WorldWideScience

Sample records for core promoter sequences

  1. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  2. Core Promoter Structure in the Oomycete Phytophthora infestans

    Science.gov (United States)

    McLeod, Adele; Smart, Christine D.; Fry, William E.

    2004-01-01

    We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

  3. Linking Core Promoter Classes to Circadian Transcription.

    Directory of Open Access Journals (Sweden)

    Pål O Westermark

    2016-08-01

    Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.

  4. Dynamic usage of transcription start sites within core promoters

    DEFF Research Database (Denmark)

    Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro

    2006-01-01

    BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...

  5. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  6. Optimized core loading sequence for Ukraine WWER-1000 reactors

    International Nuclear Information System (INIS)

    Dye, M.; Shah, H.

    2015-01-01

    Fuel Assemblies (WFAs) experienced mechanical damage of the grids during loading at both South Ukraine 2 (SU2) and South Ukraine 3 (SU3). The grids were damaged due to high lateral loads exceeding their strength limit. The high lateral loads were caused by a combination of distortion and stiffness of the mixed core fuel assemblies and significant fuel assembly-to-fuel assembly interaction combined with the core loading sequence being used. To prevent damage of the WFA grids during core loading, Westinghouse has developed a loading sequence technique and loading aides (smooth sided dummies and top nozzle loading guides) designed to minimize fuel assembly-to-fuel assembly interaction while maximizing the potential for successful loading (i.e., no fuel assembly damage and minimized loading time). The loading sequence technique accounts for cycle-specific core loading patterns and is based on previous Westinghouse WWER core loading experience and fundamental principles. The loading aids are developed to “open-up” the target core location or to provide guidance into a target core location. The Westinghouse optimized core loading sequence and smooth sided dummies were utilized during the successful loading of SU3 Cycle 25 mixed core in March 2015, with no instances of fuel assembly damage and yet still provided considerable time savings relative to the 2012 and 2013 SU3 reload campaigns. (authors)

  7. Compilation and analysis of Escherichia coli promoter DNA sequences.

    OpenAIRE

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  8. High Performance Systolic Array Core Architecture Design for DNA Sequencer

    Directory of Open Access Journals (Sweden)

    Saiful Nurdin Dayana

    2018-01-01

    Full Text Available This paper presents a high performance systolic array (SA core architecture design for Deoxyribonucleic Acid (DNA sequencer. The core implements the affine gap penalty score Smith-Waterman (SW algorithm. This time-consuming local alignment algorithm guarantees optimal alignment between DNA sequences, but it requires quadratic computation time when performed on standard desktop computers. The use of linear SA decreases the time complexity from quadratic to linear. In addition, with the exponential growth of DNA databases, the SA architecture is used to overcome the timing issue. In this work, the SW algorithm has been captured using Verilog Hardware Description Language (HDL and simulated using Xilinx ISIM simulator. The proposed design has been implemented in Xilinx Virtex -6 Field Programmable Gate Array (FPGA and improved in the core area by 90% reduction.

  9. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  10. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    Science.gov (United States)

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

  11. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    Science.gov (United States)

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  12. Kin28 regulates the transient association of Mediator with core promoters.

    Science.gov (United States)

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  13. CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs.

    Science.gov (United States)

    Gilbert, N; Labuda, D

    1999-03-16

    A 65-bp "core" sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3' ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome.

  14. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  15. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  16. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  17. The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

  18. Effect of promoter strength and signal sequence on the periplasmic ...

    African Journals Online (AJOL)

    Two plasmids, pFLAG-ATS and pET 26b(+), were studied for the periplasmic expression of recombinant human interferon-2b (IFN-2b) in Escherichia coli. The pFLAG-ATS contains ompA signal sequence and tac promoter while pET 26b(+) contains pelB signal sequence and T7lac promoter. It was observed that periplasmic ...

  19. Characterization and identification of microRNA core promoters in four model species.

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhou

    2007-03-01

    Full Text Available MicroRNAs are short, noncoding RNAs that play important roles in post-transcriptional gene regulation. Although many functions of microRNAs in plants and animals have been revealed in recent years, the transcriptional mechanism of microRNA genes is not well-understood. To elucidate the transcriptional regulation of microRNA genes, we study and characterize, in a genome scale, the promoters of intergenic microRNA genes in Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, and Oryza sativa. We show that most known microRNA genes in these four species have the same type of promoters as protein-coding genes have. To further characterize the promoters of microRNA genes, we developed a novel promoter prediction method, called common query voting (CoVote, which is more effective than available promoter prediction methods. Using this new method, we identify putative core promoters of most known microRNA genes in the four model species. Moreover, we characterize the promoters of microRNA genes in these four species. We discover many significant, characteristic sequence motifs in these core promoters, several of which match or resemble the known cis-acting elements for transcription initiation. Among these motifs, some are conserved across different species while some are specific to microRNA genes of individual species.

  20. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  1. pyPaSWAS: Python-based multi-core CPU and GPU sequence alignment.

    Science.gov (United States)

    Warris, Sven; Timal, N Roshan N; Kempenaar, Marcel; Poortinga, Arne M; van de Geest, Henri; Varbanescu, Ana L; Nap, Jan-Peter

    2018-01-01

    Our previously published CUDA-only application PaSWAS for Smith-Waterman (SW) sequence alignment of any type of sequence on NVIDIA-based GPUs is platform-specific and therefore adopted less than could be. The OpenCL language is supported more widely and allows use on a variety of hardware platforms. Moreover, there is a need to promote the adoption of parallel computing in bioinformatics by making its use and extension more simple through more and better application of high-level languages commonly used in bioinformatics, such as Python. The novel application pyPaSWAS presents the parallel SW sequence alignment code fully packed in Python. It is a generic SW implementation running on several hardware platforms with multi-core systems and/or GPUs that provides accurate sequence alignments that also can be inspected for alignment details. Additionally, pyPaSWAS support the affine gap penalty. Python libraries are used for automated system configuration, I/O and logging. This way, the Python environment will stimulate further extension and use of pyPaSWAS. pyPaSWAS presents an easy Python-based environment for accurate and retrievable parallel SW sequence alignments on GPUs and multi-core systems. The strategy of integrating Python with high-performance parallel compute languages to create a developer- and user-friendly environment should be considered for other computationally intensive bioinformatics algorithms.

  2. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  3. Core Promoter Plasticity Between Maize Tissues and Genotypes Contrasts with Predominance of Sharp Transcription Initiation Sites.

    Science.gov (United States)

    Mejía-Guerra, María Katherine; Li, Wei; Galeano, Narmer F; Vidal, Mabel; Gray, John; Doseff, Andrea I; Grotewold, Erich

    2015-12-01

    Core promoters are crucial for gene regulation, providing blueprints for the assembly of transcriptional machinery at transcription start sites (TSSs). Empirically, TSSs define the coordinates of core promoters and other regulatory sequences. Thus, experimental TSS identification provides an essential step in the characterization of promoters and their features. Here, we describe the application of CAGE (cap analysis of gene expression) to identify genome-wide TSSs used in root and shoot tissues of two maize (Zea mays) inbred lines (B73 and Mo17). Our studies indicate that most TSS clusters are sharp in maize, similar to mice, but distinct from Arabidopsis thaliana, Drosophila melanogaster, or zebra fish, in which a majority of genes have broad-shaped TSS clusters. We established that ∼38% of maize promoters are characterized by a broader TATA-motif consensus, and this motif is significantly enriched in genes with sharp TSSs. A noteworthy plasticity in TSS usage between tissues and inbreds was uncovered, with ∼1500 genes showing significantly different dominant TSSs, sometimes affecting protein sequence by providing alternate translation initiation codons. We experimentally characterized instances in which this differential TSS utilization results in protein isoforms with additional domains or targeted to distinct subcellular compartments. These results provide important insights into TSS selection and gene expression in an agronomically important crop. © 2015 American Society of Plant Biologists. All rights reserved.

  4. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  5. Functional analysis of bipartite begomovirus coat protein promoter sequences

    International Nuclear Information System (INIS)

    Lacatus, Gabriela; Sunter, Garry

    2008-01-01

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

  6. High-throughput sequencing of core STR loci for forensic genetic investigations using the Roche Genome Sequencer FLX platform

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rockenbauer, Eszter

    2011-01-01

    repeat units. These methods do not allow for the full resolution of STR base composition that sequencing approaches could provide. Here we present an STR profiling method based on the use of the Roche Genome Sequencer (GS) FLX to simultaneously sequence multiple core STR loci. Using this method...

  7. Effective Feature Selection for Classification of Promoter Sequences.

    Directory of Open Access Journals (Sweden)

    Kouser K

    Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  8. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

  9. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  10. CaMV-35S promoter sequence-specific DNA methylation in lettuce.

    Science.gov (United States)

    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

    2016-01-01

    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  11. Mammalian RNA polymerase II core promoters: insights from genome-wide studies

    DEFF Research Database (Denmark)

    Sandelin, Albin; Carninci, Piero; Lenhard, Boris

    2007-01-01

    The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

  12. Engineering fuel reloading sequence optimization for in-core shuffling system

    International Nuclear Information System (INIS)

    Jeong, Seo G.; Suh, Kune Y.

    2008-01-01

    Optimizing the nuclear fuel reloading process is central to enhancing the economics of nuclear power plant (NPP). There are two kinds of reloading method: in-core shuffling and ex-core shuffling. In-core shuffling has an advantage of reloading time when compared with ex-core shuffling. It is, however, not easy to adopt an in-core shuffling because of additional facilities required and regulations involved at the moment. The in-core shuffling necessitates minimizing the movement of refueling machine because reloading paths can be varied according to differing reloading sequences. In the past, the reloading process depended on the expert's knowledge and experience. Recent advances in computer technology have apparently facilitated the heuristic approach to nuclear fuel reloading sequence optimization. This work presents a first in its kind of in-core shuffling whereas all the Korean NPPs have so far adopted ex-core shuffling method. Several plants recently applied the in-core shuffling strategy, thereby saving approximately 24 to 48 hours of outage time. In case of in-core shuffling one need minimize the movement of refueling machine because reloading path can be varied according to different reloading sequences. Advances in computer technology have enabled optimizing the in-core shuffling by solving a traveling salesman problem. To solve this problem, heuristic algorithm is used, such as ant colony algorithm and genetic algorithm. The Systemic Engineering Reload Analysis (SERA) program is written to optimize shuffling sequence based on heuristic algorithms. SERA is applied to the Optimized Power Reactor 1000 MWe (OPR1000) on the assumption that the NPP adopts the in-core shuffling in the foreseeable future. It is shown that the optimized shuffling sequence resulted in reduced reloading time. (author)

  13. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    Science.gov (United States)

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  14. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  15. The CompHP Core Competencies Framework for Health Promotion in Europe

    Science.gov (United States)

    Barry, Margaret M.; Battel-Kirk, Barbara; Dempsey, Colette

    2012-01-01

    Background: The CompHP Project on Developing Competencies and Professional Standards for Health Promotion in Europe was developed in response to the need for new and changing health promotion competencies to address health challenges. This article presents the process of developing the CompHP Core Competencies Framework for Health Promotion across…

  16. Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

    Science.gov (United States)

    Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

    2014-09-25

    In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

  17. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  18. Development of Mycoplasma synoviae (MS) core genome multilocus sequence typing (cgMLST) scheme.

    Science.gov (United States)

    Ghanem, Mostafa; El-Gazzar, Mohamed

    2018-05-01

    Mycoplasma synoviae (MS) is a poultry pathogen with reported increased prevalence and virulence in recent years. MS strain identification is essential for prevention, control efforts and epidemiological outbreak investigations. Multiple multilocus based sequence typing schemes have been developed for MS, yet the resolution of these schemes could be limited for outbreak investigation. The cost of whole genome sequencing became close to that of sequencing the seven MLST targets; however, there is no standardized method for typing MS strains based on whole genome sequences. In this paper, we propose a core genome multilocus sequence typing (cgMLST) scheme as a standardized and reproducible method for typing MS based whole genome sequences. A diverse set of 25 MS whole genome sequences were used to identify 302 core genome genes as cgMLST targets (35.5% of MS genome) and 44 whole genome sequences of MS isolates from six countries in four continents were used for typing applying this scheme. cgMLST based phylogenetic trees displayed a high degree of agreement with core genome SNP based analysis and available epidemiological information. cgMLST allowed evaluation of two conventional MLST schemes of MS. The high discriminatory power of cgMLST allowed differentiation between samples of the same conventional MLST type. cgMLST represents a standardized, accurate, highly discriminatory, and reproducible method for differentiation between MS isolates. Like conventional MLST, it provides stable and expandable nomenclature, allowing for comparing and sharing the typing results between different laboratories worldwide. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Core damage frequency estimation using accident sequence precursor data: 1990-1993

    International Nuclear Information System (INIS)

    Martz, H.F.

    1998-01-01

    The Nuclear Regulatory Commission's (NRC's) ongoing Accident Sequence Precursor (ASP) program uses probabilistic risk assessment (PRA) techniques to assess the potential for severe core damage (henceforth referred to simply as core damage) based on operating events. The types of operating events considered include accident sequence initiators, safety equipment failures, and degradation of plant conditions that could increase the probability that various postulated accident sequences occur. Such operating events potentially reduce the margin of safety available for prevention of core damage an thus can be considered as precursors to core damage. The current process for identifying, analyzing, and documenting ASP events is described in detail in Vanden Heuval et al. The significance of a Licensee Event Report (LER) event (or events) is measured by means of the conditional probability that the event leads to core damage, the so-called conditional core damage probability or, simply, CCDP. When the first ASP study results were published in 1982, it covered the period 1969--1979. In addition to identification and ranking of precursors, the original study attempted to estimate core damage frequency (CDF) based on the precursor events. The purpose of this paper is to compare the average annual CDF estimates calculated using the CCDP sum, Cooke-Goossens, Bier, and Abramson estimators for various reactor classes using the combined ASP data for the four years, 1990--1993. An important outcome of this comparison is an answer to the persistent question regarding the degree and effect of the positive bias of the CCDP sum method in practice. Note that this paper only compares the estimators with each other. Because the true average CDF is unknown, the estimation error is also unknown. Therefore, any observations or characterizations of bias are based on purely theoretical considerations

  20. Location of core diagnostic information across various sequences in brain MRI and implications for efficiency of MRI scanner utilization.

    Science.gov (United States)

    Sharma, Aseem; Chatterjee, Arindam; Goyal, Manu; Parsons, Matthew S; Bartel, Seth

    2015-04-01

    Targeting redundancy within MRI can improve its cost-effective utilization. We sought to quantify potential redundancy in our brain MRI protocols. In this retrospective review, we aggregated 207 consecutive adults who underwent brain MRI and reviewed their medical records to document clinical indication, core diagnostic information provided by MRI, and its clinical impact. Contributory imaging abnormalities constituted positive core diagnostic information whereas absence of imaging abnormalities constituted negative core diagnostic information. The senior author selected core sequences deemed sufficient for extraction of core diagnostic information. For validating core sequences selection, four readers assessed the relative ease of extracting core diagnostic information from the core sequences. Potential redundancy was calculated by comparing the average number of core sequences to the average number of sequences obtained. Scanning had been performed using 9.4±2.8 sequences over 37.3±12.3 minutes. Core diagnostic information was deemed extractable from 2.1±1.1 core sequences, with an assumed scanning time of 8.6±4.8 minutes, reflecting a potential redundancy of 74.5%±19.1%. Potential redundancy was least in scans obtained for treatment planning (14.9%±25.7%) and highest in scans obtained for follow-up of benign diseases (81.4%±12.6%). In 97.4% of cases, all four readers considered core diagnostic information to be either easily extractable from core sequences or the ease to be equivalent to that from the entire study. With only one MRI lacking clinical impact (0.48%), overutilization did not seem to contribute to potential redundancy. High potential redundancy that can be targeted for more efficient scanner utilization exists in brain MRI protocols.

  1. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    Directory of Open Access Journals (Sweden)

    Devaraj Illakkiam

    2014-01-01

    Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

  2. Training of adolescent multipliers from the perspective of health promotion core competencies

    Directory of Open Access Journals (Sweden)

    Kely Vanessa Leite Gomes da Silva

    Full Text Available ABSTRACT Objective: Recognize the domains of health promotion core competencies in the training process of adolescents carried out by nursing students. Method: Qualitative and descriptive study, which used the theoretical methodological contribution Developing Competencies and Professional Standards for Health Promotion Capacity Building in Europe (CompHP, carried out with 14 nursing students. Results: There were four domains: Enable Change; Mediate through Partnership; Communication; and Leadership. These domains came from the interest and commitment of adolescents in intersectoral partnership, the use of communication techniques, and the role of facilitator to catalyze learning and empowerment. Conclusion: There were some domains of core competency in the training of adolescents, suggesting that nursing students act as health promoters. Challenges for Nursing are the implementation of a theoretical contribution of CompHP in undergraduate and ongoing training to carry out health promotion action.

  3. Asteroseismic measurement of surface-to-core rotation in a main-sequence star*

    Directory of Open Access Journals (Sweden)

    Kurtz Donald W.

    2015-01-01

    Full Text Available We have discovered rotationally split core g-mode triplets and surface p-mode triplets and quintuplets in a terminal age main-sequence A star, KIC 11145123, that shows both δ Sct p-mode pulsations and γ Dor g-mode pulsations. This gives the first robust determination of the rotation of the deep core and surface of a main-sequence star, essentially model-independently. We find its rotation to be nearly uniform with a period near 100 d, but we show with high confidence that the surface rotates slightly faster than the core. A strong angular momentum transfer mechanism must be operating to produce the nearly rigid rotation, and a mechanism other than viscosity must be operating to produce a more rapidly rotating surface than core. Our asteroseismic result, along with previous asteroseismic constraints on internal rotation in some B stars, and measurements of internal rotation in some subgiant, giant and white dwarf stars, has made angular momentum transport in stars throughout their lifetimes an observational science.

  4. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

    1994-01-01

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  5. HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com

    2015-10-23

    This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases

  6. HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

    International Nuclear Information System (INIS)

    Tan, Yongsheng; Li, Yan

    2015-01-01

    This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1

  7. Partnership between CTSI and business schools can promote best practices for core facilities and resources.

    Science.gov (United States)

    Reeves, Lilith; Dunn-Jensen, Linda M; Baldwin, Timothy T; Tatikonda, Mohan V; Cornetta, Kenneth

    2013-08-01

    Biomedical research enterprises require a large number of core facilities and resources to supply the infrastructure necessary for translational research. Maintaining the financial viability and promoting efficiency in an academic environment can be particularly challenging for medical schools and universities. The Indiana Clinical and Translational Sciences Institute sought to improve core and service programs through a partnership with the Indiana University Kelley School of Business. The program paired teams of Masters of Business Administration students with cores and programs that self-identified the need for assistance in project management, financial management, marketing, or resource efficiency. The projects were developed by CTSI project managers and business school faculty using service-learning principles to ensure learning for students who also received course credit for their participation. With three years of experience, the program demonstrates a successful partnership that improves clinical research infrastructure by promoting business best practices and providing a valued learning experience for business students. © 2013 Wiley Periodicals, Inc.

  8. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  9. Core genome conservation of Staphylococcus haemolyticus limits sequence based population structure analysis.

    Science.gov (United States)

    Cavanagh, Jorunn Pauline; Klingenberg, Claus; Hanssen, Anne-Merethe; Fredheim, Elizabeth Aarag; Francois, Patrice; Schrenzel, Jacques; Flægstad, Trond; Sollid, Johanna Ericson

    2012-06-01

    The notoriously multi-resistant Staphylococcus haemolyticus is an emerging pathogen causing serious infections in immunocompromised patients. Defining the population structure is important to detect outbreaks and spread of antimicrobial resistant clones. Currently, the standard typing technique is pulsed-field gel electrophoresis (PFGE). In this study we describe novel molecular typing schemes for S. haemolyticus using multi locus sequence typing (MLST) and multi locus variable number of tandem repeats (VNTR) analysis. Seven housekeeping genes (MLST) and five VNTR loci (MLVF) were selected for the novel typing schemes. A panel of 45 human and veterinary S. haemolyticus isolates was investigated. The collection had diverse PFGE patterns (38 PFGE types) and was sampled over a 20 year-period from eight countries. MLST resolved 17 sequence types (Simpsons index of diversity [SID]=0.877) and MLVF resolved 14 repeat types (SID=0.831). We found a low sequence diversity. Phylogenetic analysis clustered the isolates in three (MLST) and one (MLVF) clonal complexes, respectively. Taken together, neither the MLST nor the MLVF scheme was suitable to resolve the population structure of this S. haemolyticus collection. Future MLVF and MLST schemes will benefit from addition of more variable core genome sequences identified by comparing different fully sequenced S. haemolyticus genomes. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

  11. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

    2015-01-01

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  12. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    OpenAIRE

    W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

    2017-01-01

    The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

  13. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  14. The Interplay of Opacities and Rotation in Promoting the Explosion of Core-Collapse Supernovae

    Science.gov (United States)

    Vartanyan, David; Burrows, Adam; Radice, David

    2018-01-01

    For over five decades, the mechanism of explosion in core-collapse supernovae has been a central unsolved problem in astrophysics, challenging both our computational capabilities and our understanding of relevant physics. Current simulations often produce explosions, but they are at times underenergetic. The neutrino mechanism, wherein a fraction of emitted neutrinos is absorbed in the mantle of the star to reignite the stalled shock, remains the dominant model for reviving explosions in massive stars undergoing core collapse. We present here a diverse suite of 2D axisymmetric simulations produced by FORNAX, a highly parallelizable multidimensional supernova simulation code. We explore the effects of various corrections, including the many-body correction, to neutrino-matter opacities and the possible role of rotation in promoting explosion amongst various core-collapse progenitors.

