application of various biotechnological processes because of its cold-active characterizations. This study also suggests a useful strategy for the expression of foreign proteins in E. coli using a ProS tag.

  1. NCBI nr-aa BLAST: CBRC-OCUN-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1368 ref|YP_633021.1| adventurous gliding motility protein AgmX [Myxoc...occus xanthus DK 1622] gb|ABF87224.1| adventurous gliding motility protein AgmX [Myxococcus xanthus DK 1622] YP_633021.1 3e-05 27% ...

  2. Biocontrol Activity of Myxococcus sp. KYC 1126 against Phytophthora Blight on Hot Pepper

    Directory of Open Access Journals (Sweden)

    Sung Chul Yun

    2011-08-01

    Full Text Available Bacteriolytic myxobacteria have been known to secrete various antifungal metabolites against several soilborne phytopathogens including Phytophthora. Among the three isolates of Myxococcus spp., KYC 1126 and KYC 1136 perfectly inhibited the mycelial growth of Phytophtora capsici in vitro. In order to show the biocontrol activity on Phytophthora blight of hot pepper, we tried to find the best way of application of myxobacterial isolate. Although KYC 1126 fruiting body was easily grown on the colony of Escherichia coli as a nutrient source, it did not control the disease when it was pre-applied in soil. Before the bioassay of a liquid culture filtrate of KYC 1126 was conducted, its antifungal activity was confirmed on the seedlings applying with the mixture of the pathogen`s zoospore suspension and KYC 1126 filtrate. On greenhouse experiments with five and four replications, the control value of KYC 1126 on phyllosphere and rhizosphere was 88% and 36%, respectively. Whereas, the control value of dimetnomorph+propineb on phyllosphere was 100% and that of propamorcarb on rhizosphere was 44%. There was a phytotoxicity of the myxobacterial filtrate when seedlings were washed and soaked for 24 hours. Gummy materials were covered with roots. And stem and petiole were constricted, then a whole seedling was eventually blighted.

  3. Xanthusbase: adapting wikipedia principles to a model organism database

    OpenAIRE

    Arshinoff, Bradley I.; Suen, Garret; Just, Eric M.; Merchant, Sohel M.; Kibbe, Warren A.; Chisholm, Rex L.; Welch, Roy D.

    2006-01-01

    xanthusBase () is the official model organism database (MOD) for the social bacterium Myxococcus xanthus. In many respects, M.xanthus represents the pioneer model organism (MO) for studying the genetic, biochemical, and mechanistic basis of prokaryotic multicellularity, a topic that has garnered considerable attention due to the significance of biofilms in both basic and applied microbiology research. To facilitate its utility, the design of xanthusBase incorporates open-source software, leve...

  4. GenBank blastx search result: AK287540 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287540 J065011K01 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 0.0 0 ...

  5. GenBank blastn search result: AK241214 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241214 J065122P06 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 8e-18 1 -1 ...

  6. GenBank blastx search result: AK243510 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243510 J100075B22 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 2e-87 1 ...

  7. GenBank blastx search result: AK243527 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243527 J100075P16 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 1e-143 1 ...

  8. GenBank blastx search result: AK241214 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241214 J065122P06 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 1e-151 1 ...

  9. A generalization of Hamilton’s rule for the evolution of microbial cooperation

    OpenAIRE

    smith, jeff; Van Dyken, J. David; Zee, Peter

    2010-01-01

    Hamilton’s rule states that cooperation will evolve if the fitness cost to actors is less than the benefit to recipients multiplied by their genetic relatedness. This rule makes many simplifying assumptions, however, and does not accurately describe social evolution in organisms like microbes where selection is both strong and nonadditive. We derived a generalization of Hamilton’s rule and measured its parameters in Myxococcus xanthus bacteria. Nonadditivity made cooperative sporulation surpr...

  10. Dicty_cDB: Contig-U15795-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ... 60 2e-07 EF527414_1( EF527414 |pid:none) Aspergillus tubingensis strain V-0.....yces hygroscopicus strain... 59 5e-07 EF527413_1( EF527413 |pid:none) Aspergillus aff. tubingensis V-04-... ...00113_4409( CP000113 |pid:none) Myxococcus xanthus DK 1622, com... 59 7e-07 EF527412_1( EF527412 |pid:none) Aspergillus aff. tubing

  11. Electron tomography of cryofixed, isometrically contracting insect flight muscle reveals novel actin-myosin interactions.

    Directory of Open Access Journals (Sweden)

    Shenping Wu

    2010-09-01

    Full Text Available Isometric muscle contraction, where force is generated without muscle shortening, is a molecular traffic jam in which the number of actin-attached motors is maximized and all states of motor action are trapped with consequently high heterogeneity. This heterogeneity is a major limitation to deciphering myosin conformational changes in situ.We used multivariate data analysis to group repeat segments in electron tomograms of isometrically contracting insect flight muscle, mechanically monitored, rapidly frozen, freeze substituted, and thin sectioned. Improved resolution reveals the helical arrangement of F-actin subunits in the thin filament enabling an atomic model to be built into the thin filament density independent of the myosin. Actin-myosin attachments can now be assigned as weak or strong by their motor domain orientation relative to actin. Myosin attachments were quantified everywhere along the thin filament including troponin. Strong binding myosin attachments are found on only four F-actin subunits, the "target zone", situated exactly midway between successive troponin complexes. They show an axial lever arm range of 77°/12.9 nm. The lever arm azimuthal range of strong binding attachments has a highly skewed, 127° range compared with X-ray crystallographic structures. Two types of weak actin attachments are described. One type, found exclusively in the target zone, appears to represent pre-working-stroke intermediates. The other, which contacts tropomyosin rather than actin, is positioned M-ward of the target zone, i.e. the position toward which thin filaments slide during shortening.We present a model for the weak to strong transition in the myosin ATPase cycle that incorporates azimuthal movements of the motor domain on actin. Stress/strain in the S2 domain may explain azimuthal lever arm changes in the strong binding attachments. The results support previous conclusions that the weak attachments preceding force generation are very different from strong binding attachments.

  12. Electron Tomography of Cryofixed, Isometrically Contracting Insect Flight Muscle Reveals Novel Actin-Myosin Interactions

    International Nuclear Information System (INIS)

    Wu, Shenping; Liu, Jun; Reedy, Mary C.; Tregear, Richard T.; Winkler, Hanspeter; Franzini-Armstrong, Clara; Sasaki, Hiroyuki; Lucaveche, Carmen; Goldman, Yale E.; Reedy, Michael K.; Taylor, Kenneth A.

    2010-01-01

    Isometric muscle contraction, where force is generated without muscle shortening, is a molecular traffic jam in which the number of actin-attached motors is maximized and all states of motor action are trapped with consequently high heterogeneity. This heterogeneity is a major limitation to deciphering myosin conformational changes in situ. We used multivariate data analysis to group repeat segments in electron tomograms of isometrically contracting insect flight muscle, mechanically monitored, rapidly frozen, freeze substituted, and thin sectioned. Improved resolution reveals the helical arrangement of F-actin subunits in the thin filament enabling an atomic model to be built into the thin filament density independent of the myosin. Actin-myosin attachments can now be assigned as weak or strong by their motor domain orientation relative to actin. Myosin attachments were quantified everywhere along the thin filament including troponin. Strong binding myosin attachments are found on only four F-actin subunits, the 'target zone', situated exactly midway between successive troponin complexes. They show an axial lever arm range of 77 o /12.9 nm. The lever arm azimuthal range of strong binding attachments has a highly skewed, 127 o range compared with X-ray crystallographic structures. Two types of weak actin attachments are described. One type, found exclusively in the target zone, appears to represent pre-working-stroke intermediates. The other, which contacts tropomyosin rather than actin, is positioned M-ward of the target zone, i.e. the position toward which thin filaments slide during shortening. We present a model for the weak to strong transition in the myosin ATPase cycle that incorporates azimuthal movements of the motor domain on actin. Stress/strain in the S2 domain may explain azimuthal lever arm changes in the strong binding attachments. The results support previous conclusions that the weak attachments preceding force generation are very different from strong binding attachments.

  13. Architecture of the Vibrio cholerae toxin-coregulated pilus machine revealed by electron cryotomography

    DEFF Research Database (Denmark)

    Chang, Yi Wei; Kjær, Andreas; Ortega, Davi R.

    2017-01-01

    ,2. T4aP are more widespread and are involved in cell motility 3, DNA transfer 4, host predation 5 and electron transfer 6. T4bP are less prevalent and are mainly found in enteropathogenic bacteria, where they play key roles in host colonization 7. Following similar work on T4aP machines 8,9, here we...... sequence homology to components of the previously analysed Myxococcus xanthus T4aP machine (T4aPM), we find that their structures are nevertheless remarkably similar. Based on homologies with components of the M. xanthus T4aPM and additional reconstructions of TCPM mutants in which the non...

  14. A generalization of Hamilton's rule for the evolution of microbial cooperation.

    Science.gov (United States)

    Smith, Jeff; Van Dyken, J David; Zee, Peter C

    2010-06-25

    Hamilton's rule states that cooperation will evolve if the fitness cost to actors is less than the benefit to recipients multiplied by their genetic relatedness. This rule makes many simplifying assumptions, however, and does not accurately describe social evolution in organisms such as microbes where selection is both strong and nonadditive. We derived a generalization of Hamilton's rule and measured its parameters in Myxococcus xanthus bacteria. Nonadditivity made cooperative sporulation remarkably resistant to exploitation by cheater strains. Selection was driven by higher-order moments of population structure, not relatedness. These results provide an empirically testable cooperation principle applicable to both microbes and multicellular organisms and show how nonlinear interactions among cells insulate bacteria against cheaters.

  15. Complete genome sequence of the myxobacterium Sorangium cellulosum

    DEFF Research Database (Denmark)

    Schneiker, S; Perlova, O; Kaiser, O

    2007-01-01

    The genus Sorangium synthesizes approximately half of the secondary metabolites isolated from myxobacteria, including the anti-cancer metabolite epothilone. We report the complete genome sequence of the model Sorangium strain S. cellulosum Soce56, which produces several natural products and has...... morphological and physiological properties typical of the genus. The circular genome, comprising 13,033,779 base pairs, is the largest bacterial genome sequenced to date. No global synteny with the genome of Myxococcus xanthus is apparent, revealing an unanticipated level of divergence between...... these myxobacteria. A large percentage of the genome is devoted to regulation, particularly post-translational phosphorylation, which probably supports the strain's complex, social lifestyle. This regulatory network includes the highest number of eukaryotic protein kinase-like kinases discovered in any organism...

  16. Implementation of the agmatine-controlled expression system for inducible gene expression in Lactococcus lactis.

    Science.gov (United States)

    Linares, Daniel M; Alvarez-Sieiro, Patricia; del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Martin, Ma Cruz; Fernandez, Maria; Alvarez, Miguel A

    2015-12-30

    Lactococcus lactis has been safely consumed in fermented foods for millennia. This Gram-positive bacterium has now become of industrial importance as an expression host for the overproduction of lipopolysaccharide-free recombinant proteins used as food ingredients, therapeutic proteins and biotechnological enzymes. This paper reports an agmatine-controlled expression (ACE) system for L. lactis, comprising the lactococcal agmatine-sensor/transcriptional activator AguR and its target promoter P(aguB). The usefulness and efficiency of this system was checked via the reporter gene gfp and by producing PEP (Myxococcus xanthus prolyl-endopeptidase), an enzyme of biomedical interest able to degrade the immunotoxic peptides produced during the gastrointestinal breakdown of gluten. The ACE system developed in this work was suitable for the efficient expression of the functional recombinant proteins GFP and PEP. The expression system was tightly regulated by the agmatine concentration and allowed high protein production without leakiness.

  17. An evolutionary link between capsular biogenesis and surface motility in bacteria.

    Science.gov (United States)

    Agrebi, Rym; Wartel, Morgane; Brochier-Armanet, Céline; Mignot, Tâm

    2015-05-01

    Studying the evolution of macromolecular assemblies is important to improve our understanding of how complex cellular structures evolved, and to identify the functional building blocks that are involved. Recent studies suggest that the macromolecular complexes that are involved in two distinct processes in Myxococcus xanthus - surface motility and sporulation - are derived from an ancestral polysaccharide capsule assembly system. In this Opinion article, we argue that the available data suggest that the motility machinery evolved from this capsule assembly system following a gene duplication event, a change in carbohydrate polymer specificity and the acquisition of additional proteins by the motility complex, all of which are key features that distinguish the motility and sporulation systems. Furthermore, the presence of intermediates of these systems in bacterial genomes suggests a testable evolutionary model for their emergence and spread.

  18. Reversals and collisions optimize protein exchange in bacterial swarms

    Energy Technology Data Exchange (ETDEWEB)

    Amiri, Aboutaleb; Harvey, Cameron; Buchmann, Amy; Christley, Scott; Shrout, Joshua D.; Aranson, Igor S.; Alber, Mark

    2017-03-01

    Swarming groups of bacteria coordinate their behavior by self-organizing as a population to move over surfaces in search of nutrients and optimal niches for colonization. Many open questions remain about the cues used by swarming bacteria to achieve this self-organization. While chemical cue signaling known as quorum sensing is well-described, swarming bacteria often act and coordinate on time scales that could not be achieved via these extracellular quorum sensing cues. Here, cell-cell contact-dependent protein exchange is explored as amechanism of intercellular signaling for the bacterium Myxococcus xanthus. A detailed biologically calibrated computational model is used to study how M. xanthus optimizes the connection rate between cells and maximizes the spread of an extracellular protein within the population. The maximum rate of protein spreading is observed for cells that reverse direction optimally for swarming. Cells that reverse too slowly or too fast fail to spread extracellular protein efficiently. In particular, a specific range of cell reversal frequencies was observed to maximize the cell-cell connection rate and minimize the time of protein spreading. Furthermore, our findings suggest that predesigned motion reversal can be employed to enhance the collective behavior of biological synthetic active systems.

  19. Division of Labor in Biofilms: the Ecology of Cell Differentiation.

    Science.gov (United States)

    van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto

    2015-04-01

    The dense aggregation of cells on a surface, as seen in biofilms, inevitably results in both environmental and cellular heterogeneity. For example, nutrient gradients can trigger cells to differentiate into various phenotypic states. Not only do cells adapt physiologically to the local environmental conditions, but they also differentiate into cell types that interact with each other. This allows for task differentiation and, hence, the division of labor. In this article, we focus on cell differentiation and the division of labor in three bacterial species: Myxococcus xanthus, Bacillus subtilis, and Pseudomonas aeruginosa. During biofilm formation each of these species differentiates into distinct cell types, in some cases leading to cooperative interactions. The division of labor and the cooperative interactions between cell types are assumed to yield an emergent ecological benefit. Yet in most cases the ecological benefits have yet to be elucidated. A notable exception is M. xanthus, in which cell differentiation within fruiting bodies facilitates the dispersal of spores. We argue that the ecological benefits of the division of labor might best be understood when we consider the dynamic nature of both biofilm formation and degradation.

  20. Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglA.

    Science.gov (United States)

    Mauriello, Emilia M F; Mouhamar, Fabrice; Nan, Beiyan; Ducret, Adrien; Dai, David; Zusman, David R; Mignot, Tâm

    2010-01-20

    Gliding motility in the bacterium Myxococcus xanthus uses two motility engines: S-motility powered by type-IV pili and A-motility powered by uncharacterized motor proteins and focal adhesion complexes. In this paper, we identified MreB, an actin-like protein, and MglA, a small GTPase of the Ras superfamily, as essential for both motility systems. A22, an inhibitor of MreB cytoskeleton assembly, reversibly inhibited S- and A-motility, causing rapid dispersal of S- and A-motility protein clusters, FrzS and AglZ. This suggests that the MreB cytoskeleton is involved in directing the positioning of these proteins. We also found that a DeltamglA motility mutant showed defective localization of AglZ and FrzS clusters. Interestingly, MglA-YFP localization mimicked both FrzS and AglZ patterns and was perturbed by A22 treatment, consistent with results indicating that both MglA and MreB bind to motility complexes. We propose that MglA and the MreB cytoskeleton act together in a pathway to localize motility proteins such as AglZ and FrzS to assemble the A-motility machineries. Interestingly, M. xanthus motility systems, like eukaryotic systems, use an actin-like protein and a small GTPase spatial regulator.

