Compilation and analysis of Escherichia coli promoter DNA sequences.

OpenAIRE

Hawley, D K; McClure, W R

1983-01-01

The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

Functional analysis of bipartite begomovirus coat protein promoter sequences

International Nuclear Information System (INIS)

Lacatus, Gabriela; Sunter, Garry

2008-01-01

We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

Mammalian RNA polymerase II core promoters: insights from genome-wide studies

DEFF Research Database (Denmark)

Sandelin, Albin; Carninci, Piero; Lenhard, Boris

2007-01-01

The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

Science.gov (United States)

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

DEFF Research Database (Denmark)

Jensen, Peter Ruhdal; Hammer, Karin

1998-01-01

A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

Directory of Open Access Journals (Sweden)

R. Lakshmi

2016-06-01

Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

High Performance Systolic Array Core Architecture Design for DNA Sequencer

Directory of Open Access Journals (Sweden)

Saiful Nurdin Dayana

2018-01-01

Full Text Available This paper presents a high performance systolic array (SA core architecture design for Deoxyribonucleic Acid (DNA sequencer. The core implements the affine gap penalty score Smith-Waterman (SW algorithm. This time-consuming local alignment algorithm guarantees optimal alignment between DNA sequences, but it requires quadratic computation time when performed on standard desktop computers. The use of linear SA decreases the time complexity from quadratic to linear. In addition, with the exponential growth of DNA databases, the SA architecture is used to overcome the timing issue. In this work, the SW algorithm has been captured using Verilog Hardware Description Language (HDL and simulated using Xilinx ISIM simulator. The proposed design has been implemented in Xilinx Virtex -6 Field Programmable Gate Array (FPGA and improved in the core area by 90% reduction.

Effective Feature Selection for Classification of Promoter Sequences.

Directory of Open Access Journals (Sweden)

Kouser K

Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

Engineered Promoters for Potent Transient Overexpression.

Directory of Open Access Journals (Sweden)

Dan Y Even

Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

High-throughput sequencing of core STR loci for forensic genetic investigations using the Roche Genome Sequencer FLX platform

DEFF Research Database (Denmark)

Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rockenbauer, Eszter

2011-01-01

repeat units. These methods do not allow for the full resolution of STR base composition that sequencing approaches could provide. Here we present an STR profiling method based on the use of the Roche Genome Sequencer (GS) FLX to simultaneously sequence multiple core STR loci. Using this method...

Core damage frequency estimation using accident sequence precursor data: 1990-1993

International Nuclear Information System (INIS)

Martz, H.F.

1998-01-01

The Nuclear Regulatory Commission's (NRC's) ongoing Accident Sequence Precursor (ASP) program uses probabilistic risk assessment (PRA) techniques to assess the potential for severe core damage (henceforth referred to simply as core damage) based on operating events. The types of operating events considered include accident sequence initiators, safety equipment failures, and degradation of plant conditions that could increase the probability that various postulated accident sequences occur. Such operating events potentially reduce the margin of safety available for prevention of core damage an thus can be considered as precursors to core damage. The current process for identifying, analyzing, and documenting ASP events is described in detail in Vanden Heuval et al. The significance of a Licensee Event Report (LER) event (or events) is measured by means of the conditional probability that the event leads to core damage, the so-called conditional core damage probability or, simply, CCDP. When the first ASP study results were published in 1982, it covered the period 1969--1979. In addition to identification and ranking of precursors, the original study attempted to estimate core damage frequency (CDF) based on the precursor events. The purpose of this paper is to compare the average annual CDF estimates calculated using the CCDP sum, Cooke-Goossens, Bier, and Abramson estimators for various reactor classes using the combined ASP data for the four years, 1990--1993. An important outcome of this comparison is an answer to the persistent question regarding the degree and effect of the positive bias of the CCDP sum method in practice. Note that this paper only compares the estimators with each other. Because the true average CDF is unknown, the estimation error is also unknown. Therefore, any observations or characterizations of bias are based on purely theoretical considerations

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

The CompHP Core Competencies Framework for Health Promotion in Europe

Science.gov (United States)

Barry, Margaret M.; Battel-Kirk, Barbara; Dempsey, Colette

2012-01-01

Background: The CompHP Project on Developing Competencies and Professional Standards for Health Promotion in Europe was developed in response to the need for new and changing health promotion competencies to address health challenges. This article presents the process of developing the CompHP Core Competencies Framework for Health Promotion across…

Effect of promoter strength and signal sequence on the periplasmic ...

African Journals Online (AJOL)

Two plasmids, pFLAG-ATS and pET 26b(+), were studied for the periplasmic expression of recombinant human interferon-2b (IFN-2b) in Escherichia coli. The pFLAG-ATS contains ompA signal sequence and tac promoter while pET 26b(+) contains pelB signal sequence and T7lac promoter. It was observed that periplasmic ...

Location of core diagnostic information across various sequences in brain MRI and implications for efficiency of MRI scanner utilization.

Science.gov (United States)

Sharma, Aseem; Chatterjee, Arindam; Goyal, Manu; Parsons, Matthew S; Bartel, Seth

2015-04-01

Targeting redundancy within MRI can improve its cost-effective utilization. We sought to quantify potential redundancy in our brain MRI protocols. In this retrospective review, we aggregated 207 consecutive adults who underwent brain MRI and reviewed their medical records to document clinical indication, core diagnostic information provided by MRI, and its clinical impact. Contributory imaging abnormalities constituted positive core diagnostic information whereas absence of imaging abnormalities constituted negative core diagnostic information. The senior author selected core sequences deemed sufficient for extraction of core diagnostic information. For validating core sequences selection, four readers assessed the relative ease of extracting core diagnostic information from the core sequences. Potential redundancy was calculated by comparing the average number of core sequences to the average number of sequences obtained. Scanning had been performed using 9.4±2.8 sequences over 37.3±12.3 minutes. Core diagnostic information was deemed extractable from 2.1±1.1 core sequences, with an assumed scanning time of 8.6±4.8 minutes, reflecting a potential redundancy of 74.5%±19.1%. Potential redundancy was least in scans obtained for treatment planning (14.9%±25.7%) and highest in scans obtained for follow-up of benign diseases (81.4%±12.6%). In 97.4% of cases, all four readers considered core diagnostic information to be either easily extractable from core sequences or the ease to be equivalent to that from the entire study. With only one MRI lacking clinical impact (0.48%), overutilization did not seem to contribute to potential redundancy. High potential redundancy that can be targeted for more efficient scanner utilization exists in brain MRI protocols.

Development of Mycoplasma synoviae (MS) core genome multilocus sequence typing (cgMLST) scheme.

Science.gov (United States)

Ghanem, Mostafa; El-Gazzar, Mohamed

2018-05-01

Mycoplasma synoviae (MS) is a poultry pathogen with reported increased prevalence and virulence in recent years. MS strain identification is essential for prevention, control efforts and epidemiological outbreak investigations. Multiple multilocus based sequence typing schemes have been developed for MS, yet the resolution of these schemes could be limited for outbreak investigation. The cost of whole genome sequencing became close to that of sequencing the seven MLST targets; however, there is no standardized method for typing MS strains based on whole genome sequences. In this paper, we propose a core genome multilocus sequence typing (cgMLST) scheme as a standardized and reproducible method for typing MS based whole genome sequences. A diverse set of 25 MS whole genome sequences were used to identify 302 core genome genes as cgMLST targets (35.5% of MS genome) and 44 whole genome sequences of MS isolates from six countries in four continents were used for typing applying this scheme. cgMLST based phylogenetic trees displayed a high degree of agreement with core genome SNP based analysis and available epidemiological information. cgMLST allowed evaluation of two conventional MLST schemes of MS. The high discriminatory power of cgMLST allowed differentiation between samples of the same conventional MLST type. cgMLST represents a standardized, accurate, highly discriminatory, and reproducible method for differentiation between MS isolates. Like conventional MLST, it provides stable and expandable nomenclature, allowing for comparing and sharing the typing results between different laboratories worldwide. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

Science.gov (United States)

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-11

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

Asteroseismic measurement of surface-to-core rotation in a main-sequence star*

Directory of Open Access Journals (Sweden)

Kurtz Donald W.

2015-01-01

Full Text Available We have discovered rotationally split core g-mode triplets and surface p-mode triplets and quintuplets in a terminal age main-sequence A star, KIC 11145123, that shows both δ Sct p-mode pulsations and γ Dor g-mode pulsations. This gives the first robust determination of the rotation of the deep core and surface of a main-sequence star, essentially model-independently. We find its rotation to be nearly uniform with a period near 100 d, but we show with high confidence that the surface rotates slightly faster than the core. A strong angular momentum transfer mechanism must be operating to produce the nearly rigid rotation, and a mechanism other than viscosity must be operating to produce a more rapidly rotating surface than core. Our asteroseismic result, along with previous asteroseismic constraints on internal rotation in some B stars, and measurements of internal rotation in some subgiant, giant and white dwarf stars, has made angular momentum transport in stars throughout their lifetimes an observational science.

Training of adolescent multipliers from the perspective of health promotion core competencies

Directory of Open Access Journals (Sweden)

Kely Vanessa Leite Gomes da Silva

Full Text Available ABSTRACT Objective: Recognize the domains of health promotion core competencies in the training process of adolescents carried out by nursing students. Method: Qualitative and descriptive study, which used the theoretical methodological contribution Developing Competencies and Professional Standards for Health Promotion Capacity Building in Europe (CompHP, carried out with 14 nursing students. Results: There were four domains: Enable Change; Mediate through Partnership; Communication; and Leadership. These domains came from the interest and commitment of adolescents in intersectoral partnership, the use of communication techniques, and the role of facilitator to catalyze learning and empowerment. Conclusion: There were some domains of core competency in the training of adolescents, suggesting that nursing students act as health promoters. Challenges for Nursing are the implementation of a theoretical contribution of CompHP in undergraduate and ongoing training to carry out health promotion action.

Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

Science.gov (United States)

Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

2014-09-25

In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

Core promoter mutations 3 years after anti-hepatitis B e seroconversion in patients with chronic hepatitis B or hepatitis B and C infection and cancer remission.

Science.gov (United States)

Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe

2002-09-01

In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

Science.gov (United States)

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Unraveling Core Functional Microbiota in Traditional Solid-State Fermentation by High-Throughput Amplicons and Metatranscriptomics Sequencing

Directory of Open Access Journals (Sweden)

Zhewei Song

2017-07-01

Full Text Available Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces, and Zygosaccharomyces and lactic acid bacteria (genus Lactobacillus classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol to acid (lactic acid and acetic acid in Chinese Maotai-flavor liquor production. Our findings provide

Unraveling Core Functional Microbiota in Traditional Solid-State Fermentation by High-Throughput Amplicons and Metatranscriptomics Sequencing.

Science.gov (United States)

Song, Zhewei; Du, Hai; Zhang, Yan; Xu, Yan

2017-01-01

Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing) and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces , and Zygosaccharomyces ) and lactic acid bacteria (genus Lactobacillus ) classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol) production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid) production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol) to acid (lactic acid and acetic acid) in Chinese Maotai-flavor liquor production. Our findings provide insight into

Catalogue of generic plant states leading to core melt in PWRs: includes appendix 1: detailed description of sequences leading to core melt

International Nuclear Information System (INIS)

1996-11-01

The Task Group on thermal-hydraulic system behaviour was given a mandate from PWG 2 on Coolant System-Behaviour with the approval of CSNI to deal with the topic of Accident Management. A writing group was set up to identify generic plant states leading to core melt for pressurized water reactors (PWR) and find 'possible approaches to accident management measures' (AM-Measures) for dealing with them. From a matrix of 15 initiating events and 12 system failures (i.e. from 180 possibilities), 32 event sequences have been identified as leading to core melt. Each sequence has been divided into characteristic plant state intervals according to safety function challenges. For each of the 141 defined characteristic plant state intervals, the members of the Writing Group made proposals for AM-Measures

Genome-wide mapping of autonomous promoter activity in human cells.

Science.gov (United States)

van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

2017-02-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

OpenAIRE

W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

2017-01-01

The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

OpenAIRE

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-01

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

Rational Diversification of a Promoter Providing Fine-Tuned Expression and Orthogonal Regulation for Synthetic Biology

Science.gov (United States)

Blount, Benjamin A.; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

2012-01-01

Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex “multi-wire” logic functions. PMID:22442681

Rational diversification of a promoter providing fine-tuned expression and orthogonal regulation for synthetic biology.

Science.gov (United States)

Blount, Benjamin A; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

2012-01-01

Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex "multi-wire" logic functions.

Genome-wide analysis of promoter architecture in Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

Evaluation of the Abbott realtime HCV genotype II RUO (GT II) assay with reference to 5'UTR, core and NS5B sequencing.

Science.gov (United States)

Mallory, Melanie A; Lucic, Danijela X; Sears, Mitchell T; Cloherty, Gavin A; Hillyard, David R

2014-05-01

HCV genotyping is a critical tool for guiding initiation of therapy and selecting the most appropriate treatment regimen. To evaluate the concordance between the Abbott GT II assay and genotyping by sequencing subregions of the HCV 5'UTR, core and NS5B. The Abbott assay was used to genotype 127 routine patient specimens and 35 patient specimens with unusual subtypes and mixed infection. Abbott results were compared to genotyping by 5'UTR, core and NS5B sequencing. Sequences were genotyped using the NCBI non-redundant database and the online genotyping tool COMET. Among routine specimens, core/NS5B sequencing identified 93 genotype 1s, 13 genotype 2s, 15 genotype 3s, three genotype 4s, two genotype 6s and one recombinant specimen. Genotype calls by 5'UTR, core, NS5B sequencing and the Abbott assay were 97.6% concordant. Core/NS5B sequencing identified two discrepant samples as genotype 6 (subtypes 6l and 6u) while Abbott and 5'UTR sequencing identified these samples as genotype 1 with no subtype. The Abbott assay subtyped 91.4% of genotype 1 specimens. Among the 35 rare specimens, the Abbott assay inaccurately genotyped 3k, 6e, 6o, 6q and one genotype 4 variant; gave indeterminate results for 3g, 3h, 4r, 6m, 6n, and 6q specimens; and agreed with core/NS5B sequencing for mixed specimens. The Abbott assay is an automated HCV genotyping method with improved accuracy over 5'UTR sequencing. Samples identified by the Abbott assay as genotype 1 with no subtype may be rare subtypes of other genotypes and thus require confirmation by another method. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation and sequencing analysis on the seed-specific promoter from soybean

Institute of Scientific and Technical Information of China (English)

CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

2007-01-01

The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

Partnership between CTSI and business schools can promote best practices for core facilities and resources.

Science.gov (United States)

Reeves, Lilith; Dunn-Jensen, Linda M; Baldwin, Timothy T; Tatikonda, Mohan V; Cornetta, Kenneth

2013-08-01

Biomedical research enterprises require a large number of core facilities and resources to supply the infrastructure necessary for translational research. Maintaining the financial viability and promoting efficiency in an academic environment can be particularly challenging for medical schools and universities. The Indiana Clinical and Translational Sciences Institute sought to improve core and service programs through a partnership with the Indiana University Kelley School of Business. The program paired teams of Masters of Business Administration students with cores and programs that self-identified the need for assistance in project management, financial management, marketing, or resource efficiency. The projects were developed by CTSI project managers and business school faculty using service-learning principles to ensure learning for students who also received course credit for their participation. With three years of experience, the program demonstrates a successful partnership that improves clinical research infrastructure by promoting business best practices and providing a valued learning experience for business students. © 2013 Wiley Periodicals, Inc.

The biology of eukaryotic promoter prediction - a review

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

1999-01-01

between functional promoters has been estimated to be in the range of 30-40 kilobases. Although it is conceivable that some of these predicted promoters correspond to cryptic initiation sites that are used in vivo, it is likely that most are false positives. This suggests that it is important to carefully......Computational prediction of eukaryotic promoters from the nucleotide sequence is one of the most attractive problems in sequence analysis today, but it is also a very difficult one. Thus, current methods predict in the order of one promoter per kilobase in human DNA, while the average distance...... reconsider the biological data that forms the basis of current algorithms, and we here present a review of data that may be useful in this regard. The review covers the following topics: (1) basal transcription and core promoters, (2) activated transcription and transcription factor binding sites, (3) Cp...

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Core genome conservation of Staphylococcus haemolyticus limits sequence based population structure analysis.

Science.gov (United States)

Cavanagh, Jorunn Pauline; Klingenberg, Claus; Hanssen, Anne-Merethe; Fredheim, Elizabeth Aarag; Francois, Patrice; Schrenzel, Jacques; Flægstad, Trond; Sollid, Johanna Ericson

2012-06-01

The notoriously multi-resistant Staphylococcus haemolyticus is an emerging pathogen causing serious infections in immunocompromised patients. Defining the population structure is important to detect outbreaks and spread of antimicrobial resistant clones. Currently, the standard typing technique is pulsed-field gel electrophoresis (PFGE). In this study we describe novel molecular typing schemes for S. haemolyticus using multi locus sequence typing (MLST) and multi locus variable number of tandem repeats (VNTR) analysis. Seven housekeeping genes (MLST) and five VNTR loci (MLVF) were selected for the novel typing schemes. A panel of 45 human and veterinary S. haemolyticus isolates was investigated. The collection had diverse PFGE patterns (38 PFGE types) and was sampled over a 20 year-period from eight countries. MLST resolved 17 sequence types (Simpsons index of diversity [SID]=0.877) and MLVF resolved 14 repeat types (SID=0.831). We found a low sequence diversity. Phylogenetic analysis clustered the isolates in three (MLST) and one (MLVF) clonal complexes, respectively. Taken together, neither the MLST nor the MLVF scheme was suitable to resolve the population structure of this S. haemolyticus collection. Future MLVF and MLST schemes will benefit from addition of more variable core genome sequences identified by comparing different fully sequenced S. haemolyticus genomes. Copyright © 2012 Elsevier B.V. All rights reserved.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

Science.gov (United States)

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Genome-scale portrait and evolutionary significance of human-specific core promoter tri- and tetranucleotide short tandem repeats.

Science.gov (United States)

Nazaripanah, N; Adelirad, F; Delbari, A; Sahaf, R; Abbasi-Asl, T; Ohadi, M

2018-04-05

While there is an ongoing trend to identify single nucleotide substitutions (SNSs) that are linked to inter/intra-species differences and disease phenotypes, short tandem repeats (STRs)/microsatellites may be of equal (if not more) importance in the above processes. Genes that contain STRs in their promoters have higher expression divergence compared to genes with fixed or no STRs in the gene promoters. In line with the above, recent reports indicate a role of repetitive sequences in the rise of young transcription start sites (TSSs) in human evolution. Following a comparative genomics study of all human protein-coding genes annotated in the GeneCards database, here we provide a genome-scale portrait of human-specific short- and medium-size (≥ 3-repeats) tri- and tetranucleotide STRs and STR motifs in the critical core promoter region between - 120 and + 1 to the TSS and evidence of skewing of this compartment in reference to the STRs that are not human-specific (Levene's test p human-specific transcripts was detected in the tri and tetra human-specific compartments (mid-p genome-scale skewing of STRs at a specific region of the human genome and a link between a number of these STRs and TSS selection/transcript specificity. The STRs and genes listed here may have a role in the evolution and development of characteristics and phenotypes that are unique to the human species.

Genome Sequence of Azospirillum brasilense CBG497 and Comparative Analyses of Azospirillum Core and Accessory Genomes provide Insight into Niche Adaptation

Science.gov (United States)

Wisniewski-Dyé, Florence; Lozano, Luis; Acosta-Cruz, Erika; Borland, Stéphanie; Drogue, Benoît; Prigent-Combaret, Claire; Rouy, Zoé; Barbe, Valérie; Mendoza Herrera, Alberto; González, Victor; Mavingui, Patrick

2012-01-01

Bacteria of the genus Azospirillum colonize roots of important cereals and grasses, and promote plant growth by several mechanisms, notably phytohormone synthesis. The genomes of several Azospirillum strains belonging to different species, isolated from various host plants and locations, were recently sequenced and published. In this study, an additional genome of an A. brasilense strain, isolated from maize grown on an alkaline soil in the northeast of Mexico, strain CBG497, was obtained. Comparative genomic analyses were performed on this new genome and three other genomes (A. brasilense Sp245, A. lipoferum 4B and Azospirillum sp. B510). The Azospirillum core genome was established and consists of 2,328 proteins, representing between 30% to 38% of the total encoded proteins within a genome. It is mainly chromosomally-encoded and contains 74% of genes of ancestral origin shared with some aquatic relatives. The non-ancestral part of the core genome is enriched in genes involved in signal transduction, in transport and in metabolism of carbohydrates and amino-acids, and in surface properties features linked to adaptation in fluctuating environments, such as soil and rhizosphere. Many genes involved in colonization of plant roots, plant-growth promotion (such as those involved in phytohormone biosynthesis), and properties involved in rhizosphere adaptation (such as catabolism of phenolic compounds, uptake of iron) are restricted to a particular strain and/or species, strongly suggesting niche-specific adaptation. PMID:24705077

Genome Sequence of Azospirillum brasilense CBG497 and Comparative Analyses of Azospirillum Core and Accessory Genomes provide Insight into Niche Adaptation

Directory of Open Access Journals (Sweden)

Victor González

2012-09-01

Full Text Available Bacteria of the genus Azospirillum colonize roots of important cereals and grasses, and promote plant growth by several mechanisms, notably phytohormone synthesis. The genomes of several Azospirillum strains belonging to different species, isolated from various host plants and locations, were recently sequenced and published. In this study, an additional genome of an A. brasilense strain, isolated from maize grown on an alkaline soil in the northeast of Mexico, strain CBG497, was obtained. Comparative genomic analyses were performed on this new genome and three other genomes (A. brasilense Sp245, A. lipoferum 4B and Azospirillum sp. B510. The Azospirillum core genome was established and consists of 2,328 proteins, representing between 30% to 38% of the total encoded proteins within a genome. It is mainly chromosomally-encoded and contains 74% of genes of ancestral origin shared with some aquatic relatives. The non-ancestral part of the core genome is enriched in genes involved in signal transduction, in transport and in metabolism of carbohydrates and amino-acids, and in surface properties features linked to adaptation in fluctuating environments, such as soil and rhizosphere. Many genes involved in colonization of plant roots, plant-growth promotion (such as those involved in phytohormone biosynthesis, and properties involved in rhizosphere adaptation (such as catabolism of phenolic compounds, uptake of iron are restricted to a particular strain and/or species, strongly suggesting niche-specific adaptation.

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

Directory of Open Access Journals (Sweden)

W.S.I. de Silva

2017-07-01

Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

Genome Sequence of the Biocontrol Strain Pseudomonas fluorescens F113

Science.gov (United States)

Redondo-Nieto, Miguel; Barret, Matthieu; Morrisey, John P.; Germaine, Kieran; Martínez-Granero, Francisco; Barahona, Emma; Navazo, Ana; Sánchez-Contreras, María; Moynihan, Jennifer A.; Giddens, Stephen R.; Coppoolse, Eric R.; Muriel, Candela; Stiekema, Willem J.; Rainey, Paul B.; Dowling, David; O'Gara, Fergal; Martín, Marta

2012-01-01

Pseudomonas fluorescens F113 is a plant growth-promoting rhizobacterium (PGPR) that has biocontrol activity against fungal plant pathogens and is a model for rhizosphere colonization. Here, we present its complete genome sequence, which shows that besides a core genome very similar to those of other strains sequenced within this species, F113 possesses a wide array of genes encoding specialized functions for thriving in the rhizosphere and interacting with eukaryotic organisms. PMID:22328765

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

Directory of Open Access Journals (Sweden)

Jin Duan

Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

Science.gov (United States)

Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

2013-01-01

The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

Directory of Open Access Journals (Sweden)

Devaraj Illakkiam

2014-01-01

Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

Science.gov (United States)

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Cellular specificity of HIV-1 replication can be controlled by LTR sequences

International Nuclear Information System (INIS)

Reed-Inderbitzin, Edward; Maury, Wendy

2003-01-01

Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

The Interplay of Opacities and Rotation in Promoting the Explosion of Core-Collapse Supernovae

Science.gov (United States)

Vartanyan, David; Burrows, Adam; Radice, David

2018-01-01

For over five decades, the mechanism of explosion in core-collapse supernovae has been a central unsolved problem in astrophysics, challenging both our computational capabilities and our understanding of relevant physics. Current simulations often produce explosions, but they are at times underenergetic. The neutrino mechanism, wherein a fraction of emitted neutrinos is absorbed in the mantle of the star to reignite the stalled shock, remains the dominant model for reviving explosions in massive stars undergoing core collapse. We present here a diverse suite of 2D axisymmetric simulations produced by FORNAX, a highly parallelizable multidimensional supernova simulation code. We explore the effects of various corrections, including the many-body correction, to neutrino-matter opacities and the possible role of rotation in promoting explosion amongst various core-collapse progenitors.

Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

Directory of Open Access Journals (Sweden)

Liu Wen-Sheng

2010-11-01

Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

KAUST Repository

Lafi, Feras Fawzi

2017-03-03

Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

Science.gov (United States)

Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

2012-01-01

IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

Cued memory reactivation during slow-wave sleep promotes explicit knowledge of a motor sequence.

Science.gov (United States)

Cousins, James N; El-Deredy, Wael; Parkes, Laura M; Hennies, Nora; Lewis, Penelope A

2014-11-26

Memories are gradually consolidated after initial encoding, and this can sometimes lead to a transition from implicit to explicit knowledge. The exact physiological processes underlying this reorganization remain unclear. Here, we used a serial reaction time task to determine whether targeted memory reactivation (TMR) of specific memory traces during slow-wave sleep promotes the emergence of explicit knowledge. Human participants learned two 12-item sequences of button presses (A and B). These differed in both cue order and in the auditory tones associated with each of the four fingers (one sequence had four higher-pitched tones). Subsequent overnight sleep was monitored, and the tones associated with one learned sequence were replayed during slow-wave sleep. After waking, participants demonstrated greater explicit knowledge (p = 0.005) and more improved procedural skill (p = 0.04) for the cued sequence relative to the uncued sequence. Furthermore, fast spindles (13.5-15 Hz) at task-related motor regions predicted overnight enhancement in procedural skill (r = 0.71, p = 0.01). Auditory cues had no effect on post-sleep memory performance in a control group who received TMR before sleep. These findings suggest that TMR during sleep can alter memory representations and promote the emergence of explicit knowledge, supporting the notion that reactivation during sleep is a key mechanism in this process. Copyright © 2014 Cousins et al.

Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

International Nuclear Information System (INIS)

Jones, M.H.; Learned, R.M.; Tjian, R.

1988-01-01

The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

Further attempts at dating the palynological sequence of the Hula Lo7 core, upper Jordan Valley, Israel

CSIR Research Space (South Africa)

Weinstein-Evron, M

2001-01-01

Full Text Available The palynological sequence of the Hula L07 core was previously correlated with the global oxygen isotope stages 3-5, based on a radiocarbon age determination and comparison with other Levantine paleoclimatological curves. An attempt was made...

STELLAR AGES AND CONVECTIVE CORES IN FIELD MAIN-SEQUENCE STARS: FIRST ASTEROSEISMIC APPLICATION TO TWO KEPLER TARGETS

Energy Technology Data Exchange (ETDEWEB)

Silva Aguirre, V.; Christensen-Dalsgaard, J.; Chaplin, W. J. [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Basu, S.; Deheuvels, S. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Brandao, I. M.; Cunha, M. S.; Sousa, S. G. [Centro de Astrofisica and Faculdade de Ciencias, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Dogan, G. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Metcalfe, T. S. [Space Science Institute, Boulder, CO 80301 (United States); Serenelli, A. M.; Garcia, R. A. [Kavli Institute for Theoretical Physics, Santa Barbara, CA 93106 (United States); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin, F-31400 Toulouse (France); Weiss, A. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85748 Garching bei Muenchen (Germany); Appourchaux, T. [Institut d' Astrophysique Spatiale, Universite Paris Sud-CNRS (UMR8617) Batiment 121, F-91405 Orsay Cedex (France); Casagrande, L. [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, ACT 2611 (Australia); Cassisi, S. [INAF-Astronomical Observatory of Teramo, Via M. Maggini sn, I-64100 Teramo (Italy); Creevey, O. L. [Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, CNRS, I-06300 Nice, France. (France); Lebreton, Y. [Observatoire de Paris, GEPI, CNRS UMR 8111, F-92195 Meudon (France); Noels, A. [Institute of Astrophysics and Geophysics, University of Liege, B-4000 Liege (Belgium); and others

2013-06-01

Using asteroseismic data and stellar evolution models we obtain the first detection of a convective core in a Kepler field main-sequence star, putting a stringent constraint on the total size of the mixed zone and showing that extra mixing beyond the formal convective boundary exists. In a slightly less massive target the presence of a convective core cannot be conclusively discarded, and thus its remaining main-sequence lifetime is uncertain. Our results reveal that best-fit models found solely by matching individual frequencies of oscillations corrected for surface effects do not always properly reproduce frequency combinations. Moreover, slightly different criteria to define what the best-fit model is can lead to solutions with similar global properties but very different interior structures. We argue that the use of frequency ratios is a more reliable way to obtain accurate stellar parameters, and show that our analysis in field main-sequence stars can yield an overall precision of 1.5%, 4%, and 10% in radius, mass, and age, respectively. We compare our results with those obtained from global oscillation properties, and discuss the possible sources of uncertainties in asteroseismic stellar modeling where further studies are still needed.

