Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo
2012-01-01
HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291
International Nuclear Information System (INIS)
Lehr, Elizabeth; Brown, Darron R.
2003-01-01
Infection of the genital tract with human papillomaviruses (HPVs) leads to proliferative and dysplastic epithelial lesions. The mechanisms used by the virus to escape the infected keratinocyte are not well understood. Infection of keratinocytes with HPV does not cause lysis, the mechanism used by many viruses to release newly formed virions. For HPV 11, a type associated with a low risk of neoplastic disease, the cornified cell envelope (CCE) of infected keratinocytes is thin and fragile, and transcription of loricrin, the major CCE protein, is reduced. The effects of high-risk HPV infection on components of the CCE have not been previously reported. HPV 59, an oncogenic genital type related to HPV types 18 and 45 was identified in a condylomata acuminata lesion. An extract of this lesion was used to infect human foreskin fragments, which were grown in athymic mice as xenografts. Continued propagation using extracts of xenografts permitted growth of additional HPV 59-infected xenografts. CCEs purified from HPV 59-infected xenografts displayed subtle morphologic abnormalities compared to those derived from uninfected xenografts. HPV 59-infected xenografts revealed dysplastic-appearing cells with mitotic figures. Detection of loricrin, involucrin, and cytokeratin 10 was reduced in HPV 59-infected epithelium, while small proline-rich protein 3 (SPR3) was increased. Reduction in loricrin was most apparent in regions of epithelium containing abundant HPV 59 DNA. Compared to uninfected epithelium, loricrin transcription was decreased in HPV 59-infected epithelium. We conclude that HPV 59 shares with HPV 11 the ability to alter CCE components and to specifically reduce transcription of the loricrin gene. Because loricrin is the major CCE protein, a reduction in this component could alter the physical properties of the CCE, thus facilitating virion release
LENUS (Irish Health Repository)
Bowes, John
2010-12-01
A common deletion mapping to the psoriasis susceptibility locus 4 on chromosome 1q21, encompassing two genes of the late cornified envelope (LCE) gene cluster, has been associated with an increased risk of psoriasis vulgaris (PsV). One previous report found no association of the deletion with psoriatic arthritis (PsA), suggesting it may be a specific risk factor for PsV. Given the genetic overlap between PsA and PsV, a study was undertaken to investigate whether single nucleotide polymorphisms (SNPs) mapping to this locus are risk factors for PsA in a UK and Irish population.
Mohamad, Janan; Sarig, Ofer; Godsel, Lisa M; Peled, Alon; Malchin, Natalia; Bochner, Ron; Vodo, Dan; Rabinowitz, Tom; Pavlovsky, Mor; Taiber, Shahar; Fried, Maya; Eskin-Schwartz, Marina; Assi, Siwar; Shomron, Noam; Uitto, Jouni; Koetsier, Jennifer L; Bergman, Reuven; Green, Kathleen J; Sprecher, Eli
2018-05-11
Peeling skin syndromes form a large and heterogeneous group of inherited disorders characterized by superficial detachment of the epidermal cornified cell layers, often associated with inflammatory features. Here we report on a consanguineous family featuring non-inflammatory peeling of the skin exacerbated by exposure to heat and mechanical stress. Whole exome sequencing revealed a homozygous nonsense mutation in FLG2, encoding filaggrin 2, which co-segregated with the disease phenotype in the family. The mutation was found to result in decreased FLG2 RNA levels as well almost total absence of filaggrin 2 in the patient epidermis. Filaggrin 2 was found to be expressed throughout the cornified cell layers and to co-localize with corneodesmosin which plays a crucial role in maintaining cell-cell adhesion in this region of the epidermis. Absence of filaggrin 2 in the patient skin was associated with markedly decreased corneodesmosin expression, which may contribute to the peeling phenotype displayed by the patients. Accordingly, using the dispase dissociation assay, we showed that FLG2 down-regulation interferes with keratinocyte cell-cell adhesion. Of particular interest, this effect was aggravated by temperature elevation, consistent with the clinical phenotype. Restoration of CDSN levels by ectopic expression rescued cell-cell adhesion.Taken together, the present data suggest that filaggrin 2 is essential for normal cell-cell adhesion in the cornified cell layers. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Hönzke, Stefan; Wallmeyer, Leonie; Ostrowski, Anja; Radbruch, Moritz; Mundhenk, Lars; Schäfer-Korting, Monika; Hedtrich, Sarah
2016-03-01
Atopic dermatitis is a chronic skin condition with complex etiology. It is characterized by skin barrier defects and T helper type 2 (Th2)-polarized inflammation. Although mutations in the filaggrin gene are known to be prominent genetic risk factors for the development of atopic dermatitis, the interdependency between these and an altered cytokine milieu is not fully understood. In this study, we evaluated the direct effects of filaggrin deficiency on the cornified envelope, tight junction proteins, and innate immune response, and report the effects of Th2 cytokines in normal and filaggrin-deficient skin equivalents. Supplementation with IL-4 and IL-13 led to distinct histologic changes and significantly increased skin surface pH, both of which were enhanced in filaggrin knockdown skin equivalents. We detected a compensatory up-regulation of involucrin and occludin in filaggrin-deficient skin that was dramatically disturbed when simultaneous inflammation occurred. Furthermore, we found that a lack of filaggrin triggered an up-regulation of human ?-defensin 2 via an unknown mechanism, which was abolished by Th2 cytokine supplementation. Taken together, these results indicate that defects in the epidermal barrier, skin permeability, and cutaneous innate immune response are not primarily linked to filaggrin deficiency but are rather secondarily induced by Th2 inflammation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Salmond, G P; Lutkenhaus, J F; Donachie, W D
1980-01-01
We report the identification, cloning, and mapping of a new cell envelope gene, murG. This lies in a group of five genes of similar phenotype (in the order murE murF murG murC ddl) all concerned with peptidoglycan biosynthesis. This group is in a larger cluster of at least 10 genes, all of which are involved in some way with cell envelope growth. Images PMID:6998962
The cell envelope glycoconjugates of Mycobacterium tuberculosis
Angala, Shiva Kumar; Belardinelli, Juan Manuel; Huc-Claustre, Emilie; Wheat, William H.; Jackson, Mary
2015-01-01
Tuberculosis (TB) remains the second most common cause of death due to a single infectious agent. The cell envelope of Mycobacterium tuberculosis (Mtb), the causative agent of the disease in humans, is a source of unique glycoconjugates and the most distinctive feature of the biology of this organism. It is the basis of much of Mtb pathogenesis and one of the major causes of its intrinsic resistance to chemotherapeutic agents. At the same time, the unique structures of Mtb cell envelope glycoconjugates, their antigenicity and essentiality for mycobacterial growth provide opportunities for drug, vaccine, diagnostic and biomarker development, as clearly illustrated by recent advances in all of these translational aspects. This review focuses on our current understanding of the structure and biogenesis of Mtb glycoconjugates with particular emphasis on one of most intriguing and least understood aspect of the physiology of mycobacteria: the translocation of these complex macromolecules across the different layers of the cell envelope. It further reviews the rather impressive progress made in the last ten years in the discovery and development of novel inhibitors targeting their biogenesis. PMID:24915502
A novel mechanism of filaggrin induction and sunburn prevention by β-damascenone in Skh-1 mice.
Uddin, Ahmed N; Labuda, Ivica; Burns, Fredric J
2012-12-15
Understanding how oral administration of aroma terpenes can prevent sunburn or skin cancer in mice could lead to more effective and safer ways of blocking sun damage to human skin. To establish sunburn preventive activity, female Skh-1 mice were given oral β-damascenone followed by irradiation with UVR from fluorescent 'sunlamps'. The following endpoints were evaluated versus controls at various times between 1 and 12 days after the terpene: whole genome gene expression and in situ immunohistochemistry of PCNA, keratin 10, filaggrin and caspase 14, and sunburn was evaluated at 5 days. UVR-induced sunburn was prevented by a single oral β-damascenone dose as low as 20 μL (0.95 mg/g body weight). Microarray analysis showed sunburn prevention doses of β-damascenone up-regulated several types of cornification genes, including keratins 1 and 10, filaggrin, caspase 14, loricrin, hornerin and 6 late cornified envelope genes. Immunohistochemical studies of PCNA labeling showed that β-damascenone increased the proliferation rates of the following cell types: epidermal basal cells, follicular outer root sheath cells and sebaceous gland cells. Keratin 10 was not affected by β-damascenone in epidermis, and filaggrin and caspase 14 were increased in enlarged sebaceous glands. The thickness of the cornified envelope plus sebum layer nearly doubled within 1 day after administration of the β-damascenone and remained at or above double thickness for at least 12 days. β-Damascenone protected against sunburn by activating a sebaceous gland-based pathway that fortified and thickened the cornified envelope plus sebum layer in a way that previously has been observed to occur only in keratinocytes. Copyright © 2012 Elsevier Inc. All rights reserved.
Virulence properties of the Legionella pneumophila cell envelope
Directory of Open Access Journals (Sweden)
Olga eShevchuk
2011-04-01
Full Text Available The bacterial envelope plays a crucial role in the pathogenesis of infectious diseases. In this review, we summarize the current knowledge of the structure and molecular composition of the Legionella pneumophila cell envelope. We describe LPS biosynthesis and the biological activities of membrane and periplasmic proteins and discuss their decisive functions during the pathogen-host interaction. In addition to adherence, invasion and intracellular survival of L. pneumophila, special emphasis is laid on iron acquisition, detoxification, key elicitors of the immune response and the diverse functions of outer membrane vesicles. The critical analysis of the literature reveals that the dynamics and phenotypic plasticity of the Legionella cell surface during the different metabolic stages requires more attention in the future.
A novel mechanism of filaggrin induction and sunburn prevention by β-damascenone in Skh-1 mice
Energy Technology Data Exchange (ETDEWEB)
Uddin, Ahmed N.; Labuda, Ivica; Burns, Fredric J., E-mail: fredric.burns@nyumc.org
2012-12-15
Understanding how oral administration of aroma terpenes can prevent sunburn or skin cancer in mice could lead to more effective and safer ways of blocking sun damage to human skin. To establish sunburn preventive activity, female Skh-1 mice were given oral β-damascenone followed by irradiation with UVR from fluorescent ‘sunlamps’. The following endpoints were evaluated versus controls at various times between 1 and 12 days after the terpene: whole genome gene expression and in situ immunohistochemistry of PCNA, keratin10, filaggrin and caspase 14, and sunburn was evaluated at 5 days. UVR-induced sunburn was prevented by a single oral β-damascenone dose as low as 20 μL (0.95 mg/g body weight). Microarray analysis showed sunburn prevention doses of β-damascenone up-regulated several types of cornification genes, including keratins 1 and 10, filaggrin, caspase 14, loricrin, hornerin and 6 late cornified envelope genes. Immunohistochemical studies of PCNA labeling showed that β-damascenone increased the proliferation rates of the following cell types: epidermal basal cells, follicular outer root sheath cells and sebaceous gland cells. Keratin 10 was not affected by β-damascenone in epidermis, and filaggrin and caspase 14 were increased in enlarged sebaceous glands. The thickness of the cornified envelope plus sebum layer nearly doubled within 1 day after administration of the β-damascenone and remained at or above double thickness for at least 12 days. β-Damascenone protected against sunburn by activating a sebaceous gland-based pathway that fortified and thickened the cornified envelope plus sebum layer in a way that previously has been observed to occur only in keratinocytes. -- Highlights: ► Orally administered β-damascenone prevented UVB-induced sunburn in Skh-1 mice. ► Filaggrin and caspase 14 genes were induced in sebaceous gland cells. ► Numerous cornification genes were up-regulated by β-damascenone. ► β-Damascenone stimulated cell
A novel mechanism of filaggrin induction and sunburn prevention by β-damascenone in Skh-1 mice
International Nuclear Information System (INIS)
Uddin, Ahmed N.; Labuda, Ivica; Burns, Fredric J.
2012-01-01
Understanding how oral administration of aroma terpenes can prevent sunburn or skin cancer in mice could lead to more effective and safer ways of blocking sun damage to human skin. To establish sunburn preventive activity, female Skh-1 mice were given oral β-damascenone followed by irradiation with UVR from fluorescent ‘sunlamps’. The following endpoints were evaluated versus controls at various times between 1 and 12 days after the terpene: whole genome gene expression and in situ immunohistochemistry of PCNA, keratin10, filaggrin and caspase 14, and sunburn was evaluated at 5 days. UVR-induced sunburn was prevented by a single oral β-damascenone dose as low as 20 μL (0.95 mg/g body weight). Microarray analysis showed sunburn prevention doses of β-damascenone up-regulated several types of cornification genes, including keratins 1 and 10, filaggrin, caspase 14, loricrin, hornerin and 6 late cornified envelope genes. Immunohistochemical studies of PCNA labeling showed that β-damascenone increased the proliferation rates of the following cell types: epidermal basal cells, follicular outer root sheath cells and sebaceous gland cells. Keratin 10 was not affected by β-damascenone in epidermis, and filaggrin and caspase 14 were increased in enlarged sebaceous glands. The thickness of the cornified envelope plus sebum layer nearly doubled within 1 day after administration of the β-damascenone and remained at or above double thickness for at least 12 days. β-Damascenone protected against sunburn by activating a sebaceous gland-based pathway that fortified and thickened the cornified envelope plus sebum layer in a way that previously has been observed to occur only in keratinocytes. -- Highlights: ► Orally administered β-damascenone prevented UVB-induced sunburn in Skh-1 mice. ► Filaggrin and caspase 14 genes were induced in sebaceous gland cells. ► Numerous cornification genes were up-regulated by β-damascenone. ► β-Damascenone stimulated cell
Bacillus subtilis extracytoplasmic function (ECF) sigma factors and defense of the cell envelope.
Helmann, John D
2016-04-01
Bacillus subtilis provides a model for investigation of the bacterial cell envelope, the first line of defense against environmental threats. Extracytoplasmic function (ECF) sigma factors activate genes that confer resistance to agents that threaten the integrity of the envelope. Although their individual regulons overlap, σ(W) is most closely associated with membrane-active agents, σ(X) with cationic antimicrobial peptide resistance, and σ(V) with resistance to lysozyme. Here, I highlight the role of the σ(M) regulon, which is strongly induced by conditions that impair peptidoglycan synthesis and includes the core pathways of envelope synthesis and cell division, as well as stress-inducible alternative enzymes. Studies of these cell envelope stress responses provide insights into how bacteria acclimate to the presence of antibiotics. Copyright © 2016 Elsevier Ltd. All rights reserved.
Protamine-induced permeabilization of cell envelopes of gram-positive and gram-negative bacteria
DEFF Research Database (Denmark)
Johansen, Charlotte; Verheul, A.; Gram, Lone
1997-01-01
carboxyfluorescein and ATP after 2 to 5 min. Maximum antibacterial activity was reached at alkaline pH and in the absence of divalent cations. The efficient permeabilization of cell envelopes of both gram-positive and gram-negative bacteria suggests that protamine causes a general disruption of the cell envelope...
Polymers in cell encapsulation from an enveloped cell perspective.
de Vos, Paul; Lazarjani, Hamideh Aghajani; Poncelet, Denis; Faas, Marijke M
2014-04-01
In the past two decades, many polymers have been proposed for producing immunoprotective capsules. Examples include the natural polymers alginate, agarose, chitosan, cellulose, collagen, and xanthan and synthetic polymers poly(ethylene glycol), polyvinyl alcohol, polyurethane, poly(ether-sulfone), polypropylene, sodium polystyrene sulfate, and polyacrylate poly(acrylonitrile-sodium methallylsulfonate). The biocompatibility of these polymers is discussed in terms of tissue responses in both the host and matrix to accommodate the functional survival of the cells. Cells should grow and function in the polymer network as adequately as in their natural environment. This is critical when therapeutic cells from scarce cadaveric donors are considered, such as pancreatic islets. Additionally, the cell mass in capsules is discussed from the perspective of emerging new insights into the release of so-called danger-associated molecular pattern molecules by clumps of necrotic therapeutic cells. We conclude that despite two decades of intensive research, drawing conclusions about which polymer is most adequate for clinical application is still difficult. This is because of the lack of documentation on critical information, such as the composition of the polymer, the presence or absence of confounding factors that induce immune responses, toxicity to enveloped cells, and the permeability of the polymer network. Only alginate has been studied extensively and currently qualifies for application. This review also discusses critical issues that are not directly related to polymers and are not discussed in the other reviews in this issue, such as the functional performance of encapsulated cells in vivo. Physiological endocrine responses may indeed not be expected because of the many barriers that the metabolites encounter when traveling from the blood stream to the enveloped cells and back to circulation. However, despite these diffusion barriers, many studies have shown optimal
Purification and characterization of cell-envelope proteinase from ...
African Journals Online (AJOL)
user
2012-10-18
Oct 18, 2012 ... phenylmethylsulfonyl fluoride;. ACE, angiotensin-I-converting enzyme. Poolman, 1998). Cell-envelope proteinase (CEP) play an important role in the lactobacillus proteolytic system. CEPs are the critical enzyme in the system (Kunji et al., 1996), since it is the only enzyme that can initiate the breakdown of.
Skieresz-Szewczyk, Kinga; Jackowiak, Hanna; Ratajczak, Marlena
2018-02-01
The lingual nail as the cornified layer of the orthokeratinized epithelium in birds is responsible for the collection of solid food by pecking. The aim of the present study is to determine the manner of orthokeratinized epithelium development and assess the degree of readiness of the epithelium to fulfill its mechanical function at hatching. Three developmental phases are distinguished, i.e. embryonic, transformation and pre-hatching stage. In the embryonic stage lasting until day 13 of incubation the epithelium is composed of several layers of undifferentiated cells. During the transformation stage, from day 14 to 20 of incubation, the epithelium becomes differentiated to form three layers. A characteristic feature is the formation of osmophilic granules in the superficial layer, referred to as periderm granules. Until the pre-hatching stage the fibrous cytoskeleton of epithelial cells and an impermeable epithelial barrier are gradually developed. In the pre-hatching stage, a cornified lingual nail is formed, while the periderm is exfoliated. At hatching the orthokeratinized epithelium and lingual nail are fully developed and ready to perform feeding activities. The presence of periderm, similarly as in the epidermis, indicates the ectodermal derivation of the oral cavity epithelium. Moreover, occurrence of osmophilic granules may be considered as evidence for the phylogenetic affinity of birds and reptiles. Copyright © 2018 Elsevier GmbH. All rights reserved.
GAGE cancer-germline antigens are recruited to the nuclear envelope by germ cell-less (GCL)
DEFF Research Database (Denmark)
Gjerstorff, Morten F; Rösner, Heike I; Pedersen, Christina B
2012-01-01
GAGE proteins are highly similar, primate-specific molecules with unique primary structure and undefined cellular roles. They are restricted to cells of the germ line in adult healthy individuals, but are broadly expressed in a wide range of cancers. In a yeast two-hybrid screen we identified the...... different dsDNA fragments, suggesting sequence-nonspecific binding. Dual association of GAGE family members with GCL at the nuclear envelope inner membrane in cells, and with dsDNA in vitro, implicate GAGE proteins in chromatin regulation in germ cells and cancer cells....... the metazoan transcriptional regulator, Germ cell-less (GCL), as an interaction partner of GAGE12I. GCL directly binds LEM-domain proteins (LAP2β, emerin, MAN1) at the nuclear envelope, and we found that GAGE proteins were recruited to the nuclear envelope inner membrane by GCL. Based on yeast two...
Cell envelope stress response in cell wall-deficient L-forms of Bacillus subtilis.
Wolf, Diana; Domínguez-Cuevas, Patricia; Daniel, Richard A; Mascher, Thorsten
2012-11-01
L-forms are cell wall-deficient bacteria that can grow and proliferate in osmotically stabilizing media. Recently, a strain of the Gram-positive model bacterium Bacillus subtilis was constructed that allowed controlled switching between rod-shaped wild-type cells and corresponding L-forms. Both states can be stably maintained under suitable culture conditions. Because of the absence of a cell wall, L-forms are known to be insensitive to β-lactam antibiotics, but reports on the susceptibility of L-forms to other antibiotics that interfere with membrane-anchored steps of cell wall biosynthesis are sparse, conflicting, and strongly influenced by strain background and method of L-form generation. Here we investigated the response of B. subtilis to the presence of cell envelope antibiotics, with regard to both antibiotic resistance and the induction of the known LiaRS- and BceRS-dependent cell envelope stress biosensors. Our results show that B. subtilis L-forms are resistant to antibiotics that interfere with the bactoprenol cycle, such as bacitracin, vancomycin, and mersacidin, but are hypersensitive to nisin and daptomycin, which both affect membrane integrity. Moreover, we established a lacZ-based reporter gene assay for L-forms and provide evidence that LiaRS senses its inducers indirectly (damage sensing), while the Bce module detects its inducers directly (drug sensing).
Vlasblom, James; Gagarinova, Alla; Phanse, Sadhna; Graham, Chris; Yousif, Fouad; Ding, Huiming; Xiong, Xuejian; Nazarians-Armavil, Anaies; Alamgir, Md; Ali, Mehrab; Pogoutse, Oxana; Pe'er, Asaf; Arnold, Roland; Michaut, Magali; Parkinson, John; Golshani, Ashkan; Whitfield, Chris; Wodak, Shoshana J.; Moreno-Hagelsieb, Gabriel; Greenblatt, Jack F.; Emili, Andrew
2011-01-01
As the interface between a microbe and its environment, the bacterial cell envelope has broad biological and clinical significance. While numerous biosynthesis genes and pathways have been identified and studied in isolation, how these intersect functionally to ensure envelope integrity during adaptive responses to environmental challenge remains unclear. To this end, we performed high-density synthetic genetic screens to generate quantitative functional association maps encompassing virtually the entire cell envelope biosynthetic machinery of Escherichia coli under both auxotrophic (rich medium) and prototrophic (minimal medium) culture conditions. The differential patterns of genetic interactions detected among >235,000 digenic mutant combinations tested reveal unexpected condition-specific functional crosstalk and genetic backup mechanisms that ensure stress-resistant envelope assembly and maintenance. These networks also provide insights into the global systems connectivity and dynamic functional reorganization of a universal bacterial structure that is both broadly conserved among eubacteria (including pathogens) and an important target. PMID:22125496
Directory of Open Access Journals (Sweden)
Mohan Babu
2011-11-01
Full Text Available As the interface between a microbe and its environment, the bacterial cell envelope has broad biological and clinical significance. While numerous biosynthesis genes and pathways have been identified and studied in isolation, how these intersect functionally to ensure envelope integrity during adaptive responses to environmental challenge remains unclear. To this end, we performed high-density synthetic genetic screens to generate quantitative functional association maps encompassing virtually the entire cell envelope biosynthetic machinery of Escherichia coli under both auxotrophic (rich medium and prototrophic (minimal medium culture conditions. The differential patterns of genetic interactions detected among > 235,000 digenic mutant combinations tested reveal unexpected condition-specific functional crosstalk and genetic backup mechanisms that ensure stress-resistant envelope assembly and maintenance. These networks also provide insights into the global systems connectivity and dynamic functional reorganization of a universal bacterial structure that is both broadly conserved among eubacteria (including pathogens and an important target.
Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M
2016-07-01
The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Structure of a Pestivirus Envelope Glycoprotein E2 Clarifies Its Role in Cell Entry
Directory of Open Access Journals (Sweden)
Kamel El Omari
2013-01-01
Full Text Available Enveloped viruses have developed various adroit mechanisms to invade their host cells. This process requires one or more viral envelope glycoprotein to achieve cell attachment and membrane fusion. Members of the Flaviviridae such as flaviviruses possess only one envelope glycoprotein, E, whereas pestiviruses and hepacivirus encode two glycoproteins, E1 and E2. Although E2 is involved in cell attachment, it has been unclear which protein is responsible for membrane fusion. We report the crystal structures of the homodimeric glycoprotein E2 from the pestivirus bovine viral diarrhea virus 1 (BVDV1 at both neutral and low pH. Unexpectedly, BVDV1 E2 does not have a class II fusion protein fold, and at low pH the N-terminal domain is disordered, similarly to the intermediate postfusion state of E2 from sindbis virus, an alphavirus. Our results suggest that the pestivirus and possibly the hepacivirus fusion machinery are unlike any previously observed.
Structure of a Pestivirus Envelope Glycoprotein E2 Clarifies Its Role in Cell Entry
El Omari, Kamel; Iourin, Oleg; Harlos, Karl; Grimes, Jonathan M.; Stuart, David I.
2013-01-01
Summary Enveloped viruses have developed various adroit mechanisms to invade their host cells. This process requires one or more viral envelope glycoprotein to achieve cell attachment and membrane fusion. Members of the Flaviviridae such as flaviviruses possess only one envelope glycoprotein, E, whereas pestiviruses and hepacivirus encode two glycoproteins, E1 and E2. Although E2 is involved in cell attachment, it has been unclear which protein is responsible for membrane fusion. We report the crystal structures of the homodimeric glycoprotein E2 from the pestivirus bovine viral diarrhea virus 1 (BVDV1) at both neutral and low pH. Unexpectedly, BVDV1 E2 does not have a class II fusion protein fold, and at low pH the N-terminal domain is disordered, similarly to the intermediate postfusion state of E2 from sindbis virus, an alphavirus. Our results suggest that the pestivirus and possibly the hepacivirus fusion machinery are unlike any previously observed. PMID:23273918
Directory of Open Access Journals (Sweden)
María Inés Marchesini
Full Text Available Choloylglycine hydrolase (CGH, E.C. 3.5.1.24 is a conjugated bile salt hydrolase that catalyses the hydrolysis of the amide bond in conjugated bile acids. Bile salt hydrolases are expressed by gastrointestinal bacteria, and they presumably decrease the toxicity of host's conjugated bile salts. Brucella species are the causative agents of brucellosis, a disease affecting livestock and humans. CGH confers Brucella the ability to deconjugate and resist the antimicrobial action of bile salts, contributing to the establishment of a successful infection through the oral route in mice. Additionally, cgh-deletion mutant was also attenuated in intraperitoneally inoculated mice, which suggests that CGH may play a role during systemic infection other than hydrolyzing conjugated bile acids. To understand the role CGH plays in B. abortus virulence, we infected phagocytic and epithelial cells with a cgh-deletion mutant (Δcgh and found that it is defective in the internalization process. This defect along with the increased resistance of Δcgh to the antimicrobial action of polymyxin B, prompted an analysis of the cell envelope of this mutant. Two-dimensional electrophoretic profiles of Δcgh cell envelope-associated proteins showed an altered expression of Omp2b and different members of the Omp25/31 family. These results were confirmed by Western blot analysis with monoclonal antibodies. Altogether, the results indicate that Brucella CGH not only participates in deconjugation of bile salts but also affects overall membrane composition and host cell internalization.
Destructive effects of butyrate on the cell envelope of Helicobacter pylori.
Yonezawa, Hideo; Osaki, Takako; Hanawa, Tomoko; Kurata, Satoshi; Zaman, Cynthia; Woo, Timothy Derk Hoong; Takahashi, Motomichi; Matsubara, Sachie; Kawakami, Hayato; Ochiai, Kuniyasu; Kamiya, Shigeru
2012-04-01
Helicobacter pylori can be found in the oral cavity and is mostly detected by the use of PCR techniques. Growth of H. pylori is influenced by various factors in the mouth, such as the oral microflora, saliva and other antimicrobial substances, all of which make colonization of the oral cavity by H. pylori difficult. In the present study, we analysed the effect of the cell supernatant of a representative periodontal bacterium Porphyromonas gingivalis on H. pylori and found that the cell supernatant destroyed the H. pylori cell envelope. As P. gingivalis produces butyric acid, we focused our research on the effects of butyrate and found that it significantly inhibited the growth of H. pylori. H. pylori cytoplasmic proteins and DNA were detected in the extracellular environment after treatment with butyrate, suggesting that the integrity of the cell envelope was compromised and indicating that butyrate has a bactericidal effect on H. pylori. In addition, levels of extracellular H. pylori DNA increased following treatment with the cell supernatant of butyric acid-producing bacteria, indicating that the cell supernatant also has a bactericidal effect and that this may be due to its butyric acid content. In conclusion, butyric acid-producing bacteria may play a role in affecting H. pylori colonization of the oral cavity.
Nuclear envelope and genome interactions in cell fate
Talamas, Jessica A.; Capelson, Maya
2015-01-01
The eukaryotic cell nucleus houses an organism’s genome and is the location within the cell where all signaling induced and development-driven gene expression programs are ultimately specified. The genome is enclosed and separated from the cytoplasm by the nuclear envelope (NE), a double-lipid membrane bilayer, which contains a large variety of trans-membrane and associated protein complexes. In recent years, research regarding multiple aspects of the cell nucleus points to a highly dynamic and coordinated concert of efforts between chromatin and the NE in regulation of gene expression. Details of how this concert is orchestrated and how it directs cell differentiation and disease are coming to light at a rapid pace. Here we review existing and emerging concepts of how interactions between the genome and the NE may contribute to tissue specific gene expression programs to determine cell fate. PMID:25852741
GAGE cancer-germline antigens bind DNA and are recruited to the nuclear envelope by Germ cell-less
DEFF Research Database (Denmark)
Gjerstorff, Morten; Rösner, Heike; Pedersen, Christina Bøg
GAGE genes encode a highly similar, primate-specific protein family with unique primary structure and undefined roles in germ cells, various fetal cells and cancer cells. We report that GAGE proteins are intrinsically disordered proteins that provide novel interfaces between chromatin and the nuc......GAGE genes encode a highly similar, primate-specific protein family with unique primary structure and undefined roles in germ cells, various fetal cells and cancer cells. We report that GAGE proteins are intrinsically disordered proteins that provide novel interfaces between chromatin...... and the nuclear envelope. Structural analysis by NMR and CD spectroscopy showed GAGE proteins lack distinct secondary or tertiary structure and are therefore intrinsically disordered. In normal cells and cancer cells GAGE proteins localize predominantly in the nucleus; we found GAGE proteins formed stable......) at the nuclear envelope. Furthermore, exogenous and endogenous GAGE proteins were recruited to the nuclear envelope in GCL-overexpressing cells. Gene expression analysis and immunohistochemical staining suggest GAGE proteins and GCL interact physiologically in human cells that express both, including male germ...
Directory of Open Access Journals (Sweden)
Davide Vecchietti
Full Text Available We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedded in the cell envelope fragments. For a high number of proteins, our analysis strongly indicates either surface exposure or localization in an envelope district. The localization of most identified proteins was only predicted or totally unknown. This novel approach greatly improves the sensitivity and specificity of the previous methods, such as surface shaving with proteases that was also tested on P. aeruginosa. The magneto-capture procedure is simple, safe, and rapid, and appears to be well-suited for envelope studies in highly pathogenic bacteria.
Vecchietti, Davide; Di Silvestre, Dario; Miriani, Matteo; Bonomi, Francesco; Marengo, Mauro; Bragonzi, Alessandra; Cova, Lara; Franceschi, Eleonora; Mauri, Pierluigi; Bertoni, Giovanni
2012-01-01
We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT) for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedded in the cell envelope fragments. For a high number of proteins, our analysis strongly indicates either surface exposure or localization in an envelope district. The localization of most identified proteins was only predicted or totally unknown. This novel approach greatly improves the sensitivity and specificity of the previous methods, such as surface shaving with proteases that was also tested on P. aeruginosa. The magneto-capture procedure is simple, safe, and rapid, and appears to be well-suited for envelope studies in highly pathogenic bacteria. PMID:23226459
Unique Organization of the Nuclear Envelope in the Post-natal Quiescent Neural Stem Cells
Directory of Open Access Journals (Sweden)
Arantxa Cebrián-Silla
2017-07-01
Full Text Available Neural stem cells (B1 astrocytes; NSCs in the adult ventricular-subventricular-zone (V-SVZ originate in the embryo. Surprisingly, recent work has shown that B1 cells remain largely quiescent. They are reactivated postnatally to function as primary progenitors for neurons destined for the olfactory bulb and some corpus callosum oligodendrocytes. The cellular and molecular properties of quiescent B1 cells remain unknown. Here we found that a subpopulation of B1 cells has a unique nuclear envelope invagination specialization similar to envelope-limited chromatin sheets (ELCS, reported in certain lymphocytes and some cancer cells. Using molecular markers, [3H]thymidine birth-dating, and Ara-C, we found that B1 cells with ELCS correspond to quiescent NSCs. ELCS begin forming in embryonic radial glia cells and represent a specific nuclear compartment containing particular epigenetic modifications and telomeres. These results reveal a unique nuclear compartment in quiescent NSCs, which is useful for identifying these primary progenitors and study their gene regulation.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Mutations That Alter the Bacterial Cell Envelope Increase Lipid Production
Energy Technology Data Exchange (ETDEWEB)
Lemmer, Kimberly C.; Zhang, Weiping; Langer, Samantha J.; Dohnalkova, Alice; Hu, Dehong; Lemke, Rachelle A.; Piotrowski, Jeff S.; Orr, Galya; Noguera, Daniel R.; Donohue, Timothy J.
2017-05-23
Lipids from microbes offer a promising source of renewable alternatives to petroleum-derived compounds. In particular, oleaginous microbes are of interest because they accumulate a large fraction of their biomass as lipids. In this study, we analyzed genetic changes that alter lipid accumulation in
Radeck, Jara; Fritz, Georg; Mascher, Thorsten
2017-02-01
The cell envelope stress response (CESR) encompasses all regulatory events that enable a cell to protect the integrity of its envelope, an essential structure of any bacterial cell. The underlying signaling network is particularly well understood in the Gram-positive model organism Bacillus subtilis. It consists of a number of two-component systems (2CS) and extracytoplasmic function σ factors that together regulate the production of both specific resistance determinants and general mechanisms to protect the envelope against antimicrobial peptides targeting the biogenesis of the cell wall. Here, we summarize the current picture of the B. subtilis CESR network, from the initial identification of the corresponding signaling devices to unraveling their interdependence and the underlying regulatory hierarchy within the network. In the course of detailed mechanistic studies, a number of novel signaling features could be described for the 2CSs involved in mediating CESR. This includes a novel class of so-called intramembrane-sensing histidine kinases (IM-HKs), which-instead of acting as stress sensors themselves-are activated via interprotein signal transfer. Some of these IM-HKs are involved in sensing the flux of antibiotic resistance transporters, a unique mechanism of responding to extracellular antibiotic challenge.
A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells
International Nuclear Information System (INIS)
Mourez, Thomas; Mesel-Lemoine, Mariana; Combredet, Chantal; Najburg, Valerie; Cayet, Nadege; Tangy, Frederic
2011-01-01
We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimeric particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.
International Nuclear Information System (INIS)
Armstrong, S.K.
1986-01-01
Surface molecules of Bordetella pertussis which may be important in metabolism, pathogenesis, and immunity to whooping cough were examined using cell fractionation and 125 I cell surface labeling. Antigenic envelope proteins were examined by immunofluorescence microscopy and Western blotting procedures using monoclonal antibodies and convalescent sera. A surface protein with a high M/sub r/, missing in a mutant lacking the filamentous hemagglutinin, was identified in virulent Bordetella pertussis but was absent in virulent B. pertussis strains. At least three envelope proteins were found only in virulent B. pertussis strains and were absent or diminished in avirulent and most phenotypically modulated strains. Transposon-induced mutants unable to produce hemolysin, dermonecrotic toxin, pertussis toxin, and filamentous hemagglutinin also lacked these three envelope proteins, confirming that virulence-associated envelope proteins were genetically regulated with other virulence-associated traits. Two dimensional gel electrophoresis revealed at least five heat modifiable proteins which migrated as higher or lower M/sub r/ moieties if solubilized at 25 0 C instead of 100 0 C
The Role of the Nuclear Envelope Protein MAN1 in Mesenchymal Stem Cell Differentiation.
Bermeo, Sandra; Al-Saedi, Ahmed; Kassem, Moustapha; Vidal, Christopher; Duque, Gustavo
2017-12-01
Mutations in MAN1, a protein of the nuclear envelope, cause bone phenotypes characterized by hyperostosis. The mechanism of this pro-osteogenic phenotype remains unknown. We increased and decreased MAN1 expression in mesenchymal stem cells (MSC) upon which standard osteogenic and adipogenic differentiation were performed. MAN1 knockdown increased osteogenesis and mineralization. In contrast, osteogenesis remained stable upon MAN1 overexpression. Regarding a mechanism, we found that low levels of MAN1 facilitated the nuclear accumulation of regulatory smads and smads-related complexes, with a concurrently high expression of nuclear β-Catenin. In addition, we found adipogenesis to be decreased in both conditions, although predominantly affected by MAN1 overexpression. Finally, lamin A, a protein of the nuclear envelope that regulates MSC differentiation, was unaffected by changes in MAN1. In conclusion, our studies demonstrated that lower levels of MAN1 in differentiating MSC are associated with higher osteogenesis and lower adipogenesis. High levels of MAN1 only affected adipogenesis. These effects could have an important role in the understanding of the role of the proteins of the nuclear envelope in bone formation. J. Cell. Biochem. 118: 4425-4435, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Uratani, Y
1982-01-01
Pyocin R1, a bacteriocin of Pseudomonas aeruginosa, caused an increase in binding of fluorescent label, 1-dimethylaminonaphthalene-5-sulfonyl chloride (dansyl chloride), to sensitive cells. In pyocin R1-treated cells, cytoplasmic soluble proteins and crude ribosomes as well as cell envelopes were labeled by dansyl chloride. The amount of bound dye was proportional to the multiplicity of pyocin R1 and reached a maximal level at high multiplicity. In addition, pyocin R1 rapidly caused an increase in fluorescence intensity of the hydrophobic probes N-phenyl-1-naphthylamine, pyrene, and perylene, which were mixed with cells. These results show that pyocin R1 damages locally a cell envelope barrier to hydrophobic solutes and allows dyes to penetrate into the intracellular space across the barrier. PMID:6799489
International Nuclear Information System (INIS)
Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker
2004-01-01
The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier
Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe
2016-03-10
In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.
The Role of the Nuclear Envelope Protein MAN1 in Mesenchymal Stem Cell Differentiation
DEFF Research Database (Denmark)
Bermeo, Sandra; Al-Saedi, Ahmed; Kassem, Moustapha
2017-01-01
Mutations in MAN1, a protein of the nuclear envelope, cause bone phenotypes characterized by hyperostosis. The mechanism of this pro-osteogenic phenotype remains unknown. We increased and decreased MAN1 expression in mesenchymal stem cells (MSC) upon which standard osteogenic and adipogenic diffe...
Tucker, Trudy-Ann; Crow, Sidney A; Pierce, George E
2012-11-01
Rhodococcus is an important industrial microorganism that possesses diverse metabolic capabilities; it also has a cell envelope, composed of an outer layer of mycolic acids and glycolipids. Selected Rhodococcus species when induced are capable of transforming nitriles to the corresponding amide by the enzyme nitrile hydratase (NHase), and subsequently to the corresponding acid via an amidase. This nitrile biochemistry has generated interest in using the rhodococci as biocatalysts. It was hypothesized that altering sugars in the growth medium might impact cell envelope components and have effects on NHase. When the primary carbon source in growth media was changed from glucose to fructose, maltose, or maltodextrin, the NHase activity increased. Cells grown in the presence of maltose and maltodextrin showed the highest activities against propionitrile, 197 and 202 units/mg cdw, respectively. Stability of NHase was also affected as cells grown in the presence of maltose and maltodextrin retained more NHase activity at 55 °C (45 and 23 %, respectively) than cells grown in the presence of glucose or fructose (19 and 10 %, respectively). Supplementation of trehalose in the growth media resulted in increased NHase stability at 55 °C, as cells grown in the presence of glucose retained 40 % NHase activity as opposed to 19 % without the presence of trehalose. Changes in cell envelope components, such mycolic acids and glycolipids, were evaluated by high-performance liquid chromatography (HPLC) and thin-layer chromatography (TLC), respectively. Changing sugars and the addition of inducing components for NHase, such as cobalt and urea in growth media, resulted in changes in mycolic acid profiles. Mycolic acid content increased 5 times when cobalt and urea were added to media with glucose. Glycolipids levels were also affected by the changes in sugars and addition of inducing components. This research demonstrates that carbohydrate selection impacts NHase activity and
Yokoi, Fumiaki; Dang, Mai T; Yang, Guang; Li, Jindong; Doroodchi, Atbin; Zhou, Tong; Li, Yuqing
2012-02-01
Myoclonus-dystonia (M-D) is a movement disorder characterized by myoclonic jerks with dystonia. DYT11 M-D is caused by mutations in SGCE which codes for ɛ-sarcoglycan. SGCE is maternally imprinted and paternally expressed. Abnormal nuclear envelope has been reported in mouse models of DYT1 generalized torsion dystonia. However, it is not known whether similar alterations occur in DYT11 M-D. We developed a mouse model of DYT11 M-D using paternally inherited Sgce heterozygous knockout (Sgce KO) mice and reported that they had myoclonus and motor coordination and learning deficits in the beam-walking test. However, the specific brain regions that contribute to these phenotypes have not been identified. Since ɛ-sarcoglycan is highly expressed in the cerebellar Purkinje cells, here we examined the nuclear envelope in these cells using a transmission electron microscope and found that they are abnormal in Sgce KO mice. Our results put DYT11 M-D in a growing family of nuclear envelopathies. To analyze the effect of loss of ɛ-sarcoglycan function in the cerebellar Purkinje cells, we produced paternally inherited cerebellar Purkinje cell-specific Sgce conditional knockout (Sgce pKO) mice. Sgce pKO mice showed motor learning deficits, while they did not show abnormal nuclear envelope in the cerebellar Purkinje cells, robust motor deficits, or myoclonus. The results suggest that ɛ-sarcoglycan in the cerebellar Purkinje cells contributes to the motor learning, while loss of ɛ-sarcoglycan in other brain regions may contribute to nuclear envelope abnormality, myoclonus and motor coordination deficits. Copyright © 2011 Elsevier B.V. All rights reserved.
Baffet, Alexandre D.; Hu, Daniel J.; Vallee, Richard B.
2015-01-01
Summary Dynein recruitment to the nuclear envelope is required for pre-mitotic nucleus-centrosome interactions in nonneuronal cells, and for apical nuclear migration in neural stem cells. In each case, dynein is recruited to the nuclear envelope (NE) specifically during G2, via two nuclear pore-mediated mechanisms involving RanBP2-BicD2 and Nup133-CENP-F. The mechanisms responsible for cell cycle control of this behavior are unknown. We now find that Cdk1 serves as a direct master controller for NE dynein recruitment in neural stem cells and HeLa cells. Cdk1 phosphorylates conserved sites within RanBP2 and activates BicD2 binding and early dynein recruitment. Late recruitment is triggered by a Cdk1-induced export of CENP-F from the nucleus. Forced NE targeting of BicD2 overrides Cdk1 inhibition, fully rescuing dynein recruitment and nuclear migration in neural stem cells. These results reveal how NE dynein recruitment is cell cycle regulated, and identify the trigger mechanism for apical nuclear migration in the brain. PMID:26051540
The nuclear envelope from basic biology to therapy.
Worman, Howard J; Foisner, Roland
2010-02-01
The nuclear envelope has long been a focus of basic research for a highly specialized group of cell biologists. More recently, an expanding group of scientists and physicians have developed a keen interest in the nuclear envelope since mutations in the genes encoding lamins and associated proteins have been shown to cause a diverse range of human diseases often called laminopathies or nuclear envelopathies. Most of these diseases have tissue-selective phenotypes, suggesting that the nuclear envelope must function in cell-type- and developmental-stage-specific processes such as chromatin organization, regulation of gene expression, controlled nucleocytoplasmic transport and response to stress in metazoans. On 22-23 April 2009, Professor Christopher Hutchison organized the 4th British Nuclear Envelope Disease and Chromatin Organization meeting at the College of St Hild and St Bede at Durham University, sponsored by the Biochemical Society. In attendance were investigators with one common interest, the nuclear envelope, but with diverse expertise and training in animal and plant cell biology, genetics, developmental biology and medicine. We were each honoured to be keynote speakers. This issue of Biochemical Society Transactions contains papers written by some of the presenters at this scientifically exciting meeting, held in a bucolic setting where the food was tasty and the wine flowed freely. Perhaps at the end of this excellent meeting more questions were raised than answered, which will stimulate future research. However, what became clear is that the nuclear envelope is a cellular structure with critical functions in addition to its traditional role as a barrier separating the nuclear and cytoplasmic compartments in interphase eukaryotic cells.
Huffmeier, U.; Bergboer, J.G.M.; Becker, T.; Armour, J.A.; Traupe, H.; Estivill, X.; Riveira-Munoz, E.; Mossner, R.; Reich, K.; Kurrat, W.; Wienker, T.F.; Schalkwijk, J.; Zeeuwen, P.L.J.M.; Reis, A.
2010-01-01
Recently, a deletion of two late cornified envelope (LCE) genes within the epidermal differentiation complex on chromosome 1 was shown to be overrepresented in 1,426 psoriasis vulgaris (PsV) patients of European ancestry. In this study, we report a confirmation of this finding in 1,354 PsV patients
Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells
Institute of Scientific and Technical Information of China (English)
Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang
2004-01-01
AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.
DEFF Research Database (Denmark)
Andersen, Ove; Sørensen, A M; Svehag, S E
1991-01-01
The highly glycosylated envelope glycoprotein (gp 160) of human immunodeficiency virus (HIV) interacts with the CD4 molecule present on the membrane of CD4+ cells and is involved in the pathobiology of HIV infection. Lectins bind glycoproteins through non-covalent interactions with specific hexose...... residues. The mammalian C-type lectin bovine conglutinin was examined for its ability to interact with recombinant gp160 (rgp160) produced in vaccinia virus-infected BHK21 cells. Specific binding of conglutinin to rgp160 was demonstrated by ELISA. The interaction of bovine conglutinin with rgp160...... of the binding of rgp160 to the CD4 receptor on CEM 13 cells, as demonstrated by FACS analyses. These results indicate that conglutinin may inhibit the infection with HIV-1 through its interaction with the viral envelope glycoprotein....
Dietzel, Erik; Anderson, Danielle E; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea
2011-07-01
In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis of the closely related canine distemper virus (CDV) has not been characterized. To this end this, we generated a recombinant wild-type CDV carrying a vaccine strain M protein. The recombinant virus retained the parental growth phenotype in VerodogSLAMtag cells, but displayed an increased particle-to-infectivity ratio very similar to that of the vaccine strain, likely due to inefficient H protein incorporation. Even though infectious virus was released only from the apical surface, consistent with the release polarity of the wild-type CDV strain, envelope protein distribution in polarized epithelial cells reproduced the bipolar pattern seen in vaccine strain-infected cells. Most notably, the chimeric virus was completely attenuated in ferrets and caused only a mild and transient leukopenia, indicating that the differences in particle infectivity and envelope protein sorting mediated by the vaccine M protein contribute importantly to vaccine strain attenuation.
Envelope proteins of bovine herpesvirus 1: immunological and biochemical studies
International Nuclear Information System (INIS)
Rodriguez Roque, L.L.
1986-01-01
The authors studied immunological and biochemical properties of the bovid herpesvirus 1 (BHV-1) envelope proteins in order to understand the pathogenesis of BHV-1 infection and to provide basic information for the production of effective subunit vaccines against BHV-1. Ten glycoproteins MW 180, 150, 130, 115, 97, 77, 74, 64, 55, and 45 kilodaltons (K), and a single non-glycosylated 108 K protein were quantitatively removed from purified BHV-1 virions by detergent treatment. These glycoproteins were present on the virion envelope and on the surface of BHV-1 infected cells. The quantitative removal from virions by treatment with nonionic detergents and their presence on the surface of infected cells indicate that 180/97, 150/77, and 130/74/55 K are major components of the BHV-1 envelope and are also the targets of virus neutralizing humoral immune response. Envelope glycoproteins of herpes simplex type 1 (HSV-1) bind immunoglobulin by the Fc end and it is suggested this may increase pathogenicity of this virus. They searched for a similar function in BVH-1 by measuring the ability of BHV-1 infected cells and viral envelope proteins to bind radiolabelled rabbit and bovine IgG. Binding activity for rabbit IgG or bovine IgG-Fc could not be demonstrated by BHV-1 infected MDBK cells, whereas, MDBK cells infected with HSV-1 bound rabbit IgG and bovine IgG-Fc. None of the three major envelope proteins of BHV-1 bound to rabbit or bovine IgG. The results of this study indicate that BHV-1, unlike some other herpesviruses, lack Fc binding activity
Directory of Open Access Journals (Sweden)
Archana Gautam
Full Text Available The HIV-1 Vpu is required for efficient virus particle release from the plasma membrane and intracellular CD4 degradation in infected cells. In the present study, we found that the loss of virus infectivity as a result of envelope (Env incorporation defect caused by a Gag matrix (MA mutation (L30E was significantly alleviated by introducing a start codon mutation in vpu. Inactivation of Vpu partially restored the Env incorporation defect imposed by L30E substitution in MA. This effect was found to be comparable in cell types such as 293T, HeLa, NP2 and GHOST as well as in peripheral blood mononuclear cells (PBMC and monocyte-derived macrophages (MDM. However, in HeLa cells BST-2 knockdown was found to further alleviate the effect of Vpu inactivation on infectivity of L30E mutant. Our data demonstrated that the impaired infectivity of virus particles due to Env incorporation defect caused by MA mutation was modulated by start codon mutation in Vpu.
International Nuclear Information System (INIS)
Murphy, C.I.; Lennick, M.; Lehar, S.M.; Beltz, G.A.; Young, E.
1990-01-01
Three different human immunodeficiency virus type I (HIV-1) envelope derived recombinant proteins and the full length human CD4 polypeptide were expressed in Spodoptera frugiperda (Sf9) cells. DNA constructs encoding CD4, gp120, gp160, and gp160 delta were cloned into the baculovirus expression vector pVL941 or a derivative and used to generate recombinant viruses in a cotransfection with DNA from Autographa californica nuclear polyhedrosis virus (AcMNPV). Western blotting of cell extracts of the recombinant HIV-1 proteins showed that for each construct two major bands specifically reacted with anti-HIV-1 envelope antiserum. These bands corresponded to glycosylated and nonglycosylated versions of the HIV proteins as determined by 3H-mannose labeling and tunicamycin treatment of infected cells. A time course of HIV envelope expression revealed that at early times post-infection (24 hours) the proteins were fully glycosylated and soluble in nonionic detergents. However, at later times postinfection (48 hours), expression levels of recombinant protein reached a maximum but most of the increase was due to a rise in the level of the nonglycosylated species, which was largely insoluble in nonionic detergents. Thus, it appears that Sf9 cells cannot process large amounts of glycosylated recombinant proteins efficiently. As a measure of biological activity, the CD4 binding ability of both glycosylated and nonglycosylated recombinant HIV envelope proteins was tested in a coimmunoprecipitation assay. The results showed that CD4 and the glycosylated versions of recombinant gp120 or gp160 delta specifically associated with one another in this analysis. Nonglycosylated gp120 or gp160 delta proteins from tunicamycin-treated cultures did immunoprecipitate with anti-HIV-1 antiserum but did not interact with CD4
Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A
2013-01-01
Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Rusche, J.R.; Lynn, D.L.; Robert-Guroff, M.; Langlois, A.J.; Lyerly, H.K.; Carson, H.; Krohn, K.; Ranki, A.; Gallo, R.C.; Bolognesi, D.P.; Putney, S.D.
1987-10-01
The human immunodeficiency virus envelope gene was expressed in insect cells by using a Baculovirus expression vector. The protein has an apparent molecular mass of 160 kDa, appears on the surface of infected insect cells, and does not appear to be cleaved to glycoproteins gp120 and gp41. Goats immunized with the 160-kDa protein have high titers of antibody that neutralizes virus infection as measured by viral gene expression or cell cytolysis. In addition, immune sera can block fusion of human immunodeficiency virus-infected cells in culture. Both neutralization and fusion-blocking activities are bound to and eluted from immobilized gp120.
International Nuclear Information System (INIS)
Rusche, J.R.; Lynn, D.L.; Robert-Guroff, M.
1987-01-01
The human immunodeficiency virus envelope gene was expressed in insect cells by using a Baculovirus expression vector. The protein has an apparent molecular mass of 160 kDa, appears on the surface of infected insect cells, and does not appear to be cleaved to glycoproteins gp120 and gp41. Goats immunized with the 160-kDa protein have high titers of antibody that neutralizes virus infection as measured by viral gene expression or cell cytolysis. In addition, immune sera can block fusion of human immunodeficiency virus-infected cells in culture. Both neutralization and fusion-blocking activities are bound to and eluted from immobilized gp120
Kishida, T; Cui, F-D; Ohgitani, E; Gao, F; Hayakawa, K; Mazda, O
2013-08-01
Some viruses are sensitive to high pressure. The freeze-pressure generation method (FPGM) applies pressure as high as 250 MPa on a substance, simply by freezing a pressure-resistant reservoir in which the substance is immersed in water. Here we examined whether the FPGM successfully inactivates herpes simplex virus type 1 (HSV-1), an enveloped DNA virus belonging to the human Herpesviridae, and encephalomyocarditis virus (EMCV), an envelope-free RNA virus belonging to the Picornaviridae. After the treatment, HSV-1 drastically reduced the ability to form plaque in Vero cells in vitro as well as to kill mice in vivo. EMCV that had been pressurized failed to proliferate in HeLa cells and induce interferon response. The results suggest that the FPGM provides a feasible procedure to inactivate a broad spectrum of viruses.
Vecchietti, Davide; Di Silvestre, Dario; Miriani, Matteo; Bonomi, Francesco; Marengo, Mauro; Bragonzi, Alessandra; Cova, Lara; Franceschi, Eleonora; Mauri, Pierluigi; Bertoni, Giovanni
2012-01-01
We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT) for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedde...
Richter, Maria; Reimann, Ilona; Schirrmeier, Horst; Kirkland, Peter D; Beer, Martin
2014-10-01
Bungowannah virus is the most divergent pestivirus, and both origin and reservoir host have not been identified so far. We therefore performed in vitro tropism studies, which showed that Bungowannah virus differs remarkably from other pestiviruses. Interestingly, cell lines of vervet monkey, mouse, human and even of bat origin were susceptible. This broad in vitro tropism was not observed for a chimeric bovine viral diarrhoea virus (BVDV) expressing all structural proteins of Bungowannah virus. The viral envelope was not sufficient to completely transfer the cell tropism of Bungowannah virus to another pestivirus, and viral RNA replication was either markedly reduced or not detectable in a number of different cell lines for the tested BVDV strain and the chimera. We therefore suggest that the replication machinery together with the viral envelope is responsible for the unique broad cell tropism of Bungowannah virus. © 2014 The Authors.
International Nuclear Information System (INIS)
Saha, Kunal; Yan Hui; Nelson, Julie A.E.; Zerhouni-Layachi, Bouchra
2005-01-01
Truncation of the envelope cytoplasmic tail has enabled FIV, SIV, and some laboratory HIV-1 strains to acquire broader cellular tropism and enhanced fusogenicity. Here we have characterized a primary CD4-independent HIV-1 isolate (92UG046-T8) with a truncated cytoplasmic tail that was able to infect and induce syncytia in primary lymphocytes from human, chimpanzee, and monkey, as well as CD4-negative cell lines from human and monkey. Increased syncytia were also noticeable with 293 cells expressing the cloned envelope from the 92UG046-T8 isolate suggesting envelope-mediated cellular fusion. Except pooled serum from HIV-1-infected individuals, monoclonal anti-envelope antibodies or antibodies/antagonists against CD4, CXCR4, and CCR5 were not able to prevent infection by the 92UG046-T8 isolate. This is the first report showing a primary HIV-1 variant with truncated cytoplasmic tail which is highly fusogenic and can infect a broad range of cells from human and non-human origins. In vivo evolution of similar HIV-1 mutants may have important implications in AIDS pathogenesis
International Nuclear Information System (INIS)
Buckner, Clarisa; Gines, Leoned G.; Saunders, Cheryl J.; Vojtech, Lucia; Srivastava, Indresh; Gettie, Agegnehu; Bohm, Rudolph; Blanchard, James; Barnett, Susan W.; Safrit, Jeffrey T.; Stamatatos, Leonidas
2004-01-01
The potential of vaccine-elicited anti-HIV envelope antibodies to control HIV-infection was evaluated by immunizing macaques with the HIV envelope protein and transiently depleting them of their CD8+ cells before intravenous challenge with the pathogenic CCR5-tropic SIV/HIV chimeric virus, SHIV SF162P4 . Although sterilizing immunity was not achieved, all vaccinated animals effectively controlled infection and remained free of disease for the duration of observation (over 3 years). In contrast, during the same period, the control animals progressed to disease. Both the vaccinees and the controls developed robust cell-mediated antiviral and neutralizing antibody responses following infection. A comparative analysis of these responses suggests that the more effective long-term control of infection by the vaccinated animals is due to the more rapid development of anti-HIV envelope antibodies. These studies suggest that priming by vaccination of B cell anti-HIV envelope responses maybe crucial for the long-term control of HIV infection
Origin of envelope proteins of a leukemia virus
International Nuclear Information System (INIS)
Schneider, R.P.
1975-01-01
The roles of avian myeloblastosis virus (AMV) and host myeloblast cells in controlling the protein composition of virus envelope and host cell membrane are being studied by examining an ATPase enzyme in the virus and cells. New culture techniques for virus producing myeloblasts have been developed. (U.S.)
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Biliary Secretion of Quasi-Enveloped Human Hepatitis A Virus.
Hirai-Yuki, Asuka; Hensley, Lucinda; Whitmire, Jason K; Lemon, Stanley M
2016-12-06
Hepatitis A virus (HAV) is an unusual picornavirus that is released from cells cloaked in host-derived membranes. These quasi-enveloped virions (eHAV) are the only particle type circulating in blood during infection, whereas only nonenveloped virions are shed in feces. The reason for this is uncertain. Hepatocytes, the only cell type known to support HAV replication in vivo, are highly polarized epithelial cells with basolateral membranes facing onto hepatic (blood) sinusoids and apical membranes abutting biliary canaliculi from which bile is secreted to the gut. To assess whether eHAV and nonenveloped virus egress from cells via vectorially distinct pathways, we studied infected polarized cultures of Caco-2 and HepG2-N6 cells. Most (>99%) progeny virions were released apically from Caco-2 cells, whereas basolateral (64%) versus apical (36%) release was more balanced with HepG2-N6 cells. Both apically and basolaterally released virions were predominantly enveloped, with no suggestion of differential vectorial release of eHAV versus naked virions. Basolateral to apical transcytosis of either particle type was minimal (work reveals that it has an unusual life cycle. Virus is found in cell culture supernatant fluids in two mature, infectious forms: one wrapped in membranes (quasi-enveloped) and another that is nonenveloped. Membrane-wrapped virions circulate in blood during acute infection and are resistant to neutralizing antibodies, likely facilitating HAV dissemination within the liver. On the other hand, virus shed in feces is nonenveloped and highly stable, facilitating epidemic spread and transmission to naive hosts. Factors controlling the biogenesis of these two distinct forms of the virus in infected humans are not understood. Here we characterize vectorial release of quasi-enveloped virions from polarized epithelial cell cultures and provide evidence that bile acids strip membranes from eHAV following its secretion into the biliary tract. These results
International Nuclear Information System (INIS)
Nack, Ursula; Schnierle, Barbara S.
2003-01-01
Murine leukemia virus (MLV) capsid particles can be efficiently pseudotyped with a variant of the HIV-1 envelope protein (Env) containing the surface glycoprotein gp120-SU and a carboxyl-terminally truncated transmembrane (TM) protein, with only seven cytoplasmic amino acids. MLV/HIV pseudotyped vector particles acquire the natural host tropism of HIV-1 and their entry is dependent on the presence of CD4 and an appropriate co-receptor on the surface of the target cell. We describe here the construction of chimeric MLV/HIV proviruses containing the truncated HIV envelope gene. The MLV/HIV provirus was generated by direct replacement of the MLV envelope gene with HIV Env coding sequences either with or without the additional inclusion of the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). Chimeric MLV/HIV particles could be generated from transfected 293T cells and were able to infect CD4/CXCR4-positive target cells. However, the second round of infection of target cells was severely impaired, despite the fact that the WPRE element enhanced the amount of viral mRNA detected. Viral particles released from infected cells showed reduced HIV Env incorporation, indicating that additional factors required for efficient replication of MLV/HIV pseudotyped viruses are missing
Role of HIV-2 envelope in Lv2-mediated restriction
International Nuclear Information System (INIS)
Reuter, Sandra; Kaumanns, Patrick; Buschhorn, Sabine B.; Dittmar, Matthias T.
2005-01-01
We have characterized envelope protein pseudotyped HIV-2 particles derived from two HIV-2 isolates termed prCBL23 and CBL23 in order to define the role of the envelope protein for the Lv2-mediated restriction to infection. Previously, it has been described that the primary isolate prCBL23 is restricted to infection of several human cell types, whereas the T cell line adapted isolate CBL23 is not restricted in these cell types. Molecular cloning of the two isolates revealed that the env and the gag gene are responsible for the observed phenotype and that this restriction is mediated by Lv2, which is distinct from Ref1/Lv1 (Schmitz, C., Marchant, D., Neil, S.J., Aubin, K., Reuter, S., Dittmar, M.T., McKnight, A., Kizhatil, K., Albritton, L.M., 2004. Lv2, a novel postentry restriction, is mediated by both capsid and envelope. J. Virol. 78 (4), 2006-2016). We generated pseudotyped viruses consisting of HIV-2 (ROD-AΔenv-GFP, ROD-AΔenv-RFP, or ROD-AΔenv-REN) and the prCBL23 or CBL23 envelope proteins as well as chimeric proteins between these envelopes. We demonstrate that a single amino acid exchange at position 74 in the surface unit of CBL23-Env confers restriction to infection. This single point mutation causes tighter CD4 binding, resulting in a less efficient fusion into the cytosol of the restricted cell line. Prevention of endosome formation and prevention of endosome acidification enhance infectivity of the restricted particles for GHOST/X4 cells indicating a degradative lysosomal pathway as a cause for the reduced cytosolic entry. The described restriction to infection of the primary isolate prCBL23 is therefore largely caused by an entry defect. A remaining restriction to infection (19-fold) is preserved when endosomal acidification is prevented. This restriction to infection is also dependent on the presence of the point mutation at position 74 (G74E)
International Nuclear Information System (INIS)
Anton, D.N.
