Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

Directory of Open Access Journals (Sweden)

Allah BAKHSH

2012-11-01

Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.

Directory of Open Access Journals (Sweden)

Hongjie Feng

Full Text Available BACKGROUND: As a result of changing consumer preferences, cotton (Gossypium Hirsutum L. from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. EXPERIMENTAL DESIGN: Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. RESULT: The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL. The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. CONCLUSIONS: Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.

Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Park, Wonkeun; Scheffler, Brian E; Bauer, Philip J; Campbell, B Todd

2012-06-15

Cotton is the world's primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional/biological distribution, and

Transcriptome-wide identification of preferentially expressed genes in the hypothalamus and pituitary gland

Directory of Open Access Journals (Sweden)

Jonny eSt-Amand

2012-01-01

Full Text Available To identify preferentially expressed genes in the central endocrine organs of the hypothalamus and pituitary gland, we generated transcriptome-wide mRNA profiles of the mouse hypothalamus, pituitary gland and parietal cortex using serial analysis of gene expression (SAGE. Total counts of SAGE tags for the hypothalamus, pituitary gland and parietal cortex were 165824, 126688 and 161045 tags, respectively. This represented 59244, 45151 and 55131 distinct tags, respectively. Comparison of these mRNA profiles revealed that 22 mRNA species, including three potential novel transcripts, were preferentially expressed in the hypothalamus. In addition to well-known hypothalamic transcripts, such as hypocretin, several genes involved in hormone function, intracellular transduction, metabolism, protein transport, steroidogenesis, extracellular matrix and brain disease were identified as preferentially expressed hypothalamic transcripts. In the pituitary gland, 106 mRNA species, including 60 potential novel transcripts, were preferentially expressed. In addition to well-known pituitary genes, such as growth hormone and thyroid stimulating hormone beta, a number of genes classified to function in transport, amino acid metabolism, intracellular transduction, cell adhesion, disulfide bond formation, stress response, transcription, protein synthesis and turnover, cell differentiation, the cell cycle and in the cytoskeleton and extracellular matrix were also preferentially expressed. In conclusion, the current study identified not only well-known hypothalamic and pituitary transcripts but also a number of new candidates likely to be involved in endocrine homeostatic systems regulated by the hypothalamus and pituitary gland.

Transcriptome-wide identification of preferentially expressed genes in the hypothalamus and pituitary gland.

Science.gov (United States)

St-Amand, Jonny; Yoshioka, Mayumi; Tanaka, Keitaro; Nishida, Yuichiro

2011-01-01

To identify preferentially expressed genes in the central endocrine organs of the hypothalamus and pituitary gland, we generated transcriptome-wide mRNA profiles of the hypothalamus, pituitary gland, and parietal cortex in male mice (12-15 weeks old) using serial analysis of gene expression (SAGE). Total counts of SAGE tags for the hypothalamus, pituitary gland, and parietal cortex were 165824, 126688, and 161045 tags, respectively. This represented 59244, 45151, and 55131 distinct tags, respectively. Comparison of these mRNA profiles revealed that 22 mRNA species, including three potential novel transcripts, were preferentially expressed in the hypothalamus. In addition to well-known hypothalamic transcripts, such as hypocretin, several genes involved in hormone function, intracellular transduction, metabolism, protein transport, steroidogenesis, extracellular matrix, and brain disease were identified as preferentially expressed hypothalamic transcripts. In the pituitary gland, 106 mRNA species, including 60 potential novel transcripts, were preferentially expressed. In addition to well-known pituitary genes, such as growth hormone and thyroid stimulating hormone beta, a number of genes classified to function in transport, amino acid metabolism, intracellular transduction, cell adhesion, disulfide bond formation, stress response, transcription, protein synthesis, and turnover, cell differentiation, the cell cycle, and in the cytoskeleton and extracellular matrix were also preferentially expressed. In conclusion, the current study identified not only well-known hypothalamic and pituitary transcripts but also a number of new candidates likely to be involved in endocrine homeostatic systems regulated by the hypothalamus and pituitary gland.

MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

Science.gov (United States)

He, Qiuling; Zhu, Shuijin; Zhang, Baohong

2014-09-01

MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

International Nuclear Information System (INIS)

Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

2016-01-01

Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

Cotton transformation via pollen tube pathway.

Science.gov (United States)

Wang, Min; Zhang, Baohong; Wang, Qinglian

2013-01-01

Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

Expression of NCED gene in colored cotton genotypes subjected to water stress

Directory of Open Access Journals (Sweden)

Alexandre M. S. de Souza

Full Text Available ABSTRACT Considering that the NCED gene acts on the biosynthetic cascade of ABA, a hormone involved in the functioning of stomata and consequently in the regulation of transpiration, the aim of this research was to analyze the expression of this gene in colored cotton genotypes subjected to water stress at the beginning of plant growth. Four colored cotton genotypes were used, subjected to two managements, with and without water stress, beginning the treatments when the blade of the first true leaves reached an area that allowed the evaluation of gas exchange. For the studies of the expression of the NCED gene, via RT-qPCR, leaves were collected on three distinct dates: at 4 and 6 days of water stress, and after the plants regained their turgor. The differential expression of NCED was found in all genotypes, with higher levels of expression related to six days of water stress. When the stomatal conductance was around 25%, there was overexpression in the genotype CNPA 2009.13, followed by CNPA 2009.6, BRS SAFIRA and CNPA 2009.11, confirming the data obtained in the semi-quantitative RT-PCR. The NCED gene is involved in the response to water stress in the vegetative phase of colored cotton.

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

Science.gov (United States)

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

Directory of Open Access Journals (Sweden)

Liping Ke

Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

Cotton for removal of aquatic oil spills

International Nuclear Information System (INIS)

Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.

1992-01-01

Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills

Effects of the mutation of selected genes of cotton leaf curl Kokhran virus on infectivity, symptoms and the maintenance of cotton leaf curl Multan betasatellite

NARCIS (Netherlands)

Iqbal, Z.; Sattar, M.N.; Kvarnheden, A.; Mansoor, S.; Briddon, R.W.

2012-01-01

Cotton leaf curl Kokhran virus (CLCuKoV) is a cotton-infecting monopartite begomovirus (family Geminiviridae). The effects of mutation of the coat protein (CP), V2, C2 and C4 genes of CLCuKoV on infectivity and symptoms in Nicotiana benthamiana were investigated. Each mutation introduced a premature

Gene expression in developing fibres of Upland cotton (Gossypium hirsutum L.) was massively altered by domestication.

Science.gov (United States)

Rapp, Ryan A; Haigler, Candace H; Flagel, Lex; Hovav, Ran H; Udall, Joshua A; Wendel, Jonathan F

2010-11-15

Understanding the evolutionary genetics of modern crop phenotypes has a dual relevance to evolutionary biology and crop improvement. Modern upland cotton (Gossypium hirsutum L.) was developed following thousands of years of artificial selection from a wild form, G. hirsutum var. yucatanense, which bears a shorter, sparser, layer of single-celled, ovular trichomes ('fibre'). In order to gain an insight into the nature of the developmental genetic transformations that accompanied domestication and crop improvement, we studied the transcriptomes of cotton fibres from wild and domesticated accessions over a developmental time course. Fibre cells were harvested between 2 and 25 days post-anthesis and encompassed the primary and secondary wall synthesis stages. Using amplified messenger RNA and a custom microarray platform designed to interrogate expression for 40,430 genes, we determined global patterns of expression during fibre development. The fibre transcriptome of domesticated cotton is far more dynamic than that of wild cotton, with over twice as many genes being differentially expressed during development (12,626 versus 5273). Remarkably, a total of 9465 genes were diagnosed as differentially expressed between wild and domesticated fibres when summed across five key developmental time points. Human selection during the initial domestication and subsequent crop improvement has resulted in a biased upregulation of components of the transcriptional network that are important for agronomically advanced fibre, especially in the early stages of development. About 15% of the differentially expressed genes in wild versus domesticated cotton fibre have no homology to the genes in databases. We show that artificial selection during crop domestication can radically alter the transcriptional developmental network of even a single-celled structure, affecting nearly a quarter of the genes in the genome. Gene expression during fibre development within accessions and expression

Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) shoot apex with a fungal phytase gene improves phosphorus acquisition.

Science.gov (United States)

Ma, Zhiying; Liu, Jianfeng; Wang, Xingfen

2013-01-01

Cotton is an important world economic crop plant. It is considered that cotton is recalcitrant to in vitro proliferation. Somatic embryogenesis and plant regeneration has been successful by using hypocotyl, whereas it is highly genotype dependent. Here, a genotype-independent cotton regeneration protocol from shoot apices is presented. Shoot apices from 3- to 5-day-old seedlings of cotton are infected with an Agrobacterium strain, EHA105, carrying the binary vector pC-KSA contained phytase gene (phyA) and the marker gene neomycin phosphotransferase (NPTII), and directly regenerated as shoots in vitro. Rooted shoots can be obtained within 6-8 weeks. Plants that survived by leaf painting kanamycin (kan) were -further analyzed by DNA and RNA blottings. The transgenic plants with increased the phosphorus (P) acquisition efficiency were obtained following the transformation method.

Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

Science.gov (United States)

Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

Agrobacterium-mediated transformation of verticillium dahliae with gfr gene to study cotton-pathogen interaction using a novel inoculation method

International Nuclear Information System (INIS)

Li, F.; Bibi, N.; Fan, K.; Wang, M.

2016-01-01

Verticillium dahliae is a soil-born fungal pathogen which causes Verticillium wilt in economically important crops including cotton. We conducted a study to monitor the interaction between the fungus and cotton. V. dahliae was transformed with the gene encoding green fluorescent protein. The gene can be constitutively expressed and fluorescence was clearly visible in both hyphae and spores. Due to heterogeneous gene insertion, the growth rate, colony morphology and pathogenicity of fungus transformants showed differences compared with corresponding wild type. Similarly, quantitative real-time PCR analysis also indicated significant differences in the gene expression among different V. dahliae transformants. To study cotton-pathogen interaction, we devised a novel inoculation method and developed a successful infection by keeping GFP-expressed mycelial plug along with aseptic cotton seedlings. After 6-day inoculation, the LSM microscopic image showed that the fungus rapidly formed a mycelial network on the surface of the stems and colonized into plant tissue, displayed an intercellular infection pattern. The early events during cotton colonization by V. dahliae can be successfully observed in 10 days including the plant growth period. Besides, pathological changes of seedlings like tissue discoloration, wilting, stem dehiscence and necrosis can be clearly observed without the influences of soil and other microbes. This inoculation method provides a rapid, effective and environmental friendly technique for the study of cotton-pathogen interaction and identification of resistant plant cultivars. (author)

Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

KAUST Repository

Idris, Ali

2010-12-01

A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

Science.gov (United States)

Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

2018-06-01

Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

Science.gov (United States)

Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

2016-12-01

Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

Science.gov (United States)

Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

2011-10-01

Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

Rapid diversification of the cotton genus (Gossypium: Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes.

Science.gov (United States)

Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel

2002-01-01

Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

Directory of Open Access Journals (Sweden)

Renesh Bedre

Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

Science.gov (United States)

Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

2014-02-10

Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

Directory of Open Access Journals (Sweden)

Karunamurthy Dhivya

2016-09-01

Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of horizontal gene transfer from Fusarium.

Science.gov (United States)

Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng

2018-01-01

Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

2018-02-01

The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the

The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

Science.gov (United States)

Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

2011-02-01

The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

2015-01-01

Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

Gene expression in response to Cotton Leaf Curl Virus infection in Gossypium hirsutum under variable environmental conditions

Directory of Open Access Journals (Sweden)

Rehman Iqra

2017-01-01

Full Text Available Cotton Leaf Curl Disease (CLCuD is one of the threatening constrains of cotton production in Pakistan for which no adequate remedy is available until now. Local variety of Gossypium hirsutum (FH-142 was grown in field and infected naturally by CLCuV under variable range of temperature and humidity. Plants showed thickening of veins in lower leaf surface at 34°C and 60% relative humidity at 15days post infection (dpi and curling of leaf margins at 33°C with 58% relative humidity at 30dpi. Remarkable leaf darkening was observed with reduced boll formation at 45dpi at 26°C and 41% relative humidity. Enation developed, severe thickening and curling of leaves intensified and plants showed dwarf growth at 60dpi at 24°C with 52% relative humidity. PCR amplification of Rep associated gene confirmed the presence of CLCuD-associated begomovirus in the infected samples. Quantitative RT-PCR confirmed the amplification and differential expression of a number of pathogen stress responsive genes at different levels of temperature and humidity. This observation predicts that Cotton Leaf Curl Virus (CLCuV interacts with several host genes that are upregulated to make plants susceptible or suppress other genes to overcome host defense responses.

GhNAC18 , a novel cotton ( Gossypium hirsutum L.) NAC gene, is ...

African Journals Online (AJOL)

GhNAC18 is a novel NAC gene that was isolated from cotton (Gossypium hirsutum L.). The full-length cDNA was 1511 bp including an open reading frame of 1260 bp in length and encodes a protein of 419 amino acids. With qRT-PCR analysis, GhNAC18 was downregulated during natural and dark-induced senescence, ...

Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts.

Science.gov (United States)

Hulse-Kemp, Amanda M; Ashrafi, Hamid; Zheng, Xiuting; Wang, Fei; Hoegenauer, Kevin A; Maeda, Andrea B V; Yang, S Samuel; Stoffel, Kevin; Matvienko, Marta; Clemons, Kimberly; Udall, Joshua A; Van Deynze, Allen; Jones, Don C; Stelly, David M

2014-10-30

Cotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection. Using transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3-79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays. This large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in

Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

Science.gov (United States)

Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

2014-11-06

Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved

Asymmetric Evolution and Expansion of the NAC Transcription Factor in Polyploidized Cotton

Directory of Open Access Journals (Sweden)

Kai Fan

2018-01-01

Full Text Available Polyploidy in Gossypium hirsutum conferred different properties from its diploid ancestors under the regulation of transcription factors. The NAC transcription factor is a plant-specific family that can be related to plant growth and development. So far, little is known about the NAC family in cotton. This study identified 495 NAC genes in three cotton species and investigated the evolution and expansion of different genome-derived NAC genes in cotton. We revealed 15 distinct NAC subfamilies in cotton. Different subfamilies had different gene proportions, expansion rate, gene loss rate, and orthologous exchange rate. Paleohexaploidization (35% and cotton-specific decaploidy (32% might have primarily led to the expansion of the NAC family in cotton. Half of duplication events in G. hirsutum were inherited from its diploid ancestor, and others might have occurred after interspecific hybridization. In addition, NAC genes in the At and Dt subgenomes displayed asymmetric molecular evolution, as evidenced by their different gene loss rates, orthologous exchange, evolutionary rates, and expression levels. The dominant duplication event was different during the cotton evolutionary history. Different genome-derived NACs might have interacted with each other, which ultimately resulted in morphogenetic evolution. This study delineated the expansion and evolutionary history of the NAC family in cotton and illustrated the different fates of NAC genes during polyploidization.

Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

Science.gov (United States)

Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-08-01

Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Tissue and cell-specific transcriptomes in cotton reveal the subtleties of gene regulation underlying the diversity of plant secondary cell walls.

Science.gov (United States)

MacMillan, Colleen P; Birke, Hannah; Chuah, Aaron; Brill, Elizabeth; Tsuji, Yukiko; Ralph, John; Dennis, Elizabeth S; Llewellyn, Danny; Pettolino, Filomena A

2017-07-18

Knowledge of plant secondary cell wall (SCW) regulation and deposition is mainly based on the Arabidopsis model of a 'typical' lignocellulosic SCW. However, SCWs in other plants can vary from this. The SCW of mature cotton seed fibres is highly cellulosic and lacks lignification whereas xylem SCWs are lignocellulosic. We used cotton as a model to study different SCWs and the expression of the genes involved in their formation via RNA deep sequencing and chemical analysis of stem and seed fibre. Transcriptome comparisons from cotton xylem and pith as well as from a developmental series of seed fibres revealed tissue-specific and developmentally regulated expression of several NAC transcription factors some of which are likely to be important as top tier regulators of SCW formation in xylem and/or seed fibre. A so far undescribed hierarchy was identified between the top tier NAC transcription factors SND1-like and NST1/2 in cotton. Key SCW MYB transcription factors, homologs of Arabidopsis MYB46/83, were practically absent in cotton stem xylem. Lack of expression of other lignin-specific MYBs in seed fibre relative to xylem could account for the lack of lignin deposition in seed fibre. Expression of a MYB103 homolog correlated with temporal expression of SCW CesAs and cellulose synthesis in seed fibres. FLAs were highly expressed and may be important structural components of seed fibre SCWs. Finally, we made the unexpected observation that cell walls in the pith of cotton stems contained lignin and had a higher S:G ratio than in xylem, despite that tissue's lacking many of the gene transcripts normally associated with lignin biosynthesis. Our study in cotton confirmed some features of the currently accepted gene regulatory cascade for 'typical' plant SCWs, but also revealed substantial differences, especially with key downstream NACs and MYBs. The lignocellulosic SCW of cotton xylem appears to be achieved differently from that in Arabidopsis. Pith cell walls in

Genome-wide identification of mitogen-activated protein kinase gene family in Gossypium raimondii and the function of their corresponding orthologs in tetraploid cultivated cotton.

Science.gov (United States)

Zhang, Xueying; Wang, Liman; Xu, Xiaoyang; Cai, Caiping; Guo, Wangzhen

2014-12-10

Mitogen-activated protein kinase (MAPK) cascades play a crucial role in plant growth and development as well as biotic and abiotic stress responses. Knowledge about the MAPK gene family in cotton is limited, and systematic investigation of MAPK family proteins has not been reported. By performing a bioinformatics homology search, we identified 28 putative MAPK genes in the Gossypium raimondii genome. These MAPK members were anchored onto 11 chromosomes in G. raimondii, with uneven distribution. Phylogenetic analysis showed that the MAPK candidates could be classified into the four known A, B, C and D groups, with more MAPKs containing the TEY phosphorylation site (18 members) than the TDY motif (10 members). Furthermore, 21 cDNA sequences of MAPKs with complete open reading frames (ORFs) were identified in G. hirsutum via PCR-based approaches, including 13 novel MAPKs and eight with homologs reported previously in tetraploid cotton. The expression patterns of 23 MAPK genes reveal their important roles in diverse functions in cotton, in both various developmental stages of vegetative and reproductive growth and in the stress response. Using a reverse genetics approach based on tobacco rattle virus-induced gene silencing (TRV-VIGS), we further verified that MPK9, MPK13 and MPK25 confer resistance to defoliating isolates of Verticillium dahliae in cotton. Silencing of MPK9, MPK13 and MPK25 can significantly enhance cotton susceptibility to this pathogen. This study presents a comprehensive identification of 28 mitogen-activated protein kinase genes in G. raimondii. Their phylogenetic relationships, transcript expression patterns and responses to various stressors were verified. This study provides the first systematic analysis of MAPKs in cotton, improving our understanding of defense responses in general and laying the foundation for future crop improvement using MAPKs.

Genetic transformation of cry1EC gene into cotton ( Gossypium ...

African Journals Online (AJOL)

Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

Science.gov (United States)

Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

2015-01-01

RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

Inheritance and segregation of exogenous genes in transgenic cotton

Indian Academy of Sciences (India)

1Key Laboratory of Cotton Genetic Improvement of the Ministry of Agriculture, Cotton Research Institute, Chinese. Academy of Agricultural Sciences, Anyang Henan 455 112, People's Republic of China. 2Institute ..... Athens, Greece. Xie D. X. ...

Genome-wide analysis of the MADS-box gene family in polyploid cotton (Gossypium hirsutum) and in its diploid parental species (Gossypium arboreum and Gossypium raimondii).

Science.gov (United States)

Nardeli, Sarah Muniz; Artico, Sinara; Aoyagi, Gustavo Mitsunori; de Moura, Stéfanie Menezes; da Franca Silva, Tatiane; Grossi-de-Sa, Maria Fatima; Romanel, Elisson; Alves-Ferreira, Marcio

2018-06-01

The MADS-box gene family encodes transcription factors that share a highly conserved domain known to bind to DNA. Members of this family control various processes of development in plants, from root formation to fruit ripening. In this work, a survey of diploid (Gossypium raimondii and Gossypium arboreum) and tetraploid (Gossypium hirsutum) cotton genomes found a total of 147, 133 and 207 MADS-box genes, respectively, distributed in the MIKC, Mα, Mβ, Mγ, and Mδ subclades. A comparative phylogenetic analysis among cotton species, Arabidopsis, poplar and grapevine MADS-box homologous genes allowed us to evaluate the evolution of each MADS-box lineage in cotton plants and identify sequences within well-established subfamilies. Chromosomal localization and phylogenetic analysis revealed that G. raimondii and G. arboreum showed a conserved evolution of the MIKC subclade and a distinct pattern of duplication events in the Mα, Mγ and Mδ subclades. Additionally, G. hirsutum showed a combination of its parental subgenomes followed by a distinct evolutionary history including gene gain and loss in each subclade. qPCR analysis revealed the expression patterns of putative homologs in the AP1, AP3, AGL6, SEP4, AGL15, AG, AGL17, TM8, SVP, SOC and TT16 subfamilies of G. hirsutum. The identification of putative cotton orthologs is discussed in the light of evolution and gene expression data from other plants. This analysis of the MADS-box genes in Gossypium species opens an avenue to understanding the origin and evolution of each gene subfamily within diploid and polyploid species and paves the way for functional studies in cotton species. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

Science.gov (United States)

Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

2015-01-01

COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Selection of housekeeping genes and demonstration of RNAi in cotton leafhopper, Amrasca biguttula biguttula (Ishida)

Science.gov (United States)

Gupta, Mridula; Pandher, Suneet; Kaur, Gurmeet; Rathore, Pankaj; Palli, Subba Reddy

2018-01-01

Amrasca biguttula biguttula (Ishida) commonly known as cotton leafhopper is a severe pest of cotton and okra. Not much is known on this insect at molecular level due to lack of genomic and transcriptomic data. To prepare for functional genomic studies in this insect, we evaluated 15 common housekeeping genes (Tub, B-Tub, EF alpha, GADPH, UbiCF, RP13, Ubiq, G3PD, VATPase, Actin, 18s, 28s, TATA, ETF, SOD and Cytolytic actin) during different developmental stages and under starvation stress. We selected early (1st and 2nd), late (3rd and 4th) stage nymphs and adults for identification of stable housekeeping genes using geNorm, NormFinder, BestKeeper and RefFinder software. Based on the different algorithms, RP13 and VATPase are identified as the most suitable reference genes for quantification of gene expression by reverse transcriptase quantitative PCR (RT-qPCR). Based on RefFinder which comprehended the results of three algorithms, RP13 in adults, Tubulin (Tub) in late nymphs, 28S in early nymph and UbiCF under starvation stress were identified as the most stable genes. We also developed methods for feeding double-stranded RNA (dsRNA) incorporated in the diet. Feeding dsRNA targeting Snf7, IAP, AQP1, and VATPase caused 56.17–77.12% knockdown of targeted genes compared to control and 16 to 48% mortality of treated insects when compared to control. PMID:29329327

Selection of housekeeping genes and demonstration of RNAi in cotton leafhopper, Amrasca biguttula biguttula (Ishida.

Directory of Open Access Journals (Sweden)

Satnam Singh

Full Text Available Amrasca biguttula biguttula (Ishida commonly known as cotton leafhopper is a severe pest of cotton and okra. Not much is known on this insect at molecular level due to lack of genomic and transcriptomic data. To prepare for functional genomic studies in this insect, we evaluated 15 common housekeeping genes (Tub, B-Tub, EF alpha, GADPH, UbiCF, RP13, Ubiq, G3PD, VATPase, Actin, 18s, 28s, TATA, ETF, SOD and Cytolytic actin during different developmental stages and under starvation stress. We selected early (1st and 2nd, late (3rd and 4th stage nymphs and adults for identification of stable housekeeping genes using geNorm, NormFinder, BestKeeper and RefFinder software. Based on the different algorithms, RP13 and VATPase are identified as the most suitable reference genes for quantification of gene expression by reverse transcriptase quantitative PCR (RT-qPCR. Based on RefFinder which comprehended the results of three algorithms, RP13 in adults, Tubulin (Tub in late nymphs, 28S in early nymph and UbiCF under starvation stress were identified as the most stable genes. We also developed methods for feeding double-stranded RNA (dsRNA incorporated in the diet. Feeding dsRNA targeting Snf7, IAP, AQP1, and VATPase caused 56.17-77.12% knockdown of targeted genes compared to control and 16 to 48% mortality of treated insects when compared to control.

Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

Directory of Open Access Journals (Sweden)

Yun Chen

Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

Genetic analysis of some agronomic traits (gossypium hamster L.) in cotton

International Nuclear Information System (INIS)

Zulqarnain, M.; Khan, I.A.; Shakeel, T.; JAfri, J.S.

1998-01-01

Four varieties of cotton were crossed in a complete diallel fashion to evaluate the mode of inheritance of different agronomic traits. Height of main stem, number of bolls per plant, boll weight and yield of seed cotton per plant appeared to be controlled by additive with partial dominance type of gene action. While number of seeds per boll was controlled by over dominance type of gene action. Variety MNH-93 possessed dominant genes for height of main stem, number of bolls per plant number of seeds per boll and yield of seed cotton per plant. AMSI-38 carried dominant genes for boll weight and recessive for number of bolls per plant, number of seeds per boll and boll weight. Height of main stem and yield of seed cotton were controlled by recessive genes in Variety AMSI-38. (author)

Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.

Directory of Open Access Journals (Sweden)

Shannon Heuberger

Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.

Loop-Mediated Isothermal Amplification for Detection of Endogenous Sad1 Gene in Cotton: An Internal Control for Rapid Onsite GMO Testing.

Science.gov (United States)

Singh, Monika; Bhoge, Rajesh K; Randhawa, Gurinderjit

2018-04-20

Background : Confirming the integrity of seed samples in powdered form is important priorto conducting a genetically modified organism (GMO) test. Rapid onsite methods may provide a technological solution to check for genetically modified (GM) events at ports of entry. In India, Bt cotton is the commercialized GM crop with four approved GM events; however, 59 GM events have been approved globally. GMO screening is required to test for authorized GM events. The identity and amplifiability of test samples could be ensured first by employing endogenous genes as an internal control. Objective : A rapid onsite detection method was developed for an endogenous reference gene, stearoyl acyl carrier protein desaturase ( Sad1 ) of cotton, employing visual and real-time loop-mediated isothermal amplification (LAMP). Methods : The assays were performed at a constant temperature of 63°C for 30 min for visual LAMP and 62ºC for 40 min for real-time LAMP. Positive amplification was visualized as a change in color from orange to green on addition of SYBR ® Green or detected as real-time amplification curves. Results : Specificity of LAMP assays was confirmed using a set of 10 samples. LOD for visual LAMP was up to 0.1%, detecting 40 target copies, and for real-time LAMP up to 0.05%, detecting 20 target copies. Conclusions : The developed methods could be utilized to confirm the integrity of seed powder prior to conducting a GMO test for specific GM events of cotton. Highlights : LAMP assays for the endogenous Sad1 gene of cotton have been developed to be used as an internal control for onsite GMO testing in cotton.

Activation of Arabidopsis seed hair development by cotton fiber-related genes.

Directory of Open Access Journals (Sweden)

Xueying Guan

Full Text Available Each cotton fiber is a single-celled seed trichome or hair, and over 20,000 fibers may develop semi-synchronously on each seed. The molecular basis for seed hair development is unknown but is likely to share many similarities with leaf trichome development in Arabidopsis. Leaf trichome initiation in Arabidopsis thaliana is activated by GLABROUS1 (GL1 that is negatively regulated by TRIPTYCHON (TRY. Using laser capture microdissection and microarray analysis, we found that many putative MYB transcription factor and structural protein genes were differentially expressed in fiber and non-fiber tissues. Gossypium hirsutum MYB2 (GhMYB2, a putative GL1 homolog, and its downstream gene, GhRDL1, were highly expressed during fiber cell initiation. GhRDL1, a fiber-related gene with unknown function, was predominately localized around cell walls in stems, sepals, seed coats, and pollen grains. GFP:GhRDL1 and GhMYB2:YFP were co-localized in the nuclei of ectopic trichomes in siliques. Overexpressing GhRDL1 or GhMYB2 in A. thaliana Columbia-0 (Col-0 activated fiber-like hair production in 4-6% of seeds and had on obvious effects on trichome development in leaves or siliques. Co-overexpressing GhRDL1 and GhMYB2 in A. thaliana Col-0 plants increased hair formation in ∼8% of seeds. Overexpressing both GhRDL1 and GhMYB2 in A. thaliana Col-0 try mutant plants produced seed hair in ∼10% of seeds as well as dense trichomes inside and outside siliques, suggesting synergistic effects of GhRDL1 and GhMYB2 with try on development of trichomes inside and outside of siliques and seed hair in A. thaliana. These data suggest that a different combination of factors is required for the full development of trichomes (hairs in leaves, siliques, and seeds. A. thaliana can be developed as a model a system for discovering additional genes that control seed hair development in general and cotton fiber in particular.

Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

Science.gov (United States)

Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

2011-04-01

Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

Science.gov (United States)

Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

2014-06-01

Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

NARCIS (Netherlands)

Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

2011-01-01

Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

International Nuclear Information System (INIS)

Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

2005-01-01

Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton.

Science.gov (United States)

Suzuki, Hideaki; Rodriguez-Uribe, Laura; Xu, Jiannong; Zhang, Jinfa

2013-10-01

A global view of differential expression of genes in CMS-D8 of cotton was presented in this study which will facilitate the understanding of cytoplasmic male sterility in cotton. Cytoplasmic male sterility (CMS) is a maternally inherited trait in higher plants which is incapable of producing functional pollen. However, the male fertility can be restored by one or more nuclear-encoded restorer genes. A genome-wide transcriptome analysis of CMS and restoration in cotton is currently lacking. In this study, Affymetrix GeneChips© Cotton Genome Array containing 24,132 transcripts was used to compare differentially expressed (DE) genes of flower buds at the meiosis stage between CMS and its restorer cotton plants conditioned by the D8 cytoplasm. A total of 458 (1.9 %) of DE genes including 127 up-regulated and 331 down-regulated ones were identified in the CMS-D8 line. Quantitative RT-PCR was used to validate 10 DE genes selected from seven functional categories. The most frequent DE gene group was found to encode putative proteins involved in cell wall expansion, such as pectinesterase, pectate lyase, pectin methylesterase, glyoxal oxidase, polygalacturonase, indole-3-acetic acid-amino synthetase, and xyloglucan endo-transglycosylase. Genes in cytoskeleton category including actin, which plays a key role in cell wall expansion, cell elongation and cell division, were also highly differentially expressed between the fertile and CMS plants. This work represents the first study in utilizing microarray to identify CMS-related genes by comparing overall DE genes between fertile and CMS plants in cotton. The results provide evidence that many CMS-associated genes are mainly involved in cell wall expansion. Further analysis will be required to elucidate the molecular mechanisms of male sterility which will facilitate the development of new hybrid cultivars in cotton.

Diversity, Mutation and Recombination Analysis of Cotton Leaf Curl Geminiviruses.

Directory of Open Access Journals (Sweden)

Huma Saleem

Full Text Available The spread of cotton leaf curl disease in China, India and Pakistan is a recent phenomenon. Analysis of available sequence data determined that there is a substantial diversity of cotton-infecting geminiviruses in Pakistan. Phylogenetic analyses indicated that recombination between two major groups of viruses, cotton leaf curl Multan virus (CLCuMuV and cotton leaf curl Kokhran virus (CLCuKoV, led to the emergence of several new viruses. Recombination detection programs and phylogenetic analyses showed that CLCuMuV and CLCuKoV are highly recombinant viruses. Indeed, CLCuKoV appeared to be a major donor virus for the coat protein (CP gene, while CLCuMuV donated the Rep gene in the majority of recombination events. Using recombination free nucleotide datasets the substitution rates for CP and Rep genes were determined. We inferred similar nucleotide substitution rates for the CLCuMuV-Rep gene (4.96X10-4 and CLCuKoV-CP gene (2.706X10-4, whereas relatively higher substitution rates were observed for CLCuMuV-CP and CLCuKoV-Rep genes. The combination of sequences with equal and relatively low substitution rates, seemed to result in the emergence of viral isolates that caused epidemics in Pakistan and India. Our findings also suggest that CLCuMuV is spreading at an alarming rate, which can potentially be a threat to cotton production in the Indian subcontinent.

ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

Science.gov (United States)

Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

2017-12-01

This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

Directory of Open Access Journals (Sweden)

Gregory N. Thyssen

2016-06-01

Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

2017-07-01

The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

Anther-preferential expressing gene PMR is essential for the mitosis of pollen development in rice.

Science.gov (United States)

Liu, Yaqin; Xu, Ya; Ling, Sheng; Liu, Shasha; Yao, Jialing

2017-06-01

Phenotype identification, expression examination, and function prediction declared that the anther-preferential expressing gene PMR may participate in regulation of male gametophyte development in rice. Male germline development in flowering plants produces the pair of sperm cells for double fertilization and the pollen mitosis is a key process of it. Although the structural features of male gametophyte have been defined, the molecular mechanisms regulating the mitotic cell cycle are not well elucidated in rice. Here, we reported an anther-preferential expressing gene in rice, PMR (Pollen Mitosis Relative), playing an essential role in male gametogenesis. When PMR gene was suppressed via RNAi, the mitosis of microspore was severely damaged, and the plants formed unmatured pollens containing only one or two nucleuses at the anthesis, ultimately leading to serious reduction of pollen fertility and seed-setting. The CRISPR mutants, pmr-1 and pmr-2, both showed the similar defects as the PMR-RNAi lines. Further analysis revealed that PMR together with its co-expressing genes were liable to participate in the regulation of DNA metabolism in the nucleus, and affected the activities of some enzymes related to the cell cycle. We finally discussed that unknown protein PMR contained the PHD, SWIB and Plus-3 domains and they might have coordinating functions in regulation pathway of the pollen mitosis in rice.

Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

Science.gov (United States)

Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

2016-09-26

Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

Genomics-enabled analysis of the emergent disease cotton bacterial blight.

Directory of Open Access Journals (Sweden)

Anne Z Phillips

2017-09-01

Full Text Available Cotton bacterial blight (CBB, an important disease of (Gossypium hirsutum in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars.

Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants.

Science.gov (United States)

Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao

2015-11-01

Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Genome Editing in Cotton with the CRISPR/Cas9 System

Directory of Open Access Journals (Sweden)

Wei Gao

2017-08-01

Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.

Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

Directory of Open Access Journals (Sweden)

Nan-Yang Li

2018-02-01

Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

Asymmetric evolution and domestication in allotetraploid cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Lei Fang

2017-04-01

Full Text Available Polyploidy plays a major role in genome evolution, which corresponds to environmental changes over millions of years. The mechanisms of genome evolution, particularly during the process of domestication, are of broad interest in the fields of plant science and crop breeding. Upland cotton is derived from the hybridization and polyploidization of its ancient A and D diploid ancestors. As a result, cotton is a model for polyploid genome evolution and crop domestication. To explore the genomic mysteries of allopolyploid cotton, we investigated asymmetric evolution and domestication in the A and D subgenomes. Interestingly, more structural rearrangements have been characterized in the A subgenome than in the D subgenome. Correspondingly, more transposable elements, a greater number of lost and disrupted genes, and faster evolution have been identified in the A subgenome. In contrast, the centromeric retroelement (RT-domain related sequence of tetraploid cotton derived from the D subgenome progenitor was found to have invaded the A subgenome centromeres after allotetrapolyploid formation. Although there is no genome-wide expression bias between the subgenomes, as with expression-level alterations, gene expression bias of homoeologous gene pairs is widespread and varies from tissue to tissue. Further, there are more positively selected genes for fiber yield and quality in the A subgenome and more for stress tolerance in the D subgenome, indicating asymmetric domestication. This review highlights the asymmetric subgenomic evolution and domestication of allotetraploid cotton, providing valuable genomic resources for cotton research and enhancing our understanding of the basis of many other allopolyploids.

Genetic study of various agronomic traits in cotton (Gossypium hirsutum L.)

International Nuclear Information System (INIS)

Ashraf, F.; Khan, I.A.; Ahmed, S.

2009-01-01

The use of already existing genetic variability in the breeding material, as well as, the creation of new variability along with the genetic understanding of various agronomic traits is of crucial importance, in order to develop potential sources of cotton. For this purpose, 5 X 6 complete diallel cross experiment was conducted during 2003-04, involving 5 strains i.e. VH-55, MNH-516, ACALA-SJ-4, A-8100 and CRIS-420, to evaluate gene-action, general and specific combining ability for number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant, boll weight and yield of seed cotton. Additive type of gene action, with partial dominance for all the traits studied, was observed. Most dominant genes for boll weight, yield of seed-cotton, and number of sympodial branches were observed in CRIS-420, while maximum dominant genes for number of monopodial branches, plant height were observed in ACALA-SJ-4. Variety VH-55 carried maximum dominant genes for number of bolls per plant. Recessive genes for the number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant and yield of seed-cotton, were exhibited by MNH-516. The variety ACAU-SJ-4 showed harmonius combination for bolls per plant and yield of seed-cotton, whereas CRIS- 420 was found a good general combiner for plant height and number of sympodial branches. (author)

Flavonoid biosynthesis controls fiber color in naturally colored cotton

Directory of Open Access Journals (Sweden)

Hai-Feng Liu

2018-04-01

Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

Preferential attachment in the evolution of metabolic networks

Directory of Open Access Journals (Sweden)

Elofsson Arne

2005-11-01

Full Text Available Abstract Background Many biological networks show some characteristics of scale-free networks. Scale-free networks can evolve through preferential attachment where new nodes are preferentially attached to well connected nodes. In networks which have evolved through preferential attachment older nodes should have a higher average connectivity than younger nodes. Here we have investigated preferential attachment in the context of metabolic networks. Results The connectivities of the enzymes in the metabolic network of Escherichia coli were determined and representatives for these enzymes were located in 11 eukaryotes, 17 archaea and 46 bacteria. E. coli enzymes which have representatives in eukaryotes have a higher average connectivity while enzymes which are represented only in the prokaryotes, and especially the enzymes only present in βγ-proteobacteria, have lower connectivities than expected by chance. Interestingly, the enzymes which have been proposed as candidates for horizontal gene transfer have a higher average connectivity than the other enzymes. Furthermore, It was found that new edges are added to the highly connected enzymes at a faster rate than to enzymes with low connectivities which is consistent with preferential attachment. Conclusion Here, we have found indications of preferential attachment in the metabolic network of E. coli. A possible biological explanation for preferential attachment growth of metabolic networks is that novel enzymes created through gene duplication maintain some of the compounds involved in the original reaction, throughout its future evolution. In addition, we found that enzymes which are candidates for horizontal gene transfer have a higher average connectivity than other enzymes. This indicates that while new enzymes are attached preferentially to highly connected enzymes, these highly connected enzymes have sometimes been introduced into the E. coli genome by horizontal gene transfer. We speculate

Transcriptome analysis of Gossypium hirsutum flower buds infested by cotton boll weevil (Anthonomus grandis) larvae.

Science.gov (United States)

Artico, Sinara; Ribeiro-Alves, Marcelo; Oliveira-Neto, Osmundo Brilhante; de Macedo, Leonardo Lima Pepino; Silveira, Sylvia; Grossi-de-Sa, Maria Fátima; Martinelli, Adriana Pinheiro; Alves-Ferreira, Marcio

2014-10-04

Cotton is a major fibre crop grown worldwide that suffers extensive damage from chewing insects, including the cotton boll weevil larvae (Anthonomus grandis). Transcriptome analysis was performed to understand the molecular interactions between Gossypium hirsutum L. and cotton boll weevil larvae. The Illumina HiSeq 2000 platform was used to sequence the transcriptome of cotton flower buds infested with boll weevil larvae. The analysis generated a total of 327,489,418 sequence reads that were aligned to the G. hirsutum reference transcriptome. The total number of expressed genes was over 21,697 per sample with an average length of 1,063 bp. The DEGseq analysis identified 443 differentially expressed genes (DEG) in cotton flower buds infected with boll weevil larvae. Among them, 402 (90.7%) were up-regulated, 41 (9.3%) were down-regulated and 432 (97.5%) were identified as orthologues of A. thaliana genes using Blastx. Mapman analysis of DEG indicated that many genes were involved in the biotic stress response spanning a range of functions, from a gene encoding a receptor-like kinase to genes involved in triggering defensive responses such as MAPK, transcription factors (WRKY and ERF) and signalling by ethylene (ET) and jasmonic acid (JA) hormones. Furthermore, the spatial expression pattern of 32 of the genes responsive to boll weevil larvae feeding was determined by "in situ" qPCR analysis from RNA isolated from two flower structures, the stamen and the carpel, by laser microdissection (LMD). A large number of cotton transcripts were significantly altered upon infestation by larvae. Among the changes in gene expression, we highlighted the transcription of receptors/sensors that recognise chitin or insect oral secretions; the altered regulation of transcripts encoding enzymes related to kinase cascades, transcription factors, Ca2+ influxes, and reactive oxygen species; and the modulation of transcripts encoding enzymes from phytohormone signalling pathways. These

Effects of genetically modified cotton stalks on antibiotic resistance genes, intI1, and intI2 during pig manure composting.

Science.gov (United States)

Duan, Manli; Gu, Jie; Wang, Xiaojuan; Li, Yang; Zhang, Sheqi; Yin, Yanan; Zhang, Ranran

2018-01-01

Genetically modified (GM) cotton production generates a large yield of stalks and their disposal is difficult. In order to study the feasibility of using GM cotton stalks for composting and the changes that occur in antibiotic resistance genes (ARGs) during composting, we supplemented pig manure with GM or non-GM cotton stalks during composting and we compared their effects on the absolute abundances (AA) of intI1, intI2, and ARGs under the two treatments. The compost was mature after processing based on the germination index and C/N ratio. After composting, the AAs of ARGs, intI1, and intI2 were reduced by 41.7% and 45.0% in the non-GM and GM treatments, respectively. The ARG profiles were affected significantly by temperature and ammonia nitrogen. In addition, excluding tetC, GM cotton stalks had no significant effects on ARGs, intI1, and intI2 compared with the non-GM treatment (p composting with livestock manure, and the AAs of ARGs can be reduced. Furthermore, the results of this study provide a theoretical basis for the harmless utilization of GM cotton stalks. Copyright © 2017 Elsevier Inc. All rights reserved.

Leaf tissue assay for lepidopteran pests of Bt cotton

Science.gov (United States)

Laboratory measurements of susceptibility to Bt toxins can be a poor indicator of the ability of an insect to survive on transgenic crops. We investigated the potential of using cotton leaf tissue for evaluating heliothine susceptibilities to two dual-gene Bt cottons. A preliminary study was conduct...

Cocoa/Cotton Comparative Genomics

Science.gov (United States)

With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

Salt Stress Effects on Secondary Metabolites of Cotton in Relation to Gene Expression Responsible for Aphid Development.

Directory of Open Access Journals (Sweden)

Qi Wang

Full Text Available Many secondary metabolites have insecticidal efficacy against pests and may be affected by abiotic stress. However, little is known of how plants may respond to such stress as pertains the growth and development of pests. The objective of this study was to determine if and how salt stress on cotton plants affects the population dynamics of aphids. The NaCl treatment (50 mM, 100 mM, 150 mM and 200 mM increased contents of gossypol in cotton by 26.8-51.4%, flavonoids by 22.5-37.6% and tannic by 15.1-24.3% at 7-28 d after salt stress. Compared with non-stressed plants, the population of aphids on 150 and 200 mM NaCl stressed plants was reduced by 46.4 and 65.4% at 7d and by 97.3 and 100% at 14 days after infestation. Reductions in aphid population were possibly attributed to the elevated secondary metabolism under salt stress. A total of 796 clones for aphids transcriptome, 412 clones in the positive- library (TEST and 384 clones in the reverse-library (Ck, were obtained from subtracted cDNA libraries and sequenced. Gene ontology (GO functional classification and KEGG pathway analysis showed more genes related to fatty acid and lipid biosynthesis, and fewer genes related to carbohydrate metabolism, amino acid metabolism, energy metabolism and cell motility pathways in TEST than in Ck library, which might be the reason of aphids population reduction. A comparative analysis with qRT-PCR indicated high expression of transcripts CYP6A14, CYP6A13, CYP303A1, NADH dehydrogenase and fatty acid synthase in the TEST group. However, CYP307A1 and two ecdysone-induced protein genes were down regulated. The results indicate that genes of aphids related to growth and development can express at a higher level in reaction to the enhanced secondary metabolism in cotton under salinity stress. The expression of CYP307A1 was positively correlated with the population dynamics of aphids since it was involved in ecdysone synthesis.

Phylogeny of the New World diploid cottons (Gossypium L., Malvaceae) based on sequences of three low-copy nuclear genes.

Science.gov (United States)

I. Alvarez; R. Cronn; J.F. Wendel

2005-01-01

American diploid cottons (Gossypium L., subgenus Houzingenia Fryxell) form a monophyletic group of 13 species distributed mainly in western Mexico, extending into Arizona, Baja California, and with one disjunct species each in the Galapagos Islands and Peru. Prior phylogenetic analyses based on an alcohol dehydrogenase gene (...

Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

Science.gov (United States)

Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

2015-01-01

Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

Evolutionary dynamics of 3D genome architecture following polyploidization in cotton.

Science.gov (United States)

Wang, Maojun; Wang, Pengcheng; Lin, Min; Ye, Zhengxiu; Li, Guoliang; Tu, Lili; Shen, Chao; Li, Jianying; Yang, Qingyong; Zhang, Xianlong

2018-02-01

The formation of polyploids significantly increases the complexity of transcriptional regulation, which is expected to be reflected in sophisticated higher-order chromatin structures. However, knowledge of three-dimensional (3D) genome structure and its dynamics during polyploidization remains poor. Here, we characterize 3D genome architectures for diploid and tetraploid cotton, and find the existence of A/B compartments and topologically associated domains (TADs). By comparing each subgenome in tetraploids with its extant diploid progenitor, we find that genome allopolyploidization has contributed to the switching of A/B compartments and the reorganization of TADs in both subgenomes. We also show that the formation of TAD boundaries during polyploidization preferentially occurs in open chromatin, coinciding with the deposition of active chromatin modification. Furthermore, analysis of inter-subgenomic chromatin interactions has revealed the spatial proximity of homoeologous genes, possibly associated with their coordinated expression. This study advances our understanding of chromatin organization in plants and sheds new light on the relationship between 3D genome evolution and transcriptional regulation.

Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome

International Nuclear Information System (INIS)

Leadon, S.A.; Copper, P.K.

1993-01-01

Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions

Transcriptional Profiling in Cotton Associated with Bacillus Subtilis (UFLA285) Induced Biotic-Stress Tolerance

Science.gov (United States)

Abstract Lint yield and quality in cotton is greatly affected by water-deficit stress. The principal aim of this study was to identify cotton genes associated metabolic pathways involved in the water-deficit stress response. Gene expression profiles were developed for leaf and root tissues subject...

Drought coping strategies in cotton: increased crop per drop.

Science.gov (United States)

Ullah, Abid; Sun, Heng; Yang, Xiyan; Zhang, Xianlong

2017-03-01

The growth and yield of many crops, including cotton, are affected by water deficit. Cotton has evolved drought specific as well as general morpho-physiological, biochemical and molecular responses to drought stress, which are discussed in this review. The key physiological responses against drought stress in cotton, including stomata closing, root development, cellular adaptations, photosynthesis, abscisic acid (ABA) and jasmonic acid (JA) production and reactive oxygen species (ROS) scavenging, have been identified by researchers. Drought stress induces the expression of stress-related transcription factors and genes, such as ROS scavenging, ABA or mitogen-activated protein kinases (MAPK) signalling genes, which activate various drought-related pathways to induce tolerance in the plant. It is crucial to elucidate and induce drought-tolerant traits via quantitative trait loci (QTL) analysis, transgenic approaches and exogenous application of substances. The current review article highlights the natural as well as engineered drought tolerance strategies in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.

Directory of Open Access Journals (Sweden)

Kenji Osabe

Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.

Science.gov (United States)

Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W

2014-01-01

In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Methylation-sensitive amplified polymorphism analysis of Verticillium wilt-stressed cotton (Gossypium).

Science.gov (United States)

Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H

2016-10-06

In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

Science.gov (United States)

Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

2018-01-05

Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

Directory of Open Access Journals (Sweden)

Junhua Li

2014-01-01

Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

Hydrophobic Coatings on Cotton Obtained by in Situ Plasma Polymerization of a Fluorinated Monomer in Ethanol Solutions.

Science.gov (United States)

Molina, Ricardo; Teixidó, Josep Maria; Kan, Chi-Wai; Jovančić, Petar

2017-02-15

Plasma polymerization using hydrophobic monomers in the gas phase is a well-known technology to generate hydrophobic coatings. However, synthesis of functional hydrophobic coatings using plasma technology in liquids has not yet been accomplished. This work is consequently focused on polymerization of a liquid fluorinated monomer on cotton fabric initiated by atmospheric plasma in a dielectric barrier discharge configuration. Functional hydrophobic coatings on cotton were successfully achieved using in situ atmospheric plasma-initiated polymerization of fluorinated monomer dissolved in ethanol. Gravimetric measurements reveal that the amount of polymer deposited on cotton substrates can be modulated with the concentration of monomer in ethanol solution, and cross-linking reactions occur during plasma polymerization of a fluorinated monomer even without the presence of a cross-linking agent. FTIR and XPS analysis were used to study the chemical composition of hydrophobic coatings and to get insights into the physicochemical processes involved in plasma treatment. SEM analysis reveals that at high monomer concentration, coatings possess a three-dimensional pattern with a characteristic interconnected porous network structure. EDX analysis reveals that plasma polymerization of fluorinated monomers takes place preferentially at the surface of cotton fabric and negligible polymerization takes place inside the cotton fabric. Wetting time measurements confirm the hydrophobicity of cotton coatings obtained although equilibrium moisture content was slightly decreased. Additionally, the abrasion behavior and resistance to washing of plasma-coated cotton has been evaluated.

Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

Science.gov (United States)

MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

Directory of Open Access Journals (Sweden)

Md. Mizanur Rahman

2015-01-01

Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

Science.gov (United States)

de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

2017-03-01

Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

Molecular and Biochemical Characterization of Cotton Epicuticular Wax in Defense Against Cotton Leaf Curl Disease.

Science.gov (United States)

Khan, Muhammad Azmat Ullah; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Samiullah, Tahir Rehman; Muzaffar, Adnan; Nasir, Idrees Ahmad; Husnain, Tayyab

2015-12-01

Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite ( CLCuBuV and CLCuMB ). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV . Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants. The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition. Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum , G. harknessii and GaWM3, whereas no particle was detected in G. arboreum . Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm -2 as compared to GaWM3 with only 95 μg.cm -2 . G. hirsutum and G. harknessii had 130 μg.cm -2 and 146 μg.cm -2 , respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii . Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum . In contrast, color was observed in the rest of whiteflies. From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV , infested by whiteflies.

Characterization of the late embryogenesis abundant (LEA) proteins family and their role in drought stress tolerance in upland cotton.

Science.gov (United States)

Magwanga, Richard Odongo; Lu, Pu; Kirungu, Joy Nyangasi; Lu, Hejun; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Zhang, Zhenmei; Salih, Haron; Wang, Kunbo; Liu, Fang

2018-01-15

Late embryogenesis abundant (LEA) proteins are large groups of hydrophilic proteins with major role in drought and other abiotic stresses tolerance in plants. In-depth study and characterization of LEA protein families have been carried out in other plants, but not in upland cotton. The main aim of this research work was to characterize the late embryogenesis abundant (LEA) protein families and to carry out gene expression analysis to determine their potential role in drought stress tolerance in upland cotton. Increased cotton production in the face of declining precipitation and availability of fresh water for agriculture use is the focus for breeders, cotton being the backbone of textile industries and a cash crop for many countries globally. In this work, a total of 242, 136 and 142 LEA genes were identified in G. hirsutum, G. arboreum and G. raimondii respectively. The identified genes were classified into eight groups based on their conserved domain and phylogenetic tree analysis. LEA 2 were the most abundant, this could be attributed to their hydrophobic character. Upland cotton LEA genes have fewer introns and are distributed in all chromosomes. Majority of the duplicated LEA genes were segmental. Syntenic analysis showed that greater percentages of LEA genes are conserved. Segmental gene duplication played a key role in the expansion of LEA genes. Sixty three miRNAs were found to target 89 genes, such as miR164, ghr-miR394 among others. Gene ontology analysis revealed that LEA genes are involved in desiccation and defense responses. Almost all the LEA genes in their promoters contained ABRE, MBS, W-Box and TAC-elements, functionally known to be involved in drought stress and other stress responses. Majority of the LEA genes were involved in secretory pathways. Expression profile analysis indicated that most of the LEA genes were highly expressed in drought tolerant cultivars Gossypium tomentosum as opposed to drought susceptible, G. hirsutum. The tolerant

Genomic studies for drought tolerance in cotton (abstract)

International Nuclear Information System (INIS)

Mahboob-ur-Rehman; Ullah, I.; Asir, M.; Zafar, Y.; Malik, K.A.

2005-01-01

The cotton germplasm developed in Pakistan has not been screened comprehensively for their response to water stress, which is a pre-requisite in exploring different metabolic pathways, development of genome maps, isolation of genes etc. The objectives of the study were to identify drought tolerant/sensitive cotton genotypes, development of genetic linkage maps, and to identify the most robust DNA markers leading towards marker-assisted selection (MAS). A field trial was conducted to investigate variation in gas exchange parameters and productivity traits in 32 cotton cultivars/promising strains under water stress environment and to ascertain association among these physiological and productivity traits. Photosynthetic rate (P), stomatal conductance (gs) and transpiration rate (E) were significantly reduced under water stress. Substantial genotypic variation for gas exchange parameters especially photosynthetic rate were observed with a significant association with productivity traits under water-limited environment elucidating its use as an indirect selection criterion for seed cotton yield. Moreover, the genotypes FH-901 and CIM-1100 were found the most sensitive and tolerant cultivars, respectively. Four hundred eighty random primers were surveyed on different cotton genotypes involved in population development programs. Out of these, 32 polymorphic primers were identified which are being converted into sequence characterized amplified regions (SCARs). Similarly, 25 out of 150 microstatellite loci (SSRs) were polymorphic among the cotton genotypes. Amplified fragment length polymorphism (AFLP) fingerprinting technique is being exploited to search for additional polymorphisms. The study will have impact on cotton breeding programme by reducing span to develop drought tolerant cotton varieties. (author)

A novel VIGS method by agroinoculation of cotton seeds and application for elucidating functions of GhBI-1 in salt-stress response.

Science.gov (United States)

Zhang, Jingxia; Wang, Furong; Zhang, Chuanyun; Zhang, Junhao; Chen, Yu; Liu, Guodong; Zhao, Yanxiu; Hao, Fushun; Zhang, Jun

2018-06-04

A VIGS method by agroinoculation of cotton seeds was developed for gene silencing in young seedlings and roots, and applied in functional analysis of GhBI-1 in response to salt stress. Virus-induced gene silencing (VIGS) has been widely used to investigate the functions of genes expressed in mature leaves, but not yet in young seedlings or roots of cotton (Gossypium hirsutum L.). Here, we developed a simple and effective VIGS method for silencing genes in young cotton seedlings and roots by soaking naked seeds in Agrobacterium cultures carrying tobacco rattle virus (TRV)-VIGS vectors. When the naked seeds were soaked in Agrobacterium cultures with an OD600 of 1.5 for 90 min, it was optimal for silencing genes effectively in young seedlings as clear photo-bleaching phenotype in the newly emerging leaves of pTRV:GhCLA1 seedlings were observed at 12-14 days post inoculation. Silencing of GhPGF (cotton pigment gland formation) by this method resulted in a 90% decrease in transcript abundances of the gene in roots at the early development stage. We further used the tool to investigate function of GhBI-1 (cotton Bax inhibitor-1) gene in response to salt stress and demonstrated that GhBI-1 might play a protective role under salt stress by suppressing stress-induced cell death in cotton. Our results showed that the newly established VIGS method is a powerful tool for elucidating functions of genes in cotton, especially the genes expressed in young seedlings and roots.

Rapid and preferential activation of the c-jun gene during the mammalian UV response

International Nuclear Information System (INIS)

Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.