  15. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  16. Genome-scale portrait and evolutionary significance of human-specific core promoter tri- and tetranucleotide short tandem repeats.

    Science.gov (United States)

    Nazaripanah, N; Adelirad, F; Delbari, A; Sahaf, R; Abbasi-Asl, T; Ohadi, M

    2018-04-05

    While there is an ongoing trend to identify single nucleotide substitutions (SNSs) that are linked to inter/intra-species differences and disease phenotypes, short tandem repeats (STRs)/microsatellites may be of equal (if not more) importance in the above processes. Genes that contain STRs in their promoters have higher expression divergence compared to genes with fixed or no STRs in the gene promoters. In line with the above, recent reports indicate a role of repetitive sequences in the rise of young transcription start sites (TSSs) in human evolution. Following a comparative genomics study of all human protein-coding genes annotated in the GeneCards database, here we provide a genome-scale portrait of human-specific short- and medium-size (≥ 3-repeats) tri- and tetranucleotide STRs and STR motifs in the critical core promoter region between - 120 and + 1 to the TSS and evidence of skewing of this compartment in reference to the STRs that are not human-specific (Levene's test p human-specific transcripts was detected in the tri and tetra human-specific compartments (mid-p genome-scale skewing of STRs at a specific region of the human genome and a link between a number of these STRs and TSS selection/transcript specificity. The STRs and genes listed here may have a role in the evolution and development of characteristics and phenotypes that are unique to the human species.

  17. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  18. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    Directory of Open Access Journals (Sweden)

    W.S.I. de Silva

    2017-07-01

    Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

  19. Core promoter mutations 3 years after anti-hepatitis B e seroconversion in patients with chronic hepatitis B or hepatitis B and C infection and cancer remission.

    Science.gov (United States)

    Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe

    2002-09-01

    In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.

  20. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

  1. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Directory of Open Access Journals (Sweden)

    Jin Duan

    Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  2. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    Science.gov (United States)

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  3. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

    Directory of Open Access Journals (Sweden)

    Christine R Langlois

    2016-11-01

    Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

  4. Catalogue of generic plant states leading to core melt in PWRs: includes appendix 1: detailed description of sequences leading to core melt

    International Nuclear Information System (INIS)

    1996-11-01

    The Task Group on thermal-hydraulic system behaviour was given a mandate from PWG 2 on Coolant System-Behaviour with the approval of CSNI to deal with the topic of Accident Management. A writing group was set up to identify generic plant states leading to core melt for pressurized water reactors (PWR) and find 'possible approaches to accident management measures' (AM-Measures) for dealing with them. From a matrix of 15 initiating events and 12 system failures (i.e. from 180 possibilities), 32 event sequences have been identified as leading to core melt. Each sequence has been divided into characteristic plant state intervals according to safety function challenges. For each of the 141 defined characteristic plant state intervals, the members of the Writing Group made proposals for AM-Measures

  5. Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

    Directory of Open Access Journals (Sweden)

    Liu Wen-Sheng

    2010-11-01

    Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

  6. Mitochondrial Respiration Is Reduced in Atherosclerosis, Promoting Necrotic Core Formation and Reducing Relative Fibrous Cap Thickness.

    Science.gov (United States)

    Yu, Emma P K; Reinhold, Johannes; Yu, Haixiang; Starks, Lakshi; Uryga, Anna K; Foote, Kirsty; Finigan, Alison; Figg, Nichola; Pung, Yuh-Fen; Logan, Angela; Murphy, Michael P; Bennett, Martin

    2017-12-01

    Mitochondrial DNA (mtDNA) damage is present in murine and human atherosclerotic plaques. However, whether endogenous levels of mtDNA damage are sufficient to cause mitochondrial dysfunction and whether decreasing mtDNA damage and improving mitochondrial respiration affects plaque burden or composition are unclear. We examined mitochondrial respiration in human atherosclerotic plaques and whether augmenting mitochondrial respiration affects atherogenesis. Human atherosclerotic plaques showed marked mitochondrial dysfunction, manifested as reduced mtDNA copy number and oxygen consumption rate in fibrous cap and core regions. Vascular smooth muscle cells derived from plaques showed impaired mitochondrial respiration, reduced complex I expression, and increased mitophagy, which was induced by oxidized low-density lipoprotein. Apolipoprotein E-deficient (ApoE -/- ) mice showed decreased mtDNA integrity and mitochondrial respiration, associated with increased mitochondrial reactive oxygen species. To determine whether alleviating mtDNA damage and increasing mitochondrial respiration affects atherogenesis, we studied ApoE -/- mice overexpressing the mitochondrial helicase Twinkle (Tw + /ApoE -/- ). Tw + /ApoE -/- mice showed increased mtDNA integrity, copy number, respiratory complex abundance, and respiration. Tw + /ApoE -/- mice had decreased necrotic core and increased fibrous cap areas, and Tw + /ApoE -/- bone marrow transplantation also reduced core areas. Twinkle increased vascular smooth muscle cell mtDNA integrity and respiration. Twinkle also promoted vascular smooth muscle cell proliferation and protected both vascular smooth muscle cells and macrophages from oxidative stress-induced apoptosis. Endogenous mtDNA damage in mouse and human atherosclerosis is associated with significantly reduced mitochondrial respiration. Reducing mtDNA damage and increasing mitochondrial respiration decrease necrotic core and increase fibrous cap areas independently of changes in

  7. Cued memory reactivation during slow-wave sleep promotes explicit knowledge of a motor sequence.

    Science.gov (United States)

    Cousins, James N; El-Deredy, Wael; Parkes, Laura M; Hennies, Nora; Lewis, Penelope A

    2014-11-26

    Memories are gradually consolidated after initial encoding, and this can sometimes lead to a transition from implicit to explicit knowledge. The exact physiological processes underlying this reorganization remain unclear. Here, we used a serial reaction time task to determine whether targeted memory reactivation (TMR) of specific memory traces during slow-wave sleep promotes the emergence of explicit knowledge. Human participants learned two 12-item sequences of button presses (A and B). These differed in both cue order and in the auditory tones associated with each of the four fingers (one sequence had four higher-pitched tones). Subsequent overnight sleep was monitored, and the tones associated with one learned sequence were replayed during slow-wave sleep. After waking, participants demonstrated greater explicit knowledge (p = 0.005) and more improved procedural skill (p = 0.04) for the cued sequence relative to the uncued sequence. Furthermore, fast spindles (13.5-15 Hz) at task-related motor regions predicted overnight enhancement in procedural skill (r = 0.71, p = 0.01). Auditory cues had no effect on post-sleep memory performance in a control group who received TMR before sleep. These findings suggest that TMR during sleep can alter memory representations and promote the emergence of explicit knowledge, supporting the notion that reactivation during sleep is a key mechanism in this process. Copyright © 2014 Cousins et al.

  8. Isolation and sequencing analysis on the seed-specific promoter from soybean

    Institute of Scientific and Technical Information of China (English)

    CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

    2007-01-01

    The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

  9. Further attempts at dating the palynological sequence of the Hula Lo7 core, upper Jordan Valley, Israel

    CSIR Research Space (South Africa)

    Weinstein-Evron, M

    2001-01-01

    Full Text Available The palynological sequence of the Hula L07 core was previously correlated with the global oxygen isotope stages 3-5, based on a radiocarbon age determination and comparison with other Levantine paleoclimatological curves. An attempt was made...

  10. Unraveling Core Functional Microbiota in Traditional Solid-State Fermentation by High-Throughput Amplicons and Metatranscriptomics Sequencing.

    Science.gov (United States)

    Song, Zhewei; Du, Hai; Zhang, Yan; Xu, Yan

    2017-01-01

    Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing) and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces , and Zygosaccharomyces ) and lactic acid bacteria (genus Lactobacillus ) classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol) production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid) production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol) to acid (lactic acid and acetic acid) in Chinese Maotai-flavor liquor production. Our findings provide insight into

  11. Unraveling Core Functional Microbiota in Traditional Solid-State Fermentation by High-Throughput Amplicons and Metatranscriptomics Sequencing

    Directory of Open Access Journals (Sweden)

    Zhewei Song

    2017-07-01

    Full Text Available Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces, and Zygosaccharomyces and lactic acid bacteria (genus Lactobacillus classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol to acid (lactic acid and acetic acid in Chinese Maotai-flavor liquor production. Our findings provide

  12. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  13. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

    Science.gov (United States)

    Raynard, Steven J; Baker, Mark D

    2004-01-01

    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  14. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

    Science.gov (United States)

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

    2012-01-01

    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  15. TAF4 nucleates a core subcomplex of TFIID and mediates activated transcription from a TATA-less promoter

    OpenAIRE

    Wright, Kevin J.; Marr, Michael T.; Tjian, Robert

    2006-01-01

    Activator-dependent recruitment of TFIID initiates formation of the transcriptional preinitiation complex. TFIID binds core promoter DNA elements and directs the assembly of other general transcription factors, leading to binding of RNA polymerase II and activation of RNA synthesis. How TATA box-binding protein (TBP) and the TBP-associated factors (TAFs) are assembled into a functional TFIID complex with promoter recognition and coactivator activities in vivo remains unknown. Here, we use RNA...

  16. Genome Sequence of Azospirillum brasilense CBG497 and Comparative Analyses of Azospirillum Core and Accessory Genomes provide Insight into Niche Adaptation

    Science.gov (United States)

    Wisniewski-Dyé, Florence; Lozano, Luis; Acosta-Cruz, Erika; Borland, Stéphanie; Drogue, Benoît; Prigent-Combaret, Claire; Rouy, Zoé; Barbe, Valérie; Mendoza Herrera, Alberto; González, Victor; Mavingui, Patrick

    2012-01-01

    Bacteria of the genus Azospirillum colonize roots of important cereals and grasses, and promote plant growth by several mechanisms, notably phytohormone synthesis. The genomes of several Azospirillum strains belonging to different species, isolated from various host plants and locations, were recently sequenced and published. In this study, an additional genome of an A. brasilense strain, isolated from maize grown on an alkaline soil in the northeast of Mexico, strain CBG497, was obtained. Comparative genomic analyses were performed on this new genome and three other genomes (A. brasilense Sp245, A. lipoferum 4B and Azospirillum sp. B510). The Azospirillum core genome was established and consists of 2,328 proteins, representing between 30% to 38% of the total encoded proteins within a genome. It is mainly chromosomally-encoded and contains 74% of genes of ancestral origin shared with some aquatic relatives. The non-ancestral part of the core genome is enriched in genes involved in signal transduction, in transport and in metabolism of carbohydrates and amino-acids, and in surface properties features linked to adaptation in fluctuating environments, such as soil and rhizosphere. Many genes involved in colonization of plant roots, plant-growth promotion (such as those involved in phytohormone biosynthesis), and properties involved in rhizosphere adaptation (such as catabolism of phenolic compounds, uptake of iron) are restricted to a particular strain and/or species, strongly suggesting niche-specific adaptation. PMID:24705077

  17. Genome Sequence of Azospirillum brasilense CBG497 and Comparative Analyses of Azospirillum Core and Accessory Genomes provide Insight into Niche Adaptation

    Directory of Open Access Journals (Sweden)

    Victor González

    2012-09-01

    Full Text Available Bacteria of the genus Azospirillum colonize roots of important cereals and grasses, and promote plant growth by several mechanisms, notably phytohormone synthesis. The genomes of several Azospirillum strains belonging to different species, isolated from various host plants and locations, were recently sequenced and published. In this study, an additional genome of an A. brasilense strain, isolated from maize grown on an alkaline soil in the northeast of Mexico, strain CBG497, was obtained. Comparative genomic analyses were performed on this new genome and three other genomes (A. brasilense Sp245, A. lipoferum 4B and Azospirillum sp. B510. The Azospirillum core genome was established and consists of 2,328 proteins, representing between 30% to 38% of the total encoded proteins within a genome. It is mainly chromosomally-encoded and contains 74% of genes of ancestral origin shared with some aquatic relatives. The non-ancestral part of the core genome is enriched in genes involved in signal transduction, in transport and in metabolism of carbohydrates and amino-acids, and in surface properties features linked to adaptation in fluctuating environments, such as soil and rhizosphere. Many genes involved in colonization of plant roots, plant-growth promotion (such as those involved in phytohormone biosynthesis, and properties involved in rhizosphere adaptation (such as catabolism of phenolic compounds, uptake of iron are restricted to a particular strain and/or species, strongly suggesting niche-specific adaptation.

  18. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  19. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    OpenAIRE

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

  20. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  1. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    Science.gov (United States)

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  2. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  3. Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

    Science.gov (United States)

    Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

    2018-05-01

    Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that

  4. Core Genome Multilocus Sequence Typing Scheme for Stable, Comparative Analyses of Campylobacter jejuni and C. coli Human Disease Isolates.

    Science.gov (United States)

    Cody, Alison J; Bray, James E; Jolley, Keith A; McCarthy, Noel D; Maiden, Martin C J

    2017-07-01

    Human campylobacteriosis, caused by Campylobacter jejuni and C. coli , remains a leading cause of bacterial gastroenteritis in many countries, but the epidemiology of campylobacteriosis outbreaks remains poorly defined, largely due to limitations in the resolution and comparability of isolate characterization methods. Whole-genome sequencing (WGS) data enable the improvement of sequence-based typing approaches, such as multilocus sequence typing (MLST), by substantially increasing the number of loci examined. A core genome MLST (cgMLST) scheme defines a comprehensive set of those loci present in most members of a bacterial group, balancing very high resolution with comparability across the diversity of the group. Here we propose a set of 1,343 loci as a human campylobacteriosis cgMLST scheme (v1.0), the allelic profiles of which can be assigned to core genome sequence types. The 1,343 loci chosen were a subset of the 1,643 loci identified in the reannotation of the genome sequence of C. jejuni isolate NCTC 11168, chosen as being present in >95% of draft genomes of 2,472 representative United Kingdom campylobacteriosis isolates, comprising 2,207 (89.3%) C. jejuni isolates and 265 (10.7%) C. coli isolates. Validation of the cgMLST scheme was undertaken with 1,478 further high-quality draft genomes, containing 150 or fewer contiguous sequences, from disease isolate collections: 99.5% of these isolates contained ≥95% of the 1,343 cgMLST loci. In addition to the rapid and effective high-resolution analysis of large numbers of diverse isolates, the cgMLST scheme enabled the efficient identification of very closely related isolates from a well-defined single-source campylobacteriosis outbreak. Copyright © 2017 Cody et al.

  5. pyPaSWAS : Python-based multi-core CPU and GPU sequence alignment

    NARCIS (Netherlands)

    Warris, Sven; Timal, N Roshan N; Kempenaar, Marcel; Poortinga, Arne M; van de Geest, Henri; Varbanescu, Ana L; Nap, Jan-Peter

    2018-01-01

    BACKGROUND: Our previously published CUDA-only application PaSWAS for Smith-Waterman (SW) sequence alignment of any type of sequence on NVIDIA-based GPUs is platform-specific and therefore adopted less than could be. The OpenCL language is supported more widely and allows use on a variety of

  6. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Jing Qin Wu

    Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  7. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  8. STELLAR AGES AND CONVECTIVE CORES IN FIELD MAIN-SEQUENCE STARS: FIRST ASTEROSEISMIC APPLICATION TO TWO KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Silva Aguirre, V.; Christensen-Dalsgaard, J.; Chaplin, W. J. [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Basu, S.; Deheuvels, S. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Brandao, I. M.; Cunha, M. S.; Sousa, S. G. [Centro de Astrofisica and Faculdade de Ciencias, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Dogan, G. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Metcalfe, T. S. [Space Science Institute, Boulder, CO 80301 (United States); Serenelli, A. M.; Garcia, R. A. [Kavli Institute for Theoretical Physics, Santa Barbara, CA 93106 (United States); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin, F-31400 Toulouse (France); Weiss, A. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85748 Garching bei Muenchen (Germany); Appourchaux, T. [Institut d' Astrophysique Spatiale, Universite Paris Sud-CNRS (UMR8617) Batiment 121, F-91405 Orsay Cedex (France); Casagrande, L. [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, ACT 2611 (Australia); Cassisi, S. [INAF-Astronomical Observatory of Teramo, Via M. Maggini sn, I-64100 Teramo (Italy); Creevey, O. L. [Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, CNRS, I-06300 Nice, France. (France); Lebreton, Y. [Observatoire de Paris, GEPI, CNRS UMR 8111, F-92195 Meudon (France); Noels, A. [Institute of Astrophysics and Geophysics, University of Liege, B-4000 Liege (Belgium); and others

    2013-06-01

    Using asteroseismic data and stellar evolution models we obtain the first detection of a convective core in a Kepler field main-sequence star, putting a stringent constraint on the total size of the mixed zone and showing that extra mixing beyond the formal convective boundary exists. In a slightly less massive target the presence of a convective core cannot be conclusively discarded, and thus its remaining main-sequence lifetime is uncertain. Our results reveal that best-fit models found solely by matching individual frequencies of oscillations corrected for surface effects do not always properly reproduce frequency combinations. Moreover, slightly different criteria to define what the best-fit model is can lead to solutions with similar global properties but very different interior structures. We argue that the use of frequency ratios is a more reliable way to obtain accurate stellar parameters, and show that our analysis in field main-sequence stars can yield an overall precision of 1.5%, 4%, and 10% in radius, mass, and age, respectively. We compare our results with those obtained from global oscillation properties, and discuss the possible sources of uncertainties in asteroseismic stellar modeling where further studies are still needed.

  9. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  10. Genome-wide detection and analysis of hippocampus core promoters using DeepCAGE

    DEFF Research Database (Denmark)

    Valen, Eivind; Pascarella, Giovanni; Chalk, Alistair

    2009-01-01

    in a given tissue. Here, we present a new method for high-throughput sequencing of 5' cDNA tags-DeepCAGE: merging the Cap Analysis of Gene Expression method with ultra-high-throughput sequence technology. We apply DeepCAGE to characterize 1.4 million sequenced TSS from mouse hippocampus and reveal a wealth...

  11. Development of accident sequence precursors methodologies for core damage Probabilities in NPPs

    International Nuclear Information System (INIS)

    Munoz, R.; Minguez, E.; Melendez, E.; Sanchez-Perea, M.; Izquierdo, J.M.

    1998-01-01

    Several licensing programs have focused on the evaluation of the importance of operating events occurred in NPPs. Some have worked the dynamic aspects of the sequence of events involved, reproducing the incidents, while others are based on PSA applications to incident analysis. A method that controls the two above approaches to determine risk analysis derives from the Integrated Safety Assessment methodology (ISA). The dynamics of the event is followed by transient simulation in tree form, building a Setpoint or Deterministic Dynamic Event Tree (DDET). When a setpoint is reached, the actuation of a protection is triggered, then the tree is opened in branches corresponding to different functioning states. The engineering simulator with the new states followers each branch. One of these states is the nominal one, which is the PSA is associated to the success criterion of the system. The probability of the sequence is calculated in parallel to the dynamics. The following tools should perform the couple simulation: 1. A Scheduler that drives the simulation of the different sequences, and open branches upon demand. It will be the unique generator of processes while constructing the tree calculation, and will develop the computation in a distributed computational environment. 2. The Plant Simulator, which models the plant systems and the operator actions throughout a sequence. It receives the state of the equipment in each sequence and must provide information about setpoint crossing to the Scheduler. It will receive decision flags to continue or to stop each sequence, and to send new conditions to other plant simulators. 3. The Probability Calculator, linked only to the Scheduler, is the fault trees associated with each event tree header and performing their Boolean product. (Author)

  12. Nigeria's Core Values and the Use of Social Media to Promote Cultural Values

    Science.gov (United States)

    Asemah, Ezekiel S.; Ekhareafo, Daniel O.; Olaniran, Samuel

    2013-01-01

    This article examines how Nigeria's core values are being redefined in the face of the new media and cultural globalisation era; it identifies Nigeria's core values to include age, greeting, dressing, among others. The questionnaire was used as an instrument to elicit data from the sampled population (Jos South Local Government Area of Plateau…

  13. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  14. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  15. On the sequence of core-melt accidents: Fission product release, source terms and Chernobyl release

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht, H

    1986-01-01

    There is a sketch of our ideas on the course of a core melt-out accident in a PWR. There is then a survey of the most important results on fission product release, which were obtained by experiments on the SASCHA melt-out plant. The 3rd part considers questions which are important for determining source terms for the environment and the last part contains some considerations on radioactivity release from the Chernobyl reactor.

  16. Core Genome Multilocus Sequence Typing Scheme for High-resolution Typing of Enterococcus faecium

    DEFF Research Database (Denmark)

    de Been, Mark; Pinholt, Mette; Top, Janetta

    2015-01-01

    Enterococcus faecium, a common inhabitant of the human gut, has emerged as an important multidrug-resistant nosocomial pathogen in the last two decades. Since the start of the 21(st) century, multi-locus sequence typing (MLST) has been used to study the molecular epidemiology of E. faecium. However...

  17. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Directory of Open Access Journals (Sweden)

    Ayon Pal

    Full Text Available A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding

  18. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    Science.gov (United States)

    Pal, Ayon; Banerjee, Rachana; Mondal, Uttam K; Mukhopadhyay, Subhasis; Bothra, Asim K

    2015-01-01

    A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding frequency signature.

  19. Efficient method for simulation of BWR severe accident sequence events before core uncovery

    International Nuclear Information System (INIS)

    Harrington, R.M.