1979-01-01
Strain SB564 and its derivative DA78 are hypersensitive to the inhibitory action of the proteins coded for by genes hisF and hisH on cell division. Transduction of hisO1242, a regulatory mutation that elicits a very high level of expression of the histidine operon, into these strains resulted in the production of long filamentous cells carrying large balloons and in growth failure. Forty-one hisO1242 derivatives that escaped inhibition were isolated. These strains showed a large variety of alterations, many of which were related to the cell envelope. The more-frequent alterations included: changes in cell shape, increased sensitivity to one or more of several drugs (deoxycholate, cycloserine, penicillin, novobiocin, acridine orange), increased autolytic activity in alkaline buffer, anomalous fermentation of maltose on eosin--methylene blue plates, and temperature-conditional cell division. The alterations are produced, in some of the strains, by pleiotropic mutations in gene envB. Strains affected in divC, divD, and rodA loci have also been identified. Genetic analaysis has shown that several strains carry more than one envelope mutation. It is assumed that envelope mutations are positively selected because they somehow alleviate the particularly severe inhibition of cell division caused, in strains SB564 and DA78, by the excessive synthesis of hisF and hisH gene products
International Nuclear Information System (INIS)
Shim, Won-Bo; Je, Gil-Soo; Kim, Kyeongyeol; Mtenga, Adelard B.; Lee, Won-Gyeong; Song, Jeong-Un; Chung, Duck-Hwa; Yoon, Yohan
2012-01-01
This study evaluated effect of gamma irradiation on survival of Salmonella Typhimurium and Staphylococcus aureus on lettuce and damage of cell envelope. S. Typhimurium and S. aureus were inoculated on red leaf lettuce, and they were irradiated at 0, 0.5, 1, 1.5, 2, 2.5, and 3 kGy, and the samples were then stored at 7 and 25 °C for 7 days. Survival of S. Typhimurium and S. aureus were enumerated on xylose lysine deoxycholate agar and Baird–Parker agar, respectively. D 10 value (dose required to reduce 1 log CFU/leaf) was calculated, and kinetic parameters (maximum specific growth rate; μ max and lag phase duration; LPD) were calculated by the modified Gompertz model. In addition, cell envelope damage of the pathogens was observed by scanning electron microscope (SEM) and transmission electron microscope (TEM). D 10 values were 0.35 and 0.33 kGy for S. Typhimurium and S. aureus, respectively. During storage at 7 °C, S. Typhimurium and S. aureus had significant (P max , respectively. At 25 °C, cell counts of S. Typhimurium and S. aureus on the samples irradiated at 0 and 0.5 kGy increased (P max of both pathogens were higher in 0 kGy (1.08–2.27 log CFU/leaf/day) and 0.5 kGy (0.58–0.92 log CFU/leaf/day), and LPDs ranged from 1.53 to 3.14 day. SEM and TEM observations showed that cells irradiated at 1.5 and 3 kGy showed disrupted cell membrane. These results indicate that gamma irradiation could be a useful decontamination technology to improve food safety of lettuce by destroying cells of S. Typhimurium and S. aureus. - Highlights: ► Low dose of gamma irradiation destroyed cell envelope of the pathogens. ► Gamma irradiation decreased cell counts of the pathogens on lettuce. ► Gamma irradiation could be useful in improving food safety of lettuce.
From the Outside-In: the Francisella tularensis Envelope and Virulence
Directory of Open Access Journals (Sweden)
Hannah M. Rowe
2015-12-01
Full Text Available Francisella tularensis is a highly-infectious bacterium that causes the rapid, and often lethal disease, tularemia. Many studies have been performed to identify and characterize the virulence factors that F. tularensis uses to infect a wide variety of hosts and host cell types, evade immune defenses, and induce severe disease and death. This review focuses on the virulence factors that are present in the F. tularensis envelope, including capsule, LPS, outer membrane, periplasm, inner membrane, secretion systems, and various molecules in each of aforementioned sub-compartments. Whereas no single bacterial molecule or molecular complex single-handedly controls F. tularensis virulence, we review here how diverse bacterial systems work in conjunction to subvert the immune system, attach to and invade host cells, alter phagosome/lysosome maturation pathways, replicate in host cells without being detected, inhibit apoptosis, and induce host cell death for bacterial release and infection of adjacent cells. Given that the F. tularensis envelope is the outermost layer of the bacterium, we highlight herein how many of these molecules directly interact with the host to promote infection and disease. These and future envelope studies are important to advance our collective understanding of F. tularensis virulence mechanisms and offer targets for future vaccine development efforts.
Enveloping Aerodynamic Decelerator
Nock, Kerry T. (Inventor); Aaron, Kim M. (Inventor); McRonald, Angus D. (Inventor); Gates, Kristin L. (Inventor)
2018-01-01
An inflatable aerodynamic deceleration method and system is provided for use with an atmospheric entry payload. The inflatable aerodynamic decelerator includes an inflatable envelope and an inflatant, wherein the inflatant is configured to fill the inflatable envelope to an inflated state such that the inflatable envelope surrounds the atmospheric entry payload, causing aerodynamic forces to decelerate the atmospheric entry payload.
International Nuclear Information System (INIS)
Yue, Xiao-shan; Fujishiro, Masako; Toyoda, Masashi; Akaike, Toshihiro; Ito, Yoshihiro
2010-01-01
In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells were tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.
Energy Technology Data Exchange (ETDEWEB)
Yue, Xiao-shan [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan); Fujishiro, Masako [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Toyoda, Masashi [Department of Reproductive Biology, National Institute for Child Health and Development, 2-10-1, Okura, Setagaya-ku, Tokyo 157-8535 (Japan); Akaike, Toshihiro [Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan); Ito, Yoshihiro, E-mail: y-ito@riken.jp [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan)
2010-04-16
In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells were tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.
(Quasi-)Poisson enveloping algebras
Yang, Yan-Hong; Yao, Yuan; Ye, Yu
2010-01-01
We introduce the quasi-Poisson enveloping algebra and Poisson enveloping algebra for a non-commutative Poisson algebra. We prove that for a non-commutative Poisson algebra, the category of quasi-Poisson modules is equivalent to the category of left modules over its quasi-Poisson enveloping algebra, and the category of Poisson modules is equivalent to the category of left modules over its Poisson enveloping algebra.
Arnold, Kelly B; Burgener, Adam; Birse, Kenzie; Romas, Laura; Dunphy, Laura J; Shahabi, Kamnoosh; Abou, Max; Westmacott, Garrett R; McCorrister, Stuart; Kwatampora, Jessie; Nyanga, Billy; Kimani, Joshua; Masson, Lindi; Liebenberg, Lenine J; Abdool Karim, Salim S; Passmore, Jo-Ann S; Lauffenburger, Douglas A; Kaul, Rupert; McKinnon, Lyle R
2016-01-01
Elevated inflammatory cytokines (EMCs) at mucosal surfaces have been associated with HIV susceptibility, but the underlying mechanisms remain unclear. We characterized the soluble mucosal proteome associated with elevated cytokine expression in the female reproductive tract. A scoring system was devised based on the elevation (upper quartile) of at least three of seven inflammatory cytokines in cervicovaginal lavage. Using this score, HIV-uninfected Kenyan women were classified as either having EMC (n=28) or not (n=68). Of 455 proteins quantified in proteomic analyses, 53 were associated with EMC (5% false discovery rate threshold). EMCs were associated with proteases, cell motility, and actin cytoskeletal pathways, whereas protease inhibitor, epidermal cell differentiation, and cornified envelope pathways were decreased. Multivariate analysis identified an optimal signature of 16 proteins that distinguished the EMC group with 88% accuracy. Three proteins in this signature were neutrophil-associated proteases that correlated with many cytokines, especially GM-CSF (granulocyte-macrophage colony-stimulating factor), IL-1β (interleukin-1β), MIP-3α (macrophage inflammatory protein-3α), IL-17, and IL-8. Gene set enrichment analyses implicated activated immune cells; we verified experimentally that EMC women had an increased frequency of endocervical CD4(+) T cells. These data reveal strong linkages between mucosal cytokines, barrier function, proteases, and immune cell movement, and propose these as potential mechanisms that increase risk of HIV acquisition.
Role of the nuclear envelope in the pathogenesis of age-related bone loss and osteoporosis
Vidal, Christopher; Bermeo, Sandra; Fatkin, Diane; Duque, Gustavo
2012-01-01
The nuclear envelope is the most important border in the eukaryotic cell. The role of the nuclear envelope in cell differentiation and function is determined by a constant interaction between the elements of the nuclear envelope and the transcriptional regulators involved in signal transcription pathways. Among those components of the nuclear envelope, there is a growing evidence that changes in the expression of A-type lamins, which are essential components of the nuclear lamina, are associated with age-related changes in bone affecting the capacity of differentiation of mesenchymal stem cells into osteoblasts, favoring adipogenesis and affecting the function and survival of the osteocytes. Overall, as A-type lamins are considered as the 'guardians of the soma', these proteins are also essential for the integrity and quality of the bone and pivotal for the longevity of the musculoskeletal system. PMID:23951459
Staiano-Coico, L; Steinberg, M; Higgins, P J
1990-10-15
Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.
Directory of Open Access Journals (Sweden)
Ammar Achour
2007-11-01
Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.
DEFF Research Database (Denmark)
Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis
2013-01-01
antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...
Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan
2016-01-01
Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Results Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. Conclusion These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation. PMID:27489424
Differentiation of human scalp hair follicle keratinocytes in culture.
Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J
1984-01-01
The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.
International Nuclear Information System (INIS)
Mannioui, Abdelkrim; Schiffer, Cecile; Felix, Nathalie
2004-01-01
We examined the influence of mitosis on the kinetics of human immunodeficiency virus type 1 integration in T cells. Single-round infection of cells arrested in G1b or allowed to synchronously proceed through division showed that mitosis delays virus integration until 18-24 h postinfection, whereas integration reaches maximum levels by 15 h in G1b-arrested cells. Subcellular fractionation of metaphase-arrested cells indicated that, while nuclear envelope disassembly facilitates docking of viral DNA to chromatin, chromosome condensation directly antagonizes and therefore delays integration. As a result of the balance between the two effects, virus integration efficiency is eventually up to threefold greater in dividing cells. At the single-cell level, using a green fluorescent protein-expressing reporter virus, we found that passage through mitosis leads to prominent asymmetric segregation of the viral genome in daughter cells without interfering with provirus expression
Functional incorporation of green fluorescent protein into hepatitis B virus envelope particles
International Nuclear Information System (INIS)
Lambert, Carsten; Thome, Nicole; Kluck, Christoph J.; Prange, Reinhild
2004-01-01
The envelope of hepatitis B virus (HBV), containing the L, M, and S proteins, is essential for virus entry and maturation. For direct visualization of HBV, we determined whether envelope assembly could accommodate the green fluorescent protein (GFP). While the C-terminal addition of GFP to S trans-dominant negatively inhibited empty envelope particle secretion, the N-terminal GFP fusion to S (GFP.S) was co-integrated into the envelope, giving rise to fluorescent particles. Microscopy and topogenesis analyses demonstrated that the proper intracellular distribution and folding of GFP.S, required for particle export were rescued by interprotein interactions with wild-type S. Thereby, a dual location of GFP, inside and outside the envelope, was observed. GFP.S was also efficiently packaged into the viral envelope, and these GFP-tagged virions retained the capacity for attachment to HBV receptor-positive cells in vitro. Together, GFP-tagged virions should be suitable to monitor HBV uptake and egress in live hepatocytes
Biliary Secretion of Quasi-Enveloped Human Hepatitis A Virus
Directory of Open Access Journals (Sweden)
Asuka Hirai-Yuki
2016-12-01
Full Text Available Hepatitis A virus (HAV is an unusual picornavirus that is released from cells cloaked in host-derived membranes. These quasi-enveloped virions (eHAV are the only particle type circulating in blood during infection, whereas only nonenveloped virions are shed in feces. The reason for this is uncertain. Hepatocytes, the only cell type known to support HAV replication in vivo, are highly polarized epithelial cells with basolateral membranes facing onto hepatic (blood sinusoids and apical membranes abutting biliary canaliculi from which bile is secreted to the gut. To assess whether eHAV and nonenveloped virus egress from cells via vectorially distinct pathways, we studied infected polarized cultures of Caco-2 and HepG2-N6 cells. Most (>99% progeny virions were released apically from Caco-2 cells, whereas basolateral (64% versus apical (36% release was more balanced with HepG2-N6 cells. Both apically and basolaterally released virions were predominantly enveloped, with no suggestion of differential vectorial release of eHAV versus naked virions. Basolateral to apical transcytosis of either particle type was minimal (<0.02%/h in HepG2-N6 cells, arguing against this as a mechanism for differences in membrane envelopment of serum versus fecal virus. High concentrations of human bile acids converted eHAV to nonenveloped virions, whereas virus present in bile from HAV-infected Ifnar1−/−Ifngr1−/− and Mavs−/− mice banded over a range of densities extending from that of eHAV to that of nonenveloped virions. We conclude that nonenveloped virions shed in feces are derived from eHAV released across the canalicular membrane and stripped of membranes by the detergent action of bile acids within the proximal biliary canaliculus.
Role of the Phosphatidylserine Receptor TIM-1 in Enveloped-Virus Entry
Moller-Tank, Sven; Kondratowicz, Andrew S.; Davey, Robert A.; Rennert, Paul D.
2013-01-01
The cell surface receptor T cell immunoglobulin mucin domain 1 (TIM-1) dramatically enhances filovirus infection of epithelial cells. Here, we showed that key phosphatidylserine (PtdSer) binding residues of the TIM-1 IgV domain are critical for Ebola virus (EBOV) entry through direct interaction with PtdSer on the viral envelope. PtdSer liposomes but not phosphatidylcholine liposomes competed with TIM-1 for EBOV pseudovirion binding and transduction. Further, annexin V (AnxV) substituted for the TIM-1 IgV domain, supporting a PtdSer-dependent mechanism. Our findings suggest that TIM-1-dependent uptake of EBOV occurs by apoptotic mimicry. Additionally, TIM-1 enhanced infection of a wide range of enveloped viruses, including alphaviruses and a baculovirus. As further evidence of the critical role of enveloped-virion-associated PtdSer in TIM-1-mediated uptake, TIM-1 enhanced internalization of pseudovirions and virus-like proteins (VLPs) lacking a glycoprotein, providing evidence that TIM-1 and PtdSer-binding receptors can mediate virus uptake independent of a glycoprotein. These results provide evidence for a broad role of TIM-1 as a PtdSer-binding receptor that mediates enveloped-virus uptake. Utilization of PtdSer-binding receptors may explain the wide tropism of many of these viruses and provide new avenues for controlling their virulence. PMID:23698310
McGrath-Morrow, Sharon; Malhotra, Deepti; Lauer, Thomas; Collaco, J. Michael; Mitzner, Wayne; Neptune, Enid; Wise, Robert; Biswal, Shyam
2016-01-01
The impact of early childhood cigarette smoke (CS) exposure on CS-induced chronic obstructive pulmonary disease (COPD) is unknown. This study was performed to evaluate the individual and combined effects of neonatal and adult CS exposure on lung structure, function, and gene expression in adult mice. To model a childhood CS exposure, neonatal C57/B6 mice were exposed to 14 days of CS (Neo CS). At 10 weeks of age, Neo CS and control mice were exposed to 4 months of CS. Pulmonary function tests, bronchoalveolar lavage, and lung morphometry were measured and gene expression profiling was performed on lung tissue. Mean chord lengths and lung volumes were increased in neonatal and/or adult CS-exposed mice. Differences in immune, cornified envelope protein, muscle, and erythrocyte genes were found in CS-exposed lung. Neonatal CS exposure caused durable structural and functional changes in the adult lung but did not potentiate CS-induced COPD changes. Cornified envelope protein gene expression was decreased in all CS-exposed mice, whereas myosin and erythrocyte gene expression was increased in mice exposed to both neonatal and adult CS, suggesting an adaptive response. Additional studies may be warranted to determine the utility of these genes as biomarkers of respiratory outcomes. PMID:21649527
International Nuclear Information System (INIS)
Freshwater, J.R.; Wagman, P.I.
1980-01-01
A storage envelope or sleeve particularly for processed X-ray films is described. It consists of front and back panels joined together at a hinge line and connected along the intermediate sides by connecting flaps. An inner pocket is formed from a third flap which is folded to lie against the inner face of the back panel. The panels may have additional score lines parallel to the closed sides of the envelope and the inner pocket so that the envelope and the inner pocket can accommodate bulky contents. The free edge of the pocket is inset from the open side of the envelope, and finger cut-outs may be provided to facilitate access to the contents of the envelope and the pocket. (author)
International Nuclear Information System (INIS)
Bocharov, V.N.; Konstantinov, S.G.; Kudryavtsev, A.M.; Myskin, O.K.; Panasyuk, V.M.; Tsel'nik, F.A.
1984-06-01
A method of creating an annular plasma envelope used to protect the hot plasma from flows of impurities and gases from the walls of the vacuum chamber is described. The diameter of the envelope is 30 cm, the thickness of the wall is 1.5 cm, the length is 2.5 m, and its density is from 10 13 to 10 14 cm -3 . The envelope attenuates the incident (from outside) flow of helium 10-fold and the low of hydrogen 20-fold
Radiation-induced invagination of the nuclear envelope
International Nuclear Information System (INIS)
Szekely, J.G.; Copps, T.P.; Morash, B.D.
1980-01-01
Using electron microscopy, we have measured radiation-induced invagination of the nuclear envelope of Chinese hamster V-79 and mouse L cells to produce a quantifiable radiation endpoint on a membrane system. In the dose ranges measured (800 to 3000 rad in L cells and 1270 to 5700 rad in V-79 cells), the amount of invagination increased with dose and continued to develop in intact cells for up to 72 hr after the original population was irradiated. Small vacuoles, which sometimes appeared in the nuclei of L cells, were also more numerous in irradiated cells and increased with dose and incubation time in a similar fashion to invagination development
Horzinek, M.C.; Vahlenkamp, T.W.; Ronde, A. de; Schuurman, N.M.P.; Vliet, A.L.W. van; Drunen, J. van; Egberink, H.F.
1999-01-01
The envelope is of cardinal importance for the entry of feline immunodeficiency virus (FIV) into its host cells, which consist of cells of the immune system including macrophages. To characterize the envelope glycoprotein determinants involved in macrophage tropism, chimeric infectious molecular
Directory of Open Access Journals (Sweden)
Tim-Henrik Bruun
Full Text Available An increasing number of broadly neutralizing monoclonal antibodies (bnMAb against the HIV-1 envelope (Env protein has been discovered recently. Despite this progress, vaccination efforts with the aim to re-elicit bnMAbs that provide protective immunity have failed so far. Herein, we describe the development of a mammalian cell based FACS-panning method in which bnMAbs are used as tools to select surface-exposed envelope variants according to their binding affinity. For that purpose, an HIV-1 derived lentiviral vector was developed to infect HEK293T cells at low multiplicity of infection (MOI in order to link Env phenotype and genotype. For proof of principle, a gp145 Env model-library was established in which the complete V3 domain was substituted by five strain specific V3 loop sequences with known binding affinities to nMAb 447-52D, respectively. Env genes were recovered from selected cells by PCR, subcloned into a lentiviral vector (i to determine and quantify the enrichment nMAb binders and (ii to generate a new batch of transduction competent particles. After 2 selection cycles the Env variant with highest affinity was enriched 20-fold and represented 80% of the remaining Env population. Exploiting the recently described bnMAbs, this procedure might prove useful in selecting Env proteins from large Env libraries with the potential to elicit bnMAbs when used as vaccine candidates.
Ilaria Mazzoleni
2010-01-01
How to translate the lessons learned from the analysis and observation of the animal world is the design learning experience presented in this article. Skin is a complex and incredibly sophisticated organ that performs various functions, including protection, sensation and heat and water regulation. In a similar way building envelopes serve multiple roles, as they are the interface between the building inhabitants and environmental elements. The resulting architectural building envelopes prot...
Alibardi, Lorenzo
2007-01-01
The present ultrastructural study on regenerating feathers emphasizes the role of supportive cells in determining the branching pattern of barbs. Supportive cells are localized among developing barb and barbule cells, in marginal plates, and underneath the feather sheath, and their differentiative fate, in general, is a form of lipid degeneration. The Latter process determines the carving out of barb branching in both downfeathers and pennaceous feathers. In the latter feathers, some supportive cells (barb vane cells and cylindrical cells of marginal plates) degenerate within each barb ridge leaving separate barbules. Other supportive cells, here termed wedge cells, form columns of cornified material that merge into elongated corneous scaffolds localized among barbs and the rachis. This previously undescribed form of cornification of supportive cells derives from the aggregation of periderm and dense granules present in wedge cells. The latter cells give origin to a corneous material different from feather keratin that may initially sustain the early and soft barbules. After barbules are cornified the supportive cells scaffolds are eventually sloughed as the sheath breaks allowing the new feather to open up and form a planar vane. The corneous material of wedge cells may also contribute to molding of the overlapped nodes of barbule cells that form lateral spines or hooklets in mature barbules. Eventually, the disappearance of wedge cell scaffolding determines the regular spacing of barbs attached to the rachis in order to form a close vane.
Influence of the bud neck on nuclear envelope fission in Saccharomyces cerevisiae.
Melloy, Patricia G; Rose, Mark D
2017-09-15
Studies have shown that nuclear envelope fission (karyokinesis) in budding yeast depends on cytokinesis, but not distinguished whether this was a direct requirement, indirect, because of cell cycle arrest, or due to bud neck-localized proteins impacting both processes. To determine the requirements for karyokinesis, we examined mutants conditionally defective for bud emergence and/or nuclear migration. The common mutant phenotype was completion of the nuclear division cycle within the mother cell, but karyokinesis did not occur. In the cdc24 swe1 mutant, at the non-permissive temperature, multiple nuclei accumulated within the unbudded cell, with connected nuclear envelopes. Upon return to the permissive temperature, the cdc24 swe1 mutant initiated bud emergence, but only the nucleus spanning the neck underwent fission suggesting that the bud neck region is important for fission initiation. The neck may be critical for either mechanical reasons, as the contractile ring might facilitate fission, or for regulatory reasons, as the site of a protein network regulating nuclear envelope fission, mitotic exit, and cytokinesis. We also found that 77-85% of pairs of septin mutant nuclei completed nuclear envelope fission. In addition, 27% of myo1Δ mutant nuclei completed karyokinesis. These data suggested that fission is not dependent on mechanical contraction at the bud neck, but was instead controlled by regulatory proteins there. Copyright © 2017 Elsevier Inc. All rights reserved.
CSIR Research Space (South Africa)
Gibberd, Jeremy T
2009-01-01
Full Text Available for use in the building. This is done through photovoltaic and solar water heating panels and wind turbines. Ideally these are integrated in the design of the building envelope to improve the aesthetic quality of the building and minimise material... are naturally ventilated. Renewable energy The building envelope includes renewable energy generation such as photovoltaics, wind turbines and solar water heaters and 10% of the building’s energy requirements are generated from these sources. Views All...
Sharma, Sanjai; Murai, Fukashi; Miyanohara, Atsushi; Friedmann, Theodore
1997-01-01
Retrovirus packaging cell lines expressing the Moloney murine leukemia virus gag and pol genes but lacking virus envelope genes produce virus-like particles constitutively, whether or not they express a transcript from an integrated retroviral provirus. In the absence of a proviral transcript, the assembled particles contain processed gag and reverse transcriptase, and particles made by cells expressing an integrated lacZ provirus also contain viral RNA. The virus-like particles from both cell types are enveloped and are secreted/budded into the extracellular space but are noninfectious. Their physicochemical properties are similar to those of mature retroviral particles. The noninfectious gag pol RNA particles can readily be made infectious by the addition of lipofection reagents to produce preparations with titers of up to 105 colony-forming units per ml. PMID:9380714
Sharma, S; Murai, F; Miyanohara, A; Friedmann, T
1997-09-30
Retrovirus packaging cell lines expressing the Moloney murine leukemia virus gag and pol genes but lacking virus envelope genes produce virus-like particles constitutively, whether or not they express a transcript from an integrated retroviral provirus. In the absence of a proviral transcript, the assembled particles contain processed gag and reverse transcriptase, and particles made by cells expressing an integrated lacZ provirus also contain viral RNA. The virus-like particles from both cell types are enveloped and are secreted/budded into the extracellular space but are noninfectious. Their physicochemical properties are similar to those of mature retroviral particles. The noninfectious gag pol RNA particles can readily be made infectious by the addition of lipofection reagents to produce preparations with titers of up to 10(5) colony-forming units per ml.
2007-01-01
The series of envelopes featuring CERN issued this summer was a huge success. The French postal services of the Pays de Gex will shortly be launching the second set of pre-paid envelopes issued in collaboration with the Laboratory this year, this time highlighting the LHC. Five thousand envelopes describing the accelerator’s capabilities will go on sale on 12 November, and some of the packs will even contain a small sample of the cables from the heart of the LHC magnets. The sets of ten pre-paid envelopes will tell you everything about CERN’s flagship accelerator, from its astounding technical capabilities to its spin-offs in the fields of technology and human resources. Each envelope will feature a different attribute or spin-off of the LHC. People will be invited to consult CERN’s public website for more detailed explanations if they want to know more. The new envelopes will be available from five post offices in the Pays ...
International Nuclear Information System (INIS)
Martínez-Méndez, David; Rivera-Toledo, Evelyn; Ortega, Enrique; Licona-Limón, Ileana; Huerta, Leonor
2017-01-01
Enveloped viruses induce cell-cell fusion when infected cells expressing viral envelope proteins interact with target cells, or through the contact of cell-free viral particles with adjoining target cells. CD4"+ T lymphocytes and cells from the monocyte-macrophage lineage express receptors for HIV envelope protein. We have previously reported that lymphoid Jurkat T cells expressing the HIV-1 envelope protein (Env) can fuse with THP-1 monocytic cells, forming heterokaryons with a predominantly myeloid phenotype. This study shows that the expression of monocytic markers in heterokaryons is stable, whereas the expression of lymphoid markers is mostly lost. Like THP-1 cells, heterokaryons exhibited FcγR-dependent phagocytic activity and showed an enhanced expression of the activation marker ICAM-1 upon stimulation with PMA. In addition, heterokaryons showed morphological changes compatible with maturation, and high expression of the differentiation marker CD11b in the absence of differentiation-inducing agents. No morphological change nor increase in CD11b expression were observed when an HIV-fusion inhibitor blocked fusion, or when THP-1 cells were cocultured with Jurkat cells expressing a non-fusogenic Env protein, showing that differentiation was not induced merely by cell-cell interaction but required cell-cell fusion. Inhibition of TLR2/TLR4 signaling by a TIRAP inhibitor greatly reduced the expression of CD11b in heterokaryons. Thus, lymphocyte-monocyte heterokaryons induced by HIV-1 Env are stable and functional, and fusion prompts a phenotype characteristic of activated monocytes via intracellular TLR2/TLR4 signaling. - Highlights: • Jurkat T cells expressing the HIV-1 envelope fuse with THP-1 monocytes. • Heterokaryons display a dominant myeloid phenotype and monocyte function. • Heterokaryons exhibit activation features in the absence of activation agents. • Activation is not due to cell-cell interaction but requires cell-cell fusion. • The
Energy Technology Data Exchange (ETDEWEB)
Martínez-Méndez, David; Rivera-Toledo, Evelyn; Ortega, Enrique; Licona-Limón, Ileana; Huerta, Leonor, E-mail: leonorhh@biomedicas.unam.mx
2017-03-01
Enveloped viruses induce cell-cell fusion when infected cells expressing viral envelope proteins interact with target cells, or through the contact of cell-free viral particles with adjoining target cells. CD4{sup +} T lymphocytes and cells from the monocyte-macrophage lineage express receptors for HIV envelope protein. We have previously reported that lymphoid Jurkat T cells expressing the HIV-1 envelope protein (Env) can fuse with THP-1 monocytic cells, forming heterokaryons with a predominantly myeloid phenotype. This study shows that the expression of monocytic markers in heterokaryons is stable, whereas the expression of lymphoid markers is mostly lost. Like THP-1 cells, heterokaryons exhibited FcγR-dependent phagocytic activity and showed an enhanced expression of the activation marker ICAM-1 upon stimulation with PMA. In addition, heterokaryons showed morphological changes compatible with maturation, and high expression of the differentiation marker CD11b in the absence of differentiation-inducing agents. No morphological change nor increase in CD11b expression were observed when an HIV-fusion inhibitor blocked fusion, or when THP-1 cells were cocultured with Jurkat cells expressing a non-fusogenic Env protein, showing that differentiation was not induced merely by cell-cell interaction but required cell-cell fusion. Inhibition of TLR2/TLR4 signaling by a TIRAP inhibitor greatly reduced the expression of CD11b in heterokaryons. Thus, lymphocyte-monocyte heterokaryons induced by HIV-1 Env are stable and functional, and fusion prompts a phenotype characteristic of activated monocytes via intracellular TLR2/TLR4 signaling. - Highlights: • Jurkat T cells expressing the HIV-1 envelope fuse with THP-1 monocytes. • Heterokaryons display a dominant myeloid phenotype and monocyte function. • Heterokaryons exhibit activation features in the absence of activation agents. • Activation is not due to cell-cell interaction but requires cell-cell fusion. • The
Penicillin-binding site on the Escherichia coli cell envelope
International Nuclear Information System (INIS)
Amaral, L.; Lee, Y.; Schwarz, U.; Lorian, V.
1986-01-01
The binding of 35 S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and free epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin
International Nuclear Information System (INIS)
Schubak, G.E.; Scott, D.S.
1993-01-01
Autonomous underwater vehicles have traditionally been powered by low energy density lead-acid batteries. Recently, advanced battery technologies and H 2 -O 2 fuel cells have become available, offering significant improvements in performance. This paper compares the solid polymer fuel cell to the lithium-thionyl chloride primary battery, sodium-sulfur battery, and lead acid battery for a variety of missions. The power system performance is simulated using computer modelling techniques. Performance envelopes are constructed, indicating domains of preference for competing power system technologies. For most mission scenarios, the solid polymer fuel cell using liquid reactant storage is the preferred system. Nevertheless, the advanced battery systems are competitive with the fuel cell systems using gaseous hydrogen storage, and they illustrate preferred performance for missions requiring high power density. 11 figs., 4 tabs., 15 refs
Directory of Open Access Journals (Sweden)
David Beauparlant
2017-03-01
Full Text Available A hallmark of HIV-1 infection is the continuously declining number of the virus' predominant target cells, activated CD4+ T cells. With diminishing CD4+ T cell levels, the capacity to utilize alternate cell types and receptors, including cells that express low CD4 receptor levels such as macrophages, thus becomes crucial. To explore evolutionary paths that allow HIV-1 to acquire a wider host cell range by infecting cells with lower CD4 levels, we dissected the evolution of the envelope-CD4 interaction under in vitro culture conditions that mimicked the decline of CD4high target cells, using a prototypic subtype B, R5-tropic strain. Adaptation to CD4low targets proved to severely alter envelope functions including trimer opening as indicated by a higher affinity to CD4 and loss in shielding against neutralizing antibodies. We observed a strikingly decreased infectivity on CD4high target cells, but sustained infectivity on CD4low targets, including macrophages. Intriguingly, the adaptation to CD4low targets altered the kinetic of the entry process, leading to rapid CD4 engagement and an extended transition time between CD4 and CCR5 binding during entry. This phenotype was also observed for certain central nervous system (CNS derived macrophage-tropic viruses, highlighting that the functional perturbation we defined upon in vitro adaptation to CD4low targets occurs in vivo. Collectively, our findings suggest that CD4low adapted envelopes may exhibit severe deficiencies in entry fitness and shielding early in their evolution. Considering this, adaptation to CD4low targets may preferentially occur in a sheltered and immune-privileged environment such as the CNS to allow fitness restoring compensatory mutations to occur.
International Nuclear Information System (INIS)
Peterson, S.P.; Berns, M.W.
1978-01-01
Potorous tridactylis (PTK 2 ) cells growing in culture were treated with psoralen derivatives and dividing cells were located by phase-contrast microscopy. Psoralens, light-sensitive DNA-photoadducting drugs, were reacted with mitotic chromosomes through exposure to 365-nm light from an argon laser micro-beam system. It was shown that following mitosis and photoreaction, cells without nuclear envelopes were produced when psoralen-treated cells received 60 light pulses over their entire chromosome complement. These 'non-nuclear membrane' cells were found to incorporate [ 3 H]uridine, and to a lesser extent, [ 3 H]thymidine by autoradiography. Reduction of the light exposure by half (30 near-u.v. pulses) over the entire chromosome complement in the presence of psoralen also produced non-nuclear-membrane cells as seen by light microscopy. Further examination of these cells (30 light pulses) by single-cell electron microscopy revealed that unlike the high light exposure (60 near-u.v. pulses), the low light dosage resulted in cells with membrane patches associated with their chromatin. Since neither actinomycin D nor cycloheximide impeded nuclear envelope reformation, the psoralen-DNA reaction is concluded to produce non-nuclear membrane by a mechanism other than transcription or translation inhibition. The association of Golgi with areas of nuclear membrane patches gives indirect evidence of a possible Golgi contribution to the reformation of the nuclear envelope after mitosis. It is concluded that DNA plays a role in envelope reformation. (author)
2007-01-01
The series of envelopes featuring CERN issued this summer was a huge success. The French postal services of the Pays de Gex will shortly be launching the second set of pre-paid envelopes issued in collaboration with the Laboratory this year, this time highlighting the LHC. Five thousand envelopes describing the accelerator’s capabilities will go on sale on 12 November, and some of the packs will even contain a small sample of the cables from the heart of the LHC magnets. The sets of ten pre-paid envelopes will tell you everything about CERN’s flagship accelerator, from its astounding technical capabilities to its spin-offs in the fields of technology and human resources. Each envelope will feature a different attribute or spin-off of the LHC. People will be invited to consult CERN’s public website for more detailed explanations if they want to know more. The new envelopes will be available from five post offices in the Pays de Gex (Ferney-Voltaire, Prévessin...
Energy Technology Data Exchange (ETDEWEB)
Argaw, Takele; Wilson, Carolyn A., E-mail: carolyn.wilson@fda.hhs.gov
2015-01-15
Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. - Highlights: • Env cleavage signal impacts infectivity of gammaretroviruses. • Non-infectious mutants have hyper-glycosylated envelope that bind target cells. • Non-infectious mutants have defects in the formation of the double-stranded DNA. • Env cleavage motif has functions beyond cleavage of the env precursor.
Morita, Masahiko; Uemoto, Hiroaki; Watanabe, Atsushi
2007-08-15
A simple denitrification bioreactor for nitrate-containing wastewater without organic compounds was developed. This bioreactor consisted of packed gel envelopes in a single tank. Each envelope comprised two plates of gels containing Paracoccus denitrificans cells with an internal space between the plates. As an electron donor for denitrification, ethanol was injected into the internal space and not directly into the wastewater. P. denitrificans cells in the gel reduced nitrate to nitrogen gas by using the injected ethanol. Nitrate-containing desulfurization wastewater derived from a coal-fired thermal power plant was continuously treated with 20 packed gel envelopes (size, 1,000 x 900 x 12 mm; surface area, 1.44 m(2)) in a reactor tank (volume 1.5 m(3)). When the total nitrogen concentration in the inflow was around 150 mg-N x L(-1), the envelopes removed approximately 60-80% of the total nitrogen, and the maximum nitrogen removal rate was 5.0 g-N x day(-1) per square meter of the gel surface. This value corresponded to the volumetric nitrogen removal performance of 0.109 kg-N x m(-3) x day(-1). In each envelope, a high utilization efficiency of the electron donor was attained, although more than the double amount of the electron donor was empirically injected in the present activated sludge system to achieve denitrification when compared with the theoretical value. The bioreactor using the envelopes would be extremely effective as an additional denitrification system because these envelopes can be easily installed in the vacant spaces of preinstalled water treatment systems, without requiring additional facilities for removing surplus ethanol and sludge. (c) 2007 Wiley Periodicals, Inc.
Kirschman, Junghwa; Qi, Mingli; Ding, Lingmei; Hammonds, Jason; Dienger-Stambaugh, Krista; Wang, Jaang-Jiun; Lapierre, Lynne A; Goldenring, James R; Spearman, Paul
2018-03-01
The human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein (Env) encodes specific trafficking signals within its long cytoplasmic tail (CT) that regulate incorporation into HIV-1 particles. Rab11-family interacting protein 1C (FIP1C) and Rab14 are host trafficking factors required for Env particle incorporation, suggesting that Env undergoes sorting from the endosomal recycling compartment (ERC) to the site of particle assembly on the plasma membrane. We disrupted outward sorting from the ERC by expressing a C-terminal fragment of FIP1C (FIP1C 560-649 ) and examined the consequences on Env trafficking and incorporation into particles. FIP1C 560-649 reduced cell surface levels of Env and prevented its incorporation into HIV-1 particles. Remarkably, Env was trapped in an exaggerated perinuclear ERC in a CT-dependent manner. Mutation of either the Yxxϕ endocytic motif or the YW 795 motif in the CT prevented Env trapping in the ERC and restored incorporation into particles. In contrast, simian immunodeficiency virus SIVmac239 Env was not retained in the ERC, while substitution of the HIV-1 CT for the SIV CT resulted in SIV Env retention in this compartment. These results provide the first direct evidence that Env traffics through the ERC and support a model whereby HIV-1 Env is specifically targeted to the ERC prior to FIP1C- and CT-dependent outward sorting to the particle assembly site on the plasma membrane. IMPORTANCE The HIV envelope protein is an essential component of the viral particle. While many aspects of envelope protein structure and function have been established, the pathway it follows in the cell prior to reaching the site of particle assembly is not well understood. The envelope protein has a very long cytoplasmic tail that interacts with the host cell trafficking machinery. Here, we utilized a truncated form of the trafficking adaptor FIP1C protein to arrest the intracellular transport of the envelope protein, demonstrating that it becomes
Circuitry linking the global Csr and σE-dependent cell envelope stress response systems.
Yakhnin, Helen; Aichele, Robert; Ades, Sarah E; Romeo, Tony; Babitzke, Paul
2017-09-18
CsrA of Escherichia coli is an RNA-binding protein that globally regulates a wide variety of cellular processes and behaviors including carbon metabolism, motility, biofilm formation, and the stringent response. CsrB and CsrC are sRNAs that sequester CsrA, thereby preventing CsrA-mRNA interaction. RpoE (σ E ) is the extracytoplasmic stress response sigma factor of E. coli Previous RNA-seq studies identified rpoE mRNA as a CsrA target. Here we explored the regulation of rpoE by CsrA and found that CsrA represses rpoE translation. Gel mobility shift, footprint and toeprint studies identified three CsrA binding sites in the rpoE leader transcript, one of which overlaps the rpoE Shine-Dalgarno (SD) sequence, while another overlaps the rpoE translation initiation codon. Coupled in vitro transcription-translation experiments showed that CsrA represses rpoE translation by binding to these sites. We further demonstrate that σ E indirectly activates transcription of csrB and csrC , leading to increased sequestration of CsrA such that repression of rpoE by CsrA is reduced. We propose that the Csr system fine-tunes the σ E -dependent cell envelope stress response. We also identified a 51 amino acid coding sequence whose stop codon overlaps the rpoE start codon, and demonstrate that rpoE is translationally coupled with this upstream open reading frame (ORF51). Loss of coupling reduces rpoE translation by more than 50%. Identification of a translationally coupled ORF upstream of rpoE suggests that this previously unannotated protein may participate in the cell envelope stress response. In keeping with existing nomenclature, we name ORF51 as rseD , resulting in an operon arrangement of rseD-rpoE-rseA-rseB-rseC IMPORTANCE CsrA posttranscriptionally represses genes required for bacterial stress responses, including the stringent response, catabolite repression, and the RpoS (σ S )-mediated general stress response. We show that CsrA represses translation of rpoE , encoding the
Sun, Xiaofei; Park, Craig B; Deng, Wenbo; Potter, S Steven; Dey, Sudhansu K
2016-04-01
Embryo implantation requires that the uterus differentiate into the receptive state. Failure to attain uterine receptivity will impede blastocyst attachment and result in a compromised pregnancy. The molecular mechanism by which the uterus transitions from the prereceptive to the receptive stage is complex, involving an intricate interplay of various molecules. We recently found that mice with uterine deletion ofMsxgenes (Msx1(d/d)/Msx2(d/d)) are infertile because of implantation failure associated with heightened apicobasal polarity of luminal epithelial cells during the receptive period. However, information on Msx's roles in regulating epithelial polarity remains limited. To gain further insight, we analyzed cell-type-specific gene expression by RNA sequencing of separated luminal epithelial and stromal cells by laser capture microdissection fromMsx1(d/d)/Msx2(d/d)and floxed mouse uteri on d 4 of pseudopregnancy. We found that claudin-1, a tight junction protein, and small proline-rich (Sprr2) protein, a major component of cornified envelopes in keratinized epidermis, were substantially up-regulated inMsx1(d/d)/Msx2(d/d)uterine epithelia. These factors also exhibited unique epithelial expression patterns at the implantation chamber (crypt) inMsx1(f/f)/Msx2(f/f)females; the patterns were lost inMsx1(d/d)/Msx2(d/d)epithelia on d 5, suggesting important roles during implantation. The results suggest thatMsxgenes play important roles during uterine receptivity including modulation of epithelial junctional activity.-Sun, X., Park, C. B., Deng, W., Potter, S. S., Dey, S. K. Uterine inactivation of muscle segment homeobox (Msx) genes alters epithelial cell junction proteins during embryo implantation. © FASEB.
Bhattacharyya, Suchita; Zagórska, Anna; Lew, Erin D; Shrestha, Bimmi; Rothlin, Carla V; Naughton, John; Diamond, Michael S; Lemke, Greg; Young, John A T
2013-08-14
Upon activation by the ligands Gas6 and Protein S, Tyro3/Axl/Mer (TAM) receptor tyrosine kinases promote phagocytic clearance of apoptotic cells and downregulate immune responses initiated by Toll-like receptors and type I interferons (IFNs). Many enveloped viruses display the phospholipid phosphatidylserine on their membranes, through which they bind Gas6 and Protein S and engage TAM receptors. We find that ligand-coated viruses activate TAM receptors on dendritic cells (DCs), dampen type I IFN signaling, and thereby evade host immunity and promote infection. Upon virus challenge, TAM-deficient DCs display type I IFN responses that are elevated in comparison to wild-type cells. As a consequence, TAM-deficient DCs are relatively resistant to infection by flaviviruses and pseudotyped retroviruses, but infection can be restored with neutralizing type I IFN antibodies. Correspondingly, a TAM kinase inhibitor antagonizes the infection of wild-type DCs. Thus, TAM receptors are engaged by viruses in order to attenuate type I IFN signaling and represent potential therapeutic targets. Copyright © 2013 Elsevier Inc. All rights reserved.
Cortical processing of dynamic sound envelope transitions.
Zhou, Yi; Wang, Xiaoqin
2010-12-08
Slow envelope fluctuations in the range of 2-20 Hz provide important segmental cues for processing communication sounds. For a successful segmentation, a neural processor must capture envelope features associated with the rise and fall of signal energy, a process that is often challenged by the interference of background noise. This study investigated the neural representations of slowly varying envelopes in quiet and in background noise in the primary auditory cortex (A1) of awake marmoset monkeys. We characterized envelope features based on the local average and rate of change of sound level in envelope waveforms and identified envelope features to which neurons were selective by reverse correlation. Our results showed that envelope feature selectivity of A1 neurons was correlated with the degree of nonmonotonicity in their static rate-level functions. Nonmonotonic neurons exhibited greater feature selectivity than monotonic neurons in quiet and in background noise. The diverse envelope feature selectivity decreased spike-timing correlation among A1 neurons in response to the same envelope waveforms. As a result, the variability, but not the average, of the ensemble responses of A1 neurons represented more faithfully the dynamic transitions in low-frequency sound envelopes both in quiet and in background noise.
Bioinformatics Analysis of Envelope Glycoprotein E epitopes of ...
African Journals Online (AJOL)
The E glycoprotein of dengue virus is responsible for the viral binding to the receptor. The crystal structure of envelope glycoprotein has already been determined. However, where the well-defined Bcell and T-cell epitopes are located is still a question. Because of the large variations among the four dengue genotypes, it is ...
International Nuclear Information System (INIS)
Martin-Garcia, Julio; Cao, Wei; Varela-Rohena, Angel; Plassmeyer, Matthew L.; Gonzalez-Scarano, Francisco
2006-01-01
We previously described envelope glycoproteins of an HIV-1 isolate adapted in vitro for growth in microglia that acquired a highly fusogenic phenotype and lower CD4 dependence, as well as resistance to inhibition by anti-CD4 antibodies. Here, we investigated whether similar phenotypic changes are present in vivo. Envelope clones from the brain and spleen of an HIV-1-infected individual with neurological disease were amplified, cloned, and sequenced. Phylogenetic analysis demonstrated clustering of sequences according to the tissue of origin, as expected. Functional clones were then used in cell-to-cell fusion assays to test for CD4 and co-receptor utilization and for sensitivity to various antibodies and inhibitors. Both brain- and spleen-derived envelope clones mediated fusion in cells expressing both CD4 and CCR5 and brain envelopes also used CCR3 as co-receptor. We found that the brain envelopes had a lower CD4 dependence, since they efficiently mediated fusion in the presence of low levels of CD4 on the target cell membrane, and they were significantly more resistant to blocking by anti-CD4 antibodies than the spleen-derived envelopes. In contrast, we observed no difference in sensitivity to the CCR5 antagonist TAK-779. However, brain-derived envelopes were significantly more resistant than those from spleen to the fusion inhibitor T-1249 and concurrently showed slightly greater fusogenicity. Our results suggest an increased affinity for CD4 of brain-derived envelopes that may have originated from in vivo adaptation to replication in microglial cells. Interestingly, we note the presence of envelopes more resistant to a fusion inhibitor in the brain of an untreated, HIV-1-infected individual
Data on the association of the nuclear envelope protein Sun1 with nucleoli.
Moujaber, Ossama; Omran, Nawal; Kodiha, Mohamed; Pié, Brigitte; Cooper, Ellis; Presley, John F; Stochaj, Ursula
2017-08-01
SUN proteins participate in diverse cellular activities, many of which are connected to the nuclear envelope. Recently, the family member SUN1 has been linked to novel biological activities. These include the regulation of nucleoli, intranuclear compartments that assemble ribosomal subunits. We show that SUN1 associates with nucleoli in several mammalian epithelial cell lines. This nucleolar localization is not shared by all cell types, as SUN1 concentrates at the nuclear envelope in ganglionic neurons and non-neuronal satellite cells. Database analyses and Western blotting emphasize the complexity of SUN1 protein profiles in different mammalian cells. We constructed a STRING network which identifies SUN1-related proteins as part of a larger network that includes several nucleolar proteins. Taken together, the current data highlight the diversity of SUN1 proteins and emphasize the possible links between SUN1 and nucleoli.
Directory of Open Access Journals (Sweden)
Masaud Shah
Full Text Available Membrane fusion is the central molecular event during the entry of enveloped viruses into cells. The critical agents of this process are viral surface proteins, primed to facilitate cell bilayer fusion. The important role of Dendritic-cell-specific ICAM3-grabbing non-integrin (DC-SIGN in Dengue virus transmission makes it an attractive target to interfere with Dengue virus Propagation. Receptor mediated endocytosis allows the entry of virions due to the presence of endosomal membranes and low pH-induced fusion of the virus. DC-SIGN is the best characterized molecule among the candidate protein receptors and is able to mediate infection with the four serotypes of dengue virus (DENV. Unrestrained pair wise docking was used for the interaction of dengue envelope protein with DC-SIGN and monoclonal antibody 2G12. Pre-processed the PDB coordinates of dengue envelope glycoprotein and other candidate proteins were prepared and energy minimized through AMBER99 force field distributed in MOE software. Protein-protein interaction server, ZDOCK was used to find molecular interaction among the candidate proteins. Based on these interactions it was found that antibody successfully blocks the glycosylation site ASN 67 and other conserved residues present at DC-SIGN-Den-E complex interface. In order to know for certain, the exact location of the antibody in the envelope protein, co-crystallize of the envelope protein with these compounds is needed so that their exact docking locations can be identified with respect to our results.
Expanded breadth of the T-cell response to mosaic HIV-1 envelope DNA vaccination
Energy Technology Data Exchange (ETDEWEB)
Korber, Bette [Los Alamos National Laboratory; Fischer, William [Los Alamos National Laboratory; Wallstrom, Timothy [Los Alamos National Laboratory
2009-01-01
An effective AIDS vaccine must control highly diverse circulating strains of HIV-1. Among HIV -I gene products, the envelope (Env) protein contains variable as well as conserved regions. In this report, an informatic approach to the design of T-cell vaccines directed to HIV -I Env M group global sequences was tested. Synthetic Env antigens were designed to express mosaics that maximize the inclusion of common potential Tcell epitope (PTE) 9-mers and minimize the inclusion of rare epitopes likely to elicit strain-specific responses. DNA vaccines were evaluated using intracellular cytokine staining (ICS) in inbred mice with a standardized panel of highly conserved 15-mer PTE peptides. I, 2 and 3 mosaic sets were developed that increased theoretical epitope coverage. The breadth and magnitude ofT-cell immunity stimulated by these vaccines were compared to natural strain Env's; additional comparisons were performed on mutant Env's, including gpl60 or gpl45 with or without V regions and gp41 deletions. Among them, the 2 or 3 mosaic Env sets elicited the optimal CD4 and CD8 responses. These responses were most evident in CD8 T cells; the 3 mosaic set elicited responses to an average of 8 peptide pools compared to 2 pools for a set of3 natural Env's. Synthetic mosaic HIV -I antigens can therefore induce T-cell responses with expanded breadth and may facilitate the development of effective T -cell-based HIV -1 vaccines.
Hussain, Naveen; Thickett, Kelly R; Na, Hong; Leung, Cherry; Tailor, Chetankumar S
2011-12-01
Gammaretrovirus receptors have been suggested to contain the necessary determinants to mediate virus binding and entry. Here, we show that murine NIH 3T3 and baby hamster kidney (BHK) cells overexpressing receptors for subgroup A, B, and C feline leukemia viruses (FeLVs) are weakly susceptible (10(1) to 10(2) CFU/ml) to FeLV pseudotype viruses containing murine leukemia virus (MLV) core (Gag-Pol) proteins, whereas FeLV receptor-expressing murine Mus dunni tail fibroblast (MDTF) cells are highly susceptible (10(4) to 10(6) CFU/ml). However, NIH 3T3 cells expressing the FeLV subgroup B receptor PiT1 are highly susceptible to gibbon ape leukemia virus pseudotype virus, which differs from the FeLV pseudotype viruses only in the envelope protein. FeLV resistance is not caused by a defect in envelope binding, low receptor expression levels, or N-linked glycosylation. Resistance is not alleviated by substitution of the MLV core in the FeLV pseudotype virus with FeLV core proteins. Interestingly, FeLV resistance is alleviated by fusion of receptor-expressing NIH 3T3 and BHK cells with MDTF or human TE671 cells, suggesting the absence of an additional cellular component in NIH 3T3 and BHK cells that is required for FeLV infection. The putative FeLV-specific cellular component is not a secreted factor, as MDTF conditioned medium does not alleviate the block to FeLV infection. Together, our findings suggest that FeLV infection requires an additional envelope-dependent cellular component that is absent in NIH 3T3 and BHK cells but that is present in MDTF and TE671 cells.
All the Universe in an envelope
2007-01-01
Do you know which force is hidden in an envelope or how many billions of years old are the atoms it contains? You will find the answers to these (curious) questions in a post office in the Pays de Gex. The French postal services of the Pays de Gex are again issuing pre-paid envelopes in collaboration with CERN (see Bulletin No. 24/2006). The new series presents some of the concepts of modern physics in an amazing way by showing what you can learn about the Universe with a single envelope. Packets of ten pre-stamped envelopes, each carrying a statement on fundamental physics, will be on sale from 7 July onwards. To learn more about the physics issues presented on the envelopes, people are invited to go to the CERN Web site where they will find the explanations. Five thousand envelopes will be put on sale in July and five thousand more during the French "Fête de la science" in October. They will be available from five post offices in the Pays de Gex (F...
Directory of Open Access Journals (Sweden)
Hui Tian
2018-04-01
Full Text Available The cell-envelope protease PrtS was proved to be efficient in optimal bacterial growth and fast acidification in pure culture, while its positive effect on the performance of mixed-cultures in milk fermentation was not defined. The aim was to analyze effects of the PrtS on the symbiosis between strains during yoghurt production and cold storage. Two Streptococcus thermophilus strains, KLDS3.1012 and KLDS SM, and two different proteolytic strains of Lactobacillus delbrueckii subsp. Bulgaricus, L7 and L12, were used. Technological properties (viability, acid production, and proteolysis were determined. Comparative genomics was used to analyze the proteolytic system (cell-envelope protease, transport system, intracellular peptidase of Streptococcus thermophilus strains. S. thermophilus KLDS SM possesses an intact gene encoding PrtS (A9497_00420, which was not found in the genome of S. thermophilus KLDS3.1012. This gene is the main difference in the proteolytic system between the two genomes. PrtS endowed KLDS SM high levels of viability during fermentation and cold storage. When combined with a weaker lactobacillus strain during fermentation, the acceleration of acid production of mixed-culture by KLDS SM would start at an earlier time. KLDS SM increased the post-acidification of yoghurts during cold storage, but the pH was steadily maintained during 14–28 days. Results suggest that strains of Streptococcus thermophilus with strong proteolytic ability could be used in a wide range of dairy production. The present study provided data for yoghurt starter development from the point of view of proteolysis.
Directory of Open Access Journals (Sweden)
Vinca Icard
Full Text Available The density of circulating hepatitis C virus (HCV particles in the blood of chronically infected patients is very heterogeneous. The very low density of some particles has been attributed to an association of the virus with apolipoprotein B (apoB positive and triglyceride rich lipoproteins (TRL likely resulting in hybrid lipoproteins known as lipo-viro-particles (LVP containing the viral envelope glycoproteins E1 and E2, capsid and viral RNA. The specific infectivity of these particles has been shown to be higher than the infectivity of particles of higher density. The nature of the association of HCV particles with lipoproteins remains elusive and the role of apolipoproteins in the synthesis and assembly of the viral particles is unknown. The human intestinal Caco-2 cell line differentiates in vitro into polarized and apoB secreting cells during asymmetric culture on porous filters. By using this cell culture system, cells stably expressing E1 and E2 secreted the glycoproteins into the basal culture medium after one week of differentiation concomitantly with TRL secretion. Secreted glycoproteins were only detected in apoB containing density fractions. The E1-E2 and apoB containing particles were unique complexes bearing the envelope glycoproteins at their surface since apoB could be co-immunoprecipitated with E2-specific antibodies. Envelope protein secretion was reduced by inhibiting the lipidation of apoB with an inhibitor of the microsomal triglyceride transfer protein. HCV glycoproteins were similarly secreted in association with TRL from the human liver cell line HepG2 but not by Huh-7 and Huh-7.5 hepatoma cells that proved deficient for lipoprotein assembly. These data indicate that HCV envelope glycoproteins have the intrinsic capacity to utilize apoB synthesis and lipoprotein assembly machinery even in the absence of the other HCV proteins. A model for LVP assembly is proposed.
Sorting nexin 6 enhances lamin a synthesis and incorporation into the nuclear envelope.
Directory of Open Access Journals (Sweden)
Jose M González-Granado
Full Text Available Nuclear lamins are important structural and functional proteins in mammalian cells, but little is known about the mechanisms and cofactors that regulate their traffic into the nucleus. Here, we demonstrate that trafficking of lamin A, but not lamin B1, and its assembly into the nuclear envelope are regulated by sorting nexin 6 (SNX6, a major component of the retromer that targets proteins and other molecules to specific subcellular locations. SNX6 interacts with lamin A in vitro and in vivo and links it to the outer surface of the endoplasmic reticulum in human and mouse cells. SNX6 transports its lamin A cargo to the nuclear envelope in a process that takes several hours. Lamin A protein levels in the nucleus augment or decrease, respectively, upon gain or loss of SNX6 function. We further show that SNX6-dependent lamin A nuclear import occurs across the nuclear pore complex via a RAN-GTP-dependent mechanism. These results identify SNX6 as a key regulator of lamin A synthesis and incorporation into the nuclear envelope.
Sorting Nexin 6 Enhances Lamin A Synthesis and Incorporation into the Nuclear Envelope
González-Granado, Jose M.; Navarro-Puche, Ana; Molina-Sanchez, Pedro; Blanco-Berrocal, Marta; Viana, Rosa; de Mora, Jaime Font; Andrés, Vicente
2014-01-01
Nuclear lamins are important structural and functional proteins in mammalian cells, but little is known about the mechanisms and cofactors that regulate their traffic into the nucleus. Here, we demonstrate that trafficking of lamin A, but not lamin B1, and its assembly into the nuclear envelope are regulated by sorting nexin 6 (SNX6), a major component of the retromer that targets proteins and other molecules to specific subcellular locations. SNX6 interacts with lamin A in vitro and in vivo and links it to the outer surface of the endoplasmic reticulum in human and mouse cells. SNX6 transports its lamin A cargo to the nuclear envelope in a process that takes several hours. Lamin A protein levels in the nucleus augment or decrease, respectively, upon gain or loss of SNX6 function. We further show that SNX6-dependent lamin A nuclear import occurs across the nuclear pore complex via a RAN-GTP-dependent mechanism. These results identify SNX6 as a key regulator of lamin A synthesis and incorporation into the nuclear envelope. PMID:25535984
International Nuclear Information System (INIS)
Apruzese, J.P.
1975-01-01
The radiative transfer techniques described elsewhere by the author have been employed to construct dust envelope models of several well known infrared stars. The resulting calculations indicate that the infrared emissivity of circumstellar grains generally must be higher than that which many calculations of small nonsilicate grains yield. This conclusion is dependent to some degree on the (unknown) size of the stellar envelopes considered, but is quite firm in the case of the spatially resolved envelope of IRC+10216. Further observations of the spatial distribution of the infrared radiation from stellar envelopes will be invaluable in deciphering the properties of the circumstellar grains
Directory of Open Access Journals (Sweden)
Teruhiko Suzuki
Full Text Available Microcell-mediated chromosome transfer (MMCT is an essential step for introducing chromosomes from donor cells to recipient cells. MMCT allows not only for genetic/epigenetic analysis of specific chromosomes, but also for utilization of human and mouse artificial chromosomes (HACs/MACs as gene delivery vectors. Although the scientific demand for genome scale analyses is increasing, the poor transfer efficiency of the current method has hampered the application of chromosome engineering technology. Here, we developed a highly efficient chromosome transfer method, called retro-MMCT, which is based on Chinese hamster ovary cells expressing envelope proteins derived from ecotropic or amphotropic murine leukemia viruses. Using this method, we transferred MACs to NIH3T3 cells with 26.5 times greater efficiency than that obtained using the conventional MMCT method. Retro-MMCT was applicable to a variety of recipient cells, including embryonic stem cells. Moreover, retro-MMCT enabled efficient transfer of MAC to recipient cells derived from humans, monkeys, mice, rats, and rabbits. These results demonstrate the utility of retro-MMCT for the efficient transfer of chromosomes to various types of target cell.
Characterization of the fusion core in zebrafish endogenous retroviral envelope protein
Energy Technology Data Exchange (ETDEWEB)
Shi, Jian [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072 (China); State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Zhang, Huaidong [CAS Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Gong, Rui, E-mail: gongr@wh.iov.cn [CAS Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Xiao, Gengfu, E-mail: xiaogf@wh.iov.cn [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072 (China); State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China)
2015-05-08
Zebrafish endogenous retrovirus (ZFERV) is the unique endogenous retrovirus in zebrafish, as yet, containing intact open reading frames of its envelope protein gene in zebrafish genome. Similarly, several envelope proteins of endogenous retroviruses in human and other mammalian animal genomes (such as syncytin-1 and 2 in human, syncytin-A and B in mouse) were identified and shown to be functional in induction of cell–cell fusion involved in placental development. ZFERV envelope protein (Env) gene appears to be also functional in vivo because it is expressible. After sequence alignment, we found ZFERV Env shares similar structural profiles with syncytin and other type I viral envelopes, especially in the regions of N- and C-terminal heptad repeats (NHR and CHR) which were crucial for membrane fusion. We expressed the regions of N + C protein in the ZFERV Env (residues 459–567, including predicted NHR and CHR) to characterize the fusion core structure. We found N + C protein could form a stable coiled-coil trimer that consists of three helical NHR regions forming a central trimeric core, and three helical CHR regions packing into the grooves on the surface of the central core. The structural characterization of the fusion core revealed the possible mechanism of fusion mediated by ZFERV Env. These results gave comprehensive explanation of how the ancient virus infects the zebrafish and integrates into the genome million years ago, and showed a rational clue for discovery of physiological significance (e.g., medicate cell–cell fusion). - Highlights: • ZFERV Env shares similar structural profiles with syncytin and other type I viral envelopes. • The fusion core of ZFERV Env forms stable coiled-coil trimer including three NHRs and three CHRs. • The structural mechanism of viral entry mediated by ZFERV Env is disclosed. • The results are helpful for further discovery of physiological function of ZFERV Env in zebrafish.
Focal Targeting of the Bacterial Envelope by Antimicrobial Peptides
Directory of Open Access Journals (Sweden)
Rafi eRashid
2016-06-01
Full Text Available Antimicrobial peptides (AMPs are utilized by both eukaryotic and prokaryotic organisms. AMPs such as the human beta defensins, human neutrophil peptides, human cathelicidin, and many bacterial bacteriocins are cationic and capable of binding to anionic regions of the bacterial surface. Cationic AMPs (CAMPs target anionic lipids (e.g. phosphatidylglycerol (PG and cardiolipins (CL in the cell membrane and anionic components (e.g. lipopolysaccharide (LPS and lipoteichoic acid (LTA of the cell envelope. Bacteria have evolved mechanisms to modify these same targets in order to resist CAMP killing, e.g. lysinylation of PG to yield cationic lysyl-PG and alanylation of LTA. Since CAMPs offer a promising therapeutic alternative to conventional antibiotics, which are becoming less effective due to rapidly emerging antibiotic resistance, there is a strong need to improve our understanding about the AMP mechanism of action. Recent literature suggests that AMPs often interact with the bacterial cell envelope at discrete foci. Here we review recent AMP literature, with an emphasis on focal interactions with bacteria, including (1 CAMP disruption mechanisms, (2 delocalization of membrane proteins and lipids by CAMPs, and (3 CAMP sensing systems and resistance mechanisms. We conclude with new approaches for studying the bacterial membrane, e.g., lipidomics, high resolution imaging and non-detergent-based membrane domain extraction.