  1. Inactivation of Stigmatella aurantiaca CsgA gene impares rippling formation

    Directory of Open Access Journals (Sweden)

    Milosevic-Đeric Ana

    2015-01-01

    Full Text Available Stigmatella aurantiaca fruiting body development depends on cell-cell interactions. One type of the signaling molecule stigmolone isolated from S. aurantiaca cells acts to help cells to stay together in the aggregation phase. Another gene product involved in intercellular signaling in S. aurantiaca is the csgA homolog of Myxococcus xanthus. In close relative M. xanthus C signal the product of the csgA gene is required for rippling, aggregation and sporulation. Isolation of homologous gene in S. aurantiaca implicates a probable role of CsgA in intercellular communication. Inactivation of the gene by insertion mutagenesis caused alterations in S. aurantiaca fruiting. The motility behavior of the cells during development was changed as well as their ability to stay more closely together in the early stages of development. Inactivation of the csgA gene completely abolished rippling of the cells. This indicates the crucial role of the CsgA protein in regulating this rhythmic behavior.

  2. Emergence and modular evolution of a novel motility machinery in bacteria.

    Directory of Open Access Journals (Sweden)

    Jennifer Luciano

    2011-09-01

    Full Text Available Bacteria glide across solid surfaces by mechanisms that have remained largely mysterious despite decades of research. In the deltaproteobacterium Myxococcus xanthus, this locomotion allows the formation stress-resistant fruiting bodies where sporulation takes place. However, despite the large number of genes identified as important for gliding, no specific machinery has been identified so far, hampering in-depth investigations. Based on the premise that components of the gliding machinery must have co-evolved and encode both envelope-spanning proteins and a molecular motor, we re-annotated known gliding motility genes and examined their taxonomic distribution, genomic localization, and phylogeny. We successfully delineated three functionally related genetic clusters, which we proved experimentally carry genes encoding the basal gliding machinery in M. xanthus, using genetic and localization techniques. For the first time, this study identifies structural gliding motility genes in the Myxobacteria and opens new perspectives to study the motility mechanism. Furthermore, phylogenomics provide insight into how this machinery emerged from an ancestral conserved core of genes of unknown function that evolved to gliding by the recruitment of functional modules in Myxococcales. Surprisingly, this motility machinery appears to be highly related to a sporulation system, underscoring unsuspected common mechanisms in these apparently distinct morphogenic phenomena.

  3. Indirect evolution of social fitness inequalities and facultative social exploitation.

    Science.gov (United States)

    Nair, Ramith R; Fiegna, Francesca; Velicer, Gregory J

    2018-03-28

    Microbial genotypes with similarly high proficiency at a cooperative behaviour in genetically pure groups often exhibit fitness inequalities caused by social interaction in mixed groups. Winning competitors in this scenario have been referred to as 'cheaters' in some studies. Such interaction-specific fitness inequalities, as well as social exploitation (in which interaction between genotypes increases absolute fitness), might evolve due to selection for competitiveness at the focal behaviour or might arise non-adaptively due to pleiotropy, hitchhiking or genetic drift. The bacterium Myxococcus xanthus sporulates during cooperative development of multicellular fruiting bodies. Using M. xanthus lineages that underwent experimental evolution in allopatry without selection on sporulation, we demonstrate that interaction-specific fitness inequalities and facultative social exploitation during development readily evolved indirectly among descendant lineages. Fitness inequalities between evolved genotypes were not caused by divergence in developmental speed, as faster-developing strains were not over-represented among competition winners. In competitions between ancestors and several evolved strains, all evolved genotypes produced more spores than the ancestors, including losers of evolved-versus-evolved competitions, indicating that adaptation in non-developmental contexts pleiotropically increased competitiveness for spore production. Overall, our results suggest that fitness inequalities caused by social interaction during cooperative processes may often evolve non-adaptively in natural populations. © 2018 The Authors.

  4. Bacterial Polymertropism, the Response to Strain-Induced Alignment of Polymers

    Science.gov (United States)

    Lemon, David J.

    In nature, bacteria often live in surface-associated communities known as biofilms. Biofilm-forming bacteria deposit a layer of polysaccharide on the surfaces they inhabit; hence, polysaccharide is their immediate environment on any surface. In this study, we examined how the physical characteristics of polysaccharide substrates influence the behavior of the biofilm-forming bacterium Myxococcus xanthus. M. xanthus colonies, and indeed those of the majority of biofilm-forming species tested, respond to the compression-induced deformation of polysaccharide substrates by preferentially spreading across the surface perpendicular to the axis of compression. This response is conserved across multiple distantly related phyla and is found in species with an array of distinct motility apparatuses.The birefringence and small angle X-ray scattering patterns of compressed polysaccharide substrates indicate that the directed surface movements of these bacteria consistently match the orientation of the long axes of aligned and tightly packed polysaccharide fibers in compressed substrates. Therefore, we refer to this behavior as polymertropism to denote that the directed movements are a response to the physical arrangement of the change in packing and alignment of the polymers in the substrate. In addition to altering the colony morphology we find the behavior of groups of cells, called flares, is also affected in several species resulting in increased flare speed, duration, and displacement on compressed gel substrates.We suggest that polymertropism, which requires a downward-facing motility apparatus in M. xanthus, may be responsible for the observed tendency of bacterial cells to follow trails of extruded and presumably aligned polysaccharides, which their neighbors secrete and deposit on the substrate as they move across it. Polymertropism may also play a role in the organization of bacteria in a biofilm, as the iterative process of polysaccharide trail deposition and

  5. Myxobacteria: moving, killing, feeding, and surviving together

    Directory of Open Access Journals (Sweden)

    José eMuñoz-Dorado

    2016-05-01

    Full Text Available Myxococcus xanthus, like other myxobacteria, is a social bacterium that moves and feeds cooperatively in predatory groups. On surfaces, rod-shaped vegetative cells move in search of the prey in a coordinated manner, forming dynamic multicellular groups referred to as swarms. Within the swarms, cells interact with one another and use two separate locomotion systems. Adventurous motility, which drives the movement of individual cells, is associated with the secretion of slime that forms trails at the leading edge of the swarms. It has been proposed that cellular traffic along these trails contributes to M. xanthus social behavior via stigmergic regulation. However, most of the cells travel in groups by using social motility, which is cell contact-dependent and requires a large number of individuals. Exopolysaccharides and the retraction of type IV pili at alternate poles of the cells are the engines associated with social motility. When the swarms encounter prey, the population of M. xanthus lyses and takes up nutrients from nearby cells. This cooperative and highly density-dependent feeding behavior has the advantage that the pool of hydrolytic enzymes and other secondary metabolites secreted by the entire group is shared by the community to optimize the use of the degradation products. This multicellular behavior is especially observed in the absence of nutrients. In this condition, M. xanthus swarms have the ability to organize the gliding movements of thousands of rods, synchronizing rippling waves of oscillating cells, to form macroscopic fruiting bodies, with three subpopulations of cells showing division of labor. A small fraction of cells either develop into resistant myxospores or remain as peripheral rods, while the majority of cells die, probably to provide nutrients to allow aggregation and spore differentiation. Sporulation within multicellular fruiting bodies has the benefit of enabling survival in hostile environments, and increases

  6. Use of microorganisms to improve the cementation of granular structures. Applications in the restoration of monuments

    Science.gov (United States)

    González, Isabel; Mayoral, Eduardo; Ortiz, Pilar; Segura, Dolores; Vazquez, Auxiliadora; Barba, Cinta; Ortiz, Rocio; Romero, Antonio

    2015-04-01

    This researching work focuses on the development of new procedures to be applied in heritage rehabilitation, through the implementation of low-cost biotechnological processes in the realm of engineering and architecture. In doing so, it explores the possibilities of MICP (Microbially Induced Calcite Precipitation), which is a biomineralization process applied to improve the engineering properties of granular structures. This is a novelty approach at present, as there are few researches putting together knowledge in biotechnology and mineralogy to by applied in architecture and engineer. Some authors propose the bacteria use to generate habitable structures that reduce desertification (Magnus Larsson 2008). Innovative research teams led by De Jong and the University of California UC Davis (XXXX) study how cement or stabilize soils to prevent landslides, improving the foundation injecting populations of Bacillus pasteurii in the field. Bacterially induced mineralization has emerged as a method for protecting and consolidating decayed ornamental stone, which offers noticeable advantages compared to traditional restoration procedures (Tiano et al., 1999). Castanier et al. (2000) found that Bacillus cereus was able to induce extracellular precipitation of calcium carbonate on decayed limestones. Rodriguez-Navarro et al. (2003) tested the ability of Myxococcus xanthus to induce calcium carbonate precipitation. Current studies are evaluating the potential of bacteria as self-healing agents for the autonomous decrease of permeability of concrete upon crack formation (De Muynck, et al 2010) In the urban area of Seville, most historical buildings are constructed with calcarenites, limestones, sandstones and bricks, the weathering forms associated to this building materials often are granular disintegration, so the proposed technology has a huge potential to be applied to these materials for possible restoration. This research is mainly grounded on laboratory work, which

  7. Exploitative and hierarchical antagonism in a cooperative bacterium.

    Directory of Open Access Journals (Sweden)

    Francesca Fiegna

    2005-11-01

    Full Text Available Social organisms that cooperate with some members of their own species, such as close relatives, may fail to cooperate with other genotypes of the same species. Such noncooperation may take the form of outright antagonism or social exploitation. Myxococcus xanthus is a highly social prokaryote that cooperatively develops into spore-bearing, multicellular fruiting bodies in response to starvation. Here we have characterized the nature of social interactions among nine developmentally proficient strains of M. xanthus isolated from spatially distant locations. Strains were competed against one another in all possible pairwise combinations during starvation-induced development. In most pairings, at least one competitor exhibited strong antagonism toward its partner and a majority of mixes showed bidirectional antagonism that decreased total spore production, even to the point of driving whole populations to extinction. Differential response to mixing was the primary determinant of competitive superiority rather than the sporulation efficiencies of unmixed populations. In some competitive pairings, the dominant partner sporulated more efficiently in mixed populations than in clonal isolation. This finding represents a novel form of exploitation in bacteria carried out by socially competent genotypes and is the first documentation of social exploitation among natural bacterial isolates. Patterns of antagonistic superiority among these strains form a highly linear dominance hierarchy. At least some competition pairs construct chimeric, rather than segregated, fruiting bodies. The cooperative prokaryote M. xanthus has diverged into a large number of distinct social types that cooperate with clone-mates but exhibit intense antagonism toward distinct social types of the same species. Most lengthy migration events in nature may thus result in strong antagonism between migratory and resident populations, and this antagonism may have large effects on local

  8. Identification of proteins likely to be involved in morphogenesis, cell division, and signal transduction in Planctomycetes by comparative genomics.

    Science.gov (United States)

    Jogler, Christian; Waldmann, Jost; Huang, Xiaoluo; Jogler, Mareike; Glöckner, Frank Oliver; Mascher, Thorsten; Kolter, Roberto

    2012-12-01

    Members of the Planctomycetes clade share many unusual features for bacteria. Their cytoplasm contains membrane-bound compartments, they lack peptidoglycan and FtsZ, they divide by polar budding, and they are capable of endocytosis. Planctomycete genomes have remained enigmatic, generally being quite large (up to 9 Mb), and on average, 55% of their predicted proteins are of unknown function. Importantly, proteins related to the unusual traits of Planctomycetes remain largely unknown. Thus, we embarked on bioinformatic analyses of these genomes in an effort to predict proteins that are likely to be involved in compartmentalization, cell division, and signal transduction. We used three complementary strategies. First, we defined the Planctomycetes core genome and subtracted genes of well-studied model organisms. Second, we analyzed the gene content and synteny of morphogenesis and cell division genes and combined both methods using a "guilt-by-association" approach. Third, we identified signal transduction systems as well as sigma factors. These analyses provide a manageable list of candidate genes for future genetic studies and provide evidence for complex signaling in the Planctomycetes akin to that observed for bacteria with complex life-styles, such as Myxococcus xanthus.

  9. The small G-protein MglA connects to the MreB actin cytoskeleton at bacterial focal adhesions.

    Science.gov (United States)

    Treuner-Lange, Anke; Macia, Eric; Guzzo, Mathilde; Hot, Edina; Faure, Laura M; Jakobczak, Beata; Espinosa, Leon; Alcor, Damien; Ducret, Adrien; Keilberg, Daniela; Castaing, Jean Philippe; Lacas Gervais, Sandra; Franco, Michel; Søgaard-Andersen, Lotte; Mignot, Tâm

    2015-07-20

    In Myxococcus xanthus the gliding motility machinery is assembled at the leading cell pole to form focal adhesions, translocated rearward to propel the cell, and disassembled at the lagging pole. We show that MglA, a Ras-like small G-protein, is an integral part of this machinery. In this function, MglA stimulates the assembly of the motility complex by directly connecting it to the MreB actin cytoskeleton. Because the nucleotide state of MglA is regulated spatially and MglA only binds MreB in the guanosine triphosphate-bound form, the motility complexes are assembled at the leading pole and dispersed at the lagging pole where the guanosine triphosphatase activating protein MglB disrupts the MglA-MreB interaction. Thus, MglA acts as a nucleotide-dependent molecular switch to regulate the motility machinery spatially. The function of MreB in motility is independent of its function in peptidoglycan synthesis, representing a coopted function. Our findings highlight a new function for the MreB cytoskeleton and suggest that G-protein-cytoskeleton interactions are a universally conserved feature. © 2015 Treuner-Lange et al.

  10. Cloning and expression of isocitrate lyase from human round worm Strongyloides stercoralis

    Directory of Open Access Journals (Sweden)

    Siddiqui A.A.

    2000-09-01

    Full Text Available A full length cDNA (1463 bp encoding isocitrate lyase (EC 4.1.3.1 of Strongyloides stercoralis is described. The nucleotide sequence of this insert identified a cDNA coding for the isocitrate lyase. The conceptually translated amino acid sequence of the open reading frame for S. stercoralis isocitrate lyase encodes a 450 amino acid residue protein with an apparent molecular weight of 50 kDa and a predicted pl of 6.39. The sequence is 69 % A/T, reflecting a characteristic A/T codon bias of S. stercoralis. The amino acid sequence of S. stercoralis isocitrate lyase is compared with bifunctional glyoxylate cycle protein of Caenorhabditis elegans and isocitrate lyases from Chlamydomonas reinhardtii and Myxococcus xanthus. The full length cDNA of S. stercoralis was expressed in pRSET vector and bacteriophage T7 promoter based expression system. S. stercoralis lyase recombinant protein, purified via immobilized metal affinity chromatography, showed a molecular mass of 50 kDa on polyacrylamide gels. The role of isocitrate lyase in the glyoxylate cycle and energy metabolism of S. stercoralis is also discussed.

  11. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

    Science.gov (United States)

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

    2012-09-28

    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  12. Cytoprophet: a Cytoscape plug-in for protein and domain interaction networks inference.

    Science.gov (United States)

    Morcos, Faruck; Lamanna, Charles; Sikora, Marcin; Izaguirre, Jesús

    2008-10-01

    Cytoprophet is a software tool that allows prediction and visualization of protein and domain interaction networks. It is implemented as a plug-in of Cytoscape, an open source software framework for analysis and visualization of molecular networks. Cytoprophet implements three algorithms that predict new potential physical interactions using the domain composition of proteins and experimental assays. The algorithms for protein and domain interaction inference include maximum likelihood estimation (MLE) using expectation maximization (EM); the set cover approach maximum specificity set cover (MSSC) and the sum-product algorithm (SPA). After accepting an input set of proteins with Uniprot ID/Accession numbers and a selected prediction algorithm, Cytoprophet draws a network of potential interactions with probability scores and GO distances as edge attributes. A network of domain interactions between the domains of the initial protein list can also be generated. Cytoprophet was designed to take advantage of the visual capabilities of Cytoscape and be simple to use. An example of inference in a signaling network of myxobacterium Myxococcus xanthus is presented and available at Cytoprophet's website. http://cytoprophet.cse.nd.edu.

  13. Evolution and Design Governing Signal Precision and Amplification in a Bacterial Chemosensory Pathway.

    Directory of Open Access Journals (Sweden)

    Mathilde Guzzo

    2015-08-01

    Full Text Available Understanding the principles underlying the plasticity of signal transduction networks is fundamental to decipher the functioning of living cells. In Myxococcus xanthus, a particular chemosensory system (Frz coordinates the activity of two separate motility systems (the A- and S-motility systems, promoting multicellular development. This unusual structure asks how signal is transduced in a branched signal transduction pathway. Using combined evolution-guided and single cell approaches, we successfully uncoupled the regulations and showed that the A-motility regulation system branched-off an existing signaling system that initially only controlled S-motility. Pathway branching emerged in part following a gene duplication event and changes in the circuit structure increasing the signaling efficiency. In the evolved pathway, the Frz histidine kinase generates a steep biphasic response to increasing external stimulations, which is essential for signal partitioning to the motility systems. We further show that this behavior results from the action of two accessory response regulator proteins that act independently to filter and amplify signals from the upstream kinase. Thus, signal amplification loops may underlie the emergence of new connectivity in signal transduction pathways.