    1984-01-01

    BWR-LACP has been a versatile tool for the ORNL SASA program. The development effort was minimal, and the code is fast running and economical. Operator actions are easily simulated and the complete scope of both reactor vessel and primary containment are modeled. Valuable insights have been gained into accident sequences. A Fortran version is under development and it will be modified for application to Mark II plants

  20. Evaluation of the Abbott realtime HCV genotype II RUO (GT II) assay with reference to 5'UTR, core and NS5B sequencing.

    Science.gov (United States)

    Mallory, Melanie A; Lucic, Danijela X; Sears, Mitchell T; Cloherty, Gavin A; Hillyard, David R

    2014-05-01

    HCV genotyping is a critical tool for guiding initiation of therapy and selecting the most appropriate treatment regimen. To evaluate the concordance between the Abbott GT II assay and genotyping by sequencing subregions of the HCV 5'UTR, core and NS5B. The Abbott assay was used to genotype 127 routine patient specimens and 35 patient specimens with unusual subtypes and mixed infection. Abbott results were compared to genotyping by 5'UTR, core and NS5B sequencing. Sequences were genotyped using the NCBI non-redundant database and the online genotyping tool COMET. Among routine specimens, core/NS5B sequencing identified 93 genotype 1s, 13 genotype 2s, 15 genotype 3s, three genotype 4s, two genotype 6s and one recombinant specimen. Genotype calls by 5'UTR, core, NS5B sequencing and the Abbott assay were 97.6% concordant. Core/NS5B sequencing identified two discrepant samples as genotype 6 (subtypes 6l and 6u) while Abbott and 5'UTR sequencing identified these samples as genotype 1 with no subtype. The Abbott assay subtyped 91.4% of genotype 1 specimens. Among the 35 rare specimens, the Abbott assay inaccurately genotyped 3k, 6e, 6o, 6q and one genotype 4 variant; gave indeterminate results for 3g, 3h, 4r, 6m, 6n, and 6q specimens; and agreed with core/NS5B sequencing for mixed specimens. The Abbott assay is an automated HCV genotyping method with improved accuracy over 5'UTR sequencing. Samples identified by the Abbott assay as genotype 1 with no subtype may be rare subtypes of other genotypes and thus require confirmation by another method. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

    DEFF Research Database (Denmark)

    Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

    2003-01-01

    To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

  2. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  3. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  4. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  5. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    Science.gov (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  6. Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Genome-Wide Typing of Clostridium difficile.

    Science.gov (United States)

    Bletz, Stefan; Janezic, Sandra; Harmsen, Dag; Rupnik, Maja; Mellmann, Alexander

    2018-06-01

    Clostridium difficile , recently renamed Clostridioides difficile , is the most common cause of antibiotic-associated nosocomial gastrointestinal infections worldwide. To differentiate endogenous infections and transmission events, highly discriminatory subtyping is necessary. Today, methods based on whole-genome sequencing data are increasingly used to subtype bacterial pathogens; however, frequently a standardized methodology and typing nomenclature are missing. Here we report a core genome multilocus sequence typing (cgMLST) approach developed for C. difficile Initially, we determined the breadth of the C. difficile population based on all available MLST sequence types with Bayesian inference (BAPS). The resulting BAPS partitions were used in combination with C. difficile clade information to select representative isolates that were subsequently used to define cgMLST target genes. Finally, we evaluated the novel cgMLST scheme with genomes from 3,025 isolates. BAPS grouping ( n = 6 groups) together with the clade information led to a total of 11 representative isolates that were included for cgMLST definition and resulted in 2,270 cgMLST genes that were present in all isolates. Overall, 2,184 to 2,268 cgMLST targets were detected in the genome sequences of 70 outbreak-associated and reference strains, and on average 99.3% cgMLST targets (1,116 to 2,270 targets) were present in 2,954 genomes downloaded from the NCBI database, underlining the representativeness of the cgMLST scheme. Moreover, reanalyzing different cluster scenarios with cgMLST were concordant to published single nucleotide variant analyses. In conclusion, the novel cgMLST is representative for the whole C. difficile population, is highly discriminatory in outbreak situations, and provides a unique nomenclature facilitating interlaboratory exchange. Copyright © 2018 American Society for Microbiology.

  7. Draft Genome Sequence of Bacillus velezensis Lzh-a42, a Plant Growth-Promoting Rhizobacterium Isolated from Tomato Rhizosphere.

    Science.gov (United States)

    Li, Zhenghua; Chen, Mei; Ran, Kun; Wang, Jihua; Zeng, Qiangcheng; Song, Feng

    2018-03-22

    The plant growth-promoting rhizobacterium Bacillus velezensis strain Lzh-a42, which has antimicrobial activity, was isolated from tomato rhizosphere. Here, we report its genome sequence, which includes several predicted functional genes related to secondary metabolite biosynthesis, antimicrobial activity, and biofilm synthesis. Copyright © 2018 Li et al.

  8. Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

    Science.gov (United States)

    Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

    2017-08-31

    Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

  9. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi

    2016-11-04

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  10. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  11. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    Energy Technology Data Exchange (ETDEWEB)

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  12. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...

  13. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....

  14. Reorienting health services with capacity building: a case study of the Core Skills in Health Promotion Project.

    Science.gov (United States)

    Yeatman, H R; Nove, T

    2002-12-01

    This paper presents a case study of the application of a framework for capacity building [Hawe, P., King, L., Noort, M., Jordens, C. and Lloyd, B. (2000) Indicators to Help with Capacity Building in Health Promotion. NSW Health, Sydney] to describe actions aimed at building organizational support for health promotion within an area health service in New South Wales, Australia. The Core Skills in Health Promotion Project (CSHPP) arose from an investigation which reported that participants of a health promotion training course had increased health promotion skills but that they lacked the support to apply their skills in the workplace. The project was action-research based. It investigated and facilitated the implementation of a range of initiatives to support community health staff to apply a more preventive approach in their practice and it contributed to the establishment of new organizational structures for health promotion. An evaluation was undertaken 4 years after the CSHPP was established, and 2 years after it had submitted its final report. Interviews with senior managers, document analysis of written reports, and focus groups with middle managers and service delivery staff were undertaken. Change was achieved in the three dimensions of health infrastructure, program maintenance and problem solving capacity of the organization. It was identified that the critically important elements in achieving the aims of the project-partnership, leadership and commitment-were also key elements of the capacity building framework. This case study provides a practical example of the usefulness of the capacity building framework in orienting health services to be supportive of health promotion.

  15. An improved method for quantitatively measuring the sequences of total organic carbon and black carbon in marine sediment cores

    Science.gov (United States)

    Xu, Xiaoming; Zhu, Qing; Zhou, Qianzhi; Liu, Jinzhong; Yuan, Jianping; Wang, Jianghai

    2018-01-01

    Understanding global carbon cycle is critical to uncover the mechanisms of global warming and remediate its adverse effects on human activities. Organic carbon in marine sediments is an indispensable part of the global carbon reservoir in global carbon cycling. Evaluating such a reservoir calls for quantitative studies of marine carbon burial, which closely depend on quantifying total organic carbon and black carbon in marine sediment cores and subsequently on obtaining their high-resolution temporal sequences. However, the conventional methods for detecting the contents of total organic carbon or black carbon cannot resolve the following specific difficulties, i.e., (1) a very limited amount of each subsample versus the diverse analytical items, (2) a low and fluctuating recovery rate of total organic carbon or black carbon versus the reproducibility of carbon data, and (3) a large number of subsamples versus the rapid batch measurements. In this work, (i) adopting the customized disposable ceramic crucibles with the microporecontrolled ability, (ii) developing self-made or customized facilities for the procedures of acidification and chemothermal oxidization, and (iii) optimizing procedures and carbon-sulfur analyzer, we have built a novel Wang-Xu-Yuan method (the WXY method) for measuring the contents of total organic carbon or black carbon in marine sediment cores, which includes the procedures of pretreatment, weighing, acidification, chemothermal oxidation and quantification; and can fully meet the requirements of establishing their highresolution temporal sequences, whatever in the recovery, experimental efficiency, accuracy and reliability of the measurements, and homogeneity of samples. In particular, the usage of disposable ceramic crucibles leads to evidently simplify the experimental scenario, which further results in the very high recovery rates for total organic carbon and black carbon. This new technique may provide a significant support for

  16. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

    Science.gov (United States)

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

    2016-10-15

    Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

  17. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris Harbor a Core Subset of Bacteria Normally Associated with the Wild Host.

    Directory of Open Access Journals (Sweden)

    Ivan Meeus

    Full Text Available A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella, Orbaceae (Gilliamella, Lactobacillaceae (Lactobacillus, and Bifidobacteriaceae (Bifidobacterium. In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed.

  18. A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

    Directory of Open Access Journals (Sweden)

    Lior Levy

    2017-10-01

    Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

  19. Social Justice at the Core of Breastfeeding Protection, Promotion and Support: A Conceptualization.

    Science.gov (United States)

    Smith, Paige Hall

    2018-05-01

    Despite widespread awareness of the health benefits for both mothers and babies we are far from achieving universal breastfeeding. Breastfeeding rates globally are lower than recommended levels and there are concerns that some global breastfeeding efforts have stalled (1, 2). In addition, we see persistent disparities in breastfeeding rates by race, ethnicity, class and status (3). A growing literature documents how a range of injustices, including gender inequality (7), racism (8), poverty (9), and violence (10, 11) shape whether, how exclusive, and for how long mothers and others will be able to breastfeed or feed their infants human milk. These social injustices and inequities work to privilege breastfeeding even as the health message becomes more mainstreamed and human milk more desirable. A social justice approach could help us address the gender, race, and sexuality-based inequities and injustices in opportunities, resources, status, and power that are influencing the patterns of breastfeeding we see today. The 12th Breastfeeding and Feminism International Conference held in 2017 took as its theme Breastfeeding as Social Justice: From Crucial Conversation to Inspired Action. The planning team for that conference identified seven core domains that could help us conceptualize a framework for placing social justice at the core of our work. This paper presents this framework and suggestions for policy and practice that follow.

  20. Structural models of the different trimers present in the core of phycobilisomes from Gracilaria chilensis based on crystal structures and sequences.

    Directory of Open Access Journals (Sweden)

    Jorge Dagnino-Leone

    Full Text Available Phycobilisomes (PBS are accessory light harvesting protein complexes that directionally transfer energy towards photosystems. Phycobilisomes are organized in a central core and rods radiating from it. Components of phycobilisomes in Gracilaria chilensis (Gch are Phycobiliproteins (PBPs, Phycoerythrin (PE, and Phycocyanin (PC in the rods, while Allophycocyanin (APC is found in the core, and linker proteins (L. The function of such complexes depends on the structure of each component and their interaction. The core of PBS from cyanobacteria is mainly composed by cylinders of trimers of α and β subunits forming heterodimers of Allophycocyanin, and other components of the core including subunits αII and β18. As for the linkers, Linker core (LC and Linker core membrane (LCM are essential for the final emission towards photoreaction centers. Since we have previously focused our studies on the rods of the PBS, in the present article we investigated the components of the core in the phycobilisome from the eukaryotic algae, Gracilaria chilensis and their organization into trimers. Transmission electron microscopy provided the information for a three cylinders core, while the three dimensional structure of Allophycocyanin purified from Gch was determined by X-ray diffraction method and the biological unit was determined as a trimer by size exclusion chromatography. The protein sequences of all the components of the core were obtained by sequencing the corresponding genes and their expression confirmed by transcriptomic analysis. These subunits have seldom been reported in red algae, but not in Gracilaria chilensis. The subunits not present in the crystallographic structure were modeled to build the different composition of trimers. This article proposes structural models for the different types of trimers present in the core of phycobilisomes of Gch as a first step towards the final model for energy transfer in this system.

  1. Genome Sequence of Bacillus velezensis S141, a New Strain of Plant Growth-Promoting Rhizobacterium Isolated from Soybean Rhizosphere.

    Science.gov (United States)

    Sibponkrung, Surachat; Kondo, Takahiko; Tanaka, Kosei; Tittabutr, Panlada; Boonkerd, Nantakorn; Teaumroong, Neung; Yoshida, Ken-Ichi

    2017-11-30

    Bacillus velezensis strain S141 is a plant growth-promoting rhizobacterium isolated from soybean ( Glycine max ) rhizosphere that enhances soybean growth, nodulation, and N 2 fixation efficiency by coinoculation with Bradyrhizobium diazoefficiens USDA110. The S141 genome was identified to comprise a 3,974,582-bp-long circular DNA sequence encoding at least 3,817 proteins. Copyright © 2017 Sibponkrung et al.

  2. Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

    Science.gov (United States)

    Hampel, Stefanie; McKellar, Claire E

    2017-01-01

    A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

  3. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  4. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    Science.gov (United States)

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  5. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  6. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    Science.gov (United States)

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  8. Prevalence of hepatitis B virus subgenotypes and basal core promoter, precore variants in patients with acute hepatitis B in central Vietnam.

    Science.gov (United States)

    Hayashi, Kazuhiko; Katano, Yoshiaki; Chuong, Tran Xuan; Takeda, Yasushi; Ishigami, Masatoshi; Itoh, Akihiro; Hirooka, Yoshiki; Nakano, Isao; Huy, Tran Van; Minh, Nguyen Ngoc; Diem, Tran thi Minh; An, Dong thi Hoai; Phiet, Pham Hoang; Goto, Hidemi

    2009-01-01

    Hepatitis B virus (HBV) has been classified into 8 genotypes that have different geographic distributions. The clinical outcomes of acute hepatitis are dependent on genotype. The aim of this study was to investigate the distribution of HBV subgenotypes and basal core promoter (BCP)/precore (PC) regions in acute hepatitis patients in Central Vietnam to clarify the distributions and the clinical and virological differences. 27 patients with acute hepatitis B were studied. HBV subgenotypes and BCP/PC variants were determined by direct sequencing of the preS, BCP/PC regions, respectively. HBV subgenotypes B4/Ba (n = 22) and C1/Cs (n = 5) were detected. Of the 27 patients, 3 developed fulminant hepatic failure, and all were infected with B4/Ba. Three patients had a BCP mutation, and 10 patients had a PC mutation in subgenotype B4/Ba. Three patients with C1/Cs had a BCP mutation. Two of 3 patients who progressed to fulminant hepatic failure had T1762, A1764, and A1896 simultaneously. None of the patients with acute, self-limited hepatitis carried these triple mutations. The prevalent HBV subgenotypes in patients with acute hepatitis B in Central Vietnam were B4/Ba and C1/Cs. BCP/PC variants have an association with the development of fulminant hepatic failure in subgenotype B4/Ba. Copyright 2009 S. Karger AG, Basel.

  9. Green Infrastructure Research Promotes Students' Deeper Interest in Core Courses of a Water Resources Program

    Science.gov (United States)

    Yerk, W.; Montalto, F. A.; Foti, R.

    2015-12-01

    As one of most innovative among low impact development technologies, Green Infrastructure (GI) is a new technology that presents a range of potential research opportunities. Inherently linked to sustainability, urban quality of life, resilience, and other such topics, GI also represents a unique opportunity to highlight the social relevance of practical STEM research to undergraduate students. The nature of research on urban GI, in fact, as well as the accessibility of the GI sites, allows students to combine hands-on experience with theoretical work. Furthermore, the range of scales of the projects is such that they can be managed within a single term, but does not preclude longer engagement. The Sustainable Water Resource Engineering lab at Drexel University is engaged in two types of GI research outside the classroom. One type is a research co-op research internship. The second is a selective university-wide faculty-mentored summer scholarship STAR (Students Tackling Advanced Research) specifically designed for freshmen. The research projects we developed for those curricula can be accomplished by undergraduate students, but also address a larger research need in this emerging field. The research tasks have included identifying and calibrating affordable instruments, designing and building experimental setups, and monitoring and evaluating performance of GI sites. The work also promoted deeper understanding of the hydrological processes and initiated learning beyond the students' current curricula. The practice of the Lab's research being embedded into the educational process receives positive feedback from the students and achieves meaningful and long-lasting learning objectives. The experience helps students to students acquire hands-on experience, improves their metacognition and evidence-based inquiring into real-world problems, and further advances decision-making and communication skills.

  10. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina

    2017-10-20

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  11. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina; Lafi, Feras Fawzi; Alam, Intikhab; Zé licourt, Axel de; Eida, Abdul Aziz; Bokhari, Ameerah; Alzubaidy, Hanin S.; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  12. Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

    Science.gov (United States)

    Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

    2014-07-17

    Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

  13. Designing and evaluating a context-based lesson sequence promoting conceptual coherence in biology

    NARCIS (Netherlands)

    Ummels, M. H J; Kamp, M. J A; De Kroon, H.; Boersma, K. Th|info:eu-repo/dai/nl/073043141

    2015-01-01

    Context-based education, in which students deal with biological concepts in a meaningful way, is showing promise in promoting the development of students conceptual coherence. However, literature gives little guidance about how this kind of education should be designed. Therefore, our study aims at

  14. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  15. Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Hua

    2006-08-01

    Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

  16. Research on dragons: a teaching sequence to promote the understanding of Nature of Science at Secondary School

    Directory of Open Access Journals (Sweden)

    Romero Ariza, Marta

    2013-01-01

    Full Text Available This paper presents a teaching sequence explicitly designed to improve the understanding of Nature of Science and support Secondary School students to acquire adequate understanding about scientific hypothesis, theories and laws. The instructional intervention engages students in an inquiry process where they have to formulate hypothesis, analyse data and draw conclusions based on evidence. It is a student-centred methodology where teachers act as facilitators and guides, promoting the development of scientific competences and the meaningful understanding of the terms hypothesis, law and theory.

  17. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  18. Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

    Science.gov (United States)

    Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

    2018-01-01

    High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

  19. Efficiency of Transcription from Promoter Sequence Variants in Lactobacillus Is Both Strain and Context Dependent

    OpenAIRE

    McCracken, Andrea; Timms, Peter

    1999-01-01

    The introduction of consensus −35 (TTGACA) and −10 (TATAAT) hexamers and a TG motif into the Lactobacillus acidophilus ATCC 4356 wild-type slpA promoter resulted in significant improvements (4.3-, 4.1-, and 10.7-fold, respectively) in transcriptional activity in Lactobacillus fermentum BR11. In contrast, the same changes resulted in decreased transcription in Lactobacillus rhamnosus GG. The TG motif was shown to be important in the context of weak −35 and −10 hexamers (L. fermentum BR11) or a...

  20. Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

    Science.gov (United States)

    Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

    2012-01-01

    IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

  1. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  2. Rationally designed turn promoting mutation in the amyloid-β peptide sequence stabilizes oligomers in solution.

    Directory of Open Access Journals (Sweden)

    Jayakumar Rajadas

    Full Text Available Enhanced production of a 42-residue beta amyloid peptide (Aβ(42 in affected parts of the brain has been suggested to be the main causative factor for the development of Alzheimer's Disease (AD. The severity of the disease depends not only on the amount of the peptide but also its conformational transition leading to the formation of oligomeric amyloid-derived diffusible ligands (ADDLs in the brain of AD patients. Despite being significant to the understanding of AD mechanism, no atomic-resolution structures are available for these species due to the evanescent nature of ADDLs that hinders most structural biophysical investigations. Based on our molecular modeling and computational studies, we have designed Met35Nle and G37p mutations in the Aβ(42 peptide (Aβ(42Nle35p37 that appear to organize Aβ(42 into stable oligomers. 2D NMR on the Aβ(42Nle35p37 peptide revealed the occurrence of two β-turns in the V24-N27 and V36-V39 stretches that could be the possible cause for the oligomer stability. We did not observe corresponding NOEs for the V24-N27 turn in the Aβ(21-43Nle35p37 fragment suggesting the need for the longer length amyloid peptide to form the stable oligomer promoting conformation. Because of the presence of two turns in the mutant peptide which were absent in solid state NMR structures for the fibrils, we propose, fibril formation might be hindered. The biophysical information obtained in this work could aid in the development of structural models for toxic oligomer formation that could facilitate the development of therapeutic approaches to AD.

  3. Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

    Science.gov (United States)

    Bertke, Andrea S; Patel, Amita; Krause, Philip R

    2007-06-01

    Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

  4. The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

    Directory of Open Access Journals (Sweden)

    Anitha Shanmugham

    Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

  5. Prenylcoumarins in One or Two Steps by a Microwave-Promoted Tandem Claisen Rearrangement/Wittig Olefination/Cyclization Sequence.

    Science.gov (United States)

    Schultze, Christiane; Schmidt, Bernd

    2018-05-04

    The one-pot synthesis of 8-prenylcoumarins from 1,1-dimethylallylated salicylaldehydes and the stabilized ylide [(ethoxycarbonyl)methylene]triphenylphosphorane under microwave conditions was found to have a limited scope. The sequence suffers from a difficult and sometimes low-yielding synthesis of the precursors and from a competing deprenylation upon microwave irradiation. This side reaction occurs in particular with electron rich arenes with two or more alkoxy groups at adjacent positions, a prominent substitution pattern in naturally occurring 8-prenylcoumarins. Both limitations of this one-step sequence were overcome by a two-step synthesis consisting of a microwave-promoted tandem allyl ether Claisen rearrangement/Wittig olefination and a subsequent olefin cross metathesis with 2-methyl-2-butene. The cross metathesis step proceeds with a high selectivity and yields exclusively the desired prenyl, rather than the alternative crotyl substituent. Several naturally occurring 8-prenylcoumarins that were previously inaccessible have been synthesized in good overall yields along this route.