Creating a Lunar EVA Work Envelope
Griffin, Brand N.; Howard, Robert; Rajulu, Sudhakar; Smitherman, David
2009-01-01
A work envelope has been defined for weightless Extravehicular Activity (EVA) based on the Space Shuttle Extravehicular Mobility Unit (EMU), but there is no equivalent for planetary operations. The weightless work envelope is essential for planning all EVA tasks because it determines the location of removable parts, making sure they are within reach and visibility of the suited crew member. In addition, using the envelope positions the structural hard points for foot restraints that allow placing both hands on the job and provides a load path for reacting forces. EVA operations are always constrained by time. Tasks are carefully planned to ensure the crew has enough breathing oxygen, cooling water, and battery power. Planning first involves computers using a virtual work envelope to model tasks, next suited crew members in a simulated environment refine the tasks. For weightless operations, this process is well developed, but planetary EVA is different and no work envelope has been defined. The primary difference between weightless and planetary work envelopes is gravity. It influences anthropometry, horizontal and vertical mobility, and reaction load paths and introduces effort into doing "overhead" work. Additionally, the use of spacesuits other than the EMU, and their impacts on range of motion, must be taken into account. This paper presents the analysis leading to a concept for a planetary EVA work envelope with emphasis on lunar operations. There is some urgency in creating this concept because NASA has begun building and testing development hardware for the lunar surface, including rovers, habitats and cargo off-loading equipment. Just as with microgravity operations, a lunar EVA work envelope is needed to guide designers in the formative stages of the program with the objective of avoiding difficult and costly rework.
Mosaic HIV envelope immunogenic polypeptides
Korber, Bette T. M.; Gnanakaran, S.; Perkins, Simon; Sodroski, Joseph; Haynes, Barton
2018-01-02
Disclosed herein are mosaic HIV envelope (Env) polypeptides that can elicit an immune response to HIV (such as cytotoxic T cell (CTL), helper T cell, and/or humoral responses). Also disclosed are sets of the disclosed mosaic Env polypeptides, which include two or more (for example, three) of the polypeptides. Also disclosed herein are methods for treating or inhibiting HIV in a subject including administering one or more of the disclosed immunogenic polypeptides or compositions to a subject infected with HIV or at risk of HIV infection. In some embodiments, the methods include inducing an immune response to HIV in a subject comprising administering to the subject at least one (such as two, three, or more) of the immunogenic polypeptides or at least one (such as two, three, or more) nucleic acids encoding at least one of the immunogenic polypeptides disclosed herein.
Dynamic assembly of brambleberry mediates nuclear envelope fusion during early development.
Abrams, Elliott W; Zhang, Hong; Marlow, Florence L; Kapp, Lee; Lu, Sumei; Mullins, Mary C
2012-08-03
To accommodate the large cells following zygote formation, early blastomeres employ modified cell divisions. Karyomeres are one such modification, mitotic intermediates wherein individual chromatin masses are surrounded by nuclear envelope; the karyomeres then fuse to form a single mononucleus. We identified brambleberry, a maternal-effect zebrafish mutant that disrupts karyomere fusion, resulting in formation of multiple micronuclei. As karyomeres form, Brambleberry protein localizes to the nuclear envelope, with prominent puncta evident near karyomere-karyomere interfaces corresponding to membrane fusion sites. brambleberry corresponds to an unannotated gene with similarity to Kar5p, a protein that participates in nuclear fusion in yeast. We also demonstrate that Brambleberry is required for pronuclear fusion following fertilization in zebrafish. Our studies provide insight into the machinery required for karyomere fusion and suggest that specialized proteins are necessary for proper nuclear division in large dividing blastomeres. Copyright © 2012 Elsevier Inc. All rights reserved.
Elucidating Duramycin’s Bacterial Selectivity and Mode of Action on the Bacterial Cell Envelope
Directory of Open Access Journals (Sweden)
Sahar Hasim
2018-02-01
Full Text Available The use of naturally occurring antimicrobial peptides provides a promising route to selectively target pathogenic agents and to shape microbiome structure. Lantibiotics, such as duramycin, are one class of bacterially produced peptidic natural products that can selectively inhibit the growth of other bacteria. However, despite longstanding characterization efforts, the microbial selectivity and mode of action of duramycin are still obscure. We describe here a suite of biological, chemical, and physical characterizations that shed new light on the selective and mechanistic aspects of duramycin activity. Bacterial screening assays have been performed using duramycin and Populus-derived bacterial isolates to determine species selectivity. Lipidomic profiles of selected resistant and sensitive strains show that the sensitivity of Gram-positive bacteria depends on the presence of phosphatidylethanolamine (PE in the cell membrane. Further the surface and interface morphology were studied by high resolution atomic force microscopy and showed a progression of cellular changes in the cell envelope after treatment with duramycin for the susceptible bacterial strains. Together, these molecular and cellular level analyses provide insight into duramycin’s mode of action and a better understanding of its selectivity.
International Nuclear Information System (INIS)
Ponec, M.; Kempenaar, J.; Weerheim, A.; Boonstra, J.
1987-01-01
We have studied the relationship between differentiation capacity, plasma membrane composition, and epidermal growth factor (EGF) receptor expression of normal keratinocytes in vitro. The plasma membrane composition of the cells was modulated experimentally by cholesterol depletion, using specific inhibitors of cholesterol synthesis, such as 25-hydroxycholesterol and mevinolin. Exposure of the cells towards these inhibitors resulted in a drastic decrease of cholesterol biosynthesis, as determined from 14 C-acetate incorporation into the various lipid fractions. This effect on cholesterol biosynthesis was reflected by changes in plasma membrane composition, as determined by lipid analysis of isolated plasma membrane fractions, these resulting in a decreased cholesterol-phospholipid ratio. The experimental modulation of plasma membrane composition by 25-hydroxycholesterol or mevinolin were accompanied by a decreased cornified envelope formation and by high expression of EGF binding sites. These phenomena were more pronounced in cells induced to differentiate by exposure of cells grown under low Ca2+ to normal Ca2+ concentrations, as compared to cells grown persistently under low Ca2+ concentrations. These results suggest a close correlation between plasma membrane composition, differentiation capacity, and EGF receptor expression
14 CFR 29.87 - Height-velocity envelope.
2010-01-01
... Category A engine isolation requirements, the height-velocity envelope for complete power failure must be... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Height-velocity envelope. 29.87 Section 29... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Flight Performance § 29.87 Height-velocity envelope. (a...
Directory of Open Access Journals (Sweden)
Nagata Tatsuya
2011-05-01
Full Text Available Abstract Background Yellow fever is an haemorrhagic disease caused by a virus that belongs to the genus Flavivirus (Flaviviridae family and is transmitted by mosquitoes. Among the viral proteins, the envelope protein (E is the most studied one, due to its high antigenic potencial. Baculovirus are one of the most popular and efficient eukaryotic expression system. In this study a recombinant baculovirus (vSynYFE containing the envelope gene (env of the 17D vaccine strain of yellow fever virus was constructed and the recombinant protein antigenicity was tested. Results Insect cells infected with vSynYFE showed syncytium formation, which is a cytopathic effect characteristic of flavivirus infection and expressed a polypeptide of around 54 kDa, which corresponds to the expected size of the recombinant E protein. Furthermore, the recombinant E protein expression was also confirmed by fluorescence microscopy of vSynYFE-infected insect cells. Total vSynYFE-infected insect extracts used as antigens detected the presence of antibodies for yellow fever virus in human sera derived from yellow fever-infected patients in an immunoassay and did not cross react with sera from dengue virus-infected patients. Conclusions The E protein expressed by the recombinant baculovirus in insect cells is antigenically similar to the wild protein and it may be useful for different medical applications, from improved diagnosis of the disease to source of antigens for the development of a subunit vaccine.
Energy Technology Data Exchange (ETDEWEB)
Maric, Martina; Haugo, Alison C. [Department of Microbiology, University of Iowa, Iowa City, IA 52242 (United States); Dauer, William [Department of Neurology, University of Michigan, Ann Arbor, MI 48109 (United States); Johnson, David [Department of Microbiology and Immunology, Oregon Health Sciences University, Portland, OR 97201 (United States); Roller, Richard J., E-mail: richard-roller@uiowa.edu [Department of Microbiology, University of Iowa, Iowa City, IA 52242 (United States)
2014-07-15
Herpesvirus infection reorganizes components of the nuclear lamina usually without loss of integrity of the nuclear membranes. We report that wild-type HSV infection can cause dissolution of the nuclear envelope in transformed mouse embryonic fibroblasts that do not express torsinA. Nuclear envelope breakdown is accompanied by an eight-fold inhibition of virus replication. Breakdown of the membrane is much more limited during infection with viruses that lack the gB and gH genes, suggesting that breakdown involves factors that promote fusion at the nuclear membrane. Nuclear envelope breakdown is also inhibited during infection with virus that does not express UL34, but is enhanced when the US3 gene is deleted, suggesting that envelope breakdown may be enhanced by nuclear lamina disruption. Nuclear envelope breakdown cannot compensate for deletion of the UL34 gene suggesting that mixing of nuclear and cytoplasmic contents is insufficient to bypass loss of the normal nuclear egress pathway. - Highlights: • We show that wild-type HSV can induce breakdown of the nuclear envelope in a specific cell system. • The viral fusion proteins gB and gH are required for induction of nuclear envelope breakdown. • Nuclear envelope breakdown cannot compensate for deletion of the HSV UL34 gene.
Solitary Alfven wave envelopes and the modulational instability
International Nuclear Information System (INIS)
Kennel, C.F.
1987-06-01
The derivative nonlinear Schroedinger equation describes the modulational instability of circularly polarized dispersive Alfven wave envelopes. It also may be used to determine the properties of finite amplitude localized stationary wave envelopes. Such envelope solitons exist only in conditions of modulational stability. This leaves open the question of whether, and if so, how, the modulational instability produces envelope solitons. 12 refs
Genetic Diversity of Koala Retroviral Envelopes
Directory of Open Access Journals (Sweden)
Wenqin Xu
2015-03-01
Full Text Available Genetic diversity, attributable to the low fidelity of reverse transcription, recombination and mutation, is an important feature of infectious retroviruses. Under selective pressure, such as that imposed by superinfection interference, gammaretroviruses commonly adapt their envelope proteins to use alternative receptors to overcome this entry block. The first characterized koala retroviruses KoRV subgroup A (KoRV-A were remarkable in their absence of envelope genetic variability. Once it was determined that KoRV-A was present in all koalas in US zoos, regardless of their disease status, we sought to isolate a KoRV variant whose presence correlated with neoplastic malignancies. More than a decade after the identification of KoRV-A, we isolated a second subgroup of KoRV, KoRV-B from koalas with lymphomas. The envelope proteins of KoRV-A and KoRV-B are sufficiently divergent to confer the ability to bind and employ distinct receptors for infection. We have now obtained a number of additional KoRV envelope variants. In the present studies we report these variants, and show that they differ from KoRV-A and KoRV-B envelopes in their host range and superinfection interference properties. Thus, there appears to be considerable variation among KoRVs envelope genes suggesting genetic diversity is a factor following the KoRV-A infection process.
Energy Technology Data Exchange (ETDEWEB)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.
14 CFR 27.87 - Height-speed envelope.
2010-01-01
... applicable power failure condition in paragraph (b) of this section, a limiting height-speed envelope must be... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Height-speed envelope. 27.87 Section 27.87... STANDARDS: NORMAL CATEGORY ROTORCRAFT Flight Performance § 27.87 Height-speed envelope. (a) If there is any...
Wang, Xinhai; Kochetkova, Irina; Haddad, Asmahan; Hoyt, Teri; Hone, David M; Pascual, David W
2005-05-31
Receptor-mediated gene transfer using an M cell ligand has been shown to be an efficient method for mucosal DNA immunization. To investigate further into alternative M cell ligands, the plant lectin, Ulex europaeus agglutinin I (UEA-1), was tested. UEA-1 binds to human intestinal Caco-2 cells, and these cells can be transfected with poly-l-lysine (PL)-conjugated UEA-1 for expression of reporter cDNAs. When tested in vivo, mice nasally immunized with UEA-1-PL complexed to plasmid encoding HIV-1 envelope showed elevated systemic and mucosal antibody responses, and these were supported by tissue antibody-forming cells. Likewise, elevated envelope-specific CTLs were induced. Thus, UEA-1 mediated DNA delivery represents an alternative mucosal formulation for inducing humoral and cellular immunity against HIV-1.
Genome-wide dynamics of a bacterial response to antibiotics that target the cell envelope
Directory of Open Access Journals (Sweden)
Tran Ngat
2011-05-01
Full Text Available Abstract Background A decline in the discovery of new antibacterial drugs, coupled with a persistent rise in the occurrence of drug-resistant bacteria, has highlighted antibiotics as a diminishing resource. The future development of new drugs with novel antibacterial activities requires a detailed understanding of adaptive responses to existing compounds. This study uses Streptomyces coelicolor A3(2 as a model system to determine the genome-wide transcriptional response following exposure to three antibiotics (vancomycin, moenomycin A and bacitracin that target distinct stages of cell wall biosynthesis. Results A generalised response to all three antibiotics was identified which involves activation of transcription of the cell envelope stress sigma factor σE, together with elements of the stringent response, and of the heat, osmotic and oxidative stress regulons. Attenuation of this system by deletion of genes encoding the osmotic stress sigma factor σB or the ppGpp synthetase RelA reduced resistance to both vancomycin and bacitracin. Many antibiotic-specific transcriptional changes were identified, representing cellular processes potentially important for tolerance to each antibiotic. Sensitivity studies using mutants constructed on the basis of the transcriptome profiling confirmed a role for several such genes in antibiotic resistance, validating the usefulness of the approach. Conclusions Antibiotic inhibition of bacterial cell wall biosynthesis induces both common and compound-specific transcriptional responses. Both can be exploited to increase antibiotic susceptibility. Regulatory networks known to govern responses to environmental and nutritional stresses are also at the core of the common antibiotic response, and likely help cells survive until any specific resistance mechanisms are fully functional.
DEFF Research Database (Denmark)
Bahrami, Shervin; Jespersen, Thomas; Pedersen, Finn Skou
2003-01-01
The envelope protein of retroviruses is responsible for viral entry into host cells. Here, we describe a mutational library approach to dissect functional domains of the envelope protein involving a retroviral vector, which expresses both the envelope protein of Akv murine leukemia virus (MLV) an...
Erickson, James
Through manipulation of adaptable opportunities available within a given environment, individuals become active participants in managing personal comfort requirements, by exercising control over their comfort without the assistance of mechanical heating and cooling systems. Similarly, continuous manipulation of a building skin's form, insulation, porosity, and transmissivity qualities exerts control over the energy exchanged between indoor and outdoor environments. This research uses four adaptive response variables in a modified software algorithm to explore an adaptive building skin's potential in reacting to environmental stimuli with the purpose of minimizing energy use without sacrificing occupant comfort. Results illustrate that significant energy savings can be realized with adaptive envelopes over static building envelopes even under extreme summer and winter climate conditions; that the magnitude of these savings are dependent on climate and orientation; and that occupant thermal comfort can be improved consistently over comfort levels achieved by optimized static building envelopes. The resulting adaptive envelope's unique climate-specific behavior could inform designers in creating an intelligent kinetic aesthetic that helps facilitate adaptability and resiliency in architecture.
Directory of Open Access Journals (Sweden)
Markus Hoffmann
Full Text Available Bats (Chiroptera host major human pathogenic viruses including corona-, paramyxo, rhabdo- and filoviruses. We analyzed six different cell lines from either Yinpterochiroptera (including African flying foxes and a rhinolophid bat or Yangochiroptera (genera Carollia and Tadarida for susceptibility to infection by different enveloped RNA viruses. None of the cells were sensitive to infection by transmissible gastroenteritis virus (TGEV, a porcine coronavirus, or to infection mediated by the Spike (S protein of SARS-coronavirus (SARS-CoV incorporated into pseudotypes based on vesicular stomatitis virus (VSV. The resistance to infection was overcome if cells were transfected to express the respective cellular receptor, porcine aminopeptidase N for TGEV or angiotensin-converting enzyme 2 for SARS-CoV. VSV pseudotypes containing the S proteins of two bat SARS-related CoV (Bg08 and Rp3 were unable to infect any of the six tested bat cell lines. By contrast, viral pseudotypes containing the surface protein GP of Marburg virus from the family Filoviridae infected all six cell lines though at different efficiency. Notably, all cells were sensitive to infection by two paramyxoviruses (Sendai virus and bovine respiratory syncytial virus and three influenza viruses from different subtypes. These results indicate that bat cells are more resistant to infection by coronaviruses than to infection by paramyxoviruses, filoviruses and influenza viruses. Furthermore, these results show a receptor-dependent restriction of the infection of bat cells by CoV. The implications for the isolation of coronaviruses from bats are discussed.
Injection envelope matching in storage rings
International Nuclear Information System (INIS)
Minty, M.G.; Spence, W.L.
1995-05-01
The shape and size of the transverse phase space injected into a storage ring can be deduced from turn-by-turn measurements of the transient behavior of the beam envelope in the ring. Envelope oscillations at 2 x the β-tron frequency indicate the presence of a β-mismatch, while envelope oscillations at the β-tron frequency are the signature of a dispersion function mismatch. Experiments in injection optimization using synchrotron radiation imaging of the beam and a fast-gated camera at the SLC damping rings are reported
Envelope Protection for In-Flight Ice Contamination
Gingras, David R.; Barnhart, Billy P.; Ranaudo, Richard J.; Ratvasky, Thomas P.; Morelli, Eugene A.
2010-01-01
Fatal loss-of-control (LOC) accidents have been directly related to in-flight airframe icing. The prototype system presented in this paper directly addresses the need for real-time onboard envelope protection in icing conditions. The combinations of a-priori information and realtime aerodynamic estimations are shown to provide sufficient input for determining safe limits of the flight envelope during in-flight icing encounters. The Icing Contamination Envelope Protection (ICEPro) system has been designed and implemented to identify degradations in airplane performance and flying qualities resulting from ice contamination and provide safe flight-envelope cues to the pilot. Components of ICEPro are described and results from preliminary tests are presented.
DEFF Research Database (Denmark)
Foged, Isak Worre; Pasold, Anke
2015-01-01
The research studies the making of a responsive architectural envelope based on bi-materials. The bi-materials are organized according to a method that combines different isotropic metals and plastic into an active composite structure that reacts to temperature variations. Through an evolutionary......, environmental dynamics and occupancy dynamics. Lastly, a physical prototype is created, which illustrates the physical expression of the bi-materials and the problems related to manufacturing of these composite structures.......The research studies the making of a responsive architectural envelope based on bi-materials. The bi-materials are organized according to a method that combines different isotropic metals and plastic into an active composite structure that reacts to temperature variations. Through an evolutionary...
Joint Processing of Envelope Alignment and Phase Compensation for Isar Imaging
Chen, Tao; Jin, Guanghu; Dong, Zhen
2018-04-01
Range envelope alignment and phase compensation are spilt into two isolated parts in the classical methods of translational motion compensation in Inverse Synthetic Aperture Radar (ISAR) imaging. In classic method of the rotating object imaging, the two reference points of the envelope alignment and the Phase Difference (PD) estimation are probably not the same point, making it difficult to uncouple the coupling term by conducting the correction of Migration Through Resolution Cell (MTRC). In this paper, an improved approach of joint processing which chooses certain scattering point as the sole reference point is proposed to perform with utilizing the Prominent Point Processing (PPP) method. With this end in view, we firstly get the initial image using classical methods from which a certain scattering point can be chose. The envelope alignment and phase compensation using the selected scattering point as the same reference point are subsequently conducted. The keystone transform is thus smoothly applied to further improve imaging quality. Both simulation experiments and real data processing are provided to demonstrate the performance of the proposed method compared with classical method.
Analysis of Building Envelope Construction in 2003 CBECS
Energy Technology Data Exchange (ETDEWEB)
Winiarski, David W.; Halverson, Mark A.; Jiang, Wei
2007-06-01
The purpose of this analysis is to determine "typical" building envelope characteristics for buildings built after 1980. We address three envelope components in this paper - roofs, walls, and window area. These typical building envelope characteristics were used in the development of DOE’s Reference Buildings .
Characterization of a New Cell Envelope Proteinase PrtP from Lactobacillus rhamnosus CGMCC11055.
Guo, Tingting; Ouyang, Xudong; Xin, Yongping; Wang, Yue; Zhang, Susu; Kong, Jian
2016-09-21
Cell envelope proteinases (CEPs) play essential roles in lactic acid bacteria growth in milk and health-promoting properties of fermented dairy products. The genome of Lactobacillus rhamnosus CGMCC11055 possesses two putative CEP genes prtP and prtR2, and the PrtP displays the distinctive domain organization from PrtR2 reported. The PrtP was purified and biochemically characterized. The results showed that the optimal activity occurred at 44 °C, pH 6.5. p-Amidinophenylmethylsulfonyl fluoride obviously inhibited enzymatic activity, suggesting PrtP was a member of serine proteinases. Under the optimal conditions, β-casein was a favorite substrate over αS1- and κ-casein, and 35 oligopeptides were identified in the β-casein hydrolysate, including the phosphoserine peptide and bioactive isoleucine-proline-proline. By analysis of the amino acid sequences of those oligopeptides, proline was the preferred residue at the breakdown site. Therefore, we speculated that PrtP was a new type of CEPs from Lb. rhamnosus.
The South Carolina bridge-scour envelope curves
Benedict, Stephen T.; Feaster, Toby D.; Caldwell, Andral W.
2016-09-30
The U.S. Geological Survey, in cooperation with the South Carolina Department of Transportation, conducted a series of three field investigations to evaluate historical, riverine bridge scour in the Piedmont and Coastal Plain regions of South Carolina. These investigations included data collected at 231 riverine bridges, which lead to the development of bridge-scour envelope curves for clear-water and live-bed components of scour. The application and limitations of the South Carolina bridge-scour envelope curves were documented in four reports, each report addressing selected components of bridge scour. The current investigation (2016) synthesizes the findings of these previous reports into a guidance manual providing an integrated procedure for applying the envelope curves. Additionally, the investigation provides limited verification for selected bridge-scour envelope curves by comparing them to field data collected outside of South Carolina from previously published sources. Although the bridge-scour envelope curves have limitations, they are useful supplementary tools for assessing the potential for scour at riverine bridges in South Carolina.
Evolution of envelope solitons of ionization waves
International Nuclear Information System (INIS)
Ohe, K.; Hashimoto, M.
1985-01-01
The time evolution of a particle-like envelope soliton of ionization waves in plasma was investigated theoretically. The hydrodynamic equations of one spatial dimension were solved and the nonlinear dispersion relation was derived. For the amplitude of the wave the nonlinear Schroedinger equation was derived. Its soliton solution was interpreted as the envelope soliton which was experimentally found. The damping rate of the envelope soliton was estimated. (D.Gy.)
Directory of Open Access Journals (Sweden)
Junchen Chen
Full Text Available Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.
Chen, Junchen; Peng, Cong; Lei, Li; Zhang, Jianglin; Zeng, Weiqi; Chen, Xiang
2017-01-01
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.
Low-energy ion beam bombardment effect on the plant-cell-envelope mimetic membrane for DNA transfer
International Nuclear Information System (INIS)
Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L.D.
2012-01-01
This study is a systematic analysis of the mechanisms involved in ion-beam induced DNA transfer, an important application of ion beam biotechnology. Cellulose membranes were used to mimic the plant cell envelope. Ion beams of argon (Ar) or nitrogen (N) at an energy of 25 keV bombarded the cellulose membranes at fluences ranging from 10 15 to 10 16 ions/cm 2 . The damage to the ion-beam-bombarded membranes was characterized using infrared spectroscopy, a micro tensile test and scanning electron microscopy (SEM). Chain scission was the dominant radiation damage type in the membrane. DNA diffusion across the membrane was significantly increased after ion beam bombardment. The increase in DNA transfer is therefore attributed to chain scission, which increases the permeability by increasing the number of pores in the membrane.
Tsai, Y-S; Shiau, A-L; Chen, Y-F; Tsai, H-T; Tzai, T-S; Wu, C-L
2010-01-01
The objective of this study was to develop an HER2-targeted, envelope-modified Moloney murine leukemia virus (MoMLV)-based gammaretroviral vector carrying interleukin (IL)-12 gene for bladder cancer therapy. It displayed a chimeric envelope protein containing a single-chain variable fragment (scFv) antibody to the HER2 receptor and carried the mouse IL-12 gene. The fragment of anti-erbB2scFv was constructed into the proline-rich region of the viral envelope of the packaging vector lacking a transmembrane subunit of the carboxyl terminal region of surface subunit. As compared with envelope-unmodified gammaretroviruses, envelope-modified ones had extended viral tropism to human HER2-expressing bladder cancer cell lines, induced apoptosis, and affected cell cycle progression despite lower viral titers. Moreover, animal studies showed that envelope-modified gammaretroviruses carrying IL-12 gene exerted higher antitumor activity in terms of retarding tumor growth and prolonging the survival of tumor-bearing mice than unmodified ones, which were associated with enhanced tumor cell apoptosis as well as increased intratumoral levels of IL-12, interferon-gamma, IL-1beta, and tumor necrosis factor-alpha proteins. Therefore, the antitumor activity of gammaretroviruses carrying the IL-12 gene was enhanced through genetic modification of the envelope targeting HER2 receptor, which may be a promising strategy for bladder cancer therapy.
Sliepen, Kwinten; Ozorowski, Gabriel; Burger, Judith A.; van Montfort, Thijs; Stunnenberg, Melissa; Labranche, Celia; Montefiori, David C.; Moore, John P.; Ward, Andrew B.; Sanders, Rogier W.
2015-01-01
Background: Presenting vaccine antigens in particulate form can improve their immunogenicity by enhancing B cell activation. Findings: We describe ferritin-based protein nanoparticles that display multiple copies of native-like HIV-1 envelope glycoprotein trimers (BG505 SOSIP.664). Trimer-bearing
International Nuclear Information System (INIS)
Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.
2013-01-01
Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants
Energy Technology Data Exchange (ETDEWEB)
Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)
2013-07-05
Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.
200 Area Deactivation Project Facilities Authorization Envelope Document
International Nuclear Information System (INIS)
DODD, E.N.
2000-01-01
Project facilities as required by HNF-PRO-2701, Authorization Envelope and Authorization Agreement. The Authorization Agreements (AA's) do not identify the specific set of environmental safety and health requirements that are applicable to the facility. Therefore, the facility Authorization Envelopes are defined here to identify the applicable requirements. This document identifies the authorization envelopes for the 200 Area Deactivation
Acral peeling skin syndrome: a clinically and genetically heterogeneous disorder.
Pavlovic, Sasha; Krunic, Aleksandar L; Bulj, Tanja K; Medenica, Maria M; Fong, Kenneth; Arita, Ken; McGrath, John A
2012-01-01
Acral peeling skin syndrome (APSS) is a rare, autosomal, recessive genodermatosis characterized by painless spontaneous exfoliation of the skin of the hands and feet at a subcorneal or intracorneal level. It usually presents at birth or appears later in childhood or early adulthood. Some cases result from mutations in the TGM5 gene that encodes transglutaminase 5, which has an important role in cross-linking cornified cell envelope proteins. We report a new APSS pedigree from Jordan that contains at least 10 affected family members, although sequencing of the TGM5 gene failed to disclose any pathogenic mutation(s). On the basis of probable consanguinity, we performed homozygosity mapping and identified areas of homozygosity on chromosomes 1, 6, 10, 13, and 16, although none of the intervals contained genes of clear relevance to cornification. APSS is a clinically and genetically heterogeneous disorder, and this Jordanian pedigree underscores the likelihood of still further heterogeneity. © 2011 Wiley Periodicals, Inc.
Learning from eponyms: George F. Odland and Odland bodies
Directory of Open Access Journals (Sweden)
Rajiv Joshi
2014-01-01
Full Text Available Odland bodies (lamellar bodies are small sub-cellular structures of size 200-300 nm that are present in the upper spinous and granular cell layers of the epidermis. These act as processing and repository areas for lipids that contribute to the epidermal permeability barrier. They also contain proteases, cathepsin D, kallikrein and other proteins including corneo-desmosins. Recent information also credits them with a role in the local innate immune response as they contain beta 2 defensins, which are anti-microbial peptides with potent activity against Gram-negative bacteria and candida. Odland bodies are important for maintaining homeostasis of the epidermis and are involved in epidermal permeability barrier function, desquamation of keratinocytes, formation of the cornified envelope and in local anti-microbial immunity. This article reviews the structure and functions of these bodies with a brief biography of George F. Odland who first described these bodies in 1960 and whose name is eponymically associated with them.
Low-energy ion beam bombardment effect on the plant-cell-envelope mimetic membrane for DNA transfer
Energy Technology Data Exchange (ETDEWEB)
Prakrajang, K., E-mail: k.prakrajang@gmail.com [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K.; Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Wanichapichart, P. [Membrane Science and Technology Research Center, Department of Physics, Faculty of Science, Prince of Songkla University, Hat Yai, Songkla 90112 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.th [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)
2012-09-01
This study is a systematic analysis of the mechanisms involved in ion-beam induced DNA transfer, an important application of ion beam biotechnology. Cellulose membranes were used to mimic the plant cell envelope. Ion beams of argon (Ar) or nitrogen (N) at an energy of 25 keV bombarded the cellulose membranes at fluences ranging from 10{sup 15} to 10{sup 16} ions/cm{sup 2}. The damage to the ion-beam-bombarded membranes was characterized using infrared spectroscopy, a micro tensile test and scanning electron microscopy (SEM). Chain scission was the dominant radiation damage type in the membrane. DNA diffusion across the membrane was significantly increased after ion beam bombardment. The increase in DNA transfer is therefore attributed to chain scission, which increases the permeability by increasing the number of pores in the membrane.
Do projections from bioclimatic envelope models and climate change metrics match?
DEFF Research Database (Denmark)
Garcia, Raquel A.; Cabeza, Mar; Altwegg, Res
2016-01-01
as indicators of the exposure of species to climate change. Here, we investigate whether these two approaches provide qualitatively similar indications about where biodiversity is potentially most exposed to climate change. Location: Sub-Saharan Africa. Methods: We compared a range of climate change metrics...... for sub-Saharan Africa with ensembles of bioclimatic envelope models for 2723 species of amphibians, snakes, mammals and birds. For each taxonomic group, we performed three comparisons between the two approaches: (1) is projected change in local climatic suitability (models) greater in grid cells...... between the two approaches was found for all taxonomic groups, although it was stronger for species with a narrower climatic envelope breadth. Main conclusions: For sub-Saharan African vertebrates, projected patterns of exposure to climate change given by climate change metrics alone were qualitatively...
Featured Image: Orbiting Stars Share an Envelope
Kohler, Susanna
2016-03-01
This beautiful series of snapshots from a simulation (click for a better look!) shows what happens when two stars in a binary system become enclosed in the same stellar envelope. In this binary system, one of the stars has exhausted its hydrogen fuel and become a red giant, complete with an expanding stellar envelope composed of hydrogen and helium. Eventually, the envelope expands so much that the companion star falls into it, where it releases gravitational potential energy into the common envelope. A team led by Sebastian Ohlmann (Heidelberg Institute for Theoretical Studies and University of Wrzburg) recently performed hydrodynamic simulations of this process. Ohlmann and collaborators discovered that the energy release eventually triggers large-scale flow instabilities, which leads to turbulence within the envelope. This process has important consequences for how these systems next evolve (for instance, determining whether or not a supernova occurs!). You can check out the authors video of their simulated stellar inspiral below, or see their paper for more images and results from their study.CitationSebastian T. Ohlmann et al 2016 ApJ 816 L9. doi:10.3847/2041-8205/816/1/L9
Mechanism of protein import across the chloroplast envelope.
Chen, K; Chen, X; Schnell, D J
2000-01-01
The development and maintenance of chloroplasts relies on the contribution of protein subunits from both plastid and nuclear genomes. Most chloroplast proteins are encoded by nuclear genes and are post-translationally imported into the organelle across the double membrane of the chloroplast envelope. Protein import into the chloroplast consists of two essential elements: the specific recognition of the targeting signals (transit sequences) of cytoplasmic preproteins by receptors at the outer envelope membrane and the subsequent translocation of preproteins simultaneously across the double membrane of the envelope. These processes are mediated via the co-ordinate action of protein translocon complexes in the outer (Toc apparatus) and inner (Tic apparatus) envelope membranes.
The performance of energy efficient residential building envelope systems
Energy Technology Data Exchange (ETDEWEB)
Proskiw, G.
1996-08-01
The adequacy and durability of residential building envelope systems under actual field conditions were evaluated. A building envelope offers protection from cold, heat, moisture, wind and noise. However, they are exposed to thermal, structural, and moisture stresses and their performance can degrade over time. Envelope performance was evaluated at 20 energy efficient and four conventional, detached modern homes in Winnipeg, Canada. The three complementary measurement tools were wood moisture content (WMC) of framing members, thermographic examinations, and airtightness tests. As expected, energy efficient building envelope systems performed better than the conventional systems. No evidence of envelope degradation was found in any of the energy efficient houses. The building envelopes using polyethylene air barriers performed slightly better than those which used the airtight drywall approach, although both were considered satisfactory. WMC levels were a bit lower in the polyethylene-clad house. 1 ref., 1 tab.
Neural Spike-Train Analyses of the Speech-Based Envelope Power Spectrum Model
Rallapalli, Varsha H.
2016-01-01
Diagnosing and treating hearing impairment is challenging because people with similar degrees of sensorineural hearing loss (SNHL) often have different speech-recognition abilities. The speech-based envelope power spectrum model (sEPSM) has demonstrated that the signal-to-noise ratio (SNRENV) from a modulation filter bank provides a robust speech-intelligibility measure across a wider range of degraded conditions than many long-standing models. In the sEPSM, noise (N) is assumed to: (a) reduce S + N envelope power by filling in dips within clean speech (S) and (b) introduce an envelope noise floor from intrinsic fluctuations in the noise itself. While the promise of SNRENV has been demonstrated for normal-hearing listeners, it has not been thoroughly extended to hearing-impaired listeners because of limited physiological knowledge of how SNHL affects speech-in-noise envelope coding relative to noise alone. Here, envelope coding to speech-in-noise stimuli was quantified from auditory-nerve model spike trains using shuffled correlograms, which were analyzed in the modulation-frequency domain to compute modulation-band estimates of neural SNRENV. Preliminary spike-train analyses show strong similarities to the sEPSM, demonstrating feasibility of neural SNRENV computations. Results suggest that individual differences can occur based on differential degrees of outer- and inner-hair-cell dysfunction in listeners currently diagnosed into the single audiological SNHL category. The predicted acoustic-SNR dependence in individual differences suggests that the SNR-dependent rate of susceptibility could be an important metric in diagnosing individual differences. Future measurements of the neural SNRENV in animal studies with various forms of SNHL will provide valuable insight for understanding individual differences in speech-in-noise intelligibility.
Schlecht-Louf, Géraldine; Mangeney, Marianne; El-Garch, Hanane; Lacombe, Valérie; Poulet, Hervé; Heidmann, Thierry
2014-01-01
We previously delineated a highly conserved immunosuppressive (IS) domain within murine and primate retroviral envelope proteins that is critical for virus propagation in vivo. The envelope-mediated immunosuppression was assessed by the ability of the proteins, when expressed by allogeneic tumor cells normally rejected by engrafted mice, to allow these cells to escape, at least transiently, immune rejection. Using this approach, we identified key residues whose mutation (i) specifically abolishes immunosuppressive activity without affecting the "mechanical" function of the envelope protein and (ii) significantly enhances humoral and cellular immune responses elicited against the virus. The objective of this work was to study the immunosuppressive activity of the envelope protein (p15E) of feline leukemia virus (FeLV) and evaluate the effect of its abolition on the efficacy of a vaccine against FeLV. Here we demonstrate that the FeLV envelope protein is immunosuppressive in vivo and that this immunosuppressive activity can be "switched off" by targeted mutation of a specific amino acid. As a result of the introduction of the mutated envelope sequence into a previously well characterized canarypox virus-vectored vaccine (ALVAC-FeLV), the frequency of vaccine-induced FeLV-specific gamma interferon (IFN-γ)-producing cells was increased, whereas conversely, the frequency of vaccine-induced FeLV-specific interleukin-10 (IL-10)-producing cells was reduced. This shift in the IFN-γ/IL-10 response was associated with a higher efficacy of ALVAC-FeLV against FeLV infection. This study demonstrates that FeLV p15E is immunosuppressive in vivo, that the immunosuppressive domain of p15E can modulate the FeLV-specific immune response, and that the efficacy of FeLV vaccines can be enhanced by inhibiting the immunosuppressive activity of the IS domain through an appropriate mutation.
Implementation of an Improved Safe Operating Envelope
International Nuclear Information System (INIS)
Prime, Robyn; McIntyre, Mark; Reeves, David
2008-01-01
This paper is a continuation of the paper presented at IYNC 2004 on 'The Definition of a Safe Operating Envelope'. The current paper concentrates on the implementation process of the Safe Operating Envelope employed at the Point Lepreau Generating Station. (authors)
Directory of Open Access Journals (Sweden)
Anshuman Das
2017-09-01
Full Text Available Receptor molecules play key roles in the cellular entry of picornaviruses, and TIM1 (HAVCR1 is widely accepted to be the receptor for hepatitis A virus (HAV, an unusual, hepatotropic human picornavirus. However, its identification as the hepatovirus receptor predated the discovery that hepatoviruses undergo nonlytic release from infected cells as membrane-cloaked, quasi-enveloped HAV (eHAV virions that enter cells via a pathway distinct from naked, nonenveloped virions. We thus revisited the role of TIM1 in hepatovirus entry, examining both adherence and infection/replication in cells with clustered regularly interspaced short palindromic repeat (CRISPR/Cas9-engineered TIM1 knockout. Cell culture-derived, gradient-purified eHAV bound Huh-7.5 human hepatoma cells less efficiently than naked HAV at 4°C, but eliminating TIM1 expression caused no difference in adherence of either form of HAV, nor any impact on infection and replication in these cells. In contrast, TIM1-deficient Vero cells showed a modest reduction in quasi-enveloped eHAV (but not naked HAV attachment and replication. Thus, TIM1 facilitates quasi-enveloped eHAV entry in Vero cells, most likely by binding phosphatidylserine (PtdSer residues on the eHAV membrane. Both Tim1−/− Ifnar1−/− and Tim4−/− Ifnar1−/− double-knockout mice were susceptible to infection upon intravenous challenge with infected liver homogenate, with fecal HAV shedding and serum alanine aminotransferase (ALT elevations similar to those in Ifnar1−/− mice. However, intrahepatic HAV RNA and ALT elevations were modestly reduced in Tim1−/−Ifnar1−/− mice compared to Ifnar1−/− mice challenged with a lower titer of gradient-purified HAV or eHAV. We conclude that TIM1 is not an essential hepatovirus entry factor, although its PtdSer-binding activity may contribute to the spread of quasi-enveloped virus and liver injury in mice.
Directory of Open Access Journals (Sweden)
Douglas E H Hartley
Full Text Available Evidence from human psychophysical and animal electrophysiological studies suggests that sensitivity to interaural time delay (ITD in the modulating envelope of a high-frequency carrier can be enhanced using half-wave rectified stimuli. Recent evidence has shown potential benefits of equivalent electrical stimuli to deaf individuals with bilateral cochlear implants (CIs. In the current study we assessed the effects of envelope shape on ITD sensitivity in the primary auditory cortex of normal-hearing ferrets, and profoundly-deaf animals with bilateral CIs. In normal-hearing animals, cortical sensitivity to ITDs (±1 ms in 0.1-ms steps was assessed in response to dichotically-presented i sinusoidal amplitude-modulated (SAM and ii half-wave rectified (HWR tones (100-ms duration; 70 dB SPL presented at the best-frequency of the unit over a range of modulation frequencies. In separate experiments, adult ferrets were deafened with neomycin administration and bilaterally-implanted with intra-cochlear electrode arrays. Electrically-evoked auditory brainstem responses (EABRs were recorded in response to bipolar electrical stimulation of the apical pair of electrodes with singe biphasic current pulses (40 µs per phase over a range of current levels to measure hearing thresholds. Subsequently, we recorded cortical sensitivity to ITDs (±800 µs in 80-µs steps within the envelope of SAM and HWR biphasic-pulse trains (40 µs per phase; 6000 pulses per second, 100-ms duration over a range of modulation frequencies. In normal-hearing animals, nearly a third of cortical neurons were sensitive to envelope-ITDs in response to SAM tones. In deaf animals with bilateral CI, the proportion of ITD-sensitive cortical neurons was approximately a fifth in response to SAM pulse trains. In normal-hearing and deaf animals with bilateral CI the proportion of ITD sensitive units and neural sensitivity to ITDs increased in response to HWR, compared with SAM stimuli
Infectious Entry Pathway Mediated by the Human Endogenous Retrovirus K Envelope Protein.
Robinson, Lindsey R; Whelan, Sean P J
2016-01-20
Endogenous retroviruses (ERVs), the majority of which exist as degraded remnants of ancient viruses, comprise approximately 8% of the human genome. The youngest human ERVs (HERVs) belong to the HERV-K(HML-2) subgroup and were endogenized within the past 1 million years. The viral envelope protein (ENV) facilitates the earliest events of endogenization (cellular attachment and entry), and here, we characterize the requirements for HERV-K ENV to mediate infectious cell entry. Cell-cell fusion assays indicate that a minimum of two events are required for fusion, proteolytic processing by furin-like proteases and exposure to acidic pH. We generated an infectious autonomously replicating recombinant vesicular stomatitis virus (VSV) in which the glycoprotein was replaced by HERV-K ENV. HERV-K ENV imparts an endocytic entry pathway that requires dynamin-mediated membrane scission and endosomal acidification but is distinct from clathrin-dependent or macropinocytic uptake pathways. The lack of impediments to the replication of the VSV core in eukaryotic cells allowed us to broadly survey the HERV-K ENV-dictated tropism. Unlike extant betaretroviral envelopes, which impart a narrow species tropism, we found that HERV-K ENV mediates broad tropism encompassing cells from multiple mammalian and nonmammalian species. We conclude that HERV-K ENV dictates an evolutionarily conserved entry pathway and that the restriction of HERV-K to primate genomes reflects downstream stages of the viral replication cycle. Approximately 8% of the human genome is of retroviral origin. While many of those viral genomes have become inactivated, some copies of the most recently endogenized human retrovirus, HERV-K, can encode individual functional proteins. Here, we characterize the envelope protein (ENV) of the virus to define how it mediates infection of cells. We demonstrate that HERV-K ENV undergoes a proteolytic processing step and triggers membrane fusion in response to acidic pH--a strategy
Directory of Open Access Journals (Sweden)
Bading Hilmar
2007-07-01
Full Text Available Abstract Background In hippocampal neurons, nuclear calcium signaling is important for learning- and neuronal survival-associated gene expression. However, it is unknown whether calcium signals generated by neuronal activity at the cell membrane and propagated to the soma can unrestrictedly cross the nuclear envelope to invade the nucleus. The nuclear envelope, which allows ion transit via the nuclear pore complex, may represent a barrier for calcium and has been suggested to insulate the nucleus from activity-induced cytoplasmic calcium transients in some cell types. Results Using laser-assisted uncaging of caged calcium compounds in defined sub-cellular domains, we show here that the nuclear compartment border does not represent a barrier for calcium signals in hippocampal neurons. Although passive diffusion of molecules between the cytosol and the nucleoplasm may be modulated through changes in conformational state of the nuclear pore complex, we found no evidence for a gating mechanism for calcium movement across the nuclear border. Conclusion Thus, the nuclear envelope does not spatially restrict calcium transients to the somatic cytosol but allows calcium signals to freely enter the cell nucleus to trigger genomic events.
Energy Technology Data Exchange (ETDEWEB)
Oliva, N [Ontario Hydro, Toronto, ON (Canada)
1997-12-01
Safe Operating Envelope is described representing: The outer bound of plant conditions within which day-to-day plant operation must be maintained in order to comply with regulatory requirements, associated safety design criteria and corporate nuclear safety goals. Figs.
International Nuclear Information System (INIS)
Oliva, N.
1997-01-01
Safe Operating Envelope is described representing: The outer bound of plant conditions within which day-to-day plant operation must be maintained in order to comply with regulatory requirements, associated safety design criteria and corporate nuclear safety goals. Figs
Phytochrome regulates GTP-binding protein activity in the envelope of pea nuclei
Clark, G. B.; Memon, A. R.; Thompson, G. A. Jr; Roux, S. J.
1993-01-01
Three GTP-binding proteins with apparent molecular masses of 27, 28 and 30 kDa have been detected in isolated nuclei of etiolated pea plumules. After LDS-PAGE and transfer to nitrocellulose these proteins bind [32P]GTP in the presence of excess ATP, suggesting that they are monomeric G proteins. When nuclei are disrupted, three proteins co-purify with the nuclear envelope fraction and are highly enriched in this fraction. The level of [32P]GTP-binding for all three protein bands is significantly increased when harvested pea plumules are irradiated by red light, and this effect is reversed by far-red light. The results indicate that GTP-binding activity associated with the nuclear envelope of plant cells is photoreversibly regulated by the pigment phytochrome.
Safeguards Envelope Progress FY08
Energy Technology Data Exchange (ETDEWEB)
Robert Bean; Richard Metcalf; Aaron Bevill
2008-09-01
The Safeguards Envelope Project met its milestones by creating a rudimentary safeguards envelope, proving the value of the approach on a small scale, and determining the most appropriate path forward. The Idaho Chemical Processing Plant’s large cache of reprocessing process monitoring data, dubbed UBER Data, was recovered and used in the analysis. A probabilistic Z test was used on a Markov Monte Carlo simulation of expected diversion data when compared with normal operating data. The data regarding a fully transient event in a tank was used to create a simple requirement, representative of a safeguards envelope, whose impact was a decrease in operating efficiency by 1.3% but an increase in material balance period of 26%. This approach is operator, state, and international safeguards friendly and should be applied to future reprocessing plants. Future requirements include tank-to-tank correlations in reprocessing facilities, detailed operations impact studies, simulation inclusion, automated optimization, advanced statistics analysis, and multi-attribute utility analysis.
Safeguards Envelope Progress FY08
International Nuclear Information System (INIS)
Bean, Robert; Metcalf, Richard; Bevill, Aaron
2008-01-01
The Safeguards Envelope Project met its milestones by creating a rudimentary safeguards envelope, proving the value of the approach on a small scale, and determining the most appropriate path forward. The Idaho Chemical Processing Plant's large cache of reprocessing process monitoring data, dubbed UBER Data, was recovered and used in the analysis. A probabilistic Z test was used on a Markov Monte Carlo simulation of expected diversion data when compared with normal operating data. The data regarding a fully transient event in a tank was used to create a simple requirement, representative of a safeguards envelope, whose impact was a decrease in operating efficiency by 1.3% but an increase in material balance period of 26%. This approach is operator, state, and international safeguards friendly and should be applied to future reprocessing plants. Future requirements include tank-to-tank correlations in reprocessing facilities, detailed operations impact studies, simulation inclusion, automated optimization, advanced statistics analysis, and multi-attribute utility analysis
Human broadly neutralizing antibodies to the envelope glycoprotein complex of hepatitis C virus
DEFF Research Database (Denmark)
Giang, Erick; Dorner, Marcus; Prentoe, Jannick C
2012-01-01
, and an effective vaccine should target conserved T- and B-cell epitopes of the virus. Conserved B-cell epitopes overlapping the CD81 receptor-binding site (CD81bs) on the E2 viral envelope glycoprotein have been reported previously and provide promising vaccine targets. In this study, we isolated 73 human m......Abs recognizing five distinct antigenic regions on the virus envelope glycoprotein complex E1E2 from an HCV-immune phage-display antibody library by using an exhaustive-panning strategy. Many of these mAbs were broadly neutralizing. In particular, the mAb AR4A, recognizing a discontinuous epitope outside the CD81......bs on the E1E2 complex, has an exceptionally broad neutralizing activity toward diverse HCV genotypes and protects against heterologous HCV challenge in a small animal model. The mAb panel will be useful for the design and development of vaccine candidates to elicit broadly neutralizing antibodies...
Physical properties of the red giant envelopes
Energy Technology Data Exchange (ETDEWEB)
Maciel, W J [Instituto de Astronomia e Geofisico da Universidade de Sao Paulo (Brazil)
1978-12-01
In this work, several model envelopes are calculated for cool giant stars with mass loss due to the action of stellar radiation pressure on molecules and grains. Molecular profiles as well as average values of some physical parameters of the envelopes are obtained.
Implementation of an Improved Safe Operating Envelope
Energy Technology Data Exchange (ETDEWEB)
Prime, Robyn; McIntyre, Mark [NB Power Nuclear, P.O. Box 600, Lepreau, NB (Canada); Reeves, David [Atlantic Nuclear Services Ltd., PO Box 1268 Fredericton, NB (Canada)
2008-07-01
This paper is a continuation of the paper presented at IYNC 2004 on 'The Definition of a Safe Operating Envelope'. The current paper concentrates on the implementation process of the Safe Operating Envelope employed at the Point Lepreau Generating Station. (authors)
Physical properties of the red giant envelopes
International Nuclear Information System (INIS)
Maciel, W.J.
1978-01-01
In this work, several model envelopes are calculated for cool giant stars with mass loss due to the action of stellar radiation pressure on molecules and grains. Molecular profiles as well as average values of some physical parameters of the envelopes are obtained [pt
Full waveform inversion using envelope-based global correlation norm
Oh, Ju-Won; Alkhalifah, Tariq
2018-05-01
To increase the feasibility of full waveform inversion on real data, we suggest a new objective function, which is defined as the global correlation of the envelopes of modelled and observed data. The envelope-based global correlation norm has the advantage of the envelope inversion that generates artificial low-frequency information, which provides the possibility to recover long-wavelength structure in an early stage. In addition, the envelope-based global correlation norm maintains the advantage of the global correlation norm, which reduces the sensitivity of the misfit to amplitude errors so that the performance of inversion on real data can be enhanced when the exact source wavelet is not available and more complex physics are ignored. Through the synthetic example for 2-D SEG/EAGE overthrust model with inaccurate source wavelet, we compare the performance of four different approaches, which are the least-squares waveform inversion, least-squares envelope inversion, global correlation norm and envelope-based global correlation norm. Finally, we apply the envelope-based global correlation norm on the 3-D Ocean Bottom Cable (OBC) data from the North Sea. The envelope-based global correlation norm captures the strong reflections from the high-velocity caprock and generates artificial low-frequency reflection energy that helps us recover long-wavelength structure of the model domain in the early stages. From this long-wavelength model, the conventional global correlation norm is sequentially applied to invert for higher-resolution features of the model.
Aoki, Keita; Shiwa, Yuh; Takada, Hiraku; Yoshikawa, Hirofumi; Niki, Hironori
2013-09-01
Three types of mitosis, which are open, closed or semi-open mitosis, function in eukaryotic cells, respectively. The open mitosis involves breakage of the nuclear envelope before nuclear division, whereas the closed mitosis proceeds with an intact nuclear envelope. To understand the mechanism and significance of three types of mitotic division in eukaryotes, we investigated the process of semi-open mitosis, in which the nuclear envelope is only partially broken, in the fission yeast Schizosaccharomyces japonicus. In anaphase-promoting complex/cyclosome (APC/C) mutants of Sz. japonicus, the nuclear envelope remained relatively intact during anaphase, resulting in impaired semi-open mitosis. As a suppressor of apc2 mutant, a mutation of Oar2, which was a 3-oxoacyl-[acyl carrier protein] reductase, was obtained. The level of the Oar2, which had two destruction-box motifs recognized by APC/C, was increased in APC/C mutants. Furthermore, the defective semi-open mitosis observed in an apc2 mutant was restored by mutated oar2+. Based on these findings, we propose that APC/C regulates the dynamics of the nuclear envelope through degradation of Oar2 dependent on APC/C during the metaphase-to-anaphase transition of semi-open mitosis in Sz. japonicus. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
Inhibition of enveloped viruses infectivity by curcumin.
Directory of Open Access Journals (Sweden)
Tzu-Yen Chen
Full Text Available Curcumin, a natural compound and ingredient in curry, has antiinflammatory, antioxidant, and anticarcinogenic properties. Previously, we reported that curcumin abrogated influenza virus infectivity by inhibiting hemagglutination (HA activity. This study demonstrates a novel mechanism by which curcumin inhibits the infectivity of enveloped viruses. In all analyzed enveloped viruses, including the influenza virus, curcumin inhibited plaque formation. In contrast, the nonenveloped enterovirus 71 remained unaffected by curcumin treatment. We evaluated the effects of curcumin on the membrane structure using fluorescent dye (sulforhodamine B; SRB-containing liposomes that mimic the viral envelope. Curcumin treatment induced the leakage of SRB from these liposomes and the addition of the influenza virus reduced the leakage, indicating that curcumin disrupts the integrity of the membranes of viral envelopes and of liposomes. When testing liposomes of various diameters, we detected higher levels of SRB leakage from the smaller-sized liposomes than from the larger liposomes. Interestingly, the curcumin concentration required to reduce plaque formation was lower for the influenza virus (approximately 100 nm in diameter than for the pseudorabies virus (approximately 180 nm and the vaccinia virus (roughly 335 × 200 × 200 nm. These data provide insights on the molecular antiviral mechanisms of curcumin and its potential use as an antiviral agent for enveloped viruses.
Inhibition of Enveloped Viruses Infectivity by Curcumin
Wen, Hsiao-Wei; Ou, Jun-Lin; Chiou, Shyan-Song; Chen, Jo-Mei; Wong, Min-Liang; Hsu, Wei-Li
2013-01-01
Curcumin, a natural compound and ingredient in curry, has antiinflammatory, antioxidant, and anticarcinogenic properties. Previously, we reported that curcumin abrogated influenza virus infectivity by inhibiting hemagglutination (HA) activity. This study demonstrates a novel mechanism by which curcumin inhibits the infectivity of enveloped viruses. In all analyzed enveloped viruses, including the influenza virus, curcumin inhibited plaque formation. In contrast, the nonenveloped enterovirus 71 remained unaffected by curcumin treatment. We evaluated the effects of curcumin on the membrane structure using fluorescent dye (sulforhodamine B; SRB)-containing liposomes that mimic the viral envelope. Curcumin treatment induced the leakage of SRB from these liposomes and the addition of the influenza virus reduced the leakage, indicating that curcumin disrupts the integrity of the membranes of viral envelopes and of liposomes. When testing liposomes of various diameters, we detected higher levels of SRB leakage from the smaller-sized liposomes than from the larger liposomes. Interestingly, the curcumin concentration required to reduce plaque formation was lower for the influenza virus (approximately 100 nm in diameter) than for the pseudorabies virus (approximately 180 nm) and the vaccinia virus (roughly 335 × 200 × 200 nm). These data provide insights on the molecular antiviral mechanisms of curcumin and its potential use as an antiviral agent for enveloped viruses. PMID:23658730
Cai, Lifeng; Gochin, Miriam; Liu, Keliang
2011-12-01
Human immunodeficiency virus type 1 (HIV-1), the pathogen of acquired immunodeficiency syndrome (AIDS), causes ~2 millions death every year and still defies an effective vaccine. HIV-1 infects host cells through envelope protein - mediated virus-cell fusion. The transmembrane subunit of envelope protein, gp41, is the molecular machinery which facilitates fusion. Its ectodomain contains several distinguishing functional domains, fusion peptide (FP), Nterminal heptad repeat (NHR), C-terminal heptad repeat (CHR) and membrane proximal extracellular region (MPER). During the fusion process, FP inserts into the host cell membrane, and an extended gp41 prehairpin conformation bridges the viral and cell membranes through MPER and FP respectively. Subsequent conformational change of the unstable prehairpin results in a coiled-coil 6-helix bundle (6HB) structure formed between NHR and CHR. The energetics of 6HB formation drives membrane apposition and fusion. Drugs targeting gp41 functional domains to prevent 6HB formation inhibit HIV-1 infection. T20 (enfuvirtide, Fuzeon) was approved by the US FDA in 2003 as the first fusion inhibitor. It is a 36-residue peptide from the gp41 CHR, and it inhibits 6HB formation by targeting NHR and lipids. Development of new fusion inhibitors, especially small molecule drugs, is encouraged to overcome the shortcomings of T20 as a peptide drug. Hydrophobic characteristics and membrane association are critical for gp41 function and mechanism of action. Research in gp41-membrane interactions, using peptides corresponding to specific functional domains, or constructs including several interactive domains, are reviewed here to get a better understanding of gp41 mediated virus-cell fusion that can inform or guide the design of new HIV-1 fusion inhibitors.
Alloxan-induced diabetes and insulin resistant effects on ovulation
African Journals Online (AJOL)
Dr Olaleye
characterized based on the proportion of 3 cell types. (epithelial cells, cornified cells, and leukocytes) observed in the vaginal smear. Diabetes mellitus has been shown to interfere with ..... (1996). Altered prostanoid production by cumulus- oocyte complexes in a rat model of non-insulin- dependent diabetes mellitus.
Moisture accumulation in a building envelope
Energy Technology Data Exchange (ETDEWEB)
Forest, T.W.; Checkwitch, K.
1988-09-01
In a large number of cases, the failure of a building envelope can be traced to the accumulation of moisture. In a cold winter climate, characteristic of the Canadian prairies, moisture is deposited in the structure by the movement of warm, moist air through the envelope. Tests on the moisture accumulation in a building envelope were initiated in a test house at an Alberta research facility during the 1987/88 heating season. The indoor moisture generation rate was measured and compared with the value inferred from the measured air infiltration rate. With the flue open, the moisture generation rate was approximately 5.5 kg/d of which 0.7 kg/d entered the building envelope; the remainder was exhausted through the flue. With the flue blocked, the moisture generation rate decreased to 3.4 kg/d, while the amount of moisture migrating through the envelope increased to 4.0 kg/d. The moisture accumulation in wall panels located on the north and south face of the test house was also monitored. Moisture was allowed to enter the wall cavity via a hole in the drywall. The fiberglass insulation remained dry throughout the test period. The moisture content of the exterior sheathing of the north panel increased to a maximum of 18% wt in the vicinity of the hole, but quickly dried when the ambient temperatures increased towards the end of the season. The south panel showed very little moisture accumlation due to the effects of solar radiation. 14 refs., 9 figs.
A Spectral Algorithm for Envelope Reduction of Sparse Matrices
Barnard, Stephen T.; Pothen, Alex; Simon, Horst D.
1993-01-01
The problem of reordering a sparse symmetric matrix to reduce its envelope size is considered. A new spectral algorithm for computing an envelope-reducing reordering is obtained by associating a Laplacian matrix with the given matrix and then sorting the components of a specified eigenvector of the Laplacian. This Laplacian eigenvector solves a continuous relaxation of a discrete problem related to envelope minimization called the minimum 2-sum problem. The permutation vector computed by the spectral algorithm is a closest permutation vector to the specified Laplacian eigenvector. Numerical results show that the new reordering algorithm usually computes smaller envelope sizes than those obtained from the current standard algorithms such as Gibbs-Poole-Stockmeyer (GPS) or SPARSPAK reverse Cuthill-McKee (RCM), in some cases reducing the envelope by more than a factor of two.
Directory of Open Access Journals (Sweden)
Bruno Hernáez
2016-04-01
Full Text Available African swine fever virus (ASFV is a nucleocytoplasmic large DNA virus (NCLDV that causes a highly lethal disease in domestic pigs. As other NCLDVs, the extracellular form of ASFV possesses a multilayered structure consisting of a genome-containing nucleoid successively wrapped by a thick protein core shell, an inner lipid membrane, an icosahedral protein capsid and an outer lipid envelope. This structural complexity suggests an intricate mechanism of internalization in order to deliver the virus genome into the cytoplasm. By using flow cytometry in combination with pharmacological entry inhibitors, as well as fluorescence and electron microscopy approaches, we have dissected the entry and uncoating pathway used by ASFV to infect the macrophage, its natural host cell. We found that purified extracellular ASFV is internalized by both constitutive macropinocytosis and clathrin-mediated endocytosis. Once inside the cell, ASFV particles move from early endosomes or macropinosomes to late, multivesicular endosomes where they become uncoated. Virus uncoating requires acidic pH and involves the disruption of the outer membrane as well as of the protein capsid. As a consequence, the inner viral membrane becomes exposed and fuses with the limiting endosomal membrane to release the viral core into the cytosol. Interestingly, virus fusion is dependent on virus protein pE248R, a transmembrane polypeptide of the inner envelope that shares sequence similarity with some members of the poxviral entry/fusion complex. Collective evidence supports an entry model for ASFV that might also explain the uncoating of other multienveloped icosahedral NCLDVs.
Moisture Dynamics in Building Envelopes
DEFF Research Database (Denmark)
Peuhkuri, Ruut Hannele
2003-01-01
The overall scope of this Thesis "Moisture dynamics in building envelopes" has been to characterise how the various porous insulation materials investigated performed hygrothermally under conditions similar to those in a typical building envelope. As a result of the changing temperature...... part of the Thesis consists of a theory and literature review on the moisture storage and transport processes (Chapter 2), on the non-Fickian moisture transport (Chapter 3)and on the methods for determining the moisture properties (Chapter 4). In the second part, the conducted experimental work...
Moisture dynamics in building envelopes
Energy Technology Data Exchange (ETDEWEB)
Peuhkuri, R.
2003-07-01
The overall scope of this Thesis 'Moisture dynamics in building envelopes' has been to characterise how the various porous insulation materials investigated performed hygro thermally under conditions similar to those in a typical building envelope. As a result of the changing temperature and moisture conditions in the exterior weather and indoor climate the materials dynamically absorb and release moisture. The complexity of the impact of these conditions on the resulting moisture transport and content of the materials has been studied in this Thesis with controlled laboratory tests. (au)
Taam, Ronald E.; Ricker, Paul M.
2010-01-01
The common envelope phase of binary star evolution plays a central role in many evolutionary pathways leading to the formation of compact objects in short period systems. Using three dimensional hydrodynamical computations, we review the major features of this evolutionary phase, focusing on the
LENUS (Irish Health Repository)
Douillard, Francois P
2010-04-08
Abstract Background Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament. Results Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells. Conclusions We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.
B cell clonal lineage alterations upon recombinant HIV-1 envelope immunization of Rhesus macaques
Broadly neutralizing HIV-1 antibodies (bNAbs) isolated from infected subjects display protective potential in animal models. Their elicitation by immunization is thus highly desirable. The HIV-1 envelope glycoprotein (Env) is the sole viral target of bnAbs, but is also targeted by binding, non-neutr...
MHTGR thermal performance envelopes: Reliability by design
International Nuclear Information System (INIS)
Etzel, K.T.; Howard, W.W.; Zgliczynski, J.B.
1992-05-01
This document discusses thermal performance envelopes which are used to specify steady-state design requirements for the systems of the Modular High Temperature Gas-Cooled Reactor to maximize plant performance reliability with optimized design. The thermal performance envelopes are constructed around the expected operating point accounting for uncertainties in actual plant as-built parameters and plant operation. The components are then designed to perform successfully at all points within the envelope. As a result, plant reliability is maximized by accounting for component thermal performance variation in the design. The design is optimized by providing a means to determine required margins in a disciplined and visible fashion
The limited role of recombination energy in common envelope removal
Grichener, Aldana; Sabach, Efrat; Soker, Noam
2018-05-01
We calculate the outward energy transport time by convection and photon diffusion in an inflated common envelope and find this time to be shorter than the envelope expansion time. We conclude therefore that most of the hydrogen recombination energy ends in radiation rather than in kinetic energy of the outflowing envelope. We use the stellar evolution code MESA and inject energy inside the envelope of an asymptotic giant branch star to mimic energy deposition by a spiraling-in stellar companion. During 1.7 years the envelope expands by a factor of more than 2. Along the entire evolution the convection can carry the energy very efficiently outwards, to the radius where radiative transfer becomes more efficient. The total energy transport time stays within several months, shorter than the dynamical time of the envelope. Had we included rapid mass loss, as is expected in the common envelope evolution, the energy transport time would have been even shorter. It seems that calculations that assume that most of the recombination energy ends in the outflowing gas might be inaccurate.