  14. A guild of 45 CRISPR-associated (Cas protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Daniel H Haft

    2005-11-01

    Full Text Available Clustered regularly interspaced short palindromic repeats (CRISPRs are a family of DNA direct repeats found in many prokaryotic genomes. Repeats of 21-37 bp typically show weak dyad symmetry and are separated by regularly sized, nonrepetitive spacer sequences. Four CRISPR-associated (Cas protein families, designated Cas1 to Cas4, are strictly associated with CRISPR elements and always occur near a repeat cluster. Some spacers originate from mobile genetic elements and are thought to confer "immunity" against the elements that harbor these sequences. In the present study, we have systematically investigated uncharacterized proteins encoded in the vicinity of these CRISPRs and found many additional protein families that are strictly associated with CRISPR loci across multiple prokaryotic species. Multiple sequence alignments and hidden Markov models have been built for 45 Cas protein families. These models identify family members with high sensitivity and selectivity and classify key regulators of development, DevR and DevS, in Myxococcus xanthus as Cas proteins. These identifications show that CRISPR/cas gene regions can be quite large, with up to 20 different, tandem-arranged cas genes next to a repeat cluster or filling the region between two repeat clusters. Distinctive subsets of the collection of Cas proteins recur in phylogenetically distant species and correlate with characteristic repeat periodicity. The analyses presented here support initial proposals of mobility of these units, along with the likelihood that loci of different subtypes interact with one another as well as with host cell defensive, replicative, and regulatory systems. It is evident from this analysis that CRISPR/cas loci are larger, more complex, and more heterogeneous than previously appreciated.

  15. Cell rejuvenation and social behaviors promoted by LPS exchange in myxobacteria.

    Science.gov (United States)

    Vassallo, Christopher; Pathak, Darshankumar T; Cao, Pengbo; Zuckerman, David M; Hoiczyk, Egbert; Wall, Daniel

    2015-06-02

    Bacterial cells in their native environments must cope with factors that compromise the integrity of the cell. The mechanisms of coping with damage in a social or multicellular context are poorly understood. Here we investigated how a model social bacterium, Myxococcus xanthus, approaches this problem. We focused on the social behavior of outer membrane exchange (OME), in which cells transiently fuse and exchange their outer membrane (OM) contents. This behavior requires TraA, a homophilic cell surface receptor that identifies kin based on similarities in a polymorphic region, and the TraB cohort protein. As observed by electron microscopy, TraAB overexpression catalyzed a prefusion OM junction between cells. We then showed that damage sustained by the OM of one population was repaired by OME with a healthy population. Specifically, LPS mutants that were defective in motility and sporulation were rescued by OME with healthy donors. In addition, a mutant with a conditional lethal mutation in lpxC, an essential gene required for lipid A biosynthesis, was rescued by Tra-dependent interactions with a healthy population. Furthermore, lpxC cells with damaged OMs, which were more susceptible to antibiotics, had resistance conferred to them by OME with healthy donors. We also show that OME has beneficial fitness consequences to all cells. Here, in merged populations of damaged and healthy cells, OME catalyzed a dilution of OM damage, increasing developmental sporulation outcomes of the combined population by allowing it to reach a threshold density. We propose that OME is a mechanism that myxobacteria use to overcome cell damage and to transition to a multicellular organism.

  16. Influence of substrate mineralogy on bacterial mineralization of calcium carbonate: implications for stone conservation.

    Science.gov (United States)

    Rodriguez-Navarro, Carlos; Jroundi, Fadwa; Schiro, Mara; Ruiz-Agudo, Encarnación; González-Muñoz, María Teresa

    2012-06-01

    The influence of mineral substrate composition and structure on bacterial calcium carbonate productivity and polymorph selection was studied. Bacterial calcium carbonate precipitation occurred on calcitic (Iceland spar single crystals, marble, and porous limestone) and silicate (glass coverslips, porous sintered glass, and quartz sandstone) substrates following culturing in liquid medium (M-3P) inoculated with different types of bacteria (Myxococcus xanthus, Brevundimonas diminuta, and a carbonatogenic bacterial community isolated from porous calcarenite stone in a historical building) and direct application of sterile M-3P medium to limestone and sandstone with their own bacterial communities. Field emission scanning electron microscopy (FESEM), atomic force microscopy (AFM), powder X-ray diffraction (XRD), and 2-dimensional XRD (2D-XRD) analyses revealed that abundant highly oriented calcite crystals formed homoepitaxially on the calcitic substrates, irrespective of the bacterial type. Conversely, scattered spheroidal vaterite entombing bacterial cells formed on the silicate substrates. These results show that carbonate phase selection is not strain specific and that under equal culture conditions, the substrate type is the overruling factor for calcium carbonate polymorph selection. Furthermore, carbonate productivity is strongly dependent on the mineralogy of the substrate. Calcitic substrates offer a higher affinity for bacterial attachment than silicate substrates, thereby fostering bacterial growth and metabolic activity, resulting in higher production of calcium carbonate cement. Bacterial calcite grows coherently over the calcitic substrate and is therefore more chemically and mechanically stable than metastable vaterite, which formed incoherently on the silicate substrates. The implications of these results for technological applications of bacterial carbonatogenesis, including building stone conservation, are discussed.

  17. Sensory Transduction in Microorganisms 2008 Gordon Research Conference (January 2008)

    Energy Technology Data Exchange (ETDEWEB)

    Ann M. Stock

    2009-04-08

    Research into the mechanisms involved in the sensing and responses of microorganisms to changes in their environments is currently very active in a large number of laboratories worldwide. An increasingly wide range of prokaryotic and eukaryotic species are being studied with regard to their sensing of diverse chemical and physical stimuli, including nutrients, toxins, intercellular signaling molecules, redox indicators, light, pressure, magnetic fields, and surface contact, leading to adaptive responses affecting motile behavior, gene expression and/or development. The ease of manipulation of microorganisms has facilitated application of a broad range of techniques that have provided comprehensive descriptions of cellular behavior and its underlying molecular mechanisms. Systems and their molecular components have been probed at levels ranging from the whole organism down to atomic resolution using behavioral analyses; electrophysiology; genetics; molecular biology; biochemical and biophysical characterization; structural biology; single molecule, fluorescence and cryo-electron microscopy; computational modeling; bioinformatics and genomic analyses. Several model systems such as bacterial chemotaxis and motility, fruiting body formation in Myxococcus xanthus, and motility and development in Dictyostelium discoideum have traditionally been a focus of this meeting. By providing a basis for assessment of similarities and differences in mechanisms, understanding of these pathways has advanced the study of many other microbial sensing systems. This conference aims to bring together researchers investigating different prokaryotic and eukaryotic microbial systems using diverse approaches to compare data, share methodologies and ideas, and seek to understand the fundamental principles underlying sensory responses. Topic areas include: (1) Receptor Sensing and Signaling; (2) Intracellular Signaling (two-component, c-di-GMP, c-AMP, etc.); (3) Intracellular Localization and

  18. Segmental isotope labeling of proteins for NMR structural study using a protein S tag for higher expression and solubility

    International Nuclear Information System (INIS)

    Kobayashi, Hiroshi; Swapna, G. V. T.; Wu, Kuen-Phon; Afinogenova, Yuliya; Conover, Kenith; Mao, Binchen; Montelione, Gaetano T.; Inouye, Masayori

    2012-01-01

    A common obstacle to NMR studies of proteins is sample preparation. In many cases, proteins targeted for NMR studies are poorly expressed and/or expressed in insoluble forms. Here, we describe a novel approach to overcome these problems. In the protein S tag-intein (PSTI) technology, two tandem 92-residue N-terminal domains of protein S (PrS 2 ) from Myxococcus xanthus is fused at the N-terminal end of a protein to enhance its expression and solubility. Using intein technology, the isotope-labeled PrS 2 -tag is replaced with non-isotope labeled PrS 2 -tag, silencing the NMR signals from PrS 2 -tag in isotope-filtered 1 H-detected NMR experiments. This method was applied to the E. coli ribosome binding factor A (RbfA), which aggregates and precipitates in the absence of a solubilization tag unless the C-terminal 25-residue segment is deleted (RbfAΔ25). Using the PrS 2 -tag, full-length well-behaved RbfA samples could be successfully prepared for NMR studies. PrS 2 (non-labeled)-tagged RbfA (isotope-labeled) was produced with the use of the intein approach. The well-resolved TROSY-HSQC spectrum of full-length PrS 2 -tagged RbfA superimposes with the TROSY-HSQC spectrum of RbfAΔ25, indicating that PrS 2 -tag does not affect the structure of the protein to which it is fused. Using a smaller PrS-tag, consisting of a single N-terminal domain of protein S, triple resonance experiments were performed, and most of the backbone 1 H, 15 N and 13 C resonance assignments for full-length E. coli RbfA were determined. Analysis of these chemical shift data with the Chemical Shift Index and heteronuclear 1 H– 15 N NOE measurements reveal the dynamic nature of the C-terminal segment of the full-length RbfA protein, which could not be inferred using the truncated RbfAΔ25 construct. CS-Rosetta calculations also demonstrate that the core structure of full-length RbfA is similar to that of the RbfAΔ25 construct.

  19. Analysis of cryopreparated non-dehydrated sample systems by means of a newly developed Tof-SIMS instrument with integrated high-vacuum cutting apparature

    International Nuclear Information System (INIS)

    Moeller, Joerg

    2008-01-01

    Aim of the present thesis was to construct an analysis apparatus, which allows to perform on cryofixed samples a cryocutting respectively cryocracking preparation under vacuum conditions and in the following perform a Tof-SIMS analysis

  20. Analysis of cryopreparated non-dehydrated sample systems by means of a newly developed Tof-SIMS instrument with integrated high-vacuum cutting apparature; Analysen kryopraeparierter nicht-dehydrierter Probensysteme mit Hilfe eines neu entwickelten ToF-SIMS-Instruments mit integrierter Hochvakuumkryoschnittapparatur

    Energy Technology Data Exchange (ETDEWEB)

    Moeller, Joerg

    2008-12-05

    Aim of the present thesis was to construct an analysis apparatus, which allows to perform on cryofixed samples a cryocutting respectively cryocracking preparation under vacuum conditions and in the following perform a Tof-SIMS analysis.

  1. Assessment of different sample preparation routes for mass spectrometric monitoring and imaging of lipids in bone cells via ToF-SIMS

    Science.gov (United States)

    Schaepe, Kaija; Kokesch-Himmelreich, Julia; Rohnke, Marcus; Wagner, Alena-Svenja; Schaaf, Thimo; Wenisch, Sabine; Janek, Jürgen

    2015-01-01

    In ToF-SIMS analysis, the experimental outcome from cell experiments is to a great extent influenced by the sample preparation routine. In order to better judge this critical influence in the case of lipid analysis, a detailed comparison of different sample preparation routines is performed—aiming at an optimized preparation routine for systematic lipid imaging of cell cultures. For this purpose, human mesenchymal stem cells were analyzed: (a) as chemically fixed, (b) freeze-dried, and (c) frozen-hydrated. For chemical fixation, different fixatives, i.e., glutaraldehyde, paraformaldehyde, and a mixture of both, were tested with different postfixative handling procedures like storage in phosphate buffered saline, water or critical point drying. Furthermore, secondary lipid fixation via osmium tetroxide was taken into account and the effect of an ascending alcohol series with and without this secondary lipid fixation was evaluated. Concerning freeze-drying, three different postprocessing possibilities were examined. One can be considered as a pure cryofixation technique while the other two routes were based on chemical fixation. Cryofixation methods known from literature, i.e., freeze-fracturing and simple frozen-hydrated preparation, were also evaluated to complete the comparison of sample preparation techniques. Subsequent data evaluation of SIMS spectra in both, positive and negative, ion mode was performed via principal component analysis by use of peak sets representative for lipids. For freeze-fracturing, these experiments revealed poor reproducibility making this preparation route unsuitable for systematic investigations and statistic data evaluation. Freeze-drying after cryofixation showed improved reproducibility and well preserved lipid contents while the other freeze-drying procedures showed drawbacks in one of these criteria. In comparison, chemical fixation techniques via glutar- and/or paraformaldehyde proved most suitable in terms of reproducibility

  2. Enhanced resolution of membranes in cultured cells by cryoimmobilization and freeze-substitution.

    Science.gov (United States)

    Wild, P; Schraner, E M; Adler, H; Humbel, B M

    2001-05-15

    Investigations of cellular processes demand immediate arresting of the process at any given time and excellent retention of cellular material and excellent visibility of membranes. To achieve this goal we used cryofixation to arrest cellular processes instantly and tested diverse freeze-substitution protocols. Madin-Darby kidney cells and Vero cells were grown on carbon-coated sapphire disks. For cryofixation the sapphire disks covered with a cell monolayer were injected with the aid of a guillotine into liquid propane or ethane or a mixture of both cooled by liquid nitrogen. Freezing of the cryogen was prevented by using a partially insulated cylinder and by vigorous stirring that results in a substantial decrement of the freezing point of the cryogen. Cell monolayers can be cryofixed successfully using the guillotine in a safety hood at ambient temperature and humidity or at 37 degrees C and 45% humidity. The freezing unit can also be placed in a laminar flow for working under biohazard conditions. For visualizing cell membranes at high contrast and high resolution, cells were substituted in the presence of various concentrations of glutaraldehyde and osmium tetroxide and the temperature was raised to diverse final temperatures. Substitution for 4 hours at -90 degrees C in anhydrous acetone containing 0.25% anhydrous glutaraldehyde and 0.5% osmium tetroxide followed by a temperature rise of 5 degrees C/hour to 0 degrees C and final incubation for 1 hour at 0 degrees C resulted in high contrast and excellent visibility of subcellular components at the level of the membrane bilayer. The high spatial and temporal resolution makes this methodology an excellent tool for studying cell membrane-bound processes, such as virus-cell interactions. Copyright 2001 Wiley-Liss, Inc.

  3. Effects of different fixation and freeze substitution methods on the ultrastructural preservation of ZYMV-infected Cucurbita pepo (L.) leaves.

    Science.gov (United States)

    Zechmann, Bernd; Müller, Maria; Zellnig, Günther

    2005-08-01

    Different fixation protocols [chemical fixation, plunge and high pressure freezing (HPF)] were used to study the effects of Zucchini yellow mosaic virus (ZYMV) disease on the ultrastructure of adult leaves of Styrian oil pumpkin plants (Cucurbita pepo L. subsp. pepo var. styriaca Greb.) with the transmission electron microscope. Additionally, different media were tested for freeze substitution (FS) to evaluate differences in the ultrastructural preservation of cryofixed plant leaf cells. FS was either performed in (i) 2% osmium tetroxide in anhydrous acetone containing 0.2% uranyl acetate, (ii) 0.01% safranin in anhydrous acetone, (iii) 0.5% glutaraldehyde in anhydrous acetone or (iv) anhydrous acetone. No ultrastructural differences were found in well-preserved cells of plunge and high pressure frozen samples. Cryofixed cells showed a finer granulated cytosol and smoother membranes, than what was found in chemically fixed samples. HPF led in comparison to plunge frozen plant material to an excellent preservation of vascular bundle cells. The use of FS-media such as anhydrous acetone, 0.01% safranin and 0.5% glutaraldehyde led to low membrane contrast and did not preserve the inner fine structures of mitochondria. Additionally, the use of 0.5% glutaraldehyde caused the cytosol to be fuzzy and partly loosened. ZYMV-induced ultrastructural alterations like cylindrical inclusions and dilated ER-cisternae did not differ between chemically fixed and cryofixed cells and were found within the cytosol of infected leaf cells and within sieve tube elements. The results demonstrate specific structural differences depending on the FS-medium used, which has to be considered for investigations of selected cell structures.

  4. AcEST: DK955250 [AcEST

    Lifescience Database Archive (English)

    Full Text Available S=Myxococcus xan... 31 5.1 sp|Q5QXV0|RL17_IDILO 50S ribosomal protein L17 OS=Idiomarina loi... 31 5.1 sp|Q8WXX7|AUTS2_HUMAN Autism...APMAYIELVGRP 119 >sp|Q8WXX7|AUTS2_HUMAN Autism susceptibility gene 2 protein OS=Homo sapiens GN=AUTS2 PE=2 S

  5. Cryo-transmission electron microscopy of a superstructure of fluid dioleoylphosphatidylcholine (DOPC) membranes

    DEFF Research Database (Denmark)

    Klösgen, B; Helfrich, W

    1997-01-01

    a porous technical membrane. Sampling and cryofixation took place at various times within 3 weeks after the preparation. From the micrographs we infer that the small fraction of vesicles enclosing one another develop passages (connections) between the bilayers. In contrast, the superstructure is basically...... a feature of disconnected membranes. Among its modifications are isolated membrane bends or folds and a grainy membrane texture with a minimal grain spacing of 4-6 nm. In the extruded dispersions the passages and the superstructure seem to be formed mostly within the first day. The fraction of smooth...