Core labeling of adenovirus with EGFP

International Nuclear Information System (INIS)

Le, Long P.; Le, Helen N.; Nelson, Amy R.; Matthews, David A.; Yamamoto, Masato; Curiel, David T.

2006-01-01

The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expression vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

Science.gov (United States)

Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2012-01-01

The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

Directory of Open Access Journals (Sweden)

Christine R Langlois

2016-11-01

Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

Science.gov (United States)

Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

2012-01-01

Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

Directory of Open Access Journals (Sweden)

Lior Levy

2017-10-01

Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

Science.gov (United States)

Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

2018-02-01

Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

Science.gov (United States)

Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

2015-08-26

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

TAF4 nucleates a core subcomplex of TFIID and mediates activated transcription from a TATA-less promoter

OpenAIRE

Wright, Kevin J.; Marr, Michael T.; Tjian, Robert

2006-01-01

Activator-dependent recruitment of TFIID initiates formation of the transcriptional preinitiation complex. TFIID binds core promoter DNA elements and directs the assembly of other general transcription factors, leading to binding of RNA polymerase II and activation of RNA synthesis. How TATA box-binding protein (TBP) and the TBP-associated factors (TAFs) are assembled into a functional TFIID complex with promoter recognition and coactivator activities in vivo remains unknown. Here, we use RNA...

HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

Energy Technology Data Exchange (ETDEWEB)

Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com

2015-10-23

This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases

HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

International Nuclear Information System (INIS)

Tan, Yongsheng; Li, Yan

2015-01-01

This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Structural models of the different trimers present in the core of phycobilisomes from Gracilaria chilensis based on crystal structures and sequences.

Directory of Open Access Journals (Sweden)

Jorge Dagnino-Leone

Full Text Available Phycobilisomes (PBS are accessory light harvesting protein complexes that directionally transfer energy towards photosystems. Phycobilisomes are organized in a central core and rods radiating from it. Components of phycobilisomes in Gracilaria chilensis (Gch are Phycobiliproteins (PBPs, Phycoerythrin (PE, and Phycocyanin (PC in the rods, while Allophycocyanin (APC is found in the core, and linker proteins (L. The function of such complexes depends on the structure of each component and their interaction. The core of PBS from cyanobacteria is mainly composed by cylinders of trimers of α and β subunits forming heterodimers of Allophycocyanin, and other components of the core including subunits αII and β18. As for the linkers, Linker core (LC and Linker core membrane (LCM are essential for the final emission towards photoreaction centers. Since we have previously focused our studies on the rods of the PBS, in the present article we investigated the components of the core in the phycobilisome from the eukaryotic algae, Gracilaria chilensis and their organization into trimers. Transmission electron microscopy provided the information for a three cylinders core, while the three dimensional structure of Allophycocyanin purified from Gch was determined by X-ray diffraction method and the biological unit was determined as a trimer by size exclusion chromatography. The protein sequences of all the components of the core were obtained by sequencing the corresponding genes and their expression confirmed by transcriptomic analysis. These subunits have seldom been reported in red algae, but not in Gracilaria chilensis. The subunits not present in the crystallographic structure were modeled to build the different composition of trimers. This article proposes structural models for the different types of trimers present in the core of phycobilisomes of Gch as a first step towards the final model for energy transfer in this system.

CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

Directory of Open Access Journals (Sweden)

Ann L Griffen

2011-04-01

Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

KAUST Repository

Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

Core Genome Multilocus Sequence Typing Scheme for Stable, Comparative Analyses of Campylobacter jejuni and C. coli Human Disease Isolates.

Science.gov (United States)

Cody, Alison J; Bray, James E; Jolley, Keith A; McCarthy, Noel D; Maiden, Martin C J

2017-07-01

Human campylobacteriosis, caused by Campylobacter jejuni and C. coli , remains a leading cause of bacterial gastroenteritis in many countries, but the epidemiology of campylobacteriosis outbreaks remains poorly defined, largely due to limitations in the resolution and comparability of isolate characterization methods. Whole-genome sequencing (WGS) data enable the improvement of sequence-based typing approaches, such as multilocus sequence typing (MLST), by substantially increasing the number of loci examined. A core genome MLST (cgMLST) scheme defines a comprehensive set of those loci present in most members of a bacterial group, balancing very high resolution with comparability across the diversity of the group. Here we propose a set of 1,343 loci as a human campylobacteriosis cgMLST scheme (v1.0), the allelic profiles of which can be assigned to core genome sequence types. The 1,343 loci chosen were a subset of the 1,643 loci identified in the reannotation of the genome sequence of C. jejuni isolate NCTC 11168, chosen as being present in >95% of draft genomes of 2,472 representative United Kingdom campylobacteriosis isolates, comprising 2,207 (89.3%) C. jejuni isolates and 265 (10.7%) C. coli isolates. Validation of the cgMLST scheme was undertaken with 1,478 further high-quality draft genomes, containing 150 or fewer contiguous sequences, from disease isolate collections: 99.5% of these isolates contained ≥95% of the 1,343 cgMLST loci. In addition to the rapid and effective high-resolution analysis of large numbers of diverse isolates, the cgMLST scheme enabled the efficient identification of very closely related isolates from a well-defined single-source campylobacteriosis outbreak. Copyright © 2017 Cody et al.

Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

Directory of Open Access Journals (Sweden)

Jing Qin Wu

Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris Harbor a Core Subset of Bacteria Normally Associated with the Wild Host.

Directory of Open Access Journals (Sweden)

Ivan Meeus

Full Text Available A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella, Orbaceae (Gilliamella, Lactobacillaceae (Lactobacillus, and Bifidobacteriaceae (Bifidobacterium. In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed.

Identification and characterization of the human SOX6 promoter

International Nuclear Information System (INIS)

Ikeda, Toshiyuki; Saito, Taku; Ushita, Masahiro; Yano, Fumiko; Kan, Akinori; Itaka, Keiji; Moro, Toru; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il

2007-01-01

The present study attempted to identify and characterize the embryonic promoter of Sox6, a determinant regulator of chondrogenic differentiation. A common transcription start region for human and mouse Sox6 was initially identified, which contained a highly conserved sequence, A-box. Tandem repeats of A-box had a strong transcriptional activity both at the basal level and in response to Sox9. Cells carrying the 4xA-box-DsRed2 reporter fluoresced only upon chondrogenic differentiation. The 46-bp core enhancer region (CES6) was then identified in the 3' half of A-box, within which a C/EBP-binding motif was identified. Overexpressed C/EBPβ activated the Sox6 promoter, and mutant 4xCES6 constructs lacking the C/EBP motif lost their basal activity. CES6 and nuclear extracts formed a specific complex, which was supershifted by anti-C/EBPβ antibody, and in vitro translated C/EBPβ specifically bound to CES6. Thus, we successfully identified the Sox6 promoter and its core enhancer and characterized the interactions with regulatory transcription factors

Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?

Science.gov (United States)

Robins-Browne, Roy M.; Holt, Kathryn E.; Ingle, Danielle J.; Hocking, Dianna M.; Yang, Ji; Tauschek, Marija

2016-01-01

The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E.coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli. Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli, which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods. PMID:27917373

Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

Science.gov (United States)

Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

2010-01-01

Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

DEFF Research Database (Denmark)

Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

-regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

Science.gov (United States)

Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

2013-11-18

Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Directory of Open Access Journals (Sweden)

Hoorig Nassanian

2007-08-01

Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

Science.gov (United States)

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

Science.gov (United States)

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

Science.gov (United States)

Gerasymenko, I M; Sheludko, Y V

2017-07-01

To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

Science.gov (United States)

2015-01-01

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

DEFF Research Database (Denmark)

Hansen, K.; Læssøe, Thomas; Pfister, D.H.

2002-01-01

Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

HCV core protein-induced down-regulation of microRNA-152 promoted aberrant proliferation by regulating Wnt1 in HepG2 cells.

Directory of Open Access Journals (Sweden)

Shifeng Huang

Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell

Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

Science.gov (United States)

Raynard, Steven J; Baker, Mark D

2004-01-01

In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

Science.gov (United States)

Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

2018-01-01

High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

Based on the core competitiveness of enterprise innovation culture research

Institute of Scientific and Technical Information of China (English)

韩 军

2017-01-01

In the spring tide of market economy at present, the enterprise is a must to survive in order to achieve innovation, promote enterprise's core competitiveness. Enterprise innovation culture, the promotion enterprise's core competitiveness plays an important role in promoting, therefore must complete enterprise innovation culture. Therefore, put forward by enterprise innovation culture, promote enterprise's core competitiveness.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

Energy Technology Data Exchange (ETDEWEB)

Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden

2012-01-01

Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

Science.gov (United States)

Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

2018-05-01

Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that

Sequence comparison and phylogenetic analysis of core gene of ...

African Journals Online (AJOL)

STORAGESEVER

2010-07-19

Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

Science.gov (United States)

Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

2017-08-31

Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

Comprehensive genomic analysis of a plant growth-promoting rhizobacterium Pantoea agglomerans strain P5.

Science.gov (United States)

Shariati J, Vahid; Malboobi, Mohammad Ali; Tabrizi, Zeinab; Tavakol, Elahe; Owilia, Parviz; Safari, Maryam

2017-11-15

In this study, we provide a comparative genomic analysis of Pantoea agglomerans strain P5 and 10 closely related strains based on phylogenetic analyses. A next-generation shotgun strategy was implemented using the Illumina HiSeq 2500 technology followed by core- and pan-genome analysis. The genome of P. agglomerans strain P5 contains an assembly size of 5082485 bp with 55.4% G + C content. P. agglomerans consists of 2981 core and 3159 accessory genes for Coding DNA Sequences (CDSs) based on the pan-genome analysis. Strain P5 can be grouped closely with strains PG734 and 299 R using pan and core genes, respectively. All the predicted and annotated gene sequences were allocated to KEGG pathways. Accordingly,  genes involved in plant growth-promoting (PGP) ability, including phosphate solubilization, IAA and siderophore production, acetoin and 2,3-butanediol synthesis and bacterial secretion, were assigned. This study provides an in-depth view of the PGP characteristics of strain P5, highlighting its potential use in agriculture as a biofertilizer.

Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

DEFF Research Database (Denmark)

Sandvej, Kristian; Gratama, J W; Munch, M

1997-01-01

Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

Science.gov (United States)

Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

2014-11-30

Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

DEFF Research Database (Denmark)

Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

2011-01-01

Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

Science.gov (United States)

Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

2016-05-10

Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

Directory of Open Access Journals (Sweden)

Gagniuc Paul

2012-09-01

comprehensive data from three different databases and a new computer model whose core is using Kappa index of coincidence. Conclusions To fully understand the connections between gene promoters and gene expression, we analyzed thousands of promoter sequences using our Kappa Index of Coincidence method and a specialized Optical Character Recognition (OCR neural network. Under our criteria, 10 classes of promoters were detected. In addition, the existence of “transitional” promoters suggests that there is an evolutionary weighted continuum between classes, depending perhaps upon changes in their gene products.

Reactor core operation management system

International Nuclear Information System (INIS)

Sato, Tomomi.

1992-01-01

Among operations of periodical inspection for a nuclear power plant, sequence, time and safety rule, as well as necessary equipments and the number thereof required for each of the operation are determined previously for given operation plannings, relevant to the reactor core operations. Operation items relative to each of coordinates of the reactor core are retrieved and arranged based on specified conditions, to use the operation equipments effectively. Further, a combination of operations, relative to the reactor core coordinates with no physical interference and shortest in accordance with safety rules is judged, and the order and the step of the operation relevant to the entire reactor core operations are planned. After the start of the operation, the necessity for changing the operation sequence is judged depending on the judgement as to whether it is conducted according to the safety rule and the deviation between the plan and the result, based on the information for the progress of each of the operations. Alternatively, the operation sequence and the step to be changed are planned again in accordance with the requirement for the change of the operation planning. Then, the shortest operation time can be planned depending on the simultaneous operation impossible condition and the condition for the operation time zone determined by labor conditions. (N.H.)

Reactor core operation management system

Energy Technology Data Exchange (ETDEWEB)

Sato, Tomomi.

1992-05-28

Among operations of periodical inspection for a nuclear power plant, sequence, time and safety rule, as well as necessary equipments and the number thereof required for each of the operation are determined previously for given operation plannings, relevant to the reactor core operations. Operation items relative to each of coordinates of the reactor core are retrieved and arranged based on specified conditions, to use the operation equipments effectively. Further, a combination of operations, relative to the reactor core coordinates with no physical interference and shortest in accordance with safety rules is judged, and the order and the step of the operation relevant to the entire reactor core operations are planned. After the start of the operation, the necessity for changing the operation sequence is judged depending on the judgement as to whether it is conducted according to the safety rule and the deviation between the plan and the result, based on the information for the progress of each of the operations. Alternatively, the operation sequence and the step to be changed are planned again in accordance with the requirement for the change of the operation planning. Then, the shortest operation time can be planned depending on the simultaneous operation impossible condition and the condition for the operation time zone determined by labor conditions. (N.H.).

Reorienting health services with capacity building: a case study of the Core Skills in Health Promotion Project.

Science.gov (United States)

Yeatman, H R; Nove, T

2002-12-01

This paper presents a case study of the application of a framework for capacity building [Hawe, P., King, L., Noort, M., Jordens, C. and Lloyd, B. (2000) Indicators to Help with Capacity Building in Health Promotion. NSW Health, Sydney] to describe actions aimed at building organizational support for health promotion within an area health service in New South Wales, Australia. The Core Skills in Health Promotion Project (CSHPP) arose from an investigation which reported that participants of a health promotion training course had increased health promotion skills but that they lacked the support to apply their skills in the workplace. The project was action-research based. It investigated and facilitated the implementation of a range of initiatives to support community health staff to apply a more preventive approach in their practice and it contributed to the establishment of new organizational structures for health promotion. An evaluation was undertaken 4 years after the CSHPP was established, and 2 years after it had submitted its final report. Interviews with senior managers, document analysis of written reports, and focus groups with middle managers and service delivery staff were undertaken. Change was achieved in the three dimensions of health infrastructure, program maintenance and problem solving capacity of the organization. It was identified that the critically important elements in achieving the aims of the project-partnership, leadership and commitment-were also key elements of the capacity building framework. This case study provides a practical example of the usefulness of the capacity building framework in orienting health services to be supportive of health promotion.

The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro.

Science.gov (United States)

Cristofari, Gaël; Ivanyi-Nagy, Roland; Gabus, Caroline; Boulant, Steeve; Lavergne, Jean-Pierre; Penin, François; Darlix, Jean-Luc

2004-01-01

The hepatitis C virus (HCV) is an important human pathogen causing chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HCV is an enveloped virus with a positive-sense, single-stranded RNA genome encoding a single polyprotein that is processed to generate viral proteins. Several hundred molecules of the structural Core protein are thought to coat the genome in the viral particle, as do nucleocapsid (NC) protein molecules in Retroviruses, another class of enveloped viruses containing a positive-sense RNA genome. Retroviral NC proteins also possess nucleic acid chaperone properties that play critical roles in the structural remodelling of the genome during retrovirus replication. This analogy between HCV Core and retroviral NC proteins prompted us to investigate the putative nucleic acid chaperoning properties of the HCV Core protein. Here we report that Core protein chaperones the annealing of complementary DNA and RNA sequences and the formation of the most stable duplex by strand exchange. These results show that the HCV Core is a nucleic acid chaperone similar to retroviral NC proteins. We also find that the Core protein directs dimerization of HCV (+) RNA 3' untranslated region which is promoted by a conserved palindromic sequence possibly involved at several stages of virus replication.

Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

2015-01-01

The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

Draft Genome Sequence of Bacillus velezensis Lzh-a42, a Plant Growth-Promoting Rhizobacterium Isolated from Tomato Rhizosphere.

Science.gov (United States)

Li, Zhenghua; Chen, Mei; Ran, Kun; Wang, Jihua; Zeng, Qiangcheng; Song, Feng

2018-03-22

The plant growth-promoting rhizobacterium Bacillus velezensis strain Lzh-a42, which has antimicrobial activity, was isolated from tomato rhizosphere. Here, we report its genome sequence, which includes several predicted functional genes related to secondary metabolite biosynthesis, antimicrobial activity, and biofilm synthesis. Copyright © 2018 Li et al.

TMI-2 core examination plan

International Nuclear Information System (INIS)

Owen, D.E.; MacDonald, P.E.; Hobbins, R.R.; Ploggr, S.A.

1982-01-01

The Three Mile Island (TMI-2) core examination is divided into four stages: (1) before removing the head; (2) before removing the plenum; (3) during defueling; and (4) offsite examinations. Core examinations recommended during the first three stages are primarily devoted to documenting the post-accident condition of the core. The detailed analysis of core damage structures will be performed during offsite examinations at government and commercial hot cell facilities. The primary objectives of these examinations are to enhance the understanding of the degraded core accident sequence, to develop the technical bases for reactor regulations, and to improve LWR design and operation

Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

Energy Technology Data Exchange (ETDEWEB)

Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

2015-08-13

The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

International Nuclear Information System (INIS)

Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

1988-01-01

Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

Science.gov (United States)

Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

KAUST Repository

Andres-Barrao, Cristina; Lafi, Feras Fawzi; Alam, Intikhab; Zé licourt, Axel de; Eida, Abdul Aziz; Bokhari, Ameerah; Alzubaidy, Hanin S.; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

KAUST Repository

Andres-Barrao, Cristina

2017-10-20

Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

OpenAIRE

Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

2016-01-01

ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Bhattacharya, Monolekha; Das, Amit Kumar

2011-01-01

Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

Managing water addition to a degraded core

International Nuclear Information System (INIS)

Kuan, P.; Hanson, D.J.; Odar, F.

1992-01-01

In this paper the authors present information that can be used in severe accident management by providing an improved understanding of the effects of water addition to a degraded core. This improved understanding is developed using a diagram showing a sequence of core damage states. Whenever possible, a temperature and a time after accident initiation are estimated for each damage state in the sequence diagram. This diagram can be used to anticipate the evolution of events during an accident. Possible responses of plant instruments are described to identify these damage states and the effects of water addition. The rate and amount of water addition needed (a) to remove energy from the core, (b) to stabilize the core or (c) to not adversely affect the damage progression, are estimated. Analysis of the capability to remove energy from large cohesive and particulate debris beds indicates that these beds may not be stabilized in the core region and they may partially relocate to the lower plenum of the reactor vessel

Calcium ions affect the hepatitis B virus core assembly

International Nuclear Information System (INIS)

Choi, Yongwook; Gyoo Park, Sung; Yoo, Jun-hi; Jung, Guhung

2005-01-01

Previous report showed that cytosolic Ca 2+ induced by hepatitis B virus X protein (HBx) promotes HBV replication. In this study, in vitro experiments showed that (i) HBV core assembly in vitro was promoted by Ca 2+ through the sucrose density gradient and the analytical ultracentrifuge analysis. Also (ii) transmission electron microscope analysis demonstrated these assembled HBV core particles were the capsids. Ex vivo experiments showed that the treatment of BAPTA-AM and cyclosporine A (CsA) reduced HBV capsids in the transfected HepG2 cells. In addition to that, the treatment of Thapsigargin (TG) increased HBV capsids in the transfected HepG2 cells. Furthermore, we investigated the increased HBV core assembly by HBx. The results show that the increased cytosolic calcium ions by HBx promote the HBV core assembly

PWR degraded core analysis

International Nuclear Information System (INIS)

Gittus, J.H.

1982-04-01

A review is presented of the various phenomena involved in degraded core accidents and the ensuing transport of fission products from the fuel to the primary circuit and the containment. The dominant accident sequences found in the PWR risk studies published to date are briefly described. Then chapters deal with the following topics: the condition and behaviour of water reactor fuel during normal operation and at the commencement of degraded core accidents; the generation of hydrogen from the Zircaloy-steam and the steel-steam reactions; the way in which the core deforms and finally melts following loss of coolant; debris relocation analysis; containment integrity; fission product behaviour during a degraded core accident. (U.K.)

Are sdAs helium core stars?

Directory of Open Access Journals (Sweden)

Pelisoli Ingrid

2017-12-01

Full Text Available Evolved stars with a helium core can be formed by non-conservative mass exchange interaction with a companion or by strong mass loss. Their masses are smaller than 0.5 M⊙. In the database of the Sloan Digital Sky Survey (SDSS, there are several thousand stars which were classified by the pipeline as dwarf O, B and A stars. Considering the lifetimes of these classes on the main sequence, and their distance modulus at the SDSS bright saturation, if these were common main sequence stars, there would be a considerable population of young stars very far from the galactic disk. Their spectra are dominated by Balmer lines which suggest effective temperatures around 8 000-10 000 K. Several thousand have significant proper motions, indicative of distances smaller than 1 kpc. Many show surface gravity in intermediate values between main sequence and white dwarf, 4.75 < log g < 6.5, hence they have been called sdA stars. Their physical nature and evolutionary history remains a puzzle. We propose they are not H-core main sequence stars, but helium core stars and the outcomes of binary evolution. We report the discovery of two new extremely-low mass white dwarfs among the sdAs to support this statement.

Emergency core cooling system

International Nuclear Information System (INIS)

Kato, Ken.

1989-01-01

In PWR type reactors, a cooling water spray portion of emergency core cooling pipelines incorporated into pipelines on high temperature side is protruded to the inside of an upper plenum. Upon rupture of primary pipelines, pressure in a pressure vessel is abruptly reduced to generate a great amount of steams in the reactor core, which are discharged at a high flow rate into the primary pipelines on high temperature side. However, since the inside of the upper plenum has a larger area and the steam flow is slow, as compared with that of the pipelines on the high temperature side, ECCS water can surely be supplied into the reactor core to promote the re-flooding of the reactor core and effectively cool the reactor. Since the nuclear reactor can effectively be cooled to enable the promotion of pressure reduction and effective supply of coolants during the period of pressure reduction upon LOCA, the capacity of the pressure accumulation vessel can be decreased. Further, the re-flooding time for the reactor is shortened to provide an effect contributing to the improvement of the safety and the reduction of the cost. (N.H.)

The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

Science.gov (United States)

Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

2011-03-01

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

Identification of a novel temperature sensitive promoter in cho cells

Directory of Open Access Journals (Sweden)

Hesse Friedemann

2011-05-01

Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

KAUST Repository

Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2016-01-01

Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

KAUST Repository

Lafi, Feras Fawzi

2016-11-04

Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

DNA watermarks in non-coding regulatory sequences

Directory of Open Access Journals (Sweden)

Pyka Martin

2009-07-01

Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

Mitochondrial Respiration Is Reduced in Atherosclerosis, Promoting Necrotic Core Formation and Reducing Relative Fibrous Cap Thickness.

Science.gov (United States)

Yu, Emma P K; Reinhold, Johannes; Yu, Haixiang; Starks, Lakshi; Uryga, Anna K; Foote, Kirsty; Finigan, Alison; Figg, Nichola; Pung, Yuh-Fen; Logan, Angela; Murphy, Michael P; Bennett, Martin

2017-12-01

Mitochondrial DNA (mtDNA) damage is present in murine and human atherosclerotic plaques. However, whether endogenous levels of mtDNA damage are sufficient to cause mitochondrial dysfunction and whether decreasing mtDNA damage and improving mitochondrial respiration affects plaque burden or composition are unclear. We examined mitochondrial respiration in human atherosclerotic plaques and whether augmenting mitochondrial respiration affects atherogenesis. Human atherosclerotic plaques showed marked mitochondrial dysfunction, manifested as reduced mtDNA copy number and oxygen consumption rate in fibrous cap and core regions. Vascular smooth muscle cells derived from plaques showed impaired mitochondrial respiration, reduced complex I expression, and increased mitophagy, which was induced by oxidized low-density lipoprotein. Apolipoprotein E-deficient (ApoE -/- ) mice showed decreased mtDNA integrity and mitochondrial respiration, associated with increased mitochondrial reactive oxygen species. To determine whether alleviating mtDNA damage and increasing mitochondrial respiration affects atherogenesis, we studied ApoE -/- mice overexpressing the mitochondrial helicase Twinkle (Tw + /ApoE -/- ). Tw + /ApoE -/- mice showed increased mtDNA integrity, copy number, respiratory complex abundance, and respiration. Tw + /ApoE -/- mice had decreased necrotic core and increased fibrous cap areas, and Tw + /ApoE -/- bone marrow transplantation also reduced core areas. Twinkle increased vascular smooth muscle cell mtDNA integrity and respiration. Twinkle also promoted vascular smooth muscle cell proliferation and protected both vascular smooth muscle cells and macrophages from oxidative stress-induced apoptosis. Endogenous mtDNA damage in mouse and human atherosclerosis is associated with significantly reduced mitochondrial respiration. Reducing mtDNA damage and increasing mitochondrial respiration decrease necrotic core and increase fibrous cap areas independently of changes in

PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

OpenAIRE

Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

2002-01-01

PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

Cytotoxic T lymphocytes and CD4 epitope mutations in the pre-core/core region of hepatitis B virus in chronic hepatitis B carriers in Northeast Iran.

Science.gov (United States)

Zhand, Sareh; Tabarraei, Alijan; Nazari, Amineh; Moradi, Abdolvahab

2017-07-01

Hepatitis B virus (HBV) is vulnerable to many various mutations. Those within epitopes recognized by sensitized T cells may influence the re-emergence of the virus. This study was designed to investigate the mutation in immune epitope regions of HBV pre-core/core among chronic HBV patients of Golestan province, Northeast Iran. In 120 chronic HBV carriers, HBV DNA was extracted from blood plasma samples and PCR was done using specific primers. Direct sequencing and alignment of the pre-core/core region were applied using reference sequence from Gene Bank database (Accession Number AB033559). The study showed 27 inferred amino acid substitutions, 9 of which (33.3%) were in CD4 and 2 (7.4%) in cytotoxic T lymphocytes' (CTL) epitopes and 16 other mutations (59.2%) were observed in other regions. CTL escape mutations were not commonly observed in pre-core/core sequences of chronic HBV carriers in the locale of study. It can be concluded that most of the inferred amino acid substitutions occur in different immune epitopes other than CTL and CD4.

Human Adenovirus Core Protein V Is Targeted by the Host SUMOylation Machinery To Limit Essential Viral Functions.

Science.gov (United States)

Freudenberger, Nora; Meyer, Tina; Groitl, Peter; Dobner, Thomas; Schreiner, Sabrina

2018-02-15

Human adenoviruses (HAdV) are nonenveloped viruses containing a linear, double-stranded DNA genome surrounded by an icosahedral capsid. To allow proper viral replication, the genome is imported through the nuclear pore complex associated with viral core proteins. Until now, the role of these incoming virion proteins during the early phase of infection was poorly understood. The core protein V is speculated to bridge the core and the surrounding capsid. It binds the genome in a sequence-independent manner and localizes in the nucleus of infected cells, accumulating at nucleoli. Here, we show that protein V contains conserved SUMO conjugation motifs (SCMs). Mutation of these consensus motifs resulted in reduced SUMOylation of the protein; thus, protein V represents a novel target of the host SUMOylation machinery. To understand the role of protein V SUMO posttranslational modification during productive HAdV infection, we generated a replication-competent HAdV with SCM mutations within the protein V coding sequence. Phenotypic analyses revealed that these SCM mutations are beneficial for adenoviral replication. Blocking protein V SUMOylation at specific sites shifts the onset of viral DNA replication to earlier time points during infection and promotes viral gene expression. Simultaneously, the altered kinetics within the viral life cycle are accompanied by more efficient proteasomal degradation of host determinants and increased virus progeny production than that observed during wild-type infection. Taken together, our studies show that protein V SUMOylation reduces virus growth; hence, protein V SUMOylation represents an important novel aspect of the host antiviral strategy to limit virus replication and thereby points to potential intervention strategies. IMPORTANCE Many decades of research have revealed that HAdV structural proteins promote viral entry and mainly physical stability of the viral genome in the capsid. Our work over the last years showed that this

Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Genome-Wide Typing of Clostridium difficile.

Science.gov (United States)

Bletz, Stefan; Janezic, Sandra; Harmsen, Dag; Rupnik, Maja; Mellmann, Alexander

2018-06-01

Clostridium difficile , recently renamed Clostridioides difficile , is the most common cause of antibiotic-associated nosocomial gastrointestinal infections worldwide. To differentiate endogenous infections and transmission events, highly discriminatory subtyping is necessary. Today, methods based on whole-genome sequencing data are increasingly used to subtype bacterial pathogens; however, frequently a standardized methodology and typing nomenclature are missing. Here we report a core genome multilocus sequence typing (cgMLST) approach developed for C. difficile Initially, we determined the breadth of the C. difficile population based on all available MLST sequence types with Bayesian inference (BAPS). The resulting BAPS partitions were used in combination with C. difficile clade information to select representative isolates that were subsequently used to define cgMLST target genes. Finally, we evaluated the novel cgMLST scheme with genomes from 3,025 isolates. BAPS grouping ( n = 6 groups) together with the clade information led to a total of 11 representative isolates that were included for cgMLST definition and resulted in 2,270 cgMLST genes that were present in all isolates. Overall, 2,184 to 2,268 cgMLST targets were detected in the genome sequences of 70 outbreak-associated and reference strains, and on average 99.3% cgMLST targets (1,116 to 2,270 targets) were present in 2,954 genomes downloaded from the NCBI database, underlining the representativeness of the cgMLST scheme. Moreover, reanalyzing different cluster scenarios with cgMLST were concordant to published single nucleotide variant analyses. In conclusion, the novel cgMLST is representative for the whole C. difficile population, is highly discriminatory in outbreak situations, and provides a unique nomenclature facilitating interlaboratory exchange. Copyright © 2018 American Society for Microbiology.