  6. Human hepatocytes apoptosis induced by replication of hepatitis B virus subgenotypes F1b and F4: Role of basal core promoter and preCore mutations.

    Science.gov (United States)

    Elizalde, María Mercedes; Sevic, Ina; González López Ledesma, María Mora; Campos, Rodolfo Héctor; Barbini, Luciana; Flichman, Diego Martin

    2018-01-01

    In the context of pathogenesis of HBV infection, HBV genotypes and mutants have been shown to affect the natural course of chronic infection and treatment outcomes. In this work, we studied the induction of apoptosis by the replication of HBV subgenotypes F1b and F4, and the naturally occurring mutants BCP and preCore. Both subgenotypes F1b and F4 HBV genome transfections induced cell death by apoptosis in human hepatocytes. The BCPdm (A1762T/G1764A) and preCore (G1896A) mutants induced higher levels of apoptosis than the wt virus. This increase in apoptosis was not associated with the enhanced viral replication of the variants. HBV-mediated apoptosis was independent of viral subgenotypes, and associated with the modulation of members of the regulatory Bcl-2 family proteins expression in the mitochondrial apoptotic pathway. Finally, the apoptosis induction increase observed for the preCore mutants suggests that HBeAg might have an anti-apoptotic effect in human hepatocytes. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. HCV core protein-induced down-regulation of microRNA-152 promoted aberrant proliferation by regulating Wnt1 in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Shifeng Huang

    Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell

  8. Analysis of HBV basal core promoter/precore gene variability in patients with HBV drug resistance and HIV co-infection in Northwest Ethiopia.

    Directory of Open Access Journals (Sweden)

    Yeshambel Belyhun

    Full Text Available We recently reported complex hepatitis B virus (HBV drug resistant and concomitant vaccine escape hepatitis B surface antigen (HBsAg variants during human immunodeficiency virus (HIV co-infection and antiretroviral therapy (ART exposure in Ethiopia. As a continuation of this report using the HBV positive sera from the same study participants, the current study further analyzed the HBV basal core promoter (BCP/precore (PC genes variability in patients with HBV drug resistance (at tyrosine-methionine-aspartate-aspartate (YMDD reverse transcriptase (RT motifs and HIV co-infection in comparison with HBV mono-infected counterparts with no HBV drug resistant gene variants.A total of 143 participants of HBV-HIV co-infected (n = 48, HBV mono-infected blood donors (n = 43 and chronic liver disease (CLD patients (n = 52 were included in the study. The BCP/PC genome regions responsible for HBeAg expression from the EcoRI site (nucleotides 1653-1959 were sequenced and analyzed for the BCP/PC mutant variants.Among the major mutant variants detected, double BCP mutations (A1762T/G1764A (25.9%, Kozak sequences mutations (nt1809-1812 (51.7% and the classical PC mutations such as A1814C/C1816T (15.4%, G1896A (25.2% and G1862T (44.8% were predominant mutant variants. The prevalence of the double BCP mutations was significantly lower in HIV co-infected patients (8.3% compared with HBV mono-infected blood donors (32.6% and CLD patients (36.5%. However, the Kozak sequences BCP mutations and the majority of PC mutations showed no significant differences among the study groups. Moreover, except for the overall BCP/PC mutant variants, co-prevalence rates of each major BCP/PC mutations and YMDDRT motif associated lamivudine (3TC/entecavir (ETV resistance mutations showed no significant differences when compared with the rates of BCP/PC mutations without YMDD RT motif drug resistance gene mutations. Unlike HIV co-infected group, no similar comparison made among HBV mono

  9. TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

    Science.gov (United States)

    Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

    2013-11-18

    Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

  10. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  11. From field to database : a user-oriented approche to promote cyber-curating of scientific drilling cores

    Science.gov (United States)

    Pignol, C.; Arnaud, F.; Godinho, E.; Galabertier, B.; Caillo, A.; Billy, I.; Augustin, L.; Calzas, M.; Rousseau, D. D.; Crosta, X.

    2016-12-01

    Managing scientific data is probably one the most challenging issues in modern science. In plaeosciences the question is made even more sensitive with the need of preserving and managing high value fragile geological samples: cores. Large international scientific programs, such as IODP or ICDP led intense effort to solve this problem and proposed detailed high standard work- and dataflows thorough core handling and curating. However many paleoscience results derived from small-scale research programs in which data and sample management is too often managed only locally - when it is… In this paper we present a national effort leads in France to develop an integrated system to curate ice and sediment cores. Under the umbrella of the national excellence equipment program CLIMCOR, we launched a reflexion about core curating and the management of associated fieldwork data. Our aim was then to conserve all data from fieldwork in an integrated cyber-environment which will evolve toward laboratory-acquired data storage in a near future. To do so, our demarche was conducted through an intimate relationship with field operators as well laboratory core curators in order to propose user-oriented solutions. The national core curating initiative proposes a single web portal in which all teams can store their fieldwork data. This portal is used as a national hub to attribute IGSNs. For legacy samples, this requires the establishment of a dedicated core list with associated metadata. However, for forthcoming core data, we developed a mobile application to capture technical and scientific data directly on the field. This application is linked with a unique coring-tools library and is adapted to most coring devices (gravity, drilling, percussion etc.) including multiple sections and holes coring operations. Those field data can be uploaded automatically to the national portal, but also referenced through international standards (IGSN and INSPIRE) and displayed in international

  12. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  13. Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

    Directory of Open Access Journals (Sweden)

    Sheila M Reynolds

    2010-07-01

    Full Text Available DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the

  14. Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

    Science.gov (United States)

    Reynolds, Sheila M; Bilmes, Jeff A; Noble, William Stafford

    2010-07-08

    DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

  15. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi

    2016-07-28

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  16. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  17. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  18. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  19. Epidemiological characterization of a nosocomial outbreak of extended spectrum β-lactamase Escherichia coli ST-131 confirms the clinical value of core genome multilocus sequence typing.

    Science.gov (United States)

    Woksepp, Hanna; Ryberg, Anna; Berglind, Linda; Schön, Thomas; Söderman, Jan

    2017-12-01

    Enhanced precision of epidemiological typing in clinically suspected nosocomial outbreaks is crucial. Our aim was to investigate whether single nucleotide polymorphism (SNP) analysis and core genome (cg) multilocus sequence typing (MLST) of whole genome sequencing (WGS) data would more reliably identify a nosocomial outbreak, compared to earlier molecular typing methods. Sixteen isolates from a nosocomial outbreak of ESBL E. coli ST-131 in southeastern Sweden and three control strains were subjected to WGS. Sequences were explored by SNP analysis and cgMLST. cgMLST clearly differentiated between the outbreak isolates and the control isolates (>1400 differences). All clinically identified outbreak isolates showed close clustering (≥2 allele differences), except for two isolates (>50 allele differences). These data confirmed that the isolates with >50 differing genes did not belong to the nosocomial outbreak. The number of SNPs within the outbreak was ≤7, whereas the two discrepant isolates had >700 SNPs. Two of the ESBL E. coli ST-131 isolates did not belong to the clinically identified outbreak. Our results illustrate the power of WGS in terms of resolution, which may avoid overestimation of patients belonging to outbreaks as judged from epidemiological data and previously employed molecular methods with lower discriminatory ability. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  20. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  1. Learning a Weighted Sequence Model of the Nucleosome Core and Linker Yields More Accurate Predictions in Saccharomyces cerevisiae and Homo sapiens

    Science.gov (United States)

    Reynolds, Sheila M.; Bilmes, Jeff A.; Noble, William Stafford

    2010-01-01

    DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence—301 base pairs, centered at the position to be scored—with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

  2. Core sequence of PAPf39 amyloid fibrils and mechanism of pH-dependent fibril formation: the role of monomer conformation.

    Science.gov (United States)

    French, Kinsley C; Makhatadze, George I

    2012-12-21

    PAPf39, a 39-residue peptide fragment from human prostatic acidic phosphatase, has been shown to form amyloid fibrils in semen (SEVI), which increase HIV infectivity by up to 5 orders of magnitude. The sequence of the PAPf39 fibrillar core was identified using hydrogen-deuterium exchange (HDX) mass spectrometry and protease protection assays. The central and C-terminal regions are highly protected from HDX and proteolytic cleavage and, thus, are part of the fibrillar core. Conversely, the N-terminal region is unprotected from HDX and proteolytic cleavage, suggesting that it is exposed and not part of the fibrillar core. This finding was tested using two N-terminal truncated variants, PAPf39Δ1-8 and PAPf39Δ1-13. Both variants formed amyloid fibrils at neutral pH. However, these variants showed a markedly different pH dependence of fibril formation versus that of PAPf39. PAPf39 fibrils can form at pH 7.7, but not at pH 5.5 or 2.5, while both N-terminally truncated variants can form fibrils at these pH values. Thus, the N-terminal region is not necessary for fibril formation but modulates the pH dependence of PAPf39 fibril formation. PAPf39Δ1-8 and PAPf39Δ1-13 are capable of seeding PAPf39 fibril formation at neutral pH, suggesting that these variants are structurally compatible with PAPf39, yet no mixed fibril formation occurs between the truncated variants and PAPf39 at low pH. This suggests that pH affects the PAPf39 monomer conformational ensemble, which is supported by far-UV circular dichroism spectroscopy. A conceptual model describing the pH dependence of PAPf39 aggregation is proposed and provides potential biological implications.

  3. Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

    Science.gov (United States)

    Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

    1999-01-01

    The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

  4. Binding of Pseudomonas aeruginosa Apo-Bacterioferritin Associated Ferredoxin to Bacterioferritin B Promotes Heme Mediation of Electron Delivery and Mobilization of Core Mineral Iron†

    Science.gov (United States)

    Weeratunga, Saroja K.; Gee, Casey E.; Lovell, Scott; Zeng, Yuhong; Woodin, Carrie L.; Rivera, Mario

    2009-01-01

    The bfrB gene from Pseudomonas aeruginosa was cloned and expressed in E. coli. The resultant protein (BfrB), which assembles into a 445.3 kDa complex0020from 24 identical subunits, binds 12 molecules of heme axially coordinated by two Met residues. BfrB, isolated with 5–10 iron atoms per protein molecule, was reconstituted with ferrous ions to prepare samples with a core mineral containing 600 ± 40 ferric ions per BfrB molecule and approximately one phosphate molecule per iron atom. In the presence of sodium dithionite or in the presence of P. aeruginosa ferredoxin NADP reductase (FPR) and NADPH the heme in BfrB remains oxidized and the core iron mineral is mobilized sluggishly. In stark contrast, addition of NADPH to a solution containing BfrB, FPR and the apo-form of P. aeruginosa bacterioferritin associated ferredoxin (apo-Bfd) results in rapid reduction of the heme in BfrB and in the efficient mobilization of the core iron mineral. Results from additional experimentation indicate that Bfd must bind to BfrB to promote heme mediation of electrons from the surface to the core to support the efficient mobilization of ferrous ions from BfrB. In this context, the thus far mysterious role of heme in bacterioferritins has been brought to the front by reconstituting BfrB with its physiological partner, apo-Bfd. These findings are discussed in the context of a model for the utilization of stored iron in which the significant upregulation of the bfd gene under low-iron conditions [Ochsner, U.A., Wilderman, P.J., Vasil, A.I., and Vasil, M.L. (2002) Mol. Microbiol. 45, 1277–1287] ensures sufficient concentrations of apo-Bfd to bind BfrB and unlock the iron stored in its core. Although these findings are in contrast to previous speculations suggesting redox mediation of electron transfer by holo-Bfd, the ability of apo-Bfd to promote iron mobilization is an economical strategy used by the cell because it obviates the need to further deplete cellular iron levels to

  5. Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

    Science.gov (United States)

    Guo, Lei; Rhen, Turk

    2017-10-01

    Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    Science.gov (United States)

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  7. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

    Science.gov (United States)

    Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

    2017-06-20

    Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

    Science.gov (United States)

    Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

    1985-01-01

    We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

  9. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  10. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  11. The Last Glacial Maximum in the Northern European loess belt: Correlations between loess-paleosol sequences and the Dehner Maar core (Eifel Mountains)

    Science.gov (United States)

    Zens, Joerg; Krauß, Lydia; Römer, Wolfgang; Klasen, Nicole; Pirson, Stéphane; Schulte, Philipp; Zeeden, Christian; Sirocko, Frank; Lehmkuhl, Frank

    2016-04-01

    The D1 project of the CRC 806 "Our way to Europe" focusses on Central Europe as a destination of modern human dispersal out of Africa. The paleo-environmental conditions along the migration areas are reconstructed by loess-paleosol sequences and lacustrine sediments. Stratigraphy and luminescence dating provide the chronological framework for the correlation of grain size and geochemical data to large-scale climate proxies like isotope ratios and dust content of Greenland ice cores. The reliability of correlations is improved by the development of precise age models of specific marker beds. In this study, we focus on the (terrestrial) Last Glacial Maximum of the Weichselian Upper Pleniglacial which is supposed to be dominated by high wind speeds and an increasing aridity. Especially in the Lower Rhine Embayment (LRE), this period is linked to an extensive erosion event. The disconformity is followed by an intensive cryosol formation. In order to support the stratigraphical observations from the field, luminescence dating and grain size analysis were applied on three loess-paleosol sequences along the northern European loess belt to develop a more reliable chronology and to reconstruct paleo-environmental dynamics. The loess sections were compared to newest results from heavy mineral and grain size analysis from the Dehner Maar core (Eifel Mountains) and correlated to NGRIP records. Volcanic minerals can be found in the Dehner Maar core from a visible tephra layer at 27.8 ka up to ~25 ka. They can be correlated to the Eltville Tephra found in loess section. New quartz luminescence ages from Romont (Belgium) surrounding the tephra dated the deposition between 25.0 + 2.3 ka and 25.8 + 2.4 ka. In the following, heavy minerals show an increasing importance of strong easterly winds during the second Greenland dust peak (~24 ka b2k) correlating with an extensive erosion event in the LRE. Luminescence dating on quartz bracketing the following soil formation yielded ages of

  12. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  13. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    Science.gov (United States)

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  14. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  15. Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

    Science.gov (United States)

    Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

    2013-12-01

    Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

  16. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  17. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-27

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  18. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  19. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  20. Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Engelbrecht, Jacob

    1995-01-01

    We present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced...

  1. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter.

    NARCIS (Netherlands)

    Christiansen, H.; Hansen, A.C.; Vijn, I.; Pallisgaard, N.; Larsen, K.; Yang, W.C.; Bisseling, T.; Marcker, K.A.; Jensen, E.O.

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod

  2. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    Science.gov (United States)

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  3. Genome-Wide Mapping Targets of the Metazoan Chromatin Remodeling Factor NURF Reveals Nucleosome Remodeling at Enhancers, Core Promoters and Gene Insulators.

    Directory of Open Access Journals (Sweden)

    So Yeon Kwon

    2016-04-01

    Full Text Available NURF is a conserved higher eukaryotic ISWI-containing chromatin remodeling complex that catalyzes ATP-dependent nucleosome sliding. By sliding nucleosomes, NURF is able to alter chromatin dynamics to control transcription and genome organization. Previous biochemical and genetic analysis of the specificity-subunit of Drosophila NURF (Nurf301/Enhancer of Bithorax (E(bx has defined NURF as a critical regulator of homeotic, heat-shock and steroid-responsive gene transcription. It has been speculated that NURF controls pathway specific transcription by co-operating with sequence-specific transcription factors to remodel chromatin at dedicated enhancers. However, conclusive in vivo demonstration of this is lacking and precise regulatory elements targeted by NURF are poorly defined. To address this, we have generated a comprehensive map of in vivo NURF activity, using MNase-sequencing to determine at base pair resolution NURF target nucleosomes, and ChIP-sequencing to define sites of NURF recruitment. Our data show that, besides anticipated roles at enhancers, NURF interacts physically and functionally with the TRF2/DREF basal transcription factor to organize nucleosomes downstream of active promoters. Moreover, we detect NURF remodeling and recruitment at distal insulator sites, where NURF functionally interacts with and co-localizes with DREF and insulator proteins including CP190 to establish nucleosome-depleted domains. This insulator function of NURF is most apparent at subclasses of insulators that mark the boundaries of chromatin domains, where multiple insulator proteins co-associate. By visualizing the complete repertoire of in vivo NURF chromatin targets, our data provide new insights into how chromatin remodeling can control genome organization and regulatory interactions.

  4. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Energy Technology Data Exchange (ETDEWEB)

    Bellini, A.; Anderson, J.; Van der Marel, R. P. [Space Telescope Science Institute, 3700 San Martin Dr., Baltimore, MD 21218 (United States); Milone, A. P.; Marino, A. F. [Research School of Astronomy and Astrophysics, Australian National University, Mt Stromlo Observatory, via Cotter Rd, Weston, ACT 2611 (Australia); Piotto, G.; Bedin, L. R. [Istituto Nazionale di Astrofisica, Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, Padova, I-35122 (Italy); King, I. R., E-mail: bellini@stsci.edu [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States)

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with.

  5. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Science.gov (United States)

    Bellini, A.; Milone, A. P.; Anderson, J.; Marino, A. F.; Piotto, G.; van der Marel, R. P.; Bedin, L. R.; King, I. R.

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with. Based on archival observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  6. Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

    International Nuclear Information System (INIS)

    Gangwar, Shanti P.; Meena, Sita R.; Saxena, Ajay K.

    2012-01-01

    The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C222 1 , with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

  7. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

    DEFF Research Database (Denmark)

    Christiansen, H; Hansen, A C; Vijn, I

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...

  8. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    Science.gov (United States)

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  9. Core labeling of adenovirus with EGFP

    International Nuclear Information System (INIS)

    Le, Long P.; Le, Helen N.; Nelson, Amy R.; Matthews, David A.; Yamamoto, Masato; Curiel, David T.

    2006-01-01

    The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expression vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology

  10. Stellar evolution IV: evolution of a star of 1.5 M(S) from the main-sequence to the red-giant branch with and without overshooting from convective core

    International Nuclear Information System (INIS)

    Maeder, A.

    1975-01-01

    For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de

  11. Genome Sequence of the Biocontrol Strain Pseudomonas fluorescens F113

    Science.gov (United States)

    Redondo-Nieto, Miguel; Barret, Matthieu; Morrisey, John P.; Germaine, Kieran; Martínez-Granero, Francisco; Barahona, Emma; Navazo, Ana; Sánchez-Contreras, María; Moynihan, Jennifer A.; Giddens, Stephen R.; Coppoolse, Eric R.; Muriel, Candela; Stiekema, Willem J.; Rainey, Paul B.; Dowling, David; O'Gara, Fergal; Martín, Marta

    2012-01-01

    Pseudomonas fluorescens F113 is a plant growth-promoting rhizobacterium (PGPR) that has biocontrol activity against fungal plant pathogens and is a model for rhizosphere colonization. Here, we present its complete genome sequence, which shows that besides a core genome very similar to those of other strains sequenced within this species, F113 possesses a wide array of genes encoding specialized functions for thriving in the rhizosphere and interacting with eukaryotic organisms. PMID:22328765

  12. Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia.

    Science.gov (United States)

    Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar

    2013-12-15

    In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

  13. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  14. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  16. Prospecting plant growth promoting bacteria and cyanobacteria as options for enrichment of macro- and micronutrients in grains in rice–wheat cropping sequence

    Directory of Open Access Journals (Sweden)

    Anuj Rana

    2015-12-01

    Full Text Available The influence of plant growth promoting bacteria (PGPB and cyanobacteria, alone and in combination, was investigated on micronutrient enrichment and yield in rice–wheat sequence, over a period of two years. Analysis of variance (ANOVA in both crops indicated significant differences in soil dehydrogenase activity and micronutrient enrichment in grains (Fe, Zn in rice, and Cu, Mn in wheat. The combined inoculation of Anabaena oscillarioides CR3, Brevundimonas diminuta PR7, and Ochrobactrum anthropi PR10 (T6 significantly increased nitrogen, phosphorus, and potassium (NPK content and improved rice yield by 21.2%, as compared to the application of recommended dose of NPK fertilizers (T2. The treatment T5 (Providencia sp. PR3 + B. diminuta PR7 + O. anthropi PR10 recorded an enhancement of 13–16% in Fe, Zn, Cu, and Mn concentrations, respectively, in rice grains. In wheat, Providencia sp. PW5 (T6 recorded the highest yield (5.23 Mg ha−1 and significantly higher enrichment of Fe and Cu (44–45% in the grains. This study highlighted the promise of combinations of cyanobacteria/bacteria and their synergistic action in biofortification and providing savings of 40–60 kg N ha−1. Future focus needs to be towards integrating such promising environment-friendly and environmentally sustainable options in nutrient management strategies for this cropping sequence.

  17. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mette Burmølle

    Full Text Available Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids into a laboratory strain (Escherichia coli Genehogs® for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54 and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33 were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  18. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Science.gov (United States)

    Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

    2012-01-01

    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  19. Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter.

    Science.gov (United States)

    Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana

    2007-01-01

    The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.

  20. 5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

    Science.gov (United States)

    Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

    2014-01-01

    X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

  1. 5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

    Directory of Open Access Journals (Sweden)

    Filipe Brum Machado

    Full Text Available X-chromosome inactivation (XCI is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX and males (XY. DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa from inactive (Xi X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8 and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2 and Xq (AR chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

  2. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

    2010-10-20

    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  3. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    International Nuclear Information System (INIS)

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A.

    2006-01-01

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection

  4. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  5. Whole genome sequencing and analysis of plant growth promoting bacteria isolated from the rhizosphere of plantation crops coconut, cocoa and arecanut.