1991-01-01

Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase

Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

Directory of Open Access Journals (Sweden)

Waqas Malik

2014-01-01

Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

History of cotton fiber bioscience research at USDA-ARS Southern Regional Research Center

Science.gov (United States)

Improving fiber quality has been an important breeding goal for cotton breeders. Better understanding of fiber development helps cotton scientists to devise a strategy for crop improvement either through marker-assisted selection or via manipulation of fiber genes. USDA-ARS Southern Regional Researc...

Transcript mapping of Cotton leaf curl Burewala virus and its cognate betasatellite, Cotton leaf curl Multan betasatellite

Directory of Open Access Journals (Sweden)

Akbar Fazal

2012-10-01

Full Text Available Abstract Background Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus are major limiting factors for the production of numerous dicotyledonous crops throughout the warmer regions of the world. In the Old World a small number of begomoviruses have genomes consisting of two components whereas the majority have single-component genomes. Most of the monopartite begomoviruses associate with satellite DNA molecules, the most important of which are the betasatellites. Cotton leaf curl disease (CLCuD is one of the major problems for cotton production on the Indian sub-continent. Across Pakistan, CLCuD is currently associated with a single begomovirus (Cotton leaf curl Burewala virus [CLCuBuV] and the cotton-specific betasatellite Cotton leaf curl Multan betasatellite (CLCuMuB, both of which have recombinant origins. Surprisingly, CLCuBuV lacks C2, one of the genes present in all previously characterized begomoviruses. Virus-specific transcripts have only been mapped for few begomoviruses, including one monopartite begomovirus that does not associate with betasatellites. Similarly, the transcripts of only two betasatellites have been mapped so far. The study described has investigated whether the recombination/mutation events involved in the evolution of CLCuBuV and its associated CLCuMuB have affected their transcription strategies. Results The major transcripts of CLCuBuV and its associated betasatellite (CLCuMuB from infected Nicotiana benthamiana plants have been determined. Two complementary-sense transcripts of ~1.7 and ~0.7 kb were identified for CLCuBuV. The ~1.7 kb transcript appears similar in position and size to that of several begomoviruses and likely directs the translation of C1 and C4 proteins. Both complementary-sense transcripts can potentially direct the translation of C2 and C3 proteins. A single virion-sense transcript of ~1 kb, suitable for translation of the V1 and V2 genes was identified. A predominant

GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana.

Science.gov (United States)

Liu, Xiufang; Song, Yunzhi; Xing, Fangyu; Wang, Ning; Wen, Fujiang; Zhu, Changxiang

2016-09-01

WRKY transcription factors are involved in various processes, ranging from plant growth to abiotic and biotic stress responses. Group I WRKY members have been rarely reported compared with group II or III members, particularly in cotton (Gossypium hirsutum). In this study, a group I WRKY gene, namely, GhWRKY25, was cloned from cotton and characterized. Expression analysis revealed that GhWRKY25 can be induced or deduced by the treatments of abiotic stresses and multiple defense-related signaling molecules. Overexpression of GhWRKY25 in Nicotiana benthamiana reduced plant tolerance to drought stress but enhanced tolerance to salt stress. Moreover, more MDA and ROS accumulated in transgenic plants after drought treatment with lower activities of SOD, POD, and CAT. Our study further demonstrated that GhWRKY25 overexpression in plants enhanced sensitivity to the fungal pathogen Botrytis cinerea by reducing the expression of SA or ET signaling related genes and inducing the expression of genes involved in the JA signaling pathway. These results indicated that GhWRKY25 plays negative or positive roles in response to abiotic stresses, and the reduced pathogen resistance may be related to the crosstalk of the SA and JA/ET signaling pathways.

What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.

Directory of Open Access Journals (Sweden)

David J Spielman

Full Text Available Genetically modified, insect-resistant Bacillus thuringiensis (Bt cotton is cultivated extensively in Pakistan. Past studies, however, have raised concerns about the prevalence of Bt cotton varieties possessing weak or nonperforming insect-resistance traits conferred by the cry gene. We examine this issue using data drawn from a representative sample of cotton-growing households that were surveyed in six agroclimatic zones spanning 28 districts in Pakistan in 2013, as well as measurements of Cry protein levels in cotton tissue samples collected from the sampled households' main fields. The resultant dataset combines information from 593 sampled households with corresponding plant tissue diagnostics from 70 days after sowing, as well as information from 589 sampled households with corresponding diagnostics from 120 days after sowing. Our analysis indicates that 11 percent of farmers believed they were cultivating Bt cotton when, in fact, the Cry toxin was not present in the tested tissue at 70 days after sowing (i.e., a Type I error. The analysis further indicates that 5 percent of farmers believed they were cultivating non-Bt cotton when, in fact, the Cry toxin was present in the tested tissue (i.e., a Type II error. In addition, 17 percent of all sampled farmers were uncertain whether or not they were cultivating Bt cotton. Overall, 33 percent of farmers either did not know or were mistaken in their beliefs about the presence of the cry gene in the cotton they cultivated. Results also indicate that toxic protein levels in the plant tissue samples occurred below threshold levels for lethality in a significant percentage of cases, although these measurements may also be affected by factors related to tissue sample collection, handling, storage, and testing procedures. Nonetheless, results strongly suggest wide variability both in farmers' beliefs and in gene expression. Such variability has implications for policy and regulation in Pakistan

Resistance to glufosinate is proportional to phosphinothricin acetyltransferase expression and activity in LibertyLink(®) and WideStrike(®) cotton.

Science.gov (United States)

Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E

2016-04-01

Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this

China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

OpenAIRE

Cheng Fang; Bruce A. Babcock

2003-01-01

In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

Impact of Bollgard cotton on Indian cotton production and Income of ...

Indian Academy of Sciences (India)

Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

Transcriptomic Profiling Reveals Complex Molecular Regulation in Cotton Genic Male Sterile Mutant Yu98-8A.

Directory of Open Access Journals (Sweden)

Weiping Fang

Full Text Available Although cotton genic male sterility (GMS plays an important role in the utilization of hybrid vigor, its precise molecular mechanism remains unclear. To characterize the molecular events of pollen abortion, transcriptome analysis, combined with histological observations, was conducted in the cotton GMS line, Yu98-8A. A total of 2,412 genes were identified as significant differentially expressed genes (DEGs before and during the critical pollen abortion stages. Bioinformatics and biochemical analysis showed that the DEGs mainly associated with sugars and starch metabolism, oxidative phosphorylation, and plant endogenous hormones play a critical and complicated role in pollen abortion. These findings extend a better understanding of the molecular events involved in the regulation of pollen abortion in genic male sterile cotton, which may provide a foundation for further research studies on cotton heterosis breeding.

Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

Science.gov (United States)

Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

2006-01-01

Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

Impact of efficient refuge policies for Bt cotton in India on world cotton trade

OpenAIRE

Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

2010-01-01

India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

Dictionary of Cotton

Science.gov (United States)

The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

Science.gov (United States)

Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

2018-03-08

The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

Science.gov (United States)

Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

2017-01-01

Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

Science.gov (United States)

2012-01-01

Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

GhCAX3 gene, a novel Ca(2+/H(+ exchanger from cotton, confers regulation of cold response and ABA induced signal transduction.

Directory of Open Access Journals (Sweden)

Lian Xu

Full Text Available As a second messenger, Ca(2+ plays a major role in cold induced transduction via stimulus-specific increases in [Ca(2+]cyt, which is called calcium signature. During this process, CAXs (Ca(2+/H(+ exchangers play critical role. For the first time, a putative Ca(2+/H(+ exchanger GhCAX3 gene from upland cotton (Gossypium hirsutum cv. 'YZ-1' was isolated and characterized. It was highly expressed in all tissues of cotton except roots and fibers. This gene may act as a regulator in cotton's response to abiotic stresses as it could be up-regulated by Ca(2+, NaCl, ABA and cold stress. Similar to other CAXs, it was proved that GhCAX3 also had Ca(2+ transport activity and the N-terminal regulatory region (NRR through yeast complementation assay. Over-expression of GhCAX3 in tobacco showed less sensitivity to ABA during seed germination and seedling stages, and the phenotypic difference between wild type (WT and transgenic plants was more significant when the NRR was truncated. Furthermore, GhCAX3 conferred cold tolerance in yeast as well as in tobacco seedlings based on physiological and molecular studies. However, transgenic plant seeds showed more sensitivity to cold stress compared to WT during seed germination, especially when expressed in N-terminal truncated version. Finally, the extent of sensitivity in transgenic lines was more severe than that in WT line under sodium tungstate treatment (an ABA repressor, indicating that ABA could alleviate cold sensitivity of GhCAX3 seeds, especially in short of its NRR. Meanwhile, we also found that overexpression of GhCAX3 could enhance some cold and ABA responsive marker genes. Taken together, these results suggested that GhCAX3 plays important roles in the cross-talk of ABA and cold signal transduction, and compared to full-length of GhCAX3, the absence of NRR could enhance the tolerance or sensitivity to cold stress, depending on seedling's developmental stages.

Cotton proteomics for deciphering the mechanism of environment stress response and fiber development.

Science.gov (United States)

Zhou, Meiliang; Sun, Guoqing; Sun, Zhanmin; Tang, Yixiong; Wu, Yanmin

2014-06-13

Cotton fiber is considered as the backbone of the textile industry. The productivity of cotton crop is severely hampered by the occurrence of pathogens, pests, and various environmental factors. Nevertheless, cotton plant has developed sophisticated mechanisms to respond to environment stresses to avoid detrimental effects on its growth and development. Therefore, understanding the mechanisms of cotton fiber development and environment stress response is of considerable interest for designing agriculture breeding strategies to ensure sustainable productivity. The application of proteomics technologies to advance our knowledge in cotton fiber development and abiotic/biotic stress tolerance has increased dramatically in the last 5years as evidenced by the large amount of publications in this area. This review summarizes the work which has been reported for cotton proteomics and evaluates the findings in context of the approaches that are widely employed with the aim to generate novel insight useful for cotton improvement. Cotton (Gossypium spp.) is considered as the foremost commercially important fiber crop grown all over the world and is deemed as the backbone of the textile industry. Cotton is also an important source of edible oil seed and a nutrient-rich food crop as cottonseed contains high-quality protein and oil. The growth and productivity of cotton crop are often hampered by various biotic stress factors, such as insect pests and pathogens. In addition, cotton plants are frequently subjected to unavoidable environmental factors that cause abiotic stress, such as salt, heat and drought. Proteomic techniques provide one of the best options for understanding the gene function and phenotypic changes during cotton fiber development and stress response. This review first summarizes the work which has been reported for cotton proteomics about cotton fiber development and abiotic/biotic stress tolerance, and also evaluates the findings in context of the approaches

Effect of mutagens on the quality characters and disease resistant genes of diploid cotton (Gossypium arboreum L.)

International Nuclear Information System (INIS)

Haidar, S.; Khan, I.A.; Mansoor, S.

2002-01-01

In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton

Study on the Mitochondrial Genome of Sea Island Cotton (Gossypium barbadense) by BAC Library Screening

Institute of Scientific and Technical Information of China (English)

SU Ai-guo; LI Shuang-shuang; LIU Guo-zheng; LEI Bin-bin; KANG Ding-ming; LI Zhao-hu; MA Zhi-ying; HUA Jin-ping

2014-01-01

The plant mitochondrial genome displays complex features, particularly in terms of cytoplasmic male sterility (CMS). Therefore, research on the cotton mitochondrial genome may provide important information for analyzing genome evolution and exploring the molecular mechanism of CMS. In this paper, we present a preliminary study on the mitochondrial genome of sea island cotton (Gossypium barbadense) based on positive clones from the bacterial artiifcial chromosome (BAC) library. Thirty-ifve primers designed with the conserved sequences of functional genes and exons of mitochondria were used to screen positive clones in the genome library of the sea island cotton variety called Pima 90-53. Ten BAC clones were obtained and veriifed for further study. A contig was obtained based on six overlapping clones and subsequently laid out primarily on the mitochondrial genome. One BAC clone, clone 6 harbored with the inserter of approximate 115 kb mtDNA sequence, in which more than 10 primers fragments could be ampliifed, was sequenced and assembled using the Solexa strategy. Fifteen mitochondrial functional genes were revealed in clone 6 by gene annotation. The characteristics of the syntenic gene/exon of the sequences and RNA editing were preliminarily predicted.

Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

Directory of Open Access Journals (Sweden)

Wen-Qin Bai

Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

Directory of Open Access Journals (Sweden)

Qian Yan

Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

Science.gov (United States)

A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

Indian Bt cotton varieties do not affect the performance of cotton aphids.

Directory of Open Access Journals (Sweden)

Nora C Lawo

Full Text Available Cotton varieties expressing Cry proteins derived from the soil bacterium Bacillus thuringiensis (Bt are grown worldwide for the management of pest Lepidoptera. To prevent non-target pest outbreaks and to retain the biological control function provided by predators and parasitoids, the potential risk that Bt crops may pose to non-target arthropods is addressed prior to their commercialization. Aphids play an important role in agricultural systems since they serve as prey or host to a number of predators and parasitoids and their honeydew is an important energy source for several arthropods. To explore possible indirect effects of Bt crops we here examined the impact of Bt cotton on aphids and their honeydew. In climate chambers we assessed the performance of cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae when grown on three Indian Bt (Cry1Ac cotton varieties (MECH 12, MECH 162, MECH 184 and their non-transformed near isolines. Furthermore, we examined whether aphids pick up the Bt protein and analyzed the sugar composition of aphid honeydew to evaluate its suitability for honeydew-feeders. Plant transformation did not have any influence on aphid performance. However, some variation was observed among the three cotton varieties which might partly be explained by the variation in trichome density. None of the aphid samples contained Bt protein. As a consequence, natural enemies that feed on aphids are not exposed to the Cry protein. A significant difference in the sugar composition of aphid honeydew was detected among cotton varieties as well as between transformed and non-transformed plants. However, it is questionable if this variation is of ecological relevance, especially as honeydew is not the only sugar source parasitoids feed on in cotton fields. Our study allows the conclusion that Bt cotton poses a negligible risk for aphid antagonists and that aphids should remain under natural control in Bt cotton fields.

Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

Science.gov (United States)

Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2013-01-01

Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

Science.gov (United States)

Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

2015-05-01

Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

Dictionary of cotton: Picking & ginning

Science.gov (United States)

Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

GhNAC18, a novel cotton (Gossypium hirsutum L.) NAC gene, is ...

African Journals Online (AJOL)

EVANS

especially inhibition of leaf senescence and plant stress responses in cotton. This study provides .... For exogenous application of hormone treatments, leaves of uniformly ...... with incompatible interactions between chili pepper and pathogens.

Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

Science.gov (United States)

Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

2016-08-01

Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

Directory of Open Access Journals (Sweden)

Raquel Sampaio Oliveira

2016-02-01

Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

Science.gov (United States)

de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

Science.gov (United States)

de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

Science.gov (United States)

Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

2015-01-01

Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

Directory of Open Access Journals (Sweden)

Changwei Bi

2016-01-01

Full Text Available Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-01

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change.

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-11

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

Science.gov (United States)

Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

2018-01-01

Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

Genetic regulation of salt stress tolerance revealed by RNA-Seq in cotton diploid wild species, Gossypium davidsonii.

Science.gov (United States)

Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen

2016-02-03

Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress.

Investigating Genetic Diversity Among Cotton Genotypes Available in the Iranian Gene Bank (Gossypium sp. Using ISSR Molecular Marker

Directory of Open Access Journals (Sweden)

F Shahriari Ahmadi

2013-04-01

Full Text Available Cotton is one of the most important world crops and is considered as a major cash crop in the North East of Iran. All selections in plant breeding are based on diversity and an increase in genetic diversity determines the range of selection. In the present study, 24 cultivars of cotton available at the research station for cotton in the East of Iran -Kashmar- were studied using the ISSR marker. A total number of 13 primers, with repeated simple sequences, were used for the amplification of genomic DNA. Overall, 128 bands were obtained, 109 of which showed polymorphism. To evaluate genetic similarity between cultivars, cluster analysis accompanied by the similarity coefficient developed by Jaccard and Nee (1972, were applied using the UPGMA method. Dendrogram analysis showed a high diversity in the cotton cultivars and two main groups with 70 percent genetic similarity dividing the cotton cultivars into two main groups; namely, tetraploid and diploid. The highest polymorphism percentage was related to 5' (CT8RC3' (100% and the lowest belonged to 5' (AG8YA3' and 5' (TC8G3' (25% primers. Based on the similarity matrix, the highest genetic similarity was found in Varamin and Khordad and the lowest in Avangard and Bakhtegan cultivars. Based on the obtained results, ISSR markers can be efficiently used for the investigation of genetic diversity among cotton cultivars.

Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

Science.gov (United States)

Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

2017-03-01

An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

The anti-tumor drug bleomycin preferentially cleaves at the transcription start sites of actively transcribed genes in human cells.

Science.gov (United States)

Murray, Vincent; Chen, Jon K; Galea, Anne M

2014-04-01

The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.

Superoleophobic cotton textiles

NARCIS (Netherlands)

Leng, B.; Shao, Z.; With, de G.; Ming, W.

2009-01-01

Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

7 CFR 1205.319 - Cotton-producing region.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

Examining cotton in rotation with rice and cotton in rotation with other crops using natural experiment

Science.gov (United States)

Sun, Ling; Zhu, Zesheng

2017-08-01

This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.

Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

Simulative Global Warming Negatively Affects Cotton Fiber Length through Shortening Fiber Rapid Elongation Duration.

Science.gov (United States)

Dai, Yanjiao; Yang, Jiashuo; Hu, Wei; Zahoor, Rizwan; Chen, Binglin; Zhao, Wenqing; Meng, Yali; Zhou, Zhiguo

2017-08-23

Global warming could possibly increase the air temperature by 1.8-4.0 °C in the coming decade. Cotton fiber is an essential raw material for the textile industry. Fiber length, which was found negatively related to the excessively high temperature, determines yarn quality to a great extent. To investigate the effects of global warming on cotton fiber length and its mechaism, cottons grown in artificially elevated temperature (34.6/30.5 °C, T day /T night ) and ambient temperature (31.6/27.3 °C) regions have been investigated. Becaused of the high sensitivities of enzymes V-ATPase, PEPC, and genes GhXTH1 and GhXTH2 during fiber elongation when responding to high temperature stress, the fiber rapid elongation duration (FRED) has been shortened, which led to a significant suppression on final fiber length. Through comprehensive analysis, T night had a great influence on fiber elongation, which means T n could be deemed as an ideal index for forecasting the degree of high temperature stress would happen to cotton fiber property in future. Therefore, we speculate the global warming would bring unfavorable effects on cotton fiber length, which needs to take actions in advance for minimizing the loss in cotton production.

Molecular Characterization of a stress-induced NAC Gene ...

Indian Academy of Sciences (India)

lenovo

1Cotton Research Center, Shandong Academy of Agricultural Sciences, Jinan 250100, China. 2College of Life ... Running title: GhSNAC3 gene in Cotton ... Quantitative RT-PCR analysis indicated that GhSNAC3 was induced by high salinity, drought ..... simple and general method for transferring genes into plants. Science ...

The Impacts of U.S. Cotton Programs on the West and Central African Countries Cotton Export Earnings

OpenAIRE

Fadiga, Mohamadou L.; Mohanty, Samarendu; Pan, Suwen

2005-01-01

This study uses a stochastic simulation approach based on a partial equilibrium structural econometric model of the world fiber market to examine the effects of a removal of U.S. cotton programs on the world market. The effects on world cotton prices and African export earnings were analyzed. The results suggest that on average an elimination of U.S. cotton programs would lead to a marginal increase in the world cotton prices thus resulting in minimal gain for cotton exporting countries in Af...

Locally Grown: Examining Attitudes and Perceptions About Organic Cotton Production and Manufacturing Between Mississippi Cotton Growers and Consumers

Directory of Open Access Journals (Sweden)

Charles Freeman

2016-06-01

Full Text Available The purpose of this study is to examine attitudes and perceptions about organic cotton of Mississippi cotton growers and producers in comparison to fashion-conscious consumers, including advantages/disadvantages of growing and production processes, quality control, consumer preferences, and competitive price structures/profit margins. A sample size of 16 local Mississippi growers and/or producers and 44 undergraduate students at a mid-major Southeastern university were chosen to participate in the study. Instruments were developed based on current research and the definition of organic cotton production defined by the United States Department of Agriculture. Results indicate 75% of growers and producers do not perceive a quality difference between organic and conventionally grown cotton, while 72.7% of the consumers report organically grown cotton is capable of producing a higher quality product compared to conventionally grown cotton. Even with an increase in organic cotton prices (25- 40% higher premium, only 25% of growers and producers would be willing to convert, while a majority (52.3% of consumers would not be willing to spend more than 25% extra for an organically grown cotton product. Consumers indicate the negative effects of conventionally grown cotton, yet many report little knowledge about organic cotton production, while growers/producers immediately dismiss organically grown cotton as a retail marketing strategy.

The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

Science.gov (United States)

Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

2017-04-04

Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

Genome-wide recombination rate variation in a recombination map of cotton.

Science.gov (United States)

Shen, Chao; Li, Ximei; Zhang, Ruiting; Lin, Zhongxu

2017-01-01

Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species' genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton.

Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

Science.gov (United States)

Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

2015-02-01

WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

Superamphiphobic cotton fabrics with enhanced stability

Energy Technology Data Exchange (ETDEWEB)

Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

2015-11-30

Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change

OpenAIRE

Isengildina-Massa, Olga; MacDonald, Stephen

2009-01-01

The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...

Impact of Bollgard ® genetically modified cotton on the biodiversity ...

African Journals Online (AJOL)

Using cotton cultivars that express a gene of the Bacillus thuringiensis (Bt) bacterium producing a protein (Cry1Ac) with an insecticide effect on the Lepidoptera pests has made it possible to reduce the number of insecticide applications during the crop cycle. Thus, the objective was to determine, in the field during the ...

The water footprint of cotton consumption: An assessment of the impact of worldwide consumption of cotton products on the water resources in the cotton producing countries

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2006-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this paper is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Separation and recycling of cotton from cotton/PET blends by depolymerization of PET catalyzed by bases and ionic liquids

NARCIS (Netherlands)

Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)

2014-01-01

The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is

microRNAs involved in auxin signalling modulate male sterility under high-temperature stress in cotton (Gossypium hirsutum).

Science.gov (United States)

Ding, Yuanhao; Ma, Yizan; Liu, Nian; Xu, Jiao; Hu, Qin; Li, Yaoyao; Wu, Yuanlong; Xie, Sai; Zhu, Longfu; Min, Ling; Zhang, Xianlong

2017-09-01

Male sterility caused by long-term high-temperature (HT) stress occurs widely in crops. MicroRNAs (miRNAs), a class of endogenous non-coding small RNAs, play an important role in the plant response to various abiotic stresses. To dissect the working principle of miRNAs in male sterility under HT stress in cotton, a total of 112 known miRNAs, 270 novel miRNAs and 347 target genes were identified from anthers of HT-insensitive (84021) and HT-sensitive (H05) cotton cultivars under normal-temperature and HT conditions through small RNA and degradome sequencing. Quantitative reverse transcriptase-polymerase chain reaction and 5'-RNA ligase-mediated rapid amplification of cDNA ends experiments were used to validate the sequencing data. The results show that miR156 was suppressed by HT stress in both 84021 and H05; miR160 was suppressed in 84021 but induced in H05. Correspondingly, SPLs (target genes of miR156) were induced both in 84021 and H05; ARF10 and ARF17 (target genes of miR160) were induced in 84021 but suppressed in H05. Overexpressing miR160 increased cotton sensitivity to HT stress seen as anther indehiscence, associated with the suppression of ARF10 and ARF17 expression, thereby activating the auxin response that leads to anther indehiscence. Supporting this role for auxin, exogenous Indole-3-acetic acid (IAA) leads to a stronger male sterility phenotype both in 84021 and H05 under HT stress. Cotton plants overexpressing miR157 suppressed the auxin signal, and also showed enhanced sensitivity to HT stress, with microspore abortion and anther indehiscence. Thus, we propose that the auxin signal, mediated by miRNAs, is essential for cotton anther fertility under HT stress. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Construction and Identification of Bacterial Artificial Chromosome Library for 0-613-2R in Upland Cotton

Institute of Scientific and Technical Information of China (English)

无

2006-01-01

A bacterial artificial chromosome (BAC) library containing a large genomic DNA insert is an important tool for genome physical mapping, map-based cloning, and genome sequencing. To isolate genes via a map-based cloning strategy and to perform physical mapping of the cotton genome, a high-quality BAC library containing large cotton DNA inserts is needed. We have developed a BAC library of the restoring line 0-613-2R for isolating the fertility restorer (Rf1) gene and genomic research in cotton (Gossypium hirsutum L.). The BAC library contains 97 825 clones stored in 255 pieces of a 384-well microtiter plate. Random samples of BACs digested with the Notl enzyme indicated that the average insert size is approximately 130 kb, with a range of 80-275 kb,and 95.7% of the BAC clones in the library have an average insert size larger than 100 kb. Based on a cotton genome size of 2 250 Mb, library coverage is 5.7 x haploid genome equivalents. Four clones were selected randomly from the library to determine the stability of the BAC clones. There were no different fingerprints for 0 and 100 generations of each clone digested with Notl and Hindlll enzymes. Thus, the stability of a single BAC clone can be sustained at least for 100 generations. Eight simple sequence repeat (SSR) markers flanking the Rf1 gene were chosen to screen the BAC library by pool using PCR method and 25 positive clones were identified with 3.1 positive clones per SSR marker.

Identification of top-down forces regulating cotton aphid population growth in transgenic Bt cotton in central China.

Directory of Open Access Journals (Sweden)

Peng Han

Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.

Comparative genomic study of ALDH gene superfamily in Gossypium: A focus on Gossypium hirsutum under salt stress.

Directory of Open Access Journals (Sweden)

Yating Dong

Full Text Available Aldehyde dehydrogenases (ALDHs are a superfamily of enzymes which play important role in the scavenging of active aldehydes molecules. In present work, a comprehensive whole-genomic study of ALDH gene superfamily was carried out for an allotetraploid cultivated cotton species, G. hirsutum, as well as in parallel relative to their diploid progenitors, G. arboreum and G. raimondii. Totally, 30 and 58 ALDH gene sequences belong to 10 families were identified from diploid and allotetraploid cotton species, respectively. The gene structures among the members from same families were highly conserved. Whole-genome duplication and segmental duplication might be the major driver for the expansion of ALDH gene superfamily in G. hirsutum. In addition, the expression patterns of GhALDH genes were diverse across tissues. Most GhALDH genes were induced or repressed by salt stress in upland cotton. Our observation shed lights on the molecular evolutionary properties of ALDH genes in diploid cottons and their alloallotetraploid derivatives. It may be useful to mine key genes for improvement of cotton response to salt stress.

The "Cotton Problem"

OpenAIRE

Baffes, John

2005-01-01

Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

Tensile Properties of Single Jersey and 1×1 Rib Knitted Fabrics Made from 100% Cotton and Cotton/Lycra Yarns

Directory of Open Access Journals (Sweden)

Dereje Berihun Sitotaw

2017-01-01

Full Text Available The tensile properties such as tensile strength which is measured as breaking force in Newton (N and elongation percent (% at break of single jersey and 1×1 rib (knitted with full needles knitted fabrics made from 100% cotton and cotton/Lycra yarns (5% Lycra yarn content in 95% combed cotton yarn are investigated in this research. The sample fabrics are conditioned for 24 hours at 20±1°C temperature and 65±2% relative humidity before testing. Ten specimens (five for lengthwise and five for widthwise have been taken from each of the two knitted structures, those made from 100% cotton and cotton/Lycra (at 95/5 percent ratio blend yarns. According to the discussion and as found from the investigations, the tensile properties of single jersey and 1×1 rib knitted fabrics made from 100% cotton and cotton/Lycra yarns are significantly different from each other and both of the knitted fabrics have high elongation percent at break with cotton/Lycra blend yarns as compared to 100% cotton yarn. Knitted fabrics made from cotton/Lycra blended yarn have low breaking force and high elongation percent at break relative to knitted fabrics made from 100% cotton yarns.

Exp2 polymorphisms associated with variation for fiber quality properties in cotton (Gossypium spp.