Prevalence of hepatitis B virus subgenotypes and basal core promoter, precore variants in patients with acute hepatitis B in central Vietnam.

Science.gov (United States)

Hayashi, Kazuhiko; Katano, Yoshiaki; Chuong, Tran Xuan; Takeda, Yasushi; Ishigami, Masatoshi; Itoh, Akihiro; Hirooka, Yoshiki; Nakano, Isao; Huy, Tran Van; Minh, Nguyen Ngoc; Diem, Tran thi Minh; An, Dong thi Hoai; Phiet, Pham Hoang; Goto, Hidemi

2009-01-01

Hepatitis B virus (HBV) has been classified into 8 genotypes that have different geographic distributions. The clinical outcomes of acute hepatitis are dependent on genotype. The aim of this study was to investigate the distribution of HBV subgenotypes and basal core promoter (BCP)/precore (PC) regions in acute hepatitis patients in Central Vietnam to clarify the distributions and the clinical and virological differences. 27 patients with acute hepatitis B were studied. HBV subgenotypes and BCP/PC variants were determined by direct sequencing of the preS, BCP/PC regions, respectively. HBV subgenotypes B4/Ba (n = 22) and C1/Cs (n = 5) were detected. Of the 27 patients, 3 developed fulminant hepatic failure, and all were infected with B4/Ba. Three patients had a BCP mutation, and 10 patients had a PC mutation in subgenotype B4/Ba. Three patients with C1/Cs had a BCP mutation. Two of 3 patients who progressed to fulminant hepatic failure had T1762, A1764, and A1896 simultaneously. None of the patients with acute, self-limited hepatitis carried these triple mutations. The prevalent HBV subgenotypes in patients with acute hepatitis B in Central Vietnam were B4/Ba and C1/Cs. BCP/PC variants have an association with the development of fulminant hepatic failure in subgenotype B4/Ba. Copyright 2009 S. Karger AG, Basel.

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

Science.gov (United States)

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

HCV IRES-mediated core expression in zebrafish.

Directory of Open Access Journals (Sweden)

Ye Zhao

Full Text Available The lack of small animal models for hepatitis C virus has impeded the discovery and development of anti-HCV drugs. HCV-IRES plays an important role in HCV gene expression, and is an attractive target for antiviral therapy. In this study, we report a zebrafish model with a biscistron expression construct that can co-transcribe GFP and HCV-core genes by human hepatic lipase promoter and zebrafish liver fatty acid binding protein enhancer. HCV core translation was designed mediated by HCV-IRES sequence and gfp was by a canonical cap-dependent mechanism. Results of fluorescence image and in situ hybridization indicate that expression of HCV core and GFP is liver-specific; RT-PCR and Western blotting show that both core and gfp expression are elevated in a time-dependent manner for both transcription and translation. It means that the HCV-IRES exerted its role in this zebrafish model. Furthermore, the liver-pathological impact associated with HCV-infection was detected by examination of gene markers and some of them were elevated, such as adiponectin receptor, heparanase, TGF-β, PDGF-α, etc. The model was used to evaluate three clinical drugs, ribavirin, IFNα-2b and vitamin B12. The results show that vitamin B12 inhibited core expression in mRNA and protein levels in dose-dependent manner, but failed to impact gfp expression. Also VB12 down-regulated some gene transcriptions involved in fat liver, liver fibrosis and HCV-associated pathological process in the larvae. It reveals that HCV-IRES responds to vitamin B12 sensitively in the zebrafish model. Ribavirin did not disturb core expression, hinting that HCV-IRES is not a target site of ribavirin. IFNα-2b was not active, which maybe resulted from its degradation in vivo for the long time. These findings demonstrate the feasibility of the zebrafish model for screening of anti-HCV drugs targeting to HCV-IRES. The zebrafish system provides a novel evidence of using zebrafish as a HCV model organism.

Analysis of dismantling possibility and unloading efforts of fuel assemblies from core of WWER

International Nuclear Information System (INIS)

Danilov, V.; Dobrov, V.; Semishkin, V.; Vasilchenko, I.

2006-01-01

The computation methods of optimal dismantling sequence of fuel assemblies (FA) from core of WWER after different operating periods and accident conditions are considered. The algorithms of fuel dismantling sequence are constructed both on the basis of analysis of mutual spacer grid overlaps of adjacent fuel assemblies and numerical structure analysis of efforts required for FA removal as FA heaving from the core. Computation results for core dismantling sequence after 3-year operating period and LB LOCA are presented in the paper

Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

KAUST Repository

Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2016-01-01

We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

KAUST Repository

Lafi, Feras Fawzi

2016-07-28

We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

Structural, evolutionary and genetic analysis of the histidine biosynthetic "core" in the genus Burkholderia.

Science.gov (United States)

Papaleo, Maria Cristiana; Russo, Edda; Fondi, Marco; Emiliani, Giovanni; Frandi, Antonio; Brilli, Matteo; Pastorelli, Roberta; Fani, Renato

2009-12-01

In this work a detailed analysis of the structure, the expression and the organization of his genes belonging to the core of histidine biosynthesis (hisBHAF) in 40 newly determined and 13 available sequences of Burkholderia strains was carried out. Data obtained revealed a strong conservation of the structure and organization of these genes through the entire genus. The phylogenetic analysis showed the monophyletic origin of this gene cluster and indicated that it did not undergo horizontal gene transfer events. The analysis of the intergenic regions, based on the substitution rate, entropy plot and bendability suggested the existence of a putative transcription promoter upstream of hisB, that was supported by the genetic analysis that showed that this cluster was able to complement Escherichia colihisA, hisB, and hisF mutations. Moreover, a preliminary transcriptional analysis and the analysis of microarray data revealed that the expression of the his core was constitutive. These findings are in agreement with the fact that the entire Burkholderiahis operon is heterogeneous, in that it contains "alien" genes apparently not involved in histidine biosynthesis. Besides, they also support the idea that the proteobacterial his operon was piece-wisely assembled, i.e. through accretion of smaller units containing only some of the genes (eventually together with their own promoters) involved in this biosynthetic route. The correlation existing between the structure, organization and regulation of his "core" genes and the function(s) they perform in cellular metabolism is discussed.

Genome Sequence of Bacillus velezensis S141, a New Strain of Plant Growth-Promoting Rhizobacterium Isolated from Soybean Rhizosphere.

Science.gov (United States)

Sibponkrung, Surachat; Kondo, Takahiko; Tanaka, Kosei; Tittabutr, Panlada; Boonkerd, Nantakorn; Teaumroong, Neung; Yoshida, Ken-Ichi

2017-11-30

Bacillus velezensis strain S141 is a plant growth-promoting rhizobacterium isolated from soybean ( Glycine max ) rhizosphere that enhances soybean growth, nodulation, and N 2 fixation efficiency by coinoculation with Bradyrhizobium diazoefficiens USDA110. The S141 genome was identified to comprise a 3,974,582-bp-long circular DNA sequence encoding at least 3,817 proteins. Copyright © 2017 Sibponkrung et al.

Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

Directory of Open Access Journals (Sweden)

Sheila M Reynolds

2010-07-01

Full Text Available DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the

Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

Science.gov (United States)

Reynolds, Sheila M; Bilmes, Jeff A; Noble, William Stafford

2010-07-08

DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

Promoter characterization and genomic organization of the human X11β gene APBA2.

LENUS (Irish Health Repository)

Hao, Yan

2012-02-15

Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

MELCOR 1.8.2 calculations of selected sequences for the ABWR

International Nuclear Information System (INIS)

Kmetyk, L.N.

1994-07-01

This report summarizes the results from MELCOR calculations of severe accident sequences in the ABWR and presents comparisons with MAAP calculations for the same sequences. MELCOR was run for two low-pressure and three high-pressure sequences to identify the materials which enter containment and are available for release to the environment (source terms), to study the potential effects of core-concrete interaction, and to obtain event timings during each sequence; the source terms include fission products and other materials such as those generated by core-concrete interactions. Sensitivity studies were done on the impact of assuming limestone rather than basaltic concrete and on the effect of quenching core debris in the cavity compared to having hot, unquenched debris present

Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

Energy Technology Data Exchange (ETDEWEB)

Ferrari, S; Drusiani, E; Battini, R; Fregni, M

1988-01-11

Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

What do health-promoting schools promote?

DEFF Research Database (Denmark)

Simovska, Venka

2012-01-01

-promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

Science.gov (United States)

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

Science.gov (United States)

Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

2013-12-01

Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

Cross-species mapping of bidirectional promoters enables prediction of unannotated 5' UTRs and identification of species-specific transcripts

Directory of Open Access Journals (Sweden)

Lewin Harris A

2009-04-01

Full Text Available Abstract Background Bidirectional promoters are shared regulatory regions that influence the expression of two oppositely oriented genes. This type of regulatory architecture is found more frequently than expected by chance in the human genome, yet many specifics underlying the regulatory design are unknown. Given that the function of most orthologous genes is similar across species, we hypothesized that the architecture and regulation of bidirectional promoters might also be similar across species, representing a core regulatory structure and enabling annotation of these regions in additional mammalian genomes. Results By mapping the intergenic distances of genes in human, chimpanzee, bovine, murine, and rat, we show an enrichment for pairs of genes equal to or less than 1,000 bp between their adjacent 5' ends ("head-to-head" compared to pairs of genes that fall in the same orientation ("head-to-tail" or whose 3' ends are side-by-side ("tail-to-tail". A representative set of 1,369 human bidirectional promoters was mapped to orthologous sequences in other mammals. We confirmed predictions for 5' UTRs in nine of ten manual picks in bovine based on comparison to the orthologous human promoter set and in six of seven predictions in human based on comparison to the bovine dataset. The two predictions that did not have orthology as bidirectional promoters in the other species resulted from unique events that initiated transcription in the opposite direction in only those species. We found evidence supporting the independent emergence of bidirectional promoters from the family of five RecQ helicase genes, which gained their bidirectional promoters and partner genes independently rather than through a duplication process. Furthermore, by expanding our comparisons from pairwise to multispecies analyses we developed a map representing a core set of bidirectional promoters in mammals. Conclusion We show that the orthologous positions of bidirectional

Stellar evolution IV: evolution of a star of 1.5 M(S) from the main-sequence to the red-giant branch with and without overshooting from convective core

International Nuclear Information System (INIS)

Maeder, A.

1975-01-01

For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de

Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

KAUST Repository

Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

KAUST Repository

Lafi, Feras Fawzi

2017-03-03

Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

Research on dragons: a teaching sequence to promote the understanding of Nature of Science at Secondary School

Directory of Open Access Journals (Sweden)

Romero Ariza, Marta

2013-01-01

Full Text Available This paper presents a teaching sequence explicitly designed to improve the understanding of Nature of Science and support Secondary School students to acquire adequate understanding about scientific hypothesis, theories and laws. The instructional intervention engages students in an inquiry process where they have to formulate hypothesis, analyse data and draw conclusions based on evidence. It is a student-centred methodology where teachers act as facilitators and guides, promoting the development of scientific competences and the meaningful understanding of the terms hypothesis, law and theory.

Core-Plus Mathematics. What Works Clearinghouse Intervention Report

Science.gov (United States)

What Works Clearinghouse, 2010

2010-01-01

"Core-Plus Mathematics" is a four-year curriculum that replaces the traditional sequence with courses that each feature interwoven strands of algebra and functions, statistics and probability, geometry and trigonometry, and discrete mathematics. The first three courses in the series provide a common core of broadly useful mathematics,…

The AVRDC - The World Vegetable Center mungbean (Vigna radiata) core and mini core collections.

Science.gov (United States)

Schafleitner, Roland; Nair, Ramakrishnan Madhavan; Rathore, Abhishek; Wang, Yen-wei; Lin, Chen-yu; Chu, Shu-hui; Lin, Pin-yun; Chang, Jian-Cheng; Ebert, Andreas W

2015-04-29

Large ex situ germplasm collections generally harbor a wide range of crop diversity. AVRDC--The World Vegetable Center is holding in trust the world's second largest mungbean (Vigna radiata) germplasm collection with more than 6,700 accessions. Screening large collections for traits of interest is laborious and expensive. To enhance the access of breeders to the diversity of the crop, mungbean core and mini core collections have been established. The core collection of 1,481 entries has been built by random selection of 20% of the accessions after geographical stratification and subsequent cluster analysis of eight phenotypic descriptors in the whole collection. Summary statistics, especially the low differences of means, equal variance of the traits in both the whole and core collection and the visual inspection of quantile-quantile plots comparing the variation of phenotypic traits present in both collections indicated that the core collection well represented the pattern of diversity of the whole collection. The core collection was genotyped with 20 simple sequence repeat markers and a mini core set of 289 accessions was selected, which depicted the allele and genotype diversity of the core collection. The mungbean core and mini core collections plus their phenotypic and genotypic data are available for distribution to breeders. It is expected that these collections will enhance the access to biodiverse mungbean germplasm for breeding.

Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

Directory of Open Access Journals (Sweden)

Bouchra Kitab

Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

An improved method for quantitatively measuring the sequences of total organic carbon and black carbon in marine sediment cores

Science.gov (United States)

Xu, Xiaoming; Zhu, Qing; Zhou, Qianzhi; Liu, Jinzhong; Yuan, Jianping; Wang, Jianghai

2018-01-01

Understanding global carbon cycle is critical to uncover the mechanisms of global warming and remediate its adverse effects on human activities. Organic carbon in marine sediments is an indispensable part of the global carbon reservoir in global carbon cycling. Evaluating such a reservoir calls for quantitative studies of marine carbon burial, which closely depend on quantifying total organic carbon and black carbon in marine sediment cores and subsequently on obtaining their high-resolution temporal sequences. However, the conventional methods for detecting the contents of total organic carbon or black carbon cannot resolve the following specific difficulties, i.e., (1) a very limited amount of each subsample versus the diverse analytical items, (2) a low and fluctuating recovery rate of total organic carbon or black carbon versus the reproducibility of carbon data, and (3) a large number of subsamples versus the rapid batch measurements. In this work, (i) adopting the customized disposable ceramic crucibles with the microporecontrolled ability, (ii) developing self-made or customized facilities for the procedures of acidification and chemothermal oxidization, and (iii) optimizing procedures and carbon-sulfur analyzer, we have built a novel Wang-Xu-Yuan method (the WXY method) for measuring the contents of total organic carbon or black carbon in marine sediment cores, which includes the procedures of pretreatment, weighing, acidification, chemothermal oxidation and quantification; and can fully meet the requirements of establishing their highresolution temporal sequences, whatever in the recovery, experimental efficiency, accuracy and reliability of the measurements, and homogeneity of samples. In particular, the usage of disposable ceramic crucibles leads to evidently simplify the experimental scenario, which further results in the very high recovery rates for total organic carbon and black carbon. This new technique may provide a significant support for

Evaluating Community Health Advisor (CHA) Core Competencies: The CHA Core Competency Retrospective Pretest/Posttest (CCCRP).

Science.gov (United States)

Story, Lachel; To, Yen M

2016-05-01

Health care and academic systems are increasingly collaborating with community health advisors (CHAs) to provide culturally relevant health interventions that promote sustained community transformation. Little attention has been placed on CHA training evaluation, including core competency attainment. This study identified common CHA core competencies, generated a theoretically based measure of those competencies, and explored psychometric properties of that measure. A concept synthesis revealed five CHA core competencies (leadership, translation, guidance, advocacy, and caring). The CHA Core Competency Retrospective Pretest/Posttest (CCCRP) resulted from that synthesis, which was administered using multiple approaches to individuals who previously received CHA training (N= 142). Exploratory factor analyses revealed a two-factor structure underlying the posttraining data, and Cronbach's alpha indicated high internal consistency. This study suggested some CHA core competencies might be more interrelated than previously thought, and two major competencies exist rather than five and supported the CCCRP's use to evaluate core competency attainment resulting from training. © The Author(s) 2014.

How Should the Graduate Economics Core Be Changed?

Science.gov (United States)

Abito, Jose Miguel; Borovickova, Katarina; Golden, Hays; Goldin, Jacob; Masten, Matthew A.; Morin, Miguel; Poirier, Alexandre; Pons, Vincent; Romem, Israel; Williams, Tyler; Yoon, Chamna

2011-01-01

The authors present suggestions by graduate students from a range of economics departments for improving the first-year core sequence in economics. The students identified a number of elements that should be added to the core: more training in building microeconomic models, a discussion of the methodological foundations of model-building, more…

Overview of JSPS Core-to-Core Program: Forming Research and Educational Hubs of Medical Physics.

Science.gov (United States)

Koizumi, Masahiko; Takashina, Masaaki

To foster medical physicists, we introduce the achievement we made since 2011 under the national research project of the Japan Society for the Promotion of Science (JSPS) Core-to-Core program; 'Forming Research and Educational Hubs of Medical Physics.' On this basis and under the JSPS program, we promoted research and educational exchange with Indiana University (IU) in USA, University of Groningen (The UG) in the Netherland and other cooperating institutions such as University of Minnesota (UM).A total of 23 students and researchers were sent. UG accepted the most among three institutions. In turn, 12 foreign researchers including post-doctor fellows came to Japan for academic seminars or educational lectures.Fifteen international seminars were held; 8 in Japan, 4 in USA, and 3 in the Netherland.Lots of achievement were made through these activities in 5 years. Total of 23 research topics at the international conferences were presented. Total of 12 articles were published in international journals.This program clearly promoted the establishment of international collaboration, and many young researchers and graduate students were exchanged and collaborated with foreign researchers.

Prenylcoumarins in One or Two Steps by a Microwave-Promoted Tandem Claisen Rearrangement/Wittig Olefination/Cyclization Sequence.

Science.gov (United States)

Schultze, Christiane; Schmidt, Bernd

2018-05-04

The one-pot synthesis of 8-prenylcoumarins from 1,1-dimethylallylated salicylaldehydes and the stabilized ylide [(ethoxycarbonyl)methylene]triphenylphosphorane under microwave conditions was found to have a limited scope. The sequence suffers from a difficult and sometimes low-yielding synthesis of the precursors and from a competing deprenylation upon microwave irradiation. This side reaction occurs in particular with electron rich arenes with two or more alkoxy groups at adjacent positions, a prominent substitution pattern in naturally occurring 8-prenylcoumarins. Both limitations of this one-step sequence were overcome by a two-step synthesis consisting of a microwave-promoted tandem allyl ether Claisen rearrangement/Wittig olefination and a subsequent olefin cross metathesis with 2-methyl-2-butene. The cross metathesis step proceeds with a high selectivity and yields exclusively the desired prenyl, rather than the alternative crotyl substituent. Several naturally occurring 8-prenylcoumarins that were previously inaccessible have been synthesized in good overall yields along this route.

Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

Directory of Open Access Journals (Sweden)

Zhang Hua

2006-08-01

Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

Endoplasmic reticulum targeting sequence enhances HBV-specific cytotoxic T lymphocytes induced by a CTL epitope-based DNA vaccine

International Nuclear Information System (INIS)

Xu Wei; Chu Yiwei; Zhang Ruihua; Xu Huanbin; Wang Ying; Xiong Sidong

2005-01-01

CD8 + T cells play a critical role in protective immunity against Hepatitis B Virus (HBV). Epitope-based DNA vaccines expressing HBV-dominant CTL epitopes can be used as candidate vaccines capable of inducing cytotoxic T Lymphocytes (CTL) responses. A plasmid DNA encoding a CTL epitope of HBV core antigen, HBc 18-27 , was constructed. Intramuscular immunization of C57BL/6 mice with this DNA vaccine resulted in successful induction of HBV-specific CTL responses. In order to promote transportation of the peptide into endoplasmic reticulum (ER) to bind to MHC class I molecules for optimal class I antigen presentation, an ER targeting sequence (ERTS) was fused with the C 18-27 encoding gene. ERTS fusion significantly enhanced specific CD8 + T cell responses in terms of CTL cytolysis as well as IFN-γ secretion. This enhancement was correlated with promoted epitope presentation on target cell surface. We report here an enhanced immunogenicity of an epitope-based DNA vaccine using an ER targeting signal sequence, which has significant implications for future design of therapeutic HBV vaccine

Binding of Pseudomonas aeruginosa Apo-Bacterioferritin Associated Ferredoxin to Bacterioferritin B Promotes Heme Mediation of Electron Delivery and Mobilization of Core Mineral Iron†

Science.gov (United States)

Weeratunga, Saroja K.; Gee, Casey E.; Lovell, Scott; Zeng, Yuhong; Woodin, Carrie L.; Rivera, Mario

2009-01-01

The bfrB gene from Pseudomonas aeruginosa was cloned and expressed in E. coli. The resultant protein (BfrB), which assembles into a 445.3 kDa complex0020from 24 identical subunits, binds 12 molecules of heme axially coordinated by two Met residues. BfrB, isolated with 5–10 iron atoms per protein molecule, was reconstituted with ferrous ions to prepare samples with a core mineral containing 600 ± 40 ferric ions per BfrB molecule and approximately one phosphate molecule per iron atom. In the presence of sodium dithionite or in the presence of P. aeruginosa ferredoxin NADP reductase (FPR) and NADPH the heme in BfrB remains oxidized and the core iron mineral is mobilized sluggishly. In stark contrast, addition of NADPH to a solution containing BfrB, FPR and the apo-form of P. aeruginosa bacterioferritin associated ferredoxin (apo-Bfd) results in rapid reduction of the heme in BfrB and in the efficient mobilization of the core iron mineral. Results from additional experimentation indicate that Bfd must bind to BfrB to promote heme mediation of electrons from the surface to the core to support the efficient mobilization of ferrous ions from BfrB. In this context, the thus far mysterious role of heme in bacterioferritins has been brought to the front by reconstituting BfrB with its physiological partner, apo-Bfd. These findings are discussed in the context of a model for the utilization of stored iron in which the significant upregulation of the bfd gene under low-iron conditions [Ochsner, U.A., Wilderman, P.J., Vasil, A.I., and Vasil, M.L. (2002) Mol. Microbiol. 45, 1277–1287] ensures sufficient concentrations of apo-Bfd to bind BfrB and unlock the iron stored in its core. Although these findings are in contrast to previous speculations suggesting redox mediation of electron transfer by holo-Bfd, the ability of apo-Bfd to promote iron mobilization is an economical strategy used by the cell because it obviates the need to further deplete cellular iron levels to

In-core fuel management via perturbation theory

International Nuclear Information System (INIS)

Mingle, J.O.

1975-01-01

A two-step procedure is developed for the optimization of in-core nuclear fuel management using perturbation theory to predict the effects of various core configurations. The first procedure is a cycle cost minimization using linear programming with a zoned core and discrete burnup groups. The second program utilizes an individual fuel assembly shuffling sequence to minimize the maldistribution of power generation. This latter quantity is represented by a figure of merit or by an assembly power peaking factor. A pressurized water reactor example calculation is utilized. 24 references

Analysis of hepatitis C virus RNA dimerization and core-RNA interactions.

Science.gov (United States)

Ivanyi-Nagy, Roland; Kanevsky, Igor; Gabus, Caroline; Lavergne, Jean-Pierre; Ficheux, Damien; Penin, François; Fossé, Philippe; Darlix, Jean-Luc

2006-01-01

The core protein of hepatitis C virus (HCV) has been shown previously to act as a potent nucleic acid chaperone in vitro, promoting the dimerization of the 3'-untranslated region (3'-UTR) of the HCV genomic RNA, a process probably mediated by a small, highly conserved palindromic RNA motif, named DLS (dimer linkage sequence) [G. Cristofari, R. Ivanyi-Nagy, C. Gabus, S. Boulant, J. P. Lavergne, F. Penin and J. L. Darlix (2004) Nucleic Acids Res., 32, 2623-2631]. To investigate in depth HCV RNA dimerization, we generated a series of point mutations in the DLS region. We find that both the plus-strand 3'-UTR and the complementary minus-strand RNA can dimerize in the presence of core protein, while mutations in the DLS (among them a single point mutation that abolished RNA replication in a HCV subgenomic replicon system) completely abrogate dimerization. Structural probing of plus- and minus-strand RNAs, in their monomeric and dimeric forms, indicate that the DLS is the major if not the sole determinant of UTR RNA dimerization. Furthermore, the N-terminal basic amino acid clusters of core protein were found to be sufficient to induce dimerization, suggesting that they retain full RNA chaperone activity. These findings may have important consequences for understanding the HCV replicative cycle and the genetic variability of the virus.

Promoter reuse in prokaryotes

NARCIS (Netherlands)

Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

2012-01-01

Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

Investigation of genome sequences within the family Pasteurellaceae

DEFF Research Database (Denmark)

Angen, Øystein; Ussery, David

Introduction The bacterial genome sequences are now available for an increasing number of strains within the family Pasteurellaceae. At present, 24 Pasteurellaceae genomes are publicly available through internet databases, and another 40 genomes are being sequenced. This investigation will describe...... the core genome for both the family Pasteurellaceae and for the species Haemophilus influenzae. Methods Twenty genome sequences from the following species were included: Haemophilus influenzae (11 strains), Haemophilus ducreyi (1 strain), Histophilus somni (2 strains), Haemophilus parasuis (1 strain......), Actinobacillus pleuropneumoniae (2 strains), Actinobacillus succinogenes (1 strain), Mannheimia succiniciproducens (1 strain), and Pasteurella multocida (1 strain). The predicted proteins for each genome were BLASTed against each other, and a set of conserved core gene families was determined as described...

Textual Demands of Passages in Three English/Language Arts Common Core Assessments and One Core Literacy Program for Intermediate Elementary Grades

Science.gov (United States)

Morrison, Timothy G.; Wilcox, Brad; Murdoch, Erica; Bird, Lauren

2018-01-01

The Common Core has emphasized reading for comprehension, including making inferences. However, little is known about the textual demands found within assessment and instructional passages that are promoted as being in line with Common Core expectations. The purpose of this content analysis was to identify the readability levels, passage length,…

Enhancement of RNA synthesis by promoter duplication in tombusviruses

International Nuclear Information System (INIS)

Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

2003-01-01

Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

International Nuclear Information System (INIS)

Depto, A.S.; Stenberg, R.M.

1989-01-01

To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

KAUST Repository

Umarov, Ramzan

2017-02-03

Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

Science.gov (United States)

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Characteristics of core sampling from crumbing Paleozoic rock

Energy Technology Data Exchange (ETDEWEB)

Barabashkin, I I; Edelman, Y A; Filippov, V N; Lychev, V N

1981-01-01

The results of analysis of core sampling using standard core sampling tools with small and medium inside diameter are cited. It is demonstrated that when using these tools loss of core in Paleozoic deposits promising with regard to oil and gas content does not exceed 25 - 30%. The use of a new core sampling tool with a large inside diameter which includes drill bits of different types and a core lifter ''Krembriy'' SKU-172/100 made it possible to increase core removal approximately 52%. A representative core from a highly crumbling and vesicular rock belinging to groups III - IV in terms of difficulty of core sampling was obtained first. A description of a new core sampling tool is given. The characteristics of the technology of its use which promote preservation of the core are cited. Means of continued improvement of this tool are noted.

Tools and applications for core design and shielding in fast reactors

International Nuclear Information System (INIS)

Rachamin, Reuven

2013-01-01

Outline: • Modeling of SFR cores using the Serpent-DYN3D code sequence; • Core shielding assessment for the design of FASTEF-MYRRHA; • Neutron shielding studies on an advanced Molten Salt Fast Reactor (MSFR) design

The Microsoft Biology Foundation Applications for High-Throughput Sequencing

Science.gov (United States)

Mercer, S.

2010-01-01

w9-2 The need for reusable libraries of bioinformatics functions has been recognized for many years and a number of language-specific toolkits have been constructed. Such toolkits have served as valuable nucleation points for the community, promoting the sharing of code and establishing standards. The majority of DNA sequencing machines and many other standard pieces of lab equipment are controlled by PCs using Windows, and a Microsoft genomics toolkit would enable initial processing and quality control to happen closer to the instrumentation and provide opportunities for added-value services within core facilities. The Microsoft Biology Foundation (MBF) is an open source software library, freely available for both commercial and academic use, available as an early-stage betafrom mbf.codeplex.com. This presentation will describe the structure and goals of MBF and demonstrate some of its uses.

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

International Nuclear Information System (INIS)

Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

2003-01-01

Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

Development of useful recombinant promoter and its expression analysis in different plant cells using confocal laser scanning microscopy.

Directory of Open Access Journals (Sweden)

Deepak Kumar

Full Text Available BACKGROUND: Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s. Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27 and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, -271 to +31. Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. CONCLUSION AND SIGNIFICANCE: We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in

Avascular bone necrosis: MR imaging findings before and after core decompression

International Nuclear Information System (INIS)

Adam, G.; Keulers, P.; Forst, J.; Neuerburg, J.; Kilbinger, M.; Guenther, R.W.