Shaping the Archaeal Cell Envelope
Directory of Open Access Journals (Sweden)
Albert F. Ellen
2010-01-01
Full Text Available Although archaea have a similar cellular organization as other prokaryotes, the lipid composition of their membranes and their cell surface is unique. Here we discuss recent developments in our understanding of the archaeal protein secretion mechanisms, the assembly of macromolecular cell surface structures, and the release of S-layer-coated vesicles from the archaeal membrane.
Peeling skin syndrome: genetic defects in late terminal differentiation of the epidermis.
Bowden, Paul E
2011-03-01
In this issue, Israeli and colleagues confirm that homozygous mutations in corneodesmosin (CDSN) cause type B peeling skin syndrome (PSS), an autosomal recessive skin disorder. The deletion mutation described resulted in a frameshift, producing a downstream premature stop codon and early truncation of the protein. The recently described CDSN nonsense mutation in another PSS family also resulted in protein truncation and nonsense-mediated mRNA decay. Type B generalized PSS can now be clearly distinguished from acral PSS, caused by mutations in transglutaminase 5. This directly affects cornified envelope cross-linking rather than corneodesmosome adherence. These observations provide new insight into the molecular defects underlying two closely related forms of PSS.
Spectral Envelopes and Additive + Residual Analysis/Synthesis
Rodet, Xavier; Schwarz, Diemo
The subject of this chapter is the estimation, representation, modification, and use of spectral envelopes in the context of sinusoidal-additive-plus-residual analysis/synthesis. A spectral envelope is an amplitude-vs-frequency function, which may be obtained from the envelope of a short-time spectrum (Rodet et al., 1987; Schwarz, 1998). [Precise definitions of such an envelope and short-time spectrum (STS) are given in Section 2.] The additive-plus-residual analysis/synthesis method is based on a representation of signals in terms of a sum of time-varying sinusoids and of a non-sinusoidal residual signal [e.g., see Serra (1989), Laroche et al. (1993), McAulay and Quatieri (1995), and Ding and Qian (1997)]. Many musical sound signals may be described as a combination of a nearly periodic waveform and colored noise. The nearly periodic part of the signal can be viewed as a sum of sinusoidal components, called partials, with time-varying frequency and amplitude. Such sinusoidal components are easily observed on a spectral analysis display (Fig. 5.1) as obtained, for instance, from a discrete Fourier transform.
Preserving Envelope Efficiency in Performance Based Code Compliance
Energy Technology Data Exchange (ETDEWEB)
Thornton, Brian A. [Thornton Energy Consulting (United States); Sullivan, Greg P. [Efficiency Solutions (United States); Rosenberg, Michael I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baechler, Michael C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2015-06-20
The City of Seattle 2012 Energy Code (Seattle 2014), one of the most progressive in the country, is under revision for its 2015 edition. Additionally, city personnel participate in the development of the next generation of the Washington State Energy Code and the International Energy Code. Seattle has pledged carbon neutrality by 2050 including buildings, transportation and other sectors. The United States Department of Energy (DOE), through Pacific Northwest National Laboratory (PNNL) provided technical assistance to Seattle in order to understand the implications of one potential direction for its code development, limiting trade-offs of long-lived building envelope components less stringent than the prescriptive code envelope requirements by using better-than-code but shorter-lived lighting and heating, ventilation, and air-conditioning (HVAC) components through the total building performance modeled energy compliance path. Weaker building envelopes can permanently limit building energy performance even as lighting and HVAC components are upgraded over time, because retrofitting the envelope is less likely and more expensive. Weaker building envelopes may also increase the required size, cost and complexity of HVAC systems and may adversely affect occupant comfort. This report presents the results of this technical assistance. The use of modeled energy code compliance to trade-off envelope components with shorter-lived building components is not unique to Seattle and the lessons and possible solutions described in this report have implications for other jurisdictions and energy codes.
International Nuclear Information System (INIS)
Usami, Katsuaki; Matsuno, Keita; Igarashi, Manabu; Denda-Nagai, Kaori; Takada, Ayato; Irimura, Tatsuro
2011-01-01
Highlights: → Ebola virus infection is mediated by binding to and fusion with the target cells. → Structural feature of the viral glycoprotein determines the infectivity. → Surface C-type lectin, MGL, of macrophages and dendritic cells mediate the infection. → GP2, one of glycoprotein subunits, plays an essential role in MGL-mediated infection. → There is a critical amino acid residue involved in high infectivity. -- Abstract: Ebola virus (EBOV) infection is initiated by the interaction of the viral surface envelope glycoprotein (GP) with the binding sites on target cells. Differences in the mortality among different species of the Ebola viruses, i.e., Zaire ebolavirus (ZEBOV) and Reston ebolavirus (REBOV), correspond to the in vitro infectivity of the pseudo-typed virus constructed with the GPs in cells expressing macrophage galactose-type calcium-type lectin (MGL/CD301). Through mutagenesis of GP2, the transmembrane-anchored subunit of GP, we found that residues 502-527 of the GP2 sequence determined the different infectivity between VSV-ZEBOV GP and -REBOV GP in MGL/CD301-expressing cells and a histidine residue at position 516 of ZEBOV GP2 appeared essential in the differential infectivity. These findings may provide a clue to clarify a molecular basis of different pathogenicity among EBOV species.
Energy Technology Data Exchange (ETDEWEB)
Usami, Katsuaki [Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033 (Japan); Matsuno, Keita; Igarashi, Manabu [Department of Global Epidemiology, Hokkaido University Research Center for Zoonosis Control, Sapporo 001-0020 (Japan); Denda-Nagai, Kaori [Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033 (Japan); Takada, Ayato [Department of Global Epidemiology, Hokkaido University Research Center for Zoonosis Control, Sapporo 001-0020 (Japan); Irimura, Tatsuro, E-mail: irimura@mol.f.u-tokyo.ac.jp [Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033 (Japan)
2011-04-01
Highlights: {yields} Ebola virus infection is mediated by binding to and fusion with the target cells. {yields} Structural feature of the viral glycoprotein determines the infectivity. {yields} Surface C-type lectin, MGL, of macrophages and dendritic cells mediate the infection. {yields} GP2, one of glycoprotein subunits, plays an essential role in MGL-mediated infection. {yields} There is a critical amino acid residue involved in high infectivity. -- Abstract: Ebola virus (EBOV) infection is initiated by the interaction of the viral surface envelope glycoprotein (GP) with the binding sites on target cells. Differences in the mortality among different species of the Ebola viruses, i.e., Zaire ebolavirus (ZEBOV) and Reston ebolavirus (REBOV), correspond to the in vitro infectivity of the pseudo-typed virus constructed with the GPs in cells expressing macrophage galactose-type calcium-type lectin (MGL/CD301). Through mutagenesis of GP2, the transmembrane-anchored subunit of GP, we found that residues 502-527 of the GP2 sequence determined the different infectivity between VSV-ZEBOV GP and -REBOV GP in MGL/CD301-expressing cells and a histidine residue at position 516 of ZEBOV GP2 appeared essential in the differential infectivity. These findings may provide a clue to clarify a molecular basis of different pathogenicity among EBOV species.
DATA ENVELOPMENT ANALYSIS OF BANKING SECTOR IN BANGLADESH
Directory of Open Access Journals (Sweden)
Md. Rashedul Hoque
2012-05-01
Full Text Available Banking sector of Bangladesh is flourishing and contributing to its economy. In this aspect measuring efficiency is important. Data Envelopment Analysis technique is used for this purpose. The data are collected from the annual reports of twenty four different banks in Bangladesh. Data Envelopment Analysis is mainly of two types - constant returns to scale and variable returns to scale. Since this study attempts to maximize output, so the output oriented Data Envelopment Analysis is used. The most efficient bank is one that obtains the highest efficiency score.
Morrison, James H; Guevara, Rebekah B; Marcano, Adriana C; Saenz, Dyana T; Fadel, Hind J; Rogstad, Daniel K; Poeschla, Eric M
2014-03-01
BST2/tetherin inhibits the release of enveloped viruses from cells. Primate lentiviruses have evolved specific antagonists (Vpu, Nef, and Env). Here we characterized tetherin proteins of species representing both branches of the order Carnivora. Comparison of tiger and cat (Feliformia) to dog and ferret (Caniformia) genes demonstrated that the tiger and cat share a start codon mutation that truncated most of the tetherin cytoplasmic tail early in the Feliformia lineage (19 of 27 amino acids, including the dual tyrosine motif). Alpha interferon (IFN-α) induced tetherin and blocked feline immunodeficiency virus (FIV) replication in lymphoid and nonlymphoid feline cells. Budding of bald FIV and HIV particles was blocked by carnivore tetherins. However, infectious FIV particles were resistant, and spreading FIV replication was uninhibited. Antagonism mapped to the envelope glycoprotein (Env), which rescued FIV from carnivore tetherin restriction when expressed in trans but, in contrast to known antagonists, did not rescue noncognate particles. Also unlike the primate lentiviral antagonists, but similar to the Ebola virus glycoprotein, FIV Env did not reduce intracellular or cell surface tetherin levels. Furthermore, FIV-enveloped FIV particles actually required tetherin for optimal release from cells. The results show that FIV Envs mediate a distinctive tetherin evasion. Well adapted to a phylogenetically ancient tetherin tail truncation in the Felidae, it requires functional virion incorporation of Env, and it shields the budding particle without downregulating plasma membrane tetherin. Moreover, FIV has evolved dependence on this protein: particles containing FIV Env need tetherin for optimal release from the cell, while Env(-) particles do not. HIV-1 antagonizes the restriction factor tetherin with the accessory protein Vpu, while HIV-2 and the filovirus Ebola use their envelope (Env) glycoproteins for this purpose. It turns out that the FIV tetherin antagonist is
Validating predictions from climate envelope models
Watling, J.; Bucklin, D.; Speroterra, C.; Brandt, L.; Cabal, C.; Romañach, Stephanie S.; Mazzotti, Frank J.
2013-01-01
Climate envelope models are a potentially important conservation tool, but their ability to accurately forecast species’ distributional shifts using independent survey data has not been fully evaluated. We created climate envelope models for 12 species of North American breeding birds previously shown to have experienced poleward range shifts. For each species, we evaluated three different approaches to climate envelope modeling that differed in the way they treated climate-induced range expansion and contraction, using random forests and maximum entropy modeling algorithms. All models were calibrated using occurrence data from 1967–1971 (t1) and evaluated using occurrence data from 1998–2002 (t2). Model sensitivity (the ability to correctly classify species presences) was greater using the maximum entropy algorithm than the random forest algorithm. Although sensitivity did not differ significantly among approaches, for many species, sensitivity was maximized using a hybrid approach that assumed range expansion, but not contraction, in t2. Species for which the hybrid approach resulted in the greatest improvement in sensitivity have been reported from more land cover types than species for which there was little difference in sensitivity between hybrid and dynamic approaches, suggesting that habitat generalists may be buffered somewhat against climate-induced range contractions. Specificity (the ability to correctly classify species absences) was maximized using the random forest algorithm and was lowest using the hybrid approach. Overall, our results suggest cautious optimism for the use of climate envelope models to forecast range shifts, but also underscore the importance of considering non-climate drivers of species range limits. The use of alternative climate envelope models that make different assumptions about range expansion and contraction is a new and potentially useful way to help inform our understanding of climate change effects on species.
Validating predictions from climate envelope models.
Directory of Open Access Journals (Sweden)
James I Watling
Full Text Available Climate envelope models are a potentially important conservation tool, but their ability to accurately forecast species' distributional shifts using independent survey data has not been fully evaluated. We created climate envelope models for 12 species of North American breeding birds previously shown to have experienced poleward range shifts. For each species, we evaluated three different approaches to climate envelope modeling that differed in the way they treated climate-induced range expansion and contraction, using random forests and maximum entropy modeling algorithms. All models were calibrated using occurrence data from 1967-1971 (t1 and evaluated using occurrence data from 1998-2002 (t2. Model sensitivity (the ability to correctly classify species presences was greater using the maximum entropy algorithm than the random forest algorithm. Although sensitivity did not differ significantly among approaches, for many species, sensitivity was maximized using a hybrid approach that assumed range expansion, but not contraction, in t2. Species for which the hybrid approach resulted in the greatest improvement in sensitivity have been reported from more land cover types than species for which there was little difference in sensitivity between hybrid and dynamic approaches, suggesting that habitat generalists may be buffered somewhat against climate-induced range contractions. Specificity (the ability to correctly classify species absences was maximized using the random forest algorithm and was lowest using the hybrid approach. Overall, our results suggest cautious optimism for the use of climate envelope models to forecast range shifts, but also underscore the importance of considering non-climate drivers of species range limits. The use of alternative climate envelope models that make different assumptions about range expansion and contraction is a new and potentially useful way to help inform our understanding of climate change effects on
Transmission electron microscope studies of the nuclear envelope in Caenorhabditis elegans embryos.
Cohen, Merav; Tzur, Yonatan B; Neufeld, Esther; Feinstein, Naomi; Delannoy, Michael R; Wilson, Katherine L; Gruenbaum, Yosef
2002-01-01
Nuclear membranes and nuclear pore complexes (NPCs) are conserved in both animals and plants. However, the lamina composition and the dimensions of NPCs vary between plants, yeast, and vertebrates. In this study, we established a protocol that preserves the structure of Caenorhabditis elegans embryonic cells for high-resolution studies with thin-section transmission electron microscopy (TEM). We show that the NPCs are bigger in C. elegans embryos than in yeast, with dimensions similar to those in higher eukaryotes. We also localized the C. elegans nuclear envelope proteins Ce-lamin and Ce-emerin by pre-embedding gold labeling immunoelectron microscopy. Both proteins are present at or near the inner nuclear membrane. A fraction of Ce-lamin, but not Ce-emerin, is present in the nuclear interior. Removing the nuclear membranes leaves both Ce-lamin and Ce-emerin associated with the chromatin. Eliminating the single lamin protein caused cell death as visualized by characteristic changes in nuclear architecture including condensation of chromatin, clustering of NPCs, membrane blebbing, and the presence of vesicles inside the nucleus. Taken together, these results show evolutionarily conserved protein localization, interactions, and functions of the C. elegans nuclear envelope.
Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion.
Shen, Shu; Tobery, Cynthia E; Rose, Mark D
2009-05-01
Nuclear membrane fusion is the last step in the mating pathway of the yeast Saccharomyces cerevisiae. We adapted a bioinformatics approach to identify putative pheromone-induced membrane proteins potentially required for nuclear membrane fusion. One protein, Prm3p, was found to be required for nuclear membrane fusion; disruption of PRM3 caused a strong bilateral defect, in which nuclear congression was completed but fusion did not occur. Prm3p was localized to the nuclear envelope in pheromone-responding cells, with significant colocalization with the spindle pole body in zygotes. A previous report, using a truncated protein, claimed that Prm3p is localized to the inner nuclear envelope. Based on biochemistry, immunoelectron microscopy and live cell microscopy, we find that functional Prm3p is a peripheral membrane protein exposed on the cytoplasmic face of the outer nuclear envelope. In support of this, mutations in a putative nuclear localization sequence had no effect on full-length protein function or localization. In contrast, point mutations and deletions in the highly conserved hydrophobic carboxy-terminal domain disrupted both protein function and localization. Genetic analysis, colocalization, and biochemical experiments indicate that Prm3p interacts directly with Kar5p, suggesting that nuclear membrane fusion is mediated by a protein complex.
Transparent ceramic lamp envelope materials
Energy Technology Data Exchange (ETDEWEB)
Wei, G C [OSRAM SYLVANIA, 71 Cherry Hill Drive, Beverly, MA 01915 (United States)
2005-09-07
Transparent ceramic materials with optical qualities comparable to single crystals of similar compositions have been developed in recent years, as a result of the improved understanding of powder-processing-fabrication- sintering-property inter-relationships. These high-temperature materials with a range of thermal and mechanical properties are candidate envelopes for focused-beam, short-arc lamps containing various fills operating at temperatures higher than quartz. This paper reviews the composition, structure and properties of transparent ceramic lamp envelope materials including sapphire, small-grained polycrystalline alumina, aluminium oxynitride, yttrium aluminate garnet, magnesium aluminate spinel and yttria-lanthana. A satisfactory thermal shock resistance is required for the ceramic tube to withstand the rapid heating and cooling cycles encountered in lamps. Thermophysical properties, along with the geometry, size and thickness of a transparent ceramic tube, are important parameters in the assessment of its resistance to fracture arising from thermal stresses in lamps during service. The corrosive nature of lamp-fill liquid and vapour at high temperatures requires that all lamp components be carefully chosen to meet the target life. The wide range of new transparent ceramics represents flexibility in pushing the limit of envelope materials for improved beamer lamps.
Boosting of HIV-1 neutralizing antibody responses by a distally related retroviral envelope protein
DEFF Research Database (Denmark)
Uchtenhagen, Hannes; Schiffner, Torben; Bowles, Emma
2014-01-01
Our knowledge of the binding sites for neutralizing Abs (NAb) that recognize a broad range of HIV-1 strains (bNAb) has substantially increased in recent years. However, gaps remain in our understanding of how to focus B cell responses to vulnerable conserved sites within the HIV-1 envelope glycop...
Gravitational Waves from Accreting Neutron Stars Undergoing Common-envelope Inspiral
Holgado, A. Miguel; Ricker, Paul M.; Huerta, E. A.
2018-04-01
The common-envelope phase is a likely formation channel for close binary systems containing compact objects. Neutron stars in common envelopes accrete at a fraction of the Bondi–Hoyle–Lyttleton accretion rate, since the stellar envelope is inhomogeneous, but they may still be able to accrete at hypercritical rates (though not enough to become black holes). We show that common-envelope systems consisting of a neutron star with a massive primary may be gravitational-wave (GW) sources detectable in the Advanced LIGO band as far away as the Magellanic Clouds. To characterize their evolution, we perform orbital integrations using 1D models of 12 M ⊙ and 20 M ⊙ primaries, considering the effects of density gradient on the accretion onto the NS and spin evolution. From the range of possible accretion rates relevant to common-envelope evolution, we find that these systems may be louder GW sources than low-mass X-ray binaries like Sco X-1, which are currently the target of directed searches for continuous GWs. We also find that their strain amplitude signal may allow for novel constraints on the orbital separation and inspiral timescale in common envelopes when combined with pre-common-envelope electromagnetic observations.
Monteiro, Ricardo; Chafsey, Ingrid; Leroy, Sabine; Chambon, Christophe; Hébraud, Michel; Livrelli, Valérie; Pizza, Mariagrazia; Pezzicoli, Alfredo; Desvaux, Mickaël
2018-06-15
Surface proteins are the major factor for the interaction between bacteria and its environment, playing an important role in infection, colonisation, virulence and adaptation. However, the study of surface proteins has proven difficult mainly due to their hydrophobicity and/or relatively low abundance compared with cytoplasmic proteins. To overcome these issues new proteomic strategies have been developed, such as cell-surface protein labelling using biotinylation reagents. Sulfo-NHS-SS-biotin is the most commonly used reagent to investigate the proteins expressed at the cell surface of various organisms but its use in lipopolysaccharidic diderm bacteria (archetypical Gram-negative bacteria) remains limited to a handful of species. While generally pass over in silence, some periplasmic proteins, but also some inner membrane lipoproteins, integral membrane proteins and cytoplasmic proteins (cytoproteins) are systematically identified following this approach. To limit cell lysis and diffusion of the sulfo-NHS-SS-biotin through the outer membrane, biotin labelling was tested over short incubation times and proved to be as efficient for 1 min at room temperature. To further limit labelling of protein located below the outer membrane, the use of high-molecular weight sulfo-NHS-PEG4-bismannose-SS-biotin appeared to recover differentially cell-envelope proteins compared to low-molecular weight sulfo-NHS-SS-biotin. Actually, the sulfo-NHS-SS-biotin recovers at a higher extent the proteins completely or partly exposed in the periplasm than sulfo-NHS-PEG4-bismannose-SS-biotin, namely periplasmic and integral membrane proteins as well as inner membrane and outer membrane lipoproteins. These results highlight that protein labelling using biotinylation reagents of different sizes provides a sophisticated and accurate way to differentially explore the cell envelope proteome of lipopolysaccharidic diderm bacteria. While generally pass over in silence, some periplasmic proteins
International Nuclear Information System (INIS)
Choi, Kyoung-Jae; Lim, Chun-Woo; Yoon, Moon-Young; Ahn, Byung-Yoon; Yu, Yeon Gyu
2004-01-01
Interaction between preformed nucleocapsids and viral envelope proteins is critical for the assembly of virus particles in infected cells. The pre-S1 and pre-S2 and cytosolic regions of the human hepatitis B virus envelope protein had been implicated in the interaction with the core protein of nucleocapsids. The binding affinities of specific subdomains of the envelope protein to the core protein were quantitatively measured by both ELISA and BIAcore assay. While a marginal binding was detected with the pre-S1 or pre-S2, the core protein showed high affinities to pre-S with apparent dissociation constants (K D app ) of 7.3 ± 0.9 and 8.2 ± 0.4 μM by ELISA and BIAcore assay, respectively. The circular dichroism analysis suggested that conformational change occurs in pre-S through interaction with core protein. These results substantiate the importance of specific envelope domains in virion assembly, and demonstrate that the interaction between viral proteins can be quantitatively measured in vitro
Farnsworth, Aaron; Wisner, Todd W; Webb, Michael; Roller, Richard; Cohen, Gary; Eisenberg, Roselyn; Johnson, David C
2007-06-12
Herpesviruses must traverse the nuclear envelope to gain access to the cytoplasm and, ultimately, to exit cells. It is believed that herpesvirus nucleocapsids enter the perinuclear space by budding through the inner nuclear membrane (NM). To reach the cytoplasm these enveloped particles must fuse with the outer NM and the unenveloped capsids then acquire a second envelope in the trans-Golgi network. Little is known about the process by which herpesviruses virions fuse with the outer NM. Here we show that a herpes simplex virus (HSV) mutant lacking both the two putative fusion glycoproteins gB and gH failed to cross the nuclear envelope. Enveloped virions accumulated in the perinuclear space or in membrane vesicles that bulged into the nucleoplasm (herniations). By contrast, mutants lacking just gB or gH showed only minor or no defects in nuclear egress. We concluded that either HSV gB or gH can promote fusion between the virion envelope and the outer NM. It is noteworthy that fusion associated with HSV entry requires the cooperative action of both gB and gH, suggesting that the two types of fusion (egress versus entry) are dissimilar processes.
Novel Real-Time Flight Envelope Monitoring System, Phase II
National Aeronautics and Space Administration — The proposed innovation is an aircraft flight envelope monitoring system that will provide real-time in-cockpit estimations of aircraft flight envelope boundaries....
Pre-paid envelopes commemorating the 2013 Open Days
2013-01-01
The post office on CERN's Prévessin site is still selling pre-paid envelopes commemorating the 2013 Open Days. Hurry while stocks last! The special envelopes, which are valid in France for non-priority letters weighing up to 20 grams, are ideal for your Christmas and New Year correspondence. A set of ten envelopes, each featuring a different image, costs € 8.70 or 10 CHF. The post office is located in Building 866 on the Prévessin site and is open Mondays to Thursdays from 9.30 a.m. to 12.30 p.m.
Global Envelope Tests for Spatial Processes
DEFF Research Database (Denmark)
Myllymäki, Mari; Mrkvička, Tomáš; Grabarnik, Pavel
2017-01-01
Envelope tests are a popular tool in spatial statistics, where they are used in goodness-of-fit testing. These tests graphically compare an empirical function T(r) with its simulated counterparts from the null model. However, the type I error probability α is conventionally controlled for a fixed d......) the construction of envelopes for a deviation test. These new tests allow the a priori selection of the global α and they yield p-values. We illustrate these tests using simulated and real point pattern data....
Global envelope tests for spatial processes
DEFF Research Database (Denmark)
Myllymäki, Mari; Mrkvička, Tomáš; Grabarnik, Pavel
Envelope tests are a popular tool in spatial statistics, where they are used in goodness-of-fit testing. These tests graphically compare an empirical function T(r) with its simulated counterparts from the null model. However, the type I error probability α is conventionally controlled for a fixed......) the construction of envelopes for a deviation test. These new tests allow the a priori selection of the global α and they yield p-values. We illustrate these tests using simulated and real point pattern data....
International Nuclear Information System (INIS)
Wang Yuzhen; Zhang Xiaohua; Yuan Li; Xu Tao; Rao Yu; Li Jia; Dai Heping
2008-01-01
White spot syndrome virus (WSSV) is a major pathogen in shrimp aquaculture. VP28 is one of the most important envelope proteins of WSSV. In this study, a recombinant antibody library, as single-chain fragment variable (scFv) format, displayed on phage was constructed using mRNA from spleen cells of mice immunized with full-length VP28 expressed in Escherichia coli. After several rounds of panning, six scFv antibodies specifically binding to the epitopes in the N-terminal, middle, and C-terminal regions of VP28, respectively, were isolated from the library. Using these scFv antibodies as tools, the epitopes in VP28 were located on the envelope of the virion by immuno-electron microscopy. Neutralization assay with these antibodies in vitro suggested that these epitopes may not be the attachment site of WSSV to host cell receptor. This study provides a new way to investigate the structure and function of the envelope proteins of WSSV
Huang, R.; Liu, F.; Li, T.; Feng, Q.
2017-08-01
Single screw compressors have been used in various industrial fields. However, because the star-wheel teeth are easy to wear, the market for the development of single screw compressors is limited. In order to extend the service life of the star-wheel, researchers have developed different kinds of star-wheel tooth profile, such as single line envelope profile, single column envelope profile, and multi-column envelope profile. These profiles greatly affect the lubrication characteristics between the star-wheel teeth and the screw grooves. In this article, the lubrication characteristics between the meshing pairs with different envelope profiles are analyzed. Results show that the pressure peak of the single line envelope profile, single column envelope profile, and multi-column envelope profile are 3.23×105Pa, 3.38×105Pa, and 4.31×105Pa, respectively. This means that the multi-column enveloped meshing pair can resist the biggest external impact load. The deviation angle (γ) of the single line envelope profile, single column envelope profile, and multi-column envelope profile are 0.0139°~0.0286°, 0.0225°~0.0306° and 0.0122°~0.0262°, respectively. Thus, the self-balancing ability of the multi-column enveloped meshing pair is the strongest, and the oil film thickness on both sides of the multi-column enveloped star-wheel tooth is the most reasonable, which indicates a good lubrication state during operation, that is, longer operation life of the star-wheel teeth.
Stability charts for uniform slopes in soils with nonlinear failure envelopes
Eid, Hisham T.
2014-01-01
Based on the results of an extensive parametric study, charts were developed for assessment of the stability of uniform slopes in soils with nonlinear shear strength failure envelopes. The study was conducted using envelopes formed to represent the realistic shapes of soil nonlinear drained strength envelopes and the associated different degrees of nonlinearity. The introduction of a simple methodology to describe the nonlinear envelopes and a stability parameter, the value of which depends o...
Computation of Phase Equilibrium and Phase Envelopes
DEFF Research Database (Denmark)
Ritschel, Tobias Kasper Skovborg; Jørgensen, John Bagterp
formulate the involved equations in terms of the fugacity coefficients. We present expressions for the first-order derivatives. Such derivatives are necessary in computationally efficient gradient-based methods for solving the vapor-liquid equilibrium equations and for computing phase envelopes. Finally, we......In this technical report, we describe the computation of phase equilibrium and phase envelopes based on expressions for the fugacity coefficients. We derive those expressions from the residual Gibbs energy. We consider 1) ideal gases and liquids modeled with correlations from the DIPPR database...... and 2) nonideal gases and liquids modeled with cubic equations of state. Next, we derive the equilibrium conditions for an isothermal-isobaric (constant temperature, constant pressure) vapor-liquid equilibrium process (PT flash), and we present a method for the computation of phase envelopes. We...
Das, Anshuman; Hirai-Yuki, Asuka; González-López, Olga; Rhein, Bethany; Moller-Tank, Sven; Brouillette, Rachel; Hensley, Lucinda; Misumi, Ichiro; Lovell, William; Cullen, John M; Whitmire, Jason K; Maury, Wendy; Lemon, Stanley M
2017-09-05
Receptor molecules play key roles in the cellular entry of picornaviruses, and TIM1 (HAVCR1) is widely accepted to be the receptor for hepatitis A virus (HAV), an unusual, hepatotropic human picornavirus. However, its identification as the hepatovirus receptor predated the discovery that hepatoviruses undergo nonlytic release from infected cells as membrane-cloaked, quasi-enveloped HAV (eHAV) virions that enter cells via a pathway distinct from naked, nonenveloped virions. We thus revisited the role of TIM1 in hepatovirus entry, examining both adherence and infection/replication in cells with clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-engineered TIM1 knockout. Cell culture-derived, gradient-purified eHAV bound Huh-7.5 human hepatoma cells less efficiently than naked HAV at 4°C, but eliminating TIM1 expression caused no difference in adherence of either form of HAV, nor any impact on infection and replication in these cells. In contrast, TIM1-deficient Vero cells showed a modest reduction in quasi-enveloped eHAV (but not naked HAV) attachment and replication. Thus, TIM1 facilitates quasi-enveloped eHAV entry in Vero cells, most likely by binding phosphatidylserine (PtdSer) residues on the eHAV membrane. Both Tim1 -/- Ifnar1 -/- and Tim4 -/- Ifnar1 -/- double-knockout mice were susceptible to infection upon intravenous challenge with infected liver homogenate, with fecal HAV shedding and serum alanine aminotransferase (ALT) elevations similar to those in Ifnar1 -/- mice. However, intrahepatic HAV RNA and ALT elevations were modestly reduced in Tim1 -/- Ifnar1 -/- mice compared to Ifnar1 -/- mice challenged with a lower titer of gradient-purified HAV or eHAV. We conclude that TIM1 is not an essential hepatovirus entry factor, although its PtdSer-binding activity may contribute to the spread of quasi-enveloped virus and liver injury in mice. IMPORTANCE T cell immunoglobulin and mucin-containing domain protein 1 (TIM1) was reported more than
SAFEGUARDS ENVELOPE: PREVIOUS WORK AND EXAMPLES
International Nuclear Information System (INIS)
Metcalf, Richard; Bevill, Aaron; Charlton, William; Bean, Robert
2008-01-01
The future expansion of nuclear power will require not just electricity production but fuel cycle facilities such as fuel fabrication and reprocessing plants. As large reprocessing facilities are built in various states, they must be built and operated in a manner to minimize the risk of nuclear proliferation. Process monitoring has returned to the spotlight as an added measure that can increase confidence in the safeguards of special nuclear material (SNM). Process monitoring can be demonstrated to lengthen the allowable inventory period by reducing accountancy requirements, and to reduce the false positive indications. The next logical step is the creation of a Safeguards Envelope, a set of operational parameters and models to maximize anomaly detection and inventory period by process monitoring while minimizing operator impact and false positive rates. A brief example of a rudimentary Safeguards Envelope is presented, and shown to detect synthetic diversions overlaying a measured processing plant data set. This demonstration Safeguards Envelope is shown to increase the confidence that no SNM has been diverted with minimal operator impact, even though it is based on an information sparse environment. While the foundation on which a full Safeguards Envelope can be built has been presented in historical demonstrations of process monitoring, several requirements remain yet unfulfilled. Future work will require reprocessing plant transient models, inclusion of 'non-traditional' operating data, and exploration of new methods of identifying subtle events in transient processes
Directory of Open Access Journals (Sweden)
Ainhoa eARBUES
2014-12-01
Full Text Available Mycobacterial pathogens, including Mycobacterium tuberculosis, the etiological agent of tuberculosis (TB, have evolved a remarkable ability to evade the immune system in order to survive and to colonize the host. Among the most important evasion strategies is the capacity of these bacilli to parasitize host macrophages, since these are major effector cells against intracellular pathogens that can be used as long-term cellular reservoirs. Mycobacterial pathogens employ an array of virulence factors that manipulate macrophage function to survive and establish infection. Until recently, however, the role of mycobacterial cell envelope lipids as virulence factors in macrophage subversion has remained elusive. Here, we will address exclusively the proposed role for phthiocerol dimycocerosates (DIM in the modulation of the resident macrophage response and that of phenolic glycolipids (PGL in the regulation of the recruitment and phenotype of incoming macrophage precursors to the site of infection. We will provide a unique perspective of potential additional functions for these lipids, and highlight obstacles and opportunities to further understand their role in the pathogenesis of TB and other mycobacterial diseases.
Torsin Mediates Primary Envelopment of Large Ribonucleoprotein Granules at the Nuclear Envelope
Directory of Open Access Journals (Sweden)
Vahbiz Jokhi
2013-04-01
Full Text Available A previously unrecognized mechanism through which large ribonucleoprotein (megaRNP granules exit the nucleus is by budding through the nuclear envelope (NE. This mechanism is akin to the nuclear egress of herpes-type viruses and is essential for proper synapse development. However, the molecular machinery required to remodel the NE during this process is unknown. Here, we identify Torsin, an AAA-ATPase that in humans is linked to dystonia, as a major mediator of primary megaRNP envelopment during NE budding. In torsin mutants, megaRNPs accumulate within the perinuclear space, and the messenger RNAs contained within fail to reach synaptic sites, preventing normal synaptic protein synthesis and thus proper synaptic bouton development. These studies begin to establish the cellular machinery underlying the exit of megaRNPs via budding, offer an explanation for the “nuclear blebbing” phenotype found in dystonia models, and provide an important link between Torsin and the synaptic phenotypes observed in dystonia.
Inversion of Auditory Spectrograms, Traditional Spectrograms, and Other Envelope Representations
DEFF Research Database (Denmark)
Decorsière, Remi Julien Blaise; Søndergaard, Peter Lempel; MacDonald, Ewen
2015-01-01
Envelope representations such as the auditory or traditional spectrogram can be defined by the set of envelopes from the outputs of a filterbank. Common envelope extraction methods discard information regarding the fast fluctuations, or phase, of the signal. Thus, it is difficult to invert, or re...... to the framework is proposed, which leads to a more accurate inversion of traditional spectrograms...
Distinct pathways mediate the sorting of tail-anchored proteins to the plastid outer envelope.
Directory of Open Access Journals (Sweden)
Preetinder K Dhanoa
Full Text Available BACKGROUND: Tail-anchored (TA proteins are a distinct class of membrane proteins that are sorted post-translationally to various organelles and function in a number of important cellular processes, including redox reactions, vesicular trafficking and protein translocation. While the molecular targeting signals and pathways responsible for sorting TA proteins to their correct intracellular destinations in yeasts and mammals have begun to be characterized, relatively little is known about TA protein biogenesis in plant cells, especially for those sorted to the plastid outer envelope. METHODOLOGY/PRINCIPAL FINDINGS: Here we investigated the biogenesis of three plastid TA proteins, including the 33-kDa and 34-kDa GTPases of the translocon at the outer envelope of chloroplasts (Toc33 and Toc34 and a novel 9-kDa protein of unknown function that we define here as an outer envelope TA protein (OEP9. Using a combination of in vivo and in vitro assays we show that OEP9 utilizes a different sorting pathway than that used by Toc33 and Toc34. For instance, while all three TA proteins interact with the cytosolic OEP chaperone/receptor, AKR2A, the plastid targeting information within OEP9 is distinct from that within Toc33 and Toc34. Toc33 and Toc34 also appear to differ from OEP9 in that their insertion is dependent on themselves and the unique lipid composition of the plastid outer envelope. By contrast, the insertion of OEP9 into the plastid outer envelope occurs in a proteinaceous-dependent, but Toc33/34-independent manner and membrane lipids appear to serve primarily to facilitate normal thermodynamic integration of this TA protein. CONCLUSIONS/SIGNIFICANCE: Collectively, the results provide evidence in support of at least two sorting pathways for plastid TA outer envelope proteins and shed light on not only the complex diversity of pathways involved in the targeting and insertion of proteins into plastids, but also the molecular mechanisms that underlie
14 CFR 29.1517 - Limiting height-speed envelope.
2010-01-01
... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Limiting height-speed envelope. 29.1517... Operating Limitations § 29.1517 Limiting height-speed envelope. For Category A rotorcraft, if a range of... following power failure, the range of heights and its variation with forward speed must be established...
Old foes, new understandings: nuclear entry of small non-enveloped DNA viruses.
Fay, Nikta; Panté, Nelly
2015-06-01
The nuclear import of viral genomes is an important step of the infectious cycle for viruses that replicate in the nucleus of their host cells. Although most viruses use the cellular nuclear import machinery or some components of this machinery, others have developed sophisticated ways to reach the nucleus. Some of these have been known for some time; however, recent studies have changed our understanding of how some non-enveloped DNA viruses access the nucleus. For example, parvoviruses enter the nucleus through small disruptions of the nuclear membranes and nuclear lamina, and adenovirus tugs at the nuclear pore complex, using kinesin-1, to disassemble their capsids and deliver viral proteins and genomes into the nucleus. Here we review recent findings of the nuclear import strategies of three small non-enveloped DNA viruses, including adenovirus, parvovirus, and the polyomavirus simian virus 40. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Optimized Envelope for Cold Climate Indoor Agricultural Growing Center
Directory of Open Access Journals (Sweden)
Caroline Hachem-Vermette
2017-07-01
Full Text Available This paper presents a study of the development of building envelope design for improved energy performance of a controlled indoor agricultural growing center in a cold climate zone (Canada, 54° N. A parametric study is applied to analyze the effects of envelope parameters on the building energy loads for heating, cooling and lighting, required for maintaining growing requirement as obtained in the literature. A base case building of rectangular layout, incorporating conventionally applied insulation and glazing components, is initially analyzed, employing the EnergyPlus simulation program. Insulation and glazing parameters are then modified to minimize energy loads under assumed minimal lighting requirement. This enhanced design forms a base case for analyzing effects of additional design parameters—solar radiation control, air infiltration rate, sky-lighting and the addition of phase change materials—to obtain an enhanced design that minimizes energy loads. A second stage of the investigation applies a high lighting level to the enhanced design and modifies the design parameters to improve performance. A final part of the study is an investigation of the mechanical systems and renewable energy generation. Through the enhancement of building envelope components and day-lighting design, combined heating and cooling load of the low level lighting configuration is reduced by 65% and lighting load by 10%, relative to the base case design. Employing building integrated PV (BIPV system, this optimized model can achieve energy positive status. Solid Oxide Fuel Cells (SOFC, are discussed, as potential means to offset increased energy consumption associated with the high-level lighting model.
Boundaries, injective envelopes, and reduced crossed products
DEFF Research Database (Denmark)
Bryder, Rasmus Sylvester
In this dissertation, we study boundary actions, equivariant injective envelopes, as well as theideal structure of reduced crossed products. These topics have recently been linked to thestudy of C-simple groups, that is, groups with simple reduced group C-algebras.In joint work with Matthew Kennedy......, we consider reduced twisted crossed products overC-simple groups. For any twisted C-dynamical system over a C-simple group, we provethat there is a one-to-one correspondence between maximal invariant ideals in the underlyingC-algebra and maximal ideals in the reduced crossed product. When......*-algebras, and relate the intersection property for group actions on unital C*-algebras to the intersection property for theequivariant injective envelope. Moreover, we also prove that the equivariant injective envelopeof the centre of the injective envelope of a unital C*-algebra can be regarded as a C...
Cell-type-specific gene delivery into neuronal cells in vitro and in vivo
International Nuclear Information System (INIS)
Parveen, Zahida; Mukhtar, Muhammad; Rafi, Mohammed; Wenger, David A.; Siddiqui, Khwaja M.; Siler, Catherine A.; Dietzschold, Bernhard; Pomerantz, Roger J.; Schnell, Matthias J.; Dornburg, Ralph
2003-01-01
The avian retroviruses reticuloendotheliosis virus strain A (REV-A) and spleen necrosis virus (SNV) are not naturally infectious in human cells. However, REV-A-derived viral vectors efficiently infect human cells when they are pseudotyped with envelope proteins displaying targeting ligands specific for human cell-surface receptors. Here we report that vectors containing the gag region of REV-A and pol of SNV can be pseudotyped with the envelope protein of vesicular stomatitis virus (VSV) and the glycoproteins of different rabies virus (RV) strains. Vectors pseudotyped with the envelope protein of the highly neurotropic RV strain CVS-N2c facilitated cell type-specific gene delivery into mouse and human neurons, but did not infect other human cell types. Moreover, when such vector particles were injected into the brain of newborn mice, only neuronal cells were infected in vivo. Cell-type-specific gene delivery into neurons may present quite specific gene therapy approaches for many degenerative diseases of the brain
Solar envelope concepts: moderate density building applications. Final report
Energy Technology Data Exchange (ETDEWEB)
Knowles, R.L.; Berry, R.D.
1980-04-01
Solar energy utilization in urban areas requires public guarantees that all property owners have direct access to the sun. The study examines the implications of this premise in relation to the need for cities to also encourage or accommodate rebuilding and future development. The public policy mechanism for guaranteeing solar access is conceptualized as a solar zoning envelope that allows the largest possible building bulk on a land parcel without shadowing neighboring properties during specified times. Step-by-step methods for generating solar envelopes are described with extensive drawings, showing a variety of urban platting and lot configurations. Development and design possibilities are examined on a selected set of Los Angeles sites with typically diverse urban characteristics. Envelope attributes suitable for encouraging moderate-density commercial and residential building are examined in the context of two hypothetical but realistic development programs: one for speculative office buildings and one for condominium housing. Numerous illustrations of envelope forms and prototypical building designs are provided. The results of development simulation studies on all test sites are tabulated to show building bulk, density, land-coverage and open space characteristics obtainable under the hypothesized envelopes.
The Arabidopsis Nuclear Pore and Nuclear Envelope
Meier, Iris; Brkljacic, Jelena
2010-01-01
The nuclear envelope is a double membrane structure that separates the eukaryotic cytoplasm from the nucleoplasm. The nuclear pores embedded in the nuclear envelope are the sole gateways for macromolecular trafficking in and out of the nucleus. The nuclear pore complexes assembled at the nuclear pores are large protein conglomerates composed of multiple units of about 30 different nucleoporins. Proteins and RNAs traffic through the nuclear pore complexes, enabled by the interacting activities...
Celestino, Michele; Calistri, Arianna; Del Vecchio, Claudia; Salata, Cristiano; Chiuppesi, Flavia; Pistello, Mauro; Borsetti, Alessandra; Palù, Giorgio; Parolin, Cristina
2012-06-01
Tetherin (BST2) is the host cell factor that blocks the particle release of some enveloped viruses. Two putative feline tetherin proteins differing at the level of the N-terminal coding region have recently been described and tested for their antiviral activity. By cloning and comparing the two reported feline tetherins (called here cBST2(504) and cBST2*) and generating specific derivative mutants, this study provides evidence that feline tetherin has a shorter intracytoplasmic domain than those of other known homologues. The minimal tetherin promoter was identified and assayed for its ability to drive tetherin expression in an alpha interferon-inducible manner. We also demonstrated that cBST2(504) is able to dimerize, is localized at the cellular membrane, and impairs human immunodeficiency virus type 1 (HIV-1) particle release, regardless of the presence of the Vpu antagonist accessory protein. While cBST2(504) failed to restrict wild-type feline immunodeficiency virus (FIV) egress, FIV mutants, bearing a frameshift at the level of the envelope-encoding region, were potently blocked. The transient expression of the FIV envelope glycoprotein was able to rescue mutant particle release from feline tetherin-positive cells but did not antagonize human BST2 activity. Moreover, cBST2(504) was capable of specifically immunoprecipitating the FIV envelope glycoprotein. Finally, cBST2(504) also exerted its function on HIV-2 ROD10 and on the simian immunodeficiency virus SIVmac239. Taken together, these results show that feline tetherin does indeed have a short N-terminal region and that the FIV envelope glycoprotein is the predominant factor counteracting tetherin restriction.
A new insight into opaque envelopes in a passive solar house: Properties and roles
International Nuclear Information System (INIS)
Long, Linshuang; Ye, Hong; Liu, Minghou
2016-01-01
Highlights: • A new insight into the opaque envelopes of a passive solar house was gained. • Five parts of envelopes, i.e., roof, south/east/west/north walls, were discussed. • Each part of envelopes were analyzed separately rather than treated as a whole. • Ideal properties of materials for each envelope are diverse from one another. • Differences are related to the envelopes’ leading roles as a heater or a cooler. - Abstract: Passive solar houses are effective solutions for minimizing the operating energy of buildings. The building envelopes of passive solar houses exert a significant influence on the degree of indoor thermal comfort. The focus of this study was the construction of high-performance opaque envelopes, i.e., the roof and walls, for a passive solar house, and a new conception of the envelopes from the perspective of the relation between the properties and roles was provided. The discussion was conducted based on a comprehensive range of envelope materials that were distinguished by the thermal conductivity and volumetric heat capacity. For the first time, each part of the envelopes was analyzed separately rather than considered as an entire envelope. By analyzing each envelope individually, the optimum properties of each envelope were found to be distinct from each other. The distinctions are determined by the dominant role of each envelope, which is associated with the location and absorbed solar irradiation. For summer or hot climate applications, when the dominant role is a cooler, the envelope, e.g., the south wall, should consist of materials with high thermal conductivity and large heat capacity; if a heater is the dominant role, the envelope, e.g., the roof, should consist of materials with low thermal conductivity. For winter or cold climate applications, the envelopes with a leading role of a heater or a cooler require materials with high or low thermal conductivity, respectively. Under the guidance of the results, a discussion
Directory of Open Access Journals (Sweden)
Jens Popken
Full Text Available The present study demonstrates a major remodeling of the nuclear envelope and its underlying lamina during bovine preimplantation development. Up to the onset of major embryonic genome activation (MGA at the 8-cell stage nuclei showed a non-uniform distribution of nuclear pore complexes (NPCs. NPCs were exclusively present at sites where DNA contacted the nuclear lamina. Extended regions of the lamina, which were not contacted by DNA, lacked NPCs. In post-MGA nuclei the whole lamina was contacted rather uniformly by DNA. Accordingly, NPCs became uniformly distributed throughout the entire nuclear envelope. These findings shed new light on the conditions which control the integration of NPCs into the nuclear envelope. The switch from maternal to embryonic production of mRNAs was accompanied by multiple invaginations covered with NPCs, which may serve the increased demands of mRNA export and protein import. Other invaginations, as well as interior nuclear segments and vesicles without contact to the nuclear envelope, were exclusively positive for lamin B. Since the abundance of these invaginations and vesicles increased in concert with a massive nuclear volume reduction, we suggest that they reflect a mechanism for fitting the nuclear envelope and its lamina to a shrinking nuclear size during bovine preimplantation development. In addition, a deposit of extranuclear clusters of NUP153 (a marker for NPCs without associated lamin B was frequently observed from the zygote stage up to MGA. Corresponding RNA-Seq data revealed deposits of spliced, maternally provided NUP153 mRNA and little unspliced, newly synthesized RNA prior to MGA, which increased strongly at the initiation of embryonic expression of NUP153 at MGA.
Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi
1998-01-01
Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276
International Nuclear Information System (INIS)
Mische, Claudia C.; Yuan Wen; Strack, Bettina; Craig, Stewart; Farzan, Michael; Sodroski, Joseph
2005-01-01
The human immunodeficiency virus (HIV-1) transmembrane envelope glycoprotein, gp41, which mediates virus-cell fusion, exists in at least three different conformations within the trimeric envelope glycoprotein complex. The structures of the prefusogenic and intermediate states are unknown; structures representing the postfusion state have been solved. In the postfusion conformation, three helical heptad repeat 2 (HR2) regions pack in an antiparallel fashion into the hydrophobic grooves on the surface of a triple-helical coiled coil formed by the heptad repeat 1 (HR1) regions. We studied the prefusogenic conformation of gp41 by mutagenic alteration of membrane-anchored and soluble forms of the HIV-1 envelope glycoproteins. Our results indicate that, in the HIV-1 envelope glycoprotein precursor, the gp41 HR1 region is in a conformation distinct from that of a trimeric coiled coil. Thus, the central gp41 coiled coil is formed during the transition of the HIV-1 envelope glycoproteins from the precursor state to the receptor-bound intermediate
Asymmetry of the SN 1987A envelope
International Nuclear Information System (INIS)
Chugaj, N.N.
1991-01-01
The origin of the peculiar structure in the profiles of the emission lines observed in the spectrum of SN 1987A, namely, (1) redshift of maxima, and (2) fine structure of hydrogen lines, is considered. Among the three proposed hypothesis for the redshift, at least two (electron scattering in the spherically-symmetric envelope, and geometrical effects in the fragmented envelope) have serious drawbacks. More favorable is the third hypothesis which invokes asymmetric distribution of 56 Ni and of the iron-peak elements
Digital image envelope: method and evaluation
Huang, H. K.; Cao, Fei; Zhou, Michael Z.; Mogel, Greg T.; Liu, Brent J.; Zhou, Xiaoqiang
2003-05-01
Health data security, characterized in terms of data privacy, authenticity, and integrity, is a vital issue when digital images and other patient information are transmitted through public networks in telehealth applications such as teleradiology. Mandates for ensuring health data security have been extensively discussed (for example The Health Insurance Portability and Accountability Act, HIPAA) and health informatics guidelines (such as the DICOM standard) are beginning to focus on issues of data continue to be published by organizing bodies in healthcare; however, there has not been a systematic method developed to ensure data security in medical imaging Because data privacy and authenticity are often managed primarily with firewall and password protection, we have focused our research and development on data integrity. We have developed a systematic method of ensuring medical image data integrity across public networks using the concept of the digital envelope. When a medical image is generated regardless of the modality, three processes are performed: the image signature is obtained, the DICOM image header is encrypted, and a digital envelope is formed by combining the signature and the encrypted header. The envelope is encrypted and embedded in the original image. This assures the security of both the image and the patient ID. The embedded image is encrypted again and transmitted across the network. The reverse process is performed at the receiving site. The result is two digital signatures, one from the original image before transmission, and second from the image after transmission. If the signatures are identical, there has been no alteration of the image. This paper concentrates in the method and evaluation of the digital image envelope.
Early Site Permit Demonstration Program: Plant parameters envelope report
International Nuclear Information System (INIS)
1993-03-01
The Early Site Permit (ESP) Demonstration Program is the nuclear industry's initiative for piloting the early resolution of siting-related issues before the detailed design proceedings of the combined operating license review. The ESP Demonstration Program consists of three phases. The plant parameters envelopes task is part of Phase 1, which addresses the generic review of applicable federal regulations and develops criteria for safety and environmental assessment of potential sites. The plant parameters envelopes identify parameters that characterize the interface between an ALWR design and a potential site, and quantify the interface through values selected from the Utility Requirements Documents, vendor design information, or engineering assessments. When augmented with site-specific information, the plant parameters envelopes provide sufficient information to allow ESPs to be granted based on individual ALWR design information or enveloping design information for the evolutionary, passive, or generic ALWR plants. This document is expected to become a living document when used by future applicants
Directory of Open Access Journals (Sweden)
Meron Mengistu
2015-03-01
Full Text Available The HIV-1 envelope glycoprotein, gp120, undergoes multiple molecular interactions and structural rearrangements during the course of host cell attachment and viral entry, which are being increasingly defined at the atomic level using isolated proteins. In comparison, antigenic markers of these dynamic changes are essentially unknown for single HIV-1 particles bound to target cells. Such markers should indicate how neutralizing and/or non-neutralizing antibodies might interdict infection by either blocking infection or sensitizing host cells for elimination by Fc-mediated effector function. Here we address this deficit by imaging fluorescently labeled CCR5-tropic HIV-1 pseudoviruses using confocal and superresolution microscopy to track the exposure of neutralizing and non-neutralizing epitopes as they appear on single HIV-1 particles bound to target cells. Epitope exposure was followed under conditions permissive or non-permissive for viral entry to delimit changes associated with virion binding from those associated with post-attachment events. We find that a previously unexpected array of gp120 epitopes is exposed rapidly upon target cell binding. This array comprises both neutralizing and non-neutralizing epitopes, the latter being hidden on free virions yet capable of serving as potent targets for Fc-mediated effector function. Under non-permissive conditions for viral entry, both neutralizing and non-neutralizing epitope exposures were relatively static over time for the majority of bound virions. Under entry-permissive conditions, epitope exposure patterns changed over time on subsets of virions that exhibited concurrent variations in virion contents. These studies reveal that bound virions are distinguished by a broad array of both neutralizing and non-neutralizing gp120 epitopes that potentially sensitize a freshly engaged target cell for destruction by Fc-mediated effector function and/or for direct neutralization at a post-binding step
DEFF Research Database (Denmark)
Hansen, J E; Clausen, H; Nielsen, C
1990-01-01
), and the cell type used as the infection target (MT4, PMC, or selected T4 lymphocytes). Inhibition was observed when viruses were preincubated with MAbs but not when cells were preincubated with MAbs before inoculation, and the MAbs were shown to precipitate 125I-labeled gp120. The MAbs therefore define...... carbohydrate structures expressed by the viral envelope glycoprotein gp120, indicating that glycans of the viral envelope are possible targets for immunotherapy or vaccine development or both....
Envelope colour on thermal load in hot humid Hong Kong: Effect of hue, value, and chroma
Institute of Scientific and Technical Information of China (English)
VickyCHENG; EdwardNG
2003-01-01
Cooling energy consumption of a building can be significantly reduced by limiting solar heat gain through envelope, in which depends on the intensity of impinging solar radiation and on the colour of external surface. Albedo, from the thermal point of view, is the prime parameter of interest; however, it does appear to be too conceptual in practice. Architects, when considering choices of envelope colour, the actual decision is between various colours: yellow, blue, or green rather than a single numerical albedo. This study is to investigate the effect and magnitude of colour, in terms of visual qualities hue, value (lightness), and chroma (saturation), on thermal load of buildings. In the experiment, air temperatures inside test cells painted into different colours were measured, the results suggest that colour attribute: chroma has negligible effect on thermal performance of building envelope, while value has significant thermal effect. The effect of hue, as shown in this study, was insignificant, however further study might be needed as to obtain a clearer picture of its effect.
Cavarelli, Mariangela; Foglieni, Chiara; Rescigno, Maria; Scarlatti, Gabriella
2013-05-01
The gastrointestinal tract is a principal route of entry and site of persistence of human immunodeficiency virus type 1 (HIV-1). The intestinal mucosa, being rich of cells that are the main target of the virus, represents a primary site of viral replication and CD4(+) T-cell depletion. Here, we show both in vitro and ex vivo that HIV-1 of R5 but not X4 phenotype is capable of selectively triggering dendritic cells (DCs) to migrate within 30 min between intestinal epithelial cells to sample virions and transfer infection to target cells. The engagement of the chemokine receptor 5 on DCs and the viral envelope, regardless of the genetic subtype, drive DC migration. Viruses penetrating through transient opening of the tight junctions likely create a paracellular gradient to attract DCs. The formation of junctions with epithelial cells may initiate a haptotactic process of DCs and at the same time favour cell-to-cell viral transmission. Our findings indicate that HIV-1 translocation across the intestinal mucosa occurs through the selective engagement of DCs by R5 viruses, and may guide the design of new prevention strategies. Copyright © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.
Beam envelope profile of non-centrosymmetric polygonal phase space
International Nuclear Information System (INIS)
Chen Yinbao; Xie Xi
1984-01-01
The general theory of beam envelope profile of non-centrosymmetric polygonal phase space is developed. By means of this theory the beam envelope profile of non-centrosymmetric polygonal phase space can be calculated directly. An example is carried out in detail to show the practical application of the theory
Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes.
Kawaguchi, Mari; Yasumasu, Shigeki; Shimizu, Akio; Sano, Kaori; Iuchi, Ichiro; Nishida, Mutsumi
2010-12-01
We purified two hatching enzymes, namely high choriolytic enzyme (HCE; EC 3.4.24.67) and low choriolytic enzyme (LCE; EC 3.4.24.66), from the hatching liquid of Fundulus heteroclitus, which were named Fundulus HCE (FHCE) and Fundulus LCE (FLCE). FHCE swelled the inner layer of egg envelope, and FLCE completely digested the FHCE-swollen envelope. In addition, we cloned three Fundulus cDNAs orthologous to cDNAs for the medaka precursors of egg envelope subunit proteins (i.e. choriogenins H, H minor and L) from the female liver. Cleavage sites of FHCE and FLCE on egg envelope subunit proteins were determined by comparing the N-terminal amino acid sequences of digests with the sequences deduced from the cDNAs for egg envelope subunit proteins. FHCE and FLCE cleaved different sites of the subunit proteins. FHCE efficiently cleaved the Pro-X-Y repeat regions into tripeptides to dodecapeptides to swell the envelope, whereas FLCE cleaved the inside of the zona pellucida domain, the core structure of egg envelope subunit protein, to completely digest the FHCE-swollen envelope. A comparison showed that the positions of hatching enzyme cleavage sites on egg envelope subunit proteins were strictly conserved between Fundulus and medaka. Finally, we extended such a comparison to three other euteleosts (i.e. three-spined stickleback, spotted halibut and rainbow trout) and found that the egg envelope digestion mechanism was well conserved among them. During evolution, the egg envelope digestion by HCE and LCE orthologs was established in the lineage of euteleosts, and the mechanism is suggested to be conserved. © 2010 The Authors Journal compilation © 2010 FEBS.
Tweedy, Joshua G; Prusty, Bhupesh K; Gompels, Ursula A
2017-10-01
New antivirals are required to prevent rising antimicrobial resistance from replication inhibitors. The aim of this study was to analyse the range of emerging mutations in herpesvirus by whole genome deep sequencing. We tested human herpesvirus 6 treatment with novel antiviral K21, where evidence indicated distinct effects on virus envelope proteins. We treated BACmid cloned virus in order to analyse mechanisms and candidate targets for resistance. Illumina based next generation sequencing technology enabled analyses of mutations in 85 genes to depths of 10,000 per base detecting low prevalent minority variants (<1%). After four passages in tissue culture the untreated virus accumulated mutations in infected cells giving an emerging mixed population (45-73%) of non-synonymous SNPs in six genes including two envelope glycoproteins. Strikingly, treatment with K21 did not accumulate the passage mutations; instead a high frequency mutation was selected in envelope protein gQ2, part of the gH/gL complex essential for herpesvirus infection. This introduced a stop codon encoding a truncation mutation previously observed in increased virion production. There was reduced detection of the glycoprotein complex in infected cells. This supports a novel pathway for K21 targeting virion envelopes distinct from replication inhibition. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Intelligent building envelopes. Architectural concept and applications for daylighting quality
Energy Technology Data Exchange (ETDEWEB)
Wyckmans, Annemie
2005-11-15
How does an intelligent building envelope manage the variable and sometimes conflictive occupant requirements that arise in a day lit indoor environment. This is the research question that provides the basis for this Ph.D. work. As it touches upon several fields of application, the research question is untangled into four steps, each of which corresponds to a chapter of the thesis. 1) What characterises intelligent behaviour for a building envelope. 2) What characterises indoor day lighting quality. 3) Which functions can an intelligent building envelope be expected to perform in the context of day lighting quality. 4) How are the materials, components and composition of an intelligent building envelope designed to influence this performance. The emphasis is on design, environmental aspects, energy conservation, functional analysis and physical applications.
Deletion of Late Cornified Envelope 3B and 3C Genes Is Not Associated with Atopic Dermatitis
Bergboer, Judith G. M.; Zeeuwen, Patrick L. J. M.; Irvine, Alan D.; Weidinger, Stephan; Giardina, Emiliano; Novelli, Giuseppe; Den Heijer, Martin; Rodriguez, Elke; Illig, Thomas; Riveira-Munoz, Eva; Campbell, Linda E.; Tyson, Jess; Dannhauser, Emma N.; O'Regan, Grainne M.; Galli, Elena; Klopp, Norman; Koppelman, Gerard H.; Novak, Natalija; Estivill, Xavier; McLean, W. H. Irwin; Postma, Dirkje S.; Armour, John A. L.; Schalkwijk, Joost
Atopic dermatitis (AD) and psoriasis are common skin diseases characterized by cutaneous inflammation and disturbed epidermal differentiation. Genome-wide analyses have shown overlapping susceptibility loci, such as the epidermal differentiation complex on chromosome 1q21. Recently, a deletion on
Deletion of Late Cornified Envelope 3B and 3C genes is not associated with atopic dermatitis.
Bergboer, J.G.M.; Zeeuwen, P.L.J.M.; Irvine, A.D.; Weidinger, S.; Giardina, E.; Novelli, G.; Heijer, M. den; Rodriguez, E.; Illig, T.; Riveira-Munoz, E.; Campbell, L.E.; Tyson, J.; Dannhauser, E.N.; O'Regan, G.M.; Galli, E.; Klopp, N.; Koppelman, G.H.; Novak, N.; Estivill, X.; McLean, W.H.I.; Postma, D.S.; Armour, J.A.; Schalkwijk, J.
2010-01-01
Atopic dermatitis (AD) and psoriasis are common skin diseases characterized by cutaneous inflammation and disturbed epidermal differentiation. Genome-wide analyses have shown overlapping susceptibility loci, such as the epidermal differentiation complex on chromosome 1q21. Recently, a deletion on
A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin
International Nuclear Information System (INIS)
Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang; Liu, Yan-Hong; Li, Yan; Wang, Jia-Ye; Hattori, Toshio; Ling, Hong; Zhang, Feng-Min
2010-01-01
To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potential entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.
Dietzel, Erik; Anderson, Danielle E.; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea
2011-01-01
In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis o...
Liu, Guan-Ting; Kung, Hsiu-Ni; Chen, Chung-Kuan; Huang, Cheng; Wang, Yung-Li; Yu, Cheng-Pu; Lee, Chung-Pei
2018-02-26
Although a vesicular nucleocytoplasmic transport system is believed to exist in eukaryotic cells, the features of this pathway are mostly unknown. Here, we report that the BFRF1 protein of the Epstein-Barr virus improves vesicular transport of nuclear envelope (NE) to facilitate the translocation and clearance of nuclear components. BFRF1 expression induces vesicles that selectively transport nuclear components to the cytoplasm. With the use of aggregation-prone proteins as tools, we found that aggregated nuclear proteins are dispersed when these BFRF1-induced vesicles are formed. BFRF1-containing vesicles engulf the NE-associated aggregates, exit through from the NE, and putatively fuse with autophagic vacuoles. Chemical treatment and genetic ablation of autophagy-related factors indicate that autophagosome formation and autophagy-linked FYVE protein-mediated autophagic proteolysis are involved in this selective clearance of nuclear proteins. Remarkably, vesicular transport, elicited by BFRF1, also attenuated nuclear aggregates accumulated in neuroblastoma cells. Accordingly, induction of NE-derived vesicles by BFRF1 facilitates nuclear protein translocation and clearance, suggesting that autophagy-coupled transport of nucleus-derived vesicles can be elicited for nuclear component catabolism in mammalian cells.-Liu, G.-T., Kung, H.-N., Chen, C.-K., Huang, C., Wang, Y.-L., Yu, C.-P., Lee, C.-P. Improving nuclear envelope dynamics by EBV BFRF1 facilitates intranuclear component clearance through autophagy.