  6. Recent applications of X-ray microanalysis in muscle pathology

    International Nuclear Information System (INIS)

    Wroblewski, R.; Edstrom, L.

    1984-01-01

    X-ray microanalysis of single muscle fibres visualized in the scanning- and scanning-transmission mode of electron microscopy has been applied to human muscle biopsies to quantify changes of intracellular elements in different muscle disorders. To detect elements representing diffusible ions, cryofixation and cryosectioning was performed and analyses were conducted on freeze-dried cryosections 6μm thick. Changes in the concentration of elements were found to differentiate certain muscular disorders. A large increase in sodium (Na) and chlorine (Cl), and a decrease in potassium (K) was typical of myotubular myopathy, while a moderate increase in Na and Cl was found in central core disease and nemaline myopathy

  7. Mass spectrometric characterization of elements and molecules in cell cultures and tissues

    International Nuclear Information System (INIS)

    Arlinghaus, H.F.; Kriegeskotte, C.; Fartmann, M.; Wittig, A.; Sauerwein, W.; Lipinsky, D.

    2006-01-01

    Time-of-flight secondary ion mass spectrometry (ToF-SIMS) and laser post-ionization secondary neutral mass spectrometry (laser-SNMS) have been used to image and quantify targeted compounds, intrinsic elements and molecules with subcellular resolution in single cells of both cell cultures and tissues. Special preparation procedures for analyzing cell cultures and tissue materials were developed. Cancer cells type MeWo, incubated with boronated compounds, were sandwiched between two substrates, cryofixed, freeze-fractured and freeze-dried. Also, after injection with boronated compounds, different types of mouse tissues were extracted, prepared on a special specimen carrier and plunged with high velocity into LN 2 -cooled propane for cryofixation. After trimming, these tissue blocks were freeze-dried. The measurements of the K/Na ratio demonstrated that for both cell cultures and tissue materials the special preparation techniques used were appropriate for preserving the chemical and structural integrity of the living cell. The boron images show inter- and intracellular boron signals with different intensities. Molecular images show distinct features partly correlated with the cell structure. A comparison between laser-SNMS and ToF-SIMS showed that especially laser-SNMS is particularly well-suited for identifying specific cell structures and imaging ultratrace element concentrations in tissues

  8. SEM investigation of heart tissue samples

    Energy Technology Data Exchange (ETDEWEB)

    Saunders, R; Amoroso, M [Physics Department, University of the West Indies, St. Augustine, Trinidad and Tobago, West Indies (Trinidad and Tobago)

    2010-07-01

    We used the scanning electron microscope to examine the cardiac tissue of a cow (Bos taurus), a pig (Sus scrofa), and a human (Homo sapiens). 1mm{sup 3} blocks of left ventricular tissue were prepared for SEM scanning by fixing in 96% ethanol followed by critical point drying (cryofixation), then sputter-coating with gold. The typical ridged structure of the myofibrils was observed for all the species. In addition crystal like structures were found in one of the samples of the heart tissue of the pig. These structures were investigated further using an EDVAC x-ray analysis attachment to the SEM. Elemental x-ray analysis showed highest peaks occurred for gold, followed by carbon, oxygen, magnesium and potassium. As the samples were coated with gold for conductivity, this highest peak is expected. Much lower peaks at carbon, oxygen, magnesium and potassium suggest that a cystallized salt such as a carbonate was present in the tissue before sacrifice.

  9. SEM investigation of heart tissue samples

    International Nuclear Information System (INIS)

    Saunders, R; Amoroso, M

    2010-01-01

    We used the scanning electron microscope to examine the cardiac tissue of a cow (Bos taurus), a pig (Sus scrofa), and a human (Homo sapiens). 1mm 3 blocks of left ventricular tissue were prepared for SEM scanning by fixing in 96% ethanol followed by critical point drying (cryofixation), then sputter-coating with gold. The typical ridged structure of the myofibrils was observed for all the species. In addition crystal like structures were found in one of the samples of the heart tissue of the pig. These structures were investigated further using an EDVAC x-ray analysis attachment to the SEM. Elemental x-ray analysis showed highest peaks occurred for gold, followed by carbon, oxygen, magnesium and potassium. As the samples were coated with gold for conductivity, this highest peak is expected. Much lower peaks at carbon, oxygen, magnesium and potassium suggest that a cystallized salt such as a carbonate was present in the tissue before sacrifice.

  10. Imaging the Dynamics of Cell Wall Polymer Deposition in the Unicellular Model Plant, Penium margaritaceum.

    Science.gov (United States)

    Domozych, David; Lietz, Anna; Patten, Molly; Singer, Emily; Tinaz, Berke; Raimundo, Sandra C

    2017-01-01

    The unicellular green alga, Penium margaritaceum, represents a novel and valuable model organism for elucidating cell wall dynamics in plants. This organism's cell wall contains several polymers that are highly similar to those found in the primary cell walls of land plants. Penium is easily grown in laboratory culture and is effectively manipulated in various experimental protocols including microplate assays and correlative microscopy. Most importantly, Penium can be live labeled with cell wall-specific antibodies or other probes and returned to culture where specific cell wall developmental events can be monitored. Additionally, live cells can be rapidly cryo-fixed and cell wall surface microarchitecture can be observed with variable pressure scanning electron microscopy. Here, we describe the methodology for maintaining Penium for experimental cell wall enzyme studies.

  11. Distributions of elements in the human retinal pigment epithelium

    International Nuclear Information System (INIS)

    Ulshafer, R.J.; Allen, C.B.; Rubin, M.L.

    1990-01-01

    Distributions of elements above the atomic number of sodium were mapped in the retinal pigment epithelia of eight human eyes. X-ray energy spectra and maps were collected from cryofixed, freeze-dried, and epoxy-embedded tissues using energy-dispersive x-ray microanalysis. All eyes had high concentrations of phosphorus in the nuclei of retinal pigment epithelial cells. Melanosomes were rich in sulfur, zinc, calcium, and iron. Lipofuscin and cytoplasm contained only phosphorus and sulfur in detectable amounts. Drusen, when present, contained phosphorus and calcium. Six eyes had a prominent aluminum peak recorded from melanosomes, nuclei, and Bruch's membrane. In one pair of 90-year-old eyes, small, electron-dense deposits surrounded many melanosomes and contained mercury and selenium. Retinal pigment epithelial melanosomes may bind and accumulate metals and other potentially toxic ions over time, preventing them from reaching the neural retina

  12. Subsurface Examination of a Foliar Biofilm Using Scanning Electron- and Focused-Ion-Beam Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, Patricia K.; Arey, Bruce W.; Mahaffee, Walt F.

    2011-08-01

    The dual beam scanning electron microscope, equipped with both a focused ion- and scanning electron- beam (FIB SEM) is a novel tool for the exploration of the subsurface structure of biological tissues. The FIB can remove a predetermined amount of material from a selected site to allow for subsurface exploration and when coupled with SEM or scanning ion- beam microscopy (SIM) could be suitable to examine the subsurface structure of bacterial biofilms on the leaf surface. The suitability of chemical and cryofixation was examined for use with the FIB SEM to examine bacterial biofilms on leaf surfaces. The biological control agent, Burkholderia pyroccinia FP62, that rapidly colonizes the leaf surface and forms biofilms, was inoculated onto geranium leaves and incubated in a greenhouse for 7 or 14 days. Cryofixation was not suitable for examination of leaf biofilms because it created a frozen layer over the leaf surface that cracked when exposed to the electron beam and the protective cap required for FIB milling could not be accurately deposited. With chemically fixed samples, it was possible to precisely FIB mill a single cross section (5 µm) or sequential cross sections from a single site without any damage to the surrounding surface. Biofilms, 7 days post-inoculation (DPI), were composed of 2 to 5 bacterial cell layers while biofilms 14 DPI ranged from 5 to greater than 30 cell layers. Empty spaces between bacteria cells in the subsurface structure were observed in biofilms 7- and 14-DPI. Sequential cross sections inferred that the empty spaces were often continuous between FP62 cells and could possibly make up a network of channels throughout the biofilm. FIB SEM was a useful tool to observe the subsurface composition of a foliar biofilm.

  13. Microbial F-type lectin domains with affinity for blood group antigens.

    Science.gov (United States)

    Mahajan, Sonal; Khairnar, Aasawari; Bishnoi, Ritika; Ramya, T N C

    2017-09-23

    F-type lectins are fucose binding lectins with characteristic fucose binding and calcium binding motifs. Although they occur with a selective distribution in viruses, prokaryotes and eukaryotes, most biochemical studies have focused on vertebrate F-type lectins. Recently, using sensitive bioinformatics search techniques on the non-redundant database, we had identified many microbial F-type lectin domains with diverse domain organizations. We report here the biochemical characterization of F-type lectin domains from Cyanobium sp. PCC 7001, Myxococcus hansupus and Leucothrix mucor. We demonstrate that while all these three microbial F-type lectin domains bind to the blood group H antigen epitope on fucosylated glycans, there are fine differences in their glycan binding specificity. Cyanobium sp. PCC 7001 F-type lectin domain binds exclusively to extended H type-2 motif, Myxococcus hansupus F-type lectin domain binds to B, H type-1 and Lewis b motifs, and Leucothrix mucor F-type lectin domain binds to a wide range of fucosylated glycans, including A, B, H and Lewis antigens. We believe that these microbial lectins will be useful additions to the glycobiologist's toolbox for labeling, isolating and visualizing glycans. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Toxicity on aquatic organisms exposed to secondary effluent disinfected with chlorine, peracetic acid, ozone and UV radiation.

    Science.gov (United States)

    da Costa, Juliana Berninger; Rodgher, Suzelei; Daniel, Luiz Antonio; Espíndola, Evaldo Luiz Gaeta

    2014-11-01

    The toxic potential of four disinfectant agents (chlorine, ozone, peracetic acid and UV radiation), used in the disinfection of urban wastewater, was evaluated with respect to four aquatic organisms. Disinfection assays were carried out with wastewater from the city of Araraquara (São Paulo State, Brazil), and subsequently, toxicity bioassays were applied in order to verify possible adverse effects to the cladocerans (Ceriodaphnia silvestrii and Daphnia similis), midge larvae Chironomus xanthus and fish (Danio rerio). Under the experimental conditions tested, all the disinfectants were capable of producing harmful effects on the test organisms, except for C. xanthus. The toxicity of the effluent to C. silvestrii was observed to increase significantly as a result of disinfection using 2.5 mg L(-1) chlorine and 29.9 mg L(-1) ozone. Ozonation and chlorination significantly affected the survival of D. similis and D. rerio, causing mortality of 60 to 100 % in comparison to the non-disinfected effluent. In experiments with effluent treated with peracetic acid (PAA) and UV radiation, a statistically significant decrease in survival was only detected for D. rerio. This investigation suggested that the study of the ideal concentrations of disinfectants is a research need for ecologically safe options for the treatment of wastewater.

  15. Untersuchungen zum Vorkommen von Myxobakterien in von Meerwasser beeinflußten Substraten unter besonderer Berücksichtigung der Insel Helgoland

    Science.gov (United States)

    Rückert, G.

    1984-03-01

    Representatives of the family Myxococcaceae, Myxococcus fulvus and M. virescens as well as Archangium gephyra could be isolated from marine sediments (depth range 5 58 m), collected near the island of Helgoland (North Sea); dunes and rudiments of salt marshes additionally yielded M. coralloides and the rare species Melittangium licenicola and M. boletus (Cystobacteriaceae). In soil samples from the island, M. fulvus, M. virescens, M. coralloides, A. gephyra, Cystobacter fuscus and Stigmatella erecta were found. These results were confirmed by data, obtained from the coastal zone of the island of Amrum and marine sediments from various regions. On the other hand samples from shallow fresh water (depth range 0.3 1 m) proved to be richer in species. It is assumed that the myxobacteria found in marine sediments occur as resting cells.

  16. More than a Tad: spatiotemporal control of Caulobacter pili.

    Science.gov (United States)

    Mignolet, Johann; Panis, Gaël; Viollier, Patrick H

    2018-04-01

    The Type IV pilus (T4P) is a powerful and sophisticated bacterial nanomachine involved in numerous cellular processes, including adhesion, DNA uptake and motility. Aside from the well-described subtype T4aP of the Gram-negative genera, including Myxococcus, Pseudomonas and Neisseria, the Tad (tight adherence) pilus secretion system re-shuffles homologous parts from other secretion systems along with uncharacterized components into a new type of protein translocation apparatus. A representative of the Tad apparatus, the Caulobacter crescentus pilus assembly (Cpa) machine is built exclusively at the newborn cell pole once per cell cycle. Recent comprehensive genetic analyses unearthed a myriad of spatiotemporal determinants acting on the Tad/Cpa system, many of which are conserved in other α-proteobacteria, including obligate intracellular pathogens and symbionts. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Effects of nitrate addition on phosphorus retention in an eutrophic reservoir : laboratory experiments

    International Nuclear Information System (INIS)

    Yamada, T.; Janke, H.; Colzato, M.; Beraldo, D.; Mozeto, A.; Botta, C.; Nascimento, M.

    2010-01-01

    The Ibrite reservoir in southeast Brazil is polluted with effluents from an oil refinery as well as domestic untreated sewage from cities in the region. In this study, calcium nitrate was used as a sediment remediation technology in order to reduce phosphorus availability. Experiments were conducted in microcosms incubated for up to 135 days. Ceriodaphnia silvestrii and Vibrio fisheri were used to conduct an acute toxicity assessment of the water column and pore water of the sediments. Chironomus xanthus was used to assess bulk sediments. Results of the chemical analyses showed that high values of acid volatile sulfide in the sediments decreased by 99 per cent after 135 days of incubation. Approximately 50 per cent of the soluble reactive phosphorus was removed from the water column. The toxicity of the tested organisms was attributed to high nitrate concentrations in pore water sediments. Results indicated that calcium nitrate is not suitable as a sediment remediation technology.

  18. Ecotoxicological assessment of the pharmaceutical compound Triclosan to freshwater invertebrates with emphasis to spiked sediment tests; Avaliacao ecotoxicologica do farmaco Triclosan para invertebrados de agua doce com enfase em ensaios com sedimento marcado ('spiked sediment')

    Energy Technology Data Exchange (ETDEWEB)

    Pusceddu, Fabio Hermes

    2009-07-01

    The increasing of Pharmaceutical and Personal Care Products (PPCPs) occurrence in the aquatic environment cause adverse effects on the human health and aquatic communities. The environmental risk of the PPCPs associated with the possibility of synergic effects between PCPPs and the increase of the use of synthetic organic compounds, unchained a great concern on the toxic potential to biota aquatic. Triclosan (5-chloro-2-(2,4-dichlorophenoxy)-phenol) is a pharmaceutical compound widely used due your antibacterial mechanism effect, found in at least 932 products such as shampoos, toilet soaps, deodorants, lotions, toothpaste, detergents, socks and underwear, among others. Currently, studies about the Triclosan toxicity in the water and, mainly in the sediment, are poorly. We have the knowledge that the photodegradation of this product results into dichlorodibenzo-p-dioxin, and now it has great discussion on environmental agencies, like EPA, about the release or restriction of this product. The aim of this work is to assess the effects of Triclosan on mortality of insect larvae Chironomus xanthus and mortality and reproduction inhibition of microcrustacea Ceriodaphnia dubia exposed to Triclosan spiked sediments based on standard methods EPA and OECD. The EC50;96H obtained on acute toxicity tests with C. xanthus was 45,26 mg.Kg{sup -1}. The chronic toxicity tests with C. dubia using spiked sediments were performed following the procedure in Burton and MacPherson (1995). A no-observed-effect concentrations and lowest-observed-effect concentration were 5,78 e 6,94 mg.Kg{sup -1}, respectively. (author)

  19. Ecotoxicological assessment of the pharmaceutical compound Triclosan to freshwater invertebrates with emphasis to spiked sediment tests; Avaliacao ecotoxicologica do farmaco Triclosan para invertebrados de agua doce com enfase em ensaios com sedimento marcado ('spiked sediment')

    Energy Technology Data Exchange (ETDEWEB)