1995-01-01

17 patients with avascular epiphyseal necrosis were examined by MRI using T 1 -weighted spin echo sequences before and after gadopentetate dimeglumine application, T 2 -weighted spin echo sequences and in some patients with fat-saturated 2D gradient echo sequences up to 22 months after core decompression. All patients but one recovered from symptoms after core decompression. Although the signal morphology of the necrotic area remained unchanged in the majority of the cases, a decrease of the joint effusion was observed as well as an ongoing signal increase after gadopentetate dimeglumine application. The last examinations displayed similar signal characteristics as on the preoperative scans; however, a reduction of the necrotic zone became evident. (orig./MG) [de

Genome-wide detection and analysis of hippocampus core promoters using DeepCAGE

DEFF Research Database (Denmark)

Valen, Eivind; Pascarella, Giovanni; Chalk, Alistair

2009-01-01

in a given tissue. Here, we present a new method for high-throughput sequencing of 5' cDNA tags-DeepCAGE: merging the Cap Analysis of Gene Expression method with ultra-high-throughput sequence technology. We apply DeepCAGE to characterize 1.4 million sequenced TSS from mouse hippocampus and reveal a wealth...

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

Science.gov (United States)

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Pre-main sequence sun: a dynamic approach

International Nuclear Information System (INIS)

Newman, M.J.; Winkler, K.H.A.

1979-01-01

The classical pre-main sequence evolutionary behavior found by Hayashi and his coworkers for the Sun depends crucially on the choice of initial conditions. The Hayashi picture results from beginning the calculation with an already centrally condensed, highly Jeans unstable object not terribly far removed from the stellar state initially. The present calculation follows the work of Larson in investigating the hydrodynamic collapse and self-gravitational accretion of an initially uniform, just Jeans unstable interstellar gas-dust cloud. The resulting picture for the early history of the Sun is quite different from that found by Hayashi. A rather small (R approx. = 2 R/sub sun/), low-luminosity (L greater than or equal to L/sub sun/) protostellar core develops. A fully convective stellar core, characteristic of Hayashi's work, is not found during the accretion process, and can only develop, if at all, in the subsequent pre-main sequence Kelvin-Helmholtz contraction of the core. 3 figures, 1 table

Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

Science.gov (United States)

Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

2016-10-15

Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

Prediction of Hydrophobic Cores of Proteins Using Wavelet Analysis.

Science.gov (United States)

Hirakawa; Kuhara

1997-01-01

Information concerning the secondary structures, flexibility, epitope and hydrophobic regions of amino acid sequences can be extracted by assigning physicochemical indices to each amino acid residue, and information on structure can be derived using the sliding window averaging technique, which is in wide use for smoothing out raw functions. Wavelet analysis has shown great potential and applicability in many fields, such as astronomy, radar, earthquake prediction, and signal or image processing. This approach is efficient for removing noise from various functions. Here we employed wavelet analysis to smooth out a plot assigned to a hydrophobicity index for amino acid sequences. We then used the resulting function to predict hydrophobic cores in globular proteins. We calculated the prediction accuracy for the hydrophobic cores of 88 representative set of proteins. Use of wavelet analysis made feasible the prediction of hydrophobic cores at 6.13% greater accuracy than the sliding window averaging technique.

Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

Directory of Open Access Journals (Sweden)

Aaron Silva-Sanchez

Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

Atucha-I source terms for sequences initiated by transients

International Nuclear Information System (INIS)

Baron, J.; Bastianelli, B.

1997-01-01

The present work is part of an expected source terms study in the Atucha I nuclear power plant during severe accidents. From the accident sequences with a significant probability to produce core damage, those initiated by operational transients have been identified as the most relevant. These sequences have some common characteristics, in the sense that all of them resume in the opening of the primary system safety valves, and leave this path open for the coolant loss. In the case these sequences continue as severe accidents, the same path will be used for the release of the radionuclides, from the core, through the primary system and to the containment. Later in the severe accident sequence, the failure of the pressure vessel will occur, and the corium will fall inside the reactor cavity, interacting with the concrete. During these processes, more radioactive products will be released inside the containment. In the present work the severe accident simulation initiated by a blackout is performed, from the point of view of the phenomenology of the behavior of the radioactive products, as they are transported in the piping, during the core-concrete interactions, and inside the containment buildings until it failure. The final result is the source term into the atmosphere. (author) [es

DNA structure in human RNA polymerase II promoters

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

1998-01-01

with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...

Effects of methodic deficiencies on the quantification of core meltdown frequency

International Nuclear Information System (INIS)

Hahn, L.

1984-01-01

The application of sequence of events and fault tree analyses for the assessment of the core meltdown frequency raises problems, most of which can be classified under: - Completeness and representativeness of sequences and cuases of events - Modelling of conditional outages (common-mode outages) - Modelling of human behaviour - Reliability data and models. All of the weak points of the German Risk Study related to these problems which are mentioned by the Ecological Institute show a tendency to underestimate the core meltdown frequency by a factor at least 6. (RF) [de

Learning a Weighted Sequence Model of the Nucleosome Core and Linker Yields More Accurate Predictions in Saccharomyces cerevisiae and Homo sapiens

Science.gov (United States)

Reynolds, Sheila M.; Bilmes, Jeff A.; Noble, William Stafford

2010-01-01

DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence—301 base pairs, centered at the position to be scored—with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

Composing a Tumor Specific Bacterial Promoter.

Directory of Open Access Journals (Sweden)

Igor V Deyneko

Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

Core principles of evolutionary medicine

Science.gov (United States)

Grunspan, Daniel Z; Nesse, Randolph M; Barnes, M Elizabeth; Brownell, Sara E

2018-01-01

Abstract Background and objectives Evolutionary medicine is a rapidly growing field that uses the principles of evolutionary biology to better understand, prevent and treat disease, and that uses studies of disease to advance basic knowledge in evolutionary biology. Over-arching principles of evolutionary medicine have been described in publications, but our study is the first to systematically elicit core principles from a diverse panel of experts in evolutionary medicine. These principles should be useful to advance recent recommendations made by The Association of American Medical Colleges and the Howard Hughes Medical Institute to make evolutionary thinking a core competency for pre-medical education. Methodology The Delphi method was used to elicit and validate a list of core principles for evolutionary medicine. The study included four surveys administered in sequence to 56 expert panelists. The initial open-ended survey created a list of possible core principles; the three subsequent surveys winnowed the list and assessed the accuracy and importance of each principle. Results Fourteen core principles elicited at least 80% of the panelists to agree or strongly agree that they were important core principles for evolutionary medicine. These principles over-lapped with concepts discussed in other articles discussing key concepts in evolutionary medicine. Conclusions and implications This set of core principles will be helpful for researchers and instructors in evolutionary medicine. We recommend that evolutionary medicine instructors use the list of core principles to construct learning goals. Evolutionary medicine is a young field, so this list of core principles will likely change as the field develops further. PMID:29493660

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

International Nuclear Information System (INIS)

Adámik, Matej; Bažantová, Pavla; Navrátilová, Lucie; Polášková, Alena; Pečinka, Petr; Holaňová, Lucie; Tichý, Vlastimil; Brázdová, Marie

2015-01-01

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

Energy Technology Data Exchange (ETDEWEB)

Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

2015-01-02

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

Amyloid cores in prion domains: Key regulators for prion conformational conversion.

Science.gov (United States)

Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador

2017-01-02

Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.

pyPaSWAS : Python-based multi-core CPU and GPU sequence alignment

NARCIS (Netherlands)

Warris, Sven; Timal, N Roshan N; Kempenaar, Marcel; Poortinga, Arne M; van de Geest, Henri; Varbanescu, Ana L; Nap, Jan-Peter

2018-01-01

BACKGROUND: Our previously published CUDA-only application PaSWAS for Smith-Waterman (SW) sequence alignment of any type of sequence on NVIDIA-based GPUs is platform-specific and therefore adopted less than could be. The OpenCL language is supported more widely and allows use on a variety of

Dominant accident sequences in Oconee-1 pressurized water reactor

International Nuclear Information System (INIS)

Dearing, J.F.; Henninger, R.J.; Nassersharif, B.

1985-04-01

A set of dominant accident sequences in the Oconee-1 pressurized water reactor was selected using probabilistic risk analysis methods. Because some accident scenarios were similar, a subset of four accident sequences was selected to be analyzed with the Transient Reactor Analysis Code (TRAC) to further our insights into similar types of accidents. The sequences selected were loss-of-feedwater, small-small break loss-of-coolant, loss-of-feedwater-initiated transient without scram, and interfacing systems loss-of-coolant accidents. The normal plant response and the impact of equipment availability and potential operator actions were also examined. Strategies were developed for operator actions not covered in existing emergency operator guidelines and were tested using TRAC simulations to evaluate their effectiveness in preventing core uncovery and maintaining core cooling

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

Science.gov (United States)

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

2015-01-01

Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

Core design methods for advanced LMFBRs

International Nuclear Information System (INIS)

Chandler, J.C.; Marr, D.R.; McCurry, D.C.; Cantley, D.A.

1977-05-01

The multidiscipline approach to advanced LMFBR core design requires an iterative design procedure to obtain a closely-coupled design. HEDL's philosophy requires that the designs should be coupled to the extent that the design limiting fuel pin, the design limiting duct and the core reactivity lifetime should all be equal and should equal the fuel residence time. The design procedure consists of an iterative loop involving three stages of the design sequence. Stage 1 consists of general mechanical design and reactor physics scoping calculations to arrive at an initial core layout. Stage 2 consists of detailed reactor physics calculations for the core configuration arrived at in Stage 1. Based upon the detailed reactor physics results, a decision is made either to alter the design (Stage 1) or go to Stage 3. Stage 3 consists of core orificing and detailed component mechanical design calculations. At this point, an assessment is made regarding design adequacy. If the design is inadequate the entire procedure is repeated until the design is acceptable

A sequence of events across the Cretaceous-Tertiary boundary

NARCIS (Netherlands)

Smit, J.; Romein, A.J.T.

1985-01-01

The lithological and biological sequence of events across the Cretaceous-Tertiary (K/T), as developed in thick and complete landbased sections and termed the standard K/T event sequence, is also found in many DSDP cores from all over the globe. Microtektite-like spherules have been found in

The whole set of constitutive promoters recognized by RNA polymerase RpoD holoenzyme of Escherichia coli.

Directory of Open Access Journals (Sweden)

Tomohiro Shimada

Full Text Available The promoter selectivity of Escherichia coli RNA polymerase is determined by the sigma subunit with promoter recognition activity. The model prokaryote Escherichia coli contains seven species of the sigma subunit, each recognizing a specific set of promoters. The major sigma subunit, sigma-70 encoded by rpoD, plays a major role in transcription of growth-related genes. Concomitant with the increase in detection of promoters functioning in vivo under various stressful conditions, the variation is expanding in the consensus sequence of RpoD promoters. In order to identify the canonical sequence of "constitutive promoters" that are recognized by the RNA polymerase holoenzyme containing RpoD sigma in the absence of supporting transcription factors, an in vitro mixed transcription assay was carried out using a whole set of variant promoters, each harboring one base replacement, within the model promoter with the conserved -35 and -10 sequences of RpoD promoters. The consensus sequences, TTGACA(-35 and TATAAT(-10, were identified to be ideal for the maximum level of open complex formation and the highest rate of promoter opening, respectively. For identification of the full range of constitutive promoters on the E. coli genome, a total of 2,701 RpoD holoenzyme-binding sites were identified by Genomic SELEX screening, and using the reconfirmed consensus promoter sequence, a total of maximum 669 constitutive promoters were identified, implying that the majority of hitherto identified promoters represents the TF-dependent "inducible promoters". One unique feature of the constitutive promoters is the high level of promoter sequence conservation, about 85% carrying five-out-of-six agreements with -35 or -10 consensus sequence. The list of constitutive promoters provides the community resource toward estimation of the inducible promoters that operate under various stressful conditions in nature.

Development of accident sequence precursors methodologies for core damage Probabilities in NPPs

International Nuclear Information System (INIS)

Munoz, R.; Minguez, E.; Melendez, E.; Sanchez-Perea, M.; Izquierdo, J.M.

1998-01-01

Several licensing programs have focused on the evaluation of the importance of operating events occurred in NPPs. Some have worked the dynamic aspects of the sequence of events involved, reproducing the incidents, while others are based on PSA applications to incident analysis. A method that controls the two above approaches to determine risk analysis derives from the Integrated Safety Assessment methodology (ISA). The dynamics of the event is followed by transient simulation in tree form, building a Setpoint or Deterministic Dynamic Event Tree (DDET). When a setpoint is reached, the actuation of a protection is triggered, then the tree is opened in branches corresponding to different functioning states. The engineering simulator with the new states followers each branch. One of these states is the nominal one, which is the PSA is associated to the success criterion of the system. The probability of the sequence is calculated in parallel to the dynamics. The following tools should perform the couple simulation: 1. A Scheduler that drives the simulation of the different sequences, and open branches upon demand. It will be the unique generator of processes while constructing the tree calculation, and will develop the computation in a distributed computational environment. 2. The Plant Simulator, which models the plant systems and the operator actions throughout a sequence. It receives the state of the equipment in each sequence and must provide information about setpoint crossing to the Scheduler. It will receive decision flags to continue or to stop each sequence, and to send new conditions to other plant simulators. 3. The Probability Calculator, linked only to the Scheduler, is the fault trees associated with each event tree header and performing their Boolean product. (Author)

Parallel motif extraction from very long sequences

KAUST Repository

Sahli, Majed

2013-01-01

Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).

Artificial promoter libraries for selected organisms and promoters derived from such libraries

DEFF Research Database (Denmark)

1998-01-01

or organisms may be selected from prokaryotes and from eukaryotes; and in prokaryotes the consensus sequences to be retained most often will comprise the -35 signal (-35 to -30): TTGACA and the -10 signal (-12 to -7): TATAAT or parts of both comprising at least 3 conserved nucleotides of each, while...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....

Regulatory sequence of cupin family gene

Science.gov (United States)

Hood, Elizabeth; Teoh, Thomas

2017-07-25

This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

Core Knowledge and Standards: A Conversation with E.D. Hirsch, Jr.

Science.gov (United States)

O'Neil, John

1999-01-01

Hirsch believes it is vitally important to specify the "core knowledge" that all students must learn. Here, Hirsch explains elements of his K-8 core-knowledge sequence. Teachers should avoid canned lessons but should know where they are going. New English standards are unacceptable, since they omit Shakespeare's works. (MLH)

Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

Science.gov (United States)

Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

2015-01-01

Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

ISOLASI DAN KARAKTERISASI PROMOTER β-ACTIN DARI IKAN KERAPU BEBEK (Cromileptes altivelis

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2016-11-01

Promoter as gene expression regulator is one of the factors affecting the successful of transgenesis. Isolation and characterization of β -actin promoter (ktBA from humpback grouper (Cromileptes altivelis towards generation of autotransgenic grouper have been conducted.  β -actin promoter has high activity in muscle. Sequence of ktBA promoter was isolated by using degenerate PCR method. Sequencing was performed using ABI PRISM 3100 machine. Analysis of sequences was conducted using BLAST, GENETYX version 7 and TFBind softwares. DNA fragment of PCR amplification product digested from the vector cloning was then ligated with pEGFPN1 to generate pktBA-GFP construct. The construct was microinjected into one-cell stage of zebrafish (Danio rerio embryos to test the ktBA promoter activity. EGFP gene expression was observed by fluorescence microscope. The result of sequence analysis showed that the length of DNA fragment obtained is about 1.6 kb and containing the evolutionary conserved sequences of transcription factor for β -actin promoter including CCAAT, CArG and TATA boxes. Furthermore, ktBA sequence in pktBA-EGFP construct could drove GFP expression in muscle of zebrafish embryos injected with the construct. The results suggested that PCR amplification product is the regulator sequence of humpback grouper β -actin gene. Autotransgenic grouper can be then produced by changing GFP gene fragment of pktBA-EGFP construct with genes from grouper encoding important traits in aquaculture.

Analysis and research status of severe core damage accidents

International Nuclear Information System (INIS)

1984-03-01

The Severe Core Damage Research and Analysis Task Force was established in Nuclear Safety Research Center, Tokai Research Establishment, JAERI, in May, 1982 to make a quantitative analysis on the issues related with the severe core damage accident and also to survey the present status of the research and provide the required research subjects on the severe core damage accident. This report summarizes the results of the works performed by the Task Force during last one and half years. The main subjects investigated are as follows; (1) Discussion on the purposes and necessities of severe core damage accident research, (2) proposal of phenomenological research subjects required in Japan, (3) analysis of severe core damage accidents and identification of risk dominant accident sequences, (4) investigation of significant physical phenomena in severe core damage accidents, and (5) survey of the research status. (author)

Conceptualizations of professional competencies in school health promotion

DEFF Research Database (Denmark)

Carlsson, Monica Susanne

2016-01-01

Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...... delineates an overall professional competency model for SHP, discusses the specific demands on professional competencies within this field in relation to this model, and addresses three critical gaps in the conceptualizations of competency. Keywords: Professionals, competence, school health promotion Paper...... by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...

Conceptualizations of professional competencies in school health promotion

DEFF Research Database (Denmark)

Carlsson, Monica Susanne

2016-01-01

by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...... delineates an overall professional competency model for SHP, discusses the specific demands on professional competencies within this field in relation to this model, and addresses three critical gaps in the conceptualizations of competency. Keywords: Professionals, competence, school health promotion Paper......Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...

Conceptualizations of professional competencies in school health promotion

DEFF Research Database (Denmark)

Carlsson, Monica Susanne

2016-01-01

Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...... by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...... domains: 1) policy-development, 2) organizational development, 3) professional development, 4) development of students’ learning, and 5) development of health promotion activities. Three critical gaps in the conceptualizations of competency domains and elements are identified and discussed: 1...

Analysis of core damage frequency: Surry, Unit 1 internal events

International Nuclear Information System (INIS)

Bertucio, R.C.; Julius, J.A.; Cramond, W.R.

1990-04-01

This document contains the accident sequence analysis of internally initiated events for the Surry Nuclear Station, Unit 1. This is one of the five plant analyses conducted as part of the NUREG-1150 effort by the Nuclear Regulatory Commission. NUREG-1150 documents the risk of a selected group of nuclear power plants. The work performed and described here is an extensive of that published in November 1986 as NUREG/CR-4450, Volume 3. It addresses comments form numerous reviewers and significant changes to the plant systems and procedures made since the first report. The uncertainty analysis and presentation of results are also much improved. The context and detail of this report are directed toward PRA practitioners who need to know how the work was performed and the details for use in further studies. The mean core damage frequency at Surry was calculated to be 4.05-E-5 per year, with a 95% upper bound of 1.34E-4 and 5% lower bound of 6.8E-6 per year. Station blackout type accidents (loss of all AC power) were the largest contributors to the core damage frequency, accounting for approximately 68% of the total. The next type of dominant contributors were Loss of Coolant Accidents (LOCAs). These sequences account for 15% of core damage frequency. No other type of sequence accounts for more than 10% of core damage frequency. 49 refs., 52 figs., 70 tabs

The Harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes.

Science.gov (United States)

Treangen, Todd J; Ondov, Brian D; Koren, Sergey; Phillippy, Adam M

2014-01-01

Whole-genome sequences are now available for many microbial species and clades, however existing whole-genome alignment methods are limited in their ability to perform sequence comparisons of multiple sequences simultaneously. Here we present the Harvest suite of core-genome alignment and visualization tools for the rapid and simultaneous analysis of thousands of intraspecific microbial strains. Harvest includes Parsnp, a fast core-genome multi-aligner, and Gingr, a dynamic visual platform. Together they provide interactive core-genome alignments, variant calls, recombination detection, and phylogenetic trees. Using simulated and real data we demonstrate that our approach exhibits unrivaled speed while maintaining the accuracy of existing methods. The Harvest suite is open-source and freely available from: http://github.com/marbl/harvest.

Accident sequence quantification with KIRAP

Energy Technology Data Exchange (ETDEWEB)

Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

1997-01-01

The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.

Accident sequence quantification with KIRAP

International Nuclear Information System (INIS)

Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

1997-01-01

The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

Science.gov (United States)

Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

2017-06-20

Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Directory of Open Access Journals (Sweden)

Graziele Pereira Oliveira

2017-01-01

Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Science.gov (United States)

Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

2017-01-01

For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Core sequence of PAPf39 amyloid fibrils and mechanism of pH-dependent fibril formation: the role of monomer conformation.

Science.gov (United States)

French, Kinsley C; Makhatadze, George I

2012-12-21

PAPf39, a 39-residue peptide fragment from human prostatic acidic phosphatase, has been shown to form amyloid fibrils in semen (SEVI), which increase HIV infectivity by up to 5 orders of magnitude. The sequence of the PAPf39 fibrillar core was identified using hydrogen-deuterium exchange (HDX) mass spectrometry and protease protection assays. The central and C-terminal regions are highly protected from HDX and proteolytic cleavage and, thus, are part of the fibrillar core. Conversely, the N-terminal region is unprotected from HDX and proteolytic cleavage, suggesting that it is exposed and not part of the fibrillar core. This finding was tested using two N-terminal truncated variants, PAPf39Δ1-8 and PAPf39Δ1-13. Both variants formed amyloid fibrils at neutral pH. However, these variants showed a markedly different pH dependence of fibril formation versus that of PAPf39. PAPf39 fibrils can form at pH 7.7, but not at pH 5.5 or 2.5, while both N-terminally truncated variants can form fibrils at these pH values. Thus, the N-terminal region is not necessary for fibril formation but modulates the pH dependence of PAPf39 fibril formation. PAPf39Δ1-8 and PAPf39Δ1-13 are capable of seeding PAPf39 fibril formation at neutral pH, suggesting that these variants are structurally compatible with PAPf39, yet no mixed fibril formation occurs between the truncated variants and PAPf39 at low pH. This suggests that pH affects the PAPf39 monomer conformational ensemble, which is supported by far-UV circular dichroism spectroscopy. A conceptual model describing the pH dependence of PAPf39 aggregation is proposed and provides potential biological implications.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

Science.gov (United States)

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

Energy Technology Data Exchange (ETDEWEB)

Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

1994-09-01

The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

Status of the TMI-2 core: a review of damage assessments

International Nuclear Information System (INIS)

Croucher, D.W.

1981-01-01

Assessments of the damage within the core of the Three Mile Island Unit 2 reactor, performed by reconstructing the transient thermal-hydraulic sequence of events, estimating the amount of hydrogen generation, and evaluating the amount of fission products released, are reviewed and summarized. Minimum and maximum bounds of damage to the core are identified

Systematic search for the Cra-binding promoters using genomic SELEX system.

Science.gov (United States)

Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira

2005-09-01

Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.

THE BLUE STRAGGLER STAR POPULATION IN NGC 1261: EVIDENCE FOR A POST-CORE-COLLAPSE BOUNCE STATE

International Nuclear Information System (INIS)

Simunovic, Mirko; Puzia, Thomas H.; Sills, Alison

2014-01-01

We present a multi-passband photometric study of the Blue Straggler Star (BSS) population in the Galactic globular cluster (GC) NGC 1261, using available space- and ground-based survey data. The inner BSS population is found to have two distinct sequences in the color-magnitude diagram (CMD), similar to double BSS sequences detected in other GCs. These well defined sequences are presumably linked to single short-lived events such as core collapse, which are expected to boost the formation of BSSs. In agreement with this, we find a BSS sequence in NGC 1261 which can be well reproduced individually by a theoretical model prediction of a 2 Gyr old population of stellar collision products, which are expected to form in the denser inner regions during short-lived core contraction phases. Additionally, we report the occurrence of a group of BSSs with unusually blue colors in the CMD, which are consistent with a corresponding model of a 200 Myr old population of stellar collision products. The properties of the NGC 1261 BSS populations, including their spatial distributions, suggest an advanced dynamical evolutionary state of the cluster, but the core of this GC does not show the classical signatures of core collapse. We argue that these apparent contradictions provide evidence for a post-core-collapse bounce state seen in dynamical simulations of old GCs

The Blue Straggler Star Population in NGC 1261: Evidence for a Post-core-collapse Bounce State

Science.gov (United States)

Simunovic, Mirko; Puzia, Thomas H.; Sills, Alison

2014-11-01

We present a multi-passband photometric study of the Blue Straggler Star (BSS) population in the Galactic globular cluster (GC) NGC 1261, using available space- and ground-based survey data. The inner BSS population is found to have two distinct sequences in the color-magnitude diagram (CMD), similar to double BSS sequences detected in other GCs. These well defined sequences are presumably linked to single short-lived events such as core collapse, which are expected to boost the formation of BSSs. In agreement with this, we find a BSS sequence in NGC 1261 which can be well reproduced individually by a theoretical model prediction of a 2 Gyr old population of stellar collision products, which are expected to form in the denser inner regions during short-lived core contraction phases. Additionally, we report the occurrence of a group of BSSs with unusually blue colors in the CMD, which are consistent with a corresponding model of a 200 Myr old population of stellar collision products. The properties of the NGC 1261 BSS populations, including their spatial distributions, suggest an advanced dynamical evolutionary state of the cluster, but the core of this GC does not show the classical signatures of core collapse. We argue that these apparent contradictions provide evidence for a post-core-collapse bounce state seen in dynamical simulations of old GCs.

THE BLUE STRAGGLER STAR POPULATION IN NGC 1261: EVIDENCE FOR A POST-CORE-COLLAPSE BOUNCE STATE

Energy Technology Data Exchange (ETDEWEB)

Simunovic, Mirko; Puzia, Thomas H. [Institute of Astrophysics, Pontificia Universidad Católica de Chile, Avenida Vicuña Mackenna 4860, 7820436 Macul, Santiago (Chile); Sills, Alison, E-mail: msimunov@astro.puc.cl, E-mail: tpuzia@astro.puc.cl, E-mail: asills@mcmaster.ca [Department of Physics and Astronomy, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4M1 (Canada)

2014-11-01

We present a multi-passband photometric study of the Blue Straggler Star (BSS) population in the Galactic globular cluster (GC) NGC 1261, using available space- and ground-based survey data. The inner BSS population is found to have two distinct sequences in the color-magnitude diagram (CMD), similar to double BSS sequences detected in other GCs. These well defined sequences are presumably linked to single short-lived events such as core collapse, which are expected to boost the formation of BSSs. In agreement with this, we find a BSS sequence in NGC 1261 which can be well reproduced individually by a theoretical model prediction of a 2 Gyr old population of stellar collision products, which are expected to form in the denser inner regions during short-lived core contraction phases. Additionally, we report the occurrence of a group of BSSs with unusually blue colors in the CMD, which are consistent with a corresponding model of a 200 Myr old population of stellar collision products. The properties of the NGC 1261 BSS populations, including their spatial distributions, suggest an advanced dynamical evolutionary state of the cluster, but the core of this GC does not show the classical signatures of core collapse. We argue that these apparent contradictions provide evidence for a post-core-collapse bounce state seen in dynamical simulations of old GCs.

A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

Directory of Open Access Journals (Sweden)

Sutapa Datta

Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

Science.gov (United States)

Datta, Sutapa; Mukhopadhyay, Subhasis

2013-01-01

An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

Science.gov (United States)

Bertke, Andrea S; Patel, Amita; Krause, Philip R

2007-06-01

Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

Experiment on heat transfer in simulated molten core/concrete interaction

International Nuclear Information System (INIS)

Katsumura, Yukihiro; Hashizume, Hidetoshi; Toda, Saburo; Kawaguchi, Takahiro.

1993-01-01

In order to investigate heat transfer between molten core and concrete in LWR severe accidents, experiments were performed using water as the molten core, paraffin as the concrete, and air as gases from the decomposition of concrete. It was found that the heat transfer on the interface between paraffin and water were promoted strongly by the air gas. (author)

Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

Science.gov (United States)

Hampel, Stefanie; McKellar, Claire E

2017-01-01

A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

EEA core set of indicators. Guide

Energy Technology Data Exchange (ETDEWEB)

NONE

2005-07-01

This guide provides information on the quality of the 37 indicators in the EEA core set. Its primary role is to support improved implementation of the core set in the EEA, European topic centres and the European environment information and observation network (Eionet). In parallel, it is aimed at helping users outside the EEA/Eionet system make best use of the indicators in their own work. It is hoped that the guide will promote cooperation on improving indicator methodologies and data quality as part of the wider process to streamline and improve environmental reporting in the European Union and beyond. (au)

Dynamic mesolimbic dopamine signaling during action sequence learning and expectation violation

Science.gov (United States)

Collins, Anne L.; Greenfield, Venuz Y.; Bye, Jeffrey K.; Linker, Kay E.; Wang, Alice S.; Wassum, Kate M.