Calculation of CWKB envelope in boson and fermion productions
Indian Academy of Sciences (India)
Abstract. We present the calculation of envelope of boson and of both low- and high- mass fermion production at the end of inflation when the coherently oscillating inflatons decay into bosons and fermions. We consider three different models of inflation and use. CWKB technique to calculate the envelope to understand the ...
Neutralization of White Spot Syndrome Virus by Monoclonal Antibodies against Viral Envelope Proteins
Directory of Open Access Journals (Sweden)
Hsiu-Hui Shih
2004-09-01
Full Text Available Two monoclonal antibodies (MAbs recognizing envelope proteins of the white spot syndrome virus (WSSV, 6E1 against VP28 and 3E8 against VP19, were applied to demonstrate their neutralizing ability to this virus by using both in vitro and in vivo assays. Mixtures of MAb 6E1 with virus filtrate were inoculated into the primary explant monolayer culture derived from the lymphoid Oka organs of Penaeus monodon. Mab was likely to neutralize the infectivity of virus to monolayer since cytopathic effects were apparently blocked in experiment group. WSSV was titrated using Blue-Cell ELISA and the neutralizing index was calculated to be 6.90 for 6EI and 5.83 for 3E8. Neutralized virus fluids injected intramuscularly into post larvae of P. monodon. The shrimp in the positive control, which were injected with WSSV only showed an increasing mortality and a 100% mortality was reached at day 34, whereas no shrimp died in the negative control. The mortality for 6E1 was 6.7% and for 3E8 was 13.3%. These results suggest that Mabs recognizing the WSSV envelope proteins could neutralize viral infectivity to both cultured cells and shrimp.
Characterization and interactome study of white spot syndrome virus envelope protein VP11.
Directory of Open Access Journals (Sweden)
Wang-Jing Liu
Full Text Available White spot syndrome virus (WSSV is a large enveloped virus. The WSSV viral particle consists of three structural layers that surround its core DNA: an outer envelope, a tegument and a nucleocapsid. Here we characterize the WSSV structural protein VP11 (WSSV394, GenBank accession number AF440570, and use an interactome approach to analyze the possible associations between this protein and an array of other WSSV and host proteins. Temporal transcription analysis showed that vp11 is an early gene. Western blot hybridization of the intact viral particles and fractionation of the viral components, and immunoelectron microscopy showed that VP11 is an envelope protein. Membrane topology software predicted VP11 to be a type of transmembrane protein with a highly hydrophobic transmembrane domain at its N-terminal. Based on an immunofluorescence assay performed on VP11-transfected Sf9 cells and a trypsin digestion analysis of the virion, we conclude that, contrary to topology software prediction, the C-terminal of this protein is in fact inside the virion. Yeast two-hybrid screening combined with co-immunoprecipitation assays found that VP11 directly interacted with at least 12 other WSSV structural proteins as well as itself. An oligomerization assay further showed that VP11 could form dimers. VP11 is also the first reported WSSV structural protein to interact with the major nucleocapsid protein VP664.
Glimpsing over the event horizon: evolution of nuclear pores and envelope.
Jékely, Gáspár
2005-02-01
The origin of eukaryotes from prokaryotic ancestors is one of the major evolutionary transitions in the history of life. The nucleus, a membrane bound compartment for confining the genome, is a central feature of eukaryotic cells and its origin also has to be a central feature of any workable theory that ventures to explain eukaryotic origins. Recent bioinformatic analyses of components of the nuclear pore complex (NPC), the nuclear envelope (NE), and the nuclear transport systems revealed exciting evolutionary connections (e.g., between NPC and coated vesicles) and provided a useful record of the phyletic distribution and history of NPC and NE components. These analyses allow us to refine theories on the origin and evolution of the nucleus, and consequently, of the eukaryotic cell.
The cell cycle of the planctomycete Gemmata obscuriglobus with respect to cell compartmentalization
Directory of Open Access Journals (Sweden)
Fuerst John A
2009-01-01
Full Text Available Abstract Background Gemmata obscuriglobus is a distinctive member of the divergent phylum Planctomycetes, all known members of which are peptidoglycan-less bacteria with a shared compartmentalized cell structure and divide by a budding process. G. obscuriglobus in addition shares the unique feature that its nucleoid DNA is surrounded by an envelope consisting of two membranes forming an analogous structure to the membrane-bounded nucleoid of eukaryotes and therefore G. obscuriglobus forms a special model for cell biology. Draft genome data for G. obscuriglobus as well as complete genome sequences available so far for other planctomycetes indicate that the key bacterial cell division protein FtsZ is not present in these planctomycetes, so the cell division process in planctomycetes is of special comparative interest. The membrane-bounded nature of the nucleoid in G. obscuriglobus also suggests that special mechanisms for the distribution of this nuclear body to the bud and for distribution of chromosomal DNA might exist during division. It was therefore of interest to examine the cell division cycle in G. obscuriglobus and the process of nucleoid distribution and nuclear body formation during division in this planctomycete bacterium via light and electron microscopy. Results Using phase contrast and fluorescence light microscopy, and transmission electron microscopy, the cell division cycle of G. obscuriglobus was determined. During the budding process, the bud was formed and developed in size from one point of the mother cell perimeter until separation. The matured daughter cell acted as a new mother cell and started its own budding cycle while the mother cell can itself initiate budding repeatedly. Fluorescence microscopy of DAPI-stained cells of G. obscuriglobus suggested that translocation of the nucleoid and formation of the bud did not occur at the same time. Confocal laser scanning light microscopy applied to cells stained for membranes as
High frequency vibration analysis by the complex envelope vectorization.
Giannini, O; Carcaterra, A; Sestieri, A
2007-06-01
The complex envelope displacement analysis (CEDA) is a procedure to solve high frequency vibration and vibro-acoustic problems, providing the envelope of the physical solution. CEDA is based on a variable transformation mapping the high frequency oscillations into signals of low frequency content and has been successfully applied to one-dimensional systems. However, the extension to plates and vibro-acoustic fields met serious difficulties so that a general revision of the theory was carried out, leading finally to a new method, the complex envelope vectorization (CEV). In this paper the CEV method is described, underlying merits and limits of the procedure, and a set of applications to vibration and vibro-acoustic problems of increasing complexity are presented.
Reduction of a 4q35-encoded nuclear envelope protein in muscle differentiation
International Nuclear Information System (INIS)
Ostlund, Cecilia; Guan, Tinglu; Figlewicz, Denise A.; Hays, Arthur P.; Worman, Howard J.; Gerace, Larry; Schirmer, Eric C.
2009-01-01
Muscular dystrophy and peripheral neuropathy have been linked to mutations in genes encoding nuclear envelope proteins; however, the molecular mechanisms underlying these disorders remain unresolved. Nuclear envelope protein p19A is a protein of unknown function encoded by a gene at chromosome 4q35. p19A levels are significantly reduced in human muscle as cells differentiate from myoblasts to myotubes; however, its levels are not similarly reduced in all differentiation systems tested. Because 4q35 has been linked to facioscapulohumeral muscular dystrophy (FSHD) and some adjacent genes are reportedly misregulated in the disorder, levels of p19A were analyzed in muscle samples from patients with FSHD. Although p19A was increased in most cases, an absolute correlation was not observed. Nonetheless, p19A downregulation in normal muscle differentiation suggests that in the cases where its gene is inappropriately re-activated it could affect muscle differentiation and contribute to disease pathology.
Reduction of a 4q35-encoded nuclear envelope protein in muscle differentiation
Energy Technology Data Exchange (ETDEWEB)
Ostlund, Cecilia [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Guan, Tinglu [Department of Cell Biology, Scripps Research Institute, La Jolla, CA 92037 (United States); Figlewicz, Denise A. [Department of Neurology, University of Michigan, Ann Arbor, MI 48109 (United States); Hays, Arthur P. [Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Worman, Howard J. [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Gerace, Larry [Department of Cell Biology, Scripps Research Institute, La Jolla, CA 92037 (United States); Schirmer, Eric C., E-mail: e.schirmer@ed.ac.uk [Department of Cell Biology, Scripps Research Institute, La Jolla, CA 92037 (United States); Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR (United Kingdom)
2009-11-13
Muscular dystrophy and peripheral neuropathy have been linked to mutations in genes encoding nuclear envelope proteins; however, the molecular mechanisms underlying these disorders remain unresolved. Nuclear envelope protein p19A is a protein of unknown function encoded by a gene at chromosome 4q35. p19A levels are significantly reduced in human muscle as cells differentiate from myoblasts to myotubes; however, its levels are not similarly reduced in all differentiation systems tested. Because 4q35 has been linked to facioscapulohumeral muscular dystrophy (FSHD) and some adjacent genes are reportedly misregulated in the disorder, levels of p19A were analyzed in muscle samples from patients with FSHD. Although p19A was increased in most cases, an absolute correlation was not observed. Nonetheless, p19A downregulation in normal muscle differentiation suggests that in the cases where its gene is inappropriately re-activated it could affect muscle differentiation and contribute to disease pathology.
Aspherical Dust Envelopes Around Oxygen-Rich AGB Stars
Directory of Open Access Journals (Sweden)
Kyung-Won Suh
2006-12-01
Full Text Available We model the aspherical dust envelopes around O-rich AGB stars. We perform the radiative transfer model calculations for axisymmetric dust distributions. We simulate what could be observed from the aspherical dust envelopes around O-rich AGB stars by presenting the model spectral energy distributions and images at various wavelengths for different optical depths and viewing angles. The model results are very different from the ones with spherically symmetric geometry.
Bozler, Julianna; Nguyen, Huy Q.; Rogers, Gregory C.; Bosco, Giovanni
2014-01-01
Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. PMID:25552604
Bozler, Julianna; Nguyen, Huy Q; Rogers, Gregory C; Bosco, Giovanni
2014-12-30
Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. Copyright © 2015 Bozler et al.
Spectral envelope sensitivity of musical instrument sounds.
Gunawan, David; Sen, D
2008-01-01
It is well known that the spectral envelope is a perceptually salient attribute in musical instrument timbre perception. While a number of studies have explored discrimination thresholds for changes to the spectral envelope, the question of how sensitivity varies as a function of center frequency and bandwidth for musical instruments has yet to be addressed. In this paper a two-alternative forced-choice experiment was conducted to observe perceptual sensitivity to modifications made on trumpet, clarinet and viola sounds. The experiment involved attenuating 14 frequency bands for each instrument in order to determine discrimination thresholds as a function of center frequency and bandwidth. The results indicate that perceptual sensitivity is governed by the first few harmonics and sensitivity does not improve when extending the bandwidth any higher. However, sensitivity was found to decrease if changes were made only to the higher frequencies and continued to decrease as the distorted bandwidth was widened. The results are analyzed and discussed with respect to two other spectral envelope discrimination studies in the literature as well as what is predicted from a psychoacoustic model.
Mass-radius relations and core-envelope decompositions of super-Earths and sub-Neptunes
Energy Technology Data Exchange (ETDEWEB)
Howe, Alex R.; Burrows, Adam [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States); Verne, Wesley, E-mail: arhowe@astro.princeton.edu, E-mail: burrows@astro.princeton.edu [Department of Computer Science, Princeton University, Princeton, NJ 08544 (United States)
2014-06-01
Many exoplanets have been discovered with radii of 1-4 R {sub ⊕}, between that of Earth and Neptune. A number of these are known to have densities consistent with solid compositions, while others are 'sub-Neptunes' likely to have significant H{sub 2}-He envelopes. Future surveys will no doubt significantly expand these populations. In order to understand how the measured masses and radii of such planets can inform their structures and compositions, we construct models both for solid layered planets and for planets with solid cores and gaseous envelopes, exploring a range of core masses, H{sub 2}-He envelope masses, and associated envelope entropies. For planets in the super-Earth/sub-Neptune regime for which both radius and mass are measured, we estimate how each is partitioned into a solid core and gaseous envelope, associating a specific core mass and envelope mass with a given exoplanet. We perform this decomposition for both ''Earth-like'' rock-iron cores and pure ice cores, and find that the necessary gaseous envelope masses for this important sub-class of exoplanets must range very widely from zero to many Earth masses, even for a given core mass. This result bears importantly on exoplanet formation and envelope evaporation processes.
Mass-radius relations and core-envelope decompositions of super-Earths and sub-Neptunes
International Nuclear Information System (INIS)
Howe, Alex R.; Burrows, Adam; Verne, Wesley
2014-01-01
Many exoplanets have been discovered with radii of 1-4 R ⊕ , between that of Earth and Neptune. A number of these are known to have densities consistent with solid compositions, while others are 'sub-Neptunes' likely to have significant H 2 -He envelopes. Future surveys will no doubt significantly expand these populations. In order to understand how the measured masses and radii of such planets can inform their structures and compositions, we construct models both for solid layered planets and for planets with solid cores and gaseous envelopes, exploring a range of core masses, H 2 -He envelope masses, and associated envelope entropies. For planets in the super-Earth/sub-Neptune regime for which both radius and mass are measured, we estimate how each is partitioned into a solid core and gaseous envelope, associating a specific core mass and envelope mass with a given exoplanet. We perform this decomposition for both ''Earth-like'' rock-iron cores and pure ice cores, and find that the necessary gaseous envelope masses for this important sub-class of exoplanets must range very widely from zero to many Earth masses, even for a given core mass. This result bears importantly on exoplanet formation and envelope evaporation processes.
Solar envelope zoning: application to the city planning process. Los Angeles case study
Energy Technology Data Exchange (ETDEWEB)
1980-06-01
Solar envelope zoning represents a promising approach to solar access protection. A solar envelope defines the volume within which a building will not shade adjacent lots or buildings. Other solar access protection techniques, such as privately negotiated easements, continue to be tested and implemented but none offer the degree of comprehensiveness evident in this approach. Here, the City of Los Angeles, through the Mayor's Energy Office, the City Planning Department, and the City Attorney's Office, examine the feasibility of translating the concept of solar envelopes into zoning techniques. They concluded that envelope zoning is a fair and consistent method of guaranteeing solar access, but problems of complexity and uncertainty may limit its usefulness. Envelope zoning may be inappropriate for the development of high density centers and for more restrictive community plans. Aids or tools to administer envelope zoning need to be developed. Finally, some combination of approaches, including publicly recorded easements, subdivision approval and envelope zoning, need to be adopted to encourage solar use in cities. (MHR)
Nano-ranged low-energy ion-beam-induced DNA transfer in biological cells
Energy Technology Data Exchange (ETDEWEB)
Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.th [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Wongkham, W. [Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Prakrajang, K. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K.; Inthanon, K. [Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongkumkoon, P. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Wanichapichart, P. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Membrane Science and Technology Research Center, Department of Physics, Faculty of Science, Prince of Songkla University, Hat Yai, Songkla 90112 (Thailand); Anuntalabhochai, S. [Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2013-06-15
Low-energy ion beams at a few tens of keV were demonstrated to be able to induce exogenous macromolecules to transfer into plant and bacterial cells. In the process, the ion beam with well controlled energy and fluence bombarded living cells to cause certain degree damage in the cell envelope in nanoscales to facilitate the macromolecules such as DNA to pass through the cell envelope and enter the cell. Consequently, the technique was applied for manipulating positive improvements in the biological species. This physical DNA transfer method was highly efficient and had less risk of side-effects compared with chemical and biological methods. For better understanding of mechanisms involved in the process, a systematic study on the mechanisms was carried out. Applications of the technique were also expanded from DNA transfer in plant and bacterial cells to DNA transfection in human cancer cells potentially for the stem cell therapy purpose. Low-energy nitrogen and argon ion beams that were applied in our experiments had ranges of 100 nm or less in the cell envelope membrane which was majorly composed of polymeric cellulose. The ion beam bombardment caused chain-scission dominant damage in the polymer and electrical property changes such as increase in the impedance in the envelope membrane. These nano-modifications of the cell envelope eventually enhanced the permeability of the envelope membrane to favor the DNA transfer. The paper reports details of our research in this direction.
Nano-ranged low-energy ion-beam-induced DNA transfer in biological cells
International Nuclear Information System (INIS)
Yu, L.D.; Wongkham, W.; Prakrajang, K.; Sangwijit, K.; Inthanon, K.; Thongkumkoon, P.; Wanichapichart, P.; Anuntalabhochai, S.
2013-01-01
Low-energy ion beams at a few tens of keV were demonstrated to be able to induce exogenous macromolecules to transfer into plant and bacterial cells. In the process, the ion beam with well controlled energy and fluence bombarded living cells to cause certain degree damage in the cell envelope in nanoscales to facilitate the macromolecules such as DNA to pass through the cell envelope and enter the cell. Consequently, the technique was applied for manipulating positive improvements in the biological species. This physical DNA transfer method was highly efficient and had less risk of side-effects compared with chemical and biological methods. For better understanding of mechanisms involved in the process, a systematic study on the mechanisms was carried out. Applications of the technique were also expanded from DNA transfer in plant and bacterial cells to DNA transfection in human cancer cells potentially for the stem cell therapy purpose. Low-energy nitrogen and argon ion beams that were applied in our experiments had ranges of 100 nm or less in the cell envelope membrane which was majorly composed of polymeric cellulose. The ion beam bombardment caused chain-scission dominant damage in the polymer and electrical property changes such as increase in the impedance in the envelope membrane. These nano-modifications of the cell envelope eventually enhanced the permeability of the envelope membrane to favor the DNA transfer. The paper reports details of our research in this direction.
Schneiter, Roger; Cole, Charles N
2010-01-01
The nuclear envelope harbors numerous large proteinaceous channels, the nuclear pore complexes (NPCs), through which macromolecular exchange between the cytosol and the nucleoplasm occurs. This double-membrane nuclear envelope is continuous with the endoplasmic reticulum and thus functionally connected to such diverse processes as vesicular transport, protein maturation and lipid synthesis. Recent results obtained from studies in Saccharomyces cerevisiae indicate that assembly of the nuclear pore complex is functionally dependent upon maintenance of lipid homeostasis of the ER membrane. Previous work from one of our laboratories has revealed that an integral membrane protein Apq12 is important for the assembly of functional nuclear pores. Cells lacking APQ12 are viable but cannot grow at low temperatures, have aberrant NPCs and a defect in mRNA export. Remarkably, these defects in NPC assembly can be overcome by supplementing cells with a membrane fluidizing agent, benzyl alcohol, suggesting that Apq12 impacts the flexibility of the nuclear membrane, possibly by adjusting its lipid composition when cells are shifted to a reduced temperature. Our new study now expands these findings and reveals that an essential membrane protein, Brr6, shares at least partially overlapping functions with Apq12 and is also required for assembly of functional NPCs. A third nuclear envelope membrane protein, Brl1, is related to Brr6, and is also required for NPC assembly. Because maintenance of membrane homeostasis is essential for cellular survival, the fact that these three proteins are conserved in fungi that undergo closed mitoses, but are not found in metazoans or plants, may indicate that their functions are performed by proteins unrelated at the primary sequence level to Brr6, Brl1 and Apq12 in cells that disassemble their nuclear envelopes during mitosis.
International Nuclear Information System (INIS)
Gong Rui; Peng Xiaoxue; Kang Shuli; Feng Huixing; Huang Jianying; Zhang Wentao; Lin Donghai; Tien Po; Xiao Gengfu
2005-01-01
Syncytin is a captive retroviral envelope protein, possibly involved in the formation of the placental syncytiotrophoblast layer generated by trophoblast cell fusion at the maternal-fetal interface. We found that syncytin and type I viral envelope proteins shared similar structural profiling, especially in the regions of N- and C-terminal heptad repeats (NHR and CHR). We expressed the predicted regions of NHR (41 aa) and CHR (34 aa) in syncytin as a native single chain (named 2-helix protein) to characterize it. 2-helix protein exists as a trimer and is highly α-helix, thermo-stable, and denatured by low pH. NHR and CHR could form a protease-resistant complex. The complex structure built by the molecular docking demonstrated that NHR and CHR associated in an antiparallel manner. Overall, the 2-helix protein could form a thermo-stable coiled coil trimer. The fusion core structure of syncytin was first demonstrated in endogenous retrovirus. These results support the explanation how syncytin mediates cytotrophoblast cell fusion involved in placental morphogenesis
Santos, Clelton A; Janissen, Richard; Toledo, Marcelo A S; Beloti, Lilian L; Azzoni, Adriano R; Cotta, Monica A; Souza, Anete P
2015-10-01
The intriguing roles of the bacterial Tol-Pal trans-envelope protein complex range from maintenance of cell envelope integrity to potential participation in the process of cell division. In this study, we report the characterization of the XfTolB and XfPal proteins of the Tol-Pal complex of Xylella fastidiosa. X. fastidiosa is a major plant pathogen that forms biofilms inside xylem vessels, triggering the development of diseases in important cultivable plants around the word. Based on functional complementation experiments in Escherichia coli tolB and pal mutant strains, we confirmed the role of xftolB and xfpal in outer membrane integrity. In addition, we observed a dynamic and coordinated protein expression profile during the X. fastidiosa biofilm development process. Using small-angle X-ray scattering (SAXS), the low-resolution structure of the isolated XfTolB-XfPal complex in solution was solved for the first time. Finally, the localization of the XfTolB and XfPal polar ends was visualized via immunofluorescence labeling in vivo during bacterial cell growth. Our results highlight the major role of the components of the cell envelope, particularly the TolB-Pal complex, during the different phases of bacterial biofilm development. Copyright © 2015 Elsevier B.V. All rights reserved.
Magnified Neural Envelope Coding Predicts Deficits in Speech Perception in Noise.
Millman, Rebecca E; Mattys, Sven L; Gouws, André D; Prendergast, Garreth
2017-08-09
Verbal communication in noisy backgrounds is challenging. Understanding speech in background noise that fluctuates in intensity over time is particularly difficult for hearing-impaired listeners with a sensorineural hearing loss (SNHL). The reduction in fast-acting cochlear compression associated with SNHL exaggerates the perceived fluctuations in intensity in amplitude-modulated sounds. SNHL-induced changes in the coding of amplitude-modulated sounds may have a detrimental effect on the ability of SNHL listeners to understand speech in the presence of modulated background noise. To date, direct evidence for a link between magnified envelope coding and deficits in speech identification in modulated noise has been absent. Here, magnetoencephalography was used to quantify the effects of SNHL on phase locking to the temporal envelope of modulated noise (envelope coding) in human auditory cortex. Our results show that SNHL enhances the amplitude of envelope coding in posteromedial auditory cortex, whereas it enhances the fidelity of envelope coding in posteromedial and posterolateral auditory cortex. This dissociation was more evident in the right hemisphere, demonstrating functional lateralization in enhanced envelope coding in SNHL listeners. However, enhanced envelope coding was not perceptually beneficial. Our results also show that both hearing thresholds and, to a lesser extent, magnified cortical envelope coding in left posteromedial auditory cortex predict speech identification in modulated background noise. We propose a framework in which magnified envelope coding in posteromedial auditory cortex disrupts the segregation of speech from background noise, leading to deficits in speech perception in modulated background noise. SIGNIFICANCE STATEMENT People with hearing loss struggle to follow conversations in noisy environments. Background noise that fluctuates in intensity over time poses a particular challenge. Using magnetoencephalography, we demonstrate
A study of some Be star envelopes
International Nuclear Information System (INIS)
Kitchen, C.R.
1976-01-01
The envelope model and emission region radius of six Be stars have been determined from 36 lines on 15 spectra taken with the Isaac Newton telescope. The results have been compared with earlier determinations to search for changes with the time. No definite evidence for such changes has been found, although there may be an indication of a change in phi Per. A re-determination of the errors involved in the method of analysis shows that these are smaller than previously estimated and range from about 9% to 35% for both envelope model and emission region radius. (Auth.)
A controlled trial of envelope colour for increasing response rates in older women.
Mitchell, Natasha; Hewitt, Catherine E; Torgerson, David J
2011-06-01
Postal questionnaires are widely used in health research to provide measurable outcomes in areas such as quality of life. Participants who fail to return postal questionnaires can introduce non-response bias. Previous studies within populations over the age of 65 years have shown that response rates amongst older people can be 60% or less. The current study sought to investigate whether envelope colour affected response rates in a study about the effectiveness of screening older women for osteoporosis. A total of 2803 eligible female participants aged between 70 and 85 were sent an invitation pack from their GP practice. The invitation was either in a brown or white envelope and contained a matching pre-paid reply envelope. A study questionnaire was also sent out in brown or white envelopes 1 week after consenting to participate in the trial. The overall response rate was 78%. There was little evidence of an effect of envelope colour on response to the invitation to participate in the trial (OR 1.04, 95% CI 0.87-1.24). Similarly, there was no influence of envelope colour on the number of participants returning their questionnaires (OR 0.99, 95% CI 0.60-1.63). There was weak evidence of an effect of envelope colour on the response rates of the consent process (OR 0.86, 95% CI 0.74-1.00). When we updated a recent meta-analysis with the results of this study, there was a non-statistically- significant trend for greater response rates with brown envelopes compared with white envelopes (OR 1.19, 95% CI 0.86-1.64, I2=92%). However, the results where influenced by one study and when this study was excluded the pooled estimate was 0.98 (95% CI 0.89-1.08, I2=0%). This study found no evidence to suggest envelope colour has an effect on response to participate in a trial or questionnaire returns. There is weak evidence to suggest envelope colour may affect consent into a trial.
The psychic envelopes in psychoanalytic theories of infancy.
Directory of Open Access Journals (Sweden)
Denis eMellier
2014-07-01
Full Text Available This paper aims to review the topic of psychic envelopes and to sketch the main outlines of this concept in infancy. We first explore the origins of the concept in Freud's 'protective shield' and then its development in adult psychoanalysis before going on to see how this fits in infancy with post-Bionian psychoanalysis and development. Four central notions guide this review:1 Freud's protective shield describes a barrier to protect the psychic apparatus against potentially overflowing trauma. It is a core notion which highlights a serious clinical challenge for patients for whom the shield is damaged or faulty: the risk of confusion of borders between the internal/external world, conscious/unconscious, mind/body, or self-conservation/sexuality.2 Anzieu's Skin-Ego is defined by the different senses of the body. The different layers of experienced sensation, of this body-ego, go on to form the psychic envelope. This theory contributes to our understanding of how early trauma, due to the failures of maternal care, can continue to have an impact in adult life. 3 Bick's psychic skin establishes the concept in relation to infancy. The mother’s containing functions allow a first psychic skin to develop, which then defines an infant’s psychic space and affords the infant a degree of self-containment. Houzel then conceptualized this process as a stabilization of drive forces.4 Stern's narrative envelope derives from the intersection between psychoanalysis and neuroscience. It gives us another way to conceptualise the development of pre-verbal communication. It may also pave the way for a finer distinction of different types of envelopes.Ultimately, in this review we find that psychic envelopes in infancy can be viewed from four different perspectives (economic, topographical, dynamic and genetic and recommend further investigation.
Sanders, Rogier W.; Vesanen, Mika; Schuelke, Norbert; Master, Aditi; Schiffner, Linnea; Kalyanaraman, Roopa; Paluch, Maciej; Berkhout, Ben; Maddon, Paul J.; Olson, William C.; Lu, Min; Moore, John P.
2002-01-01
The envelope glycoprotein (Env) complex of human immunodeficiency virus type I has evolved a structure that is minimally immunogenic while retaining its natural function of receptor-mediated virus-cell fusion. The Env complex is trimeric; its six individual subunits (three gp120 and three gp41
Caulfield, Michael; Cupo, Albert; Dean, Hansi; Hoffenberg, Simon; King, C. Richter; Klasse, P. J.; Marozsan, Andre; Moore, John P.; Sanders, Rogier W.; Ward, Andrew; Wilson, Ian; Julien, Jean-Philippe
2017-08-22
The present application relates to novel HIV-1 envelope glycoproteins, which may be utilized as HIV-1 vaccine immunogens, and antigens for crystallization, electron microscopy and other biophysical, biochemical and immunological studies for the identification of broad neutralizing antibodies. The present invention encompasses the preparation and purification of immunogenic compositions, which are formulated into the vaccines of the present invention.
Handbook on data envelopment analysis
Cooper, William W; Zhu, Joe
2011-01-01
Focusing on extensively used Data Envelopment Analysis topics, this volume aims to both describe the state of the field and extend the frontier of DEA research. New chapters include DEA models for DMUs, network DEA, models for supply chain operations and applications, and new developments.
Monte Carlo investigation of the low-dose envelope from scanned proton pencil beams
International Nuclear Information System (INIS)
Sawakuchi, Gabriel O; Titt, Uwe; Mirkovic, Dragan; Ciangaru, George; Zhu, X Ronald; Sahoo, Narayan; Gillin, Michael T; Mohan, Radhe
2010-01-01
Scanned proton pencil beams carry a low-dose envelope that extends several centimeters from the individual beam's central axis. Thus, the total delivered dose depends on the size of the target volume and the corresponding number and intensity of beams necessary to cover the target volume uniformly. This dependence must be considered in dose calculation algorithms used by treatment planning systems. In this work, we investigated the sources of particles contributing to the low-dose envelope using the Monte Carlo technique. We used a validated model of our institution's scanning beam line to determine the contributions to the low-dose envelope from secondary particles created in a water phantom and particles scattered in beam line components. Our results suggested that, for high-energy beams, secondary particles produced by nuclear interactions in the water phantom are the major contributors to the low-dose envelope. For low-energy beams, the low-dose envelope is dominated by particles undergoing multiple Coulomb scattering in the beam line components and water phantom. Clearly, in the latter situation, the low-dose envelope depends directly on beam line design features. Finally, we investigated the dosimetric consequences of the low-dose envelope. Our results showed that if not modeled properly the low-dose envelope may cause clinically relevant dose disturbance in the target volume. This work suggested that this low-dose envelope is beam line specific for low-energy beams, should be thoroughly experimentally characterized and validated during commissioning of the treatment planning system, and therefore is of great concern for accurate delivery of proton scanning beam doses.
Dynamical model for the dusty envelope around the symbiotic nova PU Vulpeculae
International Nuclear Information System (INIS)
Men'shchikov, A.B.; Tutukov, A.V.; Shustov, B.M.; Ergma, E.V.
1985-01-01
An evolutionary model for PU Vul, Object Kuwano--Honda, indicates that the deep 1980--1981 minimum may have resulted from detachment of a dust envelope. The envelope ejection process and the changes in the infrared spectrum are studied numerically; evidently the envelope departs strongly from spherical symmetry. The bluing observed at minimum light might have been due to dissipation of shock energy
Semiparametric Power Envelopes for Tests of the Unit Root Hypothesis
DEFF Research Database (Denmark)
Jansson, Michael
This paper derives asymptotic power envelopes for tests of the unit root hypothesis in a zero-mean AR(1) model. The power envelopes are derived using the limits of experiments approach and are semiparametric in the sense that the underlying error distribution is treated as an unknown...
Dowdall, Jayme R; Sadow, Peter M; Hartnick, Christopher; Vinarsky, Vladimir; Mou, Hongmei; Zhao, Rui; Song, Phillip C; Franco, Ramon A; Rajagopal, Jayaraj
2015-09-01
A precise molecular schema for classifying the different cell types of the normal human vocal fold epithelium is lacking. We hypothesize that the true vocal fold epithelium has a cellular architecture and organization similar to that of other stratified squamous epithelia including the skin, cornea, oral mucosa, and esophagus. In analogy to disorders of the skin and gastrointestinal tract, a molecular definition of the normal cell types within the human vocal fold epithelium and a description of their geometric relationships should serve as a foundation for characterizing cellular changes associated with metaplasia, dysplasia, and cancer. Qualitative study with adult human larynges. Histologic sections of normal human laryngeal tissue were analyzed for morphology (hematoxylin and eosin) and immunohistochemical protein expression profile, including cytokeratins (CK13 and CK14), cornified envelope proteins (involucrin), basal cells (NGFR/p75), and proliferation markers (Ki67). We demonstrated that three distinct cell strata with unique marker profiles are present within the stratified squamous epithelium of the true vocal fold. We used these definitions to establish that cell proliferation is restricted to certain cell types and layers within the epithelium. These distinct cell types are reproducible across five normal adult larynges. We have established that three layers of cells are present within the normal adult stratified squamous epithelium of the true vocal fold. Furthermore, replicating cell populations are largely restricted to the parabasal strata within the epithelium. This delineation of distinct cell populations will facilitate future studies of vocal fold regeneration and cancer. N/A. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.
Wnt signaling induces differentiation of progenitor cells in organotypic keratinocyte cultures
Directory of Open Access Journals (Sweden)
Liu Bob Y
2007-02-01
Full Text Available Abstract Background Interfollicular skin develops normally only when the activity of the progenitor cells in the basal layer is counterbalanced by the exit of cells into the suprabasal layers, where they differentiate and cornify to establish barrier function. Distinct stem and progenitor compartments have been demonstrated in hair follicles and sebaceous glands, but there are few data to describe the control of interfollicular progenitor cell activity. Wnt signaling has been shown to be an important growth-inducer of stem cell compartments in skin and many other tissues. Results Here, we test the effect of ectopic Wnt1 expression on the behavior of interfollicular progenitor cells in an organotypic culture model, and find that Wnt1 signaling inhibits their growth and promotes terminal differentiation. Conclusion These results are consistent with the phenotypes reported for transgenic mice engineered to have gain or loss of function of Wnt signaling in skin, which would recommend our culture model as an accurate one for molecular analysis. Since it is known that canonical ligands are expressed in skin, it is likely that this pathway normally regulates the balance of growth and differentiation, and suggests it could be important to pathogenesis.
Kelly, Amélie A; Kalisch, Barbara; Hölzl, Georg; Schulze, Sandra; Thiele, Juliane; Melzer, Michael; Roston, Rebecca L; Benning, Christoph; Dörmann, Peter
2016-09-20
Galactolipids [monogalactosyldiacylglycerol (MGDG) and digalactosyldiacylglycerol (DGDG)] are the hallmark lipids of photosynthetic membranes. The galactolipid synthases MGD1 and DGD1 catalyze consecutive galactosyltransfer reactions but localize to the inner and outer chloroplast envelopes, respectively, necessitating intermembrane lipid transfer. Here we show that the N-terminal sequence of DGD1 (NDGD1) is required for galactolipid transfer between the envelopes. Different diglycosyllipid synthases (DGD1, DGD2, and Chloroflexus glucosyltransferase) were introduced into the dgd1-1 mutant of Arabidopsis in fusion with N-terminal extensions (NDGD1 and NDGD2) targeting to the outer envelope. Reconstruction of DGDG synthesis in the outer envelope membrane was observed only with diglycosyllipid synthase fusion proteins carrying NDGD1, indicating that NDGD1 enables galactolipid translocation between envelopes. NDGD1 binds to phosphatidic acid (PA) in membranes and mediates PA-dependent membrane fusion in vitro. These findings provide a mechanism for the sorting and selective channeling of lipid precursors between the galactolipid pools of the two envelope membranes.
Thermal performance envelopes for MHTGRs - Reliability by design
International Nuclear Information System (INIS)
Etzel, K.T.; Howard, W.W.; Zgliczynski, J.
1992-01-01
Thermal performance envelopes are used to specify steady-state design requirements for the systems of the modular high-temperature gas-cooled reactor (MHTGR) to maximize plant performance reliability with optimized design. The thermal performance envelopes are constructed around the expected operating point to account for uncertainties in actual plant as-built parameters and plant operation. The components are then designed to perform successfully at all points within the envelope. As a result, plant reliability is maximized by accounting for component thermal performance variation in the design. The design is optimized by providing a means to determine required margins in a disciplined and visible fashion. This is accomplished by coordinating these requirements with the various system and component designers in the early stages of the design, applying the principles of total quality management. The design is challenged by the more complex requirements associated with a range of operating conditions, but in return, high probability of delivering reliable performance throughout the plant life is ensured
Loss of the integral nuclear envelope protein SUN1 induces alteration of nucleoli.
Matsumoto, Ayaka; Sakamoto, Chiyomi; Matsumori, Haruka; Katahira, Jun; Yasuda, Yoko; Yoshidome, Katsuhide; Tsujimoto, Masahiko; Goldberg, Ilya G; Matsuura, Nariaki; Nakao, Mitsuyoshi; Saitoh, Noriko; Hieda, Miki
2016-01-01
A supervised machine learning algorithm, which is qualified for image classification and analyzing similarities, is based on multiple discriminative morphological features that are automatically assembled during the learning processes. The algorithm is suitable for population-based analysis of images of biological materials that are generally complex and heterogeneous. Here we used the algorithm wndchrm to quantify the effects on nucleolar morphology of the loss of the components of nuclear envelope in a human mammary epithelial cell line. The linker of nucleoskeleton and cytoskeleton (LINC) complex, an assembly of nuclear envelope proteins comprising mainly members of the SUN and nesprin families, connects the nuclear lamina and cytoskeletal filaments. The components of the LINC complex are markedly deficient in breast cancer tissues. We found that a reduction in the levels of SUN1, SUN2, and lamin A/C led to significant changes in morphologies that were computationally classified using wndchrm with approximately 100% accuracy. In particular, depletion of SUN1 caused nucleolar hypertrophy and reduced rRNA synthesis. Further, wndchrm revealed a consistent negative correlation between SUN1 expression and the size of nucleoli in human breast cancer tissues. Our unbiased morphological quantitation strategies using wndchrm revealed an unexpected link between the components of the LINC complex and the morphologies of nucleoli that serves as an indicator of the malignant phenotype of breast cancer cells.
Radio Imaging of Envelopes of Evolved Stars
Cotton, Bill
2018-04-01
This talk will cover imaging of stellar envelopes using radio VLBI techniques; special attention will be paid to the technical differences between radio and optical/IR interferomery. Radio heterodyne receivers allow a straightforward way to derive spectral cubes and full polarization observations. Milliarcsecond resolution of very bright, i.e. non thermal, emission of molecular masers in the envelopes of evolved stars can be achieved using VLBI techniques with baselines of thousands of km. Emission from SiO, H2O and OH masers are commonly seen at increasing distance from the photosphere. The very narrow maser lines allow accurate measurements of the velocity field within the emitting region.
Jeon, Saewha; Djian, Philippe; Green, Howard
1998-01-01
Epidermal keratinocytes, late in their terminal differentiation, form cross-linked envelopes resistant to ionic detergent and reducing agent. Because the cross-linking process is catalyzed by the keratinocyte transglutaminase, the absence of active transglutaminase should result in failure of the keratinocyte to form a cross-linked envelope. Three keratinocyte strains bearing mutations in the keratinocyte transglutaminase were examined: two contained no detectable transglutaminase mRNA and no...
Enveloping algebras of Lie groups with descrete series
International Nuclear Information System (INIS)
Nguyen huu Anh; Vuong manh Son
1990-09-01
In this article we shall prove that the enveloping algebra of the Lie algebra of some unimodular Lie group having discrete series, when localized at some element of the center, is isomorphic to the tensor product of a Weyl algebra over the ring of Laurent polynomials of one variable and the enveloping algebra of some reductive Lie algebra. In particular, it will be proved that the Lie algebra of a unimodular solvable Lie group having discrete series satisfies the Gelfand-Kirillov conjecture. (author). 6 refs
Electroporation and use of hepatitis B virus envelope L proteins as bionanocapsules.
Yamada, Tadanori; Jung, Joohee; Seno, Masaharu; Kondo, Akihiko; Ueda, Masakazu; Tanizawa, Katsuyuki; Kuroda, Shun'ichi
2012-06-01
Hepatitis B virus (HBV) envelope L proteins, when synthesized in yeast cells, form a hollow bionanocapsule (BNC) in which genes (including large plasmids up to 40 kbp), small interfering RNA (siRNA), drugs, and proteins can be enclosed by electroporation. BNCs made from L proteins have several advantages as a delivery system: Because they display a human liver-specific receptor (the pre-S region of the L protein) on their surface, BNCs can efficiently and specifically deliver their contents to human liver-derived cells and tissues ex vivo (in cell culture) and in vivo (in a mouse xenograft model). Retargeting can be achieved simply by substituting other biorecognition molecules such as antibodies, ligands, receptors, and homing peptides for the pre-S region. In addition, BNCs have already been proven to be safe for use in humans during their development as an immunogen of hepatitis B vaccine. This protocol describes the loading of BNCs and their use in cell culture and in vivo.
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-01-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-κB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor κB (NF-κB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p5...
Neural encoding of the speech envelope by children with developmental dyslexia.
Power, Alan J; Colling, Lincoln J; Mead, Natasha; Barnes, Lisa; Goswami, Usha
2016-09-01
Developmental dyslexia is consistently associated with difficulties in processing phonology (linguistic sound structure) across languages. One view is that dyslexia is characterised by a cognitive impairment in the "phonological representation" of word forms, which arises long before the child presents with a reading problem. Here we investigate a possible neural basis for developmental phonological impairments. We assess the neural quality of speech encoding in children with dyslexia by measuring the accuracy of low-frequency speech envelope encoding using EEG. We tested children with dyslexia and chronological age-matched (CA) and reading-level matched (RL) younger children. Participants listened to semantically-unpredictable sentences in a word report task. The sentences were noise-vocoded to increase reliance on envelope cues. Envelope reconstruction for envelopes between 0 and 10Hz showed that the children with dyslexia had significantly poorer speech encoding in the 0-2Hz band compared to both CA and RL controls. These data suggest that impaired neural encoding of low frequency speech envelopes, related to speech prosody, may underpin the phonological deficit that causes dyslexia across languages. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Envelope correlation in (N, N) MIMO antenna array from scattering parameters
DEFF Research Database (Denmark)
Thaysen, Jesper; Jakobsen, Kaj Bjarne
2006-01-01
the envelope correlation coefficient. This approach has the advantage that it does not require knowledge of the antenna radiation pattern. Numerical data that include conductor and permittivity loss are shown to validate the approach. Using the scattering parameters for calculating the envelope correlation......A simple closed-form equation to calculate the envelope correlation between any two receiver or transmitter antennas in a multi-input multi-output (MIMO) system of an arbitrary number of elements is derived. The equation uses the scattering parameters obtained at the antenna feed point to calculate...
Enveloped virus flocculation and removal in osmolyte solutions.
Gencoglu, Maria F; Heldt, Caryn L
2015-07-20
Our ability to reduce infectious disease burden throughout the world has been greatly improved by the creation of vaccines. However, worldwide immunization rates are low. The two most likely reasons are the lack of sufficient distribution in underdeveloped countries and the high cost of vaccine products. The high costs are due to the difficulties of manufacturing individual vaccine products with specialized purification trains. In this study, we propose to use virus flocculation in osmolytes, followed by microfiltration, as an alternative vaccine purification operation. In our previous work, we demonstrated that osmolytes preferentially flocculate a non-enveloped virus, porcine parvovirus (PPV). In this work we show that osmolytes flocculate the enveloped virus, Sindbis virus heat resistant strain (SVHR), and demonstrate a >80% removal with a 0.2 μm microfilter membrane while leaving proteins in solution. The best osmolytes were tested for their ability to flocculate SVHR at different concentrations, pH and ionic strengths. Our best removal was 98% of SVHR in 0.3M mannitol at a pH of 5. We propose that osmolytes are able to flocculate hydrophobic non-enveloped and enveloped virus particles by the reduction of the hydration layer around the particles, which stimulates virus aggregation. Now that we have demonstrated that protecting osmolytes flocculate viruses, this method has the potential to be a future platform purification process for vaccines. Copyright © 2015 Elsevier B.V. All rights reserved.
Multi-layered breathing architectural envelope
DEFF Research Database (Denmark)
Lund Larsen, Andreas; Foged, Isak Worre; Jensen, Rasmus Lund
2014-01-01
A multi layered breathing envelope is developed as a method of natural ventilation. The two main layers consist of mineral wool and air permeable concrete. The mineral wool works as a dynamic insulation and the permeable concrete as a heat recovery system with a high thermal mass for heat storage...
Yeh, Chung-Hsin; Kuo, Pao-Lin; Wang, Ya-Yun; Wu, Ying-Yu; Chen, Mei-Feng; Lin, Ding-Yen; Lai, Tsung-Hsuan; Chiang, Han-Sun; Lin, Ying-Hung
2015-01-01
Male infertility affects approximately 50% of all infertile couples. The male-related causes of intracytoplasmic sperm injection failure include the absence of sperm, immotile or immature sperm, and sperm with structural defects such as those caused by premature chromosomal condensation and DNA damage. Our previous studies based on a knockout mice model indicated that SEPT12 proteins are critical for the terminal morphological formation of sperm. SEPT12 mutations in men result in teratozospermia and oligozospermia. In addition, the spermatozoa exhibit morphological defects of the head and tail, premature chromosomal condensation, and nuclear damage. However, the molecular functions of SEPT12 during spermatogenesis remain unclear. To determine the molecular functions of SEPT12, we applied a yeast 2-hybrid system to identify SEPT12 interactors. Seven proteins that interact with SEPT12 were identified: SEPT family proteins (SEPT4 and SEPT6), nuclear or nuclear membrane proteins (protamine 2, sperm-associated antigen 4, and NDC1 transmembrane nucleoproine), and sperm-related structural proteins (pericentriolar material 1 and obscurin-like 1). Sperm-associated antigen 4 (SPAG4; also known as SUN4) belongs to the SUN family of proteins and acts as a linker protein between nucleoskeleton and cytoskeleton proteins and localizes in the nuclear membrane. We determined that SEPT12 interacts with SPAG4 in a male germ cell line through coimmunoprecipitation. During human spermiogenesis, SEPT12 is colocalized with SPAG4 near the nuclear periphery in round spermatids and in the centrosome region in elongating spermatids. Furthermore, we observed that SEPT12/SPAG4/LAMINB1 formed complexes and were coexpressed in the nuclear periphery of round spermatids. In addition, mutated SEPT12, which was screened from an infertile man, affected the integration of these nuclear envelope complexes through coimmunoprecipitation. This was the first study that suggested that SEPT proteins link to
Directory of Open Access Journals (Sweden)
Chung-Hsin Yeh
Full Text Available Male infertility affects approximately 50% of all infertile couples. The male-related causes of intracytoplasmic sperm injection failure include the absence of sperm, immotile or immature sperm, and sperm with structural defects such as those caused by premature chromosomal condensation and DNA damage. Our previous studies based on a knockout mice model indicated that SEPT12 proteins are critical for the terminal morphological formation of sperm. SEPT12 mutations in men result in teratozospermia and oligozospermia. In addition, the spermatozoa exhibit morphological defects of the head and tail, premature chromosomal condensation, and nuclear damage. However, the molecular functions of SEPT12 during spermatogenesis remain unclear. To determine the molecular functions of SEPT12, we applied a yeast 2-hybrid system to identify SEPT12 interactors. Seven proteins that interact with SEPT12 were identified: SEPT family proteins (SEPT4 and SEPT6, nuclear or nuclear membrane proteins (protamine 2, sperm-associated antigen 4, and NDC1 transmembrane nucleoproine, and sperm-related structural proteins (pericentriolar material 1 and obscurin-like 1. Sperm-associated antigen 4 (SPAG4; also known as SUN4 belongs to the SUN family of proteins and acts as a linker protein between nucleoskeleton and cytoskeleton proteins and localizes in the nuclear membrane. We determined that SEPT12 interacts with SPAG4 in a male germ cell line through coimmunoprecipitation. During human spermiogenesis, SEPT12 is colocalized with SPAG4 near the nuclear periphery in round spermatids and in the centrosome region in elongating spermatids. Furthermore, we observed that SEPT12/SPAG4/LAMINB1 formed complexes and were coexpressed in the nuclear periphery of round spermatids. In addition, mutated SEPT12, which was screened from an infertile man, affected the integration of these nuclear envelope complexes through coimmunoprecipitation. This was the first study that suggested that SEPT
Stability of an expanding cylindrical plasma envelope: Rayleigh--Taylor instability
International Nuclear Information System (INIS)
Han, S.J.
1982-01-01
The stability of a cylindrically symmetric plasma envelope driven outward by blast waves is considered. The plasma fluid is assumed to be a compressible, isentropic gas describable as an ideal gas ( p = arho/sup γ/, γ>1). The stability problem of such an envelope undergoing self-similar motion is solved by considering the initial-value problem. It is shown that in the early phase of an expansion, the envelope is unstable to Rayleigh--Taylor modes which develop at the inner surface. In the later phase of the expansion, the Rayleigh--Taylor modes are weakened due to the geometrical divergence effect. The implications of the time-dependent behavior of the Rayleigh--Taylor instability for plasma switches are discussed
Envelope method for background elimination from X-ray fluorescence spectra
International Nuclear Information System (INIS)
Monakhov, V.V.; Naumenko, P.A.; Chashinskaya, O.A.
2006-01-01
The influence of the background noise caused by Bremsstrahlung on the accuracy of the envelope method at x-ray fluorescence spectra processing is studied. This is carried out by the example of model spectra at different forms of Bremsstrahlung noise as well as at the presence of background noise in spectra. The interpolation by parabolic splines is used for the estimation of the error of the envelope method for the elimination of continuos background noise. It is found out that the error of the proposed method constitutes decimal parts of percent. It is shown that the envelope method is the effective technique for the elimination of the continuous Bremsstrahlung from x-ray fluorescence spectra of the first order [ru
Design and evaluation of a Flight Envelope Protection haptic feedback system
Ellerbroek, J.; Rodriguez Martin, M.J.M.; Lombaerts, T; van Paassen, M.M.; Mulder, M.
2016-01-01
This paper describes the design and evaluation of a shared control, haptic feedback system to communicate Flight Envelope Protection System intent. The concept uses a combination of stiffness feedback and vibration to communicate proximity of the aircraft state to flight envelope boundaries. In
Advancing the manufacture of complex geometry GFRC for today's building envelopes
Directory of Open Access Journals (Sweden)
Thomas Henriksen
2017-06-01
With this research the current architectural knowledge base has been advanced in terms of complex geometry thin-walled GFRC for building envelopes. The identified solutions should allow building with complex geometries to be realised using thin-walled GFRC as the envelope cladding.
Circumstellar envelopes of Cepheids: a possible bias affecting the distance scale?
Kervella, Pierre; Gallenne, Alexandre; Mérand, Antoine
2013-02-01
Circumstellar envelopes (CSEs) have been detected around many Cepheids, first based on long-baseline interferometry, and now also using other observing techniques. These envelopes are particularly interesting for two reasons: their presence could impact the Cepheid distance scale, and they may be valuable tracers of stellar mass loss. Here we focus on their potential impact on the calibration of the Cepheid distance scale. We consider the photometric contribution of the envelopes in the visible, near-, and thermal-infrared domains. We conclude that the impact of CSEs on the apparent luminosities of Cepheids is negligible at visible wavelengths and generally weak (case. Overall, the contribution of CSEs to the usual period-luminosity relations (from the visible to the K band) is mostly negligible. They could affect calibrations at longer wavelengths, although the presence of envelopes may have been partially taken into account in the existing empirical calibrations.
The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion
International Nuclear Information System (INIS)
Huang, Claire Y.-H.; Butrapet, Siritorn; Moss, Kelly J.; Childers, Thomas; Erb, Steven M.; Calvert, Amanda E.; Silengo, Shawn J.; Kinney, Richard M.; Blair, Carol D.; Roehrig, John T.
2010-01-01
The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could not re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.
Biomimetic Architecture in Building Envelope Maintenance (A Literature
Directory of Open Access Journals (Sweden)
Agus Salim N.A.
2014-01-01
Full Text Available The study of biomimetic architecture on building envelope is the main structure of this research. The concept is believed more sustainable and efficient for energy saving, operating cost consumption, waste recycle and design renewal in the future. The inspiration from the nature developed the intention on this study to explore on what and how this concept to overcome the problems through design. Biomimicry does catch the attention of human to study more on the system and function of its nature course. The designers are not exception influenced by this concept when the form, shape, texture and colour inspired them in their design. The domination of building form will affect the building envelope as the skin of the structure. A clear impact on building failure is begun with building envelope appearance without a proper maintenance. The faults in building design place a heavy burden on the building for the rest of its operational life and there is no compensation for it. In such situations, the responsibility falls on the shoulders of the designer.
The epigenetics of nuclear envelope organization and disease
International Nuclear Information System (INIS)
Schirmer, Eric C.
2008-01-01
Mammalian chromosomes and some specific genes have non-random positions within the nucleus that are tissue-specific and heritable. Work in many organisms has shown that genes at the nuclear periphery tend to be inactive and altering their partitioning to the interior results in their activation. Proteins of the nuclear envelope can recruit chromatin with specific epigenetic marks and can also recruit silencing factors that add new epigenetic modifications to chromatin sequestered at the periphery. Together these findings indicate that the nuclear envelope is a significant epigenetic regulator. The importance of this function is emphasized by observations of aberrant distribution of peripheral heterochromatin in several human diseases linked to mutations in NE proteins. These debilitating inherited diseases range from muscular dystrophies to the premature aging progeroid syndromes and the heterochromatin changes are just one early clue for understanding the molecular details of how they work. The architecture of the nuclear envelope provides a unique environment for epigenetic regulation and as such a great deal of research will be required before we can ascertain the full range of its contributions to epigenetics
Operating envelope to minimize probability of fractures in Zircaloy-2 pressure tubes
International Nuclear Information System (INIS)
Azer, N.; Wong, H.
1994-01-01
The failure mode of primary concern with Candu pressure tubes is fast fracture of a through-wall axial crack, resulting from delayed hydride crack growth. The application of operating envelopes is demonstrated to minimize the probability of fracture in Zircaloy-2 pressure tubes based on Zr-2.5%Nb pressure tube experience. The technical basis for the development of the operating envelopes is also summarized. The operating envelope represents an area on the pressure versus temperature diagram within which the reactor may be operated without undue concern for pressure tube fracture. The envelopes presented address both normal operating conditions and the condition where a pressure tube leak has been detected. The examples in this paper are prepared to illustrate the methodology, and are not intended to be directly applicable to the operation of any specific reactor. The application of operating envelopes to minimized the probability of fracture in 80 mm diameter Zircaloy-2 pressure tubes has been discussed. Both normal operating and leaking pressure tube conditions have been considered. 3 refs., 4 figs
Directory of Open Access Journals (Sweden)
Vanessa Danielle Muller
Full Text Available The Flaviviridae family includes several virus pathogens associated with human diseases worldwide. Within this family, Dengue virus is the most serious threat to public health, especially in tropical and sub-tropical regions of the world. Currently, there are no vaccines or specific antiviral drugs against Dengue virus or against most of the viruses of this family. Therefore, the development of vaccines and the discovery of therapeutic compounds against the medically most important flaviviruses remain a global public health priority. We previously showed that phospholipase A2 isolated from the venom of Crotalus durissus terrificus was able to inhibit Dengue virus and Yellow fever virus infection in Vero cells. Here, we present evidence that phospholipase A2 has a direct effect on Dengue virus particles, inducing a partial exposure of genomic RNA, which strongly suggests inhibition via the cleavage of glycerophospholipids at the virus lipid bilayer envelope. This cleavage might induce a disruption of the lipid bilayer that causes a destabilization of the E proteins on the virus surface, resulting in inactivation. We show by computational analysis that phospholipase A2 might gain access to the Dengue virus lipid bilayer through the pores found on each of the twenty 3-fold vertices of the E protein shell on the virus surface. In addition, phospholipase A2 is able to inactivate other enveloped viruses, highlighting its potential as a natural product lead for developing broad-spectrum antiviral drugs.
Nature of 'unseen' galactic envelopes
International Nuclear Information System (INIS)
McCrea, W.H.
1983-01-01
In this paper, it is suggested that unseen matter in a galactic envelope or in a group of galaxies may consist of substellar bodies originating as the first permanent 'stars' in the formation of a very massive galaxy according to a model for galaxy-formation on the basis of simple big-bang cosmology. (Auth.)
International Nuclear Information System (INIS)
Yamada, Yuma; Kawamura, Eriko; Harashima, Hideyoshi
2012-01-01
Mitochondrial gene therapy has the potential for curing a variety of diseases that are associated with mitochondrial DNA mutations and/or defects. To achieve this, it will be necessary to deliver therapeutic agents into the mitochondria in diseased cells. A number of mitochondrial drug delivery systems have been reported to date. However, reports of mitochondrial-targeted DNA delivery are limited. To achieve this, the therapeutic agent must be taken up by the cell (1), after which, the multi-processes associated with intracellular trafficking must be sophisticatedly regulated so as to release the agent from the endosome and deliver it to the cytosol (2) and to pass through the mitochondrial membrane (3). We report herein on the mitochondrial delivery of oligo DNA as a model therapeutic using a Dual Function (DF)-MITO-Porter, an innovative nano carrier designed for mitochondrial delivery. The critical structural elements of the DF-MITO-Porter include mitochondria-fusogenic inner envelopes and endosome-fusogenic outer envelopes, modified with octaarginine which greatly assists in cellular uptake. Inside the cell, the carrier passes through the endosomal and mitochondrial membranes via step-wise membrane fusion. When the oligo DNA was packaged in the DF-MITO-Porter, cellular uptake efficiency was strongly enhanced. Intracellular observation using confocal laser scanning microscopy showed that the DF-MITO-Porter was effectively released from endosomes. Moreover, the findings confirmed that the mitochondrial targeting activity of the DF-MITO-Porter was significantly higher than that of a carrier without outer endosome-fusogenic envelopes. These results support the conclusion that mitochondrial-targeted DNA delivery using a DF-MITO-Porter can be achieved when intracellular trafficking is optimally regulated.
Energy Technology Data Exchange (ETDEWEB)
Yamada, Yuma; Kawamura, Eriko; Harashima, Hideyoshi, E-mail: harasima@pharm.hokudai.ac.jp [Hokkaido University, Laboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences (Japan)
2012-08-15
Mitochondrial gene therapy has the potential for curing a variety of diseases that are associated with mitochondrial DNA mutations and/or defects. To achieve this, it will be necessary to deliver therapeutic agents into the mitochondria in diseased cells. A number of mitochondrial drug delivery systems have been reported to date. However, reports of mitochondrial-targeted DNA delivery are limited. To achieve this, the therapeutic agent must be taken up by the cell (1), after which, the multi-processes associated with intracellular trafficking must be sophisticatedly regulated so as to release the agent from the endosome and deliver it to the cytosol (2) and to pass through the mitochondrial membrane (3). We report herein on the mitochondrial delivery of oligo DNA as a model therapeutic using a Dual Function (DF)-MITO-Porter, an innovative nano carrier designed for mitochondrial delivery. The critical structural elements of the DF-MITO-Porter include mitochondria-fusogenic inner envelopes and endosome-fusogenic outer envelopes, modified with octaarginine which greatly assists in cellular uptake. Inside the cell, the carrier passes through the endosomal and mitochondrial membranes via step-wise membrane fusion. When the oligo DNA was packaged in the DF-MITO-Porter, cellular uptake efficiency was strongly enhanced. Intracellular observation using confocal laser scanning microscopy showed that the DF-MITO-Porter was effectively released from endosomes. Moreover, the findings confirmed that the mitochondrial targeting activity of the DF-MITO-Porter was significantly higher than that of a carrier without outer endosome-fusogenic envelopes. These results support the conclusion that mitochondrial-targeted DNA delivery using a DF-MITO-Porter can be achieved when intracellular trafficking is optimally regulated.
Safeguards Envelope Progress FY10
International Nuclear Information System (INIS)
Metcalf, Richard
2010-01-01
The Safeguards Envelope is a strategy to determine a set of specific operating parameters within which nuclear facilities may operate to maximize safeguards effectiveness without sacrificing safety or plant efficiency. This paper details the additions to the advanced operating techniques that will be applied to real plant process monitoring (PM) data from the Idaho Chemical Processing Plant (ICPP). Research this year focused on combining disparate pieces of data together to maximize operating time with minimal downtime due to safeguards. A Chi-Square and Croiser's cumulative sum were both included as part of the new analysis. Because of a major issue with the original data, the implementation of the two new tests did not add to the existing set of tests, though limited one-variable optimization made a small increase in detection probability. Additional analysis was performed to determine if prior analysis would have caused a major security or safety operating envelope issue. It was determined that a safety issue would have resulted from the prior research, but that the security may have been increased under certain conditions.
The dynamics of short envelope solitons in media with controlled dispersion
International Nuclear Information System (INIS)
Aseeva, N.V.; Gromov, E.M.; Tyutin, V.V.
2007-01-01
The dynamics of short envelope solitons in media with controlled dispersion is investigated in the framework of the third-order nonlinear Schroedinger equation. Evolution of the solitons amplitude is analyzed in the adiabatic approximation. The existence of short envelope solitons independent from linear dispersion inhomogeneity is shown
Early Site Permit Demonstration Program: Plant parameters envelope report. Volume 1
Energy Technology Data Exchange (ETDEWEB)
1993-03-01
The Early Site Permit (ESP) Demonstration Program is the nuclear industry`s initiative for piloting the early resolution of siting-related issues before the detailed design proceedings of the combined operating license review. The ESP Demonstration Program consists of three phases. The plant parameters envelopes task is part of Phase 1, which addresses the generic review of applicable federal regulations and develops criteria for safety and environmental assessment of potential sites. The plant parameters envelopes identify parameters that characterize the interface between an ALWR design and a potential site, and quantify the interface through values selected from the Utility Requirements Documents, vendor design information, or engineering assessments. When augmented with site-specific information, the plant parameters envelopes provide sufficient information to allow ESPs to be granted based on individual ALWR design information or enveloping design information for the evolutionary, passive, or generic ALWR plants. This document is expected to become a living document when used by future applicants.
Martino, Lisa; Morchoisne-Bolhy, Stéphanie; Cheerambathur, Dhanya K; Van Hove, Lucie; Dumont, Julien; Joly, Nicolas; Desai, Arshad; Doye, Valérie; Pintard, Lionel
2017-10-23
In animal cells, nuclear envelope breakdown (NEBD) is required for proper chromosome segregation. Whereas mitotic kinases have been implicated in NEBD, how they coordinate their activity to trigger this event is unclear. Here, we show that both in human cells and Caenorhabditis elegans, the Polo-like kinase 1 (PLK-1) is recruited to the nuclear pore complexes, just prior to NEBD, through its Polo-box domain (PBD). We provide evidence that PLK-1 localization to the nuclear envelope (NE) is required for efficient NEBD. We identify the central channel nucleoporins NPP-1/Nup58, NPP-4/Nup54, and NPP-11/Nup62 as the critical factors anchoring PLK-1 to the NE in C. elegans. In particular, NPP-1, NPP-4, and NPP-11 primed at multiple Polo-docking sites by Cdk1 and PLK-1 itself physically interact with the PLK-1 PBD. We conclude that nucleoporins play an unanticipated regulatory role in NEBD, by recruiting PLK-1 to the NE thereby facilitating phosphorylation of critical downstream targets. Copyright © 2017 Elsevier Inc. All rights reserved.