    Pusceddu, Fabio Hermes

    2009-07-01

    The increasing of Pharmaceutical and Personal Care Products (PPCPs) occurrence in the aquatic environment cause adverse effects on the human health and aquatic communities. The environmental risk of the PPCPs associated with the possibility of synergic effects between PCPPs and the increase of the use of synthetic organic compounds, unchained a great concern on the toxic potential to biota aquatic. Triclosan (5-chloro-2-(2,4-dichlorophenoxy)-phenol) is a pharmaceutical compound widely used due your antibacterial mechanism effect, found in at least 932 products such as shampoos, toilet soaps, deodorants, lotions, toothpaste, detergents, socks and underwear, among others. Currently, studies about the Triclosan toxicity in the water and, mainly in the sediment, are poorly. We have the knowledge that the photodegradation of this product results into dichlorodibenzo-p-dioxin, and now it has great discussion on environmental agencies, like EPA, about the release or restriction of this product. The aim of this work is to assess the effects of Triclosan on mortality of insect larvae Chironomus xanthus and mortality and reproduction inhibition of microcrustacea Ceriodaphnia dubia exposed to Triclosan spiked sediments based on standard methods EPA and OECD. The EC50;96H obtained on acute toxicity tests with C. xanthus was 45,26 mg.Kg{sup -1}. The chronic toxicity tests with C. dubia using spiked sediments were performed following the procedure in Burton and MacPherson (1995). A no-observed-effect concentrations and lowest-observed-effect concentration were 5,78 e 6,94 mg.Kg{sup -1}, respectively. (author)

  20. Ecotoxicological assessment of the pharmaceutical compound Triclosan to freshwater invertebrates with emphasis to spiked sediment tests

    International Nuclear Information System (INIS)

    Pusceddu, Fabio Hermes

    2009-01-01

    The increasing of Pharmaceutical and Personal Care Products (PPCPs) occurrence in the aquatic environment cause adverse effects on the human health and aquatic communities. The environmental risk of the PPCPs associated with the possibility of synergic effects between PCPPs and the increase of the use of synthetic organic compounds, unchained a great concern on the toxic potential to biota aquatic. Triclosan (5-chloro-2-(2,4-dichlorophenoxy)-phenol) is a pharmaceutical compound widely used due your antibacterial mechanism effect, found in at least 932 products such as shampoos, toilet soaps, deodorants, lotions, toothpaste, detergents, socks and underwear, among others. Currently, studies about the Triclosan toxicity in the water and, mainly in the sediment, are poorly. We have the knowledge that the photodegradation of this product results into dichlorodibenzo-p-dioxin, and now it has great discussion on environmental agencies, like EPA, about the release or restriction of this product. The aim of this work is to assess the effects of Triclosan on mortality of insect larvae Chironomus xanthus and mortality and reproduction inhibition of microcrustacea Ceriodaphnia dubia exposed to Triclosan spiked sediments based on standard methods EPA and OECD. The EC50;96H obtained on acute toxicity tests with C. xanthus was 45,26 mg.Kg -1 . The chronic toxicity tests with C. dubia using spiked sediments were performed following the procedure in Burton and MacPherson (1995). A no-observed-effect concentrations and lowest-observed-effect concentration were 5,78 e 6,94 mg.Kg -1 , respectively. (author)

  1. Nanoscale Bonding between Human Bone and Titanium Surfaces: Osseohybridization

    Directory of Open Access Journals (Sweden)

    Jun-Sik Kim

    2015-01-01

    Full Text Available Until now, the chemical bonding between titanium and bone has been examined only through a few mechanical detachment tests. Therefore, in this study, a sandblasted and acid-etched titanium mini-implant was removed from a human patient after 2 months of placement in order to identify the chemical integration mechanism for nanoscale osseointegration of titanium implants. To prepare a transmission electron microscopy (TEM specimen, the natural state was preserved as much as possible by cryofixation and scanning electron microscope/focused ion beam (SEM-FIB milling without any chemical treatment. High-resolution TEM (HRTEM, energy dispersive X-ray spectroscopy (EDS, and scanning TEM (STEM/electron energy loss spectroscopic analysis (EELS were used to investigate the chemical composition and structure at the interface between the titanium and bone tissue. HRTEM and EDS data showed evidence of crystalline hydroxyapatite and intermixing of bone with the oxide layer of the implant. The STEM/EELS experiment provided particularly interesting results: carbon existed in polysaccharides, calcium and phosphorus existed as tricalcium phosphate (TCP, and titanium existed as oxidized titanium. In addition, the oxygen energy loss near edge structures (ELNESs showed a possibility of the presence of CaTiO3. These STEM/EELS results can be explained by structures either with or without a chemical reaction layer. The possible existence of the osseohybridization area and the form of the carbon suggest that reconsideration of the standard definition of osseointegration is necessary.

  2. Accumulation and in vivo tissue distribution of pollutant elements in Erica andevalensis

    International Nuclear Information System (INIS)

    Rossini Oliva, S.; Valdes, B.; Leidi, E.O.

    2009-01-01

    Erica andevalensis is an endemic shrub from an area in the southwest of Spain (Andalucia) characterized by acidic and contaminated soils. Scanning electron microscopy (SEM) of samples after conventional or cryo-fixation preparation protocols was used for morphological and anatomical studies. SEM coupled with EDX-analysis was employed to localise and quantify different elements within plant parts (leaves, stems and roots) in samples collected in the field. Morphological studies revealed that the species has typical adaptive structures to drought-stress such as rolled needle-like leaves, sunken stomata and a thick waxy cuticle on the upper epidermis. Roots were associated with fungi which formed intra and extra-cellular mycelia. The SEM studies showed that Cu was not sequestrated into the root tissues and was uniformly distributed in leaf tissues. Meanwhile, Pb was only localised within epidermal root tissues which indicates that its sequestration in an external matrix might represent a tolerance mechanism in this species. Iron was uniformly distributed throughout the leaves, while in roots it was predominantly retained on the epidermal cell walls. The exclusion and tolerance mechanisms adopted by this species to survive in mining areas indicate that it can be used successfully in the re-vegetation of contaminated areas

  3. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  4. Restoration of strength despite low stress and abnormal imaging after Achilles injury.

    Science.gov (United States)

    Trudel, Guy; Doherty, Geoffrey P; Koike, Yoichi; Ramachandran, Nanthan; Lecompte, Martin; Dinh, Laurent; Uhthoff, Hans K

    2009-11-01

    To determine the usefulness of clinical imaging in predicting the mechanical properties of rabbit Achilles tendons after acute injury. We created a 2 x 7-mm full-thickness central tendon defect in one Achilles tendon of healthy rabbits. Rabbits in groups of 10 were killed immediately and 4 and 8 wk after surgery (n = 30). We then performed magnetic resonance (MR) imaging, ultrasonography (US), bone mineral densitometry (BMD), and mechanical testing to failure using a dual-cryofixation assembly on experimental and contralateral tendons. The main outcome measures included tendon dimensions, optical density (OD) of T1-weighted, proton density (PD), and T2-weighted MR sequences, US focal abnormalities, BMD of the calcaneus, and stress and peak load to failure. On MR imaging and US, all dimensions of the injured tendons after 2 wk and more were greater than those of the contralateral tendons (P tendons at both 4 wk (39 +/- 9 vs 77 +/- 16 N x mm(-2)) and 8 wk (58 +/- 6 vs 94 +/- 26 N x mm(-2); P tendons, higher T1-weighted OD correlated with lower peak load (r = -0.46; P tendon of lower stress. These findings support progressive physical loading 4 wk after an Achilles tendon injury. T1-weighted OD constituted a marker of tendon mechanical recovery.

  5. Immunohistochemical Distribution of Serum Proteins in Living Mouse Heart with In Vivo Cryotechnique

    International Nuclear Information System (INIS)

    Shi, Liye; Terada, Nobuo; Saitoh, Yurika; Saitoh, Sei; Ohno, Shinichi

    2011-01-01

    In vivo cryotechnique (IVCT), which immediately cryofixes target organs in situ, was used to clarify the morphological features of beating heart tissue of living mice. IVCT was performed for diastolic heart tissue under the condition of monitoring with electrocardiogram (ECG). Other mouse hearts were prepared with conventional perfusion-fixation (PF-DH) or immersion-fixation followed by dehydration (IM-DH), and quick-freezing of resected heart tissues (FQF). Immunolocalizations of albumin, immunoglobulin G1 (IgG1), intravenously injected bovine serum albumin (BSA), and connexin 43 were examined after different intervals of BSA injection. In the case of IVCT, the exact stop time of beating mouse hearts was recorded by ECG, and open blood vessels with flowing erythrocytes were observed with less artificial tissue shrinkage than with conventional preparation methods. Both albumin and BSA were well preserved in intercalated discs and t-tubules of cardiomyocytes in addition to blood vessels and interstitial matrices. IgG1 was immunolocalized in interstitial matrices of heart tissues in addition to their blood vessels. At 4 hr after BSA injection, it was immunolocalized in the intercalated discs of cardiomyocytes and lost later at 8 hr. IVCT should prove to be more useful for the morphofunctional examination of dynamically changing heart tissue than conventional preparation methods

  6. Correlative cryo-fluorescence light microscopy and cryo-electron tomography of Streptomyces.

    Science.gov (United States)

    Koning, Roman I; Celler, Katherine; Willemse, Joost; Bos, Erik; van Wezel, Gilles P; Koster, Abraham J

    2014-01-01

    Light microscopy and electron microscopy are complementary techniques that in a correlative approach enable identification and targeting of fluorescently labeled structures in situ for three-dimensional imaging at nanometer resolution. Correlative imaging allows electron microscopic images to be positioned in a broader temporal and spatial context. We employed cryo-correlative light and electron microscopy (cryo-CLEM), combining cryo-fluorescence light microscopy and cryo-electron tomography, on vitrified Streptomyces bacteria to study cell division. Streptomycetes are mycelial bacteria that grow as long hyphae and reproduce via sporulation. On solid media, Streptomyces subsequently form distinct aerial mycelia where cell division leads to the formation of unigenomic spores which separate and disperse to form new colonies. In liquid media, only vegetative hyphae are present divided by noncell separating crosswalls. Their multicellular life style makes them exciting model systems for the study of bacterial development and cell division. Complex intracellular structures have been visualized with transmission electron microscopy. Here, we describe the methods for cryo-CLEM that we applied for studying Streptomyces. These methods include cell growth, fluorescent labeling, cryo-fixation by vitrification, cryo-light microscopy using a Linkam cryo-stage, image overlay and relocation, cryo-electron tomography using a Titan Krios, and tomographic reconstruction. Additionally, methods for segmentation, volume rendering, and visualization of the correlative data are described. © 2014 Elsevier Inc. All rights reserved.

  7. Advances in cryo-electron tomography for biology and medicine.

    Science.gov (United States)

    Koning, Roman I; Koster, Abraham J; Sharp, Thomas H

    2018-05-01

    Cryo-electron tomography (CET) utilizes a combination of specimen cryo-fixation and multi-angle electron microscopy imaging to produce three-dimensional (3D) volume reconstructions of native-state macromolecular and subcellular biological structures with nanometer-scale resolution. In recent years, cryo-electron microscopy (cryoEM) has experienced a dramatic increase in the attainable resolution of 3D reconstructions, resulting from technical improvements of electron microscopes, improved detector sensitivity, the implementation of phase plates, automated data acquisition schemes, and improved image reconstruction software and hardware. These developments also greatly increased the usability and applicability of CET as a diagnostic and research tool, which is now enabling structural biologists to determine the structure of proteins in their native cellular environment to sub-nanometer resolution. These recent technical developments have stimulated us to update on our previous review (Koning, R.I., Koster, A.J., 2009. Cryo-electron tomography in biology and medicine. Ann Anat 191, 427-445) in which we described the fundamentals of CET. In this follow-up, we extend this basic description in order to explain the aforementioned recent advances, and describe related 3D techniques that can be applied to the anatomy of biological systems that are relevant for medicine. Copyright © 2018 Elsevier GmbH. All rights reserved.

  8. Spatial distribution of arsenic and heavy metals in willow roots from a contaminated floodplain soil measured by X-ray fluorescence spectroscopy.

    Science.gov (United States)

    Zimmer, Dana; Kruse, Jens; Baum, Christel; Borca, Camelia; Laue, Michael; Hause, Gerd; Meissner, Ralph; Leinweber, Peter

    2011-09-01

    Under changing redox conditions some plants create plaques at their root surface, which may affect the mobility and uptake of As and heavy metals but it is unknown to what extent this also holds true for willows in contaminated floodplain soils. Therefore, willow roots were sampled from a phytoremediation trial in the contaminated floodplain of the river Elbe (Germany), cryofixed, freeze-dried, and cross sections were mapped for the distribution of As, Ca, Cu, Fe, K, Mn, Ni, S and Zn by synchrotron based X-ray fluorescence spectroscopy. The elements Ca, Cu, Ni, S and Zn were concentrated in the aerenchymatic tissue, and not associated with Fe and Mn. Mixed Fe-Mn plaques covered the surface of the willow roots and As was accumulated in these plaques. The observed association pattern between As and Fe was explained by the different sorption/desorption properties of As(III) and As(V). The Cu and Zn intensities were not associated with the intensity of Fe in the plaque, which seems to be a willow-specific difference compared to other wetland plants. These results suggested that willows are especially suited to stabilize low-phytoextractable elements like Cu and As in their roots and rhizosphere. Thus, short rotation coppicing of willows may be a practical approach to mitigate the adverse effects of floodplain soil contamination. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Soft X-ray microscopy to 25 nm with applications to biology and magnetic materials

    CERN Document Server

    Denbeaux, G; Chao, W; Eimueller, T; Johnson, L; Köhler, M; Larabell, C; Legros, M; Fischer, P; Pearson, A; Schuetz, G; Yager, D; Attwood, D

    2001-01-01

    We report both technical advances in soft X-ray microscopy (XRM) and applications furthered by these advances. With new zone plate lenses we record test pattern features with good modulation to 25 nm and smaller. In combination with fast cryofixation, sub-cellular images show very fine detail previously seen only in electron microscopy, but seen here in thick, hydrated, and unstained samples. The magnetic domain structure is studied at high spatial resolution with X-ray magnetic circular dichroism (X-MCD) as a huge element-specific magnetic contrast mechanism, occurring e.g. at the L sub 2 sub , sub 3 edges of transition metals. It can be used to distinguish between in-plane and out-of-plane contributions by tilting the sample. As XRM is a photon based technique, the magnetic images can be obtained in unlimited varying external magnetic fields. The images discussed have been obtained at the XM-1 soft X-ray microscope on beamline 6.1 at the Advanced Light Source in Berkeley.

  10. Localization of proteins and nucleic acids using soft x-ray microscopy

    International Nuclear Information System (INIS)

    Larabell, Carolyn A.; Yager, Deborah; Meyer-Ilse, Werner

    2000-01-01

    The high-resolution soft x-ray microscope (XM-1) at the Advanced Light Source was used to examine whole, hydrated mammalian cells, both chemically fixed and rapidly frozen and viewed in a cryostage. Using x-ray microscopy, high contrast information about the organization of the cytoplasm and nucleus of these cells was revealed at unsurpassed resolution. It is important to note that cryo-fixed cells have been examined in a state that most closely resembles their natural environment in that the cells were not exposed to chemical fixatives or chemical contrast enhancement reagents. We also used the power of soft x-ray microscopy to examine the localization of proteins and nucleic acids in whole, hydrated cells using silver-enhanced, immunogold labeling techniques. With this approach, we have obtained information about the distribution of such molecules with respect to cellular ultrastructure at five times better resolution than light microscopy. The power of soft x-ray microscopy to provide superb resolution information about the subcellular localization of proteins and nucleic acids places it in a commanding position to contribute to our understanding of the numerous molecules being identified through modern molecular biology techniques

  11. Measuring in vitro cellular uptake of nanoparticles by transmission electron microscopy

    International Nuclear Information System (INIS)

    Brown, A P; Brydson, R M D; Hondow, N S

    2014-01-01

    Biomedical application of engineered nanoparticles (NPs) is a growing area of research and development. Uncertainty remains as to the mode of action of many NP types and TEM is a tool capable of addressing this if used in conjunction with standard cellular response assays. We will demonstrate imaging of thin sections of fixed, plastic embedded cells by analytical TEM to identify: superparamagnetic iron oxide NP translocation into cell compartments such as endosomes; amorphous silica NP penetration through a cell membrane without membrane encapsulation and zinc oxide NP degradation in cell compartments. We will then discuss how the in vitro cellular responses to a dose of NPs exposed to cell lines can be correlated to the internalized dose per cell section noting however that quantification of the latter requires random sampling procedures or correlation to higher throughout techniques to measure a population of whole cells. Similarly, analytical TEM measures of NP degradation within intracellular compartments will require a more appropriate sample preparation such as cryo-fixation

  12. Accumulation and in vivo tissue distribution of pollutant elements in Erica andevalensis

    Energy Technology Data Exchange (ETDEWEB)

    Rossini Oliva, S. [Department of Plant Biology and Ecology, University of Seville, Avda. Reina Mercedes s/n, Apartado de Correo 1095, 41080 Sevilla (Spain)], E-mail: sabina@us.es; Valdes, B. [Department of Plant Biology and Ecology, University of Seville, Avda. Reina Mercedes s/n, Apartado de Correo 1095, 41080 Sevilla (Spain); Leidi, E.O. [Department of Plant Biotechnology, IRNAS-CSIC, Avda. Reina Mercedes 10, 41012 Sevilla (Spain)

    2009-03-01

    Erica andevalensis is an endemic shrub from an area in the southwest of Spain (Andalucia) characterized by acidic and contaminated soils. Scanning electron microscopy (SEM) of samples after conventional or cryo-fixation preparation protocols was used for morphological and anatomical studies. SEM coupled with EDX-analysis was employed to localise and quantify different elements within plant parts (leaves, stems and roots) in samples collected in the field. Morphological studies revealed that the species has typical adaptive structures to drought-stress such as rolled needle-like leaves, sunken stomata and a thick waxy cuticle on the upper epidermis. Roots were associated with fungi which formed intra and extra-cellular mycelia. The SEM studies showed that Cu was not sequestrated into the root tissues and was uniformly distributed in leaf tissues. Meanwhile, Pb was only localised within epidermal root tissues which indicates that its sequestration in an external matrix might represent a tolerance mechanism in this species. Iron was uniformly distributed throughout the leaves, while in roots it was predominantly retained on the epidermal cell walls. The exclusion and tolerance mechanisms adopted by this species to survive in mining areas indicate that it can be used successfully in the re-vegetation of contaminated areas.