2016-01-01

Prolonged mesolimbic dopamine concentration changes have been detected during spatial navigation, but little is known about the conditions that engender this signaling profile or how it develops with learning. To address this, we monitored dopamine concentration changes in the nucleus accumbens core of rats throughout acquisition and performance of an instrumental action sequence task. Prolonged dopamine concentration changes were detected that ramped up as rats executed each action sequence and declined after earned reward collection. With learning, dopamine concentration began to rise increasingly earlier in the execution of the sequence and ultimately backpropagated away from stereotyped sequence actions, becoming only transiently elevated by the most distal and unexpected reward predictor. Action sequence-related dopamine signaling was reactivated in well-trained rats if they became disengaged in the task and in response to an unexpected change in the value, but not identity of the earned reward. Throughout training and test, dopamine signaling correlated with sequence performance. These results suggest that action sequences can engender a prolonged mode of dopamine signaling in the nucleus accumbens core and that such signaling relates to elements of the motivation underlying sequence execution and is dynamic with learning, overtraining and violations in reward expectation. PMID:26869075

Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

International Nuclear Information System (INIS)

Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

2010-01-01

Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

Science.gov (United States)

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

Blackout sequence modeling for Atucha-I with MARCH3 code

International Nuclear Information System (INIS)

Baron, J.; Bastianelli, B.

1997-01-01

The modeling of a blackout sequence in Atucha I nuclear power plant is presented in this paper, as a preliminary phase for a level II probabilistic safety assessment. Such sequence is analyzed with the code MARCH3 from STCP (Source Term Code Package), based on a specific model developed for Atucha, that takes into accounts it peculiarities. The analysis includes all the severe accident phases, from the initial transient (loss of heat sink), loss of coolant through the safety valves, core uncovered, heatup, metal-water reaction, melting and relocation, heatup and failure of the pressure vessel, core-concrete interaction in the reactor cavity, heatup and failure of the containment building (multi-compartmented) due to quasi-static overpressurization. The results obtained permit to visualize the time sequence of these events, as well as provide the basis for source term studies. (author) [es

Analysis of core damage frequency, Surry, Unit 1 internal events appendices

International Nuclear Information System (INIS)

Bertucio, R.C.; Julius, J.A.; Cramond, W.R.

1990-04-01

This document contains the appendices for the accident sequence analyses of internally initiated events for the Surry Nuclear Station, Unit 1. This is one of the five plant analyses conducted as part of the NUREG-1150 effort by the Nuclear Regulatory Commission. NUREG-1150 documents the risk of a selected group of nuclear power plants. The work performed is an extensive reanalysis of that published in November 1986 as NUREG/CR-4450, Volume 3. It addresses comments from numerous reviewers and significant changes to the plant systems and procedures made since the first report. The uncertainty analysis and presentation of results are also much improved. The context and detail of this report are directed toward PRA practitioners who need to know how the work was performed and the details for use in further studies. The mean core damage frequency at Surry was calculated to be 4.0E-5 per year, with a 95% upper bound of 1.3E-4 and 5% lower bound of 6.8E-6 per year. Station blackout type accidents (loss of all AC power) were the largest contributors to the core damage frequency, accounting for approximately 68% of the total. The next type of dominant contributors were Loss of Coolant Accidents (LOCAs). These sequences account for 15% of core damage frequency. No other type of sequence accounts for more than 10% of core damage frequency

From field to database : a user-oriented approche to promote cyber-curating of scientific drilling cores

Science.gov (United States)

Pignol, C.; Arnaud, F.; Godinho, E.; Galabertier, B.; Caillo, A.; Billy, I.; Augustin, L.; Calzas, M.; Rousseau, D. D.; Crosta, X.

2016-12-01

Managing scientific data is probably one the most challenging issues in modern science. In plaeosciences the question is made even more sensitive with the need of preserving and managing high value fragile geological samples: cores. Large international scientific programs, such as IODP or ICDP led intense effort to solve this problem and proposed detailed high standard work- and dataflows thorough core handling and curating. However many paleoscience results derived from small-scale research programs in which data and sample management is too often managed only locally - when it is… In this paper we present a national effort leads in France to develop an integrated system to curate ice and sediment cores. Under the umbrella of the national excellence equipment program CLIMCOR, we launched a reflexion about core curating and the management of associated fieldwork data. Our aim was then to conserve all data from fieldwork in an integrated cyber-environment which will evolve toward laboratory-acquired data storage in a near future. To do so, our demarche was conducted through an intimate relationship with field operators as well laboratory core curators in order to propose user-oriented solutions. The national core curating initiative proposes a single web portal in which all teams can store their fieldwork data. This portal is used as a national hub to attribute IGSNs. For legacy samples, this requires the establishment of a dedicated core list with associated metadata. However, for forthcoming core data, we developed a mobile application to capture technical and scientific data directly on the field. This application is linked with a unique coring-tools library and is adapted to most coring devices (gravity, drilling, percussion etc.) including multiple sections and holes coring operations. Those field data can be uploaded automatically to the national portal, but also referenced through international standards (IGSN and INSPIRE) and displayed in international

Impact of advanced BWR core physics method on BWR core monitoring

Energy Technology Data Exchange (ETDEWEB)

Moon, H; Wells, A [Siemens Power Corporation, Richland (United States)

2000-07-01

Siemens Power Corporation recently initiated development of POWERPLEX{sup TM}-III for delivery to the Grand Gulf Nuclear Power Station. The main change introduced in POWERPLEX{sup TM}-III as compared to its predecessor POWERPLEX{sup TM}-II is the incorporation of the advances BWR core simulator MICROBURN-B2. A number of issues were identified and evaluated relating to the implementation of MICROBURN-B2 and its impact on core monitoring. MICROBURN-B2 demands about three to five times more memory and two to three times more computing time than its predecessor MICROBURN-B in POWERPLEX {sup TM}-II. POWERPLEX{sup TM}-III will improve thermal margin prediction accuracy and provide more accurate plant operating conditions to operators than POWERPLEX{sup TM}-II due to its improved accuracy in predicted TIP values and critical k-effective. The most significant advantage of POWERPLEX{sup TM}-III is its capability to monitor a relaxed rod sequence exchange operation. (authors)

Status of degraded core issues. Synthesis paper prepared by G. Bandini in collaboration with the NEA task group on degraded core cooling

International Nuclear Information System (INIS)

2001-02-01

The in-vessel evolution of a severe accident in a nuclear reactor is characterised, generally, by core uncover and heat-up, core material oxidation and melting, molten material relocation and debris behaviour in the lower plenum up to vessel failure. The in-vessel core melt progression involves a large number of physical and chemical phenomena that may depend on the severe accident sequence and the reactor type under consideration. Core melt progression has been studied in the last twenty years through many experimental works. Since then, computer codes are being developed and validated to analyse different reactor accident sequences. The experience gained from the TMI-2 accident also constitutes an important source of data. The understanding of core degradation process is necessary to evaluate initial conditions for subsequent phases of the accident (ex-vessel and within the containment), and define accident management strategies and mitigative actions for operating and advanced reactors. This synthesis paper, prepared within the Task Group on Degraded Core Cooling (TG-DCC) of PWG2, contains a brief summary of current views on the status of degraded core issues regarding light water reactors. The in-vessel fission product release and transport issue is not addressed in this paper. The areas with remaining uncertainties and the needs for further experimental investigation and model development have been identified. The early phase of core melt progression is reasonably well understood. Remaining uncertainties may be addressed on the basis of ongoing experimental activities, e.g. on core quenching, and research programs foreseen in the near future. The late phase of core melt progression is less understood. Ongoing research programs are providing additional valuable information on corium molten pool behaviour. Confirmatory research is still required. The pool crust behaviour and material relocation into the lower plenum are the areas where additional research should

Thermal and hydraulic behaviour of CANDU cores under severe accident conditions - final report. Vol. 1

International Nuclear Information System (INIS)

Rogers, J.T.

1984-06-01

This report gives the results of a study of the thermo-hydraulic aspects of severe accident sequences in CANDU reactors. The accident sequences considered are the loss of the moderator cooling system and the loss of the moderator heat sink, each following a large loss-of-coolant accident accompanied by loss of emergency coolant injection. Factors considered include expulsion and boil-off of the moderator, uncovery, overheating and disintegration of the fuel channels, quenching of channel debris, re-heating of channel debris following complete moderator expulsion, formation and possible boiling of a molten pool of core debris and the effectiveness of the cooling of the calandria wall by the shield tank water during the accident sequences. The effects of these accident sequences on the reactor containment are also considered. Results show that there would be no gross melting of fuel during moderator expulsion from the calandria, and for a considerable time thereafter, as quenched core debris re-heats. Core melting would not begin until about 135 minutes after accident initiation in a loss of the moderator cooling system and until about 30 minutes in a loss of the moderator heat sink. Eventually, a pool of molten material would form in the bottom of the calandria, which may or may not boil, depending on property values. In all cases, the molten core would be contained within the calandria, as long as the shield tank water cooling system remains operational. Finally, in the period from 8 to 50 hours after the initiation of the accident, the molten core would re-solidify within the calandria. There would be no consequent damage to containment resulting from these accident sequences, nor would there be a significant increase in fission product releases from containment above those that would otherwise occur in a dual failure LOCA plus LOECI

Analysis of HBV basal core promoter/precore gene variability in patients with HBV drug resistance and HIV co-infection in Northwest Ethiopia.

Directory of Open Access Journals (Sweden)

Yeshambel Belyhun

Full Text Available We recently reported complex hepatitis B virus (HBV drug resistant and concomitant vaccine escape hepatitis B surface antigen (HBsAg variants during human immunodeficiency virus (HIV co-infection and antiretroviral therapy (ART exposure in Ethiopia. As a continuation of this report using the HBV positive sera from the same study participants, the current study further analyzed the HBV basal core promoter (BCP/precore (PC genes variability in patients with HBV drug resistance (at tyrosine-methionine-aspartate-aspartate (YMDD reverse transcriptase (RT motifs and HIV co-infection in comparison with HBV mono-infected counterparts with no HBV drug resistant gene variants.A total of 143 participants of HBV-HIV co-infected (n = 48, HBV mono-infected blood donors (n = 43 and chronic liver disease (CLD patients (n = 52 were included in the study. The BCP/PC genome regions responsible for HBeAg expression from the EcoRI site (nucleotides 1653-1959 were sequenced and analyzed for the BCP/PC mutant variants.Among the major mutant variants detected, double BCP mutations (A1762T/G1764A (25.9%, Kozak sequences mutations (nt1809-1812 (51.7% and the classical PC mutations such as A1814C/C1816T (15.4%, G1896A (25.2% and G1862T (44.8% were predominant mutant variants. The prevalence of the double BCP mutations was significantly lower in HIV co-infected patients (8.3% compared with HBV mono-infected blood donors (32.6% and CLD patients (36.5%. However, the Kozak sequences BCP mutations and the majority of PC mutations showed no significant differences among the study groups. Moreover, except for the overall BCP/PC mutant variants, co-prevalence rates of each major BCP/PC mutations and YMDDRT motif associated lamivudine (3TC/entecavir (ETV resistance mutations showed no significant differences when compared with the rates of BCP/PC mutations without YMDD RT motif drug resistance gene mutations. Unlike HIV co-infected group, no similar comparison made among HBV mono

Using Multi-Core Systems for Rover Autonomy

Science.gov (United States)

Clement, Brad; Estlin, Tara; Bornstein, Benjamin; Springer, Paul; Anderson, Robert C.

2010-01-01

Task Objectives are: (1) Develop and demonstrate key capabilities for rover long-range science operations using multi-core computing, (a) Adapt three rover technologies to execute on SOA multi-core processor (b) Illustrate performance improvements achieved (c) Demonstrate adapted capabilities with rover hardware, (2) Targeting three high-level autonomy technologies (a) Two for onboard data analysis (b) One for onboard command sequencing/planning, (3) Technologies identified as enabling for future missions, (4)Benefits will be measured along several metrics: (a) Execution time / Power requirements (b) Number of data products processed per unit time (c) Solution quality

Reference accident (Core disruption accident - safety analysis detailed report no. 11)

Energy Technology Data Exchange (ETDEWEB)

1988-01-15

The PEC safety analysis led to the conclusion that all credible sequences (incident sequences characterized by a frequency of occurrence above 10/sup minus 7/ events per year) are limited to the design basis conditions of components of the plant protection systems, and that none of them leads to a release of mechanical energy or to an extensive damage of the core and primary containment structures event in the case of failure to scram. Nevertheless, as is done in other countries for similar reactors, some events beyond the limits of credibility were considered for the PEC reactor. These were defined on a absolutely hypothetical basis that involves severe core disruption and dynamic loading of primary containment boundary. A series of containments, each having a different role, was designed to mitigate the radiological effects of a postulated core disruptive accident. The final aim was to demonstrate that residual heat can be removed and that the release of radioactivity to the environment is within acceptable limits.

Epidemiological characterization of a nosocomial outbreak of extended spectrum β-lactamase Escherichia coli ST-131 confirms the clinical value of core genome multilocus sequence typing.

Science.gov (United States)

Woksepp, Hanna; Ryberg, Anna; Berglind, Linda; Schön, Thomas; Söderman, Jan

2017-12-01

Enhanced precision of epidemiological typing in clinically suspected nosocomial outbreaks is crucial. Our aim was to investigate whether single nucleotide polymorphism (SNP) analysis and core genome (cg) multilocus sequence typing (MLST) of whole genome sequencing (WGS) data would more reliably identify a nosocomial outbreak, compared to earlier molecular typing methods. Sixteen isolates from a nosocomial outbreak of ESBL E. coli ST-131 in southeastern Sweden and three control strains were subjected to WGS. Sequences were explored by SNP analysis and cgMLST. cgMLST clearly differentiated between the outbreak isolates and the control isolates (>1400 differences). All clinically identified outbreak isolates showed close clustering (≥2 allele differences), except for two isolates (>50 allele differences). These data confirmed that the isolates with >50 differing genes did not belong to the nosocomial outbreak. The number of SNPs within the outbreak was ≤7, whereas the two discrepant isolates had >700 SNPs. Two of the ESBL E. coli ST-131 isolates did not belong to the clinically identified outbreak. Our results illustrate the power of WGS in terms of resolution, which may avoid overestimation of patients belonging to outbreaks as judged from epidemiological data and previously employed molecular methods with lower discriminatory ability. © 2017 APMIS. Published by John Wiley & Sons Ltd.

Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

Science.gov (United States)

Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

2017-10-10

Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

Directory of Open Access Journals (Sweden)

van Straalen Nico M

2007-06-01

Full Text Available Abstract Background Metallothionein (mt transcription is elevated in heavy metal tolerant field populations of Orchesella cincta (Collembola. This suggests that natural selection acts on transcriptional regulation of mt in springtails at sites where cadmium (Cd levels in soil reach toxic values This study investigates the nature and the evolutionary origin of polymorphisms in the metallothionein promoter (pmt and their functional significance for mt expression. Results We sequenced approximately 1600 bp upstream the mt coding region by genome walking. Nine pmt alleles were discovered in NW-European populations. They differ in the number of some indels, consensus transcription factor binding sites and core promoter elements. Extensive recombination events between some of the alleles can be inferred from the alignment. A deviation from neutral expectations was detected in a cadmium tolerant population, pointing towards balancing selection on some promoter stretches. Luciferase constructs were made from the most abundant alleles, and responses to Cd, paraquat (oxidative stress inducer and moulting hormone were studied in cell lines. By using paraquat we were able to dissect the effect of oxidative stress from the Cd specific effect, and extensive differences in mt induction levels between these two stressors were observed. Conclusion The pmt alleles evolved by a number of recombination events, and exhibited differential inducibilities by Cd, paraquat and molting hormone. In a tolerant population from a metal contaminated site, promoter allele frequencies differed significantly from a reference site and nucleotide polymorphisms in some promoter stretches deviated from neutral expectations, revealing a signature of balancing selection. Our results suggest that the structural differences in the Orchesella cincta metallothionein promoter alleles contribute to the metallothionein -over-expresser phenotype in cadmium tolerant populations.

Hydrophobic core substitutions in calbindin D9k

DEFF Research Database (Denmark)

Kragelund, B B; Jönsson, M; Bifulco, G

1998-01-01

Hydrophobic core residues have a marked influence on the Ca2+-binding properties of calbindin D9k, even though there are no direct contacts between these residues and the bound Ca2+ ions. Eleven different mutants with substitutions in the hydrophobic core were produced, and their equilibrium Ca2+...... that the hydrophobic core residues promote Ca2+ binding both by contributing to the preformation of the Ca2+ sites in the apo state and by preferentially stabilizing the Ca2+-bound state.......Hydrophobic core residues have a marked influence on the Ca2+-binding properties of calbindin D9k, even though there are no direct contacts between these residues and the bound Ca2+ ions. Eleven different mutants with substitutions in the hydrophobic core were produced, and their equilibrium Ca2...... that the mutation causes only very minimal perturbations in the immediate vicinity of residue 61. Substitutions of alanines or glycines for bulky residues in the center of the core were found to have significant effects on both Ca2+ affinity and dissociation rates. These substitutions caused a reduction in affinity...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

COMSORS: A light water reactor chemical core catcher

International Nuclear Information System (INIS)

Forsberg, C.W.; Parker, G.W.; Rudolph, J.C.; Osborne-Lee, I.W.

1997-01-01

The Core-Melt Source Reduction System (COMSORS) is a new approach to terminate lightwater reactor (LWR) core-melt accidents and ensure containment integrity. A special dissolution glass made of lead oxide (PbO) and boron oxide (B 2 O 3 ) is placed under the reactor vessel. If molten core debris is released onto the glass, the following sequence happens: (1) the glass absorbs decay heat as its temperature increases and the glass softens; (2) the core debris dissolves into the molten glass; (3) molten glass convective currents create a homogeneous high-level waste (HLW) glass; (4) the molten glass spreads into a wider pool, distributing the heat for removal by radiation to the reactor cavity above or transfer to water on top of the molten glass; and (5) the glass solidifies as increased surface cooling area and decreasing radioactive decay heat generation allows heat removal to exceed heat generation

Hydrogen-Poor Core-Collapse Supernovae

Science.gov (United States)

Pian, Elena; Mazzali, Paolo A.

Hydrogen-poor core-collapse supernovae (SNe) signal the explosive death of stars more massive than the progenitors of hydrogen-rich core-collapse supernovae, i.e., approximately in the range 15-50 M⊙ in main sequence. Since hydrogen-poor core-collapse supernovae include those that accompany gamma-ray bursts (GRBs), which were all rigorously identified with type Ic supernovae, their explosion energies cover almost two decades. The light curves and spectra are consequently very heterogeneous and often bear the signature of an asymmetric, i.e., aspherical, explosion. Asphericity is best traced by early-time (within days of the explosion) optical spectropolarimetry and by late-epoch (more than ˜ 100 days after explosion) low-resolution spectroscopy. While the relationship between hydrogen-poor core-collapse supernovae to hydrogen-poor super-luminous supernovae is not understood, a known case of association between an ultra-long gamma-ray burst and a very luminous hydrogen-poor supernova may help unraveling the connection. This is tantalizingly pointing to a magnetar powering source for both phenomena, although this scenario is still highly speculative. Host galaxies of hydrogen-poor supernovae are always star forming; in those of completely stripped supernovae and gamma-ray burst supernovae, the spatial distribution of the explosions follows the blue/ultraviolet light, with a correlation that is more than linear.

Identification and analysis of an efficient dicot constitutive promoter from tomato

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bashir, A.

2015-01-01

The regulatory sequence of sucrose synthase (susy) was explored in HTGS and screened using various bioinformatics tools for promoter prediction and identification of functional regulatory motifs. Transcription start site (TSS) was predicted in the promoter sequence. Species specific motifs were identified by using Plant PAN database. The Plant Care predicted various light responsive, hormone inducible and tissue specific motifs in the full length promoter which may be essential for the constitutive expression governed by this promoter. Full length susy promoter isolated from tomato (Solanum lycopersicum) drove maximum transient expression of GUS gene in various tissues of tobacco, cotton and peas. The susy promoter identified and analyzed in this study is suitable for transgene expression in economically important agricultural crops, especially to avoid strong over-expression. (author)

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

Getting to the Core of Transition: A Re-Assessment of Old Wine in New Bottles.

Science.gov (United States)

Stodden, Robert A.; Leake, David W.

1994-01-01

The core of the education system must be transformed to make it supportive of exceptional students in transition. Attempts to improve the system by adding on programs rather than instituting core changes have not been effective. A "teaming" process that promotes school-community and interagency collaboration and infuses transition into the core of…

Ice cores and palaeoclimate

International Nuclear Information System (INIS)

Krogh Andersen, K.; Ditlevsen, P.; Steffensen, J.P.

2001-01-01

Ice cores from Greenland give testimony of a highly variable climate during the last glacial period. Dramatic climate warmings of 15 to 25 deg. C for the annual average temperature in less than a human lifetime have been documented. Several questions arise: Why is the Holocene so stable? Is climatic instability only a property of glacial periods? What is the mechanism behind the sudden climate changes? Are the increased temperatures in the past century man-made? And what happens in the future? The ice core community tries to attack some of these problems. The NGRIP ice core currently being drilled is analysed in very high detail, allowing for a very precise dating of climate events. It will be possible to study some of the fast changes on a year by year basis and from this we expect to find clues to the sequence of events during rapid changes. New techniques are hoped to allow for detection of annual layers as far back as 100,000 years and thus a much improved time scale over past climate changes. It is also hoped to find ice from the Eemian period. If the Eemian layers confirm the GRIP sequence, the Eemian was actually climatically unstable just as the glacial period. This would mean that the stability of the Holocene is unique. It would also mean, that if human made global warming indeed occurs, we could jeopardize the Holocene stability and create an unstable 'Eemian situation' which ultimately could start an ice age. Currenlty mankind is changing the composition of the atmosphere. Ice cores document significant increases in greenhouse gases, and due to increased emissions of sulfuric and nitric acid from fossil fuel burning, combustion engines and agriculture, modern Greenland snow is 3 - 5 times more acidic than pre-industrial snow (Mayewski et al., 1986). However, the magnitude and abruptness of the temperature changes of the past century do not exceed the magnitude of natural variability. It is from the ice core perspective thus not possible to attribute the

Identification of the Core Set of Carbon-Associated Genes in a Bioenergy Grassland Soil.

Directory of Open Access Journals (Sweden)

Adina Howe

Full Text Available Despite the central role of soil microbial communities in global carbon (C cycling, little is known about soil microbial community structure and even less about their metabolic pathways. Efforts to characterize soil communities often focus on identifying differences in gene content across environmental gradients, but an alternative question is what genes are similar in soils. These genes may indicate critical species or potential functions that are required in all soils. Here we identified the "core" set of C cycling sequences widely present in multiple soil metagenomes from a fertilized prairie (FP. Of 226,887 sequences associated with known enzymes involved in the synthesis, metabolism, and transport of carbohydrates, 843 were identified to be consistently prevalent across four replicate soil metagenomes. This core metagenome was functionally and taxonomically diverse, representing five enzyme classes and 99 enzyme families within the CAZy database. Though it only comprised 0.4% of all CAZy-associated genes identified in FP metagenomes, the core was found to be comprised of functions similar to those within cumulative soils. The FP CAZy-associated core sequences were present in multiple publicly available soil metagenomes and most similar to soils sharing geographic proximity. In soil ecosystems, where high diversity remains a key challenge for metagenomic investigations, these core genes represent a subset of critical functions necessary for carbohydrate metabolism, which can be targeted to evaluate important C fluxes in these and other similar soils.

Dialects of the DNA Uptake Sequence in Neisseriaceae

Science.gov (United States)

Frye, Stephan A.; Nilsen, Mariann; Tønjum, Tone; Ambur, Ole Herman

2013-01-01

In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS), which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS–dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5′-CTG-3′ is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS–dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic transformation

Dialects of the DNA uptake sequence in Neisseriaceae.

Directory of Open Access Journals (Sweden)

Stephan A Frye

2013-04-01

Full Text Available In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS, which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS-dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5'-CTG-3' is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS-dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic

Prediction of plant promoters based on hexamers and random triplet pair analysis

Directory of Open Access Journals (Sweden)

Noman Nasimul

2011-06-01

Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

Coolability of severely degraded CANDU cores

International Nuclear Information System (INIS)

Meneley, D.A.; Blahnik, C.; Rogers, J.T.; Snell, V.G.; Mijhawan, S.

1995-07-01

Analytical and experimental studies have shown that the separately cooled moderator in a CANDU reactor provides an effective heat sink in the event of a loss-of-coolant accident (LOCA) accompanied by total failure of the emergency core cooling system (ECCS). The moderator heat sink prevents fuel melting and maintains the integrity of the fuel channels, therefore terminating this severe accident short of severe core damage. Nevertheless, there is a probability, however low, that the moderator heat sink could fail in such an accident. The pioneering work of Rogers (1984) for such a severe accident using simplified models showed that the fuel channels would fail and a bed of dry, solid debris would be formed at the bottom of the calandria which would heat up and eventually melt. However, the molten pool of core material would be retained in the calandria vessel, cooled by the independently cooled shield-tank water, and would eventually re solidify. Thus, the calandria vessel would act inherently as a core-catcher as long as the shield tank integrity is maintained. The present paper reviews subsequent work on the damage to a CANDU core under severe accident conditions and describes an empirically based mechanistic model of this process. It is shown that, for such severe accident sequences in a CANDU reactor, the end state following core disassembly consists of a porous bed of dry solid, coarse debris, irrespective of the initiating event and the core disassembly process. (author). 48 refs., 3 tabs., 18 figs

Reference core design Mark-I and -II of the experimental, multi-purpose, high-temperature, gas-cooled reactor

International Nuclear Information System (INIS)

Shindo, Ryuiti; Hirano, Mitsumasa; Aruga, Takeo; Yasukawa, Sigeru

1977-10-01

Reactivity worth of the control rods and power distribution in the initial hot-clean core of reference core design Mark-I and -II have been studied. The need for burnable poison was confirmed, because of the limitations in number, diameter and reactivity worth of the control rods due to structures of pressure vessel and fuel element and to safety of the core. While the initial excess reactivity is reduced by use of the burnable poison, the recovery of core reactivity with burnup of the burnable poison requires a complicated withdrawal sequence of the control rods. The radial power gradient in the core is not large, due to orifice control of the coolant helium flow, effectiveness of the reflector in the small core and continuous distribution of burnup in the core by one-batch refuelling scheme. The local peaking factor in unit orifice regions, therefore, is the most important core design. Control of the axial power distribution is necessary to reduce the maximum fuel temperature and the exponential power distribution peaked toward the inlet of the core is most suitable. However, insertion of the control rods from top of the core disturbs the axial power distribution, so this effect must be considered in design of the withdrawal sequence of control rods. Nuclear properties of the core were revealed from results of the study for the initial hot-clean core. (auth.)

Accident sequence precursor analysis level 2/3 model development

International Nuclear Information System (INIS)

Lui, C.H.; Galyean, W.J.; Brownson, D.A.

1997-01-01

The US Nuclear Regulatory Commission's Accident Sequence Precursor (ASP) program currently uses simple Level 1 models to assess the conditional core damage probability for operational events occurring in commercial nuclear power plants (NPP). Since not all accident sequences leading to core damage will result in the same radiological consequences, it is necessary to develop simple Level 2/3 models that can be used to analyze the response of the NPP containment structure in the context of a core damage accident, estimate the magnitude of the resulting radioactive releases to the environment, and calculate the consequences associated with these releases. The simple Level 2/3 model development work was initiated in 1995, and several prototype models have been completed. Once developed, these simple Level 2/3 models are linked to the simple Level 1 models to provide risk perspectives for operational events. This paper describes the methods implemented for the development of these simple Level 2/3 ASP models, and the linkage process to the existing Level 1 models

Identification of distal silencing elements in the murine interferon-A11 gene promoter.

Science.gov (United States)

Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

1996-08-01

The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

Update on the MRI Core of the Alzheimer's Disease Neuroimaging Initiative

Science.gov (United States)

Jack, Clifford R; Bernstein, Matt A; Borowski, Bret J; Gunter, Jeffrey L; Fox, Nick C; Thompson, Paul M; Schuff, Norbert; Krueger, Gunnar; Killiany, Ronald J; DeCarli, Charles S; Dale, Anders M; Weiner, Michael W

2010-01-01

Functions of the ADNI MRI core fall into three categories: (1) those of the central MRI core lab at Mayo Clinic, Rochester, Minnesota, needed to generate high quality MRI data in all subjects at each time point; (2) those of the funded ADNI MRI core imaging analysis groups responsible for analyzing the MRI data, and (3) the joint function of the entire MRI core in designing and problem solving MR image acquisition, pre-processing and analyses methods. The primary objective of ADNI was and continues to be improving methods for clinical trials in Alzheimer's disease. Our approach to the present (“ADNI-GO”) and future (“ADNI-2”, if funded) MRI protocol will be to maintain MRI methodological consistency in previously enrolled “ADNI-1” subjects who are followed longitudinally in ADNI-GO and ADNI-2. We will modernize and expand the MRI protocol for all newly enrolled ADNI-GO and ADNI-2 subjects. All newly enrolled subjects will be scanned at 3T with a core set of three sequence types: 3D T1-weighted volume, FLAIR, and a long TE gradient echo volumetric acquisition for micro hemorrhage detection. In addition to this core ADNI-GO and ADNI-2 protocol, we will perform vendor specific pilot sub-studies of arterial spin labeling perfusion, resting state functional connectivity and diffusion tensor imaging. One each of these sequences will be added to the core protocol on systems from each MRI vendor. These experimental sub-studies are designed to demonstrate the feasibility of acquiring useful data in a multi-center (but single vendor) setting for these three emerging MRI applications. PMID:20451869

Core design methodology and software for Temelin NPP

International Nuclear Information System (INIS)

Havluj, F; Hejzlar, J.; Klouzal, J.; Stary, V.; Vocka, R.