    Directory of Open Access Journals (Sweden)

    Alka Gupta

    Full Text Available Coconut, cocoa and arecanut are commercial plantation crops that play a vital role in the Indian economy while sustaining the livelihood of more than 10 million Indians. According to 2012 Food and Agricultural organization's report, India is the third largest producer of coconut and it dominates the production of arecanut worldwide. In this study, three Plant Growth Promoting Rhizobacteria (PGPR from coconut (CPCRI-1, cocoa (CPCRI-2 and arecanut (CPCRI-3 characterized for the PGP activities have been sequenced. The draft genome sizes were 4.7 Mb (56% GC, 5.9 Mb (63.6% GC and 5.1 Mb (54.8% GB for CPCRI-1, CPCRI-2, CPCRI-3, respectively. These genomes encoded 4056 (CPCRI-1, 4637 (CPCRI-2 and 4286 (CPCRI-3 protein-coding genes. Phylogenetic analysis revealed that both CPCRI-1 and CPCRI-3 belonged to Enterobacteriaceae family, while, CPCRI-2 was a Pseudomonadaceae family member. Functional annotation of the genes predicted that all three bacteria encoded genes needed for mineral phosphate solubilization, siderophores, acetoin, butanediol, 1-aminocyclopropane-1-carboxylate (ACC deaminase, chitinase, phenazine, 4-hydroxybenzoate, trehalose and quorum sensing molecules supportive of the plant growth promoting traits observed in the course of their isolation and characterization. Additionally, in all the three CPCRI PGPRs, we identified genes involved in synthesis of hydrogen sulfide (H2S, which recently has been proposed to aid plant growth. The PGPRs also carried genes for central carbohydrate metabolism indicating that the bacteria can efficiently utilize the root exudates and other organic materials as energy source. Genes for production of peroxidases, catalases and superoxide dismutases that confer resistance to oxidative stresses in plants were identified. Besides these, genes for heat shock tolerance, cold shock tolerance and glycine-betaine production that enable bacteria to survive abiotic stress were also identified.

  6. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    Science.gov (United States)

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.

  7. Proteomics Core

    Data.gov (United States)

    Federal Laboratory Consortium — Proteomics Core is the central resource for mass spectrometry based proteomics within the NHLBI. The Core staff help collaborators design proteomics experiments in a...

  8. Moving beyond Compliance: Promoting Research-Based Professional Discretion in the Implementation of the Common Core State Standards in English Language Arts

    Science.gov (United States)

    Woodard, Rebecca; Kline, Sonia

    2015-01-01

    State- and local-level mandates are currently being implemented to ensure strict compliance to the new national Common Core State Standards for English Language Arts (CCSS for ELA) and related assessments. These standards provide many potential opportunities to improve literacy education nationally and locally. However, the CCSS for ELA will…

  9. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  10. The biology of eukaryotic promoter prediction - a review

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

    1999-01-01

    between functional promoters has been estimated to be in the range of 30-40 kilobases. Although it is conceivable that some of these predicted promoters correspond to cryptic initiation sites that are used in vivo, it is likely that most are false positives. This suggests that it is important to carefully......Computational prediction of eukaryotic promoters from the nucleotide sequence is one of the most attractive problems in sequence analysis today, but it is also a very difficult one. Thus, current methods predict in the order of one promoter per kilobase in human DNA, while the average distance...... reconsider the biological data that forms the basis of current algorithms, and we here present a review of data that may be useful in this regard. The review covers the following topics: (1) basal transcription and core promoters, (2) activated transcription and transcription factor binding sites, (3) Cp...

  11. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  12. Investigating core genetic-and-epigenetic cell cycle networks for stemness and carcinogenic mechanisms, and cancer drug design using big database mining and genome-wide next-generation sequencing data.

    Science.gov (United States)

    Li, Cheng-Wei; Chen, Bor-Sen

    2016-10-01

    Recent studies have demonstrated that cell cycle plays a central role in development and carcinogenesis. Thus, the use of big databases and genome-wide high-throughput data to unravel the genetic and epigenetic mechanisms underlying cell cycle progression in stem cells and cancer cells is a matter of considerable interest. Real genetic-and-epigenetic cell cycle networks (GECNs) of embryonic stem cells (ESCs) and HeLa cancer cells were constructed by applying system modeling, system identification, and big database mining to genome-wide next-generation sequencing data. Real GECNs were then reduced to core GECNs of HeLa cells and ESCs by applying principal genome-wide network projection. In this study, we investigated potential carcinogenic and stemness mechanisms for systems cancer drug design by identifying common core and specific GECNs between HeLa cells and ESCs. Integrating drug database information with the specific GECNs of HeLa cells could lead to identification of multiple drugs for cervical cancer treatment with minimal side-effects on the genes in the common core. We found that dysregulation of miR-29C, miR-34A, miR-98, and miR-215; and methylation of ANKRD1, ARID5B, CDCA2, PIF1, STAMBPL1, TROAP, ZNF165, and HIST1H2AJ in HeLa cells could result in cell proliferation and anti-apoptosis through NFκB, TGF-β, and PI3K pathways. We also identified 3 drugs, methotrexate, quercetin, and mimosine, which repressed the activated cell cycle genes, ARID5B, STK17B, and CCL2, in HeLa cells with minimal side-effects.

  13. Tectonic uplift-influenced monsoonal changes promoted hominin occupation of the Luonan Basin: Insights from a loess-paleosol sequence, eastern Qinling Mountains, central China

    Science.gov (United States)

    Fang, Qian; Hong, Hanlie; Zhao, Lulu; Furnes, Harald; Lu, Huayu; Han, Wen; Liu, Yao; Jia, Zhuoyue; Wang, Chaowen; Yin, Ke; Algeo, Thomas J.

    2017-08-01

    Quaternary soil deposits from northern and southern China are distinctly different, reflecting variability of the East Asian monsoon north and south of the Qinling Mountains. Coeval sediments from the transitional climatic zone of central China, which are little studied to date, have the potential to improve our understanding of Quaternary monsoon changes and associated influences on hominin occupation of this region. Here, we investigate in detail a well-preserved and continuous Quaternary loess-paleosol sequence (Shangbaichuan) from the Luonan Basin, using a variety of weathering indices including major and trace element ratios, clay mineralogy, and Fe-oxide mineralogy. The whole-rock samples display similar rare earth element patterns characterized by upper continental crustal ratios: (La/Yb)N ≈ 9.5 and Eu/Eu* ≈ 0.65. Elemental data such as (La/Yb)N, La/Th and Eu/Eu* ratios show a high degree of homogeneity, suggesting that dust in the source region may have been thoroughly mixed and recycled, resulting in all samples having a uniform initial composition. Indices for pedogenic weathering such as Na/K, Ba/Sr, Rb/Sr, CIA, CIW, CPA, PIA, kaolinite/illite, (kaolinite + smectite)/illite, and hematite/(hematite + goethite) exhibit similar secular trends and reveal a four-stage accumulation history. The indices also indicate that the climate was warmer and wetter during the most recent interglacial stage, compared with coeval environments of the Chinese Loess Plateau. Secular changes in weathering intensity can be related to stepwise uplift of the Qinling Mountains and variation in East Asian monsoon intensity, both of which played significant roles in controlling climate evolution in the Luonan Basin. Furthermore, intensified aridity and winter monsoon strength in dust source areas, as evidenced by mineralogic and geochemical changes, may have been due to the mid-Pleistocene climate transition. Based on temporal correlation of warmer and wetter climatic conditions

  14. Based on the core competitiveness of enterprise innovation culture research

    Institute of Scientific and Technical Information of China (English)

    韩 军

    2017-01-01

    In the spring tide of market economy at present, the enterprise is a must to survive in order to achieve innovation, promote enterprise's core competitiveness. Enterprise innovation culture, the promotion enterprise's core competitiveness plays an important role in promoting, therefore must complete enterprise innovation culture. Therefore, put forward by enterprise innovation culture, promote enterprise's core competitiveness.

  15. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  16. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  17. TMI-2 core examination plan

    International Nuclear Information System (INIS)

    Owen, D.E.; MacDonald, P.E.; Hobbins, R.R.; Ploggr, S.A.

    1982-01-01

    The Three Mile Island (TMI-2) core examination is divided into four stages: (1) before removing the head; (2) before removing the plenum; (3) during defueling; and (4) offsite examinations. Core examinations recommended during the first three stages are primarily devoted to documenting the post-accident condition of the core. The detailed analysis of core damage structures will be performed during offsite examinations at government and commercial hot cell facilities. The primary objectives of these examinations are to enhance the understanding of the degraded core accident sequence, to develop the technical bases for reactor regulations, and to improve LWR design and operation

  18. PWR degraded core analysis

    International Nuclear Information System (INIS)

    Gittus, J.H.

    1982-04-01

    A review is presented of the various phenomena involved in degraded core accidents and the ensuing transport of fission products from the fuel to the primary circuit and the containment. The dominant accident sequences found in the PWR risk studies published to date are briefly described. Then chapters deal with the following topics: the condition and behaviour of water reactor fuel during normal operation and at the commencement of degraded core accidents; the generation of hydrogen from the Zircaloy-steam and the steel-steam reactions; the way in which the core deforms and finally melts following loss of coolant; debris relocation analysis; containment integrity; fission product behaviour during a degraded core accident. (U.K.)

  19. Rational diversification of a promoter providing fine-tuned expression and orthogonal regulation for synthetic biology.

    Science.gov (United States)

    Blount, Benjamin A; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

    2012-01-01

    Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex "multi-wire" logic functions.

  20. Rational Diversification of a Promoter Providing Fine-Tuned Expression and Orthogonal Regulation for Synthetic Biology

    Science.gov (United States)

    Blount, Benjamin A.; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

    2012-01-01

    Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex “multi-wire” logic functions. PMID:22442681

  1. Draft genome sequence of Burkholderia sordidicola S170, a potential plant growth promoter isolated from coniferous forest soil in the Czech Republic

    DEFF Research Database (Denmark)

    Lladó, Salvador; Xu, Zhuofei; Sørensen, Søren Johannes

    2014-01-01

    Burkholderia species are key players in the accumulation of carbon from cellulose decomposition in coniferous forest ecosystems. We report here the draft genome of Burkholderia sordidicola strain S170, containing features associated with known genes involved in plant growth promotion...

  2. A String Number-Line Lesson Sequence to Promote Students' Relative Thinking and Understanding of Scale, Key Elements of Proportional Reasoning

    Science.gov (United States)

    Hilton, Annette; Hilton, Geoff

    2018-01-01

    This article describes part of a study in which researchers designed lesson sequences based around using a string number line to help teachers support children's development of relative thinking and understanding of linear scale. In the first year of the study, eight teachers of Years 3-5 participated in four one-day professional development…

  3. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    Science.gov (United States)

    Shanak, Siba; Helms, Volkhard

    2014-12-01

    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  4. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  5. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-13

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  6. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi; AL Bladi, Maha Lafi Saleh; Salem, Nida M.; Al-Banna, Luma; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  7. Draft Genome Sequence of Bacillus amyloliquefaciens EBL11, a New Strain of Plant Growth-Promoting Bacterium Isolated from Rice Rhizosphere

    Science.gov (United States)

    Wang, Yinghuan; Greenfield, Paul; Jin, Decai

    2014-01-01

    Bacillus amyloliquefaciens strain EBL11 is a bacterium that can promote plant growth by inhibiting the growth of fungi on plant surfaces and providing nutrients as a nonchemical biofertilizer. The estimated genome of this strain is 4.05 Mb in size and harbors 3,683 coding genes (CDSs). PMID:25059875

  8. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  9. Transformer core

    NARCIS (Netherlands)

    Mehendale, A.; Hagedoorn, Wouter; Lötters, Joost Conrad

    2008-01-01

    A transformer core includes a stack of a plurality of planar core plates of a magnetically permeable material, which plates each consist of a first and a second sub-part that together enclose at least one opening. The sub-parts can be fitted together via contact faces that are located on either side

  10. Transformer core

    NARCIS (Netherlands)

    Mehendale, A.; Hagedoorn, Wouter; Lötters, Joost Conrad

    2010-01-01

    A transformer core includes a stack of a plurality of planar core plates of a magnetically permeable material, which plates each consist of a first and a second sub-part that together enclose at least one opening. The sub-parts can be fitted together via contact faces that are located on either side

  11. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  12. Optimized PCR with sequence specific primers (PCR-SSP for fast and efficient determination of Interleukin-6 Promoter -597/-572/-174Haplotypes

    Directory of Open Access Journals (Sweden)

    Bugert Peter

    2009-12-01

    Full Text Available Abstract Background Interleukin-6 (IL-6 promoter polymorphisms at positions -597(G→A, -572(G→C and -174(G→C were shown to have a clinical impact on different major diseases. At present PCR-SSP protocols for IL-6 -597/-572/-174haplotyping are elaborate and require large amounts of genomic DNA. Findings We describe an improved typing technique requiring a decreased number of PCR-reactions and a reduced PCR-runtime due to optimized PCR-conditions. Conclusion This enables a fast and efficient determination of IL-6 -597/-572/-174haplotypes in clinical diagnosis and further evaluation of IL-6 promoter polymorphisms in larger patient cohorts.

  13. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  14. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  15. Core lifter

    Energy Technology Data Exchange (ETDEWEB)

    Pavlov, N G; Edel' man, Ya A

    1981-02-15

    A core lifter is suggested which contains a housing, core-clamping elements installed in the housing depressions in the form of semirings with projections on the outer surface restricting the rotation of the semirings in the housing depressions. In order to improve the strength and reliability of the core lifter, the semirings have a variable transverse section formed from the outside by the surface of the rotation body of the inner arc of the semiring aroung the rotation axis and from the inner a cylindrical surface which is concentric to the outer arc of the semiring. The core-clamping elements made in this manner have the possibility of freely rotating in the housing depressions under their own weight and from contact with the core sample. These semirings do not have weakened sections, have sufficient strength, are inserted into the limited ring section of the housing of the core lifter without reduction in its through opening and this improve the reliability of the core lifter in operation.

  16. New genome sequence data and molecular tools promote the use of photosynthetic and edible cyanobacteria in bioregenerative systems to support human space exploration.

    Science.gov (United States)

    Leys, Natalie; Morin, Nicolas; Janssen, Paul; Mergeay, Max

    Cyanobacteria are daily used as nutritional supplements (e.g. Spirulina) and are considered for promising applications beyond Earth, in space, where they can play a crucial role in closed miniaturised biological waste recycling systems that are currently developed to support future long-term space missions. Cyanobacteria can be cultured with artificial light in controllable photobioreactors, and used for the efficient removal of CO2 from and production of O2 in the at-mosphere of the confined spacecraft, for removal of nitrate from waste water that is recycled to potable water, and as complementary food source. In this context, the filamentous cyanobac-terium Arthrospira sp. PCC 8005 was selected as part of the bio-regenerative life-support system MELiSSA from the European Space Agency. For bioprocess control and optimisation, the access to its genetic information and the development of molecular tools is crucial. Here we report on our efforts to determine the full genome of the cyanobacterium Arthrospira sp. PCC 8005. The obtained sequence data were analysed in detail to gain a better insight in the photosynthetic, nutritive, or potential toxic potential of this strain. In addition, the sensitivity of PCC 8005 to ionizing radiation was investigated because prolonged exposure of PCC 8005 to cosmic radiation in space might have a deleterious effect on its metabolism and oxygenic properties. To our knowledge, of the 6 different research groups across the globe trying to sequence Arthrospira strains, none of them, including us, were yet able to obtain a complete genome sequence. For Arthrospira sp. strain PCC 8005, we obtained 119 contigs (assembled in 16 scaffolds), representing 6,3 Mb, with 5,856 predicted protein-coding sequences (CDSs) and 176 genes encoding RNA. The PCC 8005 genome displays an unusual high number of large repeated sequences, covering around 8% of the genome, which likely hampered the sequenc-ing. The PCC 8005 genome is also ridden by mobile

  17. A cooperative interaction between nontranslated RNA sequences and NS5A protein promotes in vivo fitness of a chimeric hepatitis C/GB virus B.

    Directory of Open Access Journals (Sweden)

    Lucile Warter

    Full Text Available GB virus B (GBV-B is closely related to hepatitis C virus (HCV, infects small non-human primates, and is thus a valuable surrogate for studying HCV. Despite significant differences, the 5' nontranslated RNAs (NTRs of these viruses fold into four similar structured domains (I-IV, with domains II-III-IV comprising the viral internal ribosomal entry site (IRES. We previously reported the in vivo rescue of a chimeric GBV-B (vGB/III(HC containing HCV sequence in domain III, an essential segment of the IRES. We show here that three mutations identified within the vGB/III(HC genome (within the 3'NTR, upstream of the poly(U tract, and NS5A coding sequence are necessary and sufficient for production of this chimeric virus following intrahepatic inoculation of synthetic RNA in tamarins, and thus apparently compensate for the presence of HCV sequence in domain III. To assess the mechanism(s underlying these compensatory mutations, and to determine whether 5'NTR subdomains participating in genome replication do so in a virus-specific fashion, we constructed and evaluated a series of chimeric subgenomic GBV-B replicons in which various 5'NTR subdomains were substituted with their HCV homologs. Domains I and II of the GBV-B 5'NTR could not be replaced with HCV sequence, indicating that they contain essential, virus-specific RNA replication elements. In contrast, domain III could be swapped with minimal loss of genome replication capacity in cell culture. The 3'NTR and NS5A mutations required for rescue of the related chimeric virus in vivo had no effect on replication of the subgenomic GBneoD/III(HC RNA in vitro. The data suggest that in vivo fitness of the domain III chimeric virus is dependent on a cooperative interaction between the 5'NTR, 3'NTR and NS5A at a step in the viral life cycle subsequent to genome replication, most likely during particle assembly. Such a mechanism may be common to all hepaciviruses.

  18. Reactor core

    International Nuclear Information System (INIS)

    Azekura, Kazuo; Kurihara, Kunitoshi.

    1992-01-01

    In a BWR type reactor, a great number of pipes (spectral shift pipes) are disposed in the reactor core. Moderators having a small moderating cross section (heavy water) are circulated in the spectral shift pipes to suppress the excess reactivity while increasing the conversion ratio at an initial stage of the operation cycle. After the intermediate stage of the operation cycle in which the reactor core reactivity is lowered, reactivity is increased by circulating moderators having a great moderating cross section (light water) to extend the taken up burnup degree. Further, neutron absorbers such as boron are mixed to the moderator in the spectral shift pipe to control the concentration thereof. With such a constitution, control rods and driving mechanisms are no more necessary, to simplify the structure of the reactor core. This can increase the fuel conversion ratio and control great excess reactivity. Accordingly, a nuclear reactor core of high conversion and high burnup degree can be attained. (I.N.)

  19. Ice Cores

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Records of past temperature, precipitation, atmospheric trace gases, and other aspects of climate and environment derived from ice cores drilled on glaciers and ice...

  20. 推进网络空间核心支援能力建设%Considerations on promoting the building-up of PLA's core supporting capabilities in cyberspace

    Institute of Scientific and Technical Information of China (English)

    柯宏发; 祝冀鲁; 赵荣

    2017-01-01

    从网络空间侦察能力、指挥控制能力、精确攻击能力、防御能力和评估能力等五个方面,对网络空间支援力量的核心支援能力进行了系统论述,提出建设军队网络支援力量、应对网络空间安全威胁的新思考和新观点.研究认为,当前我军在网络空间的安全意识、核心技术、均衡发展等方面面临严峻困难.为实现网络强国的奋斗目标,需要加强国家网络安全的顶层设计,增强网络技术自主创新能力,强化军民融合式建设和系统常态的攻防训练等.%Core supporting capabilities of cyberspace military forces, such as cyberspace reconnaissance, command and control, precise attack, defense and evaluation, are systematically discussed.New considerations and ideas about promoting the building up of PLA's cyberspace supporting forces and encountering security threats in cyberspace are proposed.It is concluded that a lot of difficulties exist in aspects such as security awareness of cyberspace, core technologies and balanced developing.In order to realize the goal of building up a powerful country in cyberspace, emphasis should be laid on enhancing top-level design of national cyber security, independent innovation of cyber technologies, civil-military integration, and systematical and regular attack-and-defense training, etc.

  1. NFATC3-PLA2G15 Fusion Transcript Identified by RNA Sequencing Promotes Tumor Invasion and Proliferation in Colorectal Cancer Cell Lines.

    Science.gov (United States)

    Jang, Jee-Eun; Kim, Hwang-Phill; Han, Sae-Won; Jang, Hoon; Lee, Si-Hyun; Song, Sang-Hyun; Bang, Duhee; Kim, Tae-You

    2018-06-14

    This study was designed to identify novel fusion transcripts (FTs) and their functional significance in colorectal cancer lines. We performed paired-end RNA sequencing of 28 colorectal cancer (CRC) cell lines. FT candidates were identified using TopHat-fusion, ChimeraScan, and FusionMap tools and further experimental validation was conducted through reverse transcription-polymerase chain reaction and Sanger sequencing. FT was depleted in human CRC line and the effects on cell proliferation, cell migration, and cell invasion were analyzed. 1,380 FT candidates were detected through bioinformatics filtering. We selected 6 candidate FTs, including 4 inter-chromosomal and 2 intra-chromosomal FTs and each FT was found in at least 1 of the 28 cell lines. Moreover, when we tested 19 pairs of CRC tumor and adjacent normal tissue samples, NFATC3-PLA2G15 FT was found in 2. Knockdown of NFATC3-PLA2G15 using siRNA reduced mRNA expression of epithelial-mesenchymal transition (EMT) markers such as vimentin, twist, and fibronectin and increased mesenchymal-epithelial transition markers of E-cadherin, claudin-1, and FOXC2 in colo-320 cell line harboring NFATC3-PLA2G15 FT. The NFATC3-PLA2G15 knockdown also inhibited invasion, colony formation capacity, and cell proliferation. These results suggest that that NFATC3-PLA2G15 FTs may contribute to tumor progression by enhancing invasion by EMT and proliferation.