Directory of Open Access Journals (Sweden)

Daohua He

2014-10-01

Full Text Available Plant expansins are a group of extracellular proteins thought to affect the quality of cotton fibers. Previous expression profile analysis revealed that six Expansin A genes are present in cotton, of which two (GhExp1 and GhExp2 produce transcripts that are specific to the developing cotton fiber. To identify the phenotypic function of Exp2, and to determine whether nucleotide variation among alleles of Exp2 affects fiber quality, candidate gene association mapping was conducted. Gene-specific primers were designed to amplify the Exp2 gene. By amplicon sequencing, the nucleotide diversity of Exp2 was investigated across 92 accessions (including 7 Gossypium arboreum, 74 Gossypium hirsutum, and 11 Gossypium barbadense accessions with different fiber qualities. Twenty-six SNPs and seven InDels including 14 from the coding region of Exp2 were detected, forming twelve distinct haplotypes in the cotton collection. Among the 14 SNPs in the coding region, five were missense mutations and nine were synonymous nucleotide changes. The average SNP/InDel per nucleotide ratio was 2.61% (one SNP per 39 bp, with 1.81 and 3.87% occurring in coding and non-coding regions, respectively. Nucleotide and haplotype diversity across the entire Exp2 region was 0.00603 (π and 0.844, respectively, and diversity in non-coding regions was higher than that in coding regions. For linkage disequilibrium (LD, the mean r2 value for all polymorphism loci pairs was 0.48, and LD did not decay over 748 bp. Based on 132 simple sequence repeat (SSR loci evenly covering 26 chromosomes, the population structure was estimated, and the accessions were divided into seven groups that agreed well with their genomic origin and evolutionary history. A general linear model was used to calculate the Exp2-wide diversity–trait associations of 5 fiber quality traits, considering population structure (Q. Four SNPs in Exp2 were associated with at least one of the fiber quality traits, but not with

Functional Characterization of a Dihydroflavanol 4-Reductase from the Fiber of Upland Cotton (Gossypium hirsutum

Directory of Open Access Journals (Sweden)

Le Wang

2016-01-01

Full Text Available Dihydroflavanol 4-reductase (DFR is a key later enzyme involved in two polyphenols’ (anthocyanins and proanthocyanidins (PAs biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1 was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (–-epicatachin and (–-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (–-catachin and (–-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.

Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico

Directory of Open Access Journals (Sweden)

Martha G. Rocha-Munive

2018-06-01

Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to

A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

Science.gov (United States)

Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

2004-09-01

Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

Comparative De Novo Transcriptome Analysis of Fertilized Ovules in Xanthoceras sorbifolium Uncovered a Pool of Genes Expressed Specifically or Preferentially in the Selfed Ovule That Are Potentially Involved in Late-Acting Self-Incompatibility.

Directory of Open Access Journals (Sweden)

Qingyuan Zhou

Full Text Available Xanthoceras sorbifolium, a tree species endemic to northern China, has high oil content in its seeds and is recognized as an important biodiesel crop. The plant is characterized by late-acting self-incompatibility (LSI. LSI was found to occur in many angiosperm species and plays an important role in reducing inbreeding and its harmful effects, as do gametophytic self-incompatibility (GSI and sporophytic self-incompatibility (SSI. Molecular mechanisms of conventional GSI and SSI have been well characterized in several families, but no effort has been made to identify the genes involved in the LSI process. The present studies indicated that there were no significant differences in structural and histological features between the self- and cross-pollinated ovules during the early stages of ovule development until 5 days after pollination (DAP. This suggests that 5 DAP is likely to be a turning point for the development of the selfed ovules. Comparative de novo transcriptome analysis of the selfed and crossed ovules at 5 DAP identified 274 genes expressed specifically or preferentially in the selfed ovules. These genes contained a significant proportion of genes predicted to function in the biosynthesis of secondary metabolites, consistent with our histological observations in the fertilized ovules. The genes encoding signal transduction-related components, such as protein kinases and protein phosphatases, are overrepresented in the selfed ovules. X. sorbifolium selfed ovules also specifically or preferentially express many unique transcription factor (TF genes that could potentially be involved in the novel mechanisms of LSI. We also identified 42 genes significantly up-regulated in the crossed ovules compared to the selfed ovules. The expression of all 16 genes selected from the RNA-seq data was validated using PCR in the selfed and crossed ovules. This study represents the first genome-wide identification of genes expressed in the fertilized

Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul

Directory of Open Access Journals (Sweden)

Osmério Pupim Junior

2008-05-01

Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.

The water footprint of cotton consumption

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2005-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Response of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls, under elevated CO2

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

The growth, development and consumption of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls grown under elevated CO2 (double-ambient vs. ambient) in open-top chambers were examined. Significant decreases in protein, total amino acid, water and nitrogen content and increases in free fatty acid were observed in cotton bolls. Changes in quality of cotton bolls affected the growth, development and food utilization of H. armigera. Significantly longer larval development duration in three successive generations and lower pupal weight of the second and third generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower fecundity was also found in successive three generations of H. armigera fed on cotton bolls grown under elevated CO2. The consumption per larva occurred significant increase in successive three generations and frass per larva were also significantly increased during the second and third generations under elevated CO2. Significantly lower relative growth rate, efficiency of conversion of ingested food and significant higher relative consumption rate in successive three generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower potential female fecundity, larval numbers and population consumption were found in the second and third generations of cotton bollworm fed on cotton bolls grown under elevated CO2. The integrative effect of higher larval mortality rate and lower adult fecundity resulted in significant decreases in potential population consumption in the latter two generations. The results show that elevated CO2 adversely affects cotton bolls quality, which indicates the potential population dynamics and potential population consumption of cotton bollworm will alleviate the harm to the plants in the future rising CO2 atmosphere.

Evaluation of cotton stalks destroyers

OpenAIRE

Bianchini, Aloisio; Borges, Pedro H. de M.

2013-01-01

The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

Cotton : Market setting, trade policies, and issues

OpenAIRE

Baffes, John

2004-01-01

The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

Carbon contributions from roots in cotton based rotations

Science.gov (United States)

Tan, D. K. Y.; Hulugalle, N. R.

2012-04-01

Most research on the decline in soil organic carbon (SOC) stocks in Australian cotton farming systems has focussed on the inputs from above-ground crop residues, with contribution from roots being less studied. This paper aims to outline the contribution of cotton roots and roots of other crops to soil carbon stocks in furrow-irrigated Vertisols in several cotton (Gossypium hirsutum L.)-based rotations. Data was collected from cotton-based rotation systems: cotton monoculture, cotton-vetch (Vicia benghalensis) Roth.), cotton-wheat (Triticum aestivum L.), cotton-wheat-vetch, cotton-corn, corn-corn, cotton-sorghum (Sorghum bicolor L.) and from BollgardTM II (Bt) and non-Bt cotton. Land management systems were permanent beds, with or without standing stubble, and conventional tillage. Root growth in the surface 0.10 m was measured with the core-break method, and that in the 0.10 to 1.0 m depth with a minirhizotron and I-CAP image capture system. These measurements were used to derive root C added to soil through intra-seasonal root death (Clost), C in roots remaining at the end of season (Croot), and total root C added to soil (Ctotal = Croot + Clost). Ctotal in non-Bt cotton (Sicot 80RRF, 0.9 t C/ha/year) was higher than in Bt cotton (Sicot 80RRF, 0.6 t C/ha/year). Overall, Ctotal from cotton roots ranges between 0.5 to 5 t C/ha/year, with Clost contributing 25-70%. Ctotal was greater with vetch than with wheat and was in the order of vetch in cotton-wheat-vetch (5.1 t C/ha/year) > vetch in cotton-vetch (1.9 t C/ha/year) > wheat in cotton-wheat (1.6 t C/ha/year) = wheat in cotton-wheat-vetch (1.7 t C/ha/year). Intra-seasonal root mortality accounted for 12% of total root carbon in vetch and 36% in wheat. Average corn Ctotal with monoculture was 9.3 t/ha and with cotton-corn 5.0 t/ha. Ctotal averaged between both treatments was, thus, of the order of 7.7 t C/ha/year and average Clost 0.04 t/ha/yr. Sorghum roots contributed less carbon with conventional tillage (8.2 t

Upland cotton gene GhFPF1 confers promotion of flowering time and shade-avoidance responses in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Xiaoyan Wang

Full Text Available Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1 gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13 and Gossypium arboreum L. genome (A-genome, n = 13 databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26. Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319 exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses.

Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease.

Science.gov (United States)

Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P

2015-05-01

Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.

Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain.

Science.gov (United States)

Grossi-de-Sa, Maria Fatima; Quezado de Magalhaes, Mariana; Silva, Marilia Santos; Silva, Shirley Margareth Buffon; Dias, Simoni Campos; Nakasu, Erich Yukio Tempel; Brunetta, Patricia Sanglard Felipe; Oliveira, Gustavo Ramos; Neto, Osmundo Brilhante de Oliveira; Sampaio de Oliveira, Raquel; Soares, Luis Henrique Barros; Ayub, Marco Antonio Zachia; Siqueira, Herbert Alvaro Abreu; Figueira, Edson L Z

2007-09-30

Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

Science.gov (United States)

Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

2018-04-12

Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

Directory of Open Access Journals (Sweden)

Pu Lu

2018-04-01

Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

Processing and properties of PCL/cotton linter compounds

Energy Technology Data Exchange (ETDEWEB)

Bezerra, Elieber Barros; Franca, Danyelle Campos; Morais, Dayanne Diniz de Souza; Araujo, Edcleide Maria [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Departamento de Engenharia de Materiais; Rosa, Morsyleide de Freitas; Morais, Joao Paulo Saraiva [Embrapa Tropical Agroindustia, Fortaleza, CE (Brazil); Wellen, Renate Maria Ramos, E-mail: wellen.renate@gmail.com [Universidade Federal da Paraiaba (UFPB), Joao Pessoa, PB (Brazil)

2017-03-15

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton nanolinter compounds. Adding cotton linter to PCL did not change its crystalline character as showed by XRD; however an increase in degree of crystallinity was observed by means of DSC. From mechanical tests in tension was observed an increase in ductility of PCL, and from mechanical tests in flexion an increase in elastic modulus upon addition of cotton linter, whereas impact strength presented lower values for PCL/cotton linter and PCL/cotton nanolinter compounds. SEM images showed that PCL presents plastic fracture and cotton linter has an interlacing fibril structure with high L/D ratio, which are in agreement with matrix/fibril morphology observed for PCL/cotton linter compounds. PCL/cotton linter compounds made in this work cost less than neat PCL matrix and presented improved properties making feasible its commercial use. (author)

Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

NARCIS (Netherlands)

Xia, J.

1997-01-01

Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

Identification of genes preferentially expressed during

African Journals Online (AJOL)

雨林木风

2012-08-16

Aug 16, 2012 ... The suppression subtractive hybridization (SSH) method conducted to generate ... which showed the lack of genomic information currently available for lily. ..... characterization of genes expressed during somatic embryo.

Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes

Science.gov (United States)

The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...

Transcriptome Analysis of Cotton (Gossypium hirsutum L. Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis.

Directory of Open Access Journals (Sweden)

Ruijuan Li

Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

Science.gov (United States)

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

Development and validation of SUCROS-Cotton : A potential crop growth simulation model for cotton

NARCIS (Netherlands)

Zhang, L.; Werf, van der W.; Cao, W.; Li, B.; Pan, X.; Spiertz, J.H.J.

2008-01-01

A model for the development, growth and potential production of cotton (SUCROS-Cotton) was developed. Particular attention was given to the phenological development of the plant and the plasticity of fruit growth in response to temperature, radiation, daylength, variety traits, and management. The

Diversity of arthropod community in transgenic poplar-cotton ecosystems.

Science.gov (United States)

Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

2015-12-02

Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

Cotton trends in India

Indian Academy of Sciences (India)

First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

Ergonomic Evaluation of Battery Powered Portable Cotton Picker

Science.gov (United States)

Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.

2012-09-01

Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.

7 CFR 1427.1203 - Eligible ELS cotton.

Science.gov (United States)

2010-01-01

... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton... must be either: (1) Baled lint, including baled lint classified by USDA's Agricultural Marketing..., under the provisions of this subpart, has been made available; (2) Imported ELS cotton; (3) Raw...

Phospholipases Dα and δ are involved in local and systemic wound responses of cotton (G. hirsutum

Directory of Open Access Journals (Sweden)

Angeliki Bourtsala

2017-03-01

Full Text Available Phospholipases D (PLDs catabolize structural phospholipids to produce phosphatidic acid (PtdOH, a lipid playing central role in signalling pathways in animal, yeast and plant cells. In animal cells two PLD genes have been studied while in model plant Arabidopsis twelve genes exist, classified in six classes (α-ζ. This underlines the role of these enzymes in plant responses to environmental stresses. However, information concerning the PLD involvement in the widely cultivated and economically important cotton plant responses is very limited. The aim of this report was to study the activity of conventional cotton PLD and its participation in plant responses to mechanical wounding, which resembles both biotic and abiotic stresses. PLDα activity was identified and further characterized by transphosphatidylation reaction. Upon wounding, cotton leaf responses consist of an acute in vitro increase of PLDα activity in both wounded and systemic tissue. However, determination of the in vivo PtdOH levels under the same wounding conditions revealed a rapid PtdOH formation only in wounded leaves and a late response of a PtdOH increase in both tissues. Εxpression analysis of PLDα and PLDδ isoforms showed mRNA accumulation of both isoforms in the wounded tissue, but only PLDδ exerts a high and sustainable expression in systemic leaves, indicating that this isoform is mainly responsible for the systemic wound-induced PtdOH production. Therefore, our data suggest that PLDα and PLDδ isoforms are involved in different steps in cotton wound signalling.

Energy usage for cotton ginning in Australia

Energy Technology Data Exchange (ETDEWEB)

Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture

2010-07-01

This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.

[Effects of cotton stalk biochar on microbial community structure and function of continuous cropping cotton rhizosphere soil in Xinjiang, China].

Science.gov (United States)

Gu, Mei-ying; Tang, Guang-mu; Liu, Hong-liang; Li, Zhi-qiang; Liu, Xiao-wei; Xu, Wan-li

2016-01-01

In this study, field trials were conducted to examine the effects of cotton stalk biochar on microbial population, function and structural diversity of microorganisms in rhizosphere soil of continuous cotton cropping field in Xinjiang by plate count, Biolog and DGGE methods. The experiment was a factorial design with four treatments: 1) normal fertilization with cotton stalk removed (NPK); 2) normal fertilization with cotton stalk powdered and returned to field (NPKS); 3) normal fertilization plus cotton stalk biochar at 22.50 t · hm⁻² (NPKB₁); and 4) normal fertilization plus cotton stalk biochar at 45.00 t · hm⁻² (NPKB₂). The results showed that cotton stalk biochar application obviously increased the numbers of bacteria and actinomycetes in the rhizospheric soil. Compared with NPK treatment, the number of fungi was significantly increased in the NPKB₁treatment, but not in the NPKB₂ treatment. However, the number of fungi was generally lower in the biochar amended (NPKB₁, NPKB₂) than in the cotton stalk applied plots (NPKS). Application of cotton stalk biochar increased values of AWCD, and significantly improved microbial richness index, suggesting that the microbial ability of utilizing carbohydrates, amino acids and carboxylic acids, especially phenolic acids was enhanced. The number of DGGE bands of NPKB₂ treatment was the greatest, with some species of Gemmatimonadetes, Acidobacteria, Proteobacteria and Actinobacteria being enriched. UPGMC Cluster analysis pointed out that bacterial communities in the rhizospheric soil of NPKB₂ treatment were different from those in the NPK, NPKS and NPKB₁treatments, which belonged to the same cluster. These results indicated that application of cotton stalk biochar could significantly increase microbial diversity and change soil bacterial community structure in the cotton rhizosphere soil, thus improving the health of soil ecosystem.

Influence of Tencel/cotton blends on knitted fabric performance

Directory of Open Access Journals (Sweden)

Alaa Arafa Badr

2016-09-01

Full Text Available The requirements in terms of wearing comfort with sportswear, underwear and outerwear are widely linked to the use of new fibers. Today, Tencel fiber is one of the most important developments in regenerated cellulosic fiber. However, the relation between Tencel fiber properties and fabric characteristics has not been enough studied in the literature especially the influence of fiber materials on mechanical, Ultraviolet Protection Factor (UPF and absorption properties. Therefore, in this study, knitted fabric samples were manufactured with eight different yarns with two fabric types (single jersey and single jersey with Lycra. 30/1-Ne yarns from natural and regenerated cellulosic fibers: 50% Tencel-LF/50% cotton, 67% Tencel-LF/33% cotton, 67% Tencel-STD/33% cotton, 70% bamboo/30% cotton, 100% bamboo, 100% Modal, 100% Micro-Modal and 100% cotton were employed. Then, all the produced fabrics were subjected to five cycles laundering and then flat dried. The results show that 67% Tencel-LF/33% cotton has more flexural rigidity and withdrawing handle force than 67% Tencel-STD/33% cotton fabric, while 67% Tencel-STD/33% cotton has a merit of durability during bursting test. Blending Egyptian cotton fibers with bamboo and Tencel as in 70/30% bamboo/cotton and 50/50% Tencel-LF/cotton improve UPF of the produced fabric.

Semiochemicals from herbivory induced cotton plants enhance the foraging behavior of the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Magalhães, D M; Borges, M; Laumann, R A; Sujii, E R; Mayon, P; Caulfield, J C; Midega, C A O; Khan, Z R; Pickett, J A; Birkett, M A; Blassioli-Moraes, M C

2012-12-01

The boll weevil, Anthonomus grandis, has been monitored through deployment of traps baited with aggregation pheromone components. However, field studies have shown that the number of insects caught in these traps is significantly reduced during cotton squaring, suggesting that volatiles produced by plants at this phenological stage may be involved in attraction. Here, we evaluated the chemical profile of volatile organic compounds (VOCs) emitted by undamaged or damaged cotton plants at different phenological stages, under different infestation conditions, and determined the attractiveness of these VOCs to adults of A. grandis. In addition, we investigated whether or not VOCs released by cotton plants enhanced the attractiveness of the aggregation pheromone emitted by male boll weevils. Behavioral responses of A. grandis to VOCs from conspecific-damaged, heterospecific-damaged (Spodoptera frugiperda and Euschistus heros) and undamaged cotton plants, at different phenological stages, were assessed in Y-tube olfactometers. The results showed that volatiles emitted from reproductive cotton plants damaged by conspecifics were attractive to adults boll weevils, whereas volatiles induced by heterospecific herbivores were not as attractive. Additionally, addition of boll weevil-induced volatiles from reproductive cotton plants to aggregation pheromone gave increased attraction, relative to the pheromone alone. The VOC profiles of undamaged and mechanically damaged cotton plants, in both phenological stages, were not different. Chemical analysis showed that cotton plants produced qualitatively similar volatile profiles regardless of damage type, but the quantities produced differed according to the plant's phenological stage and the herbivore species. Notably, vegetative cotton plants released higher amounts of VOCs compared to reproductive plants. At both stages, the highest rate of VOC release was observed in A. grandis-damaged plants. Results show that A. grandis uses

Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

Directory of Open Access Journals (Sweden)

Jehan

2017-11-01

Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

Superhydrophobic cotton by fluorosilane modification

CSIR Research Space (South Africa)

Erasmus, E

2009-12-01

Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

Alternative Splicing Profile and Sex-Preferential Gene Expression in the Female and Male Pacific Abalone Haliotis discus hannai.

Science.gov (United States)

Kim, Mi Ae; Rhee, Jae-Sung; Kim, Tae Ha; Lee, Jung Sick; Choi, Ah-Young; Choi, Beom-Soon; Choi, Ik-Young; Sohn, Young Chang

2017-03-09

In order to characterize the female or male transcriptome of the Pacific abalone and further increase genomic resources, we sequenced the mRNA of full-length complementary DNA (cDNA) libraries derived from pooled tissues of female and male Haliotis discus hannai by employing the Iso-Seq protocol of the PacBio RSII platform. We successfully assembled whole full-length cDNA sequences and constructed a transcriptome database that included isoform information. After clustering, a total of 15,110 and 12,145 genes that coded for proteins were identified in female and male abalones, respectively. A total of 13,057 putative orthologs were retained from each transcriptome in abalones. Overall Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analyzed in each database showed a similar composition between sexes. In addition, a total of 519 and 391 isoforms were genome-widely identified with at least two isoforms from female and male transcriptome databases. We found that the number of isoforms and their alternatively spliced patterns are variable and sex-dependent. This information represents the first significant contribution to sex-preferential genomic resources of the Pacific abalone. The availability of whole female and male transcriptome database and their isoform information will be useful to improve our understanding of molecular responses and also for the analysis of population dynamics in the Pacific abalone.

Alternative Splicing Profile and Sex-Preferential Gene Expression in the Female and Male Pacific Abalone Haliotis discus hannai

Directory of Open Access Journals (Sweden)

Mi Ae Kim

2017-03-01

Full Text Available In order to characterize the female or male transcriptome of the Pacific abalone and further increase genomic resources, we sequenced the mRNA of full-length complementary DNA (cDNA libraries derived from pooled tissues of female and male Haliotis discus hannai by employing the Iso-Seq protocol of the PacBio RSII platform. We successfully assembled whole full-length cDNA sequences and constructed a transcriptome database that included isoform information. After clustering, a total of 15,110 and 12,145 genes that coded for proteins were identified in female and male abalones, respectively. A total of 13,057 putative orthologs were retained from each transcriptome in abalones. Overall Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways analyzed in each database showed a similar composition between sexes. In addition, a total of 519 and 391 isoforms were genome-widely identified with at least two isoforms from female and male transcriptome databases. We found that the number of isoforms and their alternatively spliced patterns are variable and sex-dependent. This information represents the first significant contribution to sex-preferential genomic resources of the Pacific abalone. The availability of whole female and male transcriptome database and their isoform information will be useful to improve our understanding of molecular responses and also for the analysis of population dynamics in the Pacific abalone.

In silico comparative analysis of EST-SSRs in three cotton genomes ...

African Journals Online (AJOL)

The range of repeat number change in each HG was wider in Gr-Gh. The annotation of the SSR-ESTs showed that more Gene Ontology (GO) items targeted by SSR-ESTs of Ga and Gr than those of Gh. This study gave us new insights into the difference between the three cotton genomes, which will be more helpful to ...

Transcriptome analysis in cotton boll weevil (Anthonomus grandis and RNA interference in insect pests.

Directory of Open Access Journals (Sweden)

Alexandre Augusto Pereira Firmino

Full Text Available Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

Transcriptome analysis in cotton boll weevil (Anthonomus grandis) and RNA interference in insect pests.

Science.gov (United States)

Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

2013-01-01

Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

2013-10-01

Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

Science.gov (United States)

The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

The cotton MAPK kinase GhMPK20 negatively regulates resistance to Fusarium oxysporum by mediating the MKK4-MPK20-WRKY40 cascade.

Science.gov (United States)

Wang, Chen; He, Xiaowen; Li, Yuzhen; Wang, Lijun; Guo, Xulei; Guo, Xingqi

2017-11-02

Fusarium wilt is one of the most serious diseases affecting cotton. However, the pathogenesis and mechanism by which Fusarium oxysporum overcomes plant defence responses are unclear. Here, a new group D mitogen-activated protein kinase (MAPK) gene, GhMPK20, was identified and functionally analysed in cotton. GhMPK20 expression was significantly induced by F. oxysporum. Virus-induced gene silencing (VIGS) of GhMPK20 in cotton increased the tolerance to F. oxysporum, whereas ectopic GhMPK20 overexpression in Nicotiana benthamiana reduced F. oxysporum resistance via disruption of the salicylic acid (SA)-mediated defence pathway. More importantly, an F. oxysporum-induced MAPK cascade pathway composed of GhMKK4, GhMPK20 and GhWRKY40 was identified. VIGS of GhMKK4 and GhWRKY40 also enhanced F. oxysporum resistance in cotton, and the function of GhMKK4-GhMPK20 was shown to be essential for F. oxysporum-induced GhWRKY40 expression. Together, our results indicate that the GhMKK4-GhMPK20-GhWRKY40 cascade in cotton plays an important role in the pathogenesis of F. oxysporum. This research broadens our knowledge of the negative role of the MAPK cascade in disease resistance in cotton and provides an important scientific basis for the formulation of Fusarium wilt prevention strategies. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Cotton fiber quality determined by fruit position, temperature and management

OpenAIRE

Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

2013-01-01

CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

The merging of two dynasties--identification of an African cotton leaf curl disease-associated begomovirus with cotton in Pakistan.

Directory of Open Access Journals (Sweden)

Muhammad Nouman Tahir

Full Text Available Cotton leaf curl disease (CLCuD is a severe disease of cotton that occurs in Africa and Pakistan/northwestern India. The disease is caused by begomoviruses in association with specific betasatellites that differ between Africa and Asia. During survey of symptomatic cotton in Sindh (southern Pakistan Cotton leaf curl Gezira virus (CLCuGV, the begomovirus associated with CLCuD in Africa, was identified. However, the cognate African betasatellite (Cotton leaf curl Gezira betasatellite was not found. Instead, two Asian betasatellites, the CLCuD-associated Cotton leaf curl Multan betasatellite (CLCuMB and Chilli leaf curl betasatellite (ChLCB were identified. Inoculation of the experimental plant species Nicotiana benthamiana showed that CLCuGV was competent to maintain both CLCuMB and ChLCB. Interestingly, the enations typical of CLCuD were only induced by CLCuGV in the presence of CLCuMB. Also in infections involving both CLCuMB and ChLCB the enations typical of CLCuMB were less evident. This is the first time an African begomovirus has been identified on the Indian sub-continent, highlight the growing threat of begomoviruses and particularly the threat of CLCuD causing viruses to cotton cultivation in the rest of the world.

Suppression of jasmonic acid-dependent defense in cotton plant by the mealybug Phenacoccus solenopsis.

Directory of Open Access Journals (Sweden)

Pengjun Zhang

Full Text Available The solenopsis mealybug, Phenacoccus solenopsis, has been recently recognized as an aggressively invasive pest in China, and is now becoming a serious threat to the cotton industry in the country. Thus, it is necessary to investigate the molecular mechanisms employed by cotton for defending against P. solenopsis before the pest populations reach epidemic levels. Here, we examined the effects of exogenous jasmonic acid (JA, salicylic acid (SA, and herbivory treatments on feeding behavior and on development of female P. solenopsis. Further, we compared the volatile emissions of cotton plants upon JA, SA, and herbivory treatments, as well as the time-related changes in gossypol production and defense-related genes. Female adult P. solenopsis were repelled by leaves from JA-treated plant, but were not repelled by leaves from SA-treated plants. In contrast, females were attracted by leaves from plants pre-infested by P. solenopsis. The diverse feeding responses by P. solenopsis were due to the difference in volatile emission of plants from different treatments. Furthermore, we show that JA-treated plants slowed P. solenopsis development, but plants pre-infested by P. solenopsis accelerated its development. We also show that P. solenopsis feeding inhibited the JA-regulated gossypol production, and prevented the induction of JA-related genes. We conclude that P. solenopsis is able to prevent the activation of JA-dependent defenses associated with basal resistance to mealybugs.

Microbial contamination of water-soaked cotton gauze and its cause.

Science.gov (United States)

Oie, S; Yoshida, H; Kamiya, A

2001-01-01

Seven in-use cotton gauze samples and three cotton balls soaked in sterile distilled water in canisters were investigated 7 days after they were prepared in hospital. All samples were contaminated with bacteria including 10(6) to 10(7) colony forming units/ml of Pseudomonas aeruginosa. In vitro viability tests using cotton gauze and cotton balls soaked in sterile distilled water revealed rapid proliferation of P. aeruginosa, Serratia marcescens and Candida albicans. Since the cotton gauze and the cotton balls were soaked in water containing nutrients, such as protein and glucose, these materials may be readily contaminated with bacteria including P. aeruginosa. Thus, when using cotton gauze and cotton balls containing water, microbial contamination should be expected.