2011-01-01

In the frame of the process of fuel vendor change at Temelin NPP in the Czech Republic, where, starting since 2010, TVEL TVSA-T fuel is loaded instead of Westinghouse VVANTAGE-6 fuel, new methodologies for core design and core reload safety evaluation have been developed. These documents are based on the methodologies delivered by TVEL within the fuel contract, and they were further adapted according to Temelin NPP operational needs and according to the current practice at NPP. Along with the methodology development the 3D core analysis code ANDREA, licensed for core reload safety evaluation in 2010, have been upgraded in order to optimize the safety evaluation process. New sequences of calculations were implemented in order to simplify the evaluation of different limiting parameters and output visualization tools were developed to make the verification process user friendly. Interfaces to the fuel performance code TRANSURANUS and sub-channel analysis code SUBCAL were developed as well. (authors)

Present status and needs of research on severe core damage

International Nuclear Information System (INIS)

1982-05-01

The needs for research on severe core damage accident have been emphasized recently, in particular, since TMI-2 accident. The Severe Core Damage Research Task Force was established by the Divisions of Reactor Safety and Reactor Safety Evaluation to evaluate individual phenomenon, to survey the present status of research and to provide the recommended research subjects on severe accidents. This report describes the accident phenomena involving some analytical results, status of research and recommended research subjects on severe core damage accidents, divided into accident sequence, fuel damage, and molten material behavior, fission product behavior, hydrogen generation and combustion, steam explosion and containment integrity. (author)

Evaluation of tight-pitch PWR cores

International Nuclear Information System (INIS)

Correa, F.; Driscoll, M.J.; Lanning, D.D.

1979-08-01

The impact of tight pinch cores on the consumption of natural uranium ore has been evaluated for two systems of coupled PWR's namely one particular type of thorium system - 235 U/UO 2 : Pu/ThO 2 : 233 U/ThO 2 - and the conventional recycle-mode uranium system - 235 U/UO 2 : Pu/UO 2 . The basic parameter varied was the fuel-to-moderator volume ratio (F/M) of the (uniform) lattice for the last core in each sequence. Although methods and data verification in the range of present interest, 0.5 (current lattices) 1.0, the EPRI-LEOPARD and LASER programs used for the thorium and uranium calculations, respectively, were successfully benchmarked against several of the more pertinent experiments

Core principles of evolutionary medicine: A Delphi study.

Science.gov (United States)

Grunspan, Daniel Z; Nesse, Randolph M; Barnes, M Elizabeth; Brownell, Sara E

2018-01-01

Evolutionary medicine is a rapidly growing field that uses the principles of evolutionary biology to better understand, prevent and treat disease, and that uses studies of disease to advance basic knowledge in evolutionary biology. Over-arching principles of evolutionary medicine have been described in publications, but our study is the first to systematically elicit core principles from a diverse panel of experts in evolutionary medicine. These principles should be useful to advance recent recommendations made by The Association of American Medical Colleges and the Howard Hughes Medical Institute to make evolutionary thinking a core competency for pre-medical education. The Delphi method was used to elicit and validate a list of core principles for evolutionary medicine. The study included four surveys administered in sequence to 56 expert panelists. The initial open-ended survey created a list of possible core principles; the three subsequent surveys winnowed the list and assessed the accuracy and importance of each principle. Fourteen core principles elicited at least 80% of the panelists to agree or strongly agree that they were important core principles for evolutionary medicine. These principles over-lapped with concepts discussed in other articles discussing key concepts in evolutionary medicine. This set of core principles will be helpful for researchers and instructors in evolutionary medicine. We recommend that evolutionary medicine instructors use the list of core principles to construct learning goals. Evolutionary medicine is a young field, so this list of core principles will likely change as the field develops further.

Korrelasjon mellom core styrke, core stabilitet og utholdende styrke i core

OpenAIRE

Berg-Olsen, Andrea Marie; Fugelsøy, Eivor; Maurstad, Ann-Louise

2010-01-01

Formålet med studien var å se hvilke korrelasjon det er mellom core styrke, core stabilitet og utholdende styrke i core. Testingen bestod av tre hoveddeler hvor vi testet core styrke, core stabilitet og utholdende styrke i core. Innenfor core styrke og utholdende styrke i core ble tre ulike tester utført. Ved måling av core stabilitet ble det gjennomført kun en test. I core styrke ble isometrisk abdominal fleksjon, isometrisk rygg ekstensjon og isometrisk lateral fleksjon testet. Sit-ups p...

Genomic variation in Salmonella enterica core genes for epidemiological typing

DEFF Research Database (Denmark)

Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

2012-01-01

Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

Coolability of severely degraded CANDU cores. Revised

International Nuclear Information System (INIS)

Meneley, D.A.; Blahnik, C.; Rogers, J.T.; Snell, V.G.; Nijhawan, S.

1996-01-01

Analytical and experimental studies have shown that the separately cooled moderator in a CANDU reactor provides an effective heat sink in the event of a loss-of-coolant accident (LOCA) accompanied by total failure of the emergency core cooling system (ECCS). The moderator heat sink prevents fuel melting and maintains the integrity of the fuel channels, therefore terminating this severe accident short of severe core damage. Nevertheless, there is a probability, however low, that the moderator heat sink could fail in such an accident. The pioneering work of Rogers (1984) for such a severe accident using simplified models showed that the fuel channels would fail and a bed of dry, solid debris would be formed at the bottom of the calandria which would heat up and eventually melt. However, the molten pool of core material would be retained in the calandria vessel, cooled by the independently cooled shield-tank water, and would eventually resolidify. Thus, the calandria vessel would act inherently as a 'core-catcher' as long as the shield tank integrity is maintained. The present paper reviews subsequent work on the damage to a CANDU core under severe accident conditions and describes an empirically based mechanistic model of this process. It is shown that, for such severe accident sequences in a CANDU reactor, the end state following core disassembly consists of a porous bed of dry solid, coarse debris, irrespective of the initiating event and the core disassembly process. (author)

Influence Factors and Improvement Recommendations for Core Competency of Township Enterprises

OpenAIRE

Zhang, Chengjun

2014-01-01

Core competency of township enterprises may be influenced from the property right, technology, scale operation, financial management and talent. In view of these influence factors, township enterprises should conduct technological innovation, bring into full play functions of talents, promote corporate culture of township enterprises, attach great importance to development of core products and innovation of relevant systems, and establish market information platform for township enterprises.

Functional analysis of human and chimpanzee promoters.

Science.gov (United States)

Heissig, Florian; Krause, Johannes; Bryk, Jaroslaw; Khaitovich, Philipp; Enard, Wolfgang; Pääbo, Svante

2005-01-01

It has long been argued that changes in gene expression may provide an additional and crucial perspective on the evolutionary differences between humans and chimpanzees. To investigate how often expression differences seen in tissues are caused by sequence differences in the proximal promoters, we tested the expression activity in cultured cells of human and chimpanzee promoters from genes that differ in mRNA expression between human and chimpanzee tissues. Twelve promoters for which the corresponding gene had been shown to be differentially expressed between humans and chimpanzees in liver or brain were tested. Seven showed a significant difference in activity between the human promoter and the orthologous chimpanzee promoter in at least one of the two cell lines used. However, only three of them showed a difference in the same direction as in the tissues. Differences in proximal promoter activity are likely to be common between humans and chimpanzees, but are not linked in a simple fashion to gene-expression levels in tissues. This suggests that several genetic differences between humans and chimpanzees might be responsible for a single expression difference and thus that relevant expression differences between humans and chimpanzees will be difficult to predict from cell culture experiments or DNA sequences.

Design studies for the Mark-III core of experimental multi-purpose VHTR

International Nuclear Information System (INIS)

Yasuno, Takehiko; Miyamoto, Yoshiaki; Mitake, Susumu; Shindo, Ryuiti; Arai, Taketoshi

1979-08-01

The Mark-III core in the first conceptual design made in 1975 is a fundamental core for VHTR. Subsequently, further design studies were made fuel loading scheme and control rod withdrawal sequence for the core to increase its safety margin (shutdown margin, etc.) and operational margin (minimum Reynolds number, maximum fuel temperature, etc.). It was shown that the Mark-III should exhibit the performance expected of VHTR, unless changes are made in the preconditions for its nuclear, thermal-hydraulic design. Also, the needs as below were indicated: (1) reasonable core design criteria and guidelines, (2) fuel-loading-scheme requirements in fuel management, fuel misloading and reactor operation, (3) confirmation on precision of the core design method and its further refinement. (author)

Containment loading during severe core damage accidents

International Nuclear Information System (INIS)

Fermandjian, J.; Evrard, J.M.; Cenerino, C.; Berthion, Y.; Carvallo, G.

1984-11-01

The objective of the article is to study the influence of the state of the reactor cavity (dry or flooded) and of the corium coolability on the thermal-hydraulics in the containment in the case of an accident sequence involving core melting and subsequent containment basemat erosion, in a 900 MWe PWR unit. Calculations are performed by using the JERICHO thermal hydraulics code

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

Study on core design for reduced-moderation water reactors

International Nuclear Information System (INIS)

Okubo, Tsutomu

2002-01-01

The Reduced-Moderation Water Reactor (RMWR) is a water-cooled reactor with the harder neutron spectrum comparing with the LWR, resulting from low neutron moderation due to reduced water volume fraction. Based on the difference from the spectrum from the LWR, the conversion from U-238 to Pu-239 is promoted and the new cores preferable to effective utilization of uranium resource can be possible Design study of the RMWR core started in 1997 and new four core concepts (three BWR cores and one PWR core) are recently evaluated in terms of control rod worths, plutonium multiple recycle, high burnup and void coefficient. Comparative evaluations show needed incorporation of control rod programming and simplified PUREX process as well as development of new fuel cans for high burnup of 100 GW-d/t. Final choice of design specifications will be made at the next step aiming at realization of the RMWR. (T. Tanaka)

Study on core design for reduced-moderation water reactors

Energy Technology Data Exchange (ETDEWEB)

Okubo, Tsutomu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

2002-12-01

The Reduced-Moderation Water Reactor (RMWR) is a water-cooled reactor with the harder neutron spectrum comparing with the LWR, resulting from low neutron moderation due to reduced water volume fraction. Based on the difference from the spectrum from the LWR, the conversion from U-238 to Pu-239 is promoted and the new cores preferable to effective utilization of uranium resource can be possible Design study of the RMWR core started in 1997 and new four core concepts (three BWR cores and one PWR core) are recently evaluated in terms of control rod worths, plutonium multiple recycle, high burnup and void coefficient. Comparative evaluations show needed incorporation of control rod programming and simplified PUREX process as well as development of new fuel cans for high burnup of 100 GW-d/t. Final choice of design specifications will be made at the next step aiming at realization of the RMWR. (T. Tanaka)

Compact multipurpose sub-sampling and processing of in-situ cores with press (pressurized core sub-sampling and extrusion system)

Energy Technology Data Exchange (ETDEWEB)

Anders, E.; Muller, W.H. [Technical Univ. of Berlin, Berlin (Germany). Chair of Continuum Mechanics and Material Theory

2008-07-01

Climate change, declining resources and over-consumption result in a need for sustainable resource allocation, habitat conservation and claim for new technologies and prospects for damage-containment. In order to increase knowledge of the environment and to define potential hazards, it is necessary to get an understanding of the deep biosphere. In addition, the benthic conditions of sediment structure and gas hydrates, temperature, pressure and bio-geochemistry must be maintained during the sequences of sampling, retrieval, transfer, storage and downstream analysis. In order to investigate highly instable gas hydrates, which decomposes under pressure and temperature change, a suite of research technologies have been developed by the Technische Universitat Berlin (TUB), Germany. This includes the pressurized core sub-sampling and extrusion system (PRESS) that was developed in the European Union project called HYACE/HYACINTH. The project enabled well-defined sectioning and transfer of drilled pressure-cores obtained by a rotary corer and fugro pressure corer into transportation and investigation chambers. This paper described HYACINTH pressure coring and the HYACINTH core transfer. Autoclave coring tools and HYACINTH core logging, coring tools, and sub-sampling were also discussed. It was concluded that possible future applications include, but were not limited to, research in shales and other tight formations, carbon dioxide sequestration, oil and gas exploration, coalbed methane, and microbiology of the deep biosphere. To meet the corresponding requirements and to incorporate the experiences from previous expeditions, the pressure coring system would need to be redesigned to adapt it to the new applications. 3 refs., 5 figs.

Newly discovered young CORE-SINEs in marsupial genomes.

Science.gov (United States)

Munemasa, Maruo; Nikaido, Masato; Nishihara, Hidenori; Donnellan, Stephen; Austin, Christopher C; Okada, Norihiro

2008-01-15

Although recent mammalian genome projects have uncovered a large part of genomic component of various groups, several repetitive sequences still remain to be characterized and classified for particular groups. The short interspersed repetitive elements (SINEs) distributed among marsupial genomes are one example. We have identified and characterized two new SINEs from marsupial genomes that belong to the CORE-SINE family, characterized by a highly conserved "CORE" domain. PCR and genomic dot blot analyses revealed that the distribution of each SINE shows distinct patterns among the marsupial genomes, implying different timing of their retroposition during the evolution of marsupials. The members of Mar3 (Marsupialia 3) SINE are distributed throughout the genomes of all marsupials, whereas the Mac1 (Macropodoidea 1) SINE is distributed specifically in the genomes of kangaroos. Sequence alignment of the Mar3 SINEs revealed that they can be further divided into four subgroups, each of which has diagnostic nucleotides. The insertion patterns of each SINE at particular genomic loci, together with the distribution patterns of each SINE, suggest that the Mar3 SINEs have intensively amplified after the radiation of diprotodontians, whereas the Mac1 SINE has amplified only slightly after the divergence of hypsiprimnodons from other macropods. By compiling the information of CORE-SINEs characterized to date, we propose a comprehensive picture of how SINE evolution occurred in the genomes of marsupials.

Nigeria's Core Values and the Use of Social Media to Promote Cultural Values

Science.gov (United States)

Asemah, Ezekiel S.; Ekhareafo, Daniel O.; Olaniran, Samuel

2013-01-01

This article examines how Nigeria's core values are being redefined in the face of the new media and cultural globalisation era; it identifies Nigeria's core values to include age, greeting, dressing, among others. The questionnaire was used as an instrument to elicit data from the sampled population (Jos South Local Government Area of Plateau…

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.

Science.gov (United States)

Wala, Jeremiah; Beroukhim, Rameen

2017-03-01

We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Generic BWR-4 degraded core in-vessel study. Status report

International Nuclear Information System (INIS)

1984-11-01

Original intent of this project was to produce a phenomenological study of the in-vessel degradation which occurs during the TQUX and TQUV sequences for a generic BWR-4 from the initiation of the FSAR Chapter 15 operational transient through core debris bed formation to the failure of the primary pressure boundary. Bounding calculations were to be performed for the two high pressure and low pressure non-LOCA scenarios to assess the uncertainties in the current state of knowledge regarding the source terms for containment integrity studies. Source terms as such were defined in terms of hydrogen generation, unreacted metal, and coolant inventroy, and in terms of the form, sequencing and mode of dispersal through the primary vessel boundary. Fission product release was not to be considered as part of this study. Premature termination of the project, however, led to the dicontinuation of work on an as is basis. Work on the in-core phase from the point of scram to core debris bed formation was largely completed. A preliminary scoping calculation on the debris bed phase had been initiated. This report documents the status of the study at termination

Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

Science.gov (United States)

Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

1985-01-01

We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

Complete genome sequence of Serratia plymuthica strain AS12

Energy Technology Data Exchange (ETDEWEB)

Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Hogberg, Nils [Uppsala University, Uppsala, Sweden

2012-01-01

A plant associated member of the family Enterobacteriaceae, Serratia plymuthica strain AS12 was isolated from rapeseed roots. It is of scientific interest due to its plant growth promoting and plant pathogen inhibiting ability. The genome of S. plymuthica AS12 comprises a 5,443,009 bp long circular chromosome, which consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced within the 2010 DOE-JGI Community Sequencing Program (CSP2010) as part of the project entitled 'Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens'.

HOXB4 Promotes Hemogenic Endothelium Formation without Perturbing Endothelial Cell Development

Directory of Open Access Journals (Sweden)

Nadine Teichweyde

2018-03-01

Full Text Available Summary: Generation of hematopoietic stem cells (HSCs from pluripotent stem cells, in vitro, holds great promise for regenerative therapies. Primarily, this has been achieved in mouse cells by overexpression of the homeotic selector protein HOXB4. The exact cellular stage at which HOXB4 promotes hematopoietic development, in vitro, is not yet known. However, its identification is a prerequisite to unambiguously identify the molecular circuits controlling hematopoiesis, since the activity of HOX proteins is highly cell and context dependent. To identify that stage, we retrovirally expressed HOXB4 in differentiating mouse embryonic stem cells (ESCs. Through the use of Runx1(−/− ESCs containing a doxycycline-inducible Runx1 coding sequence, we uncovered that HOXB4 promoted the formation of hemogenic endothelium cells without altering endothelial cell development. Whole-transcriptome analysis revealed that its expression mediated the upregulation of transcription of core transcription factors necessary for hematopoiesis, culminating in the formation of blood progenitors upon initiation of Runx1 expression. : In this article, Klump and colleagues demonstrate that the human homeotic selector protein HOXB4 promotes ESC-derived hematopoiesis by inducing hemogenic endothelium formation, in vitro. It propels hematopoietic specification by upregulating the transcription of genes essential for hematopoietic development, such as those encoding members of the so-called heptad transcription factors. Keywords: HOXB4, hematopoietic stem cells, hemangioblast, hemogenic endothelium, hematopoietic specification, EHT, RUNX1, pluripotent stem cells

Pol II promoter prediction using characteristic 4-mer motifs: a machine learning approach

Directory of Open Access Journals (Sweden)

Shoyaib Mohammad

2008-10-01

Full Text Available Abstract Background Eukaryotic promoter prediction using computational analysis techniques is one of the most difficult jobs in computational genomics that is essential for constructing and understanding genetic regulatory networks. The increased availability of sequence data for various eukaryotic organisms in recent years has necessitated for better tools and techniques for the prediction and analysis of promoters in eukaryotic sequences. Many promoter prediction methods and tools have been developed to date but they have yet to provide acceptable predictive performance. One obvious criteria to improve on current methods is to devise a better system for selecting appropriate features of promoters that distinguish them from non-promoters. Secondly improved performance can be achieved by enhancing the predictive ability of the machine learning algorithms used. Results In this paper, a novel approach is presented in which 128 4-mer motifs in conjunction with a non-linear machine-learning algorithm utilising a Support Vector Machine (SVM are used to distinguish between promoter and non-promoter DNA sequences. By applying this approach to plant, Drosophila, human, mouse and rat sequences, the classification model has showed 7-fold cross-validation percentage accuracies of 83.81%, 94.82%, 91.25%, 90.77% and 82.35% respectively. The high sensitivity and specificity value of 0.86 and 0.90 for plant; 0.96 and 0.92 for Drosophila; 0.88 and 0.92 for human; 0.78 and 0.84 for mouse and 0.82 and 0.80 for rat demonstrate that this technique is less prone to false positive results and exhibits better performance than many other tools. Moreover, this model successfully identifies location of promoter using TATA weight matrix. Conclusion The high sensitivity and specificity indicate that 4-mer frequencies in conjunction with supervised machine-learning methods can be beneficial in the identification of RNA pol II promoters comparative to other methods. This

The Chemistry of Curcumin, the Health Promoting Ingredient in Turmeric

Science.gov (United States)

Dewprashad, Brahmadeo

2010-01-01

Case studies pertaining to the health benefits of foods can be particularly effective in engaging students and in teaching core concepts in science (Heidemann and Urquart 2005). This case study focuses on the chemistry of curcumin, the health-promoting ingredient in turmeric. The case was developed to review core concepts in organic chemistry and…

TRACEing Last Glacial Period (25-80 ka b2k) tephra horizons within North Atlantic marine cores and exploring links to the Greenland ice-cores

Science.gov (United States)

Abbott, P. M.; Davies, S. M.; Griggs, A. J.; Bourne, A. J.; Cook, E.; Pearce, N. J. G.; Austin, W. E. N.; Chapman, M.; Hall, I. R.; Purcell, C. S.; Scourse, J. D.; Rasmussen, T. L.

2015-12-01

Tephrochronology is a powerful technique for the correlation and synchronisation of disparate palaeoclimatic records from different depositional environments and has considerable potential for testing climatic phasing. For example, the relative timing of atmospheric and marine changes caused by the abrupt climatic events that punctuated the last glacial period within the North Atlantic region. Here we report on efforts to establish a framework of tephra horizons within North Atlantic marine sequences that can correlate these records and if traced in the Greenland ice-cores can act as isochronous tie-lines. Investigations have been conducted on a network of marine cores from a number of sites across the North Atlantic. Tephra horizons have been identified using cryptotephra extraction techniques more commonly applied to the study of terrestrial sequences. There are two main challenges with assessing cryptotephras in the glacial North Atlantic; i) determining the transportation processes and ii) assessing the influence of secondary reworking processes and the stratigraphic integrity of the isochrons. These processes and their influence are investigated for each cryptotephra using shard size variations, major element heterogeneity and co-variance of IRD input for some cores. Numerous Icelandic cryptophras have been successfully identified in the marine records and we will discuss the integration of a number of these with an isochronous nature into a marine tephra framework and how potential correlations to the Greenland ice-core tephra framework are determined. Spatial patterns in the nature of tephra records that are emerging from the core network will be highlighted to outline some of the key areas that could be explored in the future. In addition, the synchronisation of multiple North Atlantic records to the Greenland ice-cores using the North Atlantic Ash Zone II to test the synchroneity of an abrupt cooling in the North Atlantic will be discussed.

A missing ethical competency? A review of critical reflection in health promotion.

Science.gov (United States)

Tretheway, Rebecca; Taylor, Jane; O'Hara, Lily; Percival, Nikki

2015-12-01

There is increasing emphasis in the health promotion literature on the ethical imperative for the profession to move towards critical practice. A key challenge for health promotion is that critical practice appears both under-developed and under-practiced. This is evident in the omission of critical reflection from Australian and international competencies for health promotion practitioners. A narrative literature review was undertaken to explore the current use of critical reflection in health promotion. Critical reflection models relevant to health promotion were identified and critiqued. There was a dearth of literature on critical reflection within health promotion, despite recognition of its potential to support critical practice. The discipline of critical social work provided literature on the use, effect and outcome of critical reflection in practice. The interdisciplinary critical reflection model was identified as the model most applicable to health promotion. Underpinned by critical theory, this model emphasises both critical and ethical practice. Critical reflection is a core competency for health promotion practitioners to address the ethical imperative to move towards critical practice. There is a need to explore the application of a critical reflection model in health promotion to determine how it may support critical and ethical practice. So what? If health promotion is to meet its ethical responsibilities, then critical reflection needs to be articulated as a core health promotion competency and a model for its application in health promotion developed.

Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

Directory of Open Access Journals (Sweden)

Shuichi Shimmura

2017-07-01

Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

Ex-vessel molten core debris interactions at CANDU nuclear power plants

Energy Technology Data Exchange (ETDEWEB)

Lewis, M J; Oyinloye, J O; Chambers, I [Electrowatt Consulting Engineers and Scientists, Warrington, Cheshire (United Kingdom); Scott, C K [Atlantic Nuclear Services, Fredericton, NB (Canada); Omar, A M [Atomic Energy Control Board, Ottawa, ON (Canada)

1991-12-31

Currently, the Atomic Energy Control Board (AECB) of Canada is sponsoring a project with a long term objective of obtaining an evaluation, independent of the industry, of the consequences to the public and the environment of postulated severe accidents at a Canadian nuclear power plant. Phase 1 of this project is a scoping study conducted to establish the relative consequences of a number of postulated event sequences. The studies in this paper model a multi-unit CANDU reactor at which pre-defined initiating events and their consequences could lead to severe core damage and relocation of the core debris onto the floor of the concrete reactor vault. Depending on the accident sequence assumptions made, an overlying pool of water may or may not be present. The US-NRC computer code CORCON Mod 2.0 was used to calculate the behaviour of the core material interacting with the concrete. The code calculates the decomposition of concrete by the molten core, and also the gases produced, which are released into the containment. The challenges to containment integrity are described, from the viewpoint of foundation decomposition and failure due to overpressure. The containment thermal-hydraulic behaviour is examined using an in-house computer code (CREM) written for this purpose. It is found that the containment envelope, in the absence of mitigating operator actions or design safety features, even for a case involving early core disassembly with the vacuum building unavailable, is unlikely to be failed within the 48 hours time frame examined. The paper identifies several areas for improvement in the models for future studies of core-concrete interactions for CANDU reactor plants. (author). 8 refs., 1 tab., 5 figs.

Ex-vessel molten core debris interactions at CANDU nuclear power plants

International Nuclear Information System (INIS)

Lewis, M.J.; Oyinloye, J.O.; Chambers, I.; Scott, C.K.; Omar, A.M.

1990-01-01

Currently, the Atomic Energy Control Board (AECB) of Canada is sponsoring a project with a long term objective of obtaining an evaluation, independent of the industry, of the consequences to the public and the environment of postulated severe accidents at a Canadian nuclear power plant. Phase 1 of this project is a scoping study conducted to establish the relative consequences of a number of postulated event sequences. The studies in this paper model a multi-unit CANDU reactor at which pre-defined initiating events and their consequences could lead to severe core damage and relocation of the core debris onto the floor of the concrete reactor vault. Depending on the accident sequence assumptions made, an overlying pool of water may or may not be present. The US-NRC computer code CORCON Mod 2.0 was used to calculate the behaviour of the core material interacting with the concrete. The code calculates the decomposition of concrete by the molten core, and also the gases produced, which are released into the containment. The challenges to containment integrity are described, from the viewpoint of foundation decomposition and failure due to overpressure. The containment thermal-hydraulic behaviour is examined using an in-house computer code (CREM) written for this purpose. It is found that the containment envelope, in the absence of mitigating operator actions or design safety features, even for a case involving early core disassembly with the vacuum building unavailable, is unlikely to be failed within the 48 hours time frame examined. The paper identifies several areas for improvement in the models for future studies of core-concrete interactions for CANDU reactor plants. (author). 8 refs., 1 tab., 5 figs

Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

International Nuclear Information System (INIS)

Gangwar, Shanti P.; Meena, Sita R.; Saxena, Ajay K.

2012-01-01

The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C222 1 , with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

Evolution of the Internet and its cores

Energy Technology Data Exchange (ETDEWEB)

Zhang Guoqing; Zhang Guoqiang; Yang Qingfeng; Cheng Suqi [Institute of Computing Technology, Chinese Academy of Sciences, Beijing 100190 (China); Zhou Tao [Department of Modern Physics, University of Science and Technology of China, Hefei 230026 (China)], E-mail: gqzhang@ict.ac.cn, E-mail: zhutou@ustc.edu

2008-12-15

In this paper, we empirically study the evolution of large scale Internet topology at the autonomous system (AS) level. The network size grows in an exponential form, obeying the famous Moore's law. We theoretically predict that the size of the AS-level Internet will double every 5.32 years. We apply the k-core decomposition method on the real Internet, and find that the size of a k-core with larger k is nearly stable over time. In addition, the maximal coreness is very stable after 2003. In contrast to the predictions of most previous models, the maximal degree of the Internet is also relatively stable versus time. We use the edge-exchange operation to obtain the randomized networks with the same degree sequence. A systematical comparison is drawn, indicating that the real Internet is more loosely connected, and both the full Internet and the nucleus are more disassortative than their randomized versions.

Evolution of the Internet and its cores

International Nuclear Information System (INIS)

Zhang Guoqing; Zhang Guoqiang; Yang Qingfeng; Cheng Suqi; Zhou Tao

2008-01-01

In this paper, we empirically study the evolution of large scale Internet topology at the autonomous system (AS) level. The network size grows in an exponential form, obeying the famous Moore's law. We theoretically predict that the size of the AS-level Internet will double every 5.32 years. We apply the k-core decomposition method on the real Internet, and find that the size of a k-core with larger k is nearly stable over time. In addition, the maximal coreness is very stable after 2003. In contrast to the predictions of most previous models, the maximal degree of the Internet is also relatively stable versus time. We use the edge-exchange operation to obtain the randomized networks with the same degree sequence. A systematical comparison is drawn, indicating that the real Internet is more loosely connected, and both the full Internet and the nucleus are more disassortative than their randomized versions.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Parallel algorithms for testing finite state machines:Generating UIO sequences

OpenAIRE

Hierons, RM; Turker, UC

2016-01-01

This paper describes an efficient parallel algorithm that uses many-core GPUs for automatically deriving Unique Input Output sequences (UIOs) from Finite State Machines. The proposed algorithm uses the global scope of the GPU's global memory through coalesced memory access and minimises the transfer between CPU and GPU memory. The results of experiments indicate that the proposed method yields considerably better results compared to a single core UIO construction algorithm. Our algorithm is s...