  2. Emergency core cooling system

    International Nuclear Information System (INIS)

    Kato, Ken.

    1989-01-01

    In PWR type reactors, a cooling water spray portion of emergency core cooling pipelines incorporated into pipelines on high temperature side is protruded to the inside of an upper plenum. Upon rupture of primary pipelines, pressure in a pressure vessel is abruptly reduced to generate a great amount of steams in the reactor core, which are discharged at a high flow rate into the primary pipelines on high temperature side. However, since the inside of the upper plenum has a larger area and the steam flow is slow, as compared with that of the pipelines on the high temperature side, ECCS water can surely be supplied into the reactor core to promote the re-flooding of the reactor core and effectively cool the reactor. Since the nuclear reactor can effectively be cooled to enable the promotion of pressure reduction and effective supply of coolants during the period of pressure reduction upon LOCA, the capacity of the pressure accumulation vessel can be decreased. Further, the re-flooding time for the reactor is shortened to provide an effect contributing to the improvement of the safety and the reduction of the cost. (N.H.)

  3. Decrease in Survival Rate of Colorectal Cancer Patients Due to Insertion of a Single Guanine Base in Promoter Sequences of Matrix Metalloproteinase-1 Gene (in Tehran Population

    Directory of Open Access Journals (Sweden)

    Z Hojati

    2009-01-01

    Full Text Available Introduction: Insertion or deletion of a guanine in -1607 at promoter region of matrix metalloproteinase-1 enzyme creates two allelic types for this gene in the population: 2G and 1G, respectively. 2G allele contains an extra binding site for ETS transcription factors that this may increase the level of gene expression. Therefore, aim of this study was investigation of the single Guanine insertion in the promoter gene and its association with colorectal cancer patient survival rate and tumor progression. Methods: Blood samples from 150 colorectal patients and 100 cases were extracted. The mean follow-up was 25 months (12-36 months. Cases and patients were genotyped using genomic DNA extraction and PCR-RFLP. Results: Colorectal cancer patients were divided in two groups; with activity of metastasis (M+ and without activity of metastasis (M-. 2G allele in metastasis group (55% showed more frequency rather than controls (23%. Survival analyses showed that 3 years survival patients rate in the patients without metastasis activity carrying 1G allele (homo and heterozygote was 81% and for 2G homozygote is 66% (p=0.04. The survival rate dependent to cancer was 90% and 71%, respectively (P=0.01. Conclusion: According to the results, it seems that patients carrying 1G allele show a better survival rate dependent on cancer as compared to patients who do not carry this allele.

  4. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    Science.gov (United States)

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  5. Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

    Science.gov (United States)

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2012-01-01

    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

  6. Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

    Science.gov (United States)

    Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

    2012-10-01

    Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

  7. Reactor core

    International Nuclear Information System (INIS)

    Matsuura, Tetsuaki; Nomura, Teiji; Tokunaga, Kensuke; Okuda, Shin-ichi

    1990-01-01

    Fuel assemblies in the portions where the gradient of fast neutron fluxes between two opposing faces of a channel box is great are kept loaded at the outermost peripheral position of the reactor core also in the second operation cycle in the order to prevent interference between a control rod and the channel box due to bending deformation of the channel box. Further, the fuel assemblies in the second row from the outer most periphery in the first operation cycle are also kept loaded at the second row in the second operation cycle. Since the gradient of the fast neutrons in the reactor core is especially great at the outer circumference of the reactor core, the channel box at the outer circumference is bent such that the surface facing to the center of the reactor core is convexed and the channel box in the second row is also bent to the identical direction, the insertion of the control rod is not interfered. Further, if the positions for the fuels at the outermost periphery and the fuels in the second row are not altered in the second operation cycle, the gaps are not reduced to prevent the interference between the control rod and the channel box. (N.H.)

  8. Promoter reuse in prokaryotes

    NARCIS (Netherlands)

    Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

    2012-01-01

    Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

  9. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    Science.gov (United States)

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  10. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  11. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona

    2014-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  12. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    Science.gov (United States)

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  13. Ice cores and palaeoclimate

    International Nuclear Information System (INIS)

    Krogh Andersen, K.; Ditlevsen, P.; Steffensen, J.P.

    2001-01-01

    Ice cores from Greenland give testimony of a highly variable climate during the last glacial period. Dramatic climate warmings of 15 to 25 deg. C for the annual average temperature in less than a human lifetime have been documented. Several questions arise: Why is the Holocene so stable? Is climatic instability only a property of glacial periods? What is the mechanism behind the sudden climate changes? Are the increased temperatures in the past century man-made? And what happens in the future? The ice core community tries to attack some of these problems. The NGRIP ice core currently being drilled is analysed in very high detail, allowing for a very precise dating of climate events. It will be possible to study some of the fast changes on a year by year basis and from this we expect to find clues to the sequence of events during rapid changes. New techniques are hoped to allow for detection of annual layers as far back as 100,000 years and thus a much improved time scale over past climate changes. It is also hoped to find ice from the Eemian period. If the Eemian layers confirm the GRIP sequence, the Eemian was actually climatically unstable just as the glacial period. This would mean that the stability of the Holocene is unique. It would also mean, that if human made global warming indeed occurs, we could jeopardize the Holocene stability and create an unstable 'Eemian situation' which ultimately could start an ice age. Currenlty mankind is changing the composition of the atmosphere. Ice cores document significant increases in greenhouse gases, and due to increased emissions of sulfuric and nitric acid from fossil fuel burning, combustion engines and agriculture, modern Greenland snow is 3 - 5 times more acidic than pre-industrial snow (Mayewski et al., 1986). However, the magnitude and abruptness of the temperature changes of the past century do not exceed the magnitude of natural variability. It is from the ice core perspective thus not possible to attribute the

  14. Core BPEL

    DEFF Research Database (Denmark)

    Hallwyl, Tim; Højsgaard, Espen

    The Web Services Business Process Execution Language (WS-BPEL) is a language for expressing business process behaviour based on web services. The language is intentionally not minimal but provides a rich set of constructs, allows omission of constructs by relying on defaults, and supports language......, does not allow omissions, and does not contain ignorable elements. We do so by identifying syntactic sugar, including default values, and ignorable elements in WS-BPEL. The analysis results in a translation from the full language to the core subset. Thus, we reduce the effort needed for working...

  15. Genome-wide mapping of autonomous promoter activity in human cells.

    Science.gov (United States)

    van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

    2017-02-01

    Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

  16. Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

    Science.gov (United States)

    Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

    2005-09-01

    We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

  17. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  18. Reactor core operation management system

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tomomi.

    1992-05-28

    Among operations of periodical inspection for a nuclear power plant, sequence, time and safety rule, as well as necessary equipments and the number thereof required for each of the operation are determined previously for given operation plannings, relevant to the reactor core operations. Operation items relative to each of coordinates of the reactor core are retrieved and arranged based on specified conditions, to use the operation equipments effectively. Further, a combination of operations, relative to the reactor core coordinates with no physical interference and shortest in accordance with safety rules is judged, and the order and the step of the operation relevant to the entire reactor core operations are planned. After the start of the operation, the necessity for changing the operation sequence is judged depending on the judgement as to whether it is conducted according to the safety rule and the deviation between the plan and the result, based on the information for the progress of each of the operations. Alternatively, the operation sequence and the step to be changed are planned again in accordance with the requirement for the change of the operation planning. Then, the shortest operation time can be planned depending on the simultaneous operation impossible condition and the condition for the operation time zone determined by labor conditions. (N.H.).

  19. Reactor core operation management system

    International Nuclear Information System (INIS)

    Sato, Tomomi.

    1992-01-01

    Among operations of periodical inspection for a nuclear power plant, sequence, time and safety rule, as well as necessary equipments and the number thereof required for each of the operation are determined previously for given operation plannings, relevant to the reactor core operations. Operation items relative to each of coordinates of the reactor core are retrieved and arranged based on specified conditions, to use the operation equipments effectively. Further, a combination of operations, relative to the reactor core coordinates with no physical interference and shortest in accordance with safety rules is judged, and the order and the step of the operation relevant to the entire reactor core operations are planned. After the start of the operation, the necessity for changing the operation sequence is judged depending on the judgement as to whether it is conducted according to the safety rule and the deviation between the plan and the result, based on the information for the progress of each of the operations. Alternatively, the operation sequence and the step to be changed are planned again in accordance with the requirement for the change of the operation planning. Then, the shortest operation time can be planned depending on the simultaneous operation impossible condition and the condition for the operation time zone determined by labor conditions. (N.H.)

  20. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  1. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  2. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  3. Core principles of evolutionary medicine

    Science.gov (United States)

    Grunspan, Daniel Z; Nesse, Randolph M; Barnes, M Elizabeth; Brownell, Sara E

    2018-01-01

    Abstract Background and objectives Evolutionary medicine is a rapidly growing field that uses the principles of evolutionary biology to better understand, prevent and treat disease, and that uses studies of disease to advance basic knowledge in evolutionary biology. Over-arching principles of evolutionary medicine have been described in publications, but our study is the first to systematically elicit core principles from a diverse panel of experts in evolutionary medicine. These principles should be useful to advance recent recommendations made by The Association of American Medical Colleges and the Howard Hughes Medical Institute to make evolutionary thinking a core competency for pre-medical education. Methodology The Delphi method was used to elicit and validate a list of core principles for evolutionary medicine. The study included four surveys administered in sequence to 56 expert panelists. The initial open-ended survey created a list of possible core principles; the three subsequent surveys winnowed the list and assessed the accuracy and importance of each principle. Results Fourteen core principles elicited at least 80% of the panelists to agree or strongly agree that they were important core principles for evolutionary medicine. These principles over-lapped with concepts discussed in other articles discussing key concepts in evolutionary medicine. Conclusions and implications This set of core principles will be helpful for researchers and instructors in evolutionary medicine. We recommend that evolutionary medicine instructors use the list of core principles to construct learning goals. Evolutionary medicine is a young field, so this list of core principles will likely change as the field develops further. PMID:29493660

  4. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. IRIS core criticality calculations

    International Nuclear Information System (INIS)

    Jecmenica, R.; Trontl, K.; Pevec, D.; Grgic, D.

    2003-01-01

    Three-dimensional Monte Carlo computer code KENO-VI of CSAS26 sequence of SCALE-4.4 code system was applied for pin-by-pin calculations of the effective multiplication factor for the first cycle IRIS reactor core. The effective multiplication factors obtained by the above mentioned Monte Carlo calculations using 27-group ENDF/B-IV library and 238-group ENDF/B-V library have been compared with the effective multiplication factors achieved by HELIOS/NESTLE, CASMO/SIMULATE, and modified CORD-2 nodal calculations. The results of Monte Carlo calculations are found to be in good agreement with the results obtained by the nodal codes. The discrepancies in effective multiplication factor are typically within 1%. (author)

  6. Cellular specificity of HIV-1 replication can be controlled by LTR sequences

    International Nuclear Information System (INIS)

    Reed-Inderbitzin, Edward; Maury, Wendy

    2003-01-01

    Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

  7. Side core lifter

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Ya A

    1982-01-01

    A side core lifter is proposed which contains a housing with guide slits and a removable core lifter with side projections on the support section connected to the core receiver. In order to preserve the structure of the rock in the core sample by means of guaranteeing rectilinear movement of the core lifter in the rock, the support and core receiver sections are hinged. The device is equipped with a spring for angular shift in the core-reception part.

  8. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  9. Accident sequence quantification with KIRAP

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.

  10. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    comprehensive data from three different databases and a new computer model whose core is using Kappa index of coincidence. Conclusions To fully understand the connections between gene promoters and gene expression, we analyzed thousands of promoter sequences using our Kappa Index of Coincidence method and a specialized Optical Character Recognition (OCR neural network. Under our criteria, 10 classes of promoters were detected. In addition, the existence of “transitional” promoters suggests that there is an evolutionary weighted continuum between classes, depending perhaps upon changes in their gene products.

  11. Animal MRI Core

    Data.gov (United States)

    Federal Laboratory Consortium — The Animal Magnetic Resonance Imaging (MRI) Core develops and optimizes MRI methods for cardiovascular imaging of mice and rats. The Core provides imaging expertise,...

  12. Identification of a novel temperature sensitive promoter in cho cells

    Directory of Open Access Journals (Sweden)

    Hesse Friedemann

    2011-05-01

    Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

  13. Characteristics of core sampling from crumbing Paleozoic rock

    Energy Technology Data Exchange (ETDEWEB)

    Barabashkin, I I; Edelman, Y A; Filippov, V N; Lychev, V N

    1981-01-01

    The results of analysis of core sampling using standard core sampling tools with small and medium inside diameter are cited. It is demonstrated that when using these tools loss of core in Paleozoic deposits promising with regard to oil and gas content does not exceed 25 - 30%. The use of a new core sampling tool with a large inside diameter which includes drill bits of different types and a core lifter ''Krembriy'' SKU-172/100 made it possible to increase core removal approximately 52%. A representative core from a highly crumbling and vesicular rock belinging to groups III - IV in terms of difficulty of core sampling was obtained first. A description of a new core sampling tool is given. The characteristics of the technology of its use which promote preservation of the core are cited. Means of continued improvement of this tool are noted.

  14. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  15. The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

    DEFF Research Database (Denmark)

    Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

    2011-01-01

    Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

  16. Core Hunter 3: flexible core subset selection.

    Science.gov (United States)

    De Beukelaer, Herman; Davenport, Guy F; Fack, Veerle

    2018-05-31

    Core collections provide genebank curators and plant breeders a way to reduce size of their collections and populations, while minimizing impact on genetic diversity and allele frequency. Many methods have been proposed to generate core collections, often using distance metrics to quantify the similarity of two accessions, based on genetic marker data or phenotypic traits. Core Hunter is a multi-purpose core subset selection tool that uses local search algorithms to generate subsets relying on one or more metrics, including several distance metrics and allelic richness. In version 3 of Core Hunter (CH3) we have incorporated two new, improved methods for summarizing distances to quantify diversity or representativeness of the core collection. A comparison of CH3 and Core Hunter 2 (CH2) showed that these new metrics can be effectively optimized with less complex algorithms, as compared to those used in CH2. CH3 is more effective at maximizing the improved diversity metric than CH2, still ensures a high average and minimum distance, and is faster for large datasets. Using CH3, a simple stochastic hill-climber is able to find highly diverse core collections, and the more advanced parallel tempering algorithm further increases the quality of the core and further reduces variability across independent samples. We also evaluate the ability of CH3 to simultaneously maximize diversity, and either representativeness or allelic richness, and compare the results with those of the GDOpt and SimEli methods. CH3 can sample equally representative cores as GDOpt, which was specifically designed for this purpose, and is able to construct cores that are simultaneously more diverse, and either are more representative or have higher allelic richness, than those obtained by SimEli. In version 3, Core Hunter has been updated to include two new core subset selection metrics that construct cores for representativeness or diversity, with improved performance. It combines and outperforms the

  17. Identification and characterization of the human SOX6 promoter

    International Nuclear Information System (INIS)

    Ikeda, Toshiyuki; Saito, Taku; Ushita, Masahiro; Yano, Fumiko; Kan, Akinori; Itaka, Keiji; Moro, Toru; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il

    2007-01-01

    The present study attempted to identify and characterize the embryonic promoter of Sox6, a determinant regulator of chondrogenic differentiation. A common transcription start region for human and mouse Sox6 was initially identified, which contained a highly conserved sequence, A-box. Tandem repeats of A-box had a strong transcriptional activity both at the basal level and in response to Sox9. Cells carrying the 4xA-box-DsRed2 reporter fluoresced only upon chondrogenic differentiation. The 46-bp core enhancer region (CES6) was then identified in the 3' half of A-box, within which a C/EBP-binding motif was identified. Overexpressed C/EBPβ activated the Sox6 promoter, and mutant 4xCES6 constructs lacking the C/EBP motif lost their basal activity. CES6 and nuclear extracts formed a specific complex, which was supershifted by anti-C/EBPβ antibody, and in vitro translated C/EBPβ specifically bound to CES6. Thus, we successfully identified the Sox6 promoter and its core enhancer and characterized the interactions with regulatory transcription factors

  18. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  19. k-core covers and the core

    NARCIS (Netherlands)

    Sanchez-Rodriguez, E.; Borm, Peter; Estevez-Fernandez, A.; Fiestras-Janeiro, G.; Mosquera, M.A.

    This paper extends the notion of individual minimal rights for a transferable utility game (TU-game) to coalitional minimal rights using minimal balanced families of a specific type, thus defining a corresponding minimal rights game. It is shown that the core of a TU-game coincides with the core of

  20. The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro.

    Science.gov (United States)

    Cristofari, Gaël; Ivanyi-Nagy, Roland; Gabus, Caroline; Boulant, Steeve; Lavergne, Jean-Pierre; Penin, François; Darlix, Jean-Luc

    2004-01-01

    The hepatitis C virus (HCV) is an important human pathogen causing chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HCV is an enveloped virus with a positive-sense, single-stranded RNA genome encoding a single polyprotein that is processed to generate viral proteins. Several hundred molecules of the structural Core protein are thought to coat the genome in the viral particle, as do nucleocapsid (NC) protein molecules in Retroviruses, another class of enveloped viruses containing a positive-sense RNA genome. Retroviral NC proteins also possess nucleic acid chaperone properties that play critical roles in the structural remodelling of the genome during retrovirus replication. This analogy between HCV Core and retroviral NC proteins prompted us to investigate the putative nucleic acid chaperoning properties of the HCV Core protein. Here we report that Core protein chaperones the annealing of complementary DNA and RNA sequences and the formation of the most stable duplex by strand exchange. These results show that the HCV Core is a nucleic acid chaperone similar to retroviral NC proteins. We also find that the Core protein directs dimerization of HCV (+) RNA 3' untranslated region which is promoted by a conserved palindromic sequence possibly involved at several stages of virus replication.

  1. The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

    Science.gov (United States)

    Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

    2011-03-01

    Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  3. Tools and applications for core design and shielding in fast reactors

    International Nuclear Information System (INIS)

    Rachamin, Reuven

    2013-01-01

    Outline: • Modeling of SFR cores using the Serpent-DYN3D code sequence; • Core shielding assessment for the design of FASTEF-MYRRHA; • Neutron shielding studies on an advanced Molten Salt Fast Reactor (MSFR) design

  4. Evaluating Community Health Advisor (CHA) Core Competencies: The CHA Core Competency Retrospective Pretest/Posttest (CCCRP).

    Science.gov (United States)

    Story, Lachel; To, Yen M

    2016-05-01

    Health care and academic systems are increasingly collaborating with community health advisors (CHAs) to provide culturally relevant health interventions that promote sustained community transformation. Little attention has been placed on CHA training evaluation, including core competency attainment. This study identified common CHA core competencies, generated a theoretically based measure of those competencies, and explored psychometric properties of that measure. A concept synthesis revealed five CHA core competencies (leadership, translation, guidance, advocacy, and caring). The CHA Core Competency Retrospective Pretest/Posttest (CCCRP) resulted from that synthesis, which was administered using multiple approaches to individuals who previously received CHA training (N= 142). Exploratory factor analyses revealed a two-factor structure underlying the posttraining data, and Cronbach's alpha indicated high internal consistency. This study suggested some CHA core competencies might be more interrelated than previously thought, and two major competencies exist rather than five and supported the CCCRP's use to evaluate core competency attainment resulting from training. © The Author(s) 2014.

  5. Containment loading during severe core damage accidents

    International Nuclear Information System (INIS)

    Fermandjian, J.; Evrard, J.M.; Cenerino, C.; Berthion, Y.; Carvallo, G.

    1984-11-01

    The objective of the article is to study the influence of the state of the reactor cavity (dry or flooded) and of the corium coolability on the thermal-hydraulics in the containment in the case of an accident sequence involving core melting and subsequent containment basemat erosion, in a 900 MWe PWR unit. Calculations are performed by using the JERICHO thermal hydraulics code

  6. Reactor core fuel management

    International Nuclear Information System (INIS)

    Silvennoinen, P.

    1976-01-01

    The subject is covered in chapters, entitled: concepts of reactor physics; neutron diffusion; core heat transfer; reactivity; reactor operation; variables of core management; computer code modules; alternative reactor concepts; methods of optimization; general system aspects. (U.K.)

  7. Nuclear reactor core catcher

    International Nuclear Information System (INIS)

    1977-01-01

    A nuclear reactor core catcher is described for containing debris resulting from an accident causing core meltdown and which incorporates a method of cooling the debris by the circulation of a liquid coolant. (U.K.)

  8. Analysis of dismantling possibility and unloading efforts of fuel assemblies from core of WWER

    International Nuclear Information System (INIS)

    Danilov, V.; Dobrov, V.; Semishkin, V.; Vasilchenko, I.