Radiation synthesis of silver nanostructures in cotton matrix

International Nuclear Information System (INIS)

Chmielewska, Dagmara; Sartowska, Bożena

2012-01-01

Cotton is one of the most popular natural fibres, composed mainly of cellulose, which finds a wide range of applications in paper, textile and health care products industry. Researchers have focused their interest on the synthesis of cotton nanocomposites, which enhances its mechanical, thermal and antimicrobial properties by the incorporation of various nanoparticles into the cotton matrix. Silver is one of the most popular antimicrobial agents with a wide spectrum of antibacterial and antifungal activity that results from a complex mechanism of its interactions with the cells of harmful microorganism. In this work, electron beam radiation was applied to synthesise silver nanostructures in cotton fibres. Investigations of the influence of the initial silver salt concentration on the size and distribution of the obtained silver nanostructures were carried out. A detailed characterisation of these nanocomposites with SEM-BSE and EDS methods was performed. TGA and DSC analyses were performed to assess the influence of different size silver nanoparticles and the effect of electron beam irradiation on the thermal properties of cotton fibres. A microbiological investigation to determine the antibacterial activity of Ag-cotton nanocomposites was carried out. - Highlights: ► Ag NPs embedded in cotton matrix were synthesised by electron beam irradiation. ► Concentration of silver salt solution influences on size of silver nanoparticles. ► Silver content as well as irradiation affect thermal properties of cotton fabrics. ► Ag-cotton nanocomposites exhibit antibacterial activity against bacteria and fungi.

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

Acoustical evaluation of carbonized and activated cotton nonwovens.

Science.gov (United States)

Jiang, N; Chen, J Y; Parikh, D V

2009-12-01

An activated carbon fiber nonwoven (ACF) was manufactured from a cotton nonwoven fabric. For the ACF acoustic application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glassfiber nonwoven, and the cotton nonwoven base layer with a layer of cotton fiber nonwoven. Their noise absorption coefficients and sound transmission loss were measured using the Brüel and Kjaer impedance tube instrument. Statistical significance of the differences between the composites was tested using the method of Duncan's grouping. The study concluded that the ACF composite exhibited a greater ability to absorb normal incidence sound waves than the composites with either glassfiber or cotton fiber. The analysis of sound transmission loss revealed that the three composites still obeyed the mass law of transmission loss. The composite with the surface layer of cotton fiber nonwoven possessed a higher fabric density and therefore showed a better sound insulation than the composites with glassfiber and ACF.

Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

2013-03-28

Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

Using cotton plant residue to produce briquettes

Energy Technology Data Exchange (ETDEWEB)

Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

2000-07-01

In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

FUBT, a putative MFS transporter, promotes secretion of fusaric acid in the cotton pathogen Fusarium oxysporum f.sp. vasinfectum

Science.gov (United States)

Fusaric acid (FA), a phytotoxic polyketide produced by Fusarium oxysporum f. sp. vasinfectum (FOV), has been shown to be associated with disease symptoms on cotton. A gene located upstream of the polyketide synthase gene responsible for the biosynthesis of FA is predicted to encode a member of the ...

Adoption of Bt Cotton: Threats and Challenges Adopción de Algodón Bt: Desafíos y Amenazas

Directory of Open Access Journals (Sweden)

Muhammad Faisal Bilal

2012-09-01

Full Text Available Adopting new technology always involves advantages and risks; Bt cotton (Gossypium hirsutum L. is a new technology well known in developed countries for its many advantages, such as reduced pesticide application, better insect pest control, and higher lint yield. However, its success in developing countries is still a question mark. Global adoption of Bt cotton has risen dramatically from 0.76 million ha when introduced in 1996 to 7.85 million ha in the 2005 cotton-growing season where 54% of the cotton crops in the USA, 76% in China, and 80% in Australia were grown with single or multiple Bt genes. Bollworms are serious cotton pests causing 30-40% yield reduction in Pakistan and 20-66% potential crop losses in India. The major advances shown in this review include: (1 Evolution of Bt cotton may prove to be a green revolution to enhance cotton yield; (2 adoption of Bt cotton by farmers is increasing due to its beneficial environmental effects by reducing pesticide application: however, a high seed price has compelled farmers to use illegal non-approved Bt causing huge damage to crops because of low tolerance to insect pests; and (3 some factors responsible for changes in the efficiency of the Bt gene and Bt cotton yield include internal phenology (genetics, atmospheric changes (CO2 concentration, nutrition, insect pests, boll distribution pattern, disease and nematodes, removal of fruiting branch and/or floral bud, introduction of Bt gene, and terpenoids and tannin production in the plant body.La adopción de nueva tecnología siempre involucra ventajas y riesgos; algodón Bt (Gossypium hirsutum L. es una nueva tecnología bien conocida en países desarrollados por muchas ventajas como reducida aplicación de pesticidas, mejor control de insectos plaga, y mayor producción de fibra, pero su éxito en países en desarrollo aún conlleva dudas. La adopción global de algodón Bt ha aumentado dramáticamente de 0,76 millones de hectáreas en su

A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

Science.gov (United States)

Zhen, Congai; Gao, Xiwu

2016-02-01

In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

7 CFR 27.21 - Preparation of samples of cotton.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...

Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

Science.gov (United States)

Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

2015-09-17

Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

STIFFNESS MODIFICATION OF COTTON IN CHITOSAN TREATMENT

Directory of Open Access Journals (Sweden)

CAMPOS Juan

2017-05-01

Full Text Available Chitosan is a biopolymer obtained from chitin, and among their most important aspects highlights its applications in a lot of industrial sectors due to its intrinsic properties, especially in the textile sector. In the last years, chitosan is widely used in the cotton and wool finishing processes due to its bond between them and its properties as an antifungical and antimicrobial properties. In this paper three different molecular weight chitosan are used in the finishing process of cotton to evaluate its influence in the surface properties modification. In order to evaluate the effect of the treatment with chitosan, flexural stiffness test is performed in warp and weft direction, and then the total value is calculated. The cotton fabric is treated with 5 g/L of different types of chitosan in an impregnation bath. This study shows the extent of surface properties modification of the cotton provided by three types of chitosan treatment. The results show that all types of chitosan modify the cotton flexural rigidity properties but the one which modifies it in a relevant manner is chitosan originated from shrimps. Chitosan, textile, flexural stiffnes, chitin, cotton.

RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

Science.gov (United States)

Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

2018-06-01

Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

Thwarting one of cotton's nemeses

International Nuclear Information System (INIS)

Senft, D.

1991-01-01

There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

Estimation of Heterosis and Combining Ability in F1 Hybrids of Upland Cotton for Yield and Fiber Traits

International Nuclear Information System (INIS)

Arain, B.T.; Baloch, M.J.; Bughio, Q.U.A.; Sial, P.; Arain, M.A.; Baloch, A.

2015-01-01

The experimental research was conducted so as to determine the general combining ability (GCA) and specific combining ability (SCA) estimates and heterotic effects for seed cotton yield and fibre traits in 5 x 5 half diallel crosses of upland cotton (Gossypium hirsutum L.). The parental genotypes studied were; CRIS-134, IR-3701, IR-1524, FH-113 and MG-6. The characters such as bolls/plant, sympodial branches/plant, boll weight (g), plant height (cm), fibre length (mm), seed cotton yield/plant (g), seed index (g) and ginning out turn percentage were studied. The experiment was laid-out in a randomized complete block design with four replications at experimental field of the Department of Plant Breeding and Genetics, Sindh Agriculture University Tandojam, Pakistan during 2013. The results revealed that, parents and hybrids differed significantly for their mean performance regarding all the traits studied. The importance of heterotic effects was evident from the significance of parents vs. hybrids performance. The variances due to GCA and SCA were significant for all the traits except that GCA was non-significant for boll weight only whereas, SCA was non-significant for boll weight, seed index and ginning out turn percentage. The significance of GCA indicated the importance of additive genes advocating the traits while, the involvement of non-additive genes was evident from the significance of SCA variances. The GCA variances were greater than SCA for bolls per plant, plant height, seed cotton yield and lint percentage while, SCA variances were higher than GCA for sympodial branches/plant and fibre length. Parents IR-3701, FH-113 and MG-6 displayed higher positive GCA effects for bolls/plant, sympodial branches/plant, fibre length, seed cotton yield, seed index and ginning out turn percentage. The per se performance of these three parents was exactly reflected in their GCA effects and such happenings are exceptional. Such results suggested that, all three parents were

75 FR 50847 - Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders

Science.gov (United States)

2010-08-18

... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... Assistance Program (EAAP) and clarifying the definition of ``active shipping order.'' DATES: Effective Date... address that matter this rule amends in the payment calculation for semi-processed and reginned motes in 7...

THE ELASTICITY OF EXPORT DEMAND FOR US COTTON

OpenAIRE

Paudel, Laxmi; Houston, Jack E.; Adhikari, Murali; Devkota, Nirmala

2004-01-01

There exist conflicting views among the researchers about the magnitudes of US cotton export demand elasticity, ranging from the highly inelastic to highly elastic. An Armington model was used to analyze the export demand elasticity of US Cotton. Our analysis confirms an elastic nature of US cotton export demand.

7 CFR 1427.23 - Cotton loan deficiency payments.

Science.gov (United States)

2010-01-01

..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan... intentions to receive a loan deficiency payment on the identified commodity or (ii) A completed request for a... cotton based on a locked-in adjusted world price, provide identifying numbers for modules or other...

Fourier transform infrared imaging of Cotton trash mixtures

Science.gov (United States)

There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...

Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

Science.gov (United States)

Among SNP markers that become increasingly valuable in molecular breeding of crop plants are the CAP and dCAP markers derived from the genes of interest. To date, the number of such gene-based markers is small in polyploid crop plants such as tetraploid cotton that has A and D subgenomes. The obje...

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

Science.gov (United States)

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

3rd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

2nd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

1st stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

Directory of Open Access Journals (Sweden)

F. Ducamp

2012-01-01

Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

Effects of Different Densities of Cotton (Gossypium Hirsutum and Common Lambsquarter (Chenopodium Album on Some Cotton Growth Characteristics in Birjand Condition

Directory of Open Access Journals (Sweden)

M. Velayati

2011-01-01

Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis

21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

Science.gov (United States)

2010-04-01

... used in dry food packaging. 182.70 Section 182.70 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are generally recognized as safe for their intended use, within the meaning of...

Relay cropping of wheat (Triticum aestivum L.) in cotton (Gossypium hirsutum L.) improves the profitability of cotton-wheat cropping system in Punjab, Pakistan.

Science.gov (United States)

Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad

2018-01-01

Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net

Weed flora, yield losses and weed control in cotton crop

OpenAIRE

Jabran, Khawar

2016-01-01

Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

Proteomic responses of drought-tolerant and drought-sensitive cotton varieties to drought stress.

Science.gov (United States)

Zhang, Haiyan; Ni, Zhiyong; Chen, Quanjia; Guo, Zhongjun; Gao, Wenwei; Su, Xiujuan; Qu, Yanying

2016-06-01

biochemical pathways responsible for drought tolerance in KK1543. Although further studies are needed, this proteomic analysis underlines the role of post-translational events. The differentially expressed proteins and their corresponding genes may be used as markers for the breeding of drought tolerance in cotton.

Increasing cotton stand establishment in soils prone to soil crusting

Science.gov (United States)

Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...

7 CFR 28.107 - Original cotton standards and reserve sets.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Original cotton standards and reserve sets. 28.107... Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a) The containers of the original Universal Standards and other official cotton standards of the United...

Cotton Production in Mali: Subsidies or Sustainable Development?

Science.gov (United States)

Moore, Lindsey

2007-01-01

Current trade rules concerning cotton subsidies are intricately linked with poverty and hunger in Mali. Over half of Mali's economy and over 30 million people depend directly on cotton. It is the main cash crop and the most important source of export revenue. Cotton also plays a key role in development policies and in the fight against poverty by…

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus

Directory of Open Access Journals (Sweden)

Schrago Carlos EG

2011-08-01

Full Text Available Abstract Background In response to infection, viral genomes are processed by Dicer-like (DCL ribonuclease proteins into viral small RNAs (vsRNAs of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV, a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus.

Science.gov (United States)

Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S

2011-08-24

In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Cotton contamination

CSIR Research Space (South Africa)

Van der Sluijs, MHJ

2018-05-01

Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

Minimization of operational impacts on spectrophotometer color measurements for cotton

Science.gov (United States)

A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...

The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new menace to cotton in Egypt and its chemical control

Directory of Open Access Journals (Sweden)

El-Zahi El-Zahi Saber

2016-04-01

Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.

Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality

International Nuclear Information System (INIS)

Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.

2014-01-01

In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed

Mining and Analysis of SNP in Response to Salinity Stress in Upland Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Wang, Xiaoge; Lu, Xuke; Wang, Junjuan; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Ye, Wuwei

2016-01-01

Salinity stress is a major abiotic factor that affects crop output, and as a pioneer crop in saline and alkaline land, salt tolerance study of cotton is particularly important. In our experiment, four salt-tolerance varieties with different salt tolerance indexes including CRI35 (65.04%), Kanghuanwei164 (56.19%), Zhong9807 (55.20%) and CRI44 (50.50%), as well as four salt-sensitive cotton varieties including Hengmian3 (48.21%), GK50 (40.20%), Xinyan96-48 (34.90%), ZhongS9612 (24.80%) were used as the materials. These materials were divided into salt-tolerant group (ST) and salt-sensitive group (SS). Illumina Cotton SNP 70K Chip was used to detect SNP in different cotton varieties. SNPv (SNP variation of the same seedling pre- and after- salt stress) in different varieties were screened; polymorphic SNP and SNPr (SNP related to salt tolerance) were obtained. Annotation and analysis of these SNPs showed that (1) the induction efficiency of salinity stress on SNPv of cotton materials with different salt tolerance index was different, in which the induction efficiency on salt-sensitive materials was significantly higher than that on salt-tolerant materials. The induction of salt stress on SNPv was obviously biased. (2) SNPv induced by salt stress may be related to the methylation changes under salt stress. (3) SNPr may influence salt tolerance of plants by affecting the expression of salt-tolerance related genes.

Response of cotton genotypes to boron under-b-adequate conditions

International Nuclear Information System (INIS)

Shah, J. A.; Sial, M. A.; Hassan, Z. U.; Rajpar, I.

2015-01-01

Balanced boron (B) application is well-known to enhance the cotton production; however, the narrow range between B-deficiency and toxicity levels makes it difficult to manage. Cotton genotypes extensively differ in their response to B requirements. The adequate dose of B for one genotype may be insufficient or even toxic to other genotype. The effects of boron (B) on seed cotton yield and its various yield associated traits were studied on 10 cotton genotypes of Pakistan. The pot studies were undertaken to categorize cotton genotypes using B-deficient (control) and B-adequate (2.0 kg B ha-1) levels arranged in CRD with four repeats. The results indicated that the seed cotton yield, yield attributes and B-uptake of genotypes were comparatively decreased in B-deficient stressed treatment. Genotype NIA-Ufaq exhibited wide range of adaptation and ranked as efficient-responsive, as it produced higher seed cotton yield under both B-regimes. SAU-2 and CIM-506 were highly-efficient and remaining all genotypes were medium-efficient. Genotype Sindh-1 produced low seed cotton yield under B deficient condition and ranked as low-efficient. B-efficient cotton genotypes can be grown in B deficient soils without B application. (author)

Insecticide use and practices among cotton farmers in northern ...

African Journals Online (AJOL)

Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

78 FR 68983 - Cotton Futures Classification: Optional Classification Procedure

Science.gov (United States)

2013-11-18

...-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing... regulations to allow for the addition of an optional cotton futures classification procedure--identified and... response to requests from the U.S. cotton industry and ICE, AMS will offer a futures classification option...

MicroRNA expression profiling during upland cotton gland forming ...

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... 2Key Laboratory of Cotton Genetic Improvement, Cotton Research Institute of the Chinese Academy of Agricultural. Sciences, Ministry of ... terpenoid aldehyde biosynthesis pathway, genetic engineering and molecular breeding of cotton. ... toxic to non-ruminant animals and humans, which means that large ...

Evaluating potassium-use-efficiency of five cotton genotypes of pakistan

International Nuclear Information System (INIS)

Hassan, Z.U.; Kubar, K.A.

2014-01-01

Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)

A Floricaula/Leafy gene homolog is preferentially expressed in developing female cones of the tropical pine Pinus caribaea var. caribaea

Directory of Open Access Journals (Sweden)

Marcelo Carnier Dornelas

2005-01-01

Full Text Available In angiosperms, flower formation is controlled by meristem identity genes, one of which, FLORICAULA (FLO/LEAFY (LFY, plays a central role. It is not known if the formation of reproductive organs of pre-angiosperm species is similarly regulated. Here, we report the cloning of a conifer (Pinus caribaea var. caribaea FLO/LFY homolog, named PcLFY. This gene has a large C-terminal region of high similarity to angiosperm FLO/LFY orthologs and shorter regions of local similarity. In contrast to angiosperms, conifers have two divergent genes resembling LFY. Gymnosperm FLO/LFY proteins constitute a separate clade, that can be divided into two divergent groups. Phylogenetic analysis of deduced protein sequences has shown that PcLFY belongs to the LFY-like clade. Northern hybridization analysis has revealed that PcLFY is preferentially expressed in developing female cones but not in developing male cones. This expression pattern was confirmed by in situ hybridization and is consistent with the hypothesis of PcLFY being involved in the determination of the female cone identity. Additionally, mutant complementation experiments have shown that the expression of the PcLFY coding region, driven by the Arabidopsis LFY promoter, can confer the wild-type phenotype to lfy-26 transgenic mutants, suggesting that both gymnosperm and angiosperm LFY homologs share the same biological role.

Producing Organic Cotton: A Toolkit - Crop Guide, Projekt guide, Extension tools

OpenAIRE

Eyhorn, Frank

2005-01-01

The CD compiles the following extension tools on organic cotton: Organic Cotton Crop Guide, Organic Cotton Training Manual, Soil Fertility Training Manual, Organic Cotton Project Guide, Record keeping tools, Video "Organic agriculture in the Nimar region", Photos for illustration.

A facile method to fabricate superhydrophobic cotton fabrics

Science.gov (United States)

Zhang, Ming; Wang, Shuliang; Wang, Chengyu; Li, Jian

2012-11-01

A facile and novel method for fabricating superhydrophobic cotton fabrics is described in the present work. The superhydrophobic surface has been prepared by utilizing cationic poly (dimethyldiallylammonium chloride) and silica particles together with subsequent modification of (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The size distribution of silica particles was measured by Particle Size Analyzer. The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, the superhydrophobic durability of coated cotton textiles has been evaluated by exposure, immersion and washing tests. The results show that the treated cotton fabrics exhibited excellent chemical stability and outstanding non-wettability with the WCA of 155 ± 2°, which offers an opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications.

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues.

Science.gov (United States)

Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F

2011-11-24

Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Transcriptome sequencing and de novo analysis of cytoplasmic male sterility and maintenance in JA-CMS cotton.

Science.gov (United States)

Yang, Peng; Han, Jinfeng; Huang, Jinling

2014-01-01

Cytoplasmic male sterility (CMS) is the failure to produce functional pollen, which is inherited maternally. And it is known that anther development is modulated through complicated interactions between nuclear and mitochondrial genes in sporophytic and gametophytic tissues. However, an unbiased transcriptome sequencing analysis of CMS in cotton is currently lacking in the literature. This study compared differentially expressed (DE) genes of floral buds at the sporogenous cells stage (SS) and microsporocyte stage (MS) (the two most important stages for pollen abortion in JA-CMS) between JA-CMS and its fertile maintainer line JB cotton plants, using the Illumina HiSeq 2000 sequencing platform. A total of 709 (1.8%) DE genes including 293 up-regulated and 416 down-regulated genes were identified in JA-CMS line comparing with its maintainer line at the SS stage, and 644 (1.6%) DE genes with 263 up-regulated and 381 down-regulated genes were detected at the MS stage. By comparing the two stages in the same material, there were 8 up-regulated and 9 down-regulated DE genes in JA-CMS line and 29 up-regulated and 9 down-regulated DE genes in JB maintainer line at the MS stage. Quantitative RT-PCR was used to validate 7 randomly selected DE genes. Bioinformatics analysis revealed that genes involved in reduction-oxidation reactions and alpha-linolenic acid metabolism were down-regulated, while genes pertaining to photosynthesis and flavonoid biosynthesis were up-regulated in JA-CMS floral buds compared with their JB counterparts at the SS and/or MS stages. All these four biological processes play important roles in reactive oxygen species (ROS) homeostasis, which may be an important factor contributing to the sterile trait of JA-CMS. Further experiments are warranted to elucidate molecular mechanisms of these genes that lead to CMS.

Milkweed, stink bugs, and Georgia cotton

Science.gov (United States)

In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

Fabrication of cotton fabric with superhydrophobicity and flame retardancy.

Science.gov (United States)

Zhang, Ming; Wang, Chengyu

2013-07-25

A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

At-line cotton color measurements by portable color spectrophotometers

Science.gov (United States)

As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...

7 CFR 27.25 - Additional samples of cotton; drawing.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed, separate samples, if desired, may be drawn and furnished to the owner of the cotton. ...

DeepCotton: in-field cotton segmentation using deep fully convolutional network

Science.gov (United States)

Li, Yanan; Cao, Zhiguo; Xiao, Yang; Cremers, Armin B.

2017-09-01

Automatic ground-based in-field cotton (IFC) segmentation is a challenging task in precision agriculture, which has not been well addressed. Nearly all the existing methods rely on hand-crafted features. Their limited discriminative power results in unsatisfactory performance. To address this, a coarse-to-fine cotton segmentation method termed "DeepCotton" is proposed. It contains two modules, fully convolutional network (FCN) stream and interference region removal stream. First, FCN is employed to predict initially coarse map in an end-to-end manner. The convolutional networks involved in FCN guarantee powerful feature description capability, simultaneously, the regression analysis ability of neural network assures segmentation accuracy. To our knowledge, we are the first to introduce deep learning to IFC segmentation. Second, our proposed "UP" algorithm composed of unary brightness transformation and pairwise region comparison is used for obtaining interference map, which is executed to refine the coarse map. The experiments on constructed IFC dataset demonstrate that our method outperforms other state-of-the-art approaches, either in different common scenarios or single/multiple plants. More remarkable, the "UP" algorithm greatly improves the property of the coarse result, with the average amplifications of 2.6%, 2.4% on accuracy and 8.1%, 5.5% on intersection over union for common scenarios and multiple plants, separately.

Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

Directory of Open Access Journals (Sweden)

T. Barakova

2017-09-01

Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

Study of mungbean intercropping in cotton planted with different techniques

International Nuclear Information System (INIS)

Khan, M.B.; Khaliq, A.

2004-01-01

Bio-economic efficiency of different cotton-based intercropping systems was determined at the Agronomic Research Area, University of Agriculture, Faisalabad, (Pakistan) during 1996-1997 and 1997-98. Cotton cultivar NIAB-78 was planted in 80-cm apart single rows and 120-cm spaced double row strips with the help of a single row hand drill. Intercropping systems were cotton alone and cotton + mungbean. Experiment was laid out in a RCBD with split arrangements in four replications. Planting patterns were kept in main plots and intercropping systems in sub-plots. Inter crop was sown in the space between 80-cm apart single rows as well as 120-cm spaced double row strips. Competition functions like relative crowding coefficient, competitive ratio, aggressivity, land equivalent ratio and area time equivalent ratio were calculated for the assessment of the benefits of the intercropping. Partial budget was prepared for determining net field benefits of the systems under study. Growing of cotton in 120-cm spaced double row strips proved superior to 80-cm spaced single rows. Intercropping decreased the seed cotton production significantly in both years, however, inter crop not only covered this loss but also increased overall productivity. Higher net field benefit (NFB) was obtained from cotton + mungbean than sole cropping of cotton. Farmers with small land holdings, seriously constrained by low crop income can adopt the practice of intercropping of mungbean in cotton. (author)

Fourier-transform imaging of cotton and botanical and field trash mixtures

Science.gov (United States)

Botanical and field cotton trash comingled with cotton lint can greatly reduce the marketability and quality of cotton. Trash can be found comingled with cotton lint during harvesting, ginning, and processing, thus this study is of interest. Attenuated Total Reflectance-Fourier Transform Infrared (A...

Population genetic structure of cotton pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) using mitochondrial cytochrome oxidase I (COI) gene sequences from India.

Science.gov (United States)

Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R

2017-11-01

Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.

7 CFR 1427.174 - Maturity of seed cotton loans.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427.174 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION... Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...

The preparation and antibacterial effects of dopa-cotton/AgNPs

International Nuclear Information System (INIS)

Xu Hong; Shi Xue; Ma Hui; Lv Yihang; Zhang Linping; Mao Zhiping

2011-01-01

Silver nanoparticles (AgNPs) have been known to have powerful antibacterial activity. In this paper, in situ generation of AgNPs on the surface of dopamine modified cotton fabrics (dopa-cotton/AgNPs) in aqueous solution under room temperature is presented. X-ray photoelectron spectroscopy (XPS) and field emission scanning electron microscope (FE-SEM) were used to analyze the surface chemical composition and the morphology of the modified cotton fabrics, respectively. The results indicated that the surface of cotton fabrics was successfully coated with polydopamine and AgNPs. The cotton fabrics with AgNPs showed durable antibacterial activity.

Marketing policies and economic interests in the cotton sector of Kenya

NARCIS (Netherlands)

Dijkstra, T.

1990-01-01

This report, which is based on field research carried out in 1988, examines the marketing arrangements for raw cotton, cotton lint and cotton seed in Kenya, as well as the relationships and conflicts between the actors involved. The report starts with the history of cotton production and marketing

Gossypium barbadense genome sequence provides insight into the evolution of extra-long staple fiber and specialized metabolites.

Science.gov (United States)

Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya

2015-09-30

Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.

76 FR 32067 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

Science.gov (United States)

2011-06-03

... ``Any AUP cotton'' and replacing it with the phrase ``Mature AUP cotton'' to clarify the AUP cotton must be mature in order to calculate a conversion factor between AUP cotton and ELS cotton. List of... dividing Price A by 85 percent of Price B. * * * * * (f) Mature AUP cotton harvested or appraised from...

Cotton in Benin: governance and pest management

NARCIS (Netherlands)

Togbe, C.E.

2013-01-01

Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,

Bacillus thuringiensis, field experiment, farmers’ participation

Pests are one of the main factors limiting cotton production worldwide. Most of the pest

control

Non-preferential Trading Clubs

DEFF Research Database (Denmark)

Raimondos-Møller, Pascalis; Woodland, Alan D.

2006-01-01

This paper examines the welfare implications of non-discriminatory tariff reforms by a subset of countries, which we term a non-preferential trading club. We show that there exist coordinated tariff reforms, accompanied by appropriate income transfers between the member countries, that unambiguou......This paper examines the welfare implications of non-discriminatory tariff reforms by a subset of countries, which we term a non-preferential trading club. We show that there exist coordinated tariff reforms, accompanied by appropriate income transfers between the member countries...

The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres

Science.gov (United States)

Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

2015-01-01

Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818

Orientation of cotton growers of multan district about heal hazards and pesticide use

International Nuclear Information System (INIS)

Haq, Q.U.; Hussain, R.; Ali, T.; Ahmad, M.

2008-01-01

Cotton growing farmers and cotton pickers are the twin pillars of cotton growing community. Cotton growing farmers (male) are involved in monitoring of quality and quantity of cotton crops by handsome usage of pesticides for better marketing of cotton crops. Whereas, cotton pickers (female) are involved in picking of cotton mainly. To assess their knowledge and source of knowledge about pesticides related health problems, the study was designed and conducted in 20 villages of district Multan selected by multistage random sampling technique. From the selected 20 villages, from the list bearing the villages, mouzas and union councils of district Multan, 220 cotton growers and 150 cotton pickers were selected by simple random sampling technique and interviewed through a reliable and validated interview schedule. The data collected were processed through Statistical Package for Social Sciences (SPSS). The results showed that 75% of cotton growing farmers were having orientation about side effects of pesticides whereas, almost 8% of cotton growers were having no knowledge about side effects of pesticides. (author)

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Science.gov (United States)

Meisner, Matthew H; Rosenheim, Jay A

2014-01-01

Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Directory of Open Access Journals (Sweden)

Matthew H Meisner

Full Text Available Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Weed hosts of cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae).