  13. Assessment of the acute toxicity of eutrophic sediments after the addition of calcium nitrate (Ibirité reservoir, Minas Gerais-SE Brazil: initial laboratory experiments

    Directory of Open Access Journals (Sweden)

    H. Janke

    Full Text Available This study evaluated the acute toxicity of sediment in a eutrophic reservoir after remediation with a calcium nitrate solution to retain phosphorus. The study involved microcosms of surface sediments and water from the sediment-water interface in the Ibirité reservoir. This reservoir, located in the vicinity of metropolitan Belo Horizonte (Minas Gerais, SE Brazil, is a water body that receives treated effluents from an oil refinery (REGAP-Petrobras, as well as high loads of untreated urban effluents from the city of Ibirité and surrounding areas and industrial effluents from a major industrial park. Incubation times of the treatment experiments were: t = 0, t = 5, t = 10, t = 25, t = 50, t = 85 and t = 135 days. One control microcosm and three treated microcosms were analysed in each time interval. Acute toxicity of water samples was assessed with Ceriodaphnia silvestrii Daday, 1902 and that of bulk sediment samples with Chironomus xanthus Rempel, 1939. Toxicity tests were carried out concomitantly with chemical analyses of dissolved inorganic nitrogen species (ammonia, nitrate and nitrite, sulfate and metals in the water samples of the microcosms. Acid volatile sulfides (AVS, simultaneously extracted metal (SEM and potentially bioavailable metal were analyzed in bulk sediment samples. Neither of the tested organisms showed toxicity in the control microcosm samples. The water column of the treated microcosm showed toxicity to C. silvestrii, starting at t = 10 days, while the sediment pore water toxicity started at t = 0 day. However, toxicity was found to decline from t = 85 days to t = 135 days. Sediments showed toxicity to C. xanthus during the entire experiment, except at the longest incubation time (t = 135 days. The overall results indicate that nitrate, which reached concentrations exceeding 1,200 mg N-NO3- L-1 in the sediment pore water of the treated microcosms, was most probably responsible for the toxicity of the samples. Although

  14. The locations and amounts of endogenous ions and elements in the cap and elongating zone of horizontally oriented roots of Zea mays L.: an electron-probe EDS study

    Science.gov (United States)

    Moore, R.; Cameron, I. L.; Hunter, K. E.; Olmos, D.; Smith, N. K.

    1987-01-01

    We used quantitative electron-probe energy-dispersive x-ray microanalysis to localize endogenous Na, Cl, K, P, S, Mg and Ca in cryofixed and freeze-dried cryosections of the cap (i.e. the putative site of graviperception) and elongating zone (i.e. site of gravicurvature) of horizontally oriented roots of Zea mays. Ca, Na, Cl, K and Mg accumulate along the lower side of caps of horizontally oriented roots. The most dramatic asymmetries of these ions occur in the apoplast, especially the mucilage. We could not detect any significant differences in the concentrations of these ions in the central cytoplasm of columella cells along the upper and lower sides of caps of horizontally-oriented roots. However, the increased amounts of Na, Cl, K and Mg in the longitudinal walls of columella cells along the lower side of the cap suggest that these ions may move down through the columella tissue of horizontally-oriented roots. Ca also accumulates (largely in the mucilage) along the lower side of the elongating zone of horizontally-oriented roots, while Na, P, Cl and K tend to accumulate along the upper side of the elongating zone. Of these ions, only K increases in concentration in the cytoplasm and longitudinal walls of cortical cells in the upper vs lower sides of the elongating zone. These results indicate that (1) gravity-induced asymmetries of ions differ significantly in the cap and elongating zone of graviresponding roots, (2) Ca accumulates along the lower side of the cap and elongating zone of graviresponding roots, (3) increased growth of the upper side of the elongating zone of horizontally-oriented roots correlates positively with increased amounts of K in the cytoplasm and longitudinal walls of cortical cells, and (4) the apoplast (especially the mucilage) may be an important component of the pathway via which ions move in graviresponding rots of Zea mays. These results are discussed relative to mechanisms for graviperception and gravicurvature of roots.

  15. Micro-PIXE in plant sciences

    International Nuclear Information System (INIS)

    Mesjasz-Przybylowicz, J.; Przybylowicz, W.J.

    2013-01-01

    Full text: Studies of the role played by elements in fundamental processes in physiology, nutrition, elemental deficiency and toxicity as well as environmental pollution require accurate, quantitative methods with good spatial resolution. the problem of proper measurements of elemental balances and elemental transfers between various levels of biological organisation (from abiotic to biotic systems; along the food chains; within organs and cells) becomes essential for understanding the mechanisms influencing the selection, interaction, distribution and transport of elements. Highly sensitive techniques for bulk elemental analysis are mostly used in these investigations. These techniques usually offer adequate sensitivity, but without spatial resolution. On the other hand, advanced studies of elemental distribution at a cellular level are mostly conducted using techniques with high spatial resolution, but low sensitivity. Ideally, these studies should be conducted on organs and tissues of sizes as far down as the cellular and sub-cellular level. This applies to e.g. future directions in ionomics and metallomics and opens up new, exciting possibilities of studies of trace metal role. The micro-PIXE has been applied in plant sciences for more than thirty years and has reached a high level of maturity. This is one of the few microanalytical, multielemental techniques capable of quantitative studies of elemental distribution at ppm level with with ability to perform quantitative elemental mapping and easy quantification of data extracted from selected micro-areas. Preparation of biological specimens is undoubtedly the crucial and most difficult part of analysis, and only cryotechniques are recommended presently for ali types of microanalytical studies. Established sample preparation protocols will be presented. Most of results are obtained for cryofixed and freeze-dried material but analysis of samples in frozen-hydrated state brings important advantage. Recent

  16. Raman microscopy of freeze-dried mouse eyeball-slice in conjunction with the "in vivo cryotechnique".

    Science.gov (United States)

    Terada, Nobuo; Ohno, Nobuhiko; Saitoh, Sei; Fujii, Yasuhisa; Ohguro, Hiroshi; Ohno, Shinichi

    2007-07-01

    The wavelength of Raman-scattered light depends on the molecular composition of the substance. This is the first attempt to acquire Raman spectra of a mouse eyeball removed from a living mouse, in which the eyeball was preserved using the "in vivo cryotechnique" followed by freeze-drying. Eyeballs were cryofixed using a rapid freezing cryotechnique, and then sliced in the cryostat machine. The slices were sandwiched between glass slides, freeze-dried, and analyzed with confocal Raman microscopy. Important areas including various eyeball tissue layers were selected using bright-field microscopy, and then the Raman spectra were obtained at 240 locations. Four typical patterns of Raman spectra were electronically mapped on the specimen images obtained by the bright-field microscopy. Tissue organization was confirmed by embedding the same eyeball slice used for Raman spectra into epoxy resin and the thick sections were prepared with the inverted capsule method. Each Raman spectral pattern represents a different histological layer in the eyeball which was mapped by comparing the images of toluidine blue staining and Raman mapping with different colors. In the choroid and pigment cell layer, the Raman spectrum had two peaks, corresponding to melanin. Some of the peaks of the Raman spectra obtained from the blood vessels in sclera and the photoreceptor layer were similar to those obtained from the purified hemoglobin and rhodopsin proteins, respectively. Our experimental protocol can distinguish different tissue components with Raman microscopy; therefore, this method can be very useful for examining the distribution of a biological structures and/or chemical components in rapidly frozen freeze-dried tissue.

  17. Apple cuticle: the perfect interface

    Science.gov (United States)

    Curry, Eric; Arey, Bruce

    2010-06-01

    The domestic apple might well be called an 'extreme' fruit. In the arid Northwest United States, the fruit often tolerates surface temperatures ranging from -2 °C in the early spring to 50 °C in the heat of summer, and again to -2 °C during controlled postharvest storage for up to 12 months. During its 18-month existence, the apple maintains a cuticle that is dynamic and environmentally responsive to protect against 1) cellular water loss during desiccation stress and 2) excessive uptake of standing surface moisture. Physiological disorders of the peel such as russeting, cracking, splitting, flecking and lenticel marking, develop as epidermal cells respond to rapid changes in ambient conditions at specific developmental stages during the growing season. Resultant market losses underlie research investigating the nature of apple cuticle growth and development. Ultrastructural analysis of the pro-cuticle using scanning electron microscopy indicates an overlapping network of lipid-based distally-elongating microtubules--produced by and connected to epidermal cells--which co-polymerize to form an organic solvent-insoluble semi-permeable cutin matrix. Microtubule elongation, aggregation, and polymerization function together as long as the fruit continues to enlarge. The nature of lipid transport from the epidermal cells through the cell wall to become part of the cuticular matrix was explored using an FEI Helios NanoLabTM DualBeamTM focused ion beam/scanning electron microscope on chemically- and cryo-fixed peel tissue from mature or freshly harvested apples. Based on microtubule dimensions, regular projections found at the cell/cuticle interface suggest an array of microtubule-like structures associated with the epidermal cell.

  18. X-ray microanalysis of freeze-dried and frozen-hydrated cryosections

    International Nuclear Information System (INIS)

    Zierold, K.

    1988-01-01

    The elemental composition and the ultrastructure of biological cells were studied by scanning transmission electron microscopy (STEM) combined with energy dispersive X-ray microanalysis. The preparation technique involves cryofixation, cryoultramicrotomy, cryotransfer, and freeze-drying of samples. Freeze-dried cryosections 100-nm thick appeared to be appropriate for measuring the distribution of diffusible elements and water in different compartments of the cells. The lateral analytical resolution was less than 50 nm, depending on ice crystal damage and section thickness. The detection limit was in the range of 10 mmol/kg dry weight for all elements with an atomic number higher than 12; for sodium and magnesium the detection limits were about 30 and 20 mmol/kg dry weight, respectively. The darkfield intensity in STEM is linearly related to the mass thickness. Thus, it becomes possible to measure the water content in intracellular compartments by using the darkfield signal of the dry mass remaining after freeze-drying. By combining the X-ray microanalytical data expressed as dry weight concentrations with the measurements of the water content, physiologically more meaningful wet weight concentrations of elements were determined. In comparison to freeze-dried cryosections frozen-hydrated sections showed poor contrast and were very sensitive against radiation damage, resulting in mass loss. The high electron exposure required for recording X-ray spectra made reproducible microanalysis of ultrathin (about 100-nm thick) frozen-hydrated sections impossible. The mass loss could be reduced by carbon coating; however, the improvement achieved thus far is still insufficient for applications in X-ray microanalysis. Therefore, at present only bulk specimens or at least 1-micron thick sections can be used for X-ray microanalysis of frozen-hydrated biological samples

  19. Comparing different preparation methods to study human fibrin fibers and platelets using TEM.

    Science.gov (United States)

    Buys, Antoinette V; Pretorius, Etheresia

    2012-06-01

    For the study of cellular ultrastructure, the sample needs to be stabilized by fixation, with the ultimate aim to preserve the native tissue organization and to protect the tissue against later stages of preparation. Chemical and freezing fixation are most used, and chemical fixation employs agents that permeate tissues and cells by diffusion and covalently bind with their major biochemical constituents to fix them. Most widely used chemical fixatives are aldehydes, e.g., formaldehyde and glutaraldehyde, which are noncoagulating, crosslinking agents. Cryofixation methods for ultrastructural studies are also popular, and high-pressure freezing immobilizes all cell constituents and arrests biological activity by removing the thermal energy from the system. In the current research, we used platelet-rich plasma (PRP) to study expansive fibrin fibers and platelet ultrastructure to compare the two fixation techniques. We also used thrombin and calcium chloride as a clotting agent to determine the technique most suitable for the formation of extensive fibrin networks. Chemically fixated fibrin fibers were more compact and condensed and also showed a banding pattern on longitudinal sections. High-pressure frozen samples were more dispersed while platelets fixated showed better preserved cellular membranes and organelle structure. PRP coagulated by addition of CaCl(2) showed blood platelets that are noticeably more activated compared with PRP; however, with thrombin, a sharp ultrastructure was seen. We conclude that PRP mixed with thrombin, and freeze substituted, is the most suitable method for the study of extensive fibrin fibers as well as platelets. Copyright © 2011 Wiley Periodicals, Inc.

  20. Spatial distribution of arsenic and heavy metals in willow roots from a contaminated floodplain soil measured by X-ray fluorescence spectroscopy

    International Nuclear Information System (INIS)

    Zimmer, Dana; Kruse, Jens; Baum, Christel; Borca, Camelia; Laue, Michael; Hause, Gerd; Meissner, Ralph; Leinweber, Peter

    2011-01-01

    Under changing redox conditions some plants create plaques at their root surface, which may affect the mobility and uptake of As and heavy metals but it is unknown to what extent this also holds true for willows in contaminated floodplain soils. Therefore, willow roots were sampled from a phytoremediation trial in the contaminated floodplain of the river Elbe (Germany), cryofixed, freeze-dried, and cross sections were mapped for the distribution of As, Ca, Cu, Fe, K, Mn, Ni, S and Zn by synchrotron based X-ray fluorescence spectroscopy. The elements Ca, Cu, Ni, S and Zn were concentrated in the aerenchymatic tissue, and not associated with Fe and Mn. Mixed Fe-Mn plaques covered the surface of the willow roots and As was accumulated in these plaques. The observed association pattern between As and Fe was explained by the different sorption/desorption properties of As(III) and As(V). The Cu and Zn intensities were not associated with the intensity of Fe in the plaque, which seems to be a willow-specific difference compared to other wetland plants. These results suggested that willows are especially suited to stabilize low-phytoextractable elements like Cu and As in their roots and rhizosphere. Thus, short rotation coppicing of willows may be a practical approach to mitigate the adverse effects of floodplain soil contamination. - Research highlights: → Elemental distributions were mapped on willow roots for the first time by synchrotron-based X-ray fluorescence. → Ca, Cu, Ni, S and Zn were enriched in the aerenchyma but As, Fe and Mn formed root plaques. → The Cu and Zn enrichments in aerenchyma but absence in plaques appeared to be willow-specific. → In the plaques were three groups of pixels which strongly differed in the As to Fe and As to Mn ratios. → This indicated different species of these redox-sensitive elements.

  1. Freeze-substitution methods for Ni localization and quantitative analysis in Berkheya coddii leaves by means of PIXE

    International Nuclear Information System (INIS)

    Budka, D.; Mesjasz-PrzybyIowicz, J.; Tylko, G.; PrzybyIowicz, W.J.