Evaluation of eco-friendly zwitterionic detergents for enveloped virus inactivation.
Conley, Lynn; Tao, Yinying; Henry, Alexis; Koepf, Edward; Cecchini, Douglas; Pieracci, John; Ghose, Sanchayita
2017-04-01
Inclusion of a detergent in protein biotherapeutic purification processes is a simple and very robust method for inactivating enveloped viruses. The detergent Triton X-100 has been used for many years and is part of the production process of several commercial therapeutic proteins. However, recent ecological studies have suggested that Triton X-100 and its break-down products can potentially behave as endocrine disrupters in aquatic organisms, raising concerns from an environmental impact perspective. As such, discharge of Triton X-100 into the waste water treatment plants is regulated in some jurisdictions, and alternative detergents for viral inactivation are required. In this work, we report on the identification and evaluation of more eco-friendly detergents as viable replacements for Triton X-100. Five detergent candidates with low to moderate environmental impact were initially identified and evaluated with respect to protein stability, followed by proof-of-concept virus inactivation studies using a model enveloped virus. From the set of candidates lauryldimethylamine N-oxide (LDAO) was identified as the most promising detergent due to its low ecotoxicity, robust anti-viral activity (LRV >4 at validation set-point conditions with X-MuLX), and absence of any negative impact on protein function. This detergent exhibited effective and robust virus inactivation in a broad range of protein concentrations, solution conductivities, pHs, and in several different cell culture fluid matrices. The only process parameter which correlated with reduced virus inactivation potency was LDAO concentration, and then only when the concentration was reduced to below the detergent's critical micelle concentration (CMC). Additionally, this work also demonstrated that LDAO was cleared to below detectable levels after Protein A affinity chromatography, making it suitable for use in a platform process that utilizes this chromatographic mode for protein capture. All these findings
Determinants of foamy virus envelope glycoprotein mediated resistance to superinfection
International Nuclear Information System (INIS)
Berg, Angelika; Pietschmann, Thomas; Rethwilm, Axel; Lindemann, Dirk
2003-01-01
Little is known about the nature of foamy virus (FV) receptor molecules on target cells and their interaction with the viral glycoproteins. Similar to other viruses, cellular expression of the FV Env protein is sufficient to induce resistance to exogenous FV, a phenomenon called superinfection resistance (SIR). In this study we define determinants of the FV Env protein essential for mediating SIR. FV Env requires the extracellular domains of the SU and the TM subunits as well as membrane anchorage, efficient cell surface transport, and most probably correct subunit processing. This is in contrast to murine leukemia virus where secreted proteins comprising the receptor-binding domain in SU are sufficient to induce SIR. Furthermore, we demonstrate that cellular expression of the prototype FV envelope proteins induces SIR against pseudotypes with glycoproteins of other FV species, including of simian, feline, bovine, and equine origin. This implies that all of them use the same receptor molecules for viral entry
Spectral Envelope Transformation in Singing Voice for Advanced Pitch Shifting
Directory of Open Access Journals (Sweden)
José L. Santacruz
2016-11-01
Full Text Available The aim of the present work is to perform a step towards more natural pitch shifting techniques in singing voice for its application in music production and entertainment systems. In this paper, we present an advanced method to achieve natural modifications when applying a pitch shifting process to singing voice by modifying the spectral envelope of the audio excerpt. To this end, an all-pole model has been selected to model the spectral envelope, which is estimated using a constrained non-linear optimization. The analysis of the global variations of the spectral envelope was carried out by identifying changes of the parameters of the model along with the changes of the pitch. With the obtained spectral envelope transformation functions, we applied our pitch shifting scheme to some sustained vowels in order to compare results with the same transformation made by using the Flex Pitch plugin of Logic Pro X and pitch synchronous overlap and add technique (PSOLA. This comparison has been carried out by means of both an objective and a subjective evaluation. The latter was done with a survey open to volunteers on our website.
de Oliveira dos Santos Soares, Ricardo; Oliveira Bortot, Leandro; van der Spoel, David; Caliri, Antonio
2017-12-01
Biological membranes are continuously remodeled in the cell by specific membrane-shaping machineries to form, for example, tubes and vesicles. We examine fundamental mechanisms involved in the vesiculation processes induced by a cluster of envelope (E) and membrane (M) proteins of the dengue virus (DENV) using molecular dynamics simulations and a coarse-grained model. We show that an arrangement of three E-M heterotetramers (EM3) works as a bending unit and an ordered cluster of five such units generates a closed vesicle, reminiscent of the virus budding process. In silico mutagenesis of two charged residues of the anchor helices of the envelope proteins of DENV shows that Arg-471 and Arg-60 are fundamental to produce bending stress on the membrane. The fine-tuning between the size of the EM3 unit and its specific bending action suggests this protein unit is an important factor in determining the viral particle size.
Bailer, Susanne M.
2017-11-25
Herpesviral capsid assembly is initiated in the nucleoplasm of the infected cell. Size constraints require that newly formed viral nucleocapsids leave the nucleus by an evolutionarily conserved vescular transport mechanism called nuclear egress. Mature capsids released from the nucleoplasm are engaged in a membrane-mediated budding process, composed of primary envelopment at the inner nuclear membrane and de-envelopment at the outer nuclear membrane. Once in the cytoplasm, the capsids receive their secondary envelope for maturation into infectious virions. Two viral proteins conserved throughout the herpesvirus family, the integral membrane protein pUL34 and the phosphoprotein pUL31, form the nuclear egress complex required for capsid transport from the infected nucleus to the cytoplasm. Formation of the nuclear egress complex results in budding of membrane vesicles revealing its function as minimal virus-encoded membrane budding and scission machinery. The recent structural analysis unraveled details of the heterodimeric nuclear egress complex and the hexagonal coat it forms at the inside of budding vesicles to drive primary envelopment. With this review, I would like to present the capsid-escort-model where pUL31 associates with capsids in nucleoplasmic replication compartments for escort to sites of primary envelopment thereby coupling capsid maturation and nuclear egress.
Nucleocytoplasmic transport of nucleocapsid proteins of enveloped RNA viruses
Directory of Open Access Journals (Sweden)
Wahyu eWulan
2015-06-01
Full Text Available Most viruses with non-segmented single stranded RNA genomes complete their life cycle in the cytoplasm of infected cells. However, despite undergoing replication in the cytoplasm, the structural proteins of some of these RNA viruses localize to the nucleus at specific times in the virus life cycle, primarily early in infection. Limited evidence suggests that this enhances successful viral replication by interfering with or inhibiting the host antiviral response. Nucleocapsid proteins of RNA viruses have a well-established, essential cytoplasmic role in virus replication and assembly. Intriguingly, nucleocapsid proteins of some RNA viruses also localize to the nucleus/nucleolus of infected cells. Their nuclear function is less well understood although significant advances have been made in recent years. This review will focus on the nucleocapsid protein of cytoplasmic enveloped RNA viruses, including their localization to the nucleus/nucleolus and function therein. A greater understanding of the nuclear localization of nucleocapsid proteins has the potential to enhance therapeutic strategies as it can be a target for the development of live-attenuated vaccines or antiviral drugs.
3D Modeling of Accretion Disks and Circumbinary Envelopes in Close Binaries
Bisikalo, D.
2010-12-01
A number of observations prove the complex flow structure in close binary stars. The gas dynamic structure of the flow is governed by the stream of matter from the inner Lagrange point, the accretion disk, the circum-disk halo, and the circumbinary envelope. Observations reflect the current state of a binary system and for their interpretation one should consider the gas dynamics of flow patterns. Three-dimensional numerical gasdynamical modeling is used to study the gaseous flow structure and dynamics in close binaries. It is shown that the periodic variations of the positions of the disk and the bow shock formed when the inner parts of the circumbinary envelope flow around the disk result in variations in both the rate of angular-momentum transfer to the disk and the flow structure near the Lagrange point L3. All these factors lead to periodic ejections of matter from the accretion disk and circum-disk halo into the outer layers of the circumbinary envelope. The results of simulations are used to estimate the physical parameters of the circumbinary envelope, including 3D matter distribution in it, and the matter-flow configuration and dynamics. The envelope becomes optically thick for systems with high mass-exchange rates, M⊙=10-8 Msun/year, and has a significant influence on the binary's observed features. The uneven phase distributions of the matter and density variations due to periodic injections of matter into the envelope are important for interpretations of observations of CBSs.
Energy Technology Data Exchange (ETDEWEB)
Furukawa, Kazuhiro, E-mail: furukawa@chem.sc.niigata-u.ac.jp [Department of Chemistry, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Ishida, Kazuya; Tsunoyama, Taka-aki; Toda, Suguru; Osoda, Shinichi; Horigome, Tsuneyoshi [Department of Chemistry, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Fisher, Paul A. [Department of Pharmacological Sciences, School of Medicine, University Medical Center, State University of New York at Stony Brook, Stony Brook, NY 11794-8651 (United States); Sugiyama, Shin [Division of Biological Science, Graduate School of Science, Nagoya University, Nagoya 464-8602 (Japan)
2009-04-15
To investigate nuclear lamina re-assembly in vivo, Drosophila A-type and B-type lamins were artificially expressed in Drosophila lamin Dm{sub 0}null mutant brain cells. Both exogenous lamin C (A-type) and Dm{sub 0} (B-type) formed sub-layers at the nuclear periphery, and efficiently reverted the abnormal clustering of the NPC. Lamin C initially appeared where NPCs were clustered, and subsequently extended along the nuclear periphery accompanied by the recovery of the regular distribution of NPCs. In contrast, lamin Dm{sub 0} did not show association with the clustered NPCs during lamina formation and NPC spacing recovered only after completion of a closed lamin Dm{sub 0} layer. Further, when lamin Dm{sub 0} and C were both expressed, they did not co-polymerize, initiating layer formation in separate regions. Thus, A and B-type lamins reveal differing properties during lamina assembly, with A-type having the primary role in organizing NPC distribution. This previously unknown complexity in the assembly of the nuclear lamina could be the basis for intricate nuclear envelope functions.
Świderski, Zdzisław; Miquel, Jordi; Azzouz-Maache, Samira; Pétavy, Anne-Françoise
2017-07-01
The origin, differentiation and functional ultrastructure of oncospheral or egg envelopes in Echinococcus multilocularis Leuckart, 1863 were studied by transmission electron microscopy (TEM) and cytochemistry. The purpose of our study is to describe the formation of the four primary embryonic envelopes, namely vitelline capsule, outer envelope, inner envelope and oncospheral membrane, and their transformation into the oncospheral or egg envelopes surrounding the mature hexacanth. This transformation takes place in the preoncospheral phase of embryonic development. The vitelline capsule and oncospheral membrane are thin membranes, while the outer and inner envelopes are thick cytoplasmic layers formed by two specific types of blastomeres: the outer envelope by cytoplasmic fusion of two macromeres and the inner envelope by cytoplasmic fusion of three mesomeres. Both outer and inner envelopes are therefore cellular in origin and syncytial in nature. During the advanced phase of embryonic development, the outer and inner envelopes undergo great modifications. The outer envelope remains as a metabolically active layer involved in the storage of glycogen and lipids for the final stages of egg development and survival. The inner envelope is the most important protective layer because of its thick layer of embryophoric blocks that assures oncospheral protection and survival. This embryophore is the principal layer of mature eggs, affording physical and physiological protection for the differentiated embryo or oncosphere, since the outer envelope is stripped from the egg before it is liberated. The embryophore is very thick and impermeable, consisting of polygonal blocks of an inert keratin-like protein held together by a cementing substance. The embryophore therefore assures extreme resistance of eggs, enabling them to withstand a wide range of environmental temperatures and physicochemical conditions.
A multi-resolution envelope-power based model for speech intelligibility
DEFF Research Database (Denmark)
Jørgensen, Søren; Ewert, Stephan D.; Dau, Torsten
2013-01-01
The speech-based envelope power spectrum model (sEPSM) presented by Jørgensen and Dau [(2011). J. Acoust. Soc. Am. 130, 1475-1487] estimates the envelope power signal-to-noise ratio (SNRenv) after modulation-frequency selective processing. Changes in this metric were shown to account well...... to conditions with stationary interferers, due to the long-term integration of the envelope power, and cannot account for increased intelligibility typically obtained with fluctuating maskers. Here, a multi-resolution version of the sEPSM is presented where the SNRenv is estimated in temporal segments...... with a modulation-filter dependent duration. The multi-resolution sEPSM is demonstrated to account for intelligibility obtained in conditions with stationary and fluctuating interferers, and noisy speech distorted by reverberation or spectral subtraction. The results support the hypothesis that the SNRenv...
Antiviral Inhibition of Enveloped Virus Release by Tetherin/BST-2: Action and Counteraction
Directory of Open Access Journals (Sweden)
Stuart J. D. Neil
2011-05-01
Full Text Available Tetherin (BST2/CD317 has been recently recognized as a potent interferon-induced antiviral molecule that inhibits the release of diverse mammalian enveloped virus particles from infected cells. By targeting an immutable structure common to all these viruses, the virion membrane, evasion of this antiviral mechanism has necessitated the development of specific countermeasures that directly inhibit tetherin activity. Here we review our current understanding of the molecular basis of tetherin’s mode of action, the viral countermeasures that antagonize it, and how virus/tetherin interactions may affect viral transmission and pathogenicity.
Chen, Zhuo; Li, Zhijie; Basti, Surendra; Farley, William J; Pflugfelder, Stephen C
2010-11-01
Protein kinase C (PKC) α plays a major role in the parasympathetic neural stimulation of lacrimal gland (LG) secretion. It also has been reported to have antiapoptotic properties and to promote cell survival. Therefore, the hypothesis for the present study was that PKCα knockout ((-/-)) mice have impaired ocular surface-lacrimal gland signaling, rendering them susceptible to desiccating stress and impaired corneal epithelial wound healing. In this study, the lacrimal function unit (LFU) and the stressed wound-healing response were examined in PKCα(-/-) mice. In PKCα(+/+) control mice and PKCα(-/-) mice, tear production, osmolarity, and clearance rate were evaluated before and after experimental desiccating stress. Histology and immunofluorescent staining of PKC and epidermal growth factor were performed in tissues of the LFU. Cornified envelope (CE) precursor protein expression and cell proliferation were evaluated. The time course of healing and degree of neutrophil infiltration was evaluated after corneal epithelial wounding. Compared with the PKCα(+/+) mice, the PKCα(-/-) mice were noted to have significantly increased lacrimal gland weight, with enlarged, carbohydrate-rich, PAS-positive acinar cells; increased corneal epithelia permeability, with reduced CE expression; and larger conjunctival epithelial goblet cells. The PKCα(-/-) mice showed more rapid corneal epithelial healing, with less neutrophil infiltration and fewer proliferating cells than did the PKCα(+/+) mice. The PKCα(-/-) mice showed lower tear production, which appeared to be caused by impaired secretion by the LG and conjunctival goblet cells. Despite their altered tear dynamics, the PKCα(-/-) mice demonstrated more rapid corneal epithelial wound healing, perhaps due to decreased neutrophil infiltration.
Nakamura, Y.; Nishikawa, M.; Osawa, H.; Okamoto, Y.; Kanao, T.; Sato, R.
2018-05-01
In this article, we propose the detection method of the recorded data pattern by the envelope of the temporal magnetization dynamics of resonantly interacting spin-torque oscillator on the microwave assisted magnetic recording for three-dimensional magnetic recording. We simulate the envelope of the waveform from recorded dots with the staggered magnetization configuration, which are calculated by using a micromagnetic simulation. We study the data detection methods for the envelope and propose a soft-output Viterbi algorithm (SOVA) for partial response (PR) system as a signal processing system for three dimensional magnetic recording.
Directory of Open Access Journals (Sweden)
Vytchikov Yury
2017-01-01
Full Text Available This paper focuses on energy consumption for heating single layer building envelopes, used in conditions of intermittent heating in different physical and mechanical and thermophysical parameters of construction materials. The authors investigated several variants of single-layer building envelopes, used frequently in building practice, with different density and coefficients of building materials thermal conductivity. For each variant of a building envelope heat leakage and time spent on heating were calculated. Heating time was calculated by both exact and approximate analytical method. Then the researchers draw a graphic dependence of energy consumption on the density of the material taking this computational data as a basis. Further analysis showed that building envelopes made of lightweight aggregate concrete and porous concrete were the most energy efficient.This paper focuses on energy consumption for heating single layer building envelopes, used in conditions of intermittent heating in different physical and mechanical and thermophysical parameters of construction materials. The authors investigated several variants of single-layer building envelopes, used frequently in building practice, with different density and coefficients of building materials thermal conductivity. For each variant of a building envelope heat leakage and time spent on heating were calculated. Heating time was calculated by both exact and approximate analytical method. Then the researchers draw a graphic dependence of energy consumption on the density of the material taking this computational data as a basis. Further analysis showed that building envelopes made of lightweight aggregate concrete and porous concrete were the most energy efficient.
Calculation of CWKB envelope in boson and fermion productions
International Nuclear Information System (INIS)
Biswas, S.; Chowdhury, I.
2007-01-01
We present the calculation of envelope of boson and of both low-and high-mass fermion production at the end of inflation when the coherently oscillating inflations decay into bosons and fermions. We consider three different models of inflation and use CWKB technique to calculate the envelope to understand the structure of resonance band formation. We observe that though low-mass fermion production is not effective in preheating because of Pauli blocking, it is quite probable for high-mass fermion to take part in pre heating. (author)
Failure envelope approach for consolidated undrained capacity of shallow foundations
Vulpe, Cristina; Gourvenec, Susan; Leman, Billy; Fung, Kah Ngii
2016-01-01
A generalized framework is applied to predict consolidated undrained VHM failure envelopes for surface circular and strip foundations. The failure envelopes for consolidated undrained conditions are shown to be scaled from those for unconsolidated undrained conditions by the uniaxial consolidated undrained capacities, which are predicted through a theoretical framework based on fundamental critical state soil mechanics. The framework is applied to results from small-strain finite-element anal...
Data Envelopment Analysis (DEA) Model in Operation Management
Malik, Meilisa; Efendi, Syahril; Zarlis, Muhammad
2018-01-01
Quality management is an effective system in operation management to develops, maintains, and improves quality from groups of companies that allow marketing, production, and service at the most economycal level as well as ensuring customer satisfication. Many companies are practicing quality management to improve their bussiness performance. One of performance measurement is through measurement of efficiency. One of the tools can be used to assess efficiency of companies performance is Data Envelopment Analysis (DEA). The aim of this paper is using Data Envelopment Analysis (DEA) model to assess efficiency of quality management. In this paper will be explained CCR, BCC, and SBM models to assess efficiency of quality management.
Asymmetry of the envelope of supernova 1987A
Energy Technology Data Exchange (ETDEWEB)
Papaliolios, C.; Karovska, M.; Koechlin, L.; Nisenson, P.; Standley, C.; Heathcote, S.
1989-04-13
The supernova SN1987A in the Large Magellanic Cloud has been observed by high-angular-resolution speckle interferometry since 25 March (30 days after the explosion) with the 4-m telescope at the Cerro Tololo Interamerican Observatory. Data obtained on 25 March and 2 April 1987 revealed a second bright 'companion' source separated from the supernova by 60 milliarcseconds and less than three magnitudes fainter than the supernova. Measurements of the average diameter of the supernova envelope have been made from data recorded from March 1987 to April 1988. Here we present a more detailed analysis of these data, which shows that the expanding envelope is asymmetric. (author).
Asymmetry of the envelope of supernova 1987A
International Nuclear Information System (INIS)
Papaliolios, C.; Karovska, M.; Koechlin, L.; Nisenson, P.; Standley, C.; Heathcote, S.
1989-01-01
The supernova SN1987A in the Large Magellanic Cloud has been observed by high-angular-resolution speckle interferometry since 25 March (30 days after the explosion) with the 4-m telescope at the Cerro Tololo Interamerican Observatory. Data obtained on 25 March and 2 April 1987 revealed a second bright 'companion' source separated from the supernova by 60 milliarcseconds and less than three magnitudes fainter than the supernova. Measurements of the average diameter of the supernova envelope have been made from data recorded from March 1987 to April 1988. Here we present a more detailed analysis of these data, which shows that the expanding envelope is asymmetric. (author)
Refractive index dispersion measurement using carrier-envelope phasemeters
International Nuclear Information System (INIS)
Hansinger, Peter; Töpfer, Philipp; Adolph, Daniel; Hoff, Dominik; Rathje, Tim; Sayler, A Max; Paulus, Gerhard G; Dimitrov, Nikolay; Dreischuh, Alexander
2017-01-01
We introduce a novel method for direct and accurate measurement of refractive index dispersion based on carrier-envelope phase detection of few-cycle laser pulses, exploiting the difference between phase and group velocity in a dispersive medium. In a layout similar to an interferometer, two carrier-envelope phasemeters are capable of measuring the dispersion of a transparent or reflective sample, where one phasemeter serves as the reference and the other records the influence of the sample. Here we report on proof-of-principle measurements that already reach relative uncertainties of a few 10 −4 . Further development is expected to allow for unprecedented precision. (paper)
IFITM Proteins Restrict HIV-1 Infection by Antagonizing the Envelope Glycoprotein
Directory of Open Access Journals (Sweden)
Jingyou Yu
2015-10-01
Full Text Available The interferon-induced transmembrane (IFITM proteins have been recently shown to restrict HIV-1 and other viruses. Here, we provide evidence that IFITM proteins, particularly IFITM2 and IFITM3, specifically antagonize the HIV-1 envelope glycoprotein (Env, thereby inhibiting viral infection. IFITM proteins interact with HIV-1 Env in viral producer cells, leading to impaired Env processing and virion incorporation. Notably, the level of IFITM incorporation into HIV-1 virions does not strictly correlate with the extent of inhibition. Prolonged passage of HIV-1 in IFITM-expressing T lymphocytes leads to emergence of Env mutants that overcome IFITM restriction. The ability of IFITMs to inhibit cell-to-cell infection can be extended to HIV-1 primary isolates, HIV-2 and SIVs; however, the extent of inhibition appears to be virus-strain dependent. Overall, our study uncovers a mechanism by which IFITM proteins specifically antagonize HIV-1 Env to restrict HIV-1 infection and provides insight into the specialized role of IFITMs in HIV infection.
A model for the sustainable selection of building envelope assemblies
Energy Technology Data Exchange (ETDEWEB)
Huedo, Patricia, E-mail: huedo@uji.es [Universitat Jaume I (Spain); Mulet, Elena, E-mail: emulet@uji.es [Universitat Jaume I (Spain); López-Mesa, Belinda, E-mail: belinda@unizar.es [Universidad de Zaragoza (Spain)
2016-02-15
The aim of this article is to define an evaluation model for the environmental impacts of building envelopes to support planners in the early phases of materials selection. The model is intended to estimate environmental impacts for different combinations of building envelope assemblies based on scientifically recognised sustainability indicators. These indicators will increase the amount of information that existing catalogues show to support planners in the selection of building assemblies. To define the model, first the environmental indicators were selected based on the specific aims of the intended sustainability assessment. Then, a simplified LCA methodology was developed to estimate the impacts applicable to three types of dwellings considering different envelope assemblies, building orientations and climate zones. This methodology takes into account the manufacturing, installation, maintenance and use phases of the building. Finally, the model was validated and a matrix in Excel was created as implementation of the model. - Highlights: • Method to assess the envelope impacts based on a simplified LCA • To be used at an earlier phase than the existing methods in a simple way. • It assigns a score by means of known sustainability indicators. • It estimates data about the embodied and operating environmental impacts. • It compares the investment costs with the costs of the consumed energy.
CONTROL OF INDOOR ENVIRONMENTS VIA THE REGULATION OF BUILDING ENVELOPES
Directory of Open Access Journals (Sweden)
Mitja Košir
2011-01-01
Full Text Available The design of comfortable, healthy and stimulating indoor environments in buildings has a direct impact on the users and on energy consumption, as well as on the wider soci-economic environment of society.The indoor environment of buildings is defined with the formulation of the building envelope, which functions as an interface between the internal and external environments and its users. A properly designed, flexible and adequately controlled building envelope is a starting point in the formulation of a high-quality indoor environment. The systematic treatment of the indoor environment and building envelope from a user’s point of view represents an engineering approach that enables the holistic treatment of buildings, as well as integrated components and systems. The presented division of indoor environment in terms of visual, thermal, olfactory, acoustic and ergonomic sub-environments enables the classification and selection of crucial factors influencing design. This selection and classification can be implemented in the design, as well as in control applications of the building envelope. The implementation of the approach described is demonstrated with an example of an automated control system for the internal environment of an office in the building of the Faculty of Civil and Geodetic Engineering.
A model for the sustainable selection of building envelope assemblies
International Nuclear Information System (INIS)
Huedo, Patricia; Mulet, Elena; López-Mesa, Belinda
2016-01-01
The aim of this article is to define an evaluation model for the environmental impacts of building envelopes to support planners in the early phases of materials selection. The model is intended to estimate environmental impacts for different combinations of building envelope assemblies based on scientifically recognised sustainability indicators. These indicators will increase the amount of information that existing catalogues show to support planners in the selection of building assemblies. To define the model, first the environmental indicators were selected based on the specific aims of the intended sustainability assessment. Then, a simplified LCA methodology was developed to estimate the impacts applicable to three types of dwellings considering different envelope assemblies, building orientations and climate zones. This methodology takes into account the manufacturing, installation, maintenance and use phases of the building. Finally, the model was validated and a matrix in Excel was created as implementation of the model. - Highlights: • Method to assess the envelope impacts based on a simplified LCA • To be used at an earlier phase than the existing methods in a simple way. • It assigns a score by means of known sustainability indicators. • It estimates data about the embodied and operating environmental impacts. • It compares the investment costs with the costs of the consumed energy.
On the relationship between multi-channel envelope and temporal fine structure
DEFF Research Database (Denmark)
Søndergaard, Peter Lempel; Decorsiere, Remi Julien Blaise; Dau, Torsten
2011-01-01
The envelope of a signal is broadly defined as the slow changes in time of the signal, where as the temporal fine structure (TFS) are the fast changes in time, i.e. the carrier wave(s) of the signal. The focus of this paper is on envelope and TFS in multi-channel systems. We discuss the differenc...
Symmetries and invariants of the oscillator and envelope equations with time-dependent frequency
Directory of Open Access Journals (Sweden)
Hong Qin
2006-05-01
Full Text Available The single-particle dynamics in a time-dependent focusing field is examined. The existence of the Courant-Snyder invariant, a fundamental concept in accelerator physics, is fundamentally a result of the corresponding symmetry admitted by the harmonic oscillator equation with linear time-dependent frequency. It is demonstrated that the Lie algebra of the symmetry group for the oscillator equation with time-dependent frequency is eight dimensional, and is composed of four independent subalgebras. A detailed analysis of the admitted symmetries reveals a deeper connection between the nonlinear envelope equation and the oscillator equation. A general theorem regarding the symmetries and invariants of the envelope equation, which includes the existence of the Courant-Snyder invariant as a special case, is demonstrated. As an application to accelerator physics, the symmetries of the envelope equation enable a fast numerical algorithm for finding matched solutions without using the conventional iterative Newton’s method, where the envelope equation needs to be numerically integrated once for every iteration, and the Jacobi matrix needs to be calculated for the envelope perturbation.
Bursting the Bubble - Nuclear Envelope Rupture as a Path to Genomic Instability?
Shah, P.; Wolf, K.A.; Lammerding, J.
2017-01-01
The nuclear envelope safeguards the genetic material inside the nucleus by separating it from the cytoplasm. Until recently, it was assumed that nuclear envelope (NE) breakdown occurs only in a highly controlled fashion during mitosis when the chromatin is condensed and divided between the daughter
National Research Council Canada - National Science Library
Pratt, David M
2006-01-01
... these facilities that have the greatest potential for energy efficient building envelope retrofits. There are hundreds of various new building envelope technologies available to retrofit an existing building envelope, including window, roof, and wall technologies...
Cost Analysis of Simple Phase Change Material-Enhanced Building Envelopes in Southern U.S. Climates
Energy Technology Data Exchange (ETDEWEB)
Kosny, Jan [Fraunhofer CSE, Cambridge, MA (United States); Shukla, Nitin [Fraunhofer CSE, Cambridge, MA (United States); Fallahi, Ali [Fraunhofer CSE, Cambridge, MA (United States)
2013-01-01
Traditional thermal designs of building envelope assemblies are based on static energy flows, yet building envelopes are subject to varying environmental conditions. This mismatch between the steady-state principles and their dynamic operation can decrease thermal efficiency. Design work supporting the development of low-energy houses showed that conventional insulations may not always be the most cost effective solution to improvement envelope thermal performance. PCM-enhanced building envelopes that simultaneously reduce the total cooling loads and shift the peak-hour loads are the focus of this report.
Change rules of a stratospheric airship’s envelope shape during ascent process
Directory of Open Access Journals (Sweden)
Shuai Zhao
2017-04-01
Full Text Available Stratospheric airship is a special near-space air vehicle, and has more advantages than other air vehicles, such as long endurance, strong survival ability, excellent resolution, low cost, and so on, which make it an ideal stratospheric platform. It is of great significance to choose a reasonable and effective way to launch a stratospheric airship to the space for both academic research and engineering applications. In this paper, the non-forming launch way is studied and the method of differential pressure gradient is used to study the change rules of the airship’s envelope shape during the ascent process. Numerical simulation results show that the head of the envelope will maintain the inflatable shape and the envelope under the zero-pressure level will be compressed into a wide range of wrinkles during the ascent process. The airship’s envelope will expand with the ascent of the airship and the position of the zero-pressure level will move downward constantly. At the same time, the envelope will gradually form a certain degree of stiffness under the action of the inner and external differential pressure. The experimental results agree well with the analytical results, which shows that the non-forming launch way is effective and reliable, and the analytical method has exactness and feasibility.
Modeling a Decision Support Tool for Buildable and Sustainable Building Envelope Designs
Directory of Open Access Journals (Sweden)
Natee Singhaputtangkul
2015-05-01
Full Text Available Sustainability and buildability requirements in building envelope design have significantly gained more importance nowadays, yet there is a lack of an appropriate decision support system (DSS that can help a building design team to incorporate these requirements and manage their tradeoffs at once. The main objective of this study is to build such a tool to facilitate a building design team to take into account sustainability and buildability criteria for assessment of building envelopes of high-rise residential buildings in Singapore. Literature reviews were conducted to investigate a comprehensive set of the sustainability and buildability criteria. This also included development of the tool using a Quality Functional Deployment (QFD approach combined with fuzzy set theory. A building design team was engaged to test the tool with the aim to evaluate usefulness of the tool in managing the tradeoffs among the sustainability and buildability criteria. The results from a qualitative data analysis suggested that the tool allowed the design team to effectively find a balance between the tradeoffs among the criteria when assessing multiple building envelope design alternatives. Main contributions of using this tool are achievement of a more efficient assessment of the building envelopes and more sustainable and buildable building envelope design.
Evolution of a blue supergiant with a neutron star companion immersed in its envelope
International Nuclear Information System (INIS)
Delgado, A.J.
1980-01-01
The evolution of a binary system consisting of 1 Msub(sun) neutron star and a 25 Msub(sun) blue supergiant through a phase of common envelope is investigated. We include the effects of an additional energy source on the supergiant's envelope, due to the presence of the neutron star, and variable mass loss from the system, taken as proportional to the total luminosity. The results indicate that, independently of the initial period, the system loses its whole envelope as a consequence of the common envelope phase, the final product of this being a detached system, consisting of a neutron star and a helium star. (orig.)
The Experimental Research on Seismic Capacity of the Envelope Systems with Steel Frame
Li, Jiuyang; Wang, Bingbing; Li, Hengxu
2017-09-01
In this paper, according to the present application situation of the external envelope systems steel frame in the severe cold region, the stuffed composite wall panels are improved, the flexible connection with the steel frame is designed, the reduced scale specimens are made, the seismic capacity test is made and some indexes of the envelope systems such as bearing capacity, energy consumption and ductility, etc. are compared, which provide reference for the development and application of the steel frame envelope systems.
A Functional Henipavirus Envelope Glycoprotein Pseudotyped Lentivirus Assay System
Directory of Open Access Journals (Sweden)
Broder Christopher C
2010-11-01
Full Text Available Abstract Background Hendra virus (HeV and Nipah virus (NiV are newly emerged zoonotic paramyxoviruses discovered during outbreaks in Queensland, Australia in 1994 and peninsular Malaysia in 1998/9 respectively and classified within the new Henipavirus genus. Both viruses can infect a broad range of mammalian species causing severe and often-lethal disease in humans and animals, and repeated outbreaks continue to occur. Extensive laboratory studies on the host cell infection stage of HeV and NiV and the roles of their envelope glycoproteins have been hampered by their highly pathogenic nature and restriction to biosafety level-4 (BSL-4 containment. To circumvent this problem, we have developed a henipavirus envelope glycoprotein pseudotyped lentivirus assay system using either a luciferase gene or green fluorescent protein (GFP gene encoding human immunodeficiency virus type-1 (HIV-1 genome in conjunction with the HeV and NiV fusion (F and attachment (G glycoproteins. Results Functional retrovirus particles pseudotyped with henipavirus F and G glycoproteins displayed proper target cell tropism and entry and infection was dependent on the presence of the HeV and NiV receptors ephrinB2 or B3 on target cells. The functional specificity of the assay was confirmed by the lack of reporter-gene signals when particles bearing either only the F or only G glycoprotein were prepared and assayed. Virus entry could be specifically blocked when infection was carried out in the presence of a fusion inhibiting C-terminal heptad (HR-2 peptide, a well-characterized, cross-reactive, neutralizing human mAb specific for the henipavirus G glycoprotein, and soluble ephrinB2 and B3 receptors. In addition, the utility of the assay was also demonstrated by an examination of the influence of the cytoplasmic tail of F in its fusion activity and incorporation into pseudotyped virus particles by generating and testing a panel of truncation mutants of NiV and HeV F
Mujib, Shariq; Liu, Jun; Rahman, A K M Nur-Ur; Schwartz, Jordan A; Bonner, Phil; Yue, Feng Yun; Ostrowski, Mario A
2017-08-15
Immunotherapy with passive administration of broadly neutralizing HIV-1 envelope-specific antibodies (bnAbs) in the setting of established infection in vivo has yielded mixed results. The contribution of different antibodies toward the direct elimination of infected cells is poorly understood. In this study, we determined the ability of 12 well-characterized anti-HIV-1 neutralizing antibodies to recognize and eliminate primary CD4 T cells infected with HIV-1 belonging to clades A, B, C, and D, via antibody-dependent complement-mediated lysis (ADCML) and antibody-dependent cell-mediated cytotoxicity (ADCC), in vitro We further tested unique combinations of these antibodies to determine the optimal antibody cocktails to be tested in future clinical trials. We report that antibody binding to infected CD4 T cells is highly variable and correlates with ADCML and ADCC processes. Particularly, antibodies targeting the envelope glycan shield (2G12) and V1/V2 site (PG9, PG16, and PGT145) are best at recognizing HIV-1-infected CD4 T cells. However, only PG9 and PG16 and their combinations with other bnAbs sufficiently induced the elimination of HIV-1-infected CD4 T cells by ADCML, ADCC, or both. Notably, CD4 binding site antibodies VRC01, 3BNC117, and NIH45-46 G54W did not exhibit recognition of infected cells and were unable to induce their killing. Future trials geared toward the development of a cure for HIV/AIDS should incorporate V1/V2 antibodies for maximal clearance of infected cells. With the use of only primary immune cells, we conducted a comprehensive cross-clade physiological analysis to aid the direction of antibodies as therapeutics toward the development of a cure for HIV/AIDS. IMPORTANCE Several antibodies capable of neutralizing the majority of circulating HIV-1 strains have been identified to date and have been shown to prevent infection in animal models. However, the use of combinations of such broadly neutralizing antibodies (bnAbs) for the treatment and
The psychic envelopes in psychoanalytic theories of infancy
Mellier, Denis
2014-01-01
This paper aims to review the topic of psychic envelopes and to sketch the main outlines of this concept in infancy. We first explore the origins of the concept in Freud's “protective shield” and then its development in adult psychoanalysis before going on to see how this fits in infancy with post-Bionian psychoanalysis and development. Four central notions guide this review: (1) Freud's “protective shield” describes a barrier to protect the psychic apparatus against potentially overflowing trauma. It is a core notion which highlights a serious clinical challenge for patients for whom the shield is damaged or faulty: the risk of confusion of borders between the internal/external world, conscious/unconscious, mind/body, or self-conservation/sexuality. (2) Anzieu's “Skin-Ego” is defined by the different senses of the body. The different layers of experienced sensation, of this body-ego, go on to form the psychic envelope. This theory contributes to our understanding of how early trauma, due to the failures of maternal care, can continue to have an impact in adult life. (3) Bick's “psychic skin” establishes the concept in relation to infancy. The mother's containing functions allow a first psychic skin to develop, which then defines an infant's psychic space and affords the infant a degree of self-containment. Houzel then conceptualized this process as a stabilization of drive forces. (4) Stern's “narrative envelope” derives from the intersection between psychoanalysis and neuroscience. It gives us another way to conceptualize the development of pre-verbal communication. It may also pave the way for a finer distinction of different types of envelopes. Ultimately, in this review we find that psychic envelopes in infancy can be viewed from four different perspectives (economic, topographical, dynamic, and genetic) and recommend further investigation. PMID:25076924
International Nuclear Information System (INIS)
Hur, Min Sup; Suk, Hyyong
2007-01-01
A new test particle method is presented for self-consistent incorporation of the kinetic effects into the fluid three-wave model. One of the most important kinetic effects is the electron trapping and it has been found that the trapping affects significantly the behavior of Raman backscatter and Raman backward laser amplification. The conventional fluid three-wave model cannot reproduce the kinetic simulations in the trapping regime. The test particle scheme utilizes the same equations for the laser evolution as in the three-wave model. However, the plasma wave is treated by the envelope-kinetic equation, which consists of envelope evolution and the kinetic term. The core of the new scheme is employing test particles to compute the kinetic term self-consistently. The benchmarking results against the averaged particle-in-cell (aPIC) code show excellent agreements, and the computation speed gain over the aPIC is from 2 to 20 depending on parameters
Structural models of the membrane anchors of envelope glycoproteins E1 and E2 from pestiviruses
Wang, Jimin; Li, Yue; Modis, Yorgo
2014-01-01
The membrane anchors of viral envelope proteins play essential roles in cell entry. Recent crystal structures of the ectodomain of envelope protein E2 from a pestivirus suggest that E2 belongs to a novel structural class of membrane fusion machinery. Based on geometric constraints from the E2 structures, we generated atomic models of the E1 and E2 membrane anchors using computational approaches. The E1 anchor contains two amphipathic perimembrane helices and one transmembrane helix; the E2 anchor contains a short helical hairpin stabilized in the membrane by an arginine residue, similar to flaviviruses. A pair of histidine residues in the E2 ectodomain may participate in pH sensing. The proposed atomic models point to Cys987 in E2 as the site of disulfide bond linkage with E1 to form E1–E2 heterodimers. The membrane anchor models provide structural constraints for the disulfide bonding pattern and overall backbone conformation of the E1 ectodomain. PMID:24725935
Constructing canonical bases of quantized enveloping algebras
Graaf, W.A. de
2001-01-01
An algorithm for computing the elements of a given weight of the canonical basis of a quantized enveloping algebra is described. Subsequently, a similar algorithm is presented for computing the canonical basis of a finite-dimensional module.
Nishigami, Misako; Mori, Takaaki; Tomita, Masahiro; Takiguchi, Kingo; Tsumoto, Kanta
2017-07-01
Giant proteoliposomes are generally useful as artificial cell membranes in biochemical and biophysical studies, and various procedures for their preparation have been reported. We present here a novel preparation technique that involves the combination of i) cell-sized lipid vesicles (giant unilamellar vesicles, GUVs) that are generated using the droplet-transfer method, where lipid monolayer-coated water-in-oil microemulsion droplets interact with oil/water interfaces to form enclosed bilayer vesicles, and ii) budded viruses (BVs) of baculovirus (Autographa californica nucleopolyhedrovirus) that express recombinant transmembrane proteins on their envelopes. GP64, a fusogenic glycoprotein on viral envelopes, is activated by weak acids and is thought to cause membrane fusion with liposomes. Using confocal laser scanning microscopy (CLSM), we observed that the single giant liposomes fused with octadecyl rhodamine B chloride (R18)-labeled wild-type BV envelopes with moderate leakage of entrapped soluble compounds (calcein), and the fusion profile depended on the pH of the exterior solution: membrane fusion occurred at pH ∼4-5. We further demonstrated that recombinant transmembrane proteins, a red fluorescent protein (RFP)-tagged GPCR (corticotropin-releasing hormone receptor 1, CRHR1) and envelope protein GP64 could be partly incorporated into membranes of the individual giant liposomes with a reduction of the pH value, though there were also some immobile fluorescent spots observed on their circumferences. This combination may be useful for preparing giant proteoliposomes containing the desired membranes and inner phases. Copyright © 2017 Elsevier B.V. All rights reserved.
Functional envelope of a non-autonomous discrete system
Directory of Open Access Journals (Sweden)
Barzanouni Ali
2017-11-01
Full Text Available Let (X, F = {fn}n =0∞ be a non-autonomous discrete system by a compact metric space X and continuous maps fn : X → X, n = 0, 1, ....We introduce functional envelope (S(X, G = {Gn}n =0∞, of (X, F = {fn}n =0∞, where S(X is the space of all continuous self maps of X and the map Gn : S(X → S(X is defined by Gn(ϕ = Fn ∘ ϕ, Fn = fn ∘ fn-1 ∘ . . . ∘ f1 ∘ f0. The paper mainly deals with the connection between the properties of a system and the properties of its functional envelope.
Marin, Virna; Stornaiuolo, Anna; Piovan, Claudia; Corna, Stefano; Bossi, Sergio; Pema, Monika; Giuliani, Erica; Scavullo, Cinzia; Zucchelli, Eleonora; Bordignon, Claudio; Rizzardi, Gian Paolo; Bovolenta, Chiara
2016-01-01
To date, gene therapy with transiently derived lentivectors has been very successful to cure rare infant genetic diseases. However, transient manufacturing is unfeasible to treat adult malignancies because large vector lots are required. By contrast, stable manufacturing is the best option for high-incidence diseases since it reduces the production cost, which is the major current limitation to scale up the transient methods. We have previously developed the proprietary RD2-MolPack technology for the stable production of second-generation lentivectors, based on the RD114-TR envelope. Of note, opposite to vesicular stomatitis virus glycoprotein (VSV-G) envelope, RD114-TR does not need inducible expression thanks to lack of toxicity. Here, we present the construction of RD2- and RD3-MolPack cells for the production of self-inactivating lentivectors expressing green fluorescent protein (GFP) as a proof-of-concept of the feasibility and safety of this technology before its later therapeutic exploitation. We report that human T lymphocytes transduced with self-inactivating lentivectors derived from RD3-MolPack cells or with self-inactivating VSV-G pseudotyped lentivectors derived from transient transfection show identical T-cell memory differentiation phenotype and comparable transduction efficiency in all T-cell subsets. RD-MolPack technology represents, therefore, a straightforward tool to simplify and standardize lentivector manufacturing to engineer T-cells for frontline immunotherapy applications.
Safety analysis to support a safe operating envelope for fuel
International Nuclear Information System (INIS)
Gibb, R.A.; Reid, P.J.
1998-01-01
This paper presents an approach for defining a safe operating envelope for fuel. 'Safe operating envelope' is defined as an envelope of fuel parameters defined for application in safety analysis that can be related to, or used to define, the acceptable range of fuel conditions due to operational transients or deviations in fuel manufacturing processes. The paper describes the motivation for developing such a methodology. The methodology involved four steps: the update of fission product inventories, the review of sheath failure criteria, a review of input parameters to be used in fuel modelling codes, and the development of an improved fission product release code. This paper discusses the aspects of fuel sheath failure criteria that pertain to operating or manufacturing conditions and to the evaluation and selection of modelling input data. The other steps are not addressed in this paper since they have been presented elsewhere. (author)
Adaptive Flight Envelope Estimation and Protection, Phase I
National Aeronautics and Space Administration — Impact Technologies, in collaboration with the Georgia Institute of Technology, proposes to develop and demonstrate an innovative flight envelope estimation and...
Rodrigues, Teresa; Alves, Ana; Lopes, António; Carrondo, Manuel J T; Alves, Paula M; Cruz, Pedro E
2008-10-01
We have investigated the role of the retroviral lipid bilayer and envelope proteins in the adsorption of retroviral vectors (RVs) to a Fractogel DEAE matrix. Intact RVs and their degradation components (envelope protein-free vectors and solubilized vector components) were adsorbed to this matrix and eluted using a linear gradient. Envelope protein-free RVs (Env(-)) and soluble envelope proteins (gp70) eluted in a significantly lower range of conductivities than intact RVs (Env(+)) (13.7-30 mS/cm for Env(-) and gp70 proteins vs. 47-80 mS/cm for Env(+)). The zeta (zeta)-potential of Env(+) and Env(-) vectors was evaluated showing that envelope proteins define the pI of the viral particles (pI (Env(+)) improvement to the quality of retroviral preparations for gene therapy applications.
2013-05-28
.... When failure states occur in the electronic flight control system, flight envelope protection features... any change in envelope limiting or maneuverability is produced by single or multiple failures of the...; Flight Envelope Protection: General Limiting Requirements AGENCY: Federal Aviation Administration (FAA...
2013-01-24
... failure states occur in the electronic flight control system, flight envelope protection features can... Envelope Protection: General Limiting Requirements AGENCY: Federal Aviation Administration (FAA), DOT...), specifically new control architecture and a full digital flight control system which provides flight envelope...
Hepatitis C Virus E2 Envelope Glycoprotein Core Structure
Energy Technology Data Exchange (ETDEWEB)
Kong, Leopold; Giang, Erick; Nieusma, Travis; Kadam, Rameshwar U.; Cogburn, Kristin E.; Hua, Yuanzi; Dai, Xiaoping; Stanfield, Robyn L.; Burton, Dennis R.; Ward, Andrew B.; Wilson, Ian A.; Law, Mansun
2014-08-26
Hepatitis C virus (HCV), a Hepacivirus, is a major cause of viral hepatitis, liver cirrhosis, and hepatocellular carcinoma. HCV envelope glycoproteins E1 and E2 mediate fusion and entry into host cells and are the primary targets of the humoral immune response. The crystal structure of the E2 core bound to broadly neutralizing antibody AR3C at 2.65 angstroms reveals a compact architecture composed of a central immunoglobulin-fold β sandwich flanked by two additional protein layers. The CD81 receptor binding site was identified by electron microscopy and site-directed mutagenesis and overlaps with the AR3C epitope. The x-ray and electron microscopy E2 structures differ markedly from predictions of an extended, three-domain, class II fusion protein fold and therefore provide valuable information for HCV drug and vaccine design.
Sakaguchi, Shoichi; Shojima, Takayuki; Fukui, Daisuke; Miyazawa, Takayuki
2015-03-01
T-lymphotropic feline leukemia virus (FeLV-T), a highly pathogenic variant of FeLV, induces severe immunosuppression in cats. FeLV-T is fusion defective because in its PHQ motif, a gammaretroviral consensus motif in the N terminus of an envelope protein, histidine is replaced with aspartate. Infection by FeLV-T requires FeLIX, a truncated envelope protein encoded by an endogenous FeLV, for transactivation of infectivity and Pit1 for binding FeLIX. Although Pit1 is present in most tissues in cats, the expression of FeLIX is limited to certain cells in lymphoid organs. Therefore, the host cell range of FeLV-T was thought to be restricted to cells expressing FeLIX. However, because FeLIX is a soluble factor and is expressed constitutively in lymphoid organs, we presumed it to be present in blood and evaluated its activities in sera of various mammalian species using a pseudotype assay. We demonstrated that cat serum has FeLIX activity at a functional level, suggesting that FeLIX is present in the blood and that FeLV-T may be able to infect cells expressing Pit1 regardless of the expression of FeLIX in vivo. In addition, FeLIX activities in sera were detected only in domestic cats and not in other feline species tested. To our knowledge, this is the first report to prove that a large amount of truncated envelope protein of endogenous retrovirus is circulating in the blood to facilitate the infection of a pathogenic exogenous retrovirus. © 2015 The Authors.
A Novel Nonviral Gene Delivery System: Multifunctional Envelope-Type Nano Device
Hatakeyama, Hiroto; Akita, Hidetaka; Kogure, Kentaro; Harashima, Hideyoshi
In this review we introduce a new concept for developing a nonviral gene delivery system which we call "Programmed Packaging." Based on this concept, we succeeded in developing a multifunctional envelope-type nano device (MEND), which exerts high transfection activities equivalent to those of an adenovirus in a dividing cell. The use of MEND has been extended to in vivo applications. PEG/peptide/DOPE ternary conjugate (PPD)-MEND, a new in vivo gene delivery system for the targeting of tumor cells that dissociates surface-modified PEG in tumor tissue by matrix metalloproteinase (MMP) and exerts significant transfection activities, was developed. In parallel with the development of MEND, a quantitative gene delivery system, Confocal Image-assisted 3-dimensionally integrated quantification (CIDIQ), also was developed. This method identified the rate-limiting step of the nonviral gene delivery system by comparing it with adenoviral-mediated gene delivery. The results of this analysis provide a new direction for the development of rational nonviral gene delivery systems.
MacDonald, David S; Waterfield, J Douglas
2011-01-01
The detectors (both solid-state sensors and photostimulable phosphor [PSP] plates) used for digital intraoral radiography cannot be autoclaved, and barriers are typically used to prevent the spread of infection. The aim of this study was to determine the effectiveness of a barrier envelope system for PSP plates. Disinfected PSP plates were aseptically inserted into barrier envelopes and placed in a periapical location. One PSP plate was placed in each of 28 patients, and 12 plates in each of 2 volunteers (D.S.M., J.D.W.). After retrieval, each PSP plate was removed from its barrier envelope, immersed in trypticase soy broth and aliquots were plated on trypticase soy agar. Bacterial colonies were counted 2 days later. Fifty-two PSP plates in barrier envelopes were evaluated for contamination. Quality assurance of the PSP plates before clinical placement revealed defects in the integrity of 4 barrier envelopes, caused by forceps-related damage or failure to achieve a uniform seal. These defects allowed substantial contamination. Contamination also occurred as a result of failure to extract the PSP plate from the barrier envelope cleanly. Of the 44 barriers with no obvious defects that were placed by either final-year dental students or a radiologist, only 3 allowed bacterial contamination of the PSP plate. Detectors contained in barrier envelopes remain a potential source of contamination. PSP plates must be disinfected between removal from a contaminated barrier envelope and placement in a new barrier envelope. In addition, placement into the barrier envelope should ideally be carried out under aseptic conditions. Finally, the integrity of each sealed barrier envelope must be verified visually before release to the clinic.
Modeling of heat and mass transfer in lateritic building envelopes
International Nuclear Information System (INIS)
Meukam, Pierre
2004-10-01
The aim of the present work is to investigate the behavior of building envelopes made of local lateritic soil bricks subjected to different climatic conditions. The analysis is developed for the prediction of the temperature, relative humidity and water content behavior within the walls. The building envelopes studied in this work consist of lateritic soil bricks with incorporation of natural pozzolan or sawdust in order to obtain small thermal conductivity and low-density materials, and limit the heat transfer between the atmospheric climate and the inside environment. In order to describe coupled heat and moisture transfer in wet porous materials, the coupled equations were solved by the introduction of diffusion coefficients. A numerical model HMtrans, developed for prediction of beat and moisture transfer in multi-layered building components, was used to simulate the temperature, water content and relative humidity profiles within the building envelopes. The results allow the prediction of the duration of the exposed building walls to the local weather conditions. They show that for any of three climatic conditions considered, relative humidity and water content do not exceed 87% and 5% respectively. There is therefore minimum possibility of water condensation in the materials studied. The durability of building envelopes made of lateritic soil bricks with incorporation of natural pozzolan or sawdust is not strongly affected by the climatic conditions in tropical and equatorial regions. (author)
Cessna Citation X Business Aircraft Eigenvalue Stability – Part2: Flight Envelope Analysis
Directory of Open Access Journals (Sweden)
Yamina BOUGHARI
2017-12-01
Full Text Available Civil aircraft flight control clearance is a time consuming, thus an expensive process in the aerospace industry. This process has to be investigated and proved to be safe for thousands of combinations in terms of speeds, altitudes, gross weights, Xcg / weight configurations and angles of attack. Even in this case, a worst-case condition that could lead to a critical situation might be missed. To address this problem, models that are able to describe an aircraft’s dynamics by taking into account all uncertainties over a region within a flight envelope have been developed using Linear Fractional Representation. In order to investigate the Cessna Citation X aircraft Eigenvalue Stability envelope, the Linear Fractional Representation models are implemented using the speeds and the altitudes as varying parameters. In this paper Part 2, the aircraft longitudinal eigenvalue stability is analyzed in a continuous range of flight envelope with varying parameter of True airspeed and altitude, instead of a single point, like classical methods. This is known as the aeroelastic stability envelope, required for civil aircraft certification as given by the Circular Advisory “Aeroelastic Stability Substantiation of Transport Category Airplanes AC No: 25.629-18”. In this new methodology the analysis is performed in time domain based on Lyapunov stability and solved by convex optimization algorithms by using the linear matrix inequalities to evaluate the eigenvalue stability, which is reduced to search for the negative eigenvalues in a region of flight envelope. It can also be used to study the stability of a system during an arbitrary motion from one point to another in the flight envelope. A whole aircraft analysis results’ for its entire envelope are presented in the form of graphs, thus offering good readability, and making them easily exploitable.
Uncertain data envelopment analysis
Wen, Meilin
2014-01-01
This book is intended to present the milestones in the progression of uncertain Data envelopment analysis (DEA). Chapter 1 gives some basic introduction to uncertain theories, including probability theory, credibility theory, uncertainty theory and chance theory. Chapter 2 presents a comprehensive review and discussion of basic DEA models. The stochastic DEA is introduced in Chapter 3, in which the inputs and outputs are assumed to be random variables. To obtain the probability distribution of a random variable, a lot of samples are needed to apply the statistics inference approach. Chapter 4
Testing to expand the rotary-mode core sampling system operating envelope
International Nuclear Information System (INIS)
Witwer, K.S.
1998-01-01
Rotary sampling using the Rotary Mode Core Sampling System (RMCSS) is constrained by what is referred to as the ''Operating Envelope''. The Operating Envelop defines the maximum downward force, maximum rotational speed and minimum purge gas flow allowed during operation of the RMCSS. The original values of 1170 lb. down force, 55 RPM rotational speed, and 30 SCFM nitrogen purge gas were determined during original envelope testing. This envelope was determined by observing the temperature rise on the bitface while drilling into waste simulants. The maximum temperature in single-shell tanks (SSTS) is considered to be approximately 9O C and the critical drill bit temperature, which is the temperature at which an exothermic reaction could be initiated in the tank waste, was previously determined to be 150 C. Thus, the drill bit temperature increase was limited to 60 C. Thermal properties of these simulants approximated typical properties of waste tank saltcake. Later, more detailed envelope testing which used a pumice block simulant, showed a notably higher temperature rise while drilling. This pumice material, which simulated a ''worst case'' foreign object embedded in the waste, has lower thermal conductivity and lower thermal diffusivity than earlier simulants. These properties caused a slower heat transfer in the pumice than in the previous simulants and consequently a higher temperature rise. The maximum downward force was subsequently reduced to 750 lb (at a maximum 55 RPM and minimum 30 SCFM purge gas flow) which was the maximum value at which the drill bit could be operated and still remain below the 60 C temperature rise
International Nuclear Information System (INIS)
Yang, Ming-Der; Lin, Min-Der; Lin, Yu-Hao; Tsai, Kang-Ting
2017-01-01
Highlights: • An effective envelope energy performance model (BEM) was developed. • We integrated NSGA-II with the BEM to optimize the green building envelope. • A tradeoff plan of green building design for three conflict objectives was obtained. • The optimal envelope design efficiently reduced the construction cost of green building. - Abstract: To realize the goal of environmental sustainability, improving energy efficiency in buildings is a major priority worldwide. However, the practical design of green building envelopes for energy conservation is a highly complex optimization problem, and architects must make multiobjective decisions. In practice, methods such as multicriteria analyses that entail capitalizing on possibly many (but in nearly any case limited) alternatives are commonly employed. This study investigated the feasibility of applying a multiobjective optimal model on building envelope design (MOPBEM), which involved integrating a building envelope energy performance model with a multiobjective optimizer. The MOPBEM was established to provide a reference for green designs. A nondominated sorting genetic algorithm-II (NSGA-II) was used to achieve a tradeoff design set between three conflicting objectives, namely minimizing the envelope construction cost (ENVCOST), minimizing the envelope energy performance (ENVLOAD), and maximizing the window opening rate (WOPR). A real office building case was designed using the MOPBEM to identify the potential strengths and weaknesses of the proposed MOPBEM. The results showed that a high ENVCOST was expended in simultaneously satisfying the low ENVLOAD and high WOPR. Various designs exhibited obvious cost reductions compared with the original architects' manual design, demonstrating the practicability of the MOPBEM.
Representations of braid group obtained from quantum sl(3) enveloping algebra
International Nuclear Information System (INIS)
Ma Zhongqi.
1989-07-01
The quantum Clebsch-Gordan coefficients for the coproduct 6x6 of the quantum sl(3) enveloping algebra are computed. Based on the representation 6, the representation of the braid group and the corresponding link polynomial are obtained. The link polynomials based on the representations of the quantum sl(3) enveloping algebra with one row Young tableau are discussed. (author). 11 refs, 3 tabs
Cold CO Gas in the Envelopes of FU Orionis-type Young Eruptive Stars
Energy Technology Data Exchange (ETDEWEB)
Kóspál, Á.; Ábrahám, P.; Moór, A. [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, Konkoly-Thege Miklós út 15-17, 1121 Budapest (Hungary); Csengeri, T.; Güsten, R. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Henning, Th. [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany)
2017-02-20
FU Orionis-type objects (FUors) are young stellar objects experiencing large optical outbursts due to highly enhanced accretion from the circumstellar disk onto the star. FUors are often surrounded by massive envelopes, which play a significant role in the outburst mechanism. Conversely, the subsequent eruptions might gradually clear up the obscuring envelope material and drive the protostar on its way to become a disk-only T Tauri star. Here we present an APEX {sup 12}CO and {sup 13}CO survey of eight southern and equatorial FUors. We measure the mass of the gaseous material surrounding our targets, locate the source of the CO emission, and derive physical parameters for the envelopes and outflows, where detected. Our results support the evolutionary scenario where FUors represent a transition phase from envelope-surrounded protostars to classical T Tauri stars.
Performative building envelope design correlated to solar radiation and cooling energy consumption
Jacky, Thiodore; Santoni
2017-11-01
Climate change as an ongoing anthropogenic environmental challenge is predominantly caused by an amplification in the amount of greenhouse gases (GHGs), notably carbon dioxide (CO2) in building sector. Global CO2 emissions are emitted from HVAC (Heating, Ventilation, and Air Conditioning) occupation to provide thermal comfort in building. In fact, the amount of energy used for cooling or heating building is implication of building envelope design. Building envelope acts as interface layer of heat transfer between outdoor environment and the interior of a building. It appears as wall, window, roof and external shading device. This paper examines performance of various design strategy on building envelope to limit solar radiation and reduce cooling loads in tropical climate. The design strategies are considering orientation, window to wall ratio, material properties, and external shading device. This research applied simulation method using Autodesk Ecotect to investigate simultaneously between variations of wall and window ratio, shading device composition and the implication to the amount of solar radiation, cooling energy consumption. Comparative analysis on the data will determine logical variation between opening and shading device composition and cooling energy consumption. Optimizing the building envelope design is crucial strategy for reducing CO2 emissions and long-term energy reduction in building sector. Simulation technology as feedback loop will lead to better performative building envelope.
Cost Allocation and Convex Data Envelopment
DEFF Research Database (Denmark)
Hougaard, Jens Leth; Tind, Jørgen
such as Data Envelopment Analysis (DEA). The convexity constraint of the BCC model introduces a non-zero slack in the objective function of the multiplier problem and we show that the cost allocation rules discussed in this paper can be used as candidates to allocate this slack value on to the input (or output...
Solution of K-V envelope equations
International Nuclear Information System (INIS)
Anderson, O.A.
1995-04-01
The envelope equations for a KV beam with space charge have been analyzed systematically by an e expansion followed by integrations. The focusing profile as a function of axial length is assumed to be symmetric but otherwise arbitrary. Given the bean current, emittance, and peak focusing field, we find the envelopes a(s) and b(s) and obtain , a max , σ, and σ 0 . Explicit results are presented for various truncations of the expansion. The zeroth order results correspond to those from the well-known smooth approximation; the same convenient format is retained for the higher order cases. The first order results, involving single correction terms, give 3--10 times better accuracy and are good to ∼1% at σ 0 = 70 degree. Third order gives a factor of 10--30 improvement over the smooth approximation and derived quantities accurate to ∼1% at σ 0 = 112 degree. The first order expressions are convenient design tools. They lend themselves to variable energy problems and have been applied to the design, construction, and testing of ESQ accelerators at LBL
Coronavirus envelope (E) protein remains at the site of assembly
International Nuclear Information System (INIS)
Venkatagopalan, Pavithra; Daskalova, Sasha M.; Lopez, Lisa A.; Dolezal, Kelly A.; Hogue, Brenda G.