Science.gov (United States)

Vennila, S; Prasad, Y G; Prabhakar, M; Agarwal, Meenu; Sreedevi, G; Bambawale, O M

2013-03-01

The exotic cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) invaded India during 2006, and caused widespread infestation across all nine cotton growing states. P. solenopsis also infested weeds that aided its faster spread and increased severity across cotton fields. Two year survey carried out to document host plants of P. solenopsis between 2008 and 2010 revealed 27, 83, 59 and 108 weeds belonging to 8, 18, 10 and 32 families serving as alternate hosts at North, Central, South and All India cotton growing zones, respectively. Plant species of four families viz., Asteraceae, Amaranthaceae, Malvaceae and Lamiaceae constituted almost 50% of the weed hosts. While 39 weed species supported P. solenopsis multiplication during the cotton season, 37 were hosts during off season. Higher number of weeds as off season hosts (17) outnumbering cotton season (13) at Central over other zones indicated the strong carryover of the pest aided by weeds between two cotton seasons. Six, two and seven weed hosts had the extreme severity of Grade 4 during cotton, off and cotton + off seasons, respectively. Higher number of weed hosts of P. solenopsis were located at roadside: South (12) > Central (8) > North (3) zones. Commonality of weed hosts was higher between C+S zones, while no weed host was common between N+S zones. Paper furnishes the wide range of weed hosts of P. solenopsis, discusses their significance, and formulated general and specific cultural management strategies for nationwide implementation to prevent its outbreaks.

Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

African Journals Online (AJOL)

Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

Elemental analysis of cotton by laser-induced breakdown spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Schenk, Emily R.; Almirall, Jose R.

2010-05-01

Laser-induced breakdown spectroscopy (LIBS) has been applied to the elemental characterization of unprocessed cotton. This research is important in forensic and fraud detection applications to establish an elemental fingerprint of U.S. cotton by region, which can be used to determine the source of the cotton. To the best of our knowledge, this is the first report of a LIBS method for the elemental analysis of cotton. The experimental setup consists of a Nd:YAG laser that operates at the fundamental wavelength as the LIBS excitation source and an echelle spectrometer equipped with an intensified CCD camera. The relative concentrations of elements Al, Ba, Ca, Cr, Cu, Fe, Mg, and Sr from both nutrients and environmental contributions were determined by LIBS. Principal component analysis was used to visualize the differences between cotton samples based on the elemental composition by region in the U.S. Linear discriminant analysis of the LIBS data resulted in the correct classification of >97% of the cotton samples by U.S. region and >81% correct classification by state of origin.

Degradation and persistence of cotton pesticides in sandy loam soils from Punjab, Pakistan.

Science.gov (United States)

Tariq, Muhammad Ilyas; Afzal, Shahzad; Hussain, Ishtiaq

2006-02-01

The present study evaluated the influence of temperature, moisture, and microbial activity on the degradation and persistence of commonly used cotton pesticides, i.e., carbosulfan, carbofuran, lambda-cyhalothrin, endosulfan, and monocrotophos, with the help of laboratory incubation and lysimeter studies on sandy loam soil (Typic Ustocurepts) in Pakistan. Drainage from the lysimeters was sampled on days 49, 52, 59, 73, 100, 113, and 119 against the pesticide application on days 37, 63, 82, 108, and 137 after the sowing of cotton. Carbofuran, monocrotophos, and nitrate were detected in the drainage samples, with an average value, respectively, of 2.34, 2.6 microg/L, and 15.6 mg/L for no-tillage and 2.16, 2.3 microg/L, and 13.4 mg/L for tillage. In the laboratory, pesticide disappearance kinetics were measured with sterile and nonsterile soils from 0 to 10 cm in depth at 15, 25, and 35 degrees C and 50% and 90% field water capacities. Monocrotophos and carbosulfan dissipation followed first-order kinetics while others followed second-order kinetics. The results of incubation studies showed that temperature and moisture contents significantly reduced the t(1/2) (half-life) values of pesticides in sterile and nonsterile soil, but the effect of microbial activity was nearly significant that might be due to less organic carbon (0.3%). The presence of carbofuran and monocrotophos in the soil profile (0-10, 10-30, 30-60, 60-90, 90-150 cm) and the higher concentrations of endosulfan and lambda-cyhalothrin in the top layer (0-10 cm) showed the persistence of the pesticides. The detection of endosulfan and lambda-cyhalothrin in the 10-30 cm soil layer might be due to preferential flow. The data generated from this study could be helpful for risk assessment studies of pesticides and for validating pesticide transport models for sandy loam soils in cotton-growing areas of Pakistan.

CATEGORIZATION OF EXTRANEOUS MATTER IN COTTON USING MACHINE VISION SYSTEMS

Science.gov (United States)

The Cotton Trash Identification System (CTIS) was developed at the Southwestern Cotton Ginning Research Laboratory to identify and categorize extraneous matter in cotton. The CTIS bark/grass categorization was evaluated with USDA-Agricultural Marketing Service (AMS) extraneous matter calls assigned ...

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Lee, Soomin; Nishimura, Takayuki; Katsuura, Tetsuo; Yasukouchi, Akira

2011-01-10

Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO). In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). The melatonin levels were analyzed in duplicate using commercially available ELISA kits. The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL). The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level (<6 pg/mL), although the BA plots didn't show proportional and relative biases, there was no significant correlation between passive and cotton saliva collection samples. Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

Preferential sampling in veterinary parasitological surveillance

Directory of Open Access Journals (Sweden)

Lorenzo Cecconi

2016-04-01

Full Text Available In parasitological surveillance of livestock, prevalence surveys are conducted on a sample of farms using several sampling designs. For example, opportunistic surveys or informative sampling designs are very common. Preferential sampling refers to any situation in which the spatial process and the sampling locations are not independent. Most examples of preferential sampling in the spatial statistics literature are in environmental statistics with focus on pollutant monitors, and it has been shown that, if preferential sampling is present and is not accounted for in the statistical modelling and data analysis, statistical inference can be misleading. In this paper, working in the context of veterinary parasitology, we propose and use geostatistical models to predict the continuous and spatially-varying risk of a parasite infection. Specifically, breaking with the common practice in veterinary parasitological surveillance to ignore preferential sampling even though informative or opportunistic samples are very common, we specify a two-stage hierarchical Bayesian model that adjusts for preferential sampling and we apply it to data on Fasciola hepatica infection in sheep farms in Campania region (Southern Italy in the years 2013-2014.

A generalized theory of preferential linking

Science.gov (United States)

Hu, Haibo; Guo, Jinli; Liu, Xuan; Wang, Xiaofan

2014-12-01

There are diverse mechanisms driving the evolution of social networks. A key open question dealing with understanding their evolution is: How do various preferential linking mechanisms produce networks with different features? In this paper we first empirically study preferential linking phenomena in an evolving online social network, find and validate the linear preference. We propose an analyzable model which captures the real growth process of the network and reveals the underlying mechanism dominating its evolution. Furthermore based on preferential linking we propose a generalized model reproducing the evolution of online social networks, and present unified analytical results describing network characteristics for 27 preference scenarios. We study the mathematical structure of degree distributions and find that within the framework of preferential linking analytical degree distributions can only be the combinations of finite kinds of functions which are related to rational, logarithmic and inverse tangent functions, and extremely complex network structure will emerge even for very simple sublinear preferential linking. This work not only provides a verifiable origin for the emergence of various network characteristics in social networks, but bridges the micro individuals' behaviors and the global organization of social networks.

Chemical analysis of plasma-assisted antimicrobial treatment on cotton

International Nuclear Information System (INIS)

Kan, C W; Lam, Y L; Yuen, C W M; Luximon, A; Lau, K W; Chen, K S

2013-01-01

This paper explores the use of plasma treatment as a pretreatment process to assist the application of antimicrobial process on cotton fabric with good functional effect. In this paper, antimicrobial finishing agent, Microfresh Liquid Formulation 9200-200 (MF), and a binder (polyurethane dispersion, Microban Liquid Formulation R10800-0, MB) will be used for treating the cotton fabric for improving the antimicrobial property and pre-treatment of cotton fabric by plasma under atmospheric pressure will be employed to improve loading of chemical agents. The chemical analysis of the treated cotton fabric will be conducted by Fourier transform Infrared Spectroscopy.

Proteomics profiling of fiber development and domestication in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Pathak, Dharminder; Chen, Sixue; Wendel, Jonathan F

2014-12-01

Comparative proteomic analyses were performed to detail the evolutionary consequences of strong directional selection for enhanced fiber traits in modern upland cotton (Gossypium hirsutum L.). Using two complementary proteomic approaches, 2-DE and iTRAQ LC-MS/MS, fiber proteomes were examined for four representative stages of fiber development. Approximately 1,000 protein features were characterized using each strategy, collectively resulting in the identification and functional categorization of 1,223 proteins. Unequal contributions of homoeologous proteins were detected for over a third of the fiber proteome, but overall expression was balanced with respect to the genome-of-origin in the allopolyploid G. hirsutum. About 30% of the proteins were differentially expressed during fiber development within wild and domesticated cotton. Notably, domestication was accompanied by a doubling of protein developmental dynamics for the period between 10 and 20 days following pollination. Expression levels of 240 iTRAQ proteins and 293 2-DE spots were altered by domestication, collectively representing multiple cellular and metabolic processes, including metabolism, energy, protein synthesis and destination, defense and stress response. Analyses of homoeolog-specific expression indicate that duplicated gene products in cotton fibers can be differently regulated in response to selection. These results demonstrate the power of proteomics for the analysis of crop domestication and phenotypic evolution.

Field Comparison of Fertigation Vs. Surface Irrigation of Cotton Crop

International Nuclear Information System (INIS)

Janat, M.

2004-01-01

Based on previous results of the same nature, one nitrogen rate 180 kg N ha -1 was tested under two-irrigation methods, surface irrigation and drip fertigation of cotton (Cultivar Rakka-5) for two consecutive seasons 2000 and 2001. The study aimed to answer various questions regarding the applicability of drip fertigation at farm level and the effect of its employment on yield and growth parameters, compared to surface irrigation. Nitrogen fertilizer was either injected in eight equally split applications for the drip fertigated cotton or divided in four unequally split applications as recommend by Ministry of Agriculture (20% before planting, 40% at thinning, 20% after 60 days from planting and 20% after 75 days after planting). 15 N labeled urea was used to evaluate nitrogen fertilizer efficiency. The experimental design was randomized block design with seven replicates. Results showed that drip fertigation led to water saving exceeding 50% in some cases. Field germination percentage was highly increased under drip- fertigated cotton relative to surface-irrigated cotton. Dry matter and seed cotton yield of surface-irrigated cotton was slightly higher than that of drip-fertigated cotton in the first growing season. The reason for that was due to the hot spill that occurred in the region, which exposed the cotton crop to water stress and consequently pushed the cotton into early flowering. Lint properties were not affected by the introduction of drip-fertigation. Actually some properties were improved relative to the standard properties identified by the cotton Bureau.Nitrogen uptake was slightly increased under drip fertigation whereas nitrogen use efficiencies were not constant along the growing seasons. The reason for that could be lateral leaching and root proliferation into the labeled and unlabeled subplots. Field water use efficiency was highly increased for both growing seasons under drip fertigation practice. The rate of field water use efficiencies

Passive and active protection of cotton textiles

NARCIS (Netherlands)

Bochove, C. van

1967-01-01

In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,

Incorporating a Sorghum Habitat for Enhancing Lady Beetles (Coleoptera: Coccinellidae in Cotton

Directory of Open Access Journals (Sweden)

P. G. Tillman

2012-01-01

Full Text Available Lady beetles (Coleoptera: Coccinellidae prey on insect pests in cotton. The objective of this 2 yr on-farm study was to document the impact of a grain sorghum trap crop on the density of Coccinellidae on nearby cotton. Scymnus spp., Coccinella septempunctata (L., Hippodamia convergens Guérin-Méneville, Harmonia axyridis (Pallas, Coleomegilla maculata (De Geer, Cycloneda munda (Say, and Olla v-nigrum (Mulsant were found in sorghum over both years. Lady beetle compositions in sorghum and cotton and in yellow pyramidal traps were similar. For both years, density of lady beetles generally was higher on cotton with sorghum than on control cotton. Our results indicate that sorghum was a source of lady beetles in cotton, and thus incorporation of a sorghum habitat in farmscapes with cotton has great potential to enhance biocontrol of insect pests in cotton.

Satellite-based monitoring of cotton evapotranspiration

Science.gov (United States)

Dalezios, Nicolas; Dercas, Nicholas; Tarquis, Ana Maria

2016-04-01

Water for agricultural use represents the largest share among all water uses. Vulnerability in agriculture is influenced, among others, by extended periods of water shortage in regions exposed to droughts. Advanced technological approaches and methodologies, including remote sensing, are increasingly incorporated for the assessment of irrigation water requirements. In this paper, remote sensing techniques are integrated for the estimation and monitoring of crop evapotranspiration ETc. The study area is Thessaly central Greece, which is a drought-prone agricultural region. Cotton fields in a small agricultural sub-catchment in Thessaly are used as an experimental site. Daily meteorological data and weekly field data are recorded throughout seven (2004-2010) growing seasons for the computation of reference evapotranspiration ETo, crop coefficient Kc and cotton crop ETc based on conventional data. Satellite data (Landsat TM) for the corresponding period are processed to estimate cotton crop coefficient Kc and cotton crop ETc and delineate its spatiotemporal variability. The methodology is applied for monitoring Kc and ETc during the growing season in the selected sub-catchment. Several error statistics are used showing very good agreement with ground-truth observations.

Integrated nutrients management for 'desi' cotton

International Nuclear Information System (INIS)

Qazi, M.A.; Akram, M.; Ahmad, N.; Khattak, M.A.

2007-01-01

Intensive cropping with no return of crop residues and other organic inputs result in the loss of soil organic matter (SOM) and nutrient supply in (Desi) cotton-wheat cropping system in Pakistan. For appraisal of problem and finding solution to sustainability, we evaluated six treatments comprised of two fertilizer doses and three management techniques over a period of three years (2003-05) monitoring their effects on seed cotton yield and soil fertility. The techniques included chemical fertilizers, municipal solid waste manure (MSWM) integrated with chemical fertilizers in 1:4 ratios with, and without pesticides. The results revealed that cotton yields. Were enhanced by 19% due to site-specific fertilizer dose over conventional dose. Ignoring weeds control by means of herbicided application resulted in 5% decrease of seed cotton yield in IPNM technique positive effect of MSWM integration was noted on soil test phosphorus and SOM. Site-specific fertilizer application and integrated plant nutrient management by MSWM proved their suitability as the techniques not only improve soil quality in terms of sustained levels of organic matter and phosphorus but also provide a safe way of waste disposal. (author)

Exploring potential and opportunities for pakistan cotton export

International Nuclear Information System (INIS)

Afridi, G. S.; Tariq, S. A.

2016-01-01

Agriculture is the single largest shareholder to GDP an employment to labour force. It has major share in export but unfortunately unable to meet international standards. This study aims to analyze the pattern of Pakistan cotton export, and to explore sector's export potential and opportunities. This new research endeavor with well-tested analytical tools enabled the trade experts and policy makers to explore the answer of lackness for diversification in export, HS-2- digits aggregated data for cotton sub-sectors have been used with latest data from 2004 to 2013 for the panel 39 countries. Revealed comparative advantage (RCA) index and gravity model approach was employed considering country and time specific fixed effect. The RCA index revealed that cotton sub-sectors have comparative advantage in export and there is gradual gain in the competitiveness with time. The opportunity exists in the markets of low, lower-middle and upper middle income countries and countries those have fair trade (low tariff and non-tariff barriers) for cotton export. Greater export potential lies with malaysia, kenya jordan, thailand, mauritius, netherlands norway, Australia and russian federation for export of cotton, however, export potential for cotton has been exhausted with canada, france, india, iran and saudi arabia. The study provide the policy information that countries of Latin america, eastern europe, central asia and northern africa are virgin for export. Therefore, pakistan should penetrate in these markets for export of cotton and other agricultural products. cognizant to new trade theories, pakistan focus on quality to gain maximum trade volume in the markets of high income countries, Pakistan may develop trade agreement with ASEAN, SAFTA, and EU-27 for export of agricultural products. (author)

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay

Directory of Open Access Journals (Sweden)

Katsuura Tetsuo

2011-01-01

Full Text Available Abstract Background Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO. In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Methods Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection and into clear sterile tubes (passive saliva collection. The melatonin levels were analyzed in duplicate using commercially available ELISA kits. Results The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL. The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level ( Conclusion Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

Processing and Properties of PCL/Cotton Linter Compounds

OpenAIRE

Bezerra,Elieber Barros; França,Danyelle Campos; Morais,Dayanne Diniz de Souza; Rosa,Morsyleide de Freitas; Morais,João Paulo Saraiva; Araújo,Edcleide Maria; Wellen,Renate Maria Ramos

2017-01-01

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton...

Cycling of fertilizer and cotton crop residue nitrogen

International Nuclear Information System (INIS)

Rochester, I.J.; Constable, G.A.; MacLeod, D.A.

1993-01-01

Mineral nitrogen (N), nitrate and ammonium contents were monitored in N-fertilized soils supporting cotton crops to provide information on the nitrification, mineralization and immobilization processes operating in the soil. The relative contributions of fertilizer N, previous cotton crop residue N and indigenous soil N to the mineral N pools and to the current crop's N uptake were calculated. After N fertilizer (urea) application, the soil's mineral N content rose rapidly and subsequently declined at a slower rate. The recovery of 15 N-labelled urea as mineral N declined exponentially with time. Biological immobilization (and possibly denitrification to some extent) were believed to be the major processes reducing post-application soil mineral N content. Progressively less N was mineralized upon incubation of soil sampled through the growing season. Little soil N (either from urea or crop residue) was mineralized at crop maturity. Cycling of N was evident between the soil mineral and organic N pools throughout the cotton growing season. Considerable quantities of fertilizer N were immobilized by the soil micro biomass; immobilized N was remineralized and subsequently taken up by the cotton crop. A large proportion of the crop N was taken up in the latter part of the season when the soil mineral N content was low. It is suggested that much of the N taken up by cotton was derived from microbial sources, rather than crop residues. The application of cotton crop residue (stubble) slightly reduced the mineral N content in the soil by encouraging biological immobilization. 15 N was mineralized very slowly from the labelled crop residue and did not contribute significantly to the supply of N to the current crop. Recovery of labelled fertilizer N and labelled crop residue N by the cotton crop was 28% and 1%, respectively. In comparison, the apparent recovery of fertilizer N was 48%. Indigenous soil N contributed 68% of the N taken up by the cotton crop. 33 refs., 1 tab

Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

Directory of Open Access Journals (Sweden)

Alves-Ferreira Marcio

2010-03-01

Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

Science.gov (United States)

Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

2010-03-21

Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

Directory of Open Access Journals (Sweden)

Jie Chen

2014-03-01

Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

Science.gov (United States)

Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

2014-08-01

Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants. Copyright © 2014 by the Genetics Society of America.

Resilient modulus of black cotton soil

Directory of Open Access Journals (Sweden)

K.H. Mamatha

2017-03-01

Full Text Available Resilient modulus (MR values of pavement layers are the basic input parameters for the design of pavements with multiple layers in the current mechanistic empirical pavement design guidelines. As the laboratory determination of resilient modulus is costly, time consuming and cumbersome, several empirical models are developed for the prediction of resilient modulus for different regions of the world based on the database of resilient modulus values of local soils. For use of these relationships there is a need to verify the suitability of these models for local conditions. Expansive clay called black cotton soil (BC soil is found in several parts of India and is characterized by low strength and high compressibility. This soil shows swell – shrink behaviour upon wetting and drying and are problematic. The BC soil shows collapse behaviour on soaking and therefore the strength of the soil needs to be improved. Additive stabilization is found to be very effective in stabilizing black cotton soils and generally lime is used to improve the strength and durability of the black cotton soil. In this paper, the results of repeated load tests on black cotton soil samples for the determination of MR under soaked and unsoaked conditions at a relative compaction levels of 100% and 95% of both standard and modified proctor conditions are reported. The results indicate that the black cotton soil fails to meet the density requirement of the subgrade soil and shows collapse behaviour under soaked condition. To overcome this, lime is added as an additive to improve the strength of black cotton soil and repeated load tests were performed as per AASHTO T 307 - 99 for MR determination. The results have shown that the samples are stable under modified proctor condition with MR values ranging from 36 MPa to 388 MPa for a lime content of 2.5% and curing period ranging from 7 to 28 days. Also, it is observed that, the CBR based resilient modulus is not in agreement

Changes in cotton gin energy consumption apportioned by ten functions

Science.gov (United States)

The public is concerned about air quality and sustainability. Cotton producers, gin owners and plant managers are concerned about rising energy prices. Both have an interest in cotton gin energy consumption trends. Changes in cotton gins’ energy consumption over the past fifty years, a period of ...

farmers' knowledge and perceptions of cotton insect pests and their

African Journals Online (AJOL)

Prince Acheampong

A survey of 337 cotton farmers in the three northern regions of Ghana was ... five applications were made during the season. ... Keywords: cotton, farmer knowledge and perception, insect pest control, Ghana. .... bordered on tests of farmers' knowledge of cotton insect pests, their damage ..... Agricultural Experiment Station.

Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

Directory of Open Access Journals (Sweden)

Iftikhar Ali Khan

2016-02-01

Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program

Energy Technology Data Exchange (ETDEWEB)

Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))

1993-09-01

Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.

Induced mutations for improvement of desi cotton

International Nuclear Information System (INIS)

Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

2000-01-01

Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

Effects of saliva collection using cotton swab on cortisol enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Hashiguchi, Nobuko; Kaji, Yumi; Yasukouchi, Akira; Tochihara, Yutaka

2009-12-01

Cotton swabs are among the most commonly used devices for collecting saliva, but various studies have reported that their use impacts the results of salivary cortisol assays. These studies, however, estimated this impact by comparing the average of the concentration and/or scatter plots. In the present study, we estimated the impact of cotton swabs on the results of salivary cortisol enzyme immunoassay (EIA) by Bland-Altman plot. Eight healthy males (aged 20-23 years) provided four saliva samples on different days to yield a total of 32 samples. Saliva samples were collected directly in plastic tubes using plastic straws and then pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). There was a lower correlation between cotton and passive saliva collection. Individually, four subjects showed a negative correlation between passive and cotton saliva collection. A Bland-Altman plot indicated that cotton swabs causes a proportional bias on the EIA assay result. Our findings indicate a considerable effect of using cotton swabs for saliva collection, and subject-specific variability in the impact. A Bland-Altman plot further suggests possible reasons for this effect.

Comparing perceptual and preferential decision making.

Science.gov (United States)

Dutilh, Gilles; Rieskamp, Jörg

2016-06-01

Perceptual and preferential decision making have been studied largely in isolation. Perceptual decisions are considered to be at a non-deliberative cognitive level and have an outside criterion that defines the quality of decisions. Preferential decisions are considered to be at a higher cognitive level and the quality of decisions depend on the decision maker's subjective goals. Besides these crucial differences, both types of decisions also have in common that uncertain information about the choice situation has to be processed before a decision can be made. The present work aims to acknowledge the commonalities of both types of decision making to lay bare the crucial differences. For this aim we examine perceptual and preferential decisions with a novel choice paradigm that uses the identical stimulus material for both types of decisions. This paradigm allows us to model the decisions and response times of both types of decisions with the same sequential sampling model, the drift diffusion model. The results illustrate that the different incentive structure in both types of tasks changes people's behavior so that they process information more efficiently and respond more cautiously in the perceptual as compared to the preferential task. These findings set out a perspective for further integration of perceptual and preferential decision making in a single ramework.

Simple Sequence Repeat (SSR Genetic Linkage Map of D Genome Diploid Cotton Derived from an Interspecific Cross between Gossypium davidsonii and Gossypium klotzschianum

Directory of Open Access Journals (Sweden)

Joy Nyangasi Kirungu

2018-01-01

Full Text Available The challenge in tetraploid cotton cultivars is the narrow genetic base and therefore, the bottleneck is how to obtain interspecific hybrids and introduce the germplasm directly from wild cotton to elite cultivars. Construction of genetic maps has provided insight into understanding the genome structure, interrelationships between organisms in relation to evolution, and discovery of genes that carry important agronomic traits in plants. In this study, we generated an interspecific hybrid between two wild diploid cottons, Gossypium davidsonii and Gossypium klotzschianum, and genotyped 188 F2:3 populations in order to develop a genetic map. We screened 12,560 SWU Simple Sequence Repeat (SSR primers and obtained 1000 polymorphic markers which accounted for only 8%. A total of 928 polymorphic primers were successfully scored and only 728 were effectively linked across the 13 chromosomes, but with an asymmetrical distribution. The map length was 1480.23 cM, with an average length of 2.182 cM between adjacent markers. A high percentage of the markers on the map developed, and for the physical map of G. raimondii, exhibited highly significant collinearity, with two types of duplication. High level of segregation distortion was observed. A total of 27 key genes were identified with diverse roles in plant hormone signaling, development, and defense reactions. The achievement of developing the F2:3 population and its genetic map constructions may be a landmark in establishing a new tool for the genetic improvement of cultivars from wild plants in cotton. Our map had an increased recombination length compared to other maps developed from other D genome cotton species.

Cotton responses to simulated insect damage: radiation-use efficiency, canopy architecture and leaf nitrogen content as affected by loss of reproductive organs

International Nuclear Information System (INIS)

Sadras, V.O.

1996-01-01

Key cotton pests feed preferentially on reproductive organs which are normally shed after injury. Loss of reproductive organs in cotton may decrease the rate of leaf nitrogen depletion associated with fruit growth and increase nitrogen uptake and reduction by extending the period of root and leaf growth compared with undamaged plants. Higher levels of leaf nitrogen resulting from more assimilation and less depletion could increase the photosynthetic capacity of damaged crops in relation to undamaged controls. To test this hypothesis, radiation-use efficiency (RUE = g dry matter per MJ of photosynthetically active radiation intercepted by the canopy) of crops in which flowerbuds and young fruits were manually removed was compared with that of undamaged controls. Removal of fruiting structures did not affect RUE when cotton was grown at low nitrogen supply and high plant density. In contrast, under high nitrogen supply and low plant density, fruit removal increased seasonal RUE by 20–27% compared to controls. Whole canopy measurements, however, failed to detect the expected variations in foliar nitrogen due to damage. Differences in RUE between damaged and undamaged canopies were in part associated with changes in plant and canopy structure (viz. internode number and length, canopy height, branch angle) that modified light distribution within the canopy. These structural responses and their influence on canopy light penetration and photosynthesis are synthetised in coefficients of light extinction (k) that were 10 to 30% smaller in damaged crops than in controls and in a positive correlation between RUE−1 and k for crops grown under favourable conditions (i.e. high nitrogen, low density). Changes in plant structure and their effects on canopy architecture and RUE should be considered in the analysis of cotton growth after damage by insects that induce abscission of reproductive organs. (author)

Spatial and temporal distribution of cotton squares and small cotton bolls fallen on ground after damage by boll weevil and the efficiency of the equipment used to collect them

Directory of Open Access Journals (Sweden)

Carlos Alberto Domingues da Silva

Full Text Available ABSTRACT: In this study, we determined the spatial and temporal distribution of fallen cotton squares and small cotton bolls fallen damaged by boll weevil and the efficiency and time interval of the equipment used to collect cotton samples. Spatial and temporal distribution of cotton squares and small cotton bolls fallen on the soil damaged by boll weevil among cotton rows was determined in an experimental design of randomized blocks in a factorial arrangement of 4x3, represented by soil surface tracks located at 1-11cm, 12-22cm, 23-33cm, and 34-44cm away from the planting row of cotton plants 70, 85, and 100 days of age. Efficiency and collection time interval of the cotton samples fallen on the soil infested by boll weevil by plastic rakes that were straight or fan-shaped, big broom, collector instrument model CNPA and aspirator of leaves ‘Trapp’ were determined in randomized block design with five treatments, 10 repetitions for each. Results demonstrated that the collection of cotton samples must be performed with greater attention to soil strips located below the cotton top projection and aspirator ‘Trapp’ of leaves was more appropriate for the operation as it used less time of collection with similar efficiency to other available equipment.

Preferential Attachment in Online Networks: Measurement and Explanations

NARCIS (Netherlands)

Kunegis, J; Blattner, M; Moser, C.

2013-01-01

We perform an empirical study of the preferential attachment phenomenon in temporal networks and show that on the Web, networks follow a nonlinear preferential attachment model in which the exponent depends on the type of network considered. The classical preferential attachment model for networks

A Grey Fuzzy Logic Approach for Cotton Fibre Selection

Science.gov (United States)

Chakraborty, Shankar; Das, Partha Protim; Kumar, Vidyapati

2017-06-01

It is a well known fact that the quality of ring spun yarn predominantly depends on various physical properties of cotton fibre. Any variation in these fibre properties may affect the strength and unevenness of the final yarn. Thus, so as to achieve the desired yarn quality and characteristics, it becomes imperative for the spinning industry personnel to identify the most suitable cotton fibre from a set of feasible alternatives in presence of several conflicting properties/attributes. This cotton fibre selection process can be modelled as a Multi-Criteria Decision Making (MCDM) problem. In this paper, a grey fuzzy logic-based approach is proposed for selection of the most apposite cotton fibre from 17 alternatives evaluated based on six important fibre properties. It is observed that the preference order of the top-ranked cotton fibres derived using the grey fuzzy logic approach closely matches with that attained by the past researchers which proves the application potentiality of this method in solving varying MCDM problems in textile industries.