    2005-01-01

    Leaves of Ni hyperaccumulator Berkheya coddii were chosen as a model to investigate the influence of eight freeze-substitution protocols on the Ni content and distribution. Freeze-substitution of leaf samples cryofixed by high-pressure freezing was carried out in dry acetone, methanol, diethyl ether and tetrahydrofuran. The same substitution media were also used with dimethylglyoxime added as a precipitation reagent. The samples were infiltrated and embedded in Spurr's resin. Micro-PIXE analysis of Ni concentration and localization, complemented by proton backscattering for matrix assessment, was performed using the nuclear microprobe at Materials Research Group, iThemba LABS, South Africa. True elemental maps and concentrations were obtained using GeoPIXE-II software. The results were compared with the control results obtained for the parallel air-dried samples, corrected for the water content. The highest Ni content was found in the leaf samples substituted in diethyl ether. This concentration was statistically different from the results obtained for other media. In case of diethyl ether medium Ni was mainly localized in the mesophyll tissue, and the distribution map of this element was in accordance with previous results obtained for freeze-dried and frozen-hydrated leaves of this species. The same distribution pattern was observed for specimens embedded in dry acetone, but Ni concentration was significantly lower. Tetrahydrofuran medium preserved Ni preferentially in the epidermis and vascular tissue, and the elemental map for samples embedded in this medium was distorted. Ni was almost completely washed out from samples substituted in methanol and it was thus impossible to obtain a picture of its distribution. Dimethylglyoxime did not improve the preservation of this element. These results show that diethyl ether is a suitable substitution medium for assessment of Ni concentration and distribution in leaves of B. coddii

  2. SARS-coronavirus replication is supported by a reticulovesicular network of modified endoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Kèvin Knoops

    2008-09-01

    Full Text Available Positive-strand RNA viruses, a large group including human pathogens such as SARS-coronavirus (SARS-CoV, replicate in the cytoplasm of infected host cells. Their replication complexes are commonly associated with modified host cell membranes. Membrane structures supporting viral RNA synthesis range from distinct spherular membrane invaginations to more elaborate webs of packed membranes and vesicles. Generally, their ultrastructure, morphogenesis, and exact role in viral replication remain to be defined. Poorly characterized double-membrane vesicles (DMVs were previously implicated in SARS-CoV RNA synthesis. We have now applied electron tomography of cryofixed infected cells for the three-dimensional imaging of coronavirus-induced membrane alterations at high resolution. Our analysis defines a unique reticulovesicular network of modified endoplasmic reticulum that integrates convoluted membranes, numerous interconnected DMVs (diameter 200-300 nm, and "vesicle packets" apparently arising from DMV merger. The convoluted membranes were most abundantly immunolabeled for viral replicase subunits. However, double-stranded RNA, presumably revealing the site of viral RNA synthesis, mainly localized to the DMV interior. Since we could not discern a connection between DMV interior and cytosol, our analysis raises several questions about the mechanism of DMV formation and the actual site of SARS-CoV RNA synthesis. Our data document the extensive virus-induced reorganization of host cell membranes into a network that is used to organize viral replication and possibly hide replicating RNA from antiviral defense mechanisms. Together with biochemical studies of the viral enzyme complex, our ultrastructural description of this "replication network" will aid to further dissect the early stages of the coronavirus life cycle and its virus-host interactions.

  3. Spatial distribution of arsenic and heavy metals in willow roots from a contaminated floodplain soil measured by X-ray fluorescence spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Zimmer, Dana, E-mail: dana.zimmer@uni-rostock.de [Soil Science, University of Rostock, Justus-von-Liebig-Weg 6, D-18051 Rostock (Germany); Kruse, Jens; Baum, Christel [Soil Science, University of Rostock, Justus-von-Liebig-Weg 6, D-18051 Rostock (Germany); Borca, Camelia [Paul Scherrer Institute, Swiss Light Source, CH-5232 Villigen PSI (Switzerland); Laue, Michael [Electron Microscopy Centre, University of Rostock, Medical Faculty, Strempelstr. 14, D-18057 Rostock (Germany); Hause, Gerd [Microscopy Unit, Biocenter of the University of Halle, Weinbergweg 22, D-06120 Halle/Saale (Germany); Meissner, Ralph [UFZ-Helmholtz Centre for Environmental Research, Department of Soil Physics, Lysimeter Station, Dorfstrasse 55, D-39615 Falkenberg (Germany); Leinweber, Peter [Soil Science, University of Rostock, Justus-von-Liebig-Weg 6, D-18051 Rostock (Germany)

    2011-09-01

    Under changing redox conditions some plants create plaques at their root surface, which may affect the mobility and uptake of As and heavy metals but it is unknown to what extent this also holds true for willows in contaminated floodplain soils. Therefore, willow roots were sampled from a phytoremediation trial in the contaminated floodplain of the river Elbe (Germany), cryofixed, freeze-dried, and cross sections were mapped for the distribution of As, Ca, Cu, Fe, K, Mn, Ni, S and Zn by synchrotron based X-ray fluorescence spectroscopy. The elements Ca, Cu, Ni, S and Zn were concentrated in the aerenchymatic tissue, and not associated with Fe and Mn. Mixed Fe-Mn plaques covered the surface of the willow roots and As was accumulated in these plaques. The observed association pattern between As and Fe was explained by the different sorption/desorption properties of As(III) and As(V). The Cu and Zn intensities were not associated with the intensity of Fe in the plaque, which seems to be a willow-specific difference compared to other wetland plants. These results suggested that willows are especially suited to stabilize low-phytoextractable elements like Cu and As in their roots and rhizosphere. Thus, short rotation coppicing of willows may be a practical approach to mitigate the adverse effects of floodplain soil contamination. - Research highlights: {yields} Elemental distributions were mapped on willow roots for the first time by synchrotron-based X-ray fluorescence. {yields} Ca, Cu, Ni, S and Zn were enriched in the aerenchyma but As, Fe and Mn formed root plaques. {yields} The Cu and Zn enrichments in aerenchyma but absence in plaques appeared to be willow-specific. {yields} In the plaques were three groups of pixels which strongly differed in the As to Fe and As to Mn ratios. {yields} This indicated different species of these redox-sensitive elements.

  4. Efficient mining of myxobacterial metabolite profiles enabled by liquid chromatography-electrospray ionisation-time-of-flight mass spectrometry and compound-based principal component analysis

    International Nuclear Information System (INIS)

    Krug, Daniel; Zurek, Gabriela; Schneider, Birgit; Garcia, Ronald; Mueller, Rolf

    2008-01-01

    Bacteria producing secondary metabolites are an important source of natural products with highly diverse structures and biological activities. Developing methods to efficiently mine procaryotic secondary metabolomes for the presence of potentially novel natural products is therefore of considerable interest. Modern mass spectrometry-coupled liquid chromatography can effectively capture microbial metabolic diversity with ever improving sensitivity and accuracy. In addition, computational and statistical tools increasingly enable the targeted analysis and exploration of information-rich LC-MS datasets. In this article, we describe the use of such techniques for the characterization of myxobacterial secondary metabolomes. Using accurate mass data from high-resolution ESI-TOF measurements, target screening has facilitated the rapid identification of known myxobacterial metabolites in extracts from nine Myxococcus species. Furthermore, principal component analysis (PCA), implementing an advanced compound-based bucketing approach, readily revealed the presence of further compounds which contribute to variation among the metabolite profiles under investigation. The generation of molecular formulae for putative novel compounds with high confidence due to evaluation of both exact mass position and isotopic pattern, is exemplified as an important key for de-replication and prioritization of candidates for further characterization

  5. Leaf litter as a possible food source for chironomids (Diptera in Brazilian and Portuguese headwater streams Detritos foliares como possível fonte de alimento para Chironomidae (Diptera em riachos de cabeceira brasileiros e portugueses

    Directory of Open Access Journals (Sweden)

    Marcos Callisto

    2007-06-01

    Full Text Available Our objective was to evaluate the potential use of leaf detritus by chironomid larvae. Field and laboratory experiments were performed using leaves and chironomid species collected in Portugal and Brazil. Laboratory experiments under controlled conditions were done using microbial conditioned senescent leaves of Alnus glutinosa (L. Gaertn, Neriumoleander L., Protium heptaphilum (Aubl. March, Protium brasiliense (Spreng Engl., Myrcia guyanensis(Aubl. DC and Miconia chartacea Triana. Laboratory experiments were performed using specimens collected from leaf litter in local streams. Whenever possible, after the experiments, chironomids were allowed to emerge as adults and identified. In Portugal the following taxa were identified: Micropsectra apposita (Walker, 1856, Polypedilum albicorne (Meigen, 1838,Eukiefferiella claripennis Lundbeck (1898, Rheocricotopus (Psilocricotopus atripes Rempel (1937 and Ablabesmyia Johannsen (1905 (Diptera, Chironomidae. Consumption rates ranged from 0.15 ± 0.10 mg (AFDM of leaf animal-1 day-1 (Micropsectra apposita feeding on Alnus glutinosa up to 0.85 ± 0.33 mg (AFDM of leaf animal-1 day-1 (Polypedilum albicorne feeding on Miconia chartacea. In Brazil, the following taxa were identified from leaves: Phaenopsectra sp., Chironomus spp. and Polypedilum sp. and maximum consumption rates reached 0.47 ± 0.28 (AFDM of leaf mg.animal-1.day-1 (Chironomus Meigen (1803 feeding on Protium heptaphilum. Feeding experiments with laboratory cultured specimens, revealed that some chironomids were unable to feed on decomposing leaves (e.g., C. xanthus Rempel (1939 on P.brasiliensis and M.guyanensis. Our results suggest that some stream chironomids (not typical shredders can use leaf litter of riparian vegetation as a complementary food source.O objetivo foi avaliar o potencial uso de detritos foliares por larvas de Chironomidae. Foram realizados experimentos em campo e em laboratório utilizando folhas e larvas de Chironomidae

  6. Laboratory soft x-ray microscopy and tomography

    International Nuclear Information System (INIS)

    Bertilson, Michael

    2011-01-01

    Soft x-ray microscopy in the water-window (λ = 2.28 nm - 4.36 nm) is based on zone-plate optics and allows high-resolution imaging of, e.g., cells and soils in their natural or near-natural environment. Three-dimensional imaging is provided via tomographic techniques, soft x-ray cryo tomography. However, soft x-ray microscopes with such capabilities have been based on large-scale synchrotron x-ray facilities, thereby limiting their accessibility for a wider scientific community. This Thesis describes the development of the Stockholm laboratory soft x-ray microscope to three-dimensional cryo tomography and to new optics-based contrast mechanisms. The microscope relies on a methanol or nitrogen liquid-jet laser-plasma source, normal-incidence multilayer or zone-plate condenser optics, in-house fabricated zone-plate objectives, and allows operation at two wavelengths in the water-window, λ = 2.48 nm and λ = 2.48 nm. With the implementation of a new state-of-the-art normal-incidence multilayer condenser for operation at λ = 2.48 nm and a tiltable cryogenic sample stage the microscope now allows imaging of dry, wet or cryo-fixed samples. This arrangement was used for the first demonstration of laboratory soft x-ray cryo microscopy and tomography. The performance of the microscope has been demonstrated in a number of experiments described in this Thesis, including, tomographic imaging with a resolution of 140 nm, cryo microscopy and tomography of various cells and parasites, and for studies of aqueous soils and clays. The Thesis also describes the development and implementation of single-element differential-interference and Zernike phase-contrast zone-plate objectives. The enhanced contrast provided by these optics reduce exposure times or lowers the dose in samples and are of major importance for harder x-ray microscopy. The implementation of a high-resolution 50 nm compound zone-plate objective for sub-25-nm resolution imaging is also described. All experiments

  7. NANODERM. Quality of skin as a barrier to ultra-fine particles

    International Nuclear Information System (INIS)

    Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.

    2007-01-01

    Complete text of publication follows. The EU5 project carried out by a consortium of 12 European universities and research institutes under the leadership of the Faculty of Physics and Geosciences, University of Leipzig started in 2003 and ended with the publication of its final report in 2007. The main goal of the project was to get quantitative information on the penetration of ultra-fine particles in all strata of skin, on their penetration pathways as well as on their impact on human health. Details of the project can be found on the following website: http://www.uni-leipzig.de/"~nanoderm. The Hungarian team was lead by the Department of Dermatology, University of Debrecen, who provided human skin grafted on SCID (Severe Combined Immune Deficiency) mice as a suitable model for studying particle penetration. In the Institute of Physiology, University of Debrecen, the cellular effects of the nanoparticles were assessed. The ATOMKI group performed ion beam analytical investigations using proton induced x-ray emission and scanning transmission ion microscopy techniques to determine the particle distribution on porcine, SCID graft and human skin samples on which various nanoparticle (TiO 2 ) formulations including commercially available sunscreens were applied. Several pre-treatments of the skin were tested, too. The skin samples were cryofixed native specimens, reducing considerably the possibility of creating artefacts. Results Titanium was only detected in the stratum corneum for healthy skin. Penetration to layers consisting of living cells was not observed. No diffusion profile was present therefore we conclude that the penetration takes place through mechanical action. Deep penetration into hair follicles was also observed, but not into vital tissue. Clearance is expected via desquamation and sebum excretion respectively for corneocyte layers and hair follicles. In conclusion, the NANODERM group does not expect any harmful effects of sunscreens containing

  8. Quantitative mapping of elemental distribution in leaves of the metallophytes Helichrysum candolleanum, Blepharis aspera, and Blepharis diversispina from Selkirk Cu–Ni mine, Botswana

    Energy Technology Data Exchange (ETDEWEB)

    Koosaletse-Mswela, Pulane, E-mail: pulane.mswela@mopipi.ub.bw [Environmental Sciences Department, University of Botswana, Private Bag 00704, Gaborone (Botswana); Przybyłowicz, Wojciech J., E-mail: przybylowicz@tlabs.ac.za [iThemba Laboratory for Accelerator Based Sciences, National Research Foundation, PO Box 722, 7129 Somerset West (South Africa); AGH University of Science and Technology, Faculty of Physics & Applied Computer Science, Al. A. Mickiewicza 30, 30-059 Krakow (Poland); Cloete, Karen J., E-mail: kcloete@tlabs.ac.za [iThemba Laboratory for Accelerator Based Sciences, National Research Foundation, PO Box 722, 7129 Somerset West (South Africa); Barnabas, Alban D., E-mail: alban@tlabs.ac.za [iThemba Laboratory for Accelerator Based Sciences, National Research Foundation, PO Box 722, 7129 Somerset West (South Africa); Torto, Nelson, E-mail: ntorto@bitri.co.bw [Department of Chemistry, Rhodes University, PO Box 94, Grahamstown 6140 (South Africa); Mesjasz-Przybyłowicz, Jolanta, E-mail: mesjasz@tlabs.ac.za [iThemba Laboratory for Accelerator Based Sciences, National Research Foundation, PO Box 722, 7129 Somerset West (South Africa)

    2015-11-15

    Multi-element profiling is essential in understanding the metal-tolerant behavior of metallophytes. Although previous reports using multi-elemental analyses show that the metallophytes Blepharis aspera, Blepharis diversispina (Acanthaceae) and Helichrysum candolleanum (Asteraceae) take up metals, no information exists on elemental spatial distribution and concentrations in specific tissues of these plants. The aim of this study therefore was to assess the spatial distribution and concentration of copper, nickel and other elements in leaf tissues of these plants using micro-PIXE. Whole plants were collected with soil in pots from an operational copper and nickel mine (i.e., a copper and nickel mineralized area), Selkirk, about 40 km north-east of Francistown, Botswana. On the same day the samples were transported by air to iThemba LABS in South Africa. Leaf specimens were cryofixed in liquid propane cooled by LN2. Parallel samples were embedded in resin for anatomical studies to facilitate interpretation of elemental maps. The distribution and concentration of copper, nickel, and other elements in leaf tissues were determined using micro-PIXE and proton backscattering spectrometry. Data evaluation was performed using GeoPIXE II software. Micro-PIXE showed that H. candolleanum had the highest whole leaf content of copper (70 ± 3 μg g{sup −1} DW) and nickel (168 ± 5 μg g{sup −1} DW), followed by B. aspera (Cu: 25 ± 1 μg g{sup −1} DW; Ni: 166 ± 4 μg g{sup −1} DW) and B. diversispina (Cu: 3 ± 1 μg g{sup −1} DW; Ni, below detection limit). For specific leaf tissues, the highest levels of copper were found in the vascular bundle for H. candolleanum (167 ± 7 μg g{sup −1} DW) and the lower epidermis for B. aspera (70 ± 9 μg g{sup −1} DW). The highest levels of nickel were present in the vascular bundle of B. aspera (479 ± 10 μg g{sup −1} DW) and H. candolleanum (90 ± 5 μg g{sup −1} DW). Elemental maps showed a similar distribution pattern

  9. Effect of sample preparation techniques on the concentrations and distributions of elements in biological tissues using µSRXRF: a comparative study

    International Nuclear Information System (INIS)

    Al-Ebraheem, A; Dao, E; Desouza, E; McNeill, F E; Farquharson, M J; Li, C; Wainman, B C

    2015-01-01

    Routine tissue sample preparation using chemical fixatives is known to preserve the morphology of the tissue being studied. A competitive method, cryofixation followed by freeze drying, involves no chemical agents and maintains the biological function of the tissue. The possible effects of both sample preparation techniques in terms of the distribution of bio-metals (calcium (Ca), copper (Cu) zinc (Zn), and iron (Fe) specifically) in human skin tissue samples was investigated. Micro synchrotron radiation x-ray fluorescence (μSRXRF) was used to map bio-metal distribution in epidermal and dermal layers of human skin samples from various locations of the body that have been prepared using both techniques. For Ca, Cu and Zn, there were statistically significant differences between the epidermis and dermis using the freeze drying technique (p = 0.02, p < 0.01, and p < 0.01, respectively). Also using the formalin fixed, paraffin embedded technique the levels of Ca, Cu and Zn, were significantly different between the epidermis and dermis layers (p = 0.03, p < 0.01, and p < 0.01, respectively). However, the difference in levels of Fe between the epidermis and dermis was unclear and further analysis was required. The epidermis was further divided into two sub-layers, one mainly composed of the stratum corneum and the other deeper layer, the stratum basale. It was found that the difference between the distribution of Fe in the two epidermal layers using the freeze drying technique resulted in a statistically significant difference (p = 0.012). This same region also showed a difference in Fe using the formalin fixed, paraffin embedded technique (p < 0.01). The formalin fixed, paraffin embedded technique also showed a difference between the deeper epidermal layer and the dermis (p < 0.01). It can be concluded that studies involving Ca, Cu and Zn might show similar results using both sample preparation techniques, however studies involving Fe would need more