Centennial-scale records of total organic carbon in sediment cores from the South Yellow Sea, China

Science.gov (United States)

Zhu, Qing; Lin, Jia; Hong, Yuehui; Yuan, Lirong; Liu, Jinzhong; Xu, Xiaoming; Wang, Jianghai

2018-01-01

Global carbon cycling is a significant factor that controls climate change. The centennial-scale variations in total organic carbon (TOC) contents and its sources in marginal sea sediments may reflect the influence of human activities on global climate change. In this study, two fine-grained sediment cores from the Yellow Sea Cold Water Mass of the South Yellow Sea were used to systematically determine TOC contents and stable carbon isotope ratios. These results were combined with previous data of black carbon and 210Pb dating from which we reconstructed the centennial-scale initial sequences of TOC, terrigenous TOC (TOCter) and marine autogenous TOC (TOCmar) after selecting suitable models to correct the measured TOC (TOCcor). These sequences showed that the TOCter decreased with time in the both cores while the TOCmar increased, particularly the rapid growth in core H43 since the late 1960s. According to the correlation between the Huanghe (Yellow) River discharge and the TOCcor, TOCter, or TOCmar, we found that the TOCter in the two cores mainly derived from the Huanghe River and was transported by it, and that higher Huanghe River discharge could strengthen the decomposition of TOCmar. The newly obtained initial TOC sequences provide important insights into the interaction between human activities and natural processes.

Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution

International Nuclear Information System (INIS)

Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.

1978-01-01

The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass

Estimation and Control for Autonomous Coring from a Rover Manipulator

Science.gov (United States)

Hudson, Nicolas; Backes, Paul; DiCicco, Matt; Bajracharya, Max

2010-01-01

A system consisting of a set of estimators and autonomous behaviors has been developed which allows robust coring from a low-mass rover platform, while accommodating for moderate rover slip. A redundant set of sensors, including a force-torque sensor, visual odometry, and accelerometers are used to monitor discrete critical and operational modes, as well as to estimate continuous drill parameters during the coring process. A set of critical failure modes pertinent to shallow coring from a mobile platform is defined, and autonomous behaviors associated with each critical mode are used to maintain nominal coring conditions. Autonomous shallow coring is demonstrated from a low-mass rover using a rotary-percussive coring tool mounted on a 5 degree-of-freedom (DOF) arm. A new architecture of using an arm-stabilized, rotary percussive tool with the robotic arm used to provide the drill z-axis linear feed is validated. Particular attention to hole start using this architecture is addressed. An end-to-end coring sequence is demonstrated, where the rover autonomously detects and then recovers from a series of slip events that exceeded 9 cm total displacement.

Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia.

Science.gov (United States)

Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar

2013-12-15

In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2

Directory of Open Access Journals (Sweden)

Oliver Hohn

2014-11-01

Full Text Available The HERV-K(HML-2 family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

Science.gov (United States)

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-11-11

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

Genome-Wide Mapping Targets of the Metazoan Chromatin Remodeling Factor NURF Reveals Nucleosome Remodeling at Enhancers, Core Promoters and Gene Insulators.

Directory of Open Access Journals (Sweden)

So Yeon Kwon

2016-04-01

Full Text Available NURF is a conserved higher eukaryotic ISWI-containing chromatin remodeling complex that catalyzes ATP-dependent nucleosome sliding. By sliding nucleosomes, NURF is able to alter chromatin dynamics to control transcription and genome organization. Previous biochemical and genetic analysis of the specificity-subunit of Drosophila NURF (Nurf301/Enhancer of Bithorax (E(bx has defined NURF as a critical regulator of homeotic, heat-shock and steroid-responsive gene transcription. It has been speculated that NURF controls pathway specific transcription by co-operating with sequence-specific transcription factors to remodel chromatin at dedicated enhancers. However, conclusive in vivo demonstration of this is lacking and precise regulatory elements targeted by NURF are poorly defined. To address this, we have generated a comprehensive map of in vivo NURF activity, using MNase-sequencing to determine at base pair resolution NURF target nucleosomes, and ChIP-sequencing to define sites of NURF recruitment. Our data show that, besides anticipated roles at enhancers, NURF interacts physically and functionally with the TRF2/DREF basal transcription factor to organize nucleosomes downstream of active promoters. Moreover, we detect NURF remodeling and recruitment at distal insulator sites, where NURF functionally interacts with and co-localizes with DREF and insulator proteins including CP190 to establish nucleosome-depleted domains. This insulator function of NURF is most apparent at subclasses of insulators that mark the boundaries of chromatin domains, where multiple insulator proteins co-associate. By visualizing the complete repertoire of in vivo NURF chromatin targets, our data provide new insights into how chromatin remodeling can control genome organization and regulatory interactions.

Formation and fragmentation of protostellar dense cores

International Nuclear Information System (INIS)

Maury, Anaelle

2009-01-01

Stars form in molecular clouds, when they collapse and fragment to produce protostellar dense cores. These dense cores are then likely to contract under their own gravity, and form young protostars, that further evolve while accreting their circumstellar mass, until they reach the main sequence. The main goal of this thesis was to study the formation and fragmentation of protostellar dense cores. To do so, two main studies, described in this manuscript, were carried out. First, we studied the formation of protostellar cores by quantifying the impact of protostellar outflows on clustered star formation. We carried out a study of the protostellar outflows powered by the young stellar objects currently formed in the NGc 2264-C proto-cluster, and we show that protostellar outflows seem to play a crucial role as turbulence progenitors in clustered star forming regions, although they seem unlikely to significantly modify the global infall processes at work on clump scales. Second, we investigated the formation of multiple systems by core fragmentation, by using high - resolution observations that allow to probe the multiplicity of young protostars on small scales. Our results suggest that the multiplicity rate of protostars on small scales increase while they evolve, and thus favor dynamical scenarios for the formation of multiple systems. Moreover, our results favor magnetized scenarios of core collapse to explain the small-scale properties of protostars at the earliest stages. (author) [fr

Identifying ELIXIR Core Data Resources.

Science.gov (United States)

Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

2016-01-01

The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

PWR core and spent fuel pool analysis using scale and nestle

International Nuclear Information System (INIS)

Murphy, J. E.; Maldonado, G. I.; St Clair, R.; Orr, D.

2012-01-01

The SCALE nuclear analysis code system [SCALE, 2011], developed and maintained at Oak Ridge National Laboratory (ORNL) is widely recognized as high quality software for analyzing nuclear systems. The SCALE code system is composed of several validated computer codes and methods with standard control sequences, such as the TRITON/NEWT lattice physics sequence, which supplies dependable and accurate analyses for industry, regulators, and academia. Although TRITON generates energy-collapsed and space-homogenized few group cross sections, SCALE does not include a full-core nodal neutron diffusion simulation module within. However, in the past few years, the open-source NESTLE core simulator [NESTLE, 2003], originally developed at North Carolina State Univ. (NCSU), has been updated and upgraded via collaboration between ORNL and the Univ. of Tennessee (UT), so it now has a growingly seamless coupling to the TRITON/NEWT lattice physics [Galloway, 2010]. This study presents the methodology used to couple lattice physics data between TRITON and NESTLE in order to perform a three-dimensional full-core analysis employing a 'real-life' Duke Energy PWR as the test bed. The focus for this step was to compare the key parameters of core reactivity and radial power distribution versus plant data. Following the core analysis, following a three cycle burn, a spent fuel pool analysis was done using information generated from NESTLE for the discharged bundles and was compared to Duke Energy spent fuel pool models. The KENO control module from SCALE was employed for this latter stage of the project. (authors)

PWR core and spent fuel pool analysis using scale and nestle

Energy Technology Data Exchange (ETDEWEB)

Murphy, J. E.; Maldonado, G. I. [Dept. of Nuclear Engineering, Univ. of Tennessee, Knoxville, TN 37996-2300 (United States); St Clair, R.; Orr, D. [Duke Energy, 526 S. Church St, Charlotte, NC 28202 (United States)

2012-07-01

The SCALE nuclear analysis code system [SCALE, 2011], developed and maintained at Oak Ridge National Laboratory (ORNL) is widely recognized as high quality software for analyzing nuclear systems. The SCALE code system is composed of several validated computer codes and methods with standard control sequences, such as the TRITON/NEWT lattice physics sequence, which supplies dependable and accurate analyses for industry, regulators, and academia. Although TRITON generates energy-collapsed and space-homogenized few group cross sections, SCALE does not include a full-core nodal neutron diffusion simulation module within. However, in the past few years, the open-source NESTLE core simulator [NESTLE, 2003], originally developed at North Carolina State Univ. (NCSU), has been updated and upgraded via collaboration between ORNL and the Univ. of Tennessee (UT), so it now has a growingly seamless coupling to the TRITON/NEWT lattice physics [Galloway, 2010]. This study presents the methodology used to couple lattice physics data between TRITON and NESTLE in order to perform a three-dimensional full-core analysis employing a 'real-life' Duke Energy PWR as the test bed. The focus for this step was to compare the key parameters of core reactivity and radial power distribution versus plant data. Following the core analysis, following a three cycle burn, a spent fuel pool analysis was done using information generated from NESTLE for the discharged bundles and was compared to Duke Energy spent fuel pool models. The KENO control module from SCALE was employed for this latter stage of the project. (authors)

Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

Science.gov (United States)

Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

2014-07-17

Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

Identification of a functional, CRM-1-dependent nuclear export signal in hepatitis C virus core protein.

Directory of Open Access Journals (Sweden)

Andrea Cerutti

Full Text Available Hepatitis C virus (HCV infection is a major cause of chronic liver disease worldwide. HCV core protein is involved in nucleocapsid formation, but it also interacts with multiple cytoplasmic and nuclear molecules and plays a crucial role in the development of liver disease and hepatocarcinogenesis. The core protein is found mostly in the cytoplasm during HCV infection, but also in the nucleus in patients with hepatocarcinoma and in core-transgenic mice. HCV core contains nuclear localization signals (NLS, but no nuclear export signal (NES has yet been identified.We show here that the aa(109-133 region directs the translocation of core from the nucleus to the cytoplasm by the CRM-1-mediated nuclear export pathway. Mutagenesis of the three hydrophobic residues (L119, I123 and L126 in the identified NES or in the sequence encoding the mature core aa(1-173 significantly enhanced the nuclear localisation of the corresponding proteins in transfected Huh7 cells. Both the NES and the adjacent hydrophobic sequence in domain II of core were required to maintain the core protein or its fragments in the cytoplasmic compartment. Electron microscopy studies of the JFH1 replication model demonstrated that core was translocated into the nucleus a few minutes after the virus entered the cell. The blockade of nucleocytoplasmic export by leptomycin B treatment early in infection led to the detection of core protein in the nucleus by confocal microscopy and coincided with a decrease in virus replication.Our data suggest that the functional NLS and NES direct HCV core protein shuttling between the cytoplasmic and nuclear compartments, with at least some core protein transported to the nucleus. These new properties of HCV core may be essential for virus multiplication and interaction with nuclear molecules, influence cell signaling and the pathogenesis of HCV infection.

Identification of a functional, CRM-1-dependent nuclear export signal in hepatitis C virus core protein.

Science.gov (United States)

Cerutti, Andrea; Maillard, Patrick; Minisini, Rosalba; Vidalain, Pierre-Olivier; Roohvand, Farzin; Pecheur, Eve-Isabelle; Pirisi, Mario; Budkowska, Agata

2011-01-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease worldwide. HCV core protein is involved in nucleocapsid formation, but it also interacts with multiple cytoplasmic and nuclear molecules and plays a crucial role in the development of liver disease and hepatocarcinogenesis. The core protein is found mostly in the cytoplasm during HCV infection, but also in the nucleus in patients with hepatocarcinoma and in core-transgenic mice. HCV core contains nuclear localization signals (NLS), but no nuclear export signal (NES) has yet been identified.We show here that the aa(109-133) region directs the translocation of core from the nucleus to the cytoplasm by the CRM-1-mediated nuclear export pathway. Mutagenesis of the three hydrophobic residues (L119, I123 and L126) in the identified NES or in the sequence encoding the mature core aa(1-173) significantly enhanced the nuclear localisation of the corresponding proteins in transfected Huh7 cells. Both the NES and the adjacent hydrophobic sequence in domain II of core were required to maintain the core protein or its fragments in the cytoplasmic compartment. Electron microscopy studies of the JFH1 replication model demonstrated that core was translocated into the nucleus a few minutes after the virus entered the cell. The blockade of nucleocytoplasmic export by leptomycin B treatment early in infection led to the detection of core protein in the nucleus by confocal microscopy and coincided with a decrease in virus replication.Our data suggest that the functional NLS and NES direct HCV core protein shuttling between the cytoplasmic and nuclear compartments, with at least some core protein transported to the nucleus. These new properties of HCV core may be essential for virus multiplication and interaction with nuclear molecules, influence cell signaling and the pathogenesis of HCV infection.

A comparison between elemental logs and core data

International Nuclear Information System (INIS)

Kerr, S.A.; Grau, J.A.; Schweitzer, J.S.

1992-01-01

Neutron-induced gamma-ray spectroscopy, of prompt capture and delayed activation, together with natural gamma-ray measurements, provides a borehole elemental analysis to characterize rock matrix composition. This study involved extensive core and log data in two wells. One well was drilled with a barite-weighted oil-based mud through a shallow marine sand. The other was drilled with fresh water-based mud through a channel sand, mudstone sequence overlying limestone. The results illustrate the importance of a suitable core sampling strategy and the problems associated with matching core to log data. Possible inaccuracies from the modelling of Ca-, Fe- and S-bearing minerals have been determined. A method for correcting the total measured aluminium concentration for that due to the borehole mud has been successfully tested against aluminium concentrations measured in the cleaned core samples. Estimates of the overall accuracy and precision of the elemental logging concentrations are obtained by comparing the log results with those obtained from the laboratory core analysis. A comprehensive core elemental analysis can also provide useful insight into the way other logs, such as the photoelectric factor or formation thermal neutron macroscopic absorption cross section, are influenced by minor and trace elements. Differences between calculated values from elemental logs and measured macroscopic parameters provide additional data for a more detailed understanding of the rock properties. (Author)

BarraCUDA - a fast short read sequence aligner using graphics processing units

Directory of Open Access Journals (Sweden)

Klus Petr

2012-01-01

Full Text Available Abstract Background With the maturation of next-generation DNA sequencing (NGS technologies, the throughput of DNA sequencing reads has soared to over 600 gigabases from a single instrument run. General purpose computing on graphics processing units (GPGPU, extracts the computing power from hundreds of parallel stream processors within graphics processing cores and provides a cost-effective and energy efficient alternative to traditional high-performance computing (HPC clusters. In this article, we describe the implementation of BarraCUDA, a GPGPU sequence alignment software that is based on BWA, to accelerate the alignment of sequencing reads generated by these instruments to a reference DNA sequence. Findings Using the NVIDIA Compute Unified Device Architecture (CUDA software development environment, we ported the most computational-intensive alignment component of BWA to GPU to take advantage of the massive parallelism. As a result, BarraCUDA offers a magnitude of performance boost in alignment throughput when compared to a CPU core while delivering the same level of alignment fidelity. The software is also capable of supporting multiple CUDA devices in parallel to further accelerate the alignment throughput. Conclusions BarraCUDA is designed to take advantage of the parallelism of GPU to accelerate the alignment of millions of sequencing reads generated by NGS instruments. By doing this, we could, at least in part streamline the current bioinformatics pipeline such that the wider scientific community could benefit from the sequencing technology. BarraCUDA is currently available from http://seqbarracuda.sf.net

BarraCUDA - a fast short read sequence aligner using graphics processing units

LENUS (Irish Health Repository)

Klus, Petr

2012-01-13

Abstract Background With the maturation of next-generation DNA sequencing (NGS) technologies, the throughput of DNA sequencing reads has soared to over 600 gigabases from a single instrument run. General purpose computing on graphics processing units (GPGPU), extracts the computing power from hundreds of parallel stream processors within graphics processing cores and provides a cost-effective and energy efficient alternative to traditional high-performance computing (HPC) clusters. In this article, we describe the implementation of BarraCUDA, a GPGPU sequence alignment software that is based on BWA, to accelerate the alignment of sequencing reads generated by these instruments to a reference DNA sequence. Findings Using the NVIDIA Compute Unified Device Architecture (CUDA) software development environment, we ported the most computational-intensive alignment component of BWA to GPU to take advantage of the massive parallelism. As a result, BarraCUDA offers a magnitude of performance boost in alignment throughput when compared to a CPU core while delivering the same level of alignment fidelity. The software is also capable of supporting multiple CUDA devices in parallel to further accelerate the alignment throughput. Conclusions BarraCUDA is designed to take advantage of the parallelism of GPU to accelerate the alignment of millions of sequencing reads generated by NGS instruments. By doing this, we could, at least in part streamline the current bioinformatics pipeline such that the wider scientific community could benefit from the sequencing technology. BarraCUDA is currently available from http:\\/\\/seqbarracuda.sf.net

Characterizing leader sequences of CRISPR loci

DEFF Research Database (Denmark)

Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

2016-01-01

The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.

2017-01-13

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.; Umarov, Ramzan; Solovyev, Victor V.

2017-01-01

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

In silico evidence for sequence-dependent nucleosome sliding

Energy Technology Data Exchange (ETDEWEB)

Lequieu, Joshua; Schwartz, David C.; de Pablo, Juan J.

2017-10-18

Nucleosomes represent the basic building block of chromatin and provide an important mechanism by which cellular processes are controlled. The locations of nucleosomes across the genome are not random but instead depend on both the underlying DNA sequence and the dynamic action of other proteins within the nucleus. These processes are central to cellular function, and the molecular details of the interplay between DNA sequence and nudeosome dynamics remain poorly understood. In this work, we investigate this interplay in detail by relying on a molecular model, which permits development of a comprehensive picture of the underlying free energy surfaces and the corresponding dynamics of nudeosome repositioning. The mechanism of nudeosome repositioning is shown to be strongly linked to DNA sequence and directly related to the binding energy of a given DNA sequence to the histone core. It is also demonstrated that chromatin remodelers can override DNA-sequence preferences by exerting torque, and the histone H4 tail is then identified as a key component by which DNA-sequence, histone modifications, and chromatin remodelers could in fact be coupled.

The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

Directory of Open Access Journals (Sweden)

Anitha Shanmugham

Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

Reconceptualizing the core of nurse practitioner education and practice.

Science.gov (United States)

Burman, Mary E; Hart, Ann Marie; Conley, Virginia; Brown, Julie; Sherard, Pat; Clarke, Pamela N

2009-01-01

The movement to the doctor of nursing practice (DNP) is progressing rapidly with new programs emerging and curricular documents being developed. We argue that the implementation of the DNP is a good move for nursing, provided that we use the opportunity to reconceptualize the core of advanced practice nursing, especially nurse practitioner (NP) practice. Theory and research articles from nursing focused on advanced practice nursing, NPs, and doctoral education. The foundation of NP education is currently based essentially on borrowed or shared content in assessment, pharmacology, and pathophysiology. We argue that the heart and soul of nursing is in health promotion, both in healthy persons and in those dealing with chronic illness. Current master's programs do not prepare NPs to assume high-level practice focused on health promotion and disease management using the latest theoretical developments in health behavior change, behavioral sciences, exercise physiology, nutrition, and medical anthropology. Although these are touched upon in most NP programs, they do not represent the core science of NP education and need to be a critical part of any DNP program. Ultimately, our vision is for NP care to be consistently "different," yet just as essential as physician care, leading to positive outcomes in health promotion and disease management.

Hard Core Pharmacology: How Much Is Taught in Pharmacy Schools?

Science.gov (United States)

Bachmann, Kenneth A.; And Others

1990-01-01

A survey was sent to eighty-five American Association of Colleges of Pharmacy-member schools and affiliates to learn how many lectures are accorded to core sequences in pharmacology. The data were intended to provide a frame of reference for the University of Toledo College of Pharmacy. (Author/MLW)

Accident sequences simulated at the Juragua nuclear power plant

International Nuclear Information System (INIS)

Carbajo, J.J.

1998-01-01

Different hypothetical accident sequences have been simulated at Unit 1 of the Juragua nuclear power plant in Cuba, a plant with two VVER-440 V213 units under construction. The computer code MELCOR was employed for these simulations. The sequences simulated are: (1) a design-basis accident (DBA) large loss of coolant accident (LOCA) with the emergency core coolant system (ECCS) on, (2) a station blackout (SBO), (3) a small LOCA (SLOCA) concurrent with SBO, (4) a large LOCA (LLOCA) concurrent with SBO, and (5) a LLOCA concurrent with SBO and with the containment breached at time zero. Timings of important events and source term releases have been calculated for the different sequences analyzed. Under certain weather conditions, the fission products released from the severe accident sequences may travel to southern Florida

Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

DEFF Research Database (Denmark)

Chen, Yun; Pai, Athma A; Herudek, Jan

2016-01-01

Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...

Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

Directory of Open Access Journals (Sweden)

Ayon Pal

Full Text Available A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding

Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

Science.gov (United States)

Pal, Ayon; Banerjee, Rachana; Mondal, Uttam K; Mukhopadhyay, Subhasis; Bothra, Asim K

2015-01-01

A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding frequency signature.

Children's science learning: A core skills approach.

Science.gov (United States)

Tolmie, Andrew K; Ghazali, Zayba; Morris, Suzanne

2016-09-01

Research has identified the core skills that predict success during primary school in reading and arithmetic, and this knowledge increasingly informs teaching. However, there has been no comparable work that pinpoints the core skills that underlie success in science. The present paper attempts to redress this by examining candidate skills and considering what is known about the way in which they emerge, how they relate to each other and to other abilities, how they change with age, and how their growth may vary between topic areas. There is growing evidence that early-emerging tacit awareness of causal associations is initially separated from language-based causal knowledge, which is acquired in part from everyday conversation and shows inaccuracies not evident in tacit knowledge. Mapping of descriptive and explanatory language onto causal awareness appears therefore to be a key development, which promotes unified conceptual and procedural understanding. This account suggests that the core components of initial science learning are (1) accurate observation, (2) the ability to extract and reason explicitly about causal connections, and (3) knowledge of mechanisms that explain these connections. Observational ability is educationally inaccessible until integrated with verbal description and explanation, for instance, via collaborative group work tasks that require explicit reasoning with respect to joint observations. Descriptive ability and explanatory ability are further promoted by managed exposure to scientific vocabulary and use of scientific language. Scientific reasoning and hypothesis testing are later acquisitions that depend on this integration of systems and improved executive control. © 2016 The British Psychological Society.

Shakespeare and the Common Core: An Opportunity to Reboot

Science.gov (United States)

Turchi, Laura; Thompson, Ayanna

2013-01-01

The Common Core generally eschews mandating texts in favor of promoting critical analysis and rigor. So it's significant that Shakespeare is the only author invoked in imperatives. His explicit inclusion offers a significant opportunity for educators to rethink how we approach Shakespearean instruction. Rather than the traditional learning of…

Model stars with degenerate dwarf cores and helium-burning shells - A stationary-burning approximation

Energy Technology Data Exchange (ETDEWEB)

Iben, I. Jr.; Tutukov, A.V. (Illinois Univ., Urbana (USA); Astronomicheskii Sovet, Moscow (USSR))

1989-07-01

The characteristics of model stars consisting of a degenerate dwarf core and an envelope which is burning a nuclear fuel or fuels in its interior are explored. The models are relevant to stars which are accreting matter from a companion, to single stars in late stages of evolution, to stripped noninteracting remnants of binary star evolution, and to merging and merged degenerate dwarfs. For any given mass and choice of nuclear fuels, a sequence of models is constructed which differ with respect to the mass of the degenerate core and the envelope characteristics. Each sequence has at least three distinct branches: a degenerate dwarf branch along which envelope mass increases with decreasing luminosity, a plateau branch characterized by a very small envelope mass and by a nearly constant luminosity which reaches the maximum achievable value for the sequence, and an asymptotic giant branch which is at the lowest temperatures achievable and along which envelope mass decreases with increasing luminosity. 78 refs.

Model stars with degenerate dwarf cores and helium-burning shells - A stationary-burning approximation

International Nuclear Information System (INIS)

Iben, I. Jr.; Tutukov, A.V.

1989-01-01

The characteristics of model stars consisting of a degenerate dwarf core and an envelope which is burning a nuclear fuel or fuels in its interior are explored. The models are relevant to stars which are accreting matter from a companion, to single stars in late stages of evolution, to stripped noninteracting remnants of binary star evolution, and to merging and merged degenerate dwarfs. For any given mass and choice of nuclear fuels, a sequence of models is constructed which differ with respect to the mass of the degenerate core and the envelope characteristics. Each sequence has at least three distinct branches: a degenerate dwarf branch along which envelope mass increases with decreasing luminosity, a plateau branch characterized by a very small envelope mass and by a nearly constant luminosity which reaches the maximum achievable value for the sequence, and an asymptotic giant branch which is at the lowest temperatures achievable and along which envelope mass decreases with increasing luminosity. 78 refs

Ecophysiology of novel core phylotypes in activated sludge wastewater treatment plants with nutrient removal

DEFF Research Database (Denmark)

McIlroy, Simon Jon; Awata, Takanori; Nierychlo, Marta

limited to no information is available for their ecophysiology in activated sludge. A combination of MAR-FISH and SIP was applied to identify members of the genera Rhodoferax, Dechloromonas and Sulfuritalea, all within the class Betaproteobacteria, to be core denitrifiers in these systems. Similar...... may explain why many of these core organisms have not attracted attention during the many years of research into the ecology of these systems. The future goal will be to obtain genome sequences for members of these core genera, applying recently developed protocols for the assembly of genomes from...

Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance

Directory of Open Access Journals (Sweden)

Xiaofei Jiang

2017-05-01

Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.

Paleoseismic record obtained by coring a sag-pond along the North Anatolian Fault (Turkey

Directory of Open Access Journals (Sweden)

Aurelia Hubert-Ferrari

2013-01-01

Full Text Available Shallow lakes along minor structural bends or discontinuities of strike-slip faults are not usually paleoseismological target sites. In the present study, we show that a 2-m-deep, 700-m-long lake that is cross-cut by the North Anatolian Fault contains a reliable paleoseimological record that can be obtained through coring. The North Anatolian Fault is a major strike-slip fault in Turkey, and it last ruptured across the Aşağıtepecik Lake in 1939, with a slip of about 6 m. Seismic lines still show remains of the fault rupture in the form of minor scarps across the lake. Collected short cores show a set of sedimentary sequences. Each sequence is composed of similar organic-rich sedimentary units. The lower unit is dark and fibrous, and is similar to the present sedimentation at the top of the core. The upper unit is disturbed and has anomalous organic matter content, grain size and mineralogy. It is interpreted as an earthquake-induced sedimentary event. The 2.5-m-long AT2007LG core comprises four sequences, and four sedimentary events. Radiogenic 210Pb and 137Cs data obtained previously imply that the shallowest event 1 was triggered by the 1939 M = 7.9 Erzincan earthquake. Radiocarbon dating and correlation to a reference varved record suggest that events 2 and 4 were initiated by the 1668 and 1254 historical earthquakes. Event 3 does not correspond to a large historical earthquake on the North Anatolian Fault.

Bacillus anthracis genome organization in light of whole transcriptome sequencing

Energy Technology Data Exchange (ETDEWEB)

Martin, Jeffrey; Zhu, Wenhan; Passalacqua, Karla D.; Bergman, Nicholas; Borodovsky, Mark

2010-03-22

Emerging knowledge of whole prokaryotic transcriptomes could validate a number of theoretical concepts introduced in the early days of genomics. What are the rules connecting gene expression levels with sequence determinants such as quantitative scores of promoters and terminators? Are translation efficiency measures, e.g. codon adaptation index and RBS score related to gene expression? We used the whole transcriptome shotgun sequencing of a bacterial pathogen Bacillus anthracis to assess correlation of gene expression level with promoter, terminator and RBS scores, codon adaptation index, as well as with a new measure of gene translational efficiency, average translation speed. We compared computational predictions of operon topologies with the transcript borders inferred from RNA-Seq reads. Transcriptome mapping may also improve existing gene annotation. Upon assessment of accuracy of current annotation of protein-coding genes in the B. anthracis genome we have shown that the transcriptome data indicate existence of more than a hundred genes missing in the annotation though predicted by an ab initio gene finder. Interestingly, we observed that many pseudogenes possess not only a sequence with detectable coding potential but also promoters that maintain transcriptional activity.

First-order and higher order sequence learning in specific language impairment.

Science.gov (United States)

Clark, Gillian M; Lum, Jarrad A G

2017-02-01

A core claim of the procedural deficit hypothesis of specific language impairment (SLI) is that the disorder is associated with poor implicit sequence learning. This study investigated whether implicit sequence learning problems in SLI are present for first-order conditional (FOC) and higher order conditional (HOC) sequences. Twenty-five children with SLI and 27 age-matched, nonlanguage-impaired children completed 2 serial reaction time tasks. On 1 version, the sequence to be implicitly learnt comprised a FOC sequence and on the other a HOC sequence. Results showed that the SLI group learned the HOC sequence (η p ² = .285, p = .005) but not the FOC sequence (η p ² = .099, p = .118). The control group learned both sequences (FOC η p ² = .497, HOC η p 2= .465, ps < .001). The SLI group's difficulty learning the FOC sequence is consistent with the procedural deficit hypothesis. However, the study provides new evidence that multiple mechanisms may underpin the learning of FOC and HOC sequences. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Source terms associated with two severe accident sequences in a 900 MWe PWR

International Nuclear Information System (INIS)

Fermandjian, J.; Evrard, J.M.; Berthion, Y.; Lhiaubet, G.; Lucas, M.