2015-01-01
Coronaviruses (CoVs) assemble at endoplasmic reticulum Golgi intermediate compartment (ERGIC) membranes and egress from cells in cargo vesicles. Only a few molecules of the envelope (E) protein are assembled into virions. The role of E in morphogenesis is not fully understood. The cellular localization and dynamics of mouse hepatitis CoV A59 (MHV) E protein were investigated to further understanding of its role during infection. E protein localized in the ERGIC and Golgi with the amino and carboxy termini in the lumen and cytoplasm, respectively. E protein does not traffic to the cell surface. MHV was genetically engineered with a tetracysteine tag at the carboxy end of E. Fluorescence recovery after photobleaching (FRAP) showed that E is mobile in ERGIC/Golgi membranes. Correlative light electron microscopy (CLEM) confirmed the presence of E in Golgi cisternae. The results provide strong support that E proteins carry out their function(s) at the site of budding/assembly. - Highlights: • Mouse hepatitis coronavirus (MHV-CoV) E protein localizes in the ERGIC and Golgi. • MHV-CoV E does not transport to the cell surface. • MHV-CoV can be genetically engineered with a tetracysteine tag appended to E. • First FRAP and correlative light electron microscopy of a CoV E protein. • Live-cell imaging shows that E is mobile in ERGIC/Golgi membranes
Coronavirus envelope (E) protein remains at the site of assembly
Energy Technology Data Exchange (ETDEWEB)
Venkatagopalan, Pavithra [The Biodesign Institute, Center for Infectious Diseases and Vaccinology, Arizona State University, Tempe, AZ 85287-5401 (United States); School of Life Sciences, Arizona State University, Tempe, AZ 85287-5401 (United States); Microbiology Graduate Program, Arizona State University, Tempe, AZ 85287-5401 (United States); Daskalova, Sasha M. [The Biodesign Institute, Center for Infectious Diseases and Vaccinology, Arizona State University, Tempe, AZ 85287-5401 (United States); Department of Biochemistry and Chemistry, Arizona State University, Tempe, AZ 85287-5401 (United States); Lopez, Lisa A. [The Biodesign Institute, Center for Infectious Diseases and Vaccinology, Arizona State University, Tempe, AZ 85287-5401 (United States); School of Life Sciences, Arizona State University, Tempe, AZ 85287-5401 (United States); Molecular and Cellular Biology Graduate Program, Arizona State University, Tempe, AZ 85287-5401 (United States); Dolezal, Kelly A. [The Biodesign Institute, Center for Infectious Diseases and Vaccinology, Arizona State University, Tempe, AZ 85287-5401 (United States); School of Life Sciences, Arizona State University, Tempe, AZ 85287-5401 (United States); Microbiology Graduate Program, Arizona State University, Tempe, AZ 85287-5401 (United States); Hogue, Brenda G., E-mail: Brenda.Hogue@asu.edu [The Biodesign Institute, Center for Infectious Diseases and Vaccinology, Arizona State University, Tempe, AZ 85287-5401 (United States); School of Life Sciences, Arizona State University, Tempe, AZ 85287-5401 (United States)
2015-04-15
Coronaviruses (CoVs) assemble at endoplasmic reticulum Golgi intermediate compartment (ERGIC) membranes and egress from cells in cargo vesicles. Only a few molecules of the envelope (E) protein are assembled into virions. The role of E in morphogenesis is not fully understood. The cellular localization and dynamics of mouse hepatitis CoV A59 (MHV) E protein were investigated to further understanding of its role during infection. E protein localized in the ERGIC and Golgi with the amino and carboxy termini in the lumen and cytoplasm, respectively. E protein does not traffic to the cell surface. MHV was genetically engineered with a tetracysteine tag at the carboxy end of E. Fluorescence recovery after photobleaching (FRAP) showed that E is mobile in ERGIC/Golgi membranes. Correlative light electron microscopy (CLEM) confirmed the presence of E in Golgi cisternae. The results provide strong support that E proteins carry out their function(s) at the site of budding/assembly. - Highlights: • Mouse hepatitis coronavirus (MHV-CoV) E protein localizes in the ERGIC and Golgi. • MHV-CoV E does not transport to the cell surface. • MHV-CoV can be genetically engineered with a tetracysteine tag appended to E. • First FRAP and correlative light electron microscopy of a CoV E protein. • Live-cell imaging shows that E is mobile in ERGIC/Golgi membranes.
International Nuclear Information System (INIS)
Xiao Yafeng; Xue Haili; Zhang Hongqing
2011-01-01
Based on Jacobi elliptic function and the Lame equation, the perturbation method is applied to get the multi-order envelope periodic solutions of the nonlinear Schrodinger equation and cubic nonlinear Schrodinger equation. These multi-order envelope periodic solutions can degenerate into the different envelope solitary solutions. (authors)
A deformation (strain) envelope for cyclic disturbed sand
DEFF Research Database (Denmark)
Sabaliauskas, Tomas; Ibsen, Lars Bo
2018-01-01
Recent advances in triaxial testing procedures revealed new properties governing disturbed sand stiffness. This paper summarizes the new observations into an original, proof of concept. The novel concept interpolates effective stress within a strain (deformation) envelope. Coulomb stress limits...... are still satisfied, but the stresses are interpolated using a deformation (strain) envelope. The method is not part of a constitutive formulation, but is remarkably functional in triaxial testing practice. The practicality is proven by plotting simulations on top of empirically measured stiffness history...... - the fitting is remarkably good even during tests of extreme complexity. The novelty has substantial interdisciplinary potential: offshore anchors and foundations, earthquakes and industrial processes - wherever dynamic loads and disturbed sand are encountered. It opens the door to a new branch of numerical...
Enveloped Lives: Practicing Health and Care in Lithuania.
Praspaliauskiene, Rima
2016-12-01
This article analyzes informal medical payments that the majority of Lithuanians give or feel compelled to give to doctors before or after treatment. It focuses on how patients and their caretakers encounter, practice, and enact informal payments in health care and how these payments create a reality of health care that is not limited to an economic rationality. Within such a frame, rather than being considered a gift or bribe, it conceptualizes these little white envelopes as a practice of health and care. The article shows how an envelope of money given to a doctor transcends the material patient-doctor transaction and emerges as a productive force for coping with illness, medical encounters, and misfortunes. © 2016 by the American Anthropological Association.
International Nuclear Information System (INIS)
Fiuza, K.; Rizzato, F.B.; Pakter, R.
2006-01-01
In this paper we analyze the combined envelope-centroid dynamics of magnetically focused high-intensity charged beams surrounded by conducting walls. Similar to the case where conducting walls are absent, it is shown that the envelope and centroid dynamics decouple from each other. Mismatched envelopes still decay into equilibrium with simultaneous emittance growth, but the centroid keeps oscillating with no appreciable energy loss. Some estimates are performed to analytically obtain characteristics of halo formation seen in the full simulations
Nakaya, Yuki; Miyazawa, Takayuki
2014-06-01
Endogenous retroviruses (ERVs) are the remnants of retroviral infection of ancestral germ cells. Mutations introduced into ERVs halt the production of infectious agents, but their effects on the function of retroviral proteins are not fully understood. Retroviral envelope glycoproteins (Envs) are utilized in membrane fusion during viral entry, and we recently identified intact coding sequences for bovine endogenous retrovirus K1 (BERV-K1) and BERV-K2 Envs. Amino acid sequences of BERV-K1 Env (also called Fematrin-1) and BERV-K2 Env are similar, and both viruses are classified in the genus Betaretrovirus. While Fematrin-1 plays an important role in cell-to-cell fusion in bovine placenta, the BERV-K2 envelope gene is marginally expressed in vivo, and its recombinant Env protein is defective in membrane fusion due to inefficient cleavage of surface (SU) and transmembrane subunits. Here, we conducted chimeric analyses of Fematrin-1 and BERV-K2 Envs and revealed that defective maturation of BERV-K2 Env contributed to failed intracellular trafficking. Fluorescence microscopy and flow cytometric analysis suggested that in contrast to Fematrin-1 Env, BERV-K2 Env could not be transported from the endoplasmic reticulum to the trans-Golgi network, where cellular proteases required for processing retroviral Envs are localized. We also identified that one of the responsive regions of this phenomenon resided within a 65-amino-acid region of BERV-K2 SU. This is the first report to identify that retroviral Env SU is involved in the regulation of intracellular trafficking, and it may help to elucidate the maturation process of Fematrin-1 and other related Envs. Retroviruses utilize envelope glycoproteins (Envs) to enter host target cells. Mature retroviral Env is a heterodimer, which consists of surface (SU) and transmembrane (TM) subunits that are generated by the cleavage of an Env precursor protein in the trans-Golgi network. SU and TM mediate the recognition of the entry
Gingras, David R.; Barnhart, Billy P.; Martos, Borja; Ratvasky, Thomas P.; Morelli, Eugene
2011-01-01
Fatal loss-of-control (LOC) accidents have been directly related to in-flight airframe icing. The prototype system presented in this paper directly addresses the need for real-time onboard envelope protection in icing conditions. The combinations of a-priori information and realtime aerodynamic estimations are shown to provide sufficient input for determining safe limits of the flight envelope during in-flight icing encounters. The Icing Contamination Envelope Protection (ICEPro) system has been designed and implemented to identify degradations in airplane performance and flying qualities resulting from ice contamination and provide safe flight-envelope cues to the pilot. Components of ICEPro are described and results from preliminary tests are presented.
Integrated Energy Design of the Building Envelope
DEFF Research Database (Denmark)
Nielsen, Martin Vraa
This thesis describes the outcome of the PhD project Integrated energy design of the building envelope carried out through a combination of scientific dissemination reported through peer-reviewed journals and a wide range of affiliated projects involved in at an architectural firm. The research...
International Nuclear Information System (INIS)
Lee, Changhee; Yoo, Dongwan
2006-01-01
The small envelope (E) protein of porcine reproductive and respiratory syndrome virus (PRRSV) is a hydrophobic 73 amino acid protein encoded in the internal open reading frame (ORF) of the bicistronic mRNA2. As a first step towards understanding the biological role of E protein during PRRSV replication, E gene expression was blocked in a full-length infectious clone by mutating the ATG translational initiation to GTG, such that the full-length mutant genomic clone was unable to synthesize the E protein. DNA transfection of PRRSV-susceptible cells with the E gene knocked-out genomic clone showed the absence of virus infectivity. P129-ΔE-transfected cells however produced virion particles in the culture supernatant, and these particles contained viral genomic RNA, demonstrating that the E protein is essential for PRRSV infection but dispensable for virion assembly. Electron microscopy suggests that the P129-ΔE virions assembled in the absence of E had a similar appearance to the wild-type particles. Strand-specific RT-PCR demonstrated that the E protein-negative, non-infectious P129-ΔE virus particles were able to enter cells but further steps of replication were interrupted. The entry of PRRSV has been suggested to be via receptor-mediated endocytosis, and lysomotropic basic compounds and known ion-channel blocking agents both inhibited PRRSV replication effectively during the uncoating process. The expression of E protein in Escherichia coli-mediated cell growth arrests and increased the membrane permeability. Cross-linking experiments in cells infected with PRRSV or transfected with E gene showed that the E protein was able to form homo-oligomers. Taken together, our data suggest that the PRRSV E protein is likely an ion-channel protein embedded in the viral envelope and facilitates uncoating of virus and release of the genome in the cytoplasm
C.H.J. Siebelink (Kees); E.J. Tijhaar (Edwin); R.C. Huisman (Robin); W. Huisman (Willem); A. de Ronde; I.H. Darby; M.J. Francis; G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert)
1995-01-01
textabstractCats were immunized three times with different recombinant feline immunodeficiency virus (FIV) candidate vaccines. Recombinant vaccinia virus (rVV)-expressed envelope glycoprotein with (vGR657) or without (vGR657 x 15) the cleavage site and an FIV envelope bacterial fusion protein
47 CFR 25.218 - Off-axis EIRP envelopes for FSS earth station operations.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Off-axis EIRP envelopes for FSS earth station operations. 25.218 Section 25.218 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.218 Off-axis EIRP envelopes for FSS...
Permeabilization of the nuclear envelope following nanosecond pulsed electric field exposure
Energy Technology Data Exchange (ETDEWEB)
Thompson, Gary L., E-mail: gary.l.thompson.3@gmail.com [Oak Ridge Institute for Science & Education, Joint Base San Antonio Fort Sam Houston, TX, 78234 (United States); Roth, Caleb C. [Department of Radiological Sciences, University of Texas Health Science Center at San Antonio, TX, 78234 (United States); Kuipers, Marjorie A. [Radio Frequency Radiation Branch, Bioeffects Division, Human Effectiveness Directorate, 711th Human Performance Wing, Air Force Research Laboratory, Joint Base San Antonio Fort Sam Houston, TX, 78234 (United States); Tolstykh, Gleb P. [General Dynamics IT, Joint Base San Antonio Fort Sam Houston, TX, 78234 (United States); Beier, Hope T. [Optical Radiation Branch, Bioeffects Division, Human Effectiveness Directorate, 711th Human Performance Wing, Air Force Research Laboratory, Joint Base San Antonio Fort Sam Houston, TX, 78234 (United States); Ibey, Bennett L. [Radio Frequency Radiation Branch, Bioeffects Division, Human Effectiveness Directorate, 711th Human Performance Wing, Air Force Research Laboratory, Joint Base San Antonio Fort Sam Houston, TX, 78234 (United States)
2016-01-29
Permeabilization of cell membranes occurs upon exposure to a threshold absorbed dose (AD) of nanosecond pulsed electric fields (nsPEF). The ultimate, physiological bioeffect of this exposure depends on the type of cultured cell and environment, indicating that cell-specific pathways and structures are stimulated. Here we investigate 10 and 600 ns duration PEF effects on Chinese hamster ovary (CHO) cell nuclei, where our hypothesis is that pulse disruption of the nuclear envelope membrane leads to observed cell death and decreased viability 24 h post-exposure. To observe short-term responses to nsPEF exposure, CHO cells have been stably transfected with two fluorescently-labeled proteins known to be sequestered for cellular chromosomal function within the nucleus – histone-2b (H2B) and proliferating cell nuclear antigen (PCNA). H2B remains associated with chromatin after nsPEF exposure, whereas PCNA leaks out of nuclei permeabilized by a threshold AD of 10 and 600 ns PEF. A downturn in 24 h viability, measured by MTT assay, is observed at the number of pulses required to induce permeabilization of the nucleus. - Highlights: • The ability of nsPEF to damage nuclear structures within cells is investigated. • Leakage of proliferating nuclear antigen from nuclei is induced by nsPEF. • High doses of nsPEF disrupt cortical lamin and cause chromatin decompaction. • Histone H2B remains attached to chromatin following nsPEF exposure. • DNA does not leak out of nsPEF-permeabilized nuclei.
Symmetries and Invariants of the Time-dependent Oscillator Equation and the Envelope Equation
Qin, Hong
2005-01-01
Single-particle dynamics in a time-dependent focusing field is examined. The existence of the Courant-Snyder invariant* is fundamentally the result of the corresponding symmetry admitted by the oscillator equation with time-dependent frequency.** A careful analysis of the admitted symmetries reveals a deeper connection between the nonlinear envelope equation and the oscillator equation. A general theorem regarding the symmetries and invariants of the envelope equation, which includes the existence of the Courant-Snyder invariant as a special case, is demonstrated. The symmetries of the envelope equation enable a fast algorithm for finding matched solutions without using the conventional iterative shooting method.
Carrier-envelope phase-stabilized attosecond pulses from asymmetric molecules
International Nuclear Information System (INIS)
Lan Pengfei; Lu Peixiang; Cao Wei; Li Yuhua; Wang Xinlin
2007-01-01
High-order harmonic generation from asymmetric molecules is investigated, and the concept of phase-stabilized infrared ultrashort laser pulses is extended to the extreme ultraviolet regime. It is shown that the ionization symmetry in consecutive half optical cycles is broken for asymmetric molecules, and both even and odd harmonics with comparable intensity are produced. In the time domain, only one attosecond pulse is generated in each cycle of the driving field, and the carrier-envelope phases of the attosecond pulses are equal. Consequently, a clean attosecond pulse train with the same carrier-envelope phase from pulse to pulse is obtained in the extreme ultraviolet regime
Constant envelope OFDM scheme for 6PolSK-QPSK
Li, Yupeng; Ding, Ding
2018-03-01
A constant envelope OFDM scheme with phase modulator (PM-CE-OFDM) for 6PolSK-QPSK modulation was demonstrated. Performance under large fiber launch power is measured to check its advantages in counteracting fiber nonlinear impairments. In our simulation, PM-CE-OFDM, RF-assisted constant envelope OFDM (RF-CE-OFDM) and conventional OFDM (Con-OFDM) are transmitted through 80 km standard single mode fiber (SSMF) single channel and WDM system. Simulation results confirm that PM-CE-OFDM has best performance in resisting fiber nonlinearity. In addition, benefiting from the simple system structure, the complexity and cost of PM-CE-OFDM system could be reduced effectively.
The role of high-frequency envelope fluctuations for speech masking release
DEFF Research Database (Denmark)
Jørgensen, Søren; Dau, Torsten
2013-01-01
The speech-based envelope power spectrum model (sEPSM; Jørgensen and Dau, 2011; Jørgensen et al., 2013) was shown to successfully predict speech intelligibility in conditions with stationary and fluctuating interferers, reverberation, and spectral subtraction. The key element in the model...... was the multi-resolution estimation of the signal-to-noise ratio in the envelope domain (SNRenv) at the output of a modulation filterbank. The simulations suggested that mainly modulation filters centered in the range from 1-8 Hz contribute to speech intelligibility in the case of stationary maskers whereas...... modulation filters tuned to frequencies above 16 Hz might be important in the case of fluctuating maskers. In the present study, the role of high-frequency envelope fluctuations for speech masking release was further investigated in conditions of speech-on-speech masking. Simulations were compared to various...
The role of high-frequency envelope fluctuations for speech masking release
DEFF Research Database (Denmark)
Jørgensen, Søren; Dau, Torsten
2013-01-01
The speech-based envelope power spectrum model [sEPSM; Jørgensen and Dau (2011), Jørgensen et al. (2013)] was shown to successfully predict speech intelligibility in conditions with stationary and fluctuating interferers, reverberation, and spectral subtraction. The key element in the model...... was the multi-resolution estimation of the signal-to-noise ratio in the envelope domain (SNRenv) at the output of a modulation filterbank. The simulations suggested that mainly modulation filters centered in the range from 1 to 8 Hz contribute to speech intelligibility in the case of stationary maskers whereas...... modulation filters tuned to frequencies above 16 Hz might be important in the case of fluctuating maskers. In the present study, the role of high-frequency envelope fluctuations for speech masking release was further investigated in conditions of speech-on-speech masking. Simulations were compared to various...
Directory of Open Access Journals (Sweden)
Goulder Philip JR
2010-11-01
Full Text Available Abstract Background HIV-1 envelope diversity remains a significant challenge for the development of an efficacious vaccine. The evolutionary forces that shape the diversity of envelope are incompletely understood. HIV-1 subtype C envelope in particular shows significant differences and unique characteristics compared to its subtype B counterpart. Here we applied the single genome sequencing strategy of plasma derived virus from a cohort of therapy naïve chronically infected individuals in order to study diversity, divergence patterns and envelope characteristics across the entire HIV-1 subtype C gp160 in 4 slow progressors and 4 progressors over an average of 19.5 months. Results Sequence analysis indicated that intra-patient nucleotide diversity within the entire envelope was higher in slow progressors, but did not reach statistical significance (p = 0.07. However, intra-patient nucleotide diversity was significantly higher in slow progressors compared to progressors in the C2 (p = 0.0006, V3 (p = 0.01 and C3 (p = 0.005 regions. Increased amino acid length and fewer potential N-linked glycosylation sites (PNGs were observed in the V1-V4 in slow progressors compared to progressors (p = 0.009 and p = 0.02 respectively. Similarly, gp41 in the progressors was significantly longer and had fewer PNGs compared to slow progressors (p = 0.02 and p = 0.02 respectively. Positive selection hotspots mapped mainly to V1, C3, V4, C4 and gp41 in slow progressors, whereas hotspots mapped mainly to gp41 in progressors. Signature consensus sequence differences between the groups occurred mainly in gp41. Conclusions These data suggest that separate regions of envelope are under differential selective forces, and that envelope evolution differs based on disease course. Differences between slow progressors and progressors may reflect differences in immunological pressure and immune evasion mechanisms. These data also indicate that the pattern of envelope evolution
AM Envelope. The potential of Additive Manufacturing for facade constructions
Directory of Open Access Journals (Sweden)
Holger Strauss
2017-11-01
Full Text Available This dissertation shows the potential of Additive Manufacturing (AM for the development of building envelopes: AM will change the way of designing facades, how we engineer and produce them. To achieve today’s demands from those future envelopes, we have to find new solutions. New technologies offer one possible way to do so. They open new approaches in designing, producing and processing building construction and facades. Finding the one capable of having big impact is difficult – Additive Manufacturing is one possible answer. The term ‘AM Envelope’ (Additive Manufacturing Envelope describes the transfer of this technology to the building envelope. Additive Fabrication is a building block that aids in developing the building envelope from a mere space enclosure to a dynamic building envelope. First beginnings of AM facade construction show up when dealing with relevant aspects like material consumption, mounting or part’s performance. From those starting points several parts of an existing post-and-beam façade system were optimized, aiming toward the implementation of AM into the production chain. Enhancements on all different levels of production were achieved: storing, producing, mounting and performance. AM offers the opportunity to manufacture facades ‘just in time’. It is no longer necessary to store or produce large numbers of parts in advance. Initial investment for tooling can be avoided, as design improvements can be realized within the dataset of the AM part. AM is based on ‘tool-less’ production, all parts can be further developed with every new generation. Producing tool-less also allows for new shapes and functional parts in small batch sizes – down to batch size one. The parts performance can be re-interpreted based on the demands within the system, not based on the limitations of conventional manufacturing. AM offers new ways of materializing the physical part around its function. It leads toward customized
Application of HVJ envelope system to boron neutron capture therapy (BNCT)
International Nuclear Information System (INIS)
Nakai, Kei; Kurooka, Masaaki; Kaneda, Yasufumi; Yamamoto, Tetsuya; Matsumura, Akira; Asano, Tomoyuki
2006-01-01
Boron Neutron Capture Therapy (BNCT) has been used clinically for the treatment of malignant tumors. Two drugs, p-boronophenylalanine (BPA) and sulfhydral borane (BSH), have been used as boron delivery agents. These drugs seem to be taken up preferentially in solid tumors, but it is uncertain whether therapeutic quantities of boron atoms are taken up by micro-invasive or distant tumor cells. High accumulation and high selective delivery of boron into tumor tissues are the most important requirements to achieve efficient BNCT for malignant tumor. The HVJ envelope (HVJ-E) vector system is a novel fusion-mediated gene delivery system based on inactivated hemagglutinating virus of Japan (HVJ; Sendai virus). Although we developed this vector system for gene transfer, it can also deliver proteins, synthetic oligonucleotides, and drugs. HVJ-liposome, which is liposome fused with HVJ-E, has higher boron trapping efficiency than HVJ-E alone. We report the boron delivery into cultured cells with HVJ-liposome systems. The cellular 10 B concentration after 60 min incubation with HVJ-E containing BSH was 24.9 μg/g cell pellet for BHK-21 cells (baby hamster kidney cells) and 19.4 μg/g cell pellet for SCC VII cells (murine squamous cell carcinoma). These concentrations are higher than that of 60 min incubated cells with BSH containing (100μg 10 B/ml) medium. These results indicate the HVJ-E fused with tumor cell membrane and rapidly delivered boron agents, and that the HVJ-E-mediated delivery system could be applicable to BNCT. Plans are underway to begin neutron radiation experiments in vivo and in vitro. (author)
International Nuclear Information System (INIS)
Lehr, Elizabeth E.; Qadadri, Brahim; Brown, Calla R.; Brown, Darron R.
2003-01-01
Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1-circumflexE4 and E1-circumflexE4-circumflexL1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1-circumflexE4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system
Mazari, Peter M; Argaw, Takele; Valdivieso, Leonardo; Zhang, Xia; Marcucci, Katherine T; Salomon, Daniel R; Wilson, Carolyn A; Roth, Monica J
2012-06-05
In vitro screening of randomized FeLV Envelope libraries identified the CP isolate, which enters cells through HuPAR-1, one of two human receptors utilized by porcine endogenous retrovirus-A (PERV-A), a distantly related gammaretrovirus. The CP and PERV-A Envs however, share little amino acid homology. Their receptor utilization was examined to define the common receptor usage of these disparate viral Envs. We demonstrate that the receptor usage of CP extends to HuPAR-2 but not to the porcine receptor PoPAR, the cognate receptor for PERV-A. Reciprocal interference between virus expressing CP and PERV-A Envs was observed on human cells. Amino acid residues localized to within the putative second extracellular loop (ECL-2) of PAR-1 and PAR-2 are found to be critical for CP envelope function. Through a panel of receptor chimeras and point mutations, this area was also found to be responsible for the differential usage of the PoPAR receptor between CP and PERV-A. Copyright © 2012 Elsevier Inc. All rights reserved.
Interior thermal insulation systems for historical building envelopes
Jerman, Miloš; Solař, Miloš; Černý, Robert
2017-11-01
The design specifics of interior thermal insulation systems applied for historical building envelopes are described. The vapor-tight systems and systems based on capillary thermal insulation materials are taken into account as two basic options differing in building-physical considerations. The possibilities of hygrothermal analysis of renovated historical envelopes including laboratory methods, computer simulation techniques, and in-situ tests are discussed. It is concluded that the application of computational models for hygrothermal assessment of interior thermal insulation systems should always be performed with a particular care. On one hand, they present a very effective tool for both service life assessment and possible planning of subsequent reconstructions. On the other, the hygrothermal analysis of any historical building can involve quite a few potential uncertainties which may affect negatively the accuracy of obtained results.
Tilsen, Sam; Arvaniti, Amalia
2013-07-01
This study presents a method for analyzing speech rhythm using empirical mode decomposition of the speech amplitude envelope, which allows for extraction and quantification of syllabic- and supra-syllabic time-scale components of the envelope. The method of empirical mode decomposition of a vocalic energy amplitude envelope is illustrated in detail, and several types of rhythm metrics derived from this method are presented. Spontaneous speech extracted from the Buckeye Corpus is used to assess the effect of utterance length on metrics, and it is shown how metrics representing variability in the supra-syllabic time-scale components of the envelope can be used to identify stretches of speech with targeted rhythmic characteristics. Furthermore, the envelope-based metrics are used to characterize cross-linguistic differences in speech rhythm in the UC San Diego Speech Lab corpus of English, German, Greek, Italian, Korean, and Spanish speech elicited in read sentences, read passages, and spontaneous speech. The envelope-based metrics exhibit significant effects of language and elicitation method that argue for a nuanced view of cross-linguistic rhythm patterns.
DEFF Research Database (Denmark)
Jensen, Jesper; Taal, C.H.
2013-01-01
of Shannon information the critical-band amplitude envelopes of the noisy/processed signal convey about the corresponding clean signal envelopes. The resulting intelligibility predictor turns out to be a simple function of the correlation between noisy/processed and clean amplitude envelopes. The proposed...
Directory of Open Access Journals (Sweden)
Ali Maisarah
2016-01-01
Full Text Available Ventilation systems play a significant role in maintaining the indoor thermal and hygric balance. Nevertheless, the systems had been implicated to result in many problems. In the tropical climate, especially for energy efficiency purposes, building spaces are operated with differential ventilation. Such spaces operate on 24-hrs basis, some on 8-hrs while others are either naturally ventilated or served with mechanical supply-exhaust fan systems with non-conditioned outdoor air. This practice had been found to result in condensation problems. This study involves a quantitative appraisal of the effect of operative conditions and hygrothermal quality of building envelopes on condensation risk. The in-situ experiment is combined with an analytical approach to assessing the hygrothermal quality of building envelopes in a tropical climate building under differential ventilation between adjacent spaces. The case-studied building is with a known history of condensation and associated damages including mould growth. The microclimate measurement and hygrothermal performance of the wall and floor against condensation and mould growth risks had been previously reported elsewhere. As a step further, the present study evaluates the effects of various envelope insulation types and configurations together with the HVAC cooling set-points on envelope hygrothermal performance. The results revealed that overcooling the air-conditioned side increases condensation risk on the non-air-conditioned side of the envelopes. The envelopes failed criteria for surface condensation at existing operative conditions irrespective of envelope hygrothermal quality improvements. However, the envelope performed well at improved cooling operative conditions even at existing envelope hygrothermal quality. It is, therefore, important to ascertain the envelope hygrothermal quality as well the cooling operative conditions while embarking on energy efficiency operations in mechanical
Tan, Zhixiang; Zhang, Yi; Zeng, Deping; Wang, Hua
2015-04-01
We proposed a research of a heart sound envelope extraction system in this paper. The system was implemented on LabVIEW based on the Hilbert-Huang transform (HHT). We firstly used the sound card to collect the heart sound, and then implemented the complete system program of signal acquisition, pretreatment and envelope extraction on LabVIEW based on the theory of HHT. Finally, we used a case to prove that the system could collect heart sound, preprocess and extract the envelope easily. The system was better to retain and show the characteristics of heart sound envelope, and its program and methods were important to other researches, such as those on the vibration and voice, etc.
Directory of Open Access Journals (Sweden)
Diana Rüthnick
2018-05-01
Full Text Available The main microtubule organizing centre in the unicellular model organisms Saccharomyces cerevisiae and Schizosaccharomyces pompe is the spindle pole body (SPB. The SPB is a multilayer structure, which duplicates exactly once per cell cycle. Unlike higher eukaryotic cells, both yeast model organisms undergo mitosis without breakdown of the nuclear envelope (NE, a so-called closed mitosis. Therefore, in order to simultaneously nucleate nuclear and cytoplasmic MTs, it is vital to embed the SPB into the NE at least during mitosis, similarly to the nuclear pore complex (NPC. This review aims to embrace the current knowledge of the SPB duplication cycle with special emphasis on the critical step of the insertion of the new SPB into the NE.
Cooperation of an RNA Packaging Signal and a Viral Envelope Protein in Coronavirus RNA Packaging
Narayanan, Krishna; Makino, Shinji
2001-01-01
Murine coronavirus mouse hepatitis virus (MHV) produces a genome-length mRNA, mRNA 1, and six or seven species of subgenomic mRNAs in infected cells. Among these mRNAs, only mRNA 1 is efficiently packaged into MHV particles. MHV N protein binds to all MHV mRNAs, whereas envelope M protein interacts only with mRNA 1. This M protein-mRNA 1 interaction most probably determines the selective packaging of mRNA 1 into MHV particles. A short cis-acting MHV RNA packaging signal is necessary and suffi...
International Nuclear Information System (INIS)
Viquez Alas, Ernesto Alonso
2013-01-01
An alternative method of design is demonstrated to be used in the creation of an architectural envelope, through the application of tools and techniques such as algorithms, optimization, parametrization and simulation. The aesthetic criteria of the form are enriched to achieve the decrease in solar radiation rates. The methods and techniques of optimization, simulation, analysis and synthesis are habituated through the study of the contemporary paradigm of generative design and design by performance. Some of the applying of potential benefits an alternative design method and conditions to be met are designed to facilitate its application in the design of envelopes. A study of application and testing is demonstrated to explore the surround topology. The optimization results in relation to reducing the solar incidence are examined in a simulated environment [es
Extended Cann Model for Behavioral Modeling of Envelope Tracking Power Amplifiers
DEFF Research Database (Denmark)
Tafuri, Felice Francesco; Larsen, Torben
2013-01-01
This paper deals with behavioral modeling of power amplifiers (PAs) for envelope tracking (ET) applications. In such a scenario, the power supply modulation brings in several additional challenges for the system design and, similarly, it becomes more difficult to obtain an accurate and general PA...... by the ET operation. The model performance is tested modeling data-sets acquired from an ET test bench including a commercial RFMD PA and an envelope modulator designed using a commercial IC from TI....
Chung, Nancy P. Y.; Matthews, Katie; Kim, Helen J.; Ketas, Thomas J.; Golabek, Michael; de Los Reyes, Kevin; Korzun, Jacob; Yasmeen, Anila; Sanders, Rogier W.; Klasse, Per Johan; Wilson, Ian A.; Ward, Andrew B.; Marozsan, Andre J.; Moore, John P.; Cupo, Albert
2014-01-01
Recombinant soluble, cleaved HIV-1 envelope glycoprotein SOSIP.664 gp140 trimers based on the subtype A BG505 sequence are being studied structurally and tested as immunogens in animals. For these trimers to become a vaccine candidate for human trials, they would need to be made in appropriate
Characterizing Functional Domains for TIM-Mediated Enveloped Virus Entry
Moller-Tank, Sven; Albritton, Lorraine M.; Rennert, Paul D.
2014-01-01
ABSTRACT T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members were recently identified as phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance entry of Ebola virus (EBOV) and other viruses by binding PtdSer on the viral envelope, concentrating virus on the cell surface, and promoting subsequent internalization. The PtdSer-binding activity of the immunoglobulin-like variable (IgV) domain is essential for both virus binding and internalization by TIM-1. However, TIM-3, whose IgV domain also binds PtdSer, does not effectively enhance virus entry, indicating that other domains of TIM proteins are functionally important. Here, we investigate the domains supporting enhancement of enveloped virus entry, thereby defining the features necessary for a functional PVEER. Using a variety of chimeras and deletion mutants, we found that in addition to a functional PtdSer-binding domain PVEERs require a stalk domain of sufficient length, containing sequences that promote an extended structure. Neither the cytoplasmic nor the transmembrane domain of TIM-1 is essential for enhancing virus entry, provided the protein is still plasma membrane bound. Based on these defined characteristics, we generated a mimic lacking TIM sequences and composed of annexin V, the mucin-like domain of α-dystroglycan, and a glycophosphatidylinositol anchor that functioned as a PVEER to enhance transduction of virions displaying Ebola, Chikungunya, Ross River, or Sindbis virus glycoproteins. This identification of the key features necessary for PtdSer-mediated enhancement of virus entry provides a basis for more effective recognition of unknown PVEERs. IMPORTANCE T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members are recently identified phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance virus entry by binding the phospholipid, PtdSer, present on the viral
International Nuclear Information System (INIS)
Hong Jun; Xu Dongmei; Yu Jiahui; Gong Peijun; Ma Hongjuan; Yao Side
2007-01-01
Ultrasmall superparamagnetic iron oxide (USPIO) with synthetic polymer, based on magnetite core, was synthesized via facile photochemical in situ polymerization. A possible mechanism of photochemical in situ polymerization was proposed. The obtained polymer-enveloped UPSIO was characterized by transmission electron microscopy (TEM), photo-correlation spectroscopy (PCS), Fourier transform infrared spectroscopy (FT-IR), thermogravimetric (TG) analysis and vibrating sampling magnetometer (VSM) measurement. Properties such as ultrasmall particle size, hydrophilicity, strong magnetization and surface characteristics, which are desirable for magnetic resonance imaging (MRI) contrast agents, were evaluated in detail. The resultant USPIO-based MRI contrast agent holds considerable promise in molecular MR tracking, MR immune imaging, cell tracking and targeted intracellular hyperthermia, etc
Solitons, envelope solitons in collisonless plasmas
International Nuclear Information System (INIS)
Ichikawa, Y.H.; Watanabe, S.
1977-08-01
A review is given to extensive development of theoretical, computational and experimental studies of nonlinear wave propagation in collisionless plasmas. Firstly, the historical experiment of Ikezi et al. is discussed in comparison with theoretical analysis based on the Korteweg-de Vries equation. Systematic discrepancy between the observation and the theoretical prediction suggests that it is necessary to examine such as higher order mode coupling effect and contribution of trapped particles. Secondly, effects of the nonlinear Landau damping on the envelope solution of ion plasma wave is discussed on the basis of theoretical study of Ichikawa-Taniuti, experimental observation of Watanabe and numerical analysis of Yajima et al. Finally, a new type of evolution equation derived for the Alfven wave is examined in some detail. The rigorous solution obtained for this mode represents a new kind of envelope solution, in which both of its phase and amplitude are subject to modulation of comparable spatial extension. In conclusion, the emphasis will be placed on the fact that much more intensive experimental researches are expected to be done, since the powerful methods to disentangle various nonlinear evolution equations are now available for theoretical approach. (auth.)
Wall envelopes in office buildings: design trend and implications on cooling load of buildings
International Nuclear Information System (INIS)
Ibrahim, N.; Ahmed, A.Z.; Ahmed, S.S.
2006-01-01
The wall envelope is a vital element of a building especially to a high rise building where its wall to building volume ratio is higher compared to other building forms. As well as a means of architectural expression, the wall envelope protects and regulates the indoor environment. In recent years there have been many applications of glass products and cladding systems in high-rise buildings built in Kuala Lumpur. This paper describes a recent research and survey on wall envelope designs adopted in 33 high-rise office buildings built in the central business district of Kuala Lumpur since 1990. This research adopts component design analysis to identify dominant trends on wall envelope design for the surveyed buildings. The paper seeks to discourse the implications of this design trend on energy consumption of high-rise office buildings in the country
Arthos, James; Rubbert, Andrea; Rabin, Ronald L.; Cicala, Claudia; Machado, Elizabeth; Wildt, Kathryne; Hanbach, Meredith; Steenbeke, Tavis D.; Swofford, Ruth; Farber, Joshua M.; Fauci, Anthony S.
2000-01-01
The capacity of human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) envelopes to transduce signals through chemokine coreceptors on macrophages was examined by measuring the ability of recombinant envelope proteins to mobilize intracellular calcium stores. Both HIV and SIV envelopes mobilized calcium via interactions with CCR5. The kinetics of these responses were similar to those observed when macrophages were treated with MIP-1β. Distinct differences in the capacity o...
The pestivirus Erns glycoprotein interacts with E2 in both infected cells and mature virions
International Nuclear Information System (INIS)
Lazar, Catalin; Zitzmann, Nicole; Dwek, Raymond A.; Branza-Nichita, Norica
2003-01-01
E rns is a pestivirus envelope glycoprotein indispensable for virus attachment and infection of target cells. Unlike the other two envelope proteins E1 and E2, E rns lacks a transmembrane domain and a vast quantity is secreted into the medium of infected cells. The protein is also present in fractions of pure pestivirus virions, raising the important and intriguing question regarding the mechanism of its attachment to the pestivirus envelope. In this study a direct interaction between E rns and E2 glycoproteins was demonstrated in both pestivirus-infected cells and mature virions. By co- and sequential immunoprecipitation we showed that an E rns -E2 heterodimer is assembled very early after translation of the viral polyprotein and before its processing is completed. Our results suggest that E rns is attached to the pestivirus envelope via a direct interaction with E2 and explain the role of E rns in the initial virus-target cell interaction
Altered Morphology and Function of the Lacrimal Functional Unit in Protein Kinase Cα Knockout Mice
Chen, Zhuo; Li, Zhijie; Basti, Surendra; Farley, William J.
2010-01-01
Purpose. Protein kinase C (PKC) α plays a major role in the parasympathetic neural stimulation of lacrimal gland (LG) secretion. It also has been reported to have antiapoptotic properties and to promote cell survival. Therefore, the hypothesis for the present study was that PKCα knockout (−/−) mice have impaired ocular surface–lacrimal gland signaling, rendering them susceptible to desiccating stress and impaired corneal epithelial wound healing. In this study, the lacrimal function unit (LFU) and the stressed wound-healing response were examined in PKCα−/− mice. Methods. In PKCα+/+ control mice and PKCα−/− mice, tear production, osmolarity, and clearance rate were evaluated before and after experimental desiccating stress. Histology and immunofluorescent staining of PKC and epidermal growth factor were performed in tissues of the LFU. Cornified envelope (CE) precursor protein expression and cell proliferation were evaluated. The time course of healing and degree of neutrophil infiltration was evaluated after corneal epithelial wounding. Results. Compared with the PKCα+/+ mice, the PKCα−/− mice were noted to have significantly increased lacrimal gland weight, with enlarged, carbohydrate-rich, PAS-positive acinar cells; increased corneal epithelia permeability, with reduced CE expression; and larger conjunctival epithelial goblet cells. The PKCα−/− mice showed more rapid corneal epithelial healing, with less neutrophil infiltration and fewer proliferating cells than did the PKCα+/+ mice. Conclusions. The PKCα−/− mice showed lower tear production, which appeared to be caused by impaired secretion by the LG and conjunctival goblet cells. Despite their altered tear dynamics, the PKCα−/− mice demonstrated more rapid corneal epithelial wound healing, perhaps due to decreased neutrophil infiltration. PMID:20505191
Yokoi, Fumiaki; Dang, Mai T; Zhou, Tong; Li, Yuqing
2012-02-15
DYT11 myoclonus-dystonia (M-D) is a movement disorder characterized by myoclonic jerks with dystonic symptoms and caused by mutations in paternally expressed SGCE, which codes for ε-sarcoglycan. Paternally inherited Sgce heterozygous knock-out (KO) mice exhibit motor deficits and spontaneous myoclonus. Abnormal nuclear envelopes have been reported in cellular and mouse models of early-onset DYT1 generalized torsion dystonia; however, the relationship between the abnormal nuclear envelopes and motor symptoms are not clear. Furthermore, it is not known whether abnormal nuclear envelope exists in non-DYT1 dystonia. In the present study, abnormal nuclear envelopes in the striatal medium spiny neurons (MSNs) were found in Sgce KO mice. To analyze whether the loss of ε-sarcoglycan in the striatum alone causes abnormal nuclear envelopes, motor deficits or myoclonus, we produced paternally inherited striatum-specific Sgce conditional KO (Sgce sKO) mice and analyzed their phenotypes. Sgce sKO mice exhibited motor deficits in both beam-walking and accelerated rotarod tests, while they did not exhibit abnormal nuclear envelopes, alteration in locomotion, or myoclonus. The results suggest that the loss of ε-sarcoglycan in the striatum contributes to motor deficits, while it alone does not produce abnormal nuclear envelopes or myoclonus. Development of therapies targeting the striatum to compensate for the loss of ε-sarcoglycan function may rescue the motor deficits in DYT11 M-D patients.
Maximum Torque and Momentum Envelopes for Reaction Wheel Arrays
Markley, F. Landis; Reynolds, Reid G.; Liu, Frank X.; Lebsock, Kenneth L.
2009-01-01
Spacecraft reaction wheel maneuvers are limited by the maximum torque and/or angular momentum that the wheels can provide. For an n-wheel configuration, the torque or momentum envelope can be obtained by projecting the n-dimensional hypercube, representing the domain boundary of individual wheel torques or momenta, into three dimensional space via the 3xn matrix of wheel axes. In this paper, the properties of the projected hypercube are discussed, and algorithms are proposed for determining this maximal torque or momentum envelope for general wheel configurations. Practical strategies for distributing a prescribed torque or momentum among the n wheels are presented, with special emphasis on configurations of four, five, and six wheels.
Serial femtosecond X-ray diffraction of enveloped virus microcrystals
Directory of Open Access Journals (Sweden)
Robert M. Lawrence
2015-07-01
Full Text Available Serial femtosecond crystallography (SFX using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ∼700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ∼40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is an important step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.
Wisner, Todd W; Wright, Catherine C; Kato, Akihisa; Kawaguchi, Yasushi; Mou, Fan; Baines, Joel D; Roller, Richard J; Johnson, David C
2009-04-01
Herpesvirus capsids collect along the inner surface of the nuclear envelope and bud into the perinuclear space. Enveloped virions then fuse with the outer nuclear membrane (NM). We previously showed that herpes simplex virus (HSV) glycoproteins gB and gH act in a redundant fashion to promote fusion between the virion envelope and the outer NM. HSV mutants lacking both gB and gH accumulate enveloped virions in herniations, vesicles that bulge into the nucleoplasm. Earlier studies had shown that HSV mutants lacking the viral serine/threonine kinase US3 also accumulate herniations. Here, we demonstrate that HSV gB is phosphorylated in a US3-dependent manner in HSV-infected cells, especially in a crude nuclear fraction. Moreover, US3 directly phosphorylated the gB cytoplasmic (CT) domain in in vitro assays. Deletion of gB in the context of a US3-null virus did not add substantially to defects in nuclear egress. The majority of the US3-dependent phosphorylation of gB involved the CT domain and amino acid T887, a residue present in a motif similar to that recognized by US3 in other proteins. HSV recombinants lacking gH and expressing either gB substitution mutation T887A or a gB truncated at residue 886 displayed substantial defects in nuclear egress. We concluded that phosphorylation of the gB CT domain is important for gB-mediated fusion with the outer NM. This suggested a model in which the US3 kinase is incorporated into the tegument layer (between the capsid and envelope) in HSV virions present in the perinuclear space. By this packaging, US3 might be brought close to the gB CT tail, leading to phosphorylation and triggering fusion between the virion envelope and the outer NM.
Infrared spectrophotometry and radiative transfer in optically thick circumstellar dust envelopes
International Nuclear Information System (INIS)
Merrill, K.M.
1976-01-01
The Two-Micron Sky Survey of Neugebauer and Leighton and, more recently, the AFCRL Infrared Sky Survey of Walker and Price have detected numerous compact, isolated, bright infrared sources which are not identified with previously cataloged stars. Observations of many such objects suggest that extensive circumstellar dust envelopes modify the flux from a central source. The present investigations employ broad bandpass photometry at lambda lambda 1.65 μm to 12.5 μm and narrow bandpass spectrophotometry (Δ lambda/lambda approximately 0.015) at lambda lambda 2-4 μm and lambda lambda 8-13 μm to determine the properties of a large sample of such infrared sources. Infrared spectrophotometry can clearly differentiate between normal stars of spectral types M(''oxygen-rich'') and C (''carbon-rich'') on the basis of characteristic absorption bands arising in cool stellar atmospheres. Most of the 2 μ Sky Survey and many of the AFCRL Sky Survey sources appear to be stars of spectral types M and C which are differentiated from normal cool comparison stars only by the presence of extensive circumstellar dust envelopes. Due to the large optical depth of the envelopes, the flux from the star and from the dust cannot be simply separated. Hence solutions of radiative transfer through spherically symmetric envelopes of arbitrary optical depth were generated by a generalized computer code which employed opacities of real dust
Directory of Open Access Journals (Sweden)
Jennifer M Friederichs
2011-11-01
Full Text Available The budding yeast spindle pole body (SPB is anchored in the nuclear envelope so that it can simultaneously nucleate both nuclear and cytoplasmic microtubules. During SPB duplication, the newly formed SPB is inserted into the nuclear membrane. The mechanism of SPB insertion is poorly understood but likely involves the action of integral membrane proteins to mediate changes in the nuclear envelope itself, such as fusion of the inner and outer nuclear membranes. Analysis of the functional domains of the budding yeast SUN protein and SPB component Mps3 revealed that most regions are not essential for growth or SPB duplication under wild-type conditions. However, a novel dominant allele in the P-loop region, MPS3-G186K, displays defects in multiple steps in SPB duplication, including SPB insertion, indicating a previously unknown role for Mps3 in this step of SPB assembly. Characterization of the MPS3-G186K mutant by electron microscopy revealed severe over-proliferation of the inner nuclear membrane, which could be rescued by altering the characteristics of the nuclear envelope using both chemical and genetic methods. Lipid profiling revealed that cells lacking MPS3 contain abnormal amounts of certain types of polar and neutral lipids, and deletion or mutation of MPS3 can suppress growth defects associated with inhibition of sterol biosynthesis, suggesting that Mps3 directly affects lipid homeostasis. Therefore, we propose that Mps3 facilitates insertion of SPBs in the nuclear membrane by modulating nuclear envelope composition.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
Energy Technology Data Exchange (ETDEWEB)
Yu, L.D., E-mail: yuld@thep-center.org [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Prakrajang, K. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Faculty of Science, Maejo University, Chiang Mai 50290 (Thailand); Phanchaisri, B. [Institute of Science and Technology Research, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongkumkoon, P. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thopan, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Singkarat, S. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2014-05-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
International Nuclear Information System (INIS)
Yu, L.D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.
2014-01-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence
Experiences when employing different alternatives for envelope upgrading
Directory of Open Access Journals (Sweden)
Peru Elguezabal Esnarrizaga
2015-06-01
Full Text Available The challenges of achieving the 2020 goals in terms of energy savings and improving efficiency are guiding numerous research initiatives looking for more insulated envelopes, dealing with thermal performance of insulation materials and envelope systems. Nevertheless, the envelope integrates within the building and this improvement on the insulation performance has to be properly adopted, taking into account the interrelation of main elements composing the overall system (facade, frame, slabs, openings, partitions etc., as well as side effects originated not only for new erected buildings, but specifically in renovation and retrofitting works. This paper describes real experiences when considering various options for upgrading the facade through the increase of the insulation capacity, starting from external overcladding prefabricated panels and ventilated facades, advancing to more sustainable low carbon systems and ending with even more highly insulated solutions employing aerogels. Lessons from these cases, where energy and hygrothermal assessments have being carried out, demonstrate the influence of the design and construction phases and the relevance of disregarded effects such as minor thermal bridges, uncontrolled craftsmanship on site, and moisture transfer for the different technologies considered. Finally, possible alternatives are provided to overcome some of the detected difficulties, such as combination with non-metallic structural components and building membranes, and being prepared for future challenges and new developments when these isolative elements are combined with other technologies, as for example, renewable energy harvesting devices.
Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.
Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee
2017-08-01
Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.
Flight envelope protection system for unmanned aerial vehicles
Claudel, Christian G.; Shaqura, Mohammad
2016-01-01
Systems and methods to protect the flight envelope in both manual flight and flight by a commercial autopilot are provided. A system can comprise: an inertial measurement unit (IMU); a computing device in data communication with the IMU
Directory of Open Access Journals (Sweden)
Jessica F Toro
Full Text Available The response of antibody-secreting cells (ASC induced by dengue has only recently started to be characterized. We propose that young age and previous infections could be simple factors that affect this response. Here, we evaluated the primary and secondary responses of circulating ASC in infants (6-12 months old and children (1-14 years old infected with dengue showing different degrees of clinical severity. The ASC response was delayed and of lower magnitude in infants, compared with older children. In primary infection (PI, the total and envelope (E protein-specific IgM ASC were dominant in infants but not in children, and a negative correlation was found between age and the number of IgM ASC (rho = -0.59, P = 0.03. However, infants with plasma dengue-specific IgG detectable in the acute phase developed an intense ASC response largely dominated by IgG and comparable to that of children with secondary infection (SI. IgM and IgG produced by ASC circulating in PI or SI were highly cross-reactive among the four serotypes. Dengue infection caused the disturbance of B cell subsets, particularly a decrease in the relative frequency of naïve B cells. Higher frequencies of total and E protein-specific IgM ASC in the infants and IgG in the children were associated with clinically severe forms of infection. Therefore, the ASC response induced by dengue is highly influenced by the age at which infection occurs and previous immune status, and its magnitude is a relevant element in the clinical outcome. These results are important in the search for correlates of protection and for determining the ideal age for vaccinating against dengue.
Slunyaev, Alexey; Klein, Marco; Clauss, Günther F.
2016-04-01
Envelope soliton solutions are key elements governing the nonlinear wave dynamics within a simplified theory for unidirectional weakly modulated weakly nonlinear wave groups on the water surface. Within integrable models the solitons preserve their structure in collisions with other waves; they do not disperse and can carry energy infinitively long. Steep and short soliton-like wave groups have been shown to exist in laboratory tests [1] and, even earlier, in numerical simulations [2, 3]. Thus, long-living wave groups may play important role in the dynamics of intense sea waves and wave-structure interactions. The solitary wave groups may change the wave statistics and can be taken into account when developing approaches for the deterministic forecasting of dangerous waves, including so-called rogue waves. An experimental campaign has been conducted in the wave basin of the Technical University of Berlin on simulations of intense solitary wave groups. The first successful experimental observation of intense envelope solitons took place in this facility [1]. The new experiments aimed at following main goals: 1) to reproduce intense envelope solitons with different carrier wave lengths; 2) to estimate the rate of envelope soliton dissipation; 3) to consider the reflection of envelope solitons on a vertical wall; 4) to consider head-on collisions of envelope solitons, and 5) to consider overtaking interactions of envelope solitons. Up to 9 wave gauges were used in each experimental run, which enabled registration of the surface movement at different distances from the wavemaker, at different locations across the wave flume and near the wall. Besides surface displacements, the group envelope shapes were directly recorded, with use of phase shifts applied to the modulated waves generated by the wavemaker. [1] A. Slunyaev, G.F. Clauss, M. Klein, M. Onorato, Simulations and experiments of short intense envelope solitons of surface water waves. Phys. Fluids 25, 067105
Evaluation of ISO CRS Envelopes Relative to U.S. Vehicles and Child Restraint Systems.
Hu, Jingwen; Manary, Miriam A; Klinich, Kathleen D; Reed, Matthew P
2015-01-01
The objectives of this study are to use computer simulation to evaluate the International Organization for Standardization (ISO) 13216-3:2006(E) child restraint system (CRS) envelopes relative to rear seat compartments from vehicles and CRSs in the U.S. market, investigate the potential compatibility issues of U.S. vehicles and CRSs, and demonstrate whether necessary modifications can be made to introduce such a system into compatibility evaluations between U.S. vehicles and CRSs. Three-dimensional geometry models for 26 vehicles and 16 convertible CRS designs developed previously were used. Geometry models of 3 forward-facing and 3 rear-facing CRS envelopes provided by the ISO were built in the current study. The virtual fit process closely followed the physical procedures described in the ISO standards. The results showed that the current ISO rear-facing envelopes can provide reasonable classifications for CRSs and vehicles, but the forward-facing envelopes do not represent products currently in the U.S. market. In particular, all of the selected vehicles could accommodate the largest forward-facing CRS envelope at the second-row seat location behind the driver seat. In contrast, half of the selected CRSs could not fit within any of the forward-facing ISO CRS envelopes, mainly due to protrusion at the rear-top corner of the envelope. The results also indicate that the rear seat compartment in U.S. vehicles often cannot accommodate a large portion of convertible CRSs in the rear-facing position. The increased demand for vehicle fuel economy and the recommendation to keep children rear-facing longer may lead to smaller cars and larger CRSs, which may increase the potential for fit problems. The virtual classifications indicated that contact between the forward-facing CRSs and the head restraints in the rear seats as well as that between the rear-facing CRSs and the back of the front seats is a main concern regarding the compatibility between the vehicles and the
Shape Transformation of the Nuclear Envelope during Closed Mitosis.
Zhu, Qian; Zheng, Fan; Liu, Allen P; Qian, Jin; Fu, Chuanhai; Lin, Yuan
2016-11-15
The nuclear envelope (NE) in lower eukaryotes such as Schizosaccharomyces pombe undergoes large morphology changes during closed mitosis. However, which physical parameters are important in governing the shape evolution of the NE, and how defects in the dividing chromosomes/microtubules are reflected in those parameters, are fundamental questions that remain unresolved. In this study, we show that improper separation of chromosomes in genetically deficient cells leads to membrane tethering or asymmetric division in contrast to the formation of two equal-sized daughter nuclei in wild-type cells. We hypothesize that the poleward force is transmitted to the nuclear membrane through its physical contact with the separated sister chromatids at the two spindle poles. A theoretical model is developed to predict the morphology evolution of the NE where key factors such as the work done by the poleward force and bending and surface energies stored in the membrane have been taken into account. Interestingly, the predicted phase diagram, summarizing the dependence of nuclear shape on the size of the load transmission regions, and the pole-to-pole distance versus surface area relationship all quantitatively agree well with our experimental observations, suggesting that this model captures the essential physics involved in closed mitosis. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Tafuri, Felice Francesco; Sira, Daniel; Jensen, Ole Kiel
2013-01-01
This paper presents a new method to improve the performance of envelope tracking (ET) power amplifiers (PAs). The method consists of combining the supply modulation that characterizes the envelope tracking architecture with supply shaping and dynamic biasing. The inclusion of dynamic biasing allo...
Hopson, Charles B.
1987-01-01
The results of an analysis performed on seven successive Space Shuttle Main Engine (SSME) static test firings, utilizing envelope detection of external accelerometer data are discussed. The results clearly show the great potential for using envelope detection techniques in SSME incipient failure detection.
Directory of Open Access Journals (Sweden)
Danuta Witkowska
2009-04-01
Full Text Available The problems concerning the pathogenicity and virulence of some bacteria of the [i]Enterobacteriaceae[/i] family are described. The structure and functional variety of the outer membrane proteins on the cell surface are presented as potent immunogens based on the structure of the cell envelope. These proteins participate in stabilization of the membrane structure and adhesion to other cells, are receptors for bacteriophages, and play a key role in signal transduction, intracellular transport, and energy transformation processes ensuring proper cell functioning. Moreover, these proteins have a protective function against immune reactions of the infected organism. Referring to current literature data, the authors’ own results are reviewed on the methodology of isolating outer membrane proteins and their participation in pathogenicity with regard to molecular mimicry. The isolated and characterized 45-kDa enolase-like protein expressing similarity to human enolase should not be a component of vaccine, although it is considered a diagnostic marker of tissue damage. Presented are also results of studies on the role of the outer membrane protein OMP38, recognized by the human immune system as an important factor in antibacterial immunity. OMP38 is considered an antigen and carrier in conjugate vaccines, but also a specific diagnostic marker of immune deficiencies useful in monitoring the level of immunity against bacteria of the [i]Enterobacteriaceae[/i] family.
International Nuclear Information System (INIS)
Nguyen, Q H; Lang, V T; Nguyen, N D; Choi, S B
2014-01-01
When designing a magneto-rheological brake (MRB), it is well known that the shape of the brake envelope significantly affects the performance characteristics of the brake. In this study, different shapes for the MR brake envelope, such as rectangular, polygonal or spline shape, are considered and the most suitable shape identified. MRBs with different envelope shapes are introduced followed by the derivation of the braking torque based on Bingham-plastic behavior of the magneto-rheological fluid (MRF). Optimization of the design of the MRB with different envelope shapes is then done. The optimization problem is to find the optimal value for the significant geometric dimensions of the MRB that can produce a certain required braking torque while the brake mass is minimized. A finite element analysis integrated with an optimization tool is employed to obtain optimal solutions for the MRBs. From the results, the most suitable shape for the brake envelope is identified and discussed with the reduction of mass. In addition, the results of the analysis are compared with the experimental results to verify the proposed optimal design characteristics. (paper)
Nguyen, Q. H.; Lang, V. T.; Nguyen, N. D.; Choi, S. B.
2014-01-01
When designing a magneto-rheological brake (MRB), it is well known that the shape of the brake envelope significantly affects the performance characteristics of the brake. In this study, different shapes for the MR brake envelope, such as rectangular, polygonal or spline shape, are considered and the most suitable shape identified. MRBs with different envelope shapes are introduced followed by the derivation of the braking torque based on Bingham-plastic behavior of the magneto-rheological fluid (MRF). Optimization of the design of the MRB with different envelope shapes is then done. The optimization problem is to find the optimal value for the significant geometric dimensions of the MRB that can produce a certain required braking torque while the brake mass is minimized. A finite element analysis integrated with an optimization tool is employed to obtain optimal solutions for the MRBs. From the results, the most suitable shape for the brake envelope is identified and discussed with the reduction of mass. In addition, the results of the analysis are compared with the experimental results to verify the proposed optimal design characteristics.
Carriot, Jérome; Jamali, Mohsen; Cullen, Kathleen E; Chacron, Maurice J
2017-01-01
There is accumulating evidence that the brain's neural coding strategies are constrained by natural stimulus statistics. Here we investigated the statistics of the time varying envelope (i.e. a second-order stimulus attribute that is related to variance) of rotational and translational self-motion signals experienced by human subjects during everyday activities. We found that envelopes can reach large values across all six motion dimensions (~450 deg/s for rotations and ~4 G for translations). Unlike results obtained in other sensory modalities, the spectral power of envelope signals decreased slowly for low (2 Hz) temporal frequencies and thus was not well-fit by a power law. We next compared the spectral properties of envelope signals resulting from active and passive self-motion, as well as those resulting from signals obtained when the subject is absent (i.e. external stimuli). Our data suggest that different mechanisms underlie deviation from scale invariance in rotational and translational self-motion envelopes. Specifically, active self-motion and filtering by the human body cause deviation from scale invariance primarily for translational and rotational envelope signals, respectively. Finally, we used well-established models in order to predict the responses of peripheral vestibular afferents to natural envelope stimuli. We found that irregular afferents responded more strongly to envelopes than their regular counterparts. Our findings have important consequences for understanding the coding strategies used by the vestibular system to process natural second-order self-motion signals.
HOPS 136: An edge-on orion protostar near the end of envelope infall
Energy Technology Data Exchange (ETDEWEB)
Fischer, William J.; Megeath, S. Thomas [Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Tobin, John J. [National Radio Astronomy Observatory, Charlottesville, VA (United States); Hartmann, Lee; Kounkel, Marina [Department of Astronomy, University of Michigan, Ann Arbor, MI (United States); Stutz, Amelia M. [Max-Planck-Institut für Astronomie, Heidelberg (Germany); Poteet, Charles A. [New York Center for Astrobiology, Rensselaer Polytechnic Institute, Troy, NY (United States); Ali, Babar [NHSC/IPAC/Caltech, Pasadena, CA (United States); Osorio, Mayra [Instituto de Astrofísica de Andalucía, CSIC, Granada (Spain); Manoj, P. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Mumbai (India); Remming, Ian [Department of Astronomy and Astrophysics, University of Chicago, Chicago, IL (United States); Stanke, Thomas [ESO, Garching bei München (Germany); Watson, Dan M., E-mail: wjfischer@gmail.com [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States)
2014-02-01
Edge-on protostars are valuable for understanding the disk and envelope properties of embedded young stellar objects, since the disk, envelope, and envelope cavities are all distinctly visible in resolved images and well constrained in modeling. Comparing Two Micron All Sky Survey, Wide-field Infrared Survey Explorer, Spitzer, Herschel, and APEX photometry and an IRAM limit from 1.2 to 1200 μm, Spitzer spectroscopy from 5 to 40 μm, and high-resolution Hubble imaging at 1.60 and 2.05 μm to radiative transfer modeling, we determine envelope and disk properties for the Class I protostar HOPS 136, an edge-on source in Orion's Lynds 1641 region. The source has a bolometric luminosity of 0.8 L {sub ☉}, a bolometric temperature of 170 K, and a ratio of submillimeter to bolometric luminosity of 0.8%. Via modeling, we find a total luminosity of 4.7 L {sub ☉} (larger than the observed luminosity due to extinction by the disk), an envelope mass of 0.06 M {sub ☉}, and a disk radius and mass of 450 AU and 0.002 M {sub ☉}. The stellar mass is highly uncertain but is estimated to fall between 0.4 and 0.5 M {sub ☉}. To reproduce the flux and wavelength of the near-infrared scattered-light peak in the spectral energy distribution, we require 5.4 × 10{sup –5} M {sub ☉} of gas and dust in each cavity. The disk has a large radius and a mass typical of more evolved T Tauri disks in spite of the significant remaining envelope. HOPS 136 appears to be a key link between the protostellar and optically revealed stages of star formation.