    2006-01-01

    The computation methods of optimal dismantling sequence of fuel assemblies (FA) from core of WWER after different operating periods and accident conditions are considered. The algorithms of fuel dismantling sequence are constructed both on the basis of analysis of mutual spacer grid overlaps of adjacent fuel assemblies and numerical structure analysis of efforts required for FA removal as FA heaving from the core. Computation results for core dismantling sequence after 3-year operating period and LB LOCA are presented in the paper

  9. The AVRDC - The World Vegetable Center mungbean (Vigna radiata) core and mini core collections.

    Science.gov (United States)

    Schafleitner, Roland; Nair, Ramakrishnan Madhavan; Rathore, Abhishek; Wang, Yen-wei; Lin, Chen-yu; Chu, Shu-hui; Lin, Pin-yun; Chang, Jian-Cheng; Ebert, Andreas W

    2015-04-29

    Large ex situ germplasm collections generally harbor a wide range of crop diversity. AVRDC--The World Vegetable Center is holding in trust the world's second largest mungbean (Vigna radiata) germplasm collection with more than 6,700 accessions. Screening large collections for traits of interest is laborious and expensive. To enhance the access of breeders to the diversity of the crop, mungbean core and mini core collections have been established. The core collection of 1,481 entries has been built by random selection of 20% of the accessions after geographical stratification and subsequent cluster analysis of eight phenotypic descriptors in the whole collection. Summary statistics, especially the low differences of means, equal variance of the traits in both the whole and core collection and the visual inspection of quantile-quantile plots comparing the variation of phenotypic traits present in both collections indicated that the core collection well represented the pattern of diversity of the whole collection. The core collection was genotyped with 20 simple sequence repeat markers and a mini core set of 289 accessions was selected, which depicted the allele and genotype diversity of the core collection. The mungbean core and mini core collections plus their phenotypic and genotypic data are available for distribution to breeders. It is expected that these collections will enhance the access to biodiverse mungbean germplasm for breeding.

  10. Seismic core shroud

    International Nuclear Information System (INIS)

    Puri, A.; Mullooly, J.F.

    1981-01-01

    A core shroud is provided, comprising: a coolant boundary, following the shape of the core boundary, for channeling the coolant through the fuel assemblies; a cylindrical band positioned inside the core barrel and surrounding the coolant boundary; and support members extending from the coolant boundary to the band, for transferring load from the coolant boundary to the band. The shroud may be assembled in parts using automated welding techniques, and it may be adjusted to fit the reactor core easily

  11. Structural, evolutionary and genetic analysis of the histidine biosynthetic "core" in the genus Burkholderia.

    Science.gov (United States)

    Papaleo, Maria Cristiana; Russo, Edda; Fondi, Marco; Emiliani, Giovanni; Frandi, Antonio; Brilli, Matteo; Pastorelli, Roberta; Fani, Renato

    2009-12-01

    In this work a detailed analysis of the structure, the expression and the organization of his genes belonging to the core of histidine biosynthesis (hisBHAF) in 40 newly determined and 13 available sequences of Burkholderia strains was carried out. Data obtained revealed a strong conservation of the structure and organization of these genes through the entire genus. The phylogenetic analysis showed the monophyletic origin of this gene cluster and indicated that it did not undergo horizontal gene transfer events. The analysis of the intergenic regions, based on the substitution rate, entropy plot and bendability suggested the existence of a putative transcription promoter upstream of hisB, that was supported by the genetic analysis that showed that this cluster was able to complement Escherichia colihisA, hisB, and hisF mutations. Moreover, a preliminary transcriptional analysis and the analysis of microarray data revealed that the expression of the his core was constitutive. These findings are in agreement with the fact that the entire Burkholderiahis operon is heterogeneous, in that it contains "alien" genes apparently not involved in histidine biosynthesis. Besides, they also support the idea that the proteobacterial his operon was piece-wisely assembled, i.e. through accretion of smaller units containing only some of the genes (eventually together with their own promoters) involved in this biosynthetic route. The correlation existing between the structure, organization and regulation of his "core" genes and the function(s) they perform in cellular metabolism is discussed.

  12. Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?

    Science.gov (United States)

    Robins-Browne, Roy M.; Holt, Kathryn E.; Ingle, Danielle J.; Hocking, Dianna M.; Yang, Ji; Tauschek, Marija

    2016-01-01

    The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E.coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli. Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli, which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods. PMID:27917373

  13. HCV IRES-mediated core expression in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ye Zhao

    Full Text Available The lack of small animal models for hepatitis C virus has impeded the discovery and development of anti-HCV drugs. HCV-IRES plays an important role in HCV gene expression, and is an attractive target for antiviral therapy. In this study, we report a zebrafish model with a biscistron expression construct that can co-transcribe GFP and HCV-core genes by human hepatic lipase promoter and zebrafish liver fatty acid binding protein enhancer. HCV core translation was designed mediated by HCV-IRES sequence and gfp was by a canonical cap-dependent mechanism. Results of fluorescence image and in situ hybridization indicate that expression of HCV core and GFP is liver-specific; RT-PCR and Western blotting show that both core and gfp expression are elevated in a time-dependent manner for both transcription and translation. It means that the HCV-IRES exerted its role in this zebrafish model. Furthermore, the liver-pathological impact associated with HCV-infection was detected by examination of gene markers and some of them were elevated, such as adiponectin receptor, heparanase, TGF-β, PDGF-α, etc. The model was used to evaluate three clinical drugs, ribavirin, IFNα-2b and vitamin B12. The results show that vitamin B12 inhibited core expression in mRNA and protein levels in dose-dependent manner, but failed to impact gfp expression. Also VB12 down-regulated some gene transcriptions involved in fat liver, liver fibrosis and HCV-associated pathological process in the larvae. It reveals that HCV-IRES responds to vitamin B12 sensitively in the zebrafish model. Ribavirin did not disturb core expression, hinting that HCV-IRES is not a target site of ribavirin. IFNα-2b was not active, which maybe resulted from its degradation in vivo for the long time. These findings demonstrate the feasibility of the zebrafish model for screening of anti-HCV drugs targeting to HCV-IRES. The zebrafish system provides a novel evidence of using zebrafish as a HCV model organism.

  14. Core Values | NREL

    Science.gov (United States)

    Core Values Core Values NREL's core values are rooted in a safe and supportive work environment guide our everyday actions and efforts: Safe and supportive work environment Respect for the rights physical and social environment Integrity Maintain the highest standard of ethics, honesty, and integrity

  15. Sidewall coring shell

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Ya A; Konstantinov, L P; Martyshin, A N

    1966-12-12

    A sidewall coring shell consists of a housing and a detachable core catcher. The core lifter is provided with projections, the ends of which are situated in another plane, along the longitudinal axis of the lifter. The chamber has corresponding projections.

  16. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    2011-04-01

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  17. The Microsoft Biology Foundation Applications for High-Throughput Sequencing

    Science.gov (United States)

    Mercer, S.

    2010-01-01

    w9-2 The need for reusable libraries of bioinformatics functions has been recognized for many years and a number of language-specific toolkits have been constructed. Such toolkits have served as valuable nucleation points for the community, promoting the sharing of code and establishing standards. The majority of DNA sequencing machines and many other standard pieces of lab equipment are controlled by PCs using Windows, and a Microsoft genomics toolkit would enable initial processing and quality control to happen closer to the instrumentation and provide opportunities for added-value services within core facilities. The Microsoft Biology Foundation (MBF) is an open source software library, freely available for both commercial and academic use, available as an early-stage betafrom mbf.codeplex.com. This presentation will describe the structure and goals of MBF and demonstrate some of its uses.

  18. Rotary core drills

    Energy Technology Data Exchange (ETDEWEB)

    1967-11-30

    The design of a rotary core drill is described. Primary consideration is given to the following component parts of the drill: the inner and outer tube, the core bit, an adapter, and the core lifter. The adapter has the form of a downward-converging sleeve and is mounted to the lower end of the inner tube. The lifter, extending from the adapter, is split along each side so that it can be held open to permit movement of a core. It is possible to grip a core by allowing the lifter to assume a closed position.

  19. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  20. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  1. How Should the Graduate Economics Core Be Changed?

    Science.gov (United States)

    Abito, Jose Miguel; Borovickova, Katarina; Golden, Hays; Goldin, Jacob; Masten, Matthew A.; Morin, Miguel; Poirier, Alexandre; Pons, Vincent; Romem, Israel; Williams, Tyler; Yoon, Chamna

    2011-01-01

    The authors present suggestions by graduate students from a range of economics departments for improving the first-year core sequence in economics. The students identified a number of elements that should be added to the core: more training in building microeconomic models, a discussion of the methodological foundations of model-building, more…

  2. Core-Plus Mathematics. What Works Clearinghouse Intervention Report

    Science.gov (United States)

    What Works Clearinghouse, 2010

    2010-01-01

    "Core-Plus Mathematics" is a four-year curriculum that replaces the traditional sequence with courses that each feature interwoven strands of algebra and functions, statistics and probability, geometry and trigonometry, and discrete mathematics. The first three courses in the series provide a common core of broadly useful mathematics,…

  3. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  4. HYDRATE CORE DRILLING TESTS

    Energy Technology Data Exchange (ETDEWEB)

    John H. Cohen; Thomas E. Williams; Ali G. Kadaster; Bill V. Liddell

    2002-11-01

    The ''Methane Hydrate Production from Alaskan Permafrost'' project is a three-year endeavor being conducted by Maurer Technology Inc. (MTI), Noble, and Anadarko Petroleum, in partnership with the U.S. DOE National Energy Technology Laboratory (NETL). The project's goal is to build on previous and ongoing R&D in the area of onshore hydrate deposition. The project team plans to design and implement a program to safely and economically drill, core and produce gas from arctic hydrates. The current work scope includes drilling and coring one well on Anadarko leases in FY 2003 during the winter drilling season. A specially built on-site core analysis laboratory will be used to determine some of the physical characteristics of the hydrates and surrounding rock. Prior to going to the field, the project team designed and conducted a controlled series of coring tests for simulating coring of hydrate formations. A variety of equipment and procedures were tested and modified to develop a practical solution for this special application. This Topical Report summarizes these coring tests. A special facility was designed and installed at MTI's Drilling Research Center (DRC) in Houston and used to conduct coring tests. Equipment and procedures were tested by cutting cores from frozen mixtures of sand and water supported by casing and designed to simulate hydrate formations. Tests were conducted with chilled drilling fluids. Tests showed that frozen core can be washed out and reduced in size by the action of the drilling fluid. Washing of the core by the drilling fluid caused a reduction in core diameter, making core recovery very difficult (if not impossible). One successful solution was to drill the last 6 inches of core dry (without fluid circulation). These tests demonstrated that it will be difficult to capture core when drilling in permafrost or hydrates without implementing certain safeguards. Among the coring tests was a simulated hydrate

  5. Regulatory sequence of cupin family gene

    Science.gov (United States)

    Hood, Elizabeth; Teoh, Thomas

    2017-07-25

    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  6. Coolability of severely degraded CANDU cores

    International Nuclear Information System (INIS)

    Meneley, D.A.; Blahnik, C.; Rogers, J.T.; Snell, V.G.; Mijhawan, S.

    1995-07-01

    Analytical and experimental studies have shown that the separately cooled moderator in a CANDU reactor provides an effective heat sink in the event of a loss-of-coolant accident (LOCA) accompanied by total failure of the emergency core cooling system (ECCS). The moderator heat sink prevents fuel melting and maintains the integrity of the fuel channels, therefore terminating this severe accident short of severe core damage. Nevertheless, there is a probability, however low, that the moderator heat sink could fail in such an accident. The pioneering work of Rogers (1984) for such a severe accident using simplified models showed that the fuel channels would fail and a bed of dry, solid debris would be formed at the bottom of the calandria which would heat up and eventually melt. However, the molten pool of core material would be retained in the calandria vessel, cooled by the independently cooled shield-tank water, and would eventually re solidify. Thus, the calandria vessel would act inherently as a core-catcher as long as the shield tank integrity is maintained. The present paper reviews subsequent work on the damage to a CANDU core under severe accident conditions and describes an empirically based mechanistic model of this process. It is shown that, for such severe accident sequences in a CANDU reactor, the end state following core disassembly consists of a porous bed of dry solid, coarse debris, irrespective of the initiating event and the core disassembly process. (author). 48 refs., 3 tabs., 18 figs

  7. Coolability of severely degraded CANDU cores. Revised

    International Nuclear Information System (INIS)

    Meneley, D.A.; Blahnik, C.; Rogers, J.T.; Snell, V.G.; Nijhawan, S.

    1996-01-01

    Analytical and experimental studies have shown that the separately cooled moderator in a CANDU reactor provides an effective heat sink in the event of a loss-of-coolant accident (LOCA) accompanied by total failure of the emergency core cooling system (ECCS). The moderator heat sink prevents fuel melting and maintains the integrity of the fuel channels, therefore terminating this severe accident short of severe core damage. Nevertheless, there is a probability, however low, that the moderator heat sink could fail in such an accident. The pioneering work of Rogers (1984) for such a severe accident using simplified models showed that the fuel channels would fail and a bed of dry, solid debris would be formed at the bottom of the calandria which would heat up and eventually melt. However, the molten pool of core material would be retained in the calandria vessel, cooled by the independently cooled shield-tank water, and would eventually resolidify. Thus, the calandria vessel would act inherently as a 'core-catcher' as long as the shield tank integrity is maintained. The present paper reviews subsequent work on the damage to a CANDU core under severe accident conditions and describes an empirically based mechanistic model of this process. It is shown that, for such severe accident sequences in a CANDU reactor, the end state following core disassembly consists of a porous bed of dry solid, coarse debris, irrespective of the initiating event and the core disassembly process. (author)

  8. Are sdAs helium core stars?

    Directory of Open Access Journals (Sweden)

    Pelisoli Ingrid

    2017-12-01

    Full Text Available Evolved stars with a helium core can be formed by non-conservative mass exchange interaction with a companion or by strong mass loss. Their masses are smaller than 0.5 M⊙. In the database of the Sloan Digital Sky Survey (SDSS, there are several thousand stars which were classified by the pipeline as dwarf O, B and A stars. Considering the lifetimes of these classes on the main sequence, and their distance modulus at the SDSS bright saturation, if these were common main sequence stars, there would be a considerable population of young stars very far from the galactic disk. Their spectra are dominated by Balmer lines which suggest effective temperatures around 8 000-10 000 K. Several thousand have significant proper motions, indicative of distances smaller than 1 kpc. Many show surface gravity in intermediate values between main sequence and white dwarf, 4.75 < log g < 6.5, hence they have been called sdA stars. Their physical nature and evolutionary history remains a puzzle. We propose they are not H-core main sequence stars, but helium core stars and the outcomes of binary evolution. We report the discovery of two new extremely-low mass white dwarfs among the sdAs to support this statement.

  9. Managing water addition to a degraded core

    International Nuclear Information System (INIS)

    Kuan, P.; Hanson, D.J.; Odar, F.

    1992-01-01

    In this paper the authors present information that can be used in severe accident management by providing an improved understanding of the effects of water addition to a degraded core. This improved understanding is developed using a diagram showing a sequence of core damage states. Whenever possible, a temperature and a time after accident initiation are estimated for each damage state in the sequence diagram. This diagram can be used to anticipate the evolution of events during an accident. Possible responses of plant instruments are described to identify these damage states and the effects of water addition. The rate and amount of water addition needed (a) to remove energy from the core, (b) to stabilize the core or (c) to not adversely affect the damage progression, are estimated. Analysis of the capability to remove energy from large cohesive and particulate debris beds indicates that these beds may not be stabilized in the core region and they may partially relocate to the lower plenum of the reactor vessel

  10. The core paradox.

    Science.gov (United States)

    Kennedy, G. C.; Higgins, G. H.

    1973-01-01

    Rebuttal of suggestions from various critics attempting to provide an escape from the seeming paradox originated by Higgins and Kennedy's (1971) proposed possibility that the liquid in the outer core was thermally stably stratified and that this stratification might prove a powerful inhibitor to circulation of the outer core fluid of the kind postulated for the generation of the earth's magnetic field. These suggestions are examined and shown to provide no reasonable escape from the core paradox.

  11. Nuclear reactor core flow baffling

    International Nuclear Information System (INIS)

    Berringer, R.T.

    1979-01-01

    A flow baffling arrangement is disclosed for the core of a nuclear reactor. A plurality of core formers are aligned with the grids of the core fuel assemblies such that the high pressure drop areas in the core are at the same elevations as the high pressure drop areas about the core periphery. The arrangement minimizes core bypass flow, maintains cooling of the structure surrounding the core, and allows the utilization of alternative beneficial components such as neutron reflectors positioned near the core

  12. Sediment Core Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: Provides instrumentation and expertise for physical and geoacoustic characterization of marine sediments.DESCRIPTION: The multisensor core logger measures...

  13. Can Psychiatric Rehabilitation Be Core to CORE?

    Science.gov (United States)

    Olney, Marjorie F.; Gill, Kenneth J.

    2016-01-01

    Purpose: In this article, we seek to determine whether psychiatric rehabilitation principles and practices have been more fully incorporated into the Council on Rehabilitation Education (CORE) standards, the extent to which they are covered in four rehabilitation counseling "foundations" textbooks, and how they are reflected in the…

  14. Analysis of aberrant methylation on promoter sequences of tumor suppressor genes and total DNA in sputum samples: a promising tool for early detection of COPD and lung cancer in smokers

    Directory of Open Access Journals (Sweden)

    Guzmán Leda

    2012-07-01

    Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is a disorder associated to cigarette smoke and lung cancer (LC. Since epigenetic changes in oncogenes and tumor suppressor genes (TSGs are clearly important in the development of LC. In this study, we hypothesize that tobacco smokers are susceptible for methylation in the promoter region of TSGs in airway epithelial cells when compared with non-smoker subjects. The purpose of this study was to investigate the usefulness of detection of genes promoter methylation in sputum specimens, as a complementary tool to identify LC biomarkers among smokers with early COPD. Methods We determined the amount of DNA in induced sputum from patients with COPD (n = 23, LC (n = 26, as well as in healthy subjects (CTR (n = 33, using a commercial kit for DNA purification, followed by absorbance measurement at 260 nm. The frequency of CDKN2A, CDH1 and MGMT promoter methylation in the same groups was determined by methylation-specific polymerase chain reaction (MSP. The Fisher’s exact test was employed to compare frequency of results between different groups. Results DNA concentration was 7.4 and 5.8 times higher in LC and COPD compared to the (CTR (p  Conclusions We provide evidence that aberrant methylation of TSGs in samples of induced sputum is a useful tool for early diagnostic of lung diseases (LC and COPD in smoker subjects. Virtual slides The abstract MUST finish with the following text: Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1127865005664160

  15. PWR core design calculations

    International Nuclear Information System (INIS)

    Trkov, A.; Ravnik, M.; Zeleznik, N.

    1992-01-01

    Functional description of the programme package Cord-2 for PWR core design calculations is presented. Programme package is briefly described. Use of the package and calculational procedures for typical core design problems are treated. Comparison of main results with experimental values is presented as part of the verification process. (author) [sl

  16. EEA core set of indicators. Guide

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This guide provides information on the quality of the 37 indicators in the EEA core set. Its primary role is to support improved implementation of the core set in the EEA, European topic centres and the European environment information and observation network (Eionet). In parallel, it is aimed at helping users outside the EEA/Eionet system make best use of the indicators in their own work. It is hoped that the guide will promote cooperation on improving indicator methodologies and data quality as part of the wider process to streamline and improve environmental reporting in the European Union and beyond. (au)

  17. Replaceable LMFBR core components

    International Nuclear Information System (INIS)

    Evans, E.A.; Cunningham, G.W.

    1976-01-01

    Much progress has been made in understanding material and component performance in the high temperature, fast neutron environment of the LMFBR. Current data have provided strong assurance that the initial core component lifetime objectives of FFTF and CRBR can be met. At the same time, this knowledge translates directly into the need for improved core designs that utilize improved materials and advanced fuels required to meet objectives of low doubling times and extended core component lifetimes. An industrial base for the manufacture of quality core components has been developed in the US, and all procurements for the first two core equivalents for FFTF will be completed this year. However, the problem of fabricating recycled plutonium while dramatically reducing fabrication costs, minimizing personnel exposure, and protecting public health and safety must be addressed

  18. Lunar Core and Tides

    Science.gov (United States)

    Williams, J. G.; Boggs, D. H.; Ratcliff, J. T.

    2004-01-01

    Variations in rotation and orientation of the Moon are sensitive to solid-body tidal dissipation, dissipation due to relative motion at the fluid-core/solid-mantle boundary, and tidal Love number k2 [1,2]. There is weaker sensitivity to flattening of the core-mantle boundary (CMB) [2,3,4] and fluid core moment of inertia [1]. Accurate Lunar Laser Ranging (LLR) measurements of the distance from observatories on the Earth to four retroreflector arrays on the Moon are sensitive to lunar rotation and orientation variations and tidal displacements. Past solutions using the LLR data have given results for dissipation due to solid-body tides and fluid core [1] plus Love number [1-5]. Detection of CMB flattening, which in the past has been marginal but improving [3,4,5], now seems significant. Direct detection of the core moment has not yet been achieved.

  19. Internal core tightener

    International Nuclear Information System (INIS)

    Brynsvold, G.V.; Snyder, H.J. Jr.