Insect pests management of bt cotton through the manipulation of different eco-friendly techniques

International Nuclear Information System (INIS)

Ahmad, N.; Khan, M.H.; Tofique, M.

2011-01-01

This study was designed to manage insect pests of Bt cotton through the manipulation of different eco-friendly techniques. A perusal of data, based on the overall performance of different treatments reflected that lowest population of jassids (0.29) was observed in bio-control treated Bt cotton followed by bio-control treated conventional cotton (0.41). Mean per leaf population of thrips was found lowest in insecticide treated Bt cotton (0.97) which was statically at par with bi-control treated conventional cotton (0.95), biocontrol treated Bt cotton (1.09) and colour traps treated Bt cotton (1.50). In case of white flies, bio-control treated Bt cotton and bio-control treated conventional cotton again proved effective in maintaining the population at lower levels per leaf (0.33 and 0.35 respectively). No bollworms infestation was recorded in transgenic cotton whereas higher attack of the same was observed in the untreated conventional cotton block. The best results were achieved with the application of bio-control agents in combination with Bt cotton resulting in least infestation by insect pests and maximum seed yield of 3657 kg/ha. The population of Chrysoperla carnea was significantly higher in Bt and conventional cotton treated with bio-control agents as compared to the other treatments. The parasitism percentage of Trichogramma chilonis was observed significantly higher in bio-control treated conventional cotton. The studies manifested that combination of bio-control technology with Bt cotton effectively preserves the local beneficial insect fauna indicating its potential to be used as integrated management system against different insect pests of cotton. (author)

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues

Directory of Open Access Journals (Sweden)

Viana Antonio AB

2011-11-01

Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

Directory of Open Access Journals (Sweden)

Zainul A Khan

Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

Using atmospheric pressure plasma treatment for treating grey cotton fabric.

Science.gov (United States)

Kan, Chi-Wai; Lam, Chui-Fung; Chan, Chee-Kooi; Ng, Sun-Pui

2014-02-15

Conventional wet treatment, desizing, scouring and bleaching, for grey cotton fabric involves the use of high water, chemical and energy consumption which may not be considered as a clean process. This study aims to investigate the efficiency of the atmospheric pressure plasma (APP) treatment on treating grey cotton fabric when compared with the conventional wet treatment. Grey cotton fabrics were treated with different combinations of plasma parameters with helium and oxygen gases and also through conventional desizing, scouring and bleaching processes in order to obtain comparable results. The results obtained from wicking and water drop tests showed that wettability of grey cotton fabrics was greatly improved after plasma treatment and yielded better results than conventional desizing and scouring. The weight reduction of plasma treated grey cotton fabrics revealed that plasma treatment can help remove sizing materials and impurities. Chemical and morphological changes in plasma treated samples were analysed by FTIR and SEM, respectively. Finally, dyeability of the plasma treated and conventional wet treated grey cotton fabrics was compared and the results showed that similar dyeing results were obtained. This can prove that plasma treatment would be another choice for treating grey cotton fabrics. Copyright © 2013 Elsevier Ltd. All rights reserved.

Heterosis and correlation in interspecific and intraspecific hybrids of cotton.

Science.gov (United States)

Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A

2016-06-24

Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.

Preferential radiosensitization of G1 checkpoint--deficient cells by methylxanthines

International Nuclear Information System (INIS)

Russell, Kenneth J.; Wiens, Linda W.; Demers, G. William; Galloway, Denise A.; Le, Tiep; Rice, Glenn C.; Bianco, James A.; Singer, Jack W.; Groudine, Mark

1996-01-01

Purpose: To develop a checkpoint-based strategy for preferential radiosensitization of human tumors with deficient and/or mutant p53. Methods and Materials: A549 human lung adenocarcinoma cell lines differing in their expression of the p53 tumor suppressor gene were produced by transduction with the E6 oncogene from human papilloma virus type 16. The cells expressing E6 (E6+) lack a G1 arrest in response to ionizing radiation, are deficient in p53 and p21 expression, and exhibit a fivefold greater clonogenic survival following 10 Gy radiation. Results: Postirradiation incubation with millimolar concentrations of the methylxanthine pentoxifylline (PTX) results in preferential radiosensitization of the E6+ cells compared to the LXSN+ vector transduced controls. There is a threefold sensitization of the LXSN+ cells and a 15-fold sensitization of the E6+ cells, which results in equal clonogenic survival of the two lines. Flow cytometry reveals PTX abrogation of the radiation induced G2 arrest for both cell lines. PTX also prolongs G1 transit for both cell lines. Preliminary results are presented using a novel methylxanthine, lisofylline (LSF), which has similar cell cycle effects on G1 and G2 and achieves differential radiosensitization at micromolar concentrations that are sustainable in humans. Conclusions: This checkpoint-based strategy is a promising approach for achieving preferential radiosensitization of p53- tumors relative to p53+ normal tissues

Fiber quality challenges facing the cotton industry

Science.gov (United States)

The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...

Within canopy distribution of cotton seed N

Science.gov (United States)

Whole cotton seeds can be an important component of dairy rations. Nitrogen content of the seed is an important determinant of the feed value of the seed. Efforts to increase the seed value as feed will be enhanced with knowledge of the range and distribution of seed N within the cotton crop. This s...

Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

Science.gov (United States)

Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

2012-11-01

Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

Various rates of k and Na influence growth, seed cotton yield and ionic ratio of two cotton varieties in soil culture

International Nuclear Information System (INIS)

Ali, L.; Maqsood, M.A.; Ashraf, M.

2009-01-01

Cotton is generally grown on alkaline calcareous soils in arid and semi-arid areas of the country. Sodium can interact with other earth cations like K, Ca and Mg. Therefore, a pot study was conducted to investigate the growth, yield and ionic response of two cotton varieties. Four levels of K and Na were developed after considering indigenous K, Na status in soil. The treatments of K+Na in mg/kg were adjusted as, 105+37.5, 135+30 135+37.5 and 105+30 (control). Control treatment represented indigenous K, Na status of soil. The experiment continued until maturity. Application of K and Na increased seed cotton yield and boll weight significantly (p<0.01). Both varieties varied non-significantly with respect to K:Na ratio in leaf. The beneficial effects of Na with K application over control on seed cotton yield and boll weight were greater in NIBGE-2 than in MNH-786. Increase in seed cotton yield was attributed to maximum boll weight of both varieties. Significant negative correlation (r= -0.89, - 0.76, n= 4) was found between K:Na ratio and K use efficiency in shoot of NIBGE-2 and MNH-786, respectively. (author)

Molecular cloning of a cysteine proteinase cDNA from the cotton boll weevil Anthonomus grandis (Coleoptera: Curculionidae).

Science.gov (United States)

De Oliveira Neto, Osmundo Brilhante; Batista, João Aguiar Nogueira; Rigden, Daniel John; Franco, Octávio Luiz; Fragoso, Rodrigo Rocha; Monteiro, Ana Carolina Santos; Monnerat, Rose Gomes; Grossi-De-Sa, Maria Fátima

2004-06-01

The cotton boll weevil (Anthonomus grandis) causes severe cotton crop losses in North and South America. This report describes the presence of cysteine proteinase activity in the cotton boll weevil. Cysteine proteinase inhibitors from different sources were assayed against total A. grandis proteinases but, unexpectedly, no inhibitor tested was particularly effective. In order to screen for active inhibitors against the boll weevil, a cysteine proteinase cDNA (Agcys1) was isolated from A. grandis larvae using degenerate primers and rapid amplification of cDNA ends (RACE) techniques. Sequence analysis showed significant homologies with other insect cysteine proteinases. Northern blot analysis indicated that the mRNA encoding the proteinase was transcribed mainly in the gut of larvae. No mRNA was detected in neonatal larvae, pupae, or in the gut of the adult insect, suggesting that Agcys1 is an important cysteine proteinase for larvae digestion. The isolated gene will facilitate the search for highly active inhibitors towards boll weevil larvae that may provide a new opportunity to control this important insect pest.

Fiber sample presentation system for spectrophotometer cotton fiber color measurements

Science.gov (United States)

The Uster® High Volume Instrument (HVI) is used to class U.S. cotton for fiber color, yielding the industry accepted, cotton-specific color parameters Rd and +b. The HVI examines a 9 square inch fiber sample, and it is also used to test large AMS standard cotton “biscuits” or rectangles. Much inte...

IMPROVED SPECTROPHOTOMETER FIBER SAMPLING SYSTEM FOR COTTON FIBER COLOR MEASUREMENTS

Science.gov (United States)

Cotton in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), and the parameters Rd and +b are used to designate color grades for cotton fiber. However, Rd and +b are cotton-specific color parameters, and the need existed to demonstrate the relationships of Rd and +b to...

Understanding the relationship between cotton fiber properties and non-cellulosic cell wall polysaccharides

DEFF Research Database (Denmark)

Rajasundaram, Dhivyaa; Runavot, Jean-Luc; Guo, Xiaoyuan

2014-01-01

cotton fibers, which are of both biological and industrial importance. To this end, we attempted to study cotton fiber characteristics together with glycan arrays using regression based approaches. Taking advantage of the comprehensive microarray polymer profiling technique (CoMPP), 32 cotton lines from...... different cotton species were studied. The glycan array was generated by sequential extraction of cell wall polysaccharides from mature cotton fibers and screening samples against eleven extensively characterized cell wall probes. Also, phenotypic characteristics of cotton fibers such as length, strength...

Preferential induction of the AhR gene battery in HepaRG cells after a single or repeated exposure to heterocyclic aromatic amines

International Nuclear Information System (INIS)

Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre

2010-01-01

2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.

Modern trends on development of cotton production and processing chain Uzbekistan

OpenAIRE

Abdimumin Alikulov

2010-01-01

The cotton production complex of Uzbekistan has high rating comparing other export oriented branches. Cotton fiber value in 2008 share made 12% from total export of the country. The paper observes some trends and policy developments in cotton industry development.

Quantification and characterization of cotton crop biomass residue

Science.gov (United States)

Cotton crop residual biomass remaining in the field after mechanical seed cotton harvest is not typically harvested and utilized off-site thereby generating additional revenue for producers. Recently, interest has increased in utilizing biomass materials as feedstock for the production of fuel and ...

Governing the transnational organic cotton network from Benin

NARCIS (Netherlands)

Glin, L.C.; Mol, A.P.J.; Oosterveer, P.J.M.; Vodouhè, S.

2012-01-01

In this article, we attempt to conceptualize the historical development and the governance structure of the transnational organic cotton network from Benin. We aim to discover how the organic cotton production-consumption network is governed locally and internationally. Existing bodies of literature

Zinc comprising coordination compounds as growth stimulants of cotton seeds

International Nuclear Information System (INIS)

Yusupov, Z.N.; Nurmatov, T.M.; Rakhimova, M.M.; Dzhafarov, M.I.; Nikolaeva, T.B.

1991-01-01

Present article is devoted to zinc comprising coordination compounds as growth stimulants of cotton seeds. The influence of zinc coordination compounds with physiologically active ligands on germinative energy and seed germination of cotton was studied. The biogical activity and effectiveness of zinc comprising coordination compounds at application them for humidification of cotton seeds was studied as well.

Women cotton pickers perceptions about health hazards due to pesticide use in irrigated punjab

International Nuclear Information System (INIS)

Abbas, M.; Mehmood, I.; Bashir, A.; Hassan, S.

2015-01-01

In Pakistan, cotton crop has special importance from the perspective of largest employment generation both for males and females in the production and value chains. Cotton picking is primarily a female specific activity in all cropping zones of Pakistan. Women cotton pickers mostly belong to poor rural society involved in this labour force to feed their families. Cotton pickers in Pakistan face some serious health related problems due to heavy use of pesticides on cotton crop. The present study was designed to investigate the problem faced by women cotton pickers and their role in household decision making. Overall 150 women cotton pickers were interviewed from Bahawalnagar, Sahiwal and Vehari districts of cotton-wheat zone of the Punjab. Summary statistics of women cotton pickers' showed mean average age was 33 years and had 2.4 ears of formal schooling and 10 years of cotton picking experience. The main reasons for cotton picking reported were to reduce family financial burden (30%) followed by better access to food and resource (23%) and better education of children (21%). Majority of the respondents (97.33%) reported that the mode of payments of cotton picking was in cash and the most of the respondents (83.70%) reported that they got wages in time. Only few respondents (8.70%) were aware of health hazards due to pesticides and only 10% women wear protective clothes during cotton picking. Majority of the respondents (76%) wash their clothes after cotton picking whereas almost all the respondents wash their hand after cotton picking. The women cotton pickers faced health problem, tiredness (54.5%), mental disturbance (9.90%) and fatigue (8.00%). More than 58% women reported their involvement in household decision making regarding food and groceries while 30.6% women involved in decision about education of children. It is suggested that the female cotton pickers should be educated about the importance (in terms of disease treatment and long-run health costs

Small interfering RNAs from bidirectional transcripts of GhMML3_A12 regulate cotton fiber development.

Science.gov (United States)

Wan, Qun; Guan, Xueying; Yang, Nannan; Wu, Huaitong; Pan, Mengqiao; Liu, Bingliang; Fang, Lei; Yang, Shouping; Hu, Yan; Ye, Wenxue; Zhang, Hua; Ma, Peiyong; Chen, Jiedan; Wang, Qiong; Mei, Gaofu; Cai, Caiping; Yang, Donglei; Wang, Jiawei; Guo, Wangzhen; Zhang, Wenhua; Chen, Xiaoya; Zhang, Tianzhen

2016-06-01

Natural antisense transcripts (NATs) are commonly observed in eukaryotic genomes, but only a limited number of such genes have been identified as being involved in gene regulation in plants. In this research, we investigated the function of small RNA derived from a NAT in fiber cell development. Using a map-based cloning strategy for the first time in tetraploid cotton, we cloned a naked seed mutant gene (N1 ) encoding a MYBMIXTA-like transcription factor 3 (MML3)/GhMYB25-like in chromosome A12, GhMML3_A12, that is associated with fuzz fiber development. The extremely low expression of GhMML3_A12 in N1 is associated with NAT production, driven by its 3' antisense promoter, as indicated by the promoter-driven histochemical staining assay. In addition, small RNA deep sequencing analysis suggested that the bidirectional transcriptions of GhMML3_A12 form double-stranded RNAs and generate 21-22 nt small RNAs. Therefore, in a fiber-specific manner, small RNA derived from the GhMML3_A12 locus can mediate GhMML3_A12 mRNA self-cleavage and result in the production of naked seeds followed by lint fiber inhibition in N1 plants. The present research reports the first observation of gene-mediated NATs and siRNA directly controlling fiber development in cotton. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

HVI Colorimeter and Color Spectrophotometer Relationships and Their Impacts on Developing "Traceable" Cotton Color Standards

Science.gov (United States)

Color measurements of cotton fiber and cotton textile products are important quality parameters. The Uster® High Volume Instrument (HVI) is an instrument used globally to classify cotton quality, including cotton color. Cotton color by HVI is based on two cotton-specific color parameters—Rd (diffuse...

Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

Science.gov (United States)

Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

2017-10-01

Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

Single-Wall Carbon Nanotube-Coated Cotton Yarn for Electrocardiography Transmission

Directory of Open Access Journals (Sweden)

Yuliang Zhao

2018-03-01

Full Text Available We fabricated a type of conductive fabric, specifically single-wall carbon nanotube-coated cotton yarns (SWNT-CYs, for electrocardiography (ECG signal transmission utilizing a “dipping and drying” method. The conductive cotton yarns were prepared by dipping cotton yarns in SWNTs (single-wall carbon nanotubes solutions and then drying them at room temperature—a simple process that shows consistency in successfully coating cotton yarns with conductive carbon nanotubes (CNTs. The influence of fabrication conditions on the conductivity properties of SWNT-CYs was investigated. The results demonstrate that our conductive yarns can transmit weak bio-electrical (i.e., ECG signals without significant attenuation and distortion. Our conductive cotton yarns, which combine the flexibility of conventional fabrics and the good conductivity of SWNTs, are promising materials for wearable electronics and sensor applications in the future.

In vitro microbiologic evaluation of PTFE and cotton as spacer materials.

Science.gov (United States)

Paranjpe, Avina; Jain, Sumita; Alibhai, Karim J; Wadhwani, Chandur P; Darveau, Richard P; Johnson, James D

2012-09-01

To microbiologically evaluate the efficacy of cotton and polytetrafluoroethylene (PTFE) tape used as spacer materials. Twenty-six extracted human molars were restored using either cotton or PTFE tape as spacers under a standardized provisional restorative material (Cavit). The teeth were incubated for 7 days in a culture of Streptococcus gordonii or in liquid media alone. The spacers were removed and tested for bacterial contamination. The access cavities were also evaluated for bacterial contamination. Nine of 10 teeth with cotton spacers and one of 10 teeth with PTFE spacers were positive for S gordonii growth. The nine teeth in the cotton group also showed contamination of the access cavities. Even under optimal conditions, cotton spacers may cause leakage into the access cavities. Cotton fibers may serve as a route for bacterial contamination of the access cavities and root canal space. In contrast, PTFE tape did not provide an avenue for bacterial contamination.

Preferential flow occurs in unsaturated conditions

Science.gov (United States)

Nimmo, John R.

2012-01-01

Because it commonly generates high-speed, high-volume flow with minimal exposure to solid earth materials, preferential flow in the unsaturated zone is a dominant influence in many problems of infiltration, recharge, contaminant transport, and ecohydrology. By definition, preferential flow occurs in a portion of a medium – that is, a preferred part, whether a pathway, pore, or macroscopic subvolume. There are many possible classification schemes, but usual consideration of preferential flow includes macropore or fracture flow, funneled flow determined by macroscale heterogeneities, and fingered flow determined by hydraulic instability rather than intrinsic heterogeneity. That preferential flow is spatially concentrated associates it with other characteristics that are typical, although not defining: it tends to be unusually fast, to transport high fluxes, and to occur with hydraulic disequilibrium within the medium. It also has a tendency to occur in association with large conduits and high water content, although these are less universal than is commonly assumed. Predictive unsaturated-zone flow models in common use employ several different criteria for when and where preferential flow occurs, almost always requiring a nearly saturated medium. A threshold to be exceeded may be specified in terms of the following (i) water content; (ii) matric potential, typically a value high enough to cause capillary filling in a macropore of minimum size; (iii) infiltration capacity or other indication of incipient surface ponding; or (iv) other conditions related to total filling of certain pores. Yet preferential flow does occur without meeting these criteria. My purpose in this commentary is to point out important exceptions and implications of ignoring them. Some of these pertain mainly to macropore flow, others to fingered or funneled flow, and others to combined or undifferentiated flow modes.

Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Echekwu, CA.

2001-01-01

Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.

The cotton farming pipeline of Malawi and South Africa: Management implications

Directory of Open Access Journals (Sweden)

J. P. Grundling

2008-12-01

Full Text Available Purpose of the study: The purpose this paper is to identify and describe the characteristics and influences of the cotton farming pipeline in Malawi and South Africa. Problem investigated: A broad based approach was followed to investigate the cotton farming pipeline to identify the major driving forces of the cotton pipeline in each of the respective countries. Research approach: A qualitative field research approach was followed to compile data on cotton farming in Malawi and South Africa. Data was compiled upstream from input suppliers, downstream from ginners, cotton transport conveyors, cotton marketing managers and agricultural government officials as well as from farmers and agricultural organizations. Findings: In Malawi a family farming model is followed versus an industrial model of production in South Africa. Despite the differences in approach, the farmers in both countries are faced with similar problems. In this regard, an urgent rethinking of the technological conditions of production and the possibilities of technological change is needed. Recommendations: The research proposes that these countries can benefit from establishing institutions like agricultural co-operatives and mechanisms like the development of a free traffic mechanism of seed-cotton. Conclusion: The present research may assist in developing first layer managerial recommendations that could enhance the sustainability and co-existence of cotton farming in the two countries.

Preferential role restrictions

CSIR Research Space (South Africa)

Britz, K

2013-07-01

Full Text Available ., Pozzato, G.: ALC+T : a preferential exten- sion of description logics. Fundamenta Informaticae 96(3), 341–372 (2009) 15. Giordano, L., Olivetti, N., Gliozzi, V., Pozzato, G.: A minimal model semantics for nonmonotonic reasoning. In: Proc. JELIA. pp. 228...

Effect of low doses gamma irradiation of cotton seeds

International Nuclear Information System (INIS)

Al-Oudat, M.; Khalifa, Kh.

1996-01-01

Field experiments and then large scale application of irradiated cotton seeds (C.V. Aleppo-40) were carried out during three seasons (1986, 1987 and 1988) for field experiment at ACSAD Station in Dier-Ezzor and 1988, 1989 and 1990 for large scale application at Euphrate's Basin, Al-Ghab and Salamia, farmers farms. The above areas were selected as they represent major cotton production areas in Syria. The aims of the experiments were to study the effect of low doses of gamma irradiation 0, 5, 10, 20, 30, 40 and 50 Gy on cotton yield and to look for the optimum dose of gamma irradiation to obtain best results. The results show that, there were positive effect (P<0.95) for doses 5-30 Gy in increasing cotton yield. The highest increase was at dose of 10 Gy. which as 19.5% higher than control. For the large scale application using 10 Gy the increase in cotton yield varied from 10-39% compared to control. (author). 11 refs., 6 figs

Sub-soil microbial activity under rotational cotton crops in Australia

Science.gov (United States)

Polain, Katherine; Knox, Oliver; Wilson, Brian; Pereg, Lily

2016-04-01

Soil microbial communities contribute significantly to soil organic matter formation, stabilisation and destabilisation, through nutrient cycling and biodegradation. The majority of soil microbial research examines the processes occurring in the top 0 cm to 30 cm of the soil, where organic nutrients are easily accessible. In soils such as Vertosols, the high clay content causes swelling and cracking. When soil cracking is coupled with rain or an irrigation event, a flush of organic nutrients can move down the soil profile, becoming available for subsoil microbial community use and potentially making a significant contribution to nutrient cycling and biodegradation in soils. At present, the mechanisms and rates of soil nutrient turnover (such as carbon and nitrogen) at depth under cotton rotations are mostly speculative and the process-response relationships remain unclear, although they are undoubtedly underpinned by microbial activity. Our research aims to determine the contribution and role of soil microbiota to the accumulation, cycling and mineralisation of carbon and nitrogen through the whole root profile under continuous cotton (Gossypium hirsutum) and cotton-maize rotations in regional New South Wales, Australia. Through seasonal work, we have established both baseline and potential microbial activity rates from 0 cm to 100 cm down the Vertosol profile, using respiration and colourimetric methods. Further whole soil profile analyses will include determination of microbial biomass and isotopic carbon signatures using phospholipid fatty acid (PLFA) methodology, identification of microbial communities (sequencing) and novel experiments to investigate potential rates of nitrogen mineralisation and quantification of associated genes. Our preliminary observations and the hypotheses tested in this three-year study will be presented.

Effect of cotton leaf-curl virus on the yield-components and fibre properties of cotton genotypes under varying plant spacing and nitrogen fertilizer

International Nuclear Information System (INIS)

Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.

2008-01-01

Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that

Field evaluation of Bt cotton crop impact on nontarget pests: cotton aphid and boll weevil.

Science.gov (United States)

Sujii, E R; Togni, P H B; de A Ribeiro, P; de A Bernardes, T; Milane, P V G N; Paula, D P; Pires, C S S; Fontes, E M G

2013-02-01

Bt cotton plants expressing Cry1Ac protein have high specificity for the control of lepidopteran larvae. However, studies conducted in several countries have shown these plants have a differential impact on nontarget herbivores. The aim of this study was to compare the colonization rates and population abundance of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) and the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), in plots of Bt (Nuopal) and non-Bt cotton (Delta Opal) in an experimental field in Brasilia, DF, Brazil. No difference was observed in the preference and colonization by winged aphids to plants from the two treatments. There was no significant difference in abundance of wingless aphids or in the production of winged aphids between treatments. Apparently, the parameters that control factors such as fecundity, survival, and dispersal were similar on both Bt and non-Bt plants. Monitoring of plants for coccinellids, a specialist predator of aphids, and ants that act on the dispersal of aphids among plants showed no significant difference between Bt and non-Bt plants, supporting the inference above. Regarding the effect on boll weevil, there was also no significant difference between treatments in the total number of fruiting structures attacked in each plot, the percentage of fruiting structures attacked per plant or on the number of weevils emerging from fruits with boll weevil damage from egg-laying, when damaged fruit samples were held in the laboratory. Based on these results, we conclude that there is no impact of Bt cotton crop expressing Cry1Ac on the nontarget herbivores tested under field conditions.

Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

Science.gov (United States)

Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

2017-12-01

Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Landscape crop composition effects on cotton yield, Lygus hesperus densities and pesticide use.

Science.gov (United States)

Meisner, Matthew H; Zaviezo, Tania; Rosenheim, Jay A

2017-01-01

Landscape crop composition surrounding agricultural fields is known to affect the density of crop pests, but quantifying these effects, as well as measuring how they translate to changes in yield, is difficult. Using a large dataset consisting of 1498 records of commercial cotton production in California between 1997 and 2008, we explored the relationship between landscape composition and cotton yield, the density of Lygus hesperus (a key cotton pest) at field-level and within-field spatial scales and pesticide use. We found that the crop composition immediately adjacent to a cotton field was associated with substantial differences in cotton yield, L. hesperus density and pesticide use. Furthermore, crops that tended to be associated with increased L. hesperus density also tended to be associated with increased pesticide use and decreased cotton yield. Our results suggest a possible mechanism by which landscape composition can affect cotton yield: by increasing the density of pests which in turn damage cotton plants. Our quantification of how surrounding crops affect pest densities, and in turn yield, in cotton fields has significant impacts for cotton farmers, who can use this information to help optimize crop selection and ranch layout. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Modeling online social networks based on preferential linking

International Nuclear Information System (INIS)

Hu Hai-Bo; Chen Jun; Guo Jin-Li

2012-01-01

We study the phenomena of preferential linking in a large-scale evolving online social network and find that the linear preference holds for preferential creation, preferential acceptance, and preferential attachment. Based on the linear preference, we propose an analyzable model, which illustrates the mechanism of network growth and reproduces the process of network evolution. Our simulations demonstrate that the degree distribution of the network produced by the model is in good agreement with that of the real network. This work provides a possible bridge between the micro-mechanisms of network growth and the macrostructures of online social networks

7 CFR 28.8 - Classification of cotton; determination.

Science.gov (United States)

2010-01-01

... Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of the Act, the classification of any cotton shall be determined by the quality of a sample in accordance... employees will determine all fiber property measurements using High Volume Instruments. The classification...

Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

Science.gov (United States)

Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

2017-01-01

We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

The prevalence of byssinosis among cotton workers in the north of Benin.

Science.gov (United States)

Hinson, A V; Schlünssen, V; Agodokpessi, G; Sigsgaards, T; Fayomi, B

2014-10-01

Cotton is the main agricultural export product in Benin. Cotton dust is thus present in the air during the handling and processing of cotton. This dust contains a mixture of substances including ground up plant matter, fibres, bacteria, fungi, soil, pesticides, noncotton matter, and other contaminants. While cotton processing is decreasing in industrialized countries, it is increasing in developing countries. Cotton processing, particularly in the early processes of spinning, can cause byssinosis. To determine the respiratory effects of cotton dust exposure among cotton mill workers in Benin. In a cross-sectional study, 109 workers exposed to cotton dust and 107 unexposed workers were studied. The International Commission on Occupational Health (ICOH) questionnaire was used for data collection on respiratory symptoms. For each worker, crossshift pulmonary function was performed with a dry spirometer. Based on the severity of respiratory symptoms and spirometry byssinosis was defined and classified according to the criteria of Schilling, et al. The mean ± SD age of the exposed and unexposed workers was 46.3 ± 7.8 and 37.0 ± 8.3 years, respectively (pcotton mill workers in Benin is high and needs prompt attention of health care workers and policymakers.