Gimpel, Petra; Lee, Yin Loon; Sobota, Radoslaw M; Calvi, Alessandra; Koullourou, Victoria; Patel, Rutti; Mamchaoui, Kamel; Nédélec, François; Shackleton, Sue; Schmoranzer, Jan; Burke, Brian; Cadot, Bruno; Gomes, Edgar R
2017-10-09
The nucleus is the main microtubule-organizing center (MTOC) in muscle cells due to the accumulation of centrosomal proteins and microtubule (MT) nucleation activity at the nuclear envelope (NE) [1-4]. The relocalization of centrosomal proteins, including Pericentrin, Pcm1, and γ-tubulin, depends on Nesprin-1, an outer nuclear membrane (ONM) protein that connects the nucleus to the cytoskeleton via its N-terminal region [5-7]. Nesprins are also involved in the recruitment of kinesin to the NE and play a role in nuclear positioning in skeletal muscle cells [8-12]. However, a function for MT nucleation from the NE in nuclear positioning has not been established. Using the proximity-dependent biotin identification (BioID) method [13, 14], we found several centrosomal proteins, including Akap450, Pcm1, and Pericentrin, whose association with Nesprin-1α is increased in differentiated myotubes. We show that Nesprin-1α recruits Akap450 to the NE independently of kinesin and that Akap450, but not other centrosomal proteins, is required for MT nucleation from the NE. Furthermore, we demonstrate that this mechanism is disrupted in congenital muscular dystrophy patient myotubes carrying a nonsense mutation within the SYNE1 gene (23560 G>T) encoding Nesprin-1 [15, 16]. Finally, using computer simulation and cell culture systems, we provide evidence for a role of MT nucleation from the NE on nuclear spreading in myotubes. Our data thus reveal a novel function for Nesprin-1α/Nesprin-1 in nuclear positioning through recruitment of Akap450-mediated MT nucleation activity to the NE. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Pegu, Poonam; Vaccari, Monica; Gordon, Shari; Keele, Brandon F.; Doster, Melvin; Guan, Yongjun; Ferrari, Guido; Pal, Ranajit; Ferrari, Maria Grazia; Whitney, Stephen; Hudacik, Lauren; Billings, Erik; Rao, Mangala; Montefiori, David; Tomaras, Georgia; Alam, S. Munir; Fenizia, Claudio; Lifson, Jeffrey D.; Stablein, Donald; Tartaglia, Jim; Michael, Nelson; Kim, Jerome; Venzon, David
2013-01-01
The recombinant canarypox vector, ALVAC-HIV, together with human immunodeficiency virus (HIV) gp120 envelope glycoprotein, has protected 31.2% of Thai individuals from HIV acquisition in the RV144 HIV vaccine trial. This outcome was unexpected, given the limited ability of the vaccine components to induce CD8+ T-cell responses or broadly neutralizing antibodies. We vaccinated macaques with an immunization regimen intended to mimic the RV144 trial and exposed them intrarectally to a dose of the simian immunodeficiency virus SIVmac251 that transmits few virus variants, similar to HIV transmission to humans. Vaccination induced anti-envelope antibodies in all vaccinees and CD4+ and CD8+ T-cell responses. Three of the 11 macaques vaccinated with ALVAC-SIV/gp120 were protected from SIVmac251 acquisition, but the result was not significant. The remaining vaccinees were infected and progressed to disease. The magnitudes of vaccine-induced SIVmac251-specific T-cell responses and binding antibodies were not significantly different between protected and infected animals. However, sera from protected animals had higher avidity antibodies to gp120, recognized the variable envelope regions V1/V2, and reduced SIVmac251 infectivity in cells that express high levels of α4β7 integrins, suggesting a functional role of antibodies to V2. The current results emphasize the utility of determining the titer of repeated mucosal challenge in the preclinical evaluation of HIV vaccines. PMID:23175374
Inner nuclear envelope protein SUN1 plays a prominent role in mammalian mRNA export.
Li, Ping; Noegel, Angelika A
2015-11-16
Nuclear export of messenger ribonucleoproteins (mRNPs) through the nuclear pore complex (NPC) can be roughly classified into two forms: bulk and specific export, involving an nuclear RNA export factor 1 (NXF1)-dependent pathway and chromosome region maintenance 1 (CRM1)-dependent pathway, respectively. SUN proteins constitute the inner nuclear envelope component of the l I: nker of N: ucleoskeleton and C: ytoskeleton (LINC) complex. Here, we show that mammalian cells require SUN1 for efficient nuclear mRNP export. The results indicate that both SUN1 and SUN2 interact with heterogeneous nuclear ribonucleoprotein (hnRNP) F/H and hnRNP K/J. SUN1 depletion inhibits the mRNP export, with accumulations of both hnRNPs and poly(A)+RNA in the nucleus. Leptomycin B treatment indicates that SUN1 functions in mammalian mRNA export involving the NXF1-dependent pathway. SUN1 mediates mRNA export through its association with mRNP complexes via a direct interaction with NXF1. Additionally, SUN1 associates with the NPC through a direct interaction with Nup153, a nuclear pore component involved in mRNA export. Taken together, our results reveal that the inner nuclear envelope protein SUN1 has additional functions aside from being a central component of the LINC complex and that it is an integral component of the mammalian mRNA export pathway suggesting a model whereby SUN1 recruits NXF1-containing mRNP onto the nuclear envelope and hands it over to Nup153. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Coleman, Gavin A. L.; Papaloizou, John C. B.; Nelson, Richard P.
2017-09-01
The core accretion hypothesis posits that planets with significant gaseous envelopes accreted them from their protoplanetary discs after the formation of rocky/icy cores. Observations indicate that such exoplanets exist at a broad range of orbital radii, but it is not known whether they accreted their envelopes in situ, or originated elsewhere and migrated to their current locations. We consider the evolution of solid cores embedded in evolving viscous discs that undergo gaseous envelope accretion in situ with orbital radii in the range 0.1-10 au. Additionally, we determine the long-term evolution of the planets that had no runaway gas accretion phase after disc dispersal. We find the following. (I) Planets with 5 M⊕ cores never undergo runaway accretion. The most massive envelope contained 2.8 M⊕ with the planet orbiting at 10 au. (II) Accretion is more efficient on to 10 M⊕ and 15 M⊕ cores. For orbital radii ap ≥ 0.5 au, 15 M⊕ cores always experienced runaway gas accretion. For ap ≥ 5 au, all but one of the 10 M⊕ cores experienced runaway gas accretion. No planets experienced runaway growth at ap = 0.1 au. (III) We find that, after disc dispersal, planets with significant gaseous envelopes cool and contract on Gyr time-scales, the contraction time being sensitive to the opacity assumed. Our results indicate that Hot Jupiters with core masses ≲15 M⊕ at ≲0.1 au likely accreted their gaseous envelopes at larger distances and migrated inwards. Consistently with the known exoplanet population, super-Earths and mini-Neptunes at small radii during the disc lifetime, accrete only modest gaseous envelopes.
Print and supply of envelopes and file covers
Indian Academy of Sciences (India)
“Tender for Supply of Printed Envelopes and File Covers". Tender ... Twenty Five Thousand Only) in the form of Demand Draft drawn on any Nationalized. Bank and .... m) The finalized contract shall be interpreted under Indian Laws. In case of ...
Yokoi, Fumiaki; Dang, Mai T.; Zhou, Tong; Li, Yuqing
2012-01-01
DYT11 myoclonus-dystonia (M-D) is a movement disorder characterized by myoclonic jerks with dystonic symptoms and caused by mutations in paternally expressed SGCE, which codes for ɛ-sarcoglycan. Paternally inherited Sgce heterozygous knock-out (KO) mice exhibit motor deficits and spontaneous myoclonus. Abnormal nuclear envelopes have been reported in cellular and mouse models of early-onset DYT1 generalized torsion dystonia; however, the relationship between the abnormal nuclear envelopes and motor symptoms are not clear. Furthermore, it is not known whether abnormal nuclear envelope exists in non-DYT1 dystonia. In the present study, abnormal nuclear envelopes in the striatal medium spiny neurons (MSNs) were found in Sgce KO mice. To analyze whether the loss of ɛ-sarcoglycan in the striatum alone causes abnormal nuclear envelopes, motor deficits or myoclonus, we produced paternally inherited striatum-specific Sgce conditional KO (Sgce sKO) mice and analyzed their phenotypes. Sgce sKO mice exhibited motor deficits in both beam-walking and accelerated rotarod tests, while they did not exhibit abnormal nuclear envelopes, alteration in locomotion, or myoclonus. The results suggest that the loss of ɛ-sarcoglycan in the striatum contributes to motor deficits, while it alone does not produce abnormal nuclear envelopes or myoclonus. Development of therapies targeting the striatum to compensate for the loss of ɛ-sarcoglycan function may rescue the motor deficits in DYT11 M-D patients. PMID:22080833
Radiative transfer in gray circumstellar dust envelopes: VY Canis Majoris revisited
International Nuclear Information System (INIS)
Schwartz, R.D.
1975-01-01
The circumstellar dust model for VY CMa proposed by Herbig is reinvestigated using a generalized form of Huang's theory of radiative transfer. The resultant envelope parameters and the emergent energy distribution are found to be insensitive to the choice of Eddington factor for a given envelope inner boundary temperature. Observed fluxes from 0.43 to 74 μ are incorporated into the model, and problems relating to grain emissivity for lambda>30 μ and grain survival at the indicated inner boundary temperature of 1855degreeK are discussed
Weir, Dawn L; Laing, Eric D; Smith, Ina L; Wang, Lin-Fa; Broder, Christopher C
2014-02-27
Australian bat lyssavirus (ABLV), a rhabdovirus of the genus Lyssavirus which circulates in both pteropid fruit bats and insectivorous bats in mainland Australia, has caused three fatal human infections, the most recent in February 2013, manifested as acute neurological disease indistinguishable from clinical rabies. Rhabdoviruses infect host cells through receptor-mediated endocytosis and subsequent pH-dependent fusion mediated by their single envelope glycoprotein (G), but the specific host factors and pathways involved in ABLV entry have not been determined. ABLV internalization into HEK293T cells was examined using maxGFP-encoding recombinant vesicular stomatitis viruses (rVSV) that express ABLV G glycoproteins. A combination of chemical and molecular approaches was used to investigate the contribution of different endocytic pathways to ABLV entry. Dominant negative Rab GTPases were used to identify the endosomal compartment utilized by ABLV to gain entry into the host cell cytosol. Here we show that ABLV G-mediated entry into HEK293T cells was significantly inhibited by the dynamin-specific inhibitor dynasore, chlorpromazine, a drug that blocks clathrin-mediated endocytosis, and the actin depolymerizing drug latrunculin B. Over expression of dominant negative mutants of Eps15 and Rab5 also significantly reduced ABLV G-mediated entry into HEK293T cells. Chemical inhibitors of caveolae-dependent endocytosis and macropinocytosis and dominant negative mutants of Rab7 and Rab11 had no effect on ABLV entry. The predominant pathway utilized by ABLV for internalization into HEK293T cells is clathrin-and actin-dependent. The requirement of Rab5 for productive infection indicates that ABLV G-mediated fusion occurs within the early endosome compartment.
Directory of Open Access Journals (Sweden)
José L. Affranchino
2014-01-01
Full Text Available The lentiviral envelope glycoproteins (Env mediate virus entry by interacting with specific receptors present at the cell surface, thereby determining viral tropism and pathogenesis. Therefore, Env incorporation into the virions formed by assembly of the viral Gag polyprotein at the plasma membrane of the infected cells is a key step in the replication cycle of lentiviruses. Besides being useful models of human immunodeficiency virus (HIV infections in humans and valuable tools for developing AIDS therapies and vaccines, simian and feline immunodeficiency viruses (SIV and FIV, respectively are relevant animal retroviruses; the study of which provides important information on how lentiviral replication strategies have evolved. In this review, we discuss the molecular mechanisms underlying the incorporation of the SIV and FIV Env glycoproteins into viral particles.
Specifics of Building Envelope Air Leakage Problems and Airtightness Measurements
Directory of Open Access Journals (Sweden)
Borodinecs Anatolijs
2016-01-01
Full Text Available In addition to transmission heat loses the infiltration of outdoor air can cause significant heat losses. The external building envelope should be airtight in order to prevent uncontrolled cold air infiltration. The article analysis modern building materials and structures influence on airtightness. The practical measurements of renovated buildings’ airtightness are presented and compared to non-renovated buildings. In addition paper presents data on airtightness measurements of whole multi apartment building and single apartment in analyzed building taking inco accout properties of building materials. The airtightness of single apartment was evaluated with support pressure in neighbor apartments. The results show that the airtightness measurements of multi apartment building can be evaluated by measuring single apartment on last floor with support pressure in neighbor apartments. The practical measurement of renovated buildings had shown the air leakage rate q50 of typical Latvian construction after renovation is between 2.5 and 2.9 m3/(m2·h. Since the building envelope has to minimize the heat loses (transmission and infiltration and ventilation system either mechanical or natural has to provide necessary air exchange, the building envelope airtightness shouldn’t be dependent on type of ventilation systems.
Study of an experimental methodology for thermal properties diagnostic of building envelop
Yang , Yingying; Sempey , Alain; Vogt Wu , Tingting; Sommier , Alain; Dumoulin , Jean; Batsale , Jean ,
2017-01-01
International audience; The building envelope plays a critical role in determining levels of comfort and building efficiency. Its real thermal properties characterization is of major interest to be able to diagnose energy efficiency performance of buildings (new construction and retrofitted existing old building). Research and development on a possible methodology for energy diagnostic of the building envelop is a hot topic and necessary trend. Many kinds of sensors and instruments are used f...
Chemistry of Protostellar Envelopes and Disks
Flores Rivera, Lizxandra; Terebey, Susan; Willacy, Karen
2018-06-01
Molecule formation is dynamic during the protostar collapse phase, driven by changes in temperature, density, and UV radiation as gas and dust flows from the envelope onto the forming protoplanetary disk. In this work, we compare physical models based on two different collapse solutions. We modeled the chemistry (created by Karen Willacy) for C18O to see how its abundance changes over time using as primary input parameters the temperature and density profile that were produced by the dust Radiative Transfer (MCRT) model called HOCHUNK3D from Whitney (2003). Given this model, we produce synthetic line emission maps from L1527 IRS to simulate the Class 0/I protostar L1527 IRS using RADMC3D code and compare them with previous observations from ALMA. High concentrations of gas phase molecules of C18O are found within the 20 AU in areas in the envelope that are close to the surface of the disk. In the outermost part of the disk surface, the C18O freezes out beyond 400 AU, showing a much reduced abundance where the temperature profile drops down below 25 K. In cold regions, the radiation field plays an important role in the chemistry.
Grain formation in cool stellar envelopes
International Nuclear Information System (INIS)
Deguchi, S.
1980-01-01
The nucleation and growth of dust grains in the stellar envelope are investigated for the case of oxygen-rich stars, where the mass loss occurs as a result of the radiation pressure on the dust grains. The number density of grains, the final grain sizes, and the final amount of metals remaining in gaseous states are calculated based on the grain-nucleation theory proposed by Yamamoto and Hasegawa and Draine and Salpeter. It is shown that, even if we base our calculations on the Lothe-Pound nucleation rate equation instead of the classical, homogeneous nucleation rate equation, the proposed theory gives a number density of grains quite similar to that based on the classical rate equation. The approximate solution of the flow, in this paper, brings physical insight to the problem of how the formation of grains couples the flow passing the sonic point. The metals in the outer envelope remain in gaseous state by the amount of 1--10% of the initial content for the mass-loss rate of 10 -5 M/sub sun/ yr -1 and by less than 1% for the massloss are less than 3 x 10 -6 M/sub sun/ yr -1 . Species of metals condensed onto the grains are also discussed
Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin
2005-01-01
Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904
Ion-acoustic envelope modes in a degenerate relativistic electron-ion plasma
Energy Technology Data Exchange (ETDEWEB)
McKerr, M.; Kourakis, I. [Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, BT7 1NN Belfast, Northern Ireland (United Kingdom); Haas, F. [Instituto de Física, Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves 9500, Porto Alegre, RS (Brazil)
2016-05-15
A self-consistent relativistic two-fluid model is proposed for one-dimensional electron-ion plasma dynamics. A multiple scales perturbation technique is employed, leading to an evolution equation for the wave envelope, in the form of a nonlinear Schrödinger type equation (NLSE). The inclusion of relativistic effects is shown to introduce density-dependent factors, not present in the non-relativistic case—in the conditions for modulational instability. The role of relativistic effects on the linear dispersion laws and on envelope soliton solutions of the NLSE is discussed.
Induced wave propagation from a vibrating containment envelope
International Nuclear Information System (INIS)
Stout, R.B.; Thigpen, L.; Rambo, J.T.
1985-09-01
Low frequency wave forms are observed in the particle velocity measurements around the cavity and containment envelope formed by an underground nuclear test. The vibration solution for a spherical shell is used to formulate a model for the low frequency wave that propagates outward from this region. In this model the containment envelope is the zone of material that is crushed by the compressive shock wave of the nuclear explosion. The containment envelope is approximated by a spherical shell of material. The material in the spherical shell is densified and is given a relatively high kinetic energy density because of the high compressive stress and particle velocity of the shock wave. After the shock wave has propagated through the spherical shell, the spherical shell vibrates in order to dissipate the kinetic energy acquired from the shock wave. Based on the model, the frequency of vibration depends on the dimensions and material properties of the spherical shell. The model can also be applied in an inverse mode to obtain global estimates of averaged materials properties. This requires using experimental data and semi-empirical relationships involving the material properties. A particular case of estimating a value for shear strength is described. Finally, the oscillation time period of the lowest frequency from five nuclear tests is correlated with the energy of the explosion. The correlation provides another diagnostic to estimate the energy of a nuclear explosion. Also, the longest oscillation time period measurement provides additional experimental data that can be used to assess and validate various computer models. 11 refs., 2 figs
Pegu, Poonam; Vaccari, Monica; Gordon, Shari; Keele, Brandon F; Doster, Melvin; Guan, Yongjun; Ferrari, Guido; Pal, Ranajit; Ferrari, Maria Grazia; Whitney, Stephen; Hudacik, Lauren; Billings, Erik; Rao, Mangala; Montefiori, David; Tomaras, Georgia; Alam, S Munir; Fenizia, Claudio; Lifson, Jeffrey D; Stablein, Donald; Tartaglia, Jim; Michael, Nelson; Kim, Jerome; Venzon, David; Franchini, Genoveffa
2013-02-01
The recombinant canarypox vector, ALVAC-HIV, together with human immunodeficiency virus (HIV) gp120 envelope glycoprotein, has protected 31.2% of Thai individuals from HIV acquisition in the RV144 HIV vaccine trial. This outcome was unexpected, given the limited ability of the vaccine components to induce CD8(+) T-cell responses or broadly neutralizing antibodies. We vaccinated macaques with an immunization regimen intended to mimic the RV144 trial and exposed them intrarectally to a dose of the simian immunodeficiency virus SIV(mac251) that transmits few virus variants, similar to HIV transmission to humans. Vaccination induced anti-envelope antibodies in all vaccinees and CD4(+) and CD8(+) T-cell responses. Three of the 11 macaques vaccinated with ALVAC-SIV/gp120 were protected from SIV(mac251) acquisition, but the result was not significant. The remaining vaccinees were infected and progressed to disease. The magnitudes of vaccine-induced SIV(mac251)-specific T-cell responses and binding antibodies were not significantly different between protected and infected animals. However, sera from protected animals had higher avidity antibodies to gp120, recognized the variable envelope regions V1/V2, and reduced SIV(mac251) infectivity in cells that express high levels of α(4)β(7) integrins, suggesting a functional role of antibodies to V2. The current results emphasize the utility of determining the titer of repeated mucosal challenge in the preclinical evaluation of HIV vaccines.
International Nuclear Information System (INIS)
King, W.D.
2000-01-01
Hanford Radioactive Waste materials have been categorized into four envelopes labeled A through D as specified in the Tank Waste Remediation Contract between BNFL and DOE. 1 Envelopes A, B and C contain only solubilized species and are specified as Low-Activity Waste (LAW). Each envelope is defined based on compositional maximums of chemical and radioactive constituents. Envelopes A and B contain low concentrations of organic species and the primary form of technetium is pertechnetate (TcO4-). Envelope C contains higher levels of organic species and technetium which is primarily in the nonpertechnetate form (presumably complexed TcO2). Envelope D is sludge which has been separated from the supernate and is referred to as High Activity Waste. The current plant design utilizes SuperLig ion exchange resins to remove cesium and technetium (the primary radioactive constituents) from the Hanford LAW. The process is designed to produce a decontaminated waste stream and a concentrated eluate waste stream for vitrification into low and high activity glasses, respectively
Energy Technology Data Exchange (ETDEWEB)
Murguia-Berthier, Ariadna; Ramirez-Ruiz, Enrico; Antoni, Andrea; Macias, Phillip [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); MacLeod, Morgan, E-mail: armurgui@ucsc.edu [School of Natural Sciences, Institute for Advanced Study, 1 Einstein Drive, Princeton, NJ 08540 (United States)
2017-08-20
During a common envelope (CE) episode in a binary system, the engulfed companion spirals to tighter orbital separations under the influence of drag from the surrounding envelope material. As this object sweeps through material with a steep radial gradient of density, net angular momentum is introduced into the flow, potentially leading to the formation of an accretion disk. The presence of a disk would have dramatic consequences for the outcome of the interaction because accretion might be accompanied by strong, polar outflows with enough energy to unbind the entire envelope. Without a detailed understanding of the necessary conditions for disk formation during CE, therefore, it is difficult to accurately predict the population of merging compact binaries. This paper examines the conditions for disk formation around objects embedded within CEs using the “wind tunnel” formalism developed by MacLeod et al. We find that the formation of disks is highly dependent on the compressibility of the envelope material. Disks form only in the most compressible of stellar envelope gas, found in envelopes’ outer layers in zones of partial ionization. These zones are largest in low-mass stellar envelopes, but comprise small portions of the envelope mass and radius in all cases. We conclude that disk formation and associated accretion feedback in CE is rare, and if it occurs, transitory. The implication for LIGO black hole binary assembly is that by avoiding strong accretion feedback, CE interactions should still result in the substantial orbital tightening needed to produce merging binaries.
International Nuclear Information System (INIS)
Carlson, J.G.
1989-01-01
Repeated microscopic observations of exponentially growing Chinese hamster ovary cells were made and the times and mitotic stages were recorded in control and irradiated cultures at 37 degree C. As determined by autoradiography, the time from the end of S phase to early prophase (the G2 phase) was 46 min, to breakdown of the nuclear envelope was 91 min, and to restoration of the nuclear envelope was 116 min. The time spent in morphologically distinguishable phases of mitosis and the effects of 0.5, 1.0, 1.5, 2.0, and 4.0 Gy of gamma or X radiation on cells at each phase were determined. Affected cells were found to be delayed without or with reversion to an earlier mitotic stage before recovering and advancing through mitosis. Cells were timed in the five steps comprising delay with reversion: inertia, cessation I, regression, cessation II, and reprogression. No cells treated in late prophase, i.e., within 8-10 min of nuclear envelope breakdown, were delayed by the doses used; therefore the critical or transition point must be situated in middle prophase. Cells irradiated in this stage were not delayed by 0.5 or 1.0 Gy, but suffered a dose-dependent delay with or without reversion after 1.5, 2.0, and 4.0 Gy. Cells irradiated in early prophase and very late interphase responded similarly, but a greater percentage of the latter reverted
Ben-Shoshan, Shirley Oren; Simon, Amos J; Jacob-Hirsch, Jasmine; Shaklai, Sigal; Paz-Yaacov, Nurit; Amariglio, Ninette; Rechavi, Gideon; Trakhtenbrot, Luba
2014-01-28
Polyploidy has been recognized for many years as an important hallmark of cancer cells. Polyploid cells can arise through cell fusion, endoreplication and abortive cell cycle. The inner nuclear membrane protein LAP2β plays key roles in nuclear envelope breakdown and reassembly during mitosis, initiation of replication and transcriptional repression. Here we studied the function of LAP2β in the maintenance of cell ploidy state, a role which has not yet been assigned to this protein. By knocking down the expression of LAP2β, using both viral and non-viral RNAi approaches in osteosarcoma derived U2OS cells, we detected enlarged nuclear size, nearly doubling of DNA content and chromosomal duplications, as analyzed by fluorescent in situ hybridization and spectral karyotyping methodologies. Spectral karyotyping analyses revealed that near-hexaploid karyotypes of LAP2β knocked down cells consisted of not only seven duplicated chromosomal markers, as could be anticipated by genome duplication mechanism, but also of four single chromosomal markers. Furthermore, spectral karyotyping analysis revealed that both of two near-triploid U2OS sub-clones contained the seven markers that were duplicated in LAP2β knocked down cells, whereas the four single chromosomal markers were detected only in one of them. Gene expression profiling of LAP2β knocked down cells revealed that up to a third of the genes exhibiting significant changes in their expression are involved in cancer progression. Our results suggest that nuclear fusion mechanism underlies the polyploidization induction upon LAP2β reduced expression. Our study implies on a novel role of LAP2β in the maintenance of cell ploidy status. LAP2β depleted U2OS cells can serve as a model to investigate polyploidy and aneuploidy formation by nuclear fusion mechanism and its involvement in cancerogenesis.
Equivariant calculus in the differential envelope
Energy Technology Data Exchange (ETDEWEB)
Kastler, D. (Centre National de la Recherche Scientifique, 13 - Marseille (France). Centre de Physique Theorique)
1991-01-01
The author shows how Z/2-graded cyclic cohomology is related to the equivariant calculus of S. Klimek, W. Kondracki, and A. Lesniewski (HUTMP 90/B247 (1990)). He uses the differential envelope of a complex unital differential algebra. After a presentation of fiber-preserved operators on equivariant functions valued in this algebra on a group he considers certain operators on this algebra. Finally he discusses explicitly the case G=Z/2. (HSI).
Equivariant calculus in the differential envelope
International Nuclear Information System (INIS)
Kastler, D.
1991-01-01
The author shows how Z/2-graded cyclic cohomology is related to the equivariant calculus of S. Klimek, W. Kondracki, and A. Lesniewski (HUTMP 90/B247 (1990)). He uses the differential envelope of a complex unital differential algebra. After a presentation of fiber-preserved operators on equivariant functions valued in this algebra on a group he considers certain operators on this algebra. Finally he discusses explicitly the case G=Z/2. (HSI)
TEMPERATURE FIELDS IN THE ZONE OF CONNECTION BETWEEN WINDOW AND BUILDING ENVELOPE
V. V. Ivanov; A. N. Butenko; L. V. Karaseva
2011-01-01
Problem statement. To determine additional heat losses through window opening slopes, it is ne-cessary to calculate temperature fields of a wall in the zone of connection between window and building envelope. Two types of building envelopes are considered: solid brick wall and two-layer-wall of bricks and fiber foam concrete block interlayered with air.Results. The results obtained show the influence of a window on the temperature field of wall opening. Different types of wall structures are ...
Reuse and Upcycling of Municipal Waste for ZEB Envelope Design in European Urban Areas
Directory of Open Access Journals (Sweden)
Elisa Pennacchia
2016-06-01
Full Text Available Building energy efficiency and urban waste management are two focal issues for improving environmental status and reducing greenhouse gas emissions. The main aim of this paper is to compare economic costs of new building envelope structures designed by authors reusing and upcycling municipal waste in order to decrease energy demand from the building sector and, at the same time, improve eco-friendly waste management at the local scale. The reuse of waste for building envelope structures is one of the main principles of the Earthship buildings model, based on the use of passive solar principles in autonomous earth-sheltered homes. This Earthship principle has been analyzed in order to optimize buildings’ energy performance and reuse municipal waste for new building envelope structures in urban areas. Indeed, the elaborated structures have been designed for urban contexts, with the aim of reuse waste coming from surrounding landfills. The methods include an analysis of thermal performance of urban waste for designing new building envelope structures realized by assembling waste and isolating materials not foreseen in Earthship buildings. The reused materials are: cardboard tubes, automobile tires, wood pallets, and plastic and glass bottles. Finally, comparing economic costs of these new building envelope structures, the obtained results highlight their economic feasibility compared to a traditional structure with similar thermal transmittance.
DEFF Research Database (Denmark)
Bianchi, Federica; Santurette, Sébastien; Fereczkowski, Michal
2015-01-01
Recent physiological studies in animals showed that noise-induced sensorineural hearing loss (SNHL) increased the amplitude of envelope coding in single auditory-nerve fibers. The present study investigated whether SNHL in human listeners was associated with enhanced temporal envelope coding...... resolvability. For the unresolved conditions, all five HI listeners performed as good as or better than NH listeners with matching musical experience. Two HI listeners showed lower amplitude-modulation detection thresholds than NH listeners for low modulation rates, and one of these listeners also showed a loss......, whether this enhancement affected pitch discrimination performance, and whether loss of compression following SNHL was a potential factor in envelope coding enhancement. Envelope processing was assessed in normal-hearing (NH) and hearing-impaired (HI) listeners in a behavioral amplitude...
Advanced Envelope Research for Factory Built Housing, Phase 3. Design Development and Prototyping
Energy Technology Data Exchange (ETDEWEB)
Levy, E. [ARIES Collaborative, New York, NY (United States); Kessler, B. [ARIES Collaborative, New York, NY (United States); Mullens, M. [ARIES Collaborative, New York, NY (United States); Rath, P. [ARIES Collaborative, New York, NY (United States)
2014-01-01
The Advanced Envelope Research effort will provide factory homebuilders with high performance, cost-effective alternative envelope designs. In the near term, these technologies will play a central role in meeting stringent energy code requirements. For manufactured homes, the thermal requirements, last updated by statute in 1994, will move up to the more rigorous IECC 2012 levels in 2013, the requirements of which are consistent with site built and modular housing. This places added urgency on identifying envelope technologies that the industry can implement in the short timeframe. The primary goal of this research is to develop wall designs that meet the thermal requirements based on 2012 IECC standards. Given the affordable nature of manufactured homes, impact on first cost is a major consideration in developing the new envelope technologies. This work is part of a four-phase, multi-year effort. Phase 1 identified seven envelope technologies and provided a preliminary assessment of three selected methods for building high performance wall systems. Phase 2 focused on the development of viable product designs, manufacturing strategies, addressing code and structural issues, and cost analysis of the three selected options. An industry advisory committee helped critique and select the most viable solution to move further in the research -- stud walls with continuous exterior insulation. Phase 3, the subject of the current report, focused on the design development of the selected wall concept and explored variations on the use of exterior foam insulation. The scope also included material selection, manufacturing and cost analysis, and prototyping and testing.
Advanced Envelope Research for Factory Built Housing, Phase 3 -- Design Development and Prototyping
Energy Technology Data Exchange (ETDEWEB)
Levy, E. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Kessler, B. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mullens, M. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Rath, P. [National Renewable Energy Lab. (NREL), Golden, CO (United States)
2014-01-01
The Advanced Envelope Research effort will provide factory homebuilders with high performance, cost-effective alternative envelope designs. In the near term, these technologies will play a central role in meeting stringent energy code requirements. For manufactured homes, the thermal requirements, last updated by statute in 1994, will move up to the more rigorous IECC 2012 levels in 2013, the requirements of which are consistent with site built and modular housing. This places added urgency on identifying envelope technologies that the industry can implement in the short timeframe. The primary goal of this research is to develop wall designs that meet the thermal requirements based on 2012 IECC standards. Given the affordable nature of manufactured homes, impact on first cost is a major consideration in developing the new envelope technologies. This work is part of a four-phase, multi-year effort. Phase 1 identified seven envelope technologies and provided a preliminary assessment of three selected methods for building high performance wall systems. Phase 2 focused on the development of viable product designs, manufacturing strategies, addressing code and structural issues, and cost analysis of the three selected options. An industry advisory committee helped critique and select the most viable solution to move further in the research -- stud walls with continuous exterior insulation. Phase 3, the subject of the current report, focused on the design development of the selected wall concept and explored variations on the use of exterior foam insulation. The scope also included material selection, manufacturing and cost analysis, and prototyping and testing.
Innovative Danish Building Envelope Components for Passive Houses
DEFF Research Database (Denmark)
Tommerup, Henrik M.; Svendsen, Svend
2006-01-01
and in some cases very innovative envelope constructions. In this paper, two of the most interesting components are described; a prefabricated light-weight exterior wall element with a load-bearing plywood and steel frame and a foundation / slab on ground solution based on concrete and EPS insulation...
Directory of Open Access Journals (Sweden)
Eiden Maribeth V
2011-07-01
Full Text Available Abstract Background Over the last several decades it has been noted, using a variety of different methods, that cells infected by a specific gammaretrovirus are resistant to infection by other retroviruses that employ the same receptor; a phenomenon termed receptor interference. Receptor masking is thought to provide an earlier means of blocking superinfection, whereas receptor down regulation is generally considered to occur in chronically infected cells. Results We used replication-competent GFP-expressing viruses containing either an amphotropic murine leukemia virus (A-MLV or the gibbon ape leukemia virus (GALV envelope. We also constructed similar viruses containing fluorescence-labeled Gag proteins for the detection of viral particles. Using this repertoire of reagents together with a wide range of antibodies, we were able to determine the presence and availability of viral receptors, and detect viral envelope proteins and particles presence on the cell surface of chronically infected cells. Conclusions A-MLV or GALV receptors remain on the surface of chronically infected cells and are detectable by respective antibodies, indicating that these receptors are not downregulated in these infected cells as previously proposed. We were also able to detect viral envelope proteins on the infected cell surface and infected cells are unable to bind soluble A-MLV or GALV envelopes indicating that receptor binding sites are masked by endogenously expressed A-MLV or GALV viral envelope. However, receptor masking does not completely prevent A-MLV or GALV superinfection.
that Bind Specifically to Recombinant Envelope Protein of Dengue
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research June 2015; 14 (6): 997-1003 ... Revised accepted: 30 April 2015. Abstract ... Results: The 45 KDa, 43 KDa and 30 KDa plasma membrane proteins were identified as viral envelope targets.
Characterization of Simulant LAW Envelope A, B, and C with Glass Formers
International Nuclear Information System (INIS)
Hansen, E.K.
2000-01-01
The River Protection Project-Waste Treatment Plant (RPP-WPT) pretreatment and immobilization processes being developed by the DOE Office of River Protection will decontaminate High Level Waste (HLW) Envelopes A and B supernates using crossflow filtration followed by cesium and technetium ion exchange. Envelope C will undergo Sr/TRU precipitation prior to filtration to remove chelated actinides. The decontaminated supernates, now called low activity waste (LAW), will be concentrated through the LAW Melter Feed Evaporator. The concentrated LAW Melter Feed will be mixed with glass forming minerals and chemicals in an in the LAW Melter Feed Preparation Tank. The resulting slurry is then transferred to a Melter Feed Tank from which it is fed to one of the joule-heated, refractory-lined melters. Characterization of the melter feed slurry is required to complete the design of the RPP-WPT slurry feed systems. This report discusses the results obtained from the task, ''Bench Scale Mixing - Characterization of Simulant LAW Envelope A (AN105), B (AZ101), and C (AN107) With Glass Formers''. This task characterized the physical and chemical properties (rheology, particle size, weight percent soluble and insoluble solids, and chemical composition) of simulated LAW Melter feeds made from the different envelopes mentioned above. The goal of this task was to provide data for the design of the RPP-WPT Melter feed system
International Nuclear Information System (INIS)
Lazarian, A.; Esquivel, A.; Crutcher, R.
2012-01-01
Recent observational results for magnetic fields in molecular clouds reviewed by Crutcher seem to be inconsistent with the predictions of the ambipolar diffusion theory of star formation. These include the measured decrease in mass to flux ratio between envelopes and cores, the failure to detect any self-gravitating magnetically subcritical clouds, the determination of the flat probability distribution function (PDF) of the total magnetic field strengths implying that there are many clouds with very weak magnetic fields, and the observed scaling B∝ρ 2/3 that implies gravitational contraction with weak magnetic fields. We consider the problem of magnetic field evolution in turbulent molecular clouds and discuss the process of magnetic field diffusion mediated by magnetic reconnection. For this process that we termed 'reconnection diffusion', we provide a simple physical model and explain that this process is inevitable in view of the present-day understanding of MHD turbulence. We address the issue of the expected magnetization of cores and envelopes in the process of star formation and show that reconnection diffusion provides an efficient removal of magnetic flux that depends only on the properties of MHD turbulence in the core and the envelope. We show that as the amplitude of turbulence as well as the scale of turbulent motions decrease from the envelope to the core of the cloud, the diffusion of the magnetic field is faster in the envelope. As a result, the magnetic flux trapped during the collapse in the envelope is being released faster than the flux trapped in the core, resulting in much weaker fields in envelopes than in cores, as observed. We provide simple semi-analytical model calculations which support this conclusion and qualitatively agree with the observational results. Magnetic reconnection is also consistent with the lack of subcritical self-gravitating clouds, with the observed flat PDF of field strengths, and with the scaling of field strength
Energy Technology Data Exchange (ETDEWEB)
Lazarian, A. [Astronomy Department, University of Wisconsin, Madison, WI 53706 (United States); Esquivel, A. [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-543, 04510 Mexico D.F. (Mexico); Crutcher, R. [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 W. Green Street, Urbana, IL 61801 (United States)
2012-10-01
Recent observational results for magnetic fields in molecular clouds reviewed by Crutcher seem to be inconsistent with the predictions of the ambipolar diffusion theory of star formation. These include the measured decrease in mass to flux ratio between envelopes and cores, the failure to detect any self-gravitating magnetically subcritical clouds, the determination of the flat probability distribution function (PDF) of the total magnetic field strengths implying that there are many clouds with very weak magnetic fields, and the observed scaling B{proportional_to}{rho}{sup 2/3} that implies gravitational contraction with weak magnetic fields. We consider the problem of magnetic field evolution in turbulent molecular clouds and discuss the process of magnetic field diffusion mediated by magnetic reconnection. For this process that we termed 'reconnection diffusion', we provide a simple physical model and explain that this process is inevitable in view of the present-day understanding of MHD turbulence. We address the issue of the expected magnetization of cores and envelopes in the process of star formation and show that reconnection diffusion provides an efficient removal of magnetic flux that depends only on the properties of MHD turbulence in the core and the envelope. We show that as the amplitude of turbulence as well as the scale of turbulent motions decrease from the envelope to the core of the cloud, the diffusion of the magnetic field is faster in the envelope. As a result, the magnetic flux trapped during the collapse in the envelope is being released faster than the flux trapped in the core, resulting in much weaker fields in envelopes than in cores, as observed. We provide simple semi-analytical model calculations which support this conclusion and qualitatively agree with the observational results. Magnetic reconnection is also consistent with the lack of subcritical self-gravitating clouds, with the observed flat PDF of field strengths, and
3+1 dimensional envelop waves and its stability in magnetized dusty plasma
International Nuclear Information System (INIS)
Duan Wenshan
2006-01-01
It is well known that there are envelope solitary waves in unmagnetized dusty plasmas which are described by a nonlinear Schrodinger equation (NLSE). A three dimension nonlinear Schrodinger equation for small but finite amplitude dust acoustic waves is first obtained for magnetized dusty plasma in this paper. It suggest that in magnetized dusty plasmas the envelope solitary waves exist. The modulational instability for three dimensional NLSE is studied as well. The regions of stability and instability are well determined in this paper
Expansion of the HMX-1 Flight Envelope With the EDU-5/P Laser Eye Protection Spectacles
National Research Council Canada - National Science Library
Penhallegon, William
2004-01-01
The purpose of this testing was to determine if the day operations envelope should be expanded to include takeoffs and landings, whether the night operations envelope should he expanded in the VH-6ON...
Jurco, B; Jurco, B; Schlieker, M
1995-01-01
In this paper we construct explicitly natural (from the geometrical point of view) Fock space representations (contragradient Verma modules) of the quantized enveloping algebras. In order to do so, we start from the Gauss decomposition of the quantum group and introduce the differential operators on the corresponding q-deformed flag manifold (asuumed as a left comodule for the quantum group) by a projection to it of the right action of the quantized enveloping algebra on the quantum group. Finally, we express the representatives of the elements of the quantized enveloping algebra corresponding to the left-invariant vector fields on the quantum group as first-order differential operators on the q-deformed flag manifold.
Directory of Open Access Journals (Sweden)
Hsin-Wei Chen
Full Text Available Dengue is the leading cause of mosquito-borne viral infections and no vaccine is available now. Envelope protein domain III (ED3 is the major target for the binding of dengue virus neutralizing antibodies; however, the ED3-specifc T-cell response is less well understood. To investigate the T-cell responses to four serotypes of dengue virus (DENV-1 to 4, we immunized mice using either a tetravalent ED3-based DNA or protein vaccine, or combined both as a DNA prime-protein boost strategy (prime-boost. A significant serotype-dependent IFN-γ or IL-4 response was observed in mice immunized with either the DNA or protein vaccine. The IFN-γ response was dominant to DENV-1 to 3, whereas the IL-4 response was dominant to DENV-4. Although the similar IgG titers for the four serotypes were observed in mice immunized with the tetravalent vaccines, the neutralizing antibody titers varied and followed the order of 2 = 3>1>4. Interestingly, the lower IFN-γ response to DENV-4 is attributable to the immunodominance change between two CD4+ T-cell epitopes; one T-cell epitope located at E349-363 of DENV-1 to 3 was more immunogenic than the DENV-4 epitope E313-327. Despite DENV-4 specific IFN-γ responses were suppressed by immunodominance change, either DENV-4-specific IFN-γ or neutralizing antibody responses were still recalled after DENV-4 challenge and contributed to virus clearance. Immunization with the prime-boost elicited both IFN-γ and neutralizing antibody responses and provided better protection than either DNA or protein immunization. Our findings shed light on how ED3-based tetravalent dengue vaccines sharpen host CD4 T-cell responses and contribute to protection against dengue virus.
Maric, Martina; Haugo, Alison C; Dauer, William; Johnson, David; Roller, Richard J
2014-07-01
Herpesvirus infection reorganizes components of the nuclear lamina usually without loss of integrity of the nuclear membranes. We report that wild-type HSV infection can cause dissolution of the nuclear envelope in transformed mouse embryonic fibroblasts that do not express torsinA. Nuclear envelope breakdown is accompanied by an eight-fold inhibition of virus replication. Breakdown of the membrane is much more limited during infection with viruses that lack the gB and gH genes, suggesting that breakdown involves factors that promote fusion at the nuclear membrane. Nuclear envelope breakdown is also inhibited during infection with virus that does not express UL34, but is enhanced when the US3 gene is deleted, suggesting that envelope breakdown may be enhanced by nuclear lamina disruption. Nuclear envelope breakdown cannot compensate for deletion of the UL34 gene suggesting that mixing of nuclear and cytoplasmic contents is insufficient to bypass loss of the normal nuclear egress pathway. Copyright © 2014 Elsevier Inc. All rights reserved.
Protein composition of the hepatitis A virus quasi-envelope.
McKnight, Kevin L; Xie, Ling; González-López, Olga; Rivera-Serrano, Efraín E; Chen, Xian; Lemon, Stanley M
2017-06-20
The Picornaviridae are a diverse family of RNA viruses including many pathogens of medical and veterinary importance. Classically considered "nonenveloped," recent studies show that some picornaviruses, notably hepatitis A virus (HAV; genus Hepatovirus) and some members of the Enterovirus genus, are released from cells nonlytically in membranous vesicles. To better understand the biogenesis of quasi-enveloped HAV (eHAV) virions, we conducted a quantitative proteomics analysis of eHAV purified from cell-culture supernatant fluids by isopycnic ultracentrifugation. Amino acid-coded mass tagging (AACT) with stable isotopes followed by tandem mass spectrometry sequencing and AACT quantitation of peptides provided unambiguous identification of proteins associated with eHAV versus unrelated extracellular vesicles with similar buoyant density. Multiple peptides were identified from HAV capsid proteins (53.7% coverage), but none from nonstructural proteins, indicating capsids are packaged as cargo into eHAV vesicles via a highly specific sorting process. Other eHAV-associated proteins ( n = 105) were significantly enriched for components of the endolysosomal system (>60%, P hepatitis A. No LC3-related peptides were identified by mass spectrometry. RNAi depletion studies confirmed that ESCRT-III proteins, particularly CHMP2A, function in eHAV biogenesis. In addition to identifying surface markers of eHAV vesicles, the results support an exosome-like mechanism of eHAV egress involving endosomal budding of HAV capsids into multivesicular bodies.
An Assessment of Envelope Measures in Mild Climate Deep Energy Retrofits
Energy Technology Data Exchange (ETDEWEB)
Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Less, Brennan [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)
2014-06-01
Energy end-uses and interior comfort conditions have been monitored in 11 Deep Energy Retrofits (DERs) in a mild marine climate. Two broad categories of DER envelope were identified: first, bringing homes up to current code levels of insulation and airtightness, and second, enhanced retrofits that go beyond these code requirements. The efficacy of envelope measures in DERs was difficult to determine, due to the intermingled effects of enclosure improvements, HVAC system upgrades and changes in interior comfort conditions. While energy reductions in these project homes could not be assigned to specific improvements, the combined effects of changes in enclosure, HVAC system and comfort led to average heating energy reductions of 76percent (12,937 kWh) in the five DERs with pre-retrofit data, or 80percent (5.9 kWh/ft2) when normalized by floor area. Overall, net-site energy reductions averaged 58percent (15,966 kWh; n=5), and DERs with code-style envelopes achieved average net-site energy reductions of 65percent (18,923 kWh; n=4). In some homes, the heating energy reductions were actually larger than the whole house reductions that were achieved, which suggests that substantial additional energy uses were added to the home during the retrofit that offset some heating savings. Heating system operation and energy use was shown to vary inconsistently with outdoor conditions, suggesting that most DERs were not thermostatically controlled and that occupants were engaged in managing the indoor environmental conditions. Indoor temperatures maintained in these DERs were highly variable, and no project home consistently provided conditions within the ASHRAE Standard 55-2010 heating season comfort zone. Thermal comfort and heating system operation had a large impact on performance and were found to depend upon the occupant activities, so DERs should be designed with the occupants needs and patterns of consumption in mind. Beyond-code building envelopes were not found to be
Kates, James M; Arehart, Kathryn H
2015-10-01
This paper uses mutual information to quantify the relationship between envelope modulation fidelity and perceptual responses. Data from several previous experiments that measured speech intelligibility, speech quality, and music quality are evaluated for normal-hearing and hearing-impaired listeners. A model of the auditory periphery is used to generate envelope signals, and envelope modulation fidelity is calculated using the normalized cross-covariance of the degraded signal envelope with that of a reference signal. Two procedures are used to describe the envelope modulation: (1) modulation within each auditory frequency band and (2) spectro-temporal processing that analyzes the modulation of spectral ripple components fit to successive short-time spectra. The results indicate that low modulation rates provide the highest information for intelligibility, while high modulation rates provide the highest information for speech and music quality. The low-to-mid auditory frequencies are most important for intelligibility, while mid frequencies are most important for speech quality and high frequencies are most important for music quality. Differences between the spectral ripple components used for the spectro-temporal analysis were not significant in five of the six experimental conditions evaluated. The results indicate that different modulation-rate and auditory-frequency weights may be appropriate for indices designed to predict different types of perceptual relationships.
Towards Energy Demand Reduction in Social Housing Buildings: Envelope System Optimization Strategies
Directory of Open Access Journals (Sweden)
Paula M. Esquivias
2012-07-01
Full Text Available This work evaluates the potential for the reduction of energy demand in residential buildings by acting on the exterior envelope, both in newly constructed buildings and in the retrofitting of existing stock. It focuses on analysing social housing buildings in Mediterranean areas and on quantifying the scope of that reduction in the application of different envelope design strategies, with the purpose of prioritizing their application based on their energy efficiency. The analyses and quantifications were made by means of the generation of energy models with the TRNSYS tool for simple or combined solutions, identifying possible potentials for reduction of the energy demand from 20% to 25%, basically by acting on the windows. The case study was a newly built social housing building of a closed block type located in Seville (Spain. Its constructive techniques and the insulation level of its envelope are standardized for current buildings widespread across Mediterranean Europe.
Envelope matching for enhanced backward Raman amplification by using self-ionizing plasmas
International Nuclear Information System (INIS)
Zhang, Z. M.; Zhang, B.; Hong, W.; Teng, J.; He, S. K.; Gu, Y. Q.; Yu, M. Y.
2014-01-01
Backward Raman amplification (BRA) in plasmas has been promoted as a means for generating ultrapowerful laser pulses. For the purpose of achieving the maximum intensities over the shortest distances, an envelope matching between the seed pulse and the amplification gain is required, i.e., the seed pulse propagates at the same velocity with the gain such that the peak of the seed pulse can always enjoy the maximum gain. However, such an envelope matching is absent in traditional BRA because in the latter the amplification gain propagates at superluminous velocity while the seed pulse propagates at the group velocity, which is less than the speed of light. It is shown here that, by using self-ionizing plasmas, the speed of the amplification gain can be well reduced to reach the envelope matching regime. This results in a favorable BRA process, in which higher saturated intensity, shorter interaction length and higher energy-transfer efficiency are achieved
The excess infrared emission of Herbig Ae/Be stars - Disks or envelopes?
Hartmann, Lee; Kenyon, Scott J.; Calvet, Nuria
1993-01-01
It is suggested that the near-IR emission in many Herbig Ae/Be stars arises in surrounding dusty envelopes, rather than circumstellar disks. It is shown that disks around Ae/Be stars are likely to remain optically thick at the required accretion rates. It is proposed that the IR excesses of many Ae/Be stars originate in surrounding dust nebulae instead of circumstellar disks. It is suggested that the near-IR emission of the envelope is enhanced by the same processes that produce anomalous strong continuum emission at temperatures of about 1000 K in reflection nebulae surrounding hot stars. This near-IR emission could be due to small grains transiently heated by UV photons. The dust envelopes could be associated with the primary star or a nearby companion star. Some Ae/Be stars show evidence for the 3.3-6.3-micron emission features seen in reflection nebulae around hot stars, which lends further support to this suggestion.
Structural insights into SUN-KASH complexes across the nuclear envelope
Institute of Scientific and Technical Information of China (English)
Wenjia Wang; Zhaocai Zhou; Zhubing Shi; Shi Jiao; Cuicui Chen; Huizhen Wang; Guoguang Liu; Qiang Wang; Yun Zhao; Mark I Greene
2012-01-01
Linker of the nucleoskeleton and the cytoskeleton (LINC) complexes are composed of SUN and KASH domaincontaining proteins and bridge the inner and outer membranes of the nuclear envelope.LINC complexes play critical roles in nuclear positioning,cell polarization and cellular stiffness.Previously,we reported the homotrimeric structure of human SUN2.We have now determined the crystal structure of the human SUN2-KASH complex.In the complex structure,the SUN domain homotrimer binds to three independent "hook"-like KASH peptides.The overall conformation of the SUN domain in the complex closely resembles the SUN domain in its apo state.A major conformational change involves the AA'-loop of KASH-bound SUN domain,which rearranges to form a mini β-sheet that interacts with the KASH peptide.The PPPT motif of the KASH domain fits tightly into a hydrophobic pocket on the homotrimeric interface of the SUN domain,which we termed the BI-pocket.Moreover,two adjacent protomers of the SUN domain homotrimer sandwich the KASH domain by hydrophobic interaction and hydrogen bonding.Mutations of these binding sites disrupt or reduce the association between the SUN and KASH domains in vitro.In addition,transfection of wild-type,but not mutant,SUN2 promotes cell migration in Ovcar-3 cells.These results provide a structural model of the LINC complex,which is essential for additional study of the physical and functional coupling between the cytoplasm and the nucleoplasm.
Bellanca building, Yellowknife : building envelope retrofit project
Energy Technology Data Exchange (ETDEWEB)
Rajewski, G. [A.D. Williams Engineering Inc., Edmonton, AB (Canada)
2008-07-01
The Bellanca building is a ten-story, commercial office building, located in Yellowknife, Northwest Territories. The owner was concerned about annual fuel consumption, relative to other buildings of similar size. Tenants reported cold drafts and some ice build-up had been reported in the past, on the exterior of the cladding. In addition, some water penetration had occurred during rainfall. This presentation provided background information on the Bellanca building and discussed a building envelope retrofit project. A.D. Williams was hired in late 2006 in order to provide an opinion on the present condition of the building envelope. This presentation described the site investigation and presented an interior and exterior review of the building. It also presented a thermographic survey in order to map thermal anomalies and establish trends. Following acceptance of the report on findings, one of five options was selected for further development. This included removal of existing cladding, exterior gypsum wallboard, fiberglass insulation and application of BASF Walltite CT foam, sheathing, rigid insulation, drainage plane and new cladding. The preliminary design was then presented. This paper also described the tender and award of the contract; construction phase; and substantial completion of the project. tabs, figs.
Tyre-road contact using a particle-envelope surface model
Pinnington, Roger J.
2013-12-01
Determination of the contact forces is the central problem in all aspects of road-tyre interaction: i.e. noise, energy loss and friction. A procedure to find the contact forces under a rolling tyre is presented in four stages. First, the contact stiffness of a uniform peak array from indentations in the rubber tread, and also tyre carcass deflection, is described by some new simplified expressions. Second, a routine divides a single surface profile into equal search intervals, in which the highest peaks are identified. These are used to obtain the parameters for the interval, i.e. the mean envelope and the mean interval. The process is repeated at geometrically decreasing search intervals until the level of the data resolution, thereby describing the profile by a set of envelopes. The ‘strip profile’ ultimately used to describe the surface, is obtained by selecting the highest points across the profiles of one stone's width. The third stage is to combine the strip profile envelopes with the contact stiffness expressions, yielding the nonlinear stiffness-displacement, and force-displacement relationships for the chosen road-tyre combination. Finally the contact pressure distribution from a steady-state rolling tyre model is applied to the strip profile, via the force-displacement relationship, giving the local tyre displacements on the road texture. This displacement pattern is shown to be proportional to the time and space varying contact pressure, which then is incorporated into a wave equation for rolling contact.
Direct observation of nanoparticle-cancer cell nucleus interactions.
Dam, Duncan Hieu M; Lee, Jung Heon; Sisco, Patrick N; Co, Dick T; Zhang, Ming; Wasielewski, Michael R; Odom, Teri W
2012-04-24
We report the direct visualization of interactions between drug-loaded nanoparticles and the cancer cell nucleus. Nanoconstructs composed of nucleolin-specific aptamers and gold nanostars were actively transported to the nucleus and induced major changes to the nuclear phenotype via nuclear envelope invaginations near the site of the construct. The number of local deformations could be increased by ultrafast, light-triggered release of the aptamers from the surface of the gold nanostars. Cancer cells with more nuclear envelope folding showed increased caspase 3 and 7 activity (apoptosis) as well as decreased cell viability. This newly revealed correlation between drug-induced changes in nuclear phenotype and increased therapeutic efficacy could provide new insight for nuclear-targeted cancer therapy.
Solti, Ádám; Kovács, Krisztina; Müller, Brigitta; Vázquez, Saúl; Hamar, Éva; Pham, Hong Diep; Tóth, Brigitta; Abadía, Javier; Fodor, Ferenc
2016-12-01
Based on the effects of inorganic salts on chloroplast Fe uptake, the presence of a voltage-dependent step is proposed to play a role in Fe uptake through the outer envelope. Although iron (Fe) plays a crucial role in chloroplast physiology, only few pieces of information are available on the mechanisms of chloroplast Fe acquisition. Here, the effect of inorganic salts on the Fe uptake of intact chloroplasts was tested, assessing Fe and transition metal uptake using bathophenantroline-based spectrophotometric detection and plasma emission-coupled mass spectrometry, respectively. The microenvironment of Fe was studied by Mössbauer spectroscopy. Transition metal cations (Cd 2+ , Zn 2+ , and Mn 2+ ) enhanced, whereas oxoanions (NO 3 - , SO 4 2- , and BO 3 3- ) reduced the chloroplast Fe uptake. The effect was insensitive to diuron (DCMU), an inhibitor of chloroplast inner envelope-associated Fe uptake. The inorganic salts affected neither Fe forms in the uptake assay buffer nor those incorporated into the chloroplasts. The significantly lower Zn and Mn uptake compared to that of Fe indicates that different mechanisms/transporters are involved in their acquisition. The enhancing effect of transition metals on chloroplast Fe uptake is likely related to outer envelope-associated processes, since divalent metal cations are known to inhibit Fe 2+ transport across the inner envelope. Thus, a voltage-dependent step is proposed to play a role in Fe uptake through the chloroplast outer envelope on the basis of the contrasting effects of transition metal cations and oxoaninons.
Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.
Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R
2016-02-19
Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV.
Morphology and Molecular Composition of Purified Bovine Viral Diarrhea Virus Envelope.
Directory of Open Access Journals (Sweden)
Nathalie Callens
2016-03-01
Full Text Available The family Flaviviridae includes viruses that have different virion structures and morphogenesis mechanisms. Most cellular and molecular studies have been so far performed with viruses of the Hepacivirus and Flavivirus genera. Here, we studied bovine viral diarrhea virus (BVDV, a member of the Pestivirus genus. We set up a method to purify BVDV virions and analyzed their morphology by electron microscopy and their protein and lipid composition by mass spectrometry. Cryo-electron microscopy showed near spherical viral particles displaying an electron-dense capsid surrounded by a phospholipid bilayer with no visible spikes. Most particles had a diameter of 50 nm and about 2% were larger with a diameter of up to 65 nm, suggesting some size flexibility during BVDV morphogenesis. Morphological and biochemical data suggested a low envelope glycoprotein content of BVDV particles, E1 and E2 being apparently less abundant than Erns. Lipid content of BVDV particles displayed a ~2.3 to 3.5-fold enrichment in cholesterol, sphingomyelin and hexosyl-ceramide, concomitant with a 1.5 to 5-fold reduction of all glycerophospholipid classes, as compared to lipid content of MDBK cells. Although BVDV buds in the endoplasmic reticulum, its lipid content differs from a typical endoplasmic reticulum membrane composition. This suggests that BVDV morphogenesis includes a mechanism of lipid sorting. Functional analyses confirmed the importance of cholesterol and sphingomyelin for BVDV entry. Surprisingly, despite a high cholesterol and sphingolipid content of BVDV envelope, E2 was not found in detergent-resistant membranes. Our results indicate that there are differences between the structure and molecular composition of viral particles of Flaviviruses, Pestiviruses and Hepaciviruses within the Flaviviridae family.
Development and applications of VSV vectors based on cell tropism
Directory of Open Access Journals (Sweden)
Hideki eTani
2012-01-01
Full Text Available Viral vectors have been available in various fields such as medical and biological research or gene therapy applications. Targeting vectors pseudotyped with distinct viral envelope proteins that influence cell tropism and transfection efficiency is a useful tool not only for examining entry mechanisms or cell tropisms but also for vaccine vector development. Vesicular stomatitis virus (VSV is an excellent candidate for development as a pseudotype vector. A recombinant VSV lacking its own envelope (G gene has been used to produce a pseudotype or recombinant VSV possessing the envelope proteins of heterologous viruses. These viruses possess a reporter gene instead of a VSV G gene in their genome, and therefore it is easy to evaluate their infectivity in the study of viral entry, including identification of viral receptors. Furthermore, advantage can be taken of a property of the pseudotype VSV, which is competence for single-round infection, in handling many different viruses that are either difficult to amplify in cultured cells or animals or that require specialized containment facilities. Here we describe procedures for producing pseudotype or recombinant VSVs and a few of the more prominent examples from among envelope viruses, such as hepatitis C virus, Japanese encephalitis virus, baculovirus, and hemorrhagic fever viruses.
Kostov, Veselin B.; Moore, Keavin; Tamayo, Daniel; Jayawardhana, Ray; Rinehart, Stephen A.
2016-01-01
Inspired by the recent Kepler discoveries of circumbinary planets orbiting nine close binary stars, we explore the fate of the former as the latter evolve off the main sequence. We combine binary star evolution models with dynamical simulations to study the orbital evolution of these planets as their hosts undergo common-envelope stages, losing in the process a tremendous amount of mass on dynamical timescales. Five of the systems experience at least one Roche-lobe overflow and common-envelope stages (Kepler-1647 experiences three), and the binary stars either shrink to very short orbits or coalesce; two systems trigger a double-degenerate supernova explosion. Kepler's circumbinary planets predominantly remain gravitationally bound at the end of the common-envelope phase, migrate to larger orbits, and may gain significant eccentricity; their orbital expansion can be more than an order of magnitude and can occur over the course of a single planetary orbit. The orbits these planets can reach are qualitatively consistent with those of the currently known post-common-envelope, eclipse-time variations circumbinary candidates. Our results also show that circumbinary planets can experience both modes of orbital expansion (adiabatic and non-adiabatic) if their host binaries undergo more than one common-envelope stage; multiplanet circumbinary systems like Kepler-47 can experience both modes during the same common-envelope stage. Additionally, unlike Mercury orbiting the Sun, a circumbinary planet with the same semi-major axis can survive the common envelope evolution of a close binary star with a total mass of 1 Solar Mass.
Directory of Open Access Journals (Sweden)
Ziegenfuss Jeanette Y
2012-03-01
Full Text Available Abstract Background Physician surveys are an important tool to assess attitudes, beliefs and self-reported behaviors of this policy relevant group. In order for a physician to respond to a mailed survey, they must first open the envelope. While there is some evidence that package elements can impact physician response rates, the impact of an envelope teaser is unknown. Here we assess this by testing the impact of adding a brightly colored "$25 incentive" sticker to the outside of an envelope on response rates and nonresponse bias in a survey of physicians. Methods In the second mailing of a survey assessing physicians' moral beliefs and views on controversial health care topics, initial nonrespondents were randomly assigned to receive a survey in an envelope with a colored "$25 incentive" sticker (teaser group or an envelope without a sticker (control group. Response rates were compared between the teaser and control groups overall and by age, gender, region of the United States, specialty and years in practice. Nonresponse bias was assessed by comparing the demographic composition of the respondents to the nonrespondents in the experimental and control condition. Results No significant differences in response rates were observed between the experimental and control conditions overall (p = 0.38 or after stratifying by age, gender, region, or practice type. Within the teaser condition, there was some variation in response rate by years since graduation. There was no independent effect of the teaser on response when simultaneously controlling for demographic characteristics (OR = 0.875, p = 0.4112. Conclusions Neither response rates nor nonresponse bias were impacted by the use of an envelope teaser in a survey of physicians in the United States.
Enveloped virus-like particles as vaccines against pathogenic arboviruses
Pijlman, G.P.
2015-01-01
Arthropod-borne arboviruses form a continuous threat to human and animal health, but few arboviral vaccines are currently available. Advances in expression technology for complex, enveloped virus-like particles (eVLPs) create new opportunities to develop potent vaccines against pathogenic
Measuring Eco-efficiency of Production with Data Envelopment Analysis
Kuosmanen, T.K.; Kortelainen, M.
2005-01-01
Aggregation of environmental pressures into a single environmental damage index is a major challenge of eco-efficiency measurement. This article examines how the data envelopment analysis (DEA) method can be adapted for this purpose. DEA accounts for substitution possibilities between different
Masking Release for Sweeping Masker Components with Correlated Envelopes
DEFF Research Database (Denmark)
Verhey, Jesko l.; Klein-Hennig, Hendrike; Epp, Bastian
2013-01-01
To separate sounds from different sound sources, common properties of natural sounds are used by the auditory system, such as coherent temporal envelope fluctuations and correlated changes of frequency in different frequency regions. The present study investigates how the auditory systemprocesses...