  10. Hierarchical super-structure identified by polarized light microscopy, electron microscopy and nanoindentation: Implications for the limits of biological control over the growth mode of abalone sea shells

    Directory of Open Access Journals (Sweden)

    Schneider Andreas S

    2012-09-01

    Full Text Available Abstract Background Mollusc shells are commonly investigated using high-resolution imaging techniques based on cryo-fixation. Less detailed information is available regarding the light-optical properties. Sea shells of Haliotis pulcherina were embedded for polishing in defined orientations in order to investigate the interface between prismatic calcite and nacreous aragonite by standard materialographic methods. A polished thin section of the interface was prepared with a defined thickness of 60 μm for quantitative birefringence analysis using polarized light and LC-PolScope microscopy. Scanning electron microscopy images were obtained for comparison. In order to study structural-mechanical relationships, nanoindentation experiments were performed. Results Incident light microscopy revealed a super-structure in semi-transparent regions of the polished cross-section under a defined angle. This super-structure is not visible in transmitted birefringence analysis due to the blurred polarization of small nacre platelets and numerous organic interfaces. The relative orientation and homogeneity of calcite prisms was directly identified, some of them with their optical axes exactly normal to the imaging plane. Co-oriented "prism colonies" were identified by polarized light analyses. The nacreous super-structure was also visualized by secondary electron imaging under defined angles. The domains of the super-structure were interpreted to consist of crystallographically aligned platelet stacks. Nanoindentation experiments showed that mechanical properties changed with the same periodicity as the domain size. Conclusions In this study, we have demonstrated that insights into the growth mechanisms of nacre can be obtained by conventional light-optical methods. For example, we observed super-structures formed by co-oriented nacre platelets as previously identified using X-ray Photo-electron Emission Microscopy (X-PEEM [Gilbert et al., Journal of the

  11. Quantitative mapping of elemental distribution in leaves of the metallophytes Helichrysum candolleanum, Blepharis aspera, and Blepharis diversispina from Selkirk Cu-Ni mine, Botswana

    Science.gov (United States)

    Koosaletse-Mswela, Pulane; Przybyłowicz, Wojciech J.; Cloete, Karen J.; Barnabas, Alban D.; Torto, Nelson; Mesjasz-Przybyłowicz, Jolanta

    2015-11-01

    Multi-element profiling is essential in understanding the metal-tolerant behavior of metallophytes. Although previous reports using multi-elemental analyses show that the metallophytes Blepharis aspera, Blepharis diversispina (Acanthaceae) and Helichrysum candolleanum (Asteraceae) take up metals, no information exists on elemental spatial distribution and concentrations in specific tissues of these plants. The aim of this study therefore was to assess the spatial distribution and concentration of copper, nickel and other elements in leaf tissues of these plants using micro-PIXE. Whole plants were collected with soil in pots from an operational copper and nickel mine (i.e., a copper and nickel mineralized area), Selkirk, about 40 km north-east of Francistown, Botswana. On the same day the samples were transported by air to iThemba LABS in South Africa. Leaf specimens were cryofixed in liquid propane cooled by LN2. Parallel samples were embedded in resin for anatomical studies to facilitate interpretation of elemental maps. The distribution and concentration of copper, nickel, and other elements in leaf tissues were determined using micro-PIXE and proton backscattering spectrometry. Data evaluation was performed using GeoPIXE II software. Micro-PIXE showed that H. candolleanum had the highest whole leaf content of copper (70 ± 3 μg g-1 DW) and nickel (168 ± 5 μg g-1 DW), followed by B. aspera (Cu: 25 ± 1 μg g-1 DW; Ni: 166 ± 4 μg g-1 DW) and B. diversispina (Cu: 3 ± 1 μg g-1 DW; Ni, below detection limit). For specific leaf tissues, the highest levels of copper were found in the vascular bundle for H. candolleanum (167 ± 7 μg g-1 DW) and the lower epidermis for B. aspera (70 ± 9 μg g-1 DW). The highest levels of nickel were present in the vascular bundle of B. aspera (479 ± 10 μg g-1 DW) and H. candolleanum (90 ± 5 μg g-1 DW). Elemental maps showed a similar distribution pattern for copper and nickel in B. aspera and B diversispina, with these

  12. Quantitative mapping of elemental distribution in leaves of the metallophytes Helichrysum candolleanum, Blepharis aspera, and Blepharis diversispina from Selkirk Cu–Ni mine, Botswana

    International Nuclear Information System (INIS)

    Koosaletse-Mswela, Pulane; Przybyłowicz, Wojciech J.; Cloete, Karen J.; Barnabas, Alban D.; Torto, Nelson; Mesjasz-Przybyłowicz, Jolanta

    2015-01-01

    Multi-element profiling is essential in understanding the metal-tolerant behavior of metallophytes. Although previous reports using multi-elemental analyses show that the metallophytes Blepharis aspera, Blepharis diversispina (Acanthaceae) and Helichrysum candolleanum (Asteraceae) take up metals, no information exists on elemental spatial distribution and concentrations in specific tissues of these plants. The aim of this study therefore was to assess the spatial distribution and concentration of copper, nickel and other elements in leaf tissues of these plants using micro-PIXE. Whole plants were collected with soil in pots from an operational copper and nickel mine (i.e., a copper and nickel mineralized area), Selkirk, about 40 km north-east of Francistown, Botswana. On the same day the samples were transported by air to iThemba LABS in South Africa. Leaf specimens were cryofixed in liquid propane cooled by LN2. Parallel samples were embedded in resin for anatomical studies to facilitate interpretation of elemental maps. The distribution and concentration of copper, nickel, and other elements in leaf tissues were determined using micro-PIXE and proton backscattering spectrometry. Data evaluation was performed using GeoPIXE II software. Micro-PIXE showed that H. candolleanum had the highest whole leaf content of copper (70 ± 3 μg g"−"1 DW) and nickel (168 ± 5 μg g"−"1 DW), followed by B. aspera (Cu: 25 ± 1 μg g"−"1 DW; Ni: 166 ± 4 μg g"−"1 DW) and B. diversispina (Cu: 3 ± 1 μg g"−"1 DW; Ni, below detection limit). For specific leaf tissues, the highest levels of copper were found in the vascular bundle for H. candolleanum (167 ± 7 μg g"−"1 DW) and the lower epidermis for B. aspera (70 ± 9 μg g"−"1 DW). The highest levels of nickel were present in the vascular bundle of B. aspera (479 ± 10 μg g"−"1 DW) and H. candolleanum (90 ± 5 μg g"−"1 DW). Elemental maps showed a similar distribution pattern for copper and nickel in B. aspera

  13. Measurement of total calcium in neurons by electron probe X-ray microanalysis.

    Science.gov (United States)

    Pivovarova, Natalia B; Andrews, S Brian

    2013-11-20

    In this article the tools, techniques, and instruments appropriate for quantitative measurements of intracellular elemental content using the technique known as electron probe microanalysis (EPMA) are described. Intramitochondrial calcium is a particular focus because of the critical role that mitochondrial calcium overload plays in neurodegenerative diseases. The method is based on the analysis of X-rays generated in an electron microscope (EM) by interaction of an electron beam with the specimen. In order to maintain the native distribution of diffusible elements in electron microscopy specimens, EPMA requires "cryofixation" of tissue followed by the preparation of ultrathin cryosections. Rapid freezing of cultured cells or organotypic slice cultures is carried out by plunge freezing in liquid ethane or by slam freezing against a cold metal block, respectively. Cryosections nominally 80 nm thick are cut dry with a diamond knife at ca. -160 °C, mounted on carbon/pioloform-coated copper grids, and cryotransferred into a cryo-EM using a specialized cryospecimen holder. After visual survey and location mapping at ≤-160 °C and low electron dose, frozen-hydrated cryosections are freeze-dried at -100 °C for ~30 min. Organelle-level images of dried cryosections are recorded, also at low dose, by means of a slow-scan CCD camera and subcellular regions of interest selected for analysis. X-rays emitted from ROIs by a stationary, focused, high-intensity electron probe are collected by an energy-dispersive X-ray (EDX) spectrometer, processed by associated electronics, and presented as an X-ray spectrum, that is, a plot of X-ray intensity vs. energy. Additional software facilitates: 1) identification of elemental components by their "characteristic" peak energies and fingerprint; and 2) quantitative analysis by extraction of peak areas/background. This paper concludes with two examples that illustrate typical EPMA applications, one in which mitochondrial calcium analysis

  14. Resistance of Wheat Accessions to the English Grain Aphid Sitobion avenae

    Science.gov (United States)

    Hu, Xiang-Shun; Liu, Ying-Jie; Wang, Yu-Han; Wang, Zhe; Yu, Xin-lin; Wang, Bo; Zhang, Gai-Sheng; Liu, Xiao-Feng; Hu, Zu-Qing; Zhao, Hui-Yan; Liu, Tong-Xian

    2016-01-01

    The English grain aphid, Sitobion avenae, is a major pest species of wheat crops; however, certain varieties may have stronger resistance to infestation than others. Here, we investigated 3 classical resistance mechanisms (antixenosis, antibiosis, and tolerance) by 14 wheat varieties/lines to S. avenae under laboratory and field conditions. Under laboratory conditions, alatae given the choice between 2 wheat varieties, strongly discriminated against certain varieties. Specifically, the ‘Amigo’ variety had the lowest palatability to S. avenae alatae of all varieties. ‘Tm’ (Triticum monococcum), ‘Astron,’ ‘Xanthus,’ ‘Ww2730,’ and ‘Batis’ varieties also had lower palatability than other varieties. Thus, these accessions may use antibiosis as the resistant mechanism. In contrast, under field conditions, there were no significant differences in the number of alatae detected on the 14 wheat varieties. One synthetic line (98-10-30, a cross between of Triticum aestivum (var. Chris) and Triticum turgidum (var. durum) hybridization) had low aphid numbers but high yield loss, indicating that it has high antibiosis, but poor tolerance. In comparison, ‘Amigo,’ ‘Xiaoyan22,’ and some ‘186Tm’ samples had high aphid numbers but low yield loss rates, indicating they have low antibiosis, but good tolerance. Aphid population size and wheat yield loss rates greatly varied in different fields and years for ‘98-10-35,’ ‘Xiaoyan22,’ ‘Tp,’ ‘Tam200,’ ‘PI high,’ and other ‘186Tm’ samples, which were hybrid offspring of T. aestivum and wheat related species. Thus, these germplasm should be considered for use in future studies. Overall, S. avenae is best adapted to ‘Xinong1376,’ because it was the most palatable variety, with the greatest yield loss rates of all 14 wheat varieties. However, individual varieties/lines influenced aphid populations differently in different years. Therefore, we strongly recommend a combination of

  15. Quality of skin as a barrier to ultra-fine particles. Contribution of the IBA group to the NANODERM EU-5 project in 2003-2004

    International Nuclear Information System (INIS)

    Kertesz, Zs.; Szikszai, Z.; Kiss, A.Z.

    2004-01-01

    Complete text of publication follows. Micronised titanium-, zinc- or silicon-oxide is a widely used physical photoprotective agent as a component of various cosmetic products. Due to the small particle size (down to 15 nm) it is supposed, that the particles may pass through the uppermost horny skin layer, and penetrate into deeper vital skin layers. However, only a few experiments have been carried out on its penetration through the human epidermal barrier and its possible biological effects in vivo and in vitro, using the tape stripping method which has no lateral and limited depth resolution. A consortium consisting of 12 European universities and scientific institutes has been established under the leadership of the Fakultat fuer Physik und Geowissenchaft Universitat Leipzig, whose goal is to get quantitative information on the penetration of ultrafine particles in all strata of skin, on their penetration pathways as well as on their impact on human health [1]. The IBA group of the Atomki takes part in this project as a subcontractor of the Department of Dermatology, University of Debrecen, Hungary. Ion microscopy, electron microscopy and autoradiography are used to trace the penetration of the nanoparticles into the skin layers, molecular and cell-biological methods are applied to assess the skin response and activation of dermal cells. The IBA group of the Atomki takes part in WP3: Ion Microscopy Work Package together with five other nuclear microprobe laboratories. The participants provide quantitative elemental composition in all strata of skin with detection limits of about 1 μg/g and lateral resolution of 1-2 μm by applying various ion beam analytical techniques. Samples investigated by ion microscopy are 14-16 μm thick cryo-fixed freeze-dried sections of porcine and human skin. Since the sample preparation requires completely different treatment for ion microscopy than for conventional microscopy, the members of the IBA group, who already have

  16. The Doryctinae (Braconidae of Costa Rica: genera and species of the tribe Heterospilini

    Directory of Open Access Journals (Sweden)

    Paul Marsh

    2013-11-01

    . wrightae sp. n., H. xanthus sp. n., H. xerxes sp. n., H. xinca sp. n., H. yaqui sp. n., H. ypsilon sp. n., H. zapotec sp. n., H. zeus sp. n., H. zitaniae sp. n., H. zoque sp. n., H. zunigai sp. n., H. zurquiensis sp. n. One new combination is proposed, Pioscelus costaricensis (Marsh comb. n.

  17. The Doryctinae (Braconidae) of Costa Rica: genera and species of the tribe Heterospilini.

    Science.gov (United States)

    Marsh, Paul M; Wild, Alexander L; Whitfield, James B

    2013-01-01

    ., H. nigracapitus sp. n., H. nigragonatus sp. n., H. nigricoxus sp. n., H. nixoni sp. n., H. noyesi sp. n., H. nueve sp. n., H. nunesi sp. n., H. once sp. n., H. orbitus sp. n., H. orosi sp. n., H. paloverde sp. n., H. pappi sp. n., H. parkeri sp. n., H. parvus sp. n., H. pech sp. n., H. penosa sp. n., H. petiolatus sp. n., H. petralbus sp. n., H. phaeocoxus sp. n., H. phaeoskelus sp. n., H. pharkidodus sp. n., H. phytorius sp. n., H. pitillaensis sp. n., H. poqomchi sp. n., H. poqomom sp. n., H. puertoviejoensis sp. n., H. puntarensis sp. n., H. qanjobal sp. n., H. quickei sp. n., H. quitirrisi sp. n., H. racostica sp. n., H. rama sp. n., H. ramirezi sp. n., H. ratzeburgi sp. n., H. reagani sp. n., H. reinhardi sp. n., H. retheospilus sp. n., H. rhabdotus sp. n., H. ricacosta sp. n., H. rinconensis sp. n., H. robbieae sp. n., H. rohweri sp. n., H. rojasi sp. n., H. romani sp. n., H. rugosus sp. n., H. sabrinae sp. n., H. saminae sp. n., H. sanjosensis sp. n., H. santarosensis sp. n., H. sanvitoensis sp. n., H. saturn sp. n., H. seis sp. n., H. sergeyi sp. n., H. sharkeyi sp. n., H. shawi sp. n., H. shenefelti sp. n., H. shonan sp. n., H. siete sp. n., H. similis sp. n., H. sinuatus sp. n., H. smithi sp. n., H. spiloheterus sp. n., H. staryi sp. n., H. stelfoxi sp. n., H. strazanaci sp. n., H. sumo sp. n., H. szepligeti sp. n., H. terrabas sp. n., H. thereospilus sp. n., H. tobiasi sp. n., H. tolupan sp. n., H. townesi sp. n., H. trece sp. n., H. tres sp. n., H. tricolor sp. n., H. trienta sp. n., H. tuberculatus sp. n., H. turrialbaensis sp. n., H. tzutujil sp. n., H. ugaldei sp. n., H. uno sp. n., H. variabilis sp. n., H. veinte sp. n., H. veintidos sp. n., H. veintitres sp. n., H. veintiuno sp. n., H. vierecki sp. n., H. villegasi sp. n., H. vittatus sp. n., H. vulcanus sp. n., H. wahli sp. n., H. warreni sp. n., H. washingtoni sp. n., H. wesmaeli sp. n., H. whartoni sp. n., H. whitfieldi sp. n., H. wildi sp. n., H. wilkinsoni sp. n., H. wrightae sp. n., H. xanthus