1983-12-01

Hypothetical accidents taken into account in PWR risk assessment result in fission product release from the fuel, transfer through the primary circuit, transfer into the reactor containment building (RCB) and finally release to the environment. The objective of this paper is to define the characteristics of the source term (noble gases, particles and volatile iodine forms) released from the reactor containment building during two dominant core-melt accident sequences: S 2 CD and TLB according to the ''Reactor Safety Study'' terminology. The reactor chosen for this study is a French 900 MWe PWR unit. The reactor building is a prestressed concrete containment with an internal liner. The first core-melt accident sequence is a 2-break loss-of-coolant accident on the cold leg, with failure of both system and the containment spray system. The second one is a transient initiated by a loss of offsite and onsite power supply and auxiliary feedwater system. These two sequences have been chosen because they are representative of risk dominant scenarios. Source terms associated with hypothetical core-melt accidents S 2 CD and TLB in a French PWR -900 MWe- have been performed using French computer codes (in particular, JERICHO Code for containment response analysis and AEROSOLS/31 for aerosol behavior in the containment)

Convective shells and the core He-burning phase of massive stars

Energy Technology Data Exchange (ETDEWEB)

Chiosi, C [Padua Univ. (Italy). Ist. di Astronomia; Nasi, E [Osservatorio Astronomico, Padova, Italy

1978-07-01

In this paper the effect of complete homogenization in the intermediate unstable layers of massive stars is briefly discussed on the effective temperature of the core He-burning models. To this end, a 20 solar masses star of Population I chemical composition (X=0.700, Z=0.020) has been allowed to evolve from the Main Sequence into the core He-exhaustion stage without taking into account semiconvective mixing. The results show that the models are systematically bluer than those computed with the same physical parameters but with the inclusion of semiconvection.

Particle-core multiplets in 89Y

International Nuclear Information System (INIS)

Batsch, T.; Kownacki, J.; Zelazny, Z.; Guttormsen, M.; Ramsoey, T.; Rekstad, J.

1987-10-01

The 89 Y nucleus has been formed in its excited states via the 87 Rb(α,2n) reaction at incident energies 24-34 MeV. The γ-ray decay of the states has been studied by measuring γ-γ-t coincidences, angular distributions and relative excitation functions. The experimental results from the present investigation are in general agreement with the former studies. However, some corrections in the level scheme have been introduced. Eight new levels with spins up to around 31/2 ℎ have been observed. The uppermost levels have been arranged into a rotational-like sequence, suggesting a nuclear shape change. Using our and previously known data we have tried to locate and calculate the members of the 1g 9/2 x core multiplet. The present results are compared with the semi-empirical shell model and the particle-core weak coupling description

The Last Glacial Maximum in the Northern European loess belt: Correlations between loess-paleosol sequences and the Dehner Maar core (Eifel Mountains)

Science.gov (United States)

Zens, Joerg; Krauß, Lydia; Römer, Wolfgang; Klasen, Nicole; Pirson, Stéphane; Schulte, Philipp; Zeeden, Christian; Sirocko, Frank; Lehmkuhl, Frank

2016-04-01

The D1 project of the CRC 806 "Our way to Europe" focusses on Central Europe as a destination of modern human dispersal out of Africa. The paleo-environmental conditions along the migration areas are reconstructed by loess-paleosol sequences and lacustrine sediments. Stratigraphy and luminescence dating provide the chronological framework for the correlation of grain size and geochemical data to large-scale climate proxies like isotope ratios and dust content of Greenland ice cores. The reliability of correlations is improved by the development of precise age models of specific marker beds. In this study, we focus on the (terrestrial) Last Glacial Maximum of the Weichselian Upper Pleniglacial which is supposed to be dominated by high wind speeds and an increasing aridity. Especially in the Lower Rhine Embayment (LRE), this period is linked to an extensive erosion event. The disconformity is followed by an intensive cryosol formation. In order to support the stratigraphical observations from the field, luminescence dating and grain size analysis were applied on three loess-paleosol sequences along the northern European loess belt to develop a more reliable chronology and to reconstruct paleo-environmental dynamics. The loess sections were compared to newest results from heavy mineral and grain size analysis from the Dehner Maar core (Eifel Mountains) and correlated to NGRIP records. Volcanic minerals can be found in the Dehner Maar core from a visible tephra layer at 27.8 ka up to ~25 ka. They can be correlated to the Eltville Tephra found in loess section. New quartz luminescence ages from Romont (Belgium) surrounding the tephra dated the deposition between 25.0 + 2.3 ka and 25.8 + 2.4 ka. In the following, heavy minerals show an increasing importance of strong easterly winds during the second Greenland dust peak (~24 ka b2k) correlating with an extensive erosion event in the LRE. Luminescence dating on quartz bracketing the following soil formation yielded ages of

VVER-specific features regarding core degradation - Status Report

International Nuclear Information System (INIS)

Hozer, Z.; Trambauer, K.; Duspiva, J.

1999-01-01

The objective of this report is to compare VVER reactors to pressurised water reactors (PWRs) of Western design from the point of view of core degradation phenomena using the terminology which was applied to the systematisation of severe accident phenomena in earlier CSNI reports. In the following the acronym 'PWR' is used for a PWR of Western design. The basic design features are described and the most important parameters are summarised in order to identify the differences between the two reactor types. In some specific cases the comparison shows more similarities with boiling water reactors (BWRs) than with PWRs. The known VVER experimental support is also summarised. RBMKs are not included in this report, as this reactor type is not operated in OECD countries, furthermore its design is completely different from those of VVERs and PWRs. The scope of this report is limited to in-vessel severe fuel damage phenomena. Neither thermal hydraulic processes involving no core degradation, nor containment phenomena, are discussed in detail. The VVER (water-cooled water-moderated power reactor) is a pressurised light water reactor of Soviet design. It operates on the same principles as a Western PWR reactor and uses similar technological systems. The primary coolant is pressurised water, which heats up in the reactor core and steam is produced on the secondary side of steam generators. The comparison of basic geometrical and technological parameters pointed out some differences between a PWR and a VVER, but it should be noted that differences exist even between two Western PWRs of different design. The VVER reactors are special types of PWRs, the most important design features of which are the horizontal steam generators and the hexagonal core structure. Similarity between PWR and VVER reactors was found in the comparison of dominant accidents sequences leading to core melt. The accident progression sequence consists of the same steps for VVERs and PWRs. The larger water

Development of an Electrochemistry Teaching Sequence using a Phenomenographic Approach

Science.gov (United States)

Rodriguez-Velazquez, Sorangel

the core concepts from discipline-specific models and theories serve as visual tools to describe reversible redox half-reactions at equilibrium, predict the spontaneity of the electrochemical process and explain interfacial equilibrium between redox species and electrodes in solution. The integration of physics concepts into electrochemistry instruction facilitated describing the interactions between the chemical system (e.g., redox species) and the external circuit (e.g., voltmeter). The "Two worlds" theoretical framework was chosen to anchor a robust educational design where the world of objects and events is deliberately connected to the world of theories and models. The core concepts in Marcus theory and density of states (DOS) provided the scientific foundations to connect both worlds. The design of this teaching sequence involved three phases; the selection of the content to be taught, the determination of a coherent and explicit connection among concepts and the development of educational activities to engage students in the learning process. The reduction-oxidation and electrochemistry chapters of three of the most popular general chemistry textbooks were revised in order to identify potential gaps during instruction, taking into consideration learning and teaching difficulties. The electrochemistry curriculum was decomposed into manageable sections contained in modules. Thirteen modules were developed and each module addresses specific conceptions with regard to terminology, redox reactions in electrochemical cells, and the function of the external circuit in electrochemical process. The electrochemistry teaching sequence was evaluated using a phenomenographic approach. This approach allows describing the qualitative variation in instructors' consciousness about the teaching of electrochemistry. A phenomenographic analysis revealed that the most relevant aspect of variation came from instructors' expertise. Participant A expertise (electrochemist) promoted in

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

Science.gov (United States)

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

DEFF Research Database (Denmark)

Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

2003-01-01

To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

Design of a PWR emergency core cooling simulator loop

International Nuclear Information System (INIS)

Melo, C.A. de.

1982-12-01

The preliminary design of a PWR Emergency Core Cooling Simulator Loop for investigations of the phenomena involved in a postulated Loss-of-Coolant Accident, during the Reflooding Phase, is presented. The functions of each component of the loop, the design methods and calculations, the specification of the instrumentation, the system operation sequence, the materials list and a cost assessment are included. (Author) [pt

CORAL: aligning conserved core regions across domain families.

Science.gov (United States)

Fong, Jessica H; Marchler-Bauer, Aron

2009-08-01

Homologous protein families share highly conserved sequence and structure regions that are frequent targets for comparative analysis of related proteins and families. Many protein families, such as the curated domain families in the Conserved Domain Database (CDD), exhibit similar structural cores. To improve accuracy in aligning such protein families, we propose a profile-profile method CORAL that aligns individual core regions as gap-free units. CORAL computes optimal local alignment of two profiles with heuristics to preserve continuity within core regions. We benchmarked its performance on curated domains in CDD, which have pre-defined core regions, against COMPASS, HHalign and PSI-BLAST, using structure superpositions and comprehensive curator-optimized alignments as standards of truth. CORAL improves alignment accuracy on core regions over general profile methods, returning a balanced score of 0.57 for over 80% of all domain families in CDD, compared with the highest balanced score of 0.45 from other methods. Further, CORAL provides E-values to aid in detecting homologous protein families and, by respecting block boundaries, produces alignments with improved 'readability' that facilitate manual refinement. CORAL will be included in future versions of the NCBI Cn3D/CDTree software, which can be downloaded at http://www.ncbi.nlm.nih.gov/Structure/cdtree/cdtree.shtml. Supplementary data are available at Bioinformatics online.

Characterization of prokaryotic and eukaryotic promoters usinghidden Markov models

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Brunak, Søren

1996-01-01

In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma-70 and sigma-54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...

Distinct profiles of TERT promoter mutations and telomerase expression in head and neck cancer and cervical carcinoma.

Science.gov (United States)

Annunziata, Clorinda; Pezzuto, Francesca; Greggi, Stefano; Ionna, Franco; Losito, Simona; Botti, Gerardo; Buonaguro, Luigi; Buonaguro, Franco M; Tornesello, Maria Lina

2018-03-31

Two recurrent mutations (-124 G > A and -146 G > A) in the core promoter region of the human telomerase reverse transcriptase (TERT) gene create consensus binding sites for ETS transcription factors and cause increased TERT expression in several tumour types. We analyzed TERT promoter mutations and TERT mRNA levels in head and neck cancer, cervical carcinoma and cervical intraepithelial neoplasia (CIN) as well as in C-4I, CaSki, HeLa and SiHa cervical cell lines. Nucleotide sequence analysis of TERT promoter region showed that 33.3% of oral squamous cell carcinoma (SCC) and 16.8% of cervical SCC harboured mutually exclusive G to A transitions at nucleotide position -124 or -146. TERT promoter was mutated at nucleotide -146 (G > A) in SiHa cell line. Other nucleotide changes creating in some cases putative ETS binding sites were more frequent in oral SCC (26.7%) than in cervical carcinoma (4.8%). The frequency of mutations was independent of human papillomavirus (HPV) tumour status in both cervical and oral cancer. Expression of TERT gene was significantly higher in TERT promoter mutated (-124G > A or -146G > A) cervical SCC compared to not mutated SCC irrespective of HPV16 E6 and E7 levels. Such hot spot changes were not detected in oropharyngeal SCC, cervical adenocarcinoma and CIN lesions. Our results suggest that TERT promoter mutations play a relevant role in oral SCC as well as in cervical SCC, besides the already known effect of HPV16 E6 protein on TERT expression. © 2018 UICC.

First identification and characterization of Borrobol-type tephra in the Greenland ice cores

DEFF Research Database (Denmark)

Cook, Eliza; Davies, Siwan M.; Guðmundsdóttir, Esther R.

2018-01-01

in the ice-cores or that it relates to just one of the ice-core events. A firm correlation cannot be established at present due to their strong geochemical similarities. The older tephra horizon, found within all three ice-cores and dated to 17326 ± 319 a b2k, can be correlated to a known layer within marine....... The older deposit is consistent with BT age estimates derived from Scottish sites, while the younger deposit overlaps with both BT and PT age estimates. We suggest that either the BT in Northern European terrestrial sequences represents an amalgamation of tephra from both of the GI-1e events identified...

A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa

NARCIS (Netherlands)

Choi, H.K.; Kim, D.; Uhm, T.; Limpens, E.H.M.; Lim, H.; Mun, J.H.; Kalo, P.; Penmetsa, R.V.; Seres, A.; Kulikova, O.; Roe, B.A.; Bisseling, T.; Kiss, G.B.; Cook, D.R.

2004-01-01

A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an E, population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene

RAMBO-K: Rapid and Sensitive Removal of Background Sequences from Next Generation Sequencing Data.

Directory of Open Access Journals (Sweden)

Simon H Tausch

Full Text Available The assembly of viral or endosymbiont genomes from Next Generation Sequencing (NGS data is often hampered by the predominant abundance of reads originating from the host organism. These reads increase the memory and CPU time usage of the assembler and can lead to misassemblies.We developed RAMBO-K (Read Assignment Method Based On K-mers, a tool which allows rapid and sensitive removal of unwanted host sequences from NGS datasets. Reaching a speed of 10 Megabases/s on 4 CPU cores and a standard hard drive, RAMBO-K is faster than any tool we tested, while showing a consistently high sensitivity and specificity across different datasets.RAMBO-K rapidly and reliably separates reads from different species without data preprocessing. It is suitable as a straightforward standard solution for workflows dealing with mixed datasets. Binaries and source code (java and python are available from http://sourceforge.net/projects/rambok/.

Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

Directory of Open Access Journals (Sweden)

Mette Burmølle

Full Text Available Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids into a laboratory strain (Escherichia coli Genehogs® for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54 and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33 were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

Science.gov (United States)

Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

2012-01-01

Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

IRIS core criticality calculations

International Nuclear Information System (INIS)

Jecmenica, R.; Trontl, K.; Pevec, D.; Grgic, D.

2003-01-01

Three-dimensional Monte Carlo computer code KENO-VI of CSAS26 sequence of SCALE-4.4 code system was applied for pin-by-pin calculations of the effective multiplication factor for the first cycle IRIS reactor core. The effective multiplication factors obtained by the above mentioned Monte Carlo calculations using 27-group ENDF/B-IV library and 238-group ENDF/B-V library have been compared with the effective multiplication factors achieved by HELIOS/NESTLE, CASMO/SIMULATE, and modified CORD-2 nodal calculations. The results of Monte Carlo calculations are found to be in good agreement with the results obtained by the nodal codes. The discrepancies in effective multiplication factor are typically within 1%. (author)

A database of paleoceanographic sediment cores from the North Pacific, 1951-2016

Science.gov (United States)

Borreggine, Marisa; Myhre, Sarah E.; Mislan, K. Allison S.; Deutsch, Curtis; Davis, Catherine V.

2017-09-01

We assessed sediment coring, data acquisition, and publications from the North Pacific (north of 30° N) from 1951 to 2016. There are 2134 sediment cores collected by American, French, Japanese, Russian, and international research vessels across the North Pacific (including the Pacific subarctic gyre, Alaskan gyre, Japan margin, and California margin; 1391 cores), the Sea of Okhotsk (271 cores), the Bering Sea (123 cores), and the Sea of Japan (349 cores) reported here. All existing metadata associated with these sediment cores are documented here, including coring date, location, core number, cruise number, water depth, vessel metadata, and coring technology. North Pacific sediment core age models are built with isotope stratigraphy, radiocarbon dating, magnetostratigraphy, biostratigraphy, tephrochronology, % opal, color, and lithological proxies. Here, we evaluate the iterative generation of each published age model and provide comprehensive documentation of the dating techniques used, along with sedimentation rates and age ranges. We categorized cores according to the availability of a variety of proxy evidence, including biological (e.g., benthic and planktonic foraminifera assemblages), geochemical (e.g., major trace element concentrations), isotopic (e.g., bulk sediment nitrogen, oxygen, and carbon isotopes), and stratigraphic (e.g., preserved laminations) proxies. This database is a unique resource to the paleoceanographic and paleoclimate communities and provides cohesive accessibility to sedimentary sequences, age model development, and proxies. The data set is publicly available through PANGAEA at PANGAEA.875998" target="_blank">https://doi.org/10.1594/PANGAEA.875998.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

MRI-derived measurements of fibrous-cap and lipid-core thickness: the potential for identifying vulnerable carotid plaques in vivo

International Nuclear Information System (INIS)

Trivedi, Rikin A.; U-King-Im, Jean-Marie; Graves, Martin J.; Horsley, Jo; Goddard, Martin; Kirkpatrick, Peter J.; Gillard, Jonathan H.

2004-01-01

Vulnerable plaques have thin fibrous caps overlying large necrotic lipid cores. Recent studies have shown that high-resolution MR imaging can identify these components. We set out to determine whether in vivo high-resolution MRI could quantify this aspect of the vulnerable plaque. Forty consecutive patients scheduled for carotid endarterectomy underwent pre-operative in vivo multi-sequence MR imaging of the carotid artery. Individual plaque constituents were characterised on MR images. Fibrous-cap and lipid-core thickness was measured on MRI and histology images. Bland-Altman plots were generated to determine the level of agreement between the two methods. Multi-sequence MRI identified 133 corresponding MR and histology slices. Plaque calcification or haemorrhage was seen in 47 of these slices. MR and histology derived fibrous cap-lipid-core thickness ratios showed strong agreement with a mean difference between MR and histology ratios of 0.02 (±0.04). The intra-class correlation coefficient between two readers for measurements was 0.87 (95% confidence interval, 0.73 and 0.93). Multi-sequence, high-resolution MR imaging accurately quantified the relative thickness of fibrous-cap and lipid-core components of carotid atheromatous plaques. This may prove to be a useful tool to characterise vulnerable plaques in vivo. (orig.)

MRI-derived measurements of fibrous-cap and lipid-core thickness: the potential for identifying vulnerable carotid plaques in vivo

Energy Technology Data Exchange (ETDEWEB)

Trivedi, Rikin A. [Addenbrooke' s Hospital, University Department of Radiology, Cambridge (United Kingdom); Addenbrooke' s Hospital, Academic Department of Neurosurgery, Cambridge (United Kingdom); U-King-Im, Jean-Marie; Graves, Martin J. [Addenbrooke' s Hospital, University Department of Radiology, Cambridge (United Kingdom); Horsley, Jo; Goddard, Martin [Papworth Hospital, Department of Histopathology, Papworth Everard (United Kingdom); Kirkpatrick, Peter J. [Addenbrooke' s Hospital, Academic Department of Neurosurgery, Cambridge (United Kingdom); Gillard, Jonathan H. [Addenbrooke' s Hospital, University Department of Radiology, Cambridge (United Kingdom); Addenbrooke' s Hospital, Hills Road, Box 219, Cambridge (United Kingdom)

2004-09-01

Vulnerable plaques have thin fibrous caps overlying large necrotic lipid cores. Recent studies have shown that high-resolution MR imaging can identify these components. We set out to determine whether in vivo high-resolution MRI could quantify this aspect of the vulnerable plaque. Forty consecutive patients scheduled for carotid endarterectomy underwent pre-operative in vivo multi-sequence MR imaging of the carotid artery. Individual plaque constituents were characterised on MR images. Fibrous-cap and lipid-core thickness was measured on MRI and histology images. Bland-Altman plots were generated to determine the level of agreement between the two methods. Multi-sequence MRI identified 133 corresponding MR and histology slices. Plaque calcification or haemorrhage was seen in 47 of these slices. MR and histology derived fibrous cap-lipid-core thickness ratios showed strong agreement with a mean difference between MR and histology ratios of 0.02 ({+-}0.04). The intra-class correlation coefficient between two readers for measurements was 0.87 (95% confidence interval, 0.73 and 0.93). Multi-sequence, high-resolution MR imaging accurately quantified the relative thickness of fibrous-cap and lipid-core components of carotid atheromatous plaques. This may prove to be a useful tool to characterise vulnerable plaques in vivo. (orig.)

Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Hu, Wen-Ta [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Li, Hui-Chun [Department of Biochemistry, Tzu Chi University, Hualien, Taiwan (China); Lee, Shen-Kao; Ma, Hsin-Chieh; Yang, Chee-Hing; Chen, Hung-Ling [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Lo, Shih-Yen, E-mail: losylo@mail.tcu.edu.tw [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Department of Laboratory Medicine, Buddhist Tzu Chi General Hospital, Hualien, Taiwan (China)

2013-05-24

Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway.

Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

International Nuclear Information System (INIS)

Hu, Wen-Ta; Li, Hui-Chun; Lee, Shen-Kao; Ma, Hsin-Chieh; Yang, Chee-Hing; Chen, Hung-Ling; Lo, Shih-Yen

2013-01-01

Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway

The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

Science.gov (United States)

Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

1995-09-01

The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

The fitness landscapes of cis-acting binding sites in different promoter and environmental contexts.

Directory of Open Access Journals (Sweden)

Ryan K Shultzaberger

2010-07-01

Full Text Available The biophysical nature of the interaction between a transcription factor and its target sequences in vitro is sufficiently well understood to allow for the effects of DNA sequence alterations on affinity to be predicted. But even in relatively simple in vivo systems, the complexities of promoter organization and activity have made it difficult to predict how altering specific interactions between a transcription factor and DNA will affect promoter output. To better understand this, we measured the relative fitness of nearly all Escherichia coli sigma(70 -35 binding sites in different promoter and environmental contexts by competing four randomized -35 promoter libraries controlling the expression of the tetracycline resistance gene (tetagainst each other in increasing concentrations of drug. We sequenced populations after competition to determine the relative enrichment of each -35 sequence. We observed a consistent relationship between the frequency of recovery of each -35 binding site and its predicted affinity for sigma(70 that varied depending on the sequence context of the promoter and drug concentration. Overall the relative fitness of each promoter could be predicted by a simple thermodynamic model of transcriptional regulation, in which the rate of transcriptional initiation (and hence fitness is dependent upon the overall stability of the initiation complex, which in turn is dependent upon the energetic contributions of all sites within the complex. As implied by this model, a decrease in the free energy of association at one site could be compensated for by an increase in the binding energy at another to produce a similar output. Furthermore, these data show that a large and continuous range of transcriptional outputs can be accessed by merely changing the -35, suggesting that evolved or engineered mutations at this site could allow for subtle and precise control over gene expression.

Fatty acid elongase 1 (FAE1) promoter as a candidate for genetic ...

African Journals Online (AJOL)

As an important cis-regulatory element, a promoter plays a key role in plant gene expression and regulation, and has been widely used in plant genetic engineering. The fatty acid elongase 1 (FAE1) promoter was isolated from Arabidopsis thaliana. Sequence analysis showed that the FAE1 promoter contains two Skn-1 ...

A review of MAAP4 code structure and core T/H model

International Nuclear Information System (INIS)

Song, Yong Mann; Park, Soo Yong

1998-03-01

The modular accident analysis program (MAAP) version 4 is a computer code that can simulate the response of LWR plants during severe accident sequences and includes models for all of the important phenomena which might occur during accident sequences. In this report, MAAP4 code structure and core thermal hydraulic (T/H) model which models the T/H behavior of the reactor core and the response of core components during all accident phases involving degraded cores are specifically reviewed and then reorganized. This reorganization is performed via getting the related models together under each topic whose contents and order are same with other two reports for MELCOR and SCDAP/RELAP5 to be simultaneously published. Major purpose of the report is to provide information about the characteristics of MAAP4 core T/H models for an integrated severe accident computer code development being performed under the one of on-going mid/long-term nuclear developing project. The basic characteristics of the new integrated severe accident code includes: 1) Flexible simulation capability of primary side, secondary side, and the containment under severe accident conditions, 2) Detailed plant simulation, 3) Convenient user-interfaces, 4) Highly modularization for easy maintenance/improvement, and 5) State-of-the-art model selection. In conclusion, MAAP4 code has appeared to be superior for 3) and 4) items but to be somewhat inferior for 1) and 2) items. For item 5), more efforts should be made in the future to compare separated models in detail with not only other codes but also recent world-wide work. (author). 17 refs., 1 tab., 12 figs

Utilization of control rod drive (CRD) system for long term core cooling

International Nuclear Information System (INIS)

Huerta B, A.

1991-01-01

In this paper we consider an application of Probabilistic Risk Assessment (PRA) to risk management. Foreseeable risk management strategies to prevent core damage are constrained by the availability of first line systems as well as support systems. The actual trend in the evaluation of risk management options can be performed in a number of ways. An example is the identification of back-up systems which could be used to perform the same safety functions. In this work we deal with the evaluation of the feasibility, for BWR's, to use the Control Rod Drive system to maintain an adequate reactor core long term cooling in some accident sequences. This preliminary evaluation is carried out as a part of the Internal Events Analysis for Laguna Verde Nuclear Power Plant (LVNPP) that is currently under way by the Mexican Nuclear Regulatory Body. This analysis addresses the evaluation and incorporation of all the systems, including the safety related and the back-up non safety related systems, that are available for the operator in order to prevent core damage. As a part of this analysis the containment venting capability is also evaluated as a back-up of the containment heat removal function. This will prevent the primary containment overpressurization and loss of certain core cooling systems. A selection of accident sequences in which the Control Rod Drive system could be used to mitigate the accident and prevent core damage are discussed. A personal computer transient analysis code is used to carry out thermohydraulic simulations in order to evaluate the Control Rod Drive system performance, the corresponding results are presented. Finally, some preliminary conclusions are drawn. (author). 9 refs, 5 figs

Regulation of ALF promoter activity in Xenopus oocytes.

Directory of Open Access Journals (Sweden)

Dan Li

Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

Developing Consensus on the CompHP Professional Standards for Health Promotion in Europe

Science.gov (United States)

Speller, Viv; Parish, Richard; Davison, Heather; Zilnyk, Anna

2012-01-01

Building on the CompHP Core Competencies for health promotion the Professional Standards for Health Promotion have been developed and consulted on across Europe. The standards were formulated to fit within the complexity of professional, occupational and educational standards frameworks in Europe as learning outcome standards with performance…

Risk assessment of small-sized HTR with pebble-bed core

International Nuclear Information System (INIS)

Kroeger, W.; Mertens, J.; Wolters, J.

1987-01-01

Two recent concepts of small-sized HTR's (HTR-Modul and HTR-100) were analysed regarding their safety concepts and risk protection. In neither case do core cooling accidents contribute to the risk because of the low induced core temperatures. Water ingress accidents dominate the risk in both cases by detaching deposited fission products which can be released into the environment. For these accident sequences no early fatalities and practically no lethal case of cancer were computed. Both HTR concepts include adequate precautionary measures and an infinitely small risk according to the usual standards. The safety concepts make express use of the specific inherent safety features of pebble-bed HTR's. (orig.)

An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

International Nuclear Information System (INIS)

Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A.

2006-01-01

The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection

Gradients in giant branch morphology in the core of 47 Tucanae

Science.gov (United States)

Bailyn, Charles D.

1994-01-01

I describe an algorithm which uses the high spatial resolution of the Hubble Space Telescope to complement the high spatial-to-noise, approximately symmetric point response function, relatively large spatial coverage, and standard filters available from ground based images of crowded fields. Applying this technique to the central regions of the globular cluster 47 Tucanae, I find that the morphology of the giant branch in the core is significantly different from that in more distant regions (r approximately equals 5 to 10 core radii) of the cluster. In particular, there appear to be fewer bright giants in the core, along with an enhanced `asymptotic giant branch' (AGB) sequence. Depletion of giants has been observed in the cores of other dense clusters, and may be due to `stripping' of large stars by stellar encounters and/or mass transfer in binary systems. Central concentrations of true asymptotic giant branch stars are not expected to result from dynamical processes; possibly some of these stars may be evolved blue stragglers.

Identification of two novel pathogenic compound heterozygous MYO7A mutations in Usher syndrome by whole exome sequencing.

Science.gov (United States)

Jia, Ying; Li, Xiaoge; Yang, Dong; Xu, Yi; Guo, Ying; Li, Xin

2018-01-01

The current study aims to identify the pathogenic sites in a core pedigree of Usher syndrome (USH). A core pedigree of USH was analyzed by whole exome sequencing (WES). Mutations were verified by polymerase chain reaction (PCR) amplification and Sanger sequencing. Two pathogenic variations (c.849+2T>C and c.5994G>A) in MYO7A were successfully identified and individually separated from parents. One variant (c.849+2T>C) was nonsense mutation, causing the protein terminated in advance, and the other one (c.5994G>A) located near the boundary of exon could cause aberrant splicing. This study provides a meaningful exploration for identification of clinical core genetic pedigrees. Copyright © 2017 Elsevier B.V. All rights reserved.

Researches on Transcriptome Sequencing in the Study of Traditional Chinese Medicine

Science.gov (United States)

Xin, Jie; Zhang, Rong-chao; Wang, Lei

2017-01-01