Structure and properties of cotton fabrics treated with functionalized dialdehyde chitosan.

Science.gov (United States)

He, Xuemei; Tao, Ran; Zhou, Tianchi; Wang, Chunxia; Xie, Kongliang

2014-03-15

In this research, modified cotton fabrics were prepared by pad-dry-cure technique from the aldehyde chitosan solution containing 3-aminopropyltriethoxysilane (APTES) and 1,2-ethanediamine (EDA) respectively. The structural characterization of the modified cotton fabrics was performed by attenuated total reflection ATR, scanning electron microscopy (SEM) and thermogravimetry (TG) analysis and physical mechanical properties were measured. The adsorption kinetics of modified cotton fabrics were also investigated by using the pseudo first-order and pseudo second-order kinetic model. The dyeing rate constant k1, k2 and half adsorption time t1/2 were calculated, respectively. The results show that the mechanical properties of different modified cotton fabrics were improved, and the surface color depth values (K/S), UV index UPF and anti-wrinkle properties were better than those of untreated cotton. Dyeing kinetics data at different temperatures indicate that Direct Pink 12B up-take on the modified cotton fabrics fitted to pseudo second-order kinetic model. Copyright © 2014 Elsevier Ltd. All rights reserved.

Efficacy of Cotton Root Destruction and Winter Cover Crops for Suppression of Hoplolaimus columbus.

Science.gov (United States)

Davis, R F; Baird, R E; McNeil, R D

2000-12-01

The efficacy of rye (Secale cereale) and wheat (Triticum aestivum) winter cover crops and cotton stalk and root destruction (i.e., pulling them up) were evaluated in field tests during two growing seasons for Hoplolaimus columbus management in cotton. The effect of removing debris from the field following root destruction also was evaluated. Wheat and rye produced similar amounts of biomass, and both crops produced more biomass (P Cover crops did not suppress H. columbus population levels or increase subsequent cotton yields. Cotton root destruction did not affect cotton stand or plant height the following year. Cotton root destruction lowered (P rye or wheat cover crop or cotton root destruction following harvest is ineffective for H. columbus management in cotton.

Preferential Affirmative Action.

Science.gov (United States)

Bell, Derrick A., Jr.

1982-01-01

Discusses the philosophical rationale for preferential affirmative action presented by Daniel C. Maguire in "A New American Justice." Maintains that self-interest bars present society's acceptance of Maguire's theories of justice, as demonstrated in negative reactions to the Harvard Law Review's affirmative action plan. (MJL)

Pilot scale cotton gin trash energy recovery

Energy Technology Data Exchange (ETDEWEB)

Harp, S.L. [Oklahoma State Univ., Stillwater, OK (United States)

1993-12-31

During the summer of 1992 a 520,000 kcal/h (2,064,400 Btu/hr) biomass combustor was installed at a cotton gin in southwestern Oklahoma. The gin has a capacity of approximately 35 bales per hour. Each bale of cotton ginned weighs about 227 kg (500 lb) and produces about 68 kg (150 lb) of trash. Therefore, this gin produces about 52,360 kg (115,500 lb) of trash per day during a typical ginning season. Approximately 2 million kg (4 million lb) of gin trash are produced at this site each year. Cotton must first be dried to about 3-5% moisture content before the ginning process is begun. To accomplish this at this gin, two six million Btu/hour direct fired gas heaters are used to heat air for drying the cotton. The biomass combustor was installed to operate in parallel with one of the heaters to supply heated air for the drying process. A pneumatic conveying system was installed to intercept a portion of the gin trash and divert it to the burner. The burner was operated during the 1992 ginning season, which lasted from September through November, with few problems.

Influence of cover crops on insect pests and predators in conservation tillage cotton.

Science.gov (United States)

Tillman, Glynn; Schomberg, Harry; Phatak, Sharad; Mullinix, Benjamin; Lachnicht, Sharon; Timper, Patricia; Olson, Dawn

2004-08-01

In fall 2000, an on-farm sustainable agricultural research project was established for cotton, Gossypium hirsutum L., in Tift County, Georgia. The objective of our 2-yr research project was to determine the impact of several cover crops on pest and predator insects in cotton. The five cover crop treatments included 1) cereal rye, Secale cereale L., a standard grass cover crop; 2) crimson clover, Trifolium incarnatum L., a standard legume cover crop; 3) a legume mixture of balansa clover, Trifolium michelianum Savi; crimson clover; and hairy vetch, Vicia villosa Roth; 4) a legume mixture + rye combination; and 5) no cover crop in conventionally tilled fields. Three main groups or species of pests were collected in cover crops and cotton: 1) the heliothines Heliothis virescens (F.) and Helicoverpa zea (Boddie); 2) the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois); and 3) stink bugs. The main stink bugs collected were the southern green stink bug, Nezara viridula (L.); the brown stink bug, Euschistus servus (Say); and the green stink bug, Acrosternum hilare (Say). Cotton aphids, Aphis gossypii Glover, were collected only on cotton. For both years of the study, the heliothines were the only pests that exceeded their economic threshold in cotton, and the number of times this threshold was exceeded in cotton was higher in control cotton than in crimson clover and rye cotton. Heliothine predators and aphidophagous lady beetles occurred in cover crops and cotton during both years of the experiment. Geocoris punctipes (Say), Orius insidiosus (Say), and red imported fire ant, Solenopsis invicta Buren were relatively the most abundant heliothine predators observed. Lady beetles included the convergent lady beetle, Hippodamia convergens Guérin-Méneville; the sevenspotted lady beetle, Coccinella septempunctata L.; spotted lady beetle, Coleomegilla maculata (DeGeer); and the multicolored Asian lady beetle, Harmonia axyridis (Pallas). Density of G. punctipes was

Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

Directory of Open Access Journals (Sweden)

Fok, M.

2011-01-01

Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

Radiation degradation of short-cotton linters

International Nuclear Information System (INIS)

Ma Zue Teh; Zhou Rui Min

1984-01-01

Radiation degradation of short-cotton linters has been studied by using X-ray diffraction, an infrared spectrometer and a viscosimeter. Average molecular weight and crystallinity of short-cotton linters and the change of reducing sugar in γ-radiation degradation were examined. It was found that cellulosic saccharification in hydrolysis was enhanced with preirradiation of linter. This probably resulted from the radiation induced change of cellulosic structure. Sensitizers to promote radiation degradation effect were investigated. Carbon tetrachloride has been found to be effective. (author)

7 CFR 1427.16 - Movement and protection of warehouse-stored cotton.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Movement and protection of warehouse-stored cotton. 1427.16 Section 1427.16 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY... Cotton Loan and Loan Deficiency Payments § 1427.16 Movement and protection of warehouse-stored cotton. (a...

Current university and USDA lab cotton contamination research

Science.gov (United States)

U.S. cotton is considered to have some of the lowest levels of contamination in the world. However, that reputation is in jeopardy as complaints of contamination from domestic and foreign mills are on the rise. Cotton contamination can be classified under four major categorizes: fabrics and strings ...

cotton fabric 51

African Journals Online (AJOL)

DR. AMINU

1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.

Concept model semantics for DL preferential reasoning

CSIR Research Space (South Africa)

Britz, K

2011-07-01

Full Text Available ., Olivetti, N., Gliozzi, V., Pozzato, G.: ALC +T : a preferential exten- sion of description logics. Fund. Informatica 96(3), 341{372 (2009) 7. Kraus, S., Lehmann, D., Magidor, M.: Nonmonotonic reasoning, preferential mod- els and cumulative logics. Arti...

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

Science.gov (United States)

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

Conductive Cotton Textile from Safely Functionalized Carbon Nanotubes

Directory of Open Access Journals (Sweden)

Mohammad Jellur Rahman

2015-01-01

Full Text Available Electroconductive cotton textile has been prepared by a simple dipping-drying coating technique using safely functionalized multiwalled carbon nanotubes (f-MWCNTs. Owing to the surface functional groups, the f-MWCNTs become strongly attached with the cotton fibers forming network armors on their surfaces. As a result, the textile exhibits enhanced electrical properties with improved thermal conductivity and therefore is demonstrated as a flexible electrothermal heating element. The fabricated f-MWCNTs/cotton textile can be heated uniformly from room temperature to ca. 100°C within few minutes depending on the applied voltage. The textile shows good thermal stability and repeatability during a long-term heating test.

The Optimal Tax on Antebellum U.S. Cotton Exports

OpenAIRE

Douglas A. Irwin

2001-01-01

The United States produced about 80 percent of the world's cotton in the decades prior to the Civil War. How much monopoly power did the United States possess in the world cotton market and what would have been the effect of an optimal export tax? This paper estimates the elasticity of foreign demand for U.S. cotton exports and uses the elasticity in a simple partial equilibrium model to calculate the optimal export tax and its effect on prices, trade, and welfare. The results indicate that t...

Cotton Leaf Curl Multan Betasatellite DNA as a Tool to Deliver and Express the Human B-Cell Lymphoma 2 (Bcl-2) Gene in Plants.

Science.gov (United States)

Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar

2016-05-01

The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.

Identification and characterization of microRNAs in Asiatic cotton (Gossypium arboreum L..

Directory of Open Access Journals (Sweden)

Min Wang

Full Text Available To date, no miRNAs have been identified in the important diploid cotton species although there are several reports on miRNAs in upland cotton. In this study, we identified 73 miRNAs, belonging to 49 families, from Asiatic cotton using a well-developed comparative genome-based homologue search. Several of the predicted miRNAs were validated using quantitative real time PCR (qRT-PCR. The length of miRNAs varied from 18 to 22 nt with an average of 20 nt. The length of miRNA precursors also varied from 46 to 684 nt with an average of 138 ±120 nt. For a majority of Asiatic cotton miRNAs, there is only one member per family; however, multiple members were identified for miRNA 156, 414, 837, 838, 1044, 1533, 2902, 2868, 5021 and 5142 families. Nucleotides A and U were dominant, accounted for 62.95%, in the Asiatic cotton pre-miRNAs. The Asiatic cotton pre-miRNAs had high negative minimal folding free energy (MFE and adjusted MFE (AMFE and high MFE index (MFEI. Many miRNAs identified in Asiatic cotton suggest that miRNAs also play a similar regulatory mechanism in diploid cotton.

Fabrication of superhydrophobic cotton fabrics using crosslinking polymerization method

Science.gov (United States)

Jiang, Bin; Chen, Zhenxing; Sun, Yongli; Yang, Huawei; Zhang, Hongjie; Dou, Haozhen; Zhang, Luhong

2018-05-01

With the aim of removing and recycling oil and organic solvent from water, a facile and low-cost crosslinking polymerization method was first applied on surface modification of cotton fabrics for water/oil separation. Micro-nano hierarchical rough structure was constructed by triethylenetetramine (TETA) and trimesoyl chloride (TMC) that formed a polymeric layer on the surface of the fabric and anchored Al2O3 nanoparticles firmly between the fabric surface and the polymer layer. Superhydrophobic property was further obtained through self-assembly grafting of hydrophobic groups on the rough surface. The as-prepared cotton fabric exhibited superoleophilicity in atmosphere and superhydrophobicity both in atmosphere and under oil with the water contact angle of 153° and 152° respectively. Water/oil separation test showed that the as-prepared cotton fabric can handle with various oil-water mixtures with a high separation efficiency over 99%. More importantly, the separation efficiency remained above 98% over 20 cycles of reusing without losing its superhydrophobicity which demonstrated excellent reusability in oil/water separation process. Moreover, the as-prepared cotton fabric possessed good contamination resistance ability and self-cleaning property. Simulation washing process test showed the superhydrophobic cotton fabric maintained high value of water contact angle above 150° after 100 times washing, indicating great stability and durability. In summary, this work provides a brand-new way to surface modification of cotton fabric and makes it a promising candidate material for oil/water separation.

Inventories of Asian textile producers, US cotton exports, and the exchange rate

Directory of Open Access Journals (Sweden)

Durmaz Nazif

2014-01-01

Full Text Available The present paper develops a model with US cotton exports depending on the stock-to-use ratio, trade weighted exchange rates, and the relative cotton prices. The role of inventories in cotton consumption is examined in five textile producing cotton importers, China, Indonesia, Thailand, South Korea, and Taiwan. Cotton inventory dynamics is diverse among Asian textile producers. Relative prices have negative effect in all markets as expected. Exchange rate elasticities show that effects should be examined for each separate market. Changes in rates of depreciation also have stronger effects than exchange rate. Results reveal that these countries are not all that homogenous.

Dynamic and Stochastic Structures of U.S. Cotton Exports and Mill Demand

OpenAIRE

Fadiga, Mohamadou L.

2006-01-01

This study employs a structural time-series method to model and estimate U.S. cotton exports and mill use. The results show that the stochastic process governing cotton export fluctuations is transitory, while the process pertaining to mill use has transitory, seasonal, and secular origins. The estimated structural relationships after accounting for the unobserved components indicate U.S. cotton exports respond directly to higher international price relative to domestic price of cotton, while...

Textile industry can be less pollutant: introducing naturally colored cotton

Directory of Open Access Journals (Sweden)

Solimar Garcia

2014-07-01

Full Text Available 800x600 Studies in agribusiness and textile industry, both involved with the production of manufacturing fashion present insufficient development for new products that could represent water savings and reduction of chemical effluents, making this production chain a sustainable business. This paper introduces the colored and organic cotton as an alternative to foster colored cotton producing farmers and improving the concept of sustainability in the textile sector. Results show that the increase in the production of colored and organic cotton, may result in reduction of water use, and consequent reduction in the disposal of effluents in nature. As the colored and organic cotton is produced by small farmers, governmental agencies need to participate in the effort of improving its production and distribution, providing the needed infrastructure to meet the increasing market. This would slowly encourage the reduction of white cotton consumption in exchange for this naturally colored product. The water used, and consequent polluted discharge in the use of colored cotton in the textile industry might be reduced by 70%, assuming a reduction of environmental impact of 5% per year would represent expressive numbers in the next ten years. Normal 0 21 false false false ES X-NONE X-NONE

Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda).

Science.gov (United States)

Martins, E S; Aguiar, R W D S; Martins, N F; Melatti, V M; Falcão, R; Gomes, A C M M; Ribeiro, B M; Monnerat, R G

2008-05-01

To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.

Preferential attachment in evolutionary earthquake networks

Science.gov (United States)

Rezaei, Soghra; Moghaddasi, Hanieh; Darooneh, Amir Hossein

2018-04-01

Earthquakes as spatio-temporal complex systems have been recently studied using complex network theory. Seismic networks are dynamical networks due to addition of new seismic events over time leading to establishing new nodes and links to the network. Here we have constructed Iran and Italy seismic networks based on Hybrid Model and testified the preferential attachment hypothesis for the connection of new nodes which states that it is more probable for newly added nodes to join the highly connected nodes comparing to the less connected ones. We showed that the preferential attachment is present in the case of earthquakes network and the attachment rate has a linear relationship with node degree. We have also found the seismic passive points, the most probable points to be influenced by other seismic places, using their preferential attachment values.

A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

Science.gov (United States)

Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

2015-07-01

Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

Thermal reduction of graphene-oxide-coated cotton for oil and organic solvent removal

International Nuclear Information System (INIS)

Hoai, Nguyen To; Sang, Nguyen Nhat; Hoang, Tran Dinh

2017-01-01

Highlights: • A new method for preparation of reduced-graphene-oxide (RGO) coated cotton is proposed. • The RGO-Cotton composites were carefully characterized using many modern techniques. • RGO-Cotton exhibited superhydrophobicity and superolephilicity. • RGO-Cotton sponges can absorb many types of oils and organic solvents and can be recycled. - Abstract: The reduced-graphene-oxide (RGO)-coated cotton sponge (RGO-Cot) was prepared by simply heating a graphene-oxide (GO)-coated cotton sponge, which was fabricated by dipping a commercial cotton sponge into a GO dispersion, under vacuum at 200 °C for 2 h. The thus prepared RGO-Cot sponges exhibited superhydrophobicity and superoleophilicity, with a water contact angle of 151°. These RGO-Cot sponges could be used for removal of many types of oils and organic solvents as they exhibit absorption capacities in the range of 22–45 times their weight and good absorption recyclability.

Thermal reduction of graphene-oxide-coated cotton for oil and organic solvent removal

Energy Technology Data Exchange (ETDEWEB)

Hoai, Nguyen To, E-mail: hoaito@pvu.edu.vn; Sang, Nguyen Nhat; Hoang, Tran Dinh

2017-02-15

Highlights: • A new method for preparation of reduced-graphene-oxide (RGO) coated cotton is proposed. • The RGO-Cotton composites were carefully characterized using many modern techniques. • RGO-Cotton exhibited superhydrophobicity and superolephilicity. • RGO-Cotton sponges can absorb many types of oils and organic solvents and can be recycled. - Abstract: The reduced-graphene-oxide (RGO)-coated cotton sponge (RGO-Cot) was prepared by simply heating a graphene-oxide (GO)-coated cotton sponge, which was fabricated by dipping a commercial cotton sponge into a GO dispersion, under vacuum at 200 °C for 2 h. The thus prepared RGO-Cot sponges exhibited superhydrophobicity and superoleophilicity, with a water contact angle of 151°. These RGO-Cot sponges could be used for removal of many types of oils and organic solvents as they exhibit absorption capacities in the range of 22–45 times their weight and good absorption recyclability.

THE WORLD TRADE ORGANIZATION AND SOUTHERN AGRICULTURE: THE COTTON PERSPECTIVE

OpenAIRE

Hudson, Darren

2000-01-01

The World Trade Organization (WTO) negotiations could have important implications for Southern Agriculture. This paper explores some of the issues surrounding the WTO negotiations for cotton. Specifically, this paper examines the impacts of the phase-out of the Multi-Fiber Arrangement (MFA) on the location of textile production and cotton trade flows. Generally, it is believed that the WTO negotiations will have little direct impact on cotton, but will have indirect impacts through textile po...

King Cotton's Lasting Legacy of Poverty and Southern Region Contemporary Conditions

Science.gov (United States)

Guthrie, James W.; Peevely, Gary

2010-01-01

One hundred fifty years ago, cotton was considered as the king of all United States' agricultural exports. Cotton's dollar value far exceeded that of any other mid-19th-century United States trade item, much more than tobacco, fish, forest products, raw materials for manufacturing, or manufactured items. Indeed, in the mid-19th century, cotton was…

Effect Of Bird Manure On Cotton Plants Grown On Soils Sampled ...

African Journals Online (AJOL)

Cotton plant had a better development and growth when bird manure was only applied to soil or combined with mineral fertilizer and when cotton was grown on a soil where the previous crops were cereals (maize or sorghum). Planting cotton on a soil where the previous crop grown was maize or sorghum had no significant ...

POLICY IMPLICATIONS OF TEXTILE TRADE MANAGEMENT AND THE U.S. COTTON INDUSTRY

OpenAIRE

Shui, Shangnan; Wohlgenant, Michael K.; Beghin, John C.

1993-01-01

This study investigates the effects on the U.S. cotton industry of textile trade liberalization using a multi-market equilibrium displacement model. The simulation results suggest that textile trade liberalization would induce small changes in the total demand for U.S. cotton but would affect considerable y U.S. cotton demand structure, making U. S, cotton growers more dependent on world markets. The welfare analyses reveal that textile trade liberalization would result in a small welfare los...

Effects of nematicides on cotton root mycobiota.

Science.gov (United States)

Baird, R E; Carling, D E; Watson, C E; Scruggs, M L; Hightower, P

2004-02-01

Baseline information on the diversity and population densities of fungi collected from soil debris and cotton (Gossypium hirsutum L.) roots was determined. Samples were collected from Tifton, GA, and Starkville, MS containing cotton field soil treated with the nematicides 1,3-dichloroproprene (fumigant) and aldicarb (granules). A total of 10,550 and 13,450 fungal isolates were collected from these two study sites, respectively. Of this total, 34 genera of plant pathogenic or saprophytic species were identified. Pathogenic root fungi included Fusarium spp. (40% of all isolations), Macrophomina, Pythium, Rhizoctonia, and Sclerotium. Fusarium and Rhizoctonia were the most common fungal species identified and included F. oxysporum, F. verticillioides and F. solani, the three Fusarium species pathogenic on cotton plants. Population densities of Fusarium were not significantly different among locations or tissue types sampled. Macrophomina was isolated at greater numbers near the end of the growing seasons. Anastomosis groups of R. solani isolated from roots and soil debris included AG-3, -4, -7, 2-2, and -13 and anastomosis groups of binucleate Rhizoctonia included CAG-2, -3, and -5. Occurrences and frequency of isolations among sampling dates were not consistent. Fluctuations in the frequency of isolation of Rhizoctonia did not correspond with changes in frequency of isolation of the biological control fungus, Trichoderma. When individual or pooled frequencies of the mycobiota were compared to nematicide treatments, no specific trends occurred between treatments, application methods or rates. Results from this study show that use of 1,3-D and aldicarb in cotton fields does not significantly impact plant pathogenic fungi or saprophytic fungal populations. Thus cotton producers need not adjust seedling disease control measures when these two nematicides are used.

Cyclic mechanical stretch contributes to network development of osteocyte-like cells with morphological change and autophagy promotion but without preferential cell alignment in rat.

Science.gov (United States)

Inaba, Nao; Kuroshima, Shinichiro; Uto, Yusuke; Sasaki, Muneteru; Sawase, Takashi

2017-09-01

Osteocytes play important roles in controlling bone quality as well as preferential alignment of biological apatite c -axis/collagen fibers. However, the relationship between osteocytes and mechanical stress remains unclear due to the difficulty of three-dimensional (3D) culture of osteocytes in vitro . The aim of this study was to investigate the effect of cyclic mechanical stretch on 3D-cultured osteocyte-like cells. Osteocyte-like cells were established using rat calvarial osteoblasts cultured in a 3D culture system. Cyclic mechanical stretch (8% amplitude at a rate of 2 cycles min -1 ) was applied for 24, 48 and 96 consecutive hours. Morphology, cell number and preferential cell alignment were evaluated. Apoptosis- and autophagy-related gene expression levels were measured using quantitative PCR. 3D-cultured osteoblasts became osteocyte-like cells that expressed osteocyte-specific genes such as Dmp1 , Cx43 , Sost , Fgf23 and RANKL , with morphological changes similar to osteocytes. Cell number was significantly decreased in a time-dependent manner under non-loaded conditions, whereas cyclic mechanical stretch significantly prevented decreased cell numbers with increased expression of anti-apoptosis-related genes. Moreover, cyclic mechanical stretch significantly decreased cell size and ellipticity with increased expression of autophagy-related genes, LC3b and atg7 . Interestingly, preferential cell alignment did not occur, irrespective of mechanical stretch. These findings suggest that an anti-apoptotic effect contributes to network development of osteocyte-like cells under loaded condition. Spherical change of osteocyte-like cells induced by mechanical stretch may be associated with autophagy upregulation. Preferential alignment of osteocytes induced by mechanical load in vivo may be partially predetermined before osteoblasts differentiate into osteocytes and embed into bone matrix.

Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Min Lin

Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

78 FR 54970 - Cotton Futures Classification: Optional Classification Procedure

Science.gov (United States)

2013-09-09

... Service 7 CFR Part 27 [AMS-CN-13-0043] RIN 0581-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing Service, USDA. ACTION: Proposed rule. SUMMARY: The... optional cotton futures classification procedure--identified and known as ``registration'' by the U.S...

78 FR 9330 - Revision of Regulations Defining Bona Fide Cotton Spot Markets

Science.gov (United States)

2013-02-08

... Cotton Spot Markets AGENCY: Agricultural Marketing Service, USDA. ACTION: Proposed rule. SUMMARY: The... bona fide cotton spot markets in order to assure consistency with the revised Cotton Research and Promotion Act. Updated bona fide spot market definitions will allow for published spot quotes to consider...

Conductive Cotton Fabrics for Motion Sensing and Heating Applications

Directory of Open Access Journals (Sweden)

Mengyun Yang

2018-05-01

Full Text Available Conductive cotton fabric was prepared by coating single-wall carbon nanotubes (CNTs on a knitted cotton fabric surface through a “dip-and-dry” method. The combination of CNTs and cotton fabric was analyzed using scanning electron microscopy (SEM and Raman scattering spectroscopy. The CNTs coating improved the mechanical properties of the fabric and imparted conductivity to the fabric. The electromechanical performance of the CNT-cotton fabric (CCF was evaluated. Strain sensors made from the CCF exhibited a large workable strain range (0~100%, fast response and great stability. Furthermore, CCF-based strain sensors was used to monitor the real-time human motions, such as standing, walking, running, squatting and bending of finger and elbow. The CCF also exhibited strong electric heating effect. The flexible strain sensors and electric heaters made from CCF have potential applications in wearable electronic devices and cold weather conditions.

Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

Science.gov (United States)

Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

2017-12-30

Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

Comparative Analysis of Discovery Function of Cotton Future Price among Different Regions——A Case Study of Xinjiang

Institute of Scientific and Technical Information of China (English)

2011-01-01

Through comparative analysis, We research the relationship between cotton future price and cotton spot price in different regions, in order to formulate corresponding strategies in different regions under the new situation. We use ADF unit root test, E-G two-step cointegration test, Granger causality test, and other research methods in Eviews 5.0 statistical software, to empirically study the relationship between the cotton future price and cotton spot price in Xinjiang, the relationship between the cotton future price and cotton spot price in China. The results show that there is a long-term relationship between the cotton future price and cotton spot price in Xinjiang, between the cotton future price and cotton spot price in China; the cotton future price plays unidirectional role in guiding cotton spot price in Xinjiang and cotton spot price in China. The discovery function of cotton future price plays much greater role in the cotton market of China than in the cotton market of Xinjiang.

Effect of Gamma Irradiation Doses on Some Chemical Characteristics of Cotton Seed Oil

International Nuclear Information System (INIS)

Saleh, O.I.

2011-01-01

Cotton Seeds c.v. Giza 85 (Gossypium hirsutum L.) were exposed to gamma irradiation doses of 0.5, 1.0 and 1.5 kGy to improve some chemical characteristics of cotton seed oil i.e. saturated and unsaturated fatty acids, gossypol and βsitosterol that were bound oil. The presented study showed that, the saturated fatty acids; lauric, palmitic and stearic increased when the cotton seeds were exposed to gamma irradiation doses of 0.5 up to 1.5 kGy, On the other hand, arachidic acid content decreased in all the irradiated treatments compared with untreated cotton seed. The unsaturated fatty acid oleic was increased in irradiated cotton seed samples compared with untreated one, while linoleic, the major unsaturated fatty acid decreased in irradiated cotton seed oil than untreated seeds. Gossypol and βsitosterol, bound oil, in irradiated cotton seeds increased gradually with gamma irradiated doses compared with untreated control samples

An Assessment of Current Policy Initiatives in Zambia's Cotton Sector

OpenAIRE

Zulu, Ballard; Tschirley, David L.

2004-01-01

This paper assesses three of these policy initiatives: input credit provision for smallholder producers of selected cash crops including cotton, the proposed creation of a Cotton Board, and the emergence in 2003 of District Council levies as a point of conflict between local governments and cotton companies. The purpose of the paper is to provide guidance to public and private decision makers regarding key modifications which may need to be made to these policies to ensure continued healthy d...

Developing Cotton IPM by Conserving Parasitoids and Predators of The Main Pest

Directory of Open Access Journals (Sweden)

Nurindah Nurindah

2015-09-01

Full Text Available On early development of intensive cotton program, insect pests were considered as an important aspect in cotton cultivation, so that it needed to be scheduled sprays. The frequency of sprays was 7 times used 12L of chemical insecticides per hectare per season. Development of cotton IPM was emphasized on non-chemical control methods through optimally utilize natural enemies of the cotton main pests (Amrasca biguttulla (IshidaHelicoverpa armigera (Hübner. Conservation of parasitoids and predators by providing the environment that support their population development is an act of supporting the natural enemies as an effective biotic mortality factor of the insect pests. The conservation could be done by improving the plant matter and cultivation techniques that include the use of resistant variety to leafhopper, intercropping cotton with secondary food plants, mulch utilization, using action threshold that considered the presence of natural enemies, and application of botanical insecticides, if needed. Conservation of parasitoids and predators in cotton IPM could control the insect pests without any insecticide spray in obtaining the production of cotton seed. As such, the use of IPM method would increase farmers’ income.