    1976-01-01

    An internal core tightener is disclosed which is a linear actuated (vertical actuation motion) expanding device utilizing a minimum of moving parts to perform the lateral tightening function. The key features are: (1) large contact areas to transmit loads during reactor operation; (2) actuation cam surfaces loaded only during clamping and unclamping operation; (3) separation of the parts and internal operation involved in the holding function from those involved in the actuation function; and (4) preloaded pads with compliant travel at each face of the hexagonal assembly at the two clamping planes to accommodate thermal expansion and irradiation induced swelling. The latter feature enables use of a ''fixed'' outer core boundary, and thus eliminates the uncertainty in gross core dimensions, and potential for rapid core reactivity changes as a result of core dimensional change. 5 claims, 12 drawing figures

  20. Formation and fragmentation of protostellar dense cores

    International Nuclear Information System (INIS)

    Maury, Anaelle

    2009-01-01

    Stars form in molecular clouds, when they collapse and fragment to produce protostellar dense cores. These dense cores are then likely to contract under their own gravity, and form young protostars, that further evolve while accreting their circumstellar mass, until they reach the main sequence. The main goal of this thesis was to study the formation and fragmentation of protostellar dense cores. To do so, two main studies, described in this manuscript, were carried out. First, we studied the formation of protostellar cores by quantifying the impact of protostellar outflows on clustered star formation. We carried out a study of the protostellar outflows powered by the young stellar objects currently formed in the NGc 2264-C proto-cluster, and we show that protostellar outflows seem to play a crucial role as turbulence progenitors in clustered star forming regions, although they seem unlikely to significantly modify the global infall processes at work on clump scales. Second, we investigated the formation of multiple systems by core fragmentation, by using high - resolution observations that allow to probe the multiplicity of young protostars on small scales. Our results suggest that the multiplicity rate of protostars on small scales increase while they evolve, and thus favor dynamical scenarios for the formation of multiple systems. Moreover, our results favor magnetized scenarios of core collapse to explain the small-scale properties of protostars at the earliest stages. (author) [fr

  1. Calcium ions affect the hepatitis B virus core assembly

    International Nuclear Information System (INIS)

    Choi, Yongwook; Gyoo Park, Sung; Yoo, Jun-hi; Jung, Guhung

    2005-01-01

    Previous report showed that cytosolic Ca 2+ induced by hepatitis B virus X protein (HBx) promotes HBV replication. In this study, in vitro experiments showed that (i) HBV core assembly in vitro was promoted by Ca 2+ through the sucrose density gradient and the analytical ultracentrifuge analysis. Also (ii) transmission electron microscope analysis demonstrated these assembled HBV core particles were the capsids. Ex vivo experiments showed that the treatment of BAPTA-AM and cyclosporine A (CsA) reduced HBV capsids in the transfected HepG2 cells. In addition to that, the treatment of Thapsigargin (TG) increased HBV capsids in the transfected HepG2 cells. Furthermore, we investigated the increased HBV core assembly by HBx. The results show that the increased cytosolic calcium ions by HBx promote the HBV core assembly

  2. Human Adenovirus Core Protein V Is Targeted by the Host SUMOylation Machinery To Limit Essential Viral Functions.

    Science.gov (United States)

    Freudenberger, Nora; Meyer, Tina; Groitl, Peter; Dobner, Thomas; Schreiner, Sabrina

    2018-02-15

    Human adenoviruses (HAdV) are nonenveloped viruses containing a linear, double-stranded DNA genome surrounded by an icosahedral capsid. To allow proper viral replication, the genome is imported through the nuclear pore complex associated with viral core proteins. Until now, the role of these incoming virion proteins during the early phase of infection was poorly understood. The core protein V is speculated to bridge the core and the surrounding capsid. It binds the genome in a sequence-independent manner and localizes in the nucleus of infected cells, accumulating at nucleoli. Here, we show that protein V contains conserved SUMO conjugation motifs (SCMs). Mutation of these consensus motifs resulted in reduced SUMOylation of the protein; thus, protein V represents a novel target of the host SUMOylation machinery. To understand the role of protein V SUMO posttranslational modification during productive HAdV infection, we generated a replication-competent HAdV with SCM mutations within the protein V coding sequence. Phenotypic analyses revealed that these SCM mutations are beneficial for adenoviral replication. Blocking protein V SUMOylation at specific sites shifts the onset of viral DNA replication to earlier time points during infection and promotes viral gene expression. Simultaneously, the altered kinetics within the viral life cycle are accompanied by more efficient proteasomal degradation of host determinants and increased virus progeny production than that observed during wild-type infection. Taken together, our studies show that protein V SUMOylation reduces virus growth; hence, protein V SUMOylation represents an important novel aspect of the host antiviral strategy to limit virus replication and thereby points to potential intervention strategies. IMPORTANCE Many decades of research have revealed that HAdV structural proteins promote viral entry and mainly physical stability of the viral genome in the capsid. Our work over the last years showed that this

  3. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    Science.gov (United States)

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    Science.gov (United States)

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

    2015-01-01

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  5. Earth's inner core: Innermost inner core or hemispherical variations?

    NARCIS (Netherlands)

    Lythgoe, K. H.; Deuss, A.|info:eu-repo/dai/nl/412396610; Rudge, J. F.; Neufeld, J. A.

    2014-01-01

    The structure of Earth's deep inner core has important implications for core evolution, since it is thought to be related to the early stages of core formation. Previous studies have suggested that there exists an innermost inner core with distinct anisotropy relative to the rest of the inner core.

  6. Dependence of Core and Extended Flux on Core Dominance ...

    Indian Academy of Sciences (India)

    Abstract. Based on two extragalactic radio source samples, the core dominance parameter is calculated, and the correlations between the core/extended flux density and core dominance parameter are investi- gated. When the core dominance parameter is lower than unity, it is linearly correlated with the core flux density, ...

  7. Korrelasjon mellom core styrke, core stabilitet og utholdende styrke i core

    OpenAIRE

    Berg-Olsen, Andrea Marie; Fugelsøy, Eivor; Maurstad, Ann-Louise

    2010-01-01

    Formålet med studien var å se hvilke korrelasjon det er mellom core styrke, core stabilitet og utholdende styrke i core. Testingen bestod av tre hoveddeler hvor vi testet core styrke, core stabilitet og utholdende styrke i core. Innenfor core styrke og utholdende styrke i core ble tre ulike tester utført. Ved måling av core stabilitet ble det gjennomført kun en test. I core styrke ble isometrisk abdominal fleksjon, isometrisk rygg ekstensjon og isometrisk lateral fleksjon testet. Sit-ups p...

  8. Windscale pile core surveys

    International Nuclear Information System (INIS)

    Curtis, R.F.; Mathews, R.F.

    1996-01-01

    The two Windscale Piles were closed down, defueled as far as possible and mothballed for thirty years following a fire in the core of Pile 1 in 1957 resulting from the spontaneous release of stored Wigner energy in the graphite moderator. Decommissioning of the reactors commenced in 1987 and has reached the stage where the condition of both cores needs to be determined. To this end, non-intrusive and intrusive surveys and sampling of the cores have been planned and partly implemented. The objectives for each Pile differ slightly. The location and quantity of fuel remaining in the damaged core of Pile 1 needed to be established, whereas the removal of all fuel from Pile 2 needed to be confirmed. In Pile 1, the possible existence of a void in the core is to be explored and in Pile 2, the level of Wigner energy remaining required to be quantified. Levels of radioactivity in both cores needed to be measured. The planning of the surveys is described including strategy, design, safety case preparation and the remote handling and viewing equipment required to carry out the inspection, sampling and monitoring work. The results from the completed non-intrusive survey of Pile 2 are summarised. They confirm that the core is empty and the graphite is in good condition. The survey of Pile 1 has just started. (UK)

  9. Evolution of the Internet and its cores

    International Nuclear Information System (INIS)

    Zhang Guoqing; Zhang Guoqiang; Yang Qingfeng; Cheng Suqi; Zhou Tao

    2008-01-01

    In this paper, we empirically study the evolution of large scale Internet topology at the autonomous system (AS) level. The network size grows in an exponential form, obeying the famous Moore's law. We theoretically predict that the size of the AS-level Internet will double every 5.32 years. We apply the k-core decomposition method on the real Internet, and find that the size of a k-core with larger k is nearly stable over time. In addition, the maximal coreness is very stable after 2003. In contrast to the predictions of most previous models, the maximal degree of the Internet is also relatively stable versus time. We use the edge-exchange operation to obtain the randomized networks with the same degree sequence. A systematical comparison is drawn, indicating that the real Internet is more loosely connected, and both the full Internet and the nucleus are more disassortative than their randomized versions.

  10. Evolution of the Internet and its cores

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Guoqing; Zhang Guoqiang; Yang Qingfeng; Cheng Suqi [Institute of Computing Technology, Chinese Academy of Sciences, Beijing 100190 (China); Zhou Tao [Department of Modern Physics, University of Science and Technology of China, Hefei 230026 (China)], E-mail: gqzhang@ict.ac.cn, E-mail: zhutou@ustc.edu

    2008-12-15

    In this paper, we empirically study the evolution of large scale Internet topology at the autonomous system (AS) level. The network size grows in an exponential form, obeying the famous Moore's law. We theoretically predict that the size of the AS-level Internet will double every 5.32 years. We apply the k-core decomposition method on the real Internet, and find that the size of a k-core with larger k is nearly stable over time. In addition, the maximal coreness is very stable after 2003. In contrast to the predictions of most previous models, the maximal degree of the Internet is also relatively stable versus time. We use the edge-exchange operation to obtain the randomized networks with the same degree sequence. A systematical comparison is drawn, indicating that the real Internet is more loosely connected, and both the full Internet and the nucleus are more disassortative than their randomized versions.

  11. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  12. Core shroud corner joints

    Science.gov (United States)

    Gilmore, Charles B.; Forsyth, David R.

    2013-09-10

    A core shroud is provided, which includes a number of planar members, a number of unitary corners, and a number of subassemblies each comprising a combination of the planar members and the unitary corners. Each unitary corner comprises a unitary extrusion including a first planar portion and a second planar portion disposed perpendicularly with respect to the first planar portion. At least one of the subassemblies comprises a plurality of the unitary corners disposed side-by-side in an alternating opposing relationship. A plurality of the subassemblies can be combined to form a quarter perimeter segment of the core shroud. Four quarter perimeter segments join together to form the core shroud.

  13. IGCSE core mathematics

    CERN Document Server

    Wall, Terry

    2013-01-01

    Give your core level students the support and framework they require to get their best grades with this book dedicated to the core level content of the revised syllabus and written specifically to ensure a more appropriate pace. This title has been written for Core content of the revised Cambridge IGCSE Mathematics (0580) syllabus for first teaching from 2013. ? Gives students the practice they require to deepen their understanding through plenty of practice questions. ? Consolidates learning with unique digital resources on the CD, included free with every book. We are working with Cambridge

  14. Heterogeneous gas core reactor

    International Nuclear Information System (INIS)

    Diaz, N.J.; Dugan, E.T.

    1983-01-01

    A heterogeneous gas core nuclear reactor is disclosed comprising a core barrel provided interiorly with an array of moderator-containing tubes and being otherwise filled with a fissile and/or fertile gaseous fuel medium. The fuel medium may be flowed through the chamber and through an external circuit in which heat is extracted. The moderator may be a fluid which is flowed through the tubes and through an external circuit in which heat is extracted. The moderator may be a solid which may be cooled by a fluid flowing within the tubes and through an external heat extraction circuit. The core barrel is surrounded by moderator/coolant material. Fissionable blanket material may be disposed inwardly or outwardly of the core barrel

  15. iPSC Core

    Data.gov (United States)

    Federal Laboratory Consortium — The induced Pluripotent Stem Cells (iPSC) Core was created in 2011 to accelerate stem cell research in the NHLBI by providing investigators consultation, technical...

  16. Core Flight Software

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Core Flight Software (CFS) project purpose is to analyze applicability, and evolve and extend the reusability of the CFS system originally developed by...

  17. Restraint system for core elements of a reactor core

    International Nuclear Information System (INIS)

    Class, G.

    1975-01-01

    In a nuclear reactor, a core element bundle formed of a plurality of side-by-side arranged core elements is surrounded by restraining elements that exert a radially inwardly directly restraining force generating friction forces between the core elements in a restraining plane that is transverse to the core element axes. The adjoining core elements are in rolling contact with one another in the restraining plane by virtue of rolling-type bearing elements supported in the core elements. (Official Gazette)

  18. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  20. Heterogeneous gas core reactor

    International Nuclear Information System (INIS)

    Han, K.I.

    1977-01-01

    Preliminary investigations of a heterogeneous gas core reactor (HGCR) concept suggest that this potential power reactor offers distinct advantages over other existing or conceptual reactor power plants. One of the most favorable features of the HGCR is the flexibility of the power producing system which allows it to be efficiently designed to conform to a desired optimum condition without major conceptual changes. The arrangement of bundles of moderator/coolant channels in a fissionable gas or mixture of gases makes a truly heterogeneous nuclear reactor core. It is this full heterogeneity for a gas-fueled reactor core which accounts for the novelty of the heterogeneous gas core reactor concept and leads to noted significant advantages over previous gas core systems with respect to neutron and fuel economy, power density, and heat transfer characteristics. The purpose of this work is to provide an insight into the design, operating characteristics, and safety of a heterogeneous gas core reactor system. The studies consist mainly of neutronic, energetic and kinetic analyses of the power producing and conversion systems as a preliminary assessment of the heterogeneous gas core reactor concept and basic design. The results of the conducted research indicate a high potential for the heterogeneous gas core reactor system as an electrical power generating unit (either large or small), with an overall efficiency as high as 40 to 45%. The HGCR system is found to be stable and safe, under the conditions imposed upon the analyses conducted in this work, due to the inherent safety of ann expanding gaseous fuel and the intrinsic feedback effects of the gas and water coolant

  1. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  2. Analysis of hepatitis C virus RNA dimerization and core-RNA interactions.

    Science.gov (United States)

    Ivanyi-Nagy, Roland; Kanevsky, Igor; Gabus, Caroline; Lavergne, Jean-Pierre; Ficheux, Damien; Penin, François; Fossé, Philippe; Darlix, Jean-Luc

    2006-01-01

    The core protein of hepatitis C virus (HCV) has been shown previously to act as a potent nucleic acid chaperone in vitro, promoting the dimerization of the 3'-untranslated region (3'-UTR) of the HCV genomic RNA, a process probably mediated by a small, highly conserved palindromic RNA motif, named DLS (dimer linkage sequence) [G. Cristofari, R. Ivanyi-Nagy, C. Gabus, S. Boulant, J. P. Lavergne, F. Penin and J. L. Darlix (2004) Nucleic Acids Res., 32, 2623-2631]. To investigate in depth HCV RNA dimerization, we generated a series of point mutations in the DLS region. We find that both the plus-strand 3'-UTR and the complementary minus-strand RNA can dimerize in the presence of core protein, while mutations in the DLS (among them a single point mutation that abolished RNA replication in a HCV subgenomic replicon system) completely abrogate dimerization. Structural probing of plus- and minus-strand RNAs, in their monomeric and dimeric forms, indicate that the DLS is the major if not the sole determinant of UTR RNA dimerization. Furthermore, the N-terminal basic amino acid clusters of core protein were found to be sufficient to induce dimerization, suggesting that they retain full RNA chaperone activity. These findings may have important consequences for understanding the HCV replicative cycle and the genetic variability of the virus.

  3. Analysis and research status of severe core damage accidents

    International Nuclear Information System (INIS)

    1984-03-01

    The Severe Core Damage Research and Analysis Task Force was established in Nuclear Safety Research Center, Tokai Research Establishment, JAERI, in May, 1982 to make a quantitative analysis on the issues related with the severe core damage accident and also to survey the present status of the research and provide the required research subjects on the severe core damage accident. This report summarizes the results of the works performed by the Task Force during last one and half years. The main subjects investigated are as follows; (1) Discussion on the purposes and necessities of severe core damage accident research, (2) proposal of phenomenological research subjects required in Japan, (3) analysis of severe core damage accidents and identification of risk dominant accident sequences, (4) investigation of significant physical phenomena in severe core damage accidents, and (5) survey of the research status. (author)

  4. FBR type reactor core

    International Nuclear Information System (INIS)

    Tamiya, Tadashi; Kawashima, Katsuyuki; Fujimura, Koji; Murakami, Tomoko.

    1995-01-01

    Neutron reflectors are disposed at the periphery of a reactor core fuel region and a blanket region, and a neutron shielding region is disposed at the periphery of them. The neutron reflector has a hollow duct structure having a sealed upper portion, a lower portion opened to cooling water, in which a gas and coolants separately sealed in the inside thereof. A driving pressure of a primary recycling pump is lowered upon reduction of coolant flow rate, then the liquid level of coolants in the neutron reflector is lowered due to imbalance between the driving pressure and a gas pressure, so that coolants having an effect as a reflector are eliminated from the outer circumference of the reactor core. Therefore, the amount of neutrons leaking from the reactor core is increased, and negative reactivity is charged to the reactor core. The negative reactivity of the neutron reflector is made greater than a power compensation reactivity. Since this enables reactor scram by using an inherent performance of the reactor core, the reactor core safety of an LMFBR-type reactor can be improved. (I.N.)

  5. The earths innermost core

    International Nuclear Information System (INIS)

    Nanda, J.N.

    1989-01-01

    A new earth model is advanced with a solid innermost core at the centre of the Earth where elements heavier than iron, over and above what can be retained in solution in the iron core, are collected. The innermost core is separated from the solid iron-nickel core by a shell of liquid copper. The innermost core has a natural vibration measured on the earth's surface as the long period 26 seconds microseisms. The earth was formed initially as a liquid sphere with a relatively thin solid crust above the Byerly discontinuity. The trace elements that entered the innermost core amounted to only 0.925 ppm of the molten mass. Gravitational differentiation must have led to the separation of an explosive thickness of pure 235 U causing a fission explosion that could expel beyond the Roche limit a crustal scab which would form the centre piece of the moon. A reservoir of helium floats on the liquid copper. A small proportion of helium-3, a relic of the ancient fission explosion present there will spell the exciting magnetic field. The field is stable for thousands of years because of the presence of large quantity of helium-4 which accounts for most of the gaseous collisions that will not disturb the atomic spin of helium-3 atoms. This field is prone to sudden reversals after long periods of stability. (author). 14 refs

  6. Getting to the Core of Transition: A Re-Assessment of Old Wine in New Bottles.

    Science.gov (United States)

    Stodden, Robert A.; Leake, David W.

    1994-01-01

    The core of the education system must be transformed to make it supportive of exceptional students in transition. Attempts to improve the system by adding on programs rather than instituting core changes have not been effective. A "teaming" process that promotes school-community and interagency collaboration and infuses transition into the core of…

  7. Comprehensive genomic analysis of a plant growth-promoting rhizobacterium Pantoea agglomerans strain P5.

    Science.gov (United States)

    Shariati J, Vahid; Malboobi, Mohammad Ali; Tabrizi, Zeinab; Tavakol, Elahe; Owilia, Parviz; Safari, Maryam

    2017-11-15

    In this study, we provide a comparative genomic analysis of Pantoea agglomerans strain P5 and 10 closely related strains based on phylogenetic analyses. A next-generation shotgun strategy was implemented using the Illumina HiSeq 2500 technology followed by core- and pan-genome analysis. The genome of P. agglomerans strain P5 contains an assembly size of 5082485 bp with 55.4% G + C content. P. agglomerans consists of 2981 core and 3159 accessory genes for Coding DNA Sequences (CDSs) based on the pan-genome analysis. Strain P5 can be grouped closely with strains PG734 and 299 R using pan and core genes, respectively. All the predicted and annotated gene sequences were allocated to KEGG pathways. Accordingly,  genes involved in plant growth-promoting (PGP) ability, including phosphate solubilization, IAA and siderophore production, acetoin and 2,3-butanediol synthesis and bacterial secretion, were assigned. This study provides an in-depth view of the PGP characteristics of strain P5, highlighting its potential use in agriculture as a biofertilizer.

  8. Development of useful recombinant promoter and its expression analysis in different plant cells using confocal laser scanning microscopy.

    Directory of Open Access Journals (Sweden)

    Deepak Kumar

    Full Text Available BACKGROUND: Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s. Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27 and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, -271 to +31. Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. CONCLUSION AND SIGNIFICANCE: We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in

  9. Core design methods for advanced LMFBRs

    International Nuclear Information System (INIS)

    Chandler, J.C.; Marr, D.R.; McCurry, D.C.; Cantley, D.A.

    1977-05-01

    The multidiscipline approach to advanced LMFBR core design requires an iterative design procedure to obtain a closely-coupled design. HEDL's philosophy requires that the designs should be coupled to the extent that the design limiting fuel pin, the design limiting duct and the core reactivity lifetime should all be equal and should equal the fuel residence time. The design procedure consists of an iterative loop involving three stages of the design sequence. Stage 1 consists of general mechanical design and reactor physics scoping calculations to arrive at an initial core layout. Stage 2 consists of detailed reactor physics calculations for the core configuration arrived at in Stage 1. Based upon the detailed reactor physics results, a decision is made either to alter the design (Stage 1) or go to Stage 3. Stage 3 consists of core orificing and detailed component mechanical design calculations. At this point, an assessment is made regarding design adequacy. If the design is inadequate the entire procedure is repeated until the design is acceptable

  10. A sequence of events across the Cretaceous-Tertiary boundary

    NARCIS (Netherlands)

    Smit, J.; Romein, A.J.T.

    1985-01-01

    The lithological and biological sequence of events across the Cretaceous-Tertiary (K/T), as developed in thick and complete landbased sections and termed the standard K/T event sequence, is also found in many DSDP cores from all over the globe. Microtektite-like spherules have been found in

  11. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  12. Assessing Core Competencies

    Science.gov (United States)

    Narayanan, M.

    2004-12-01

    Catherine Palomba and Trudy Banta offer the following definition of assessment, adapted from one provided by Marches in 1987. Assessment in the systematic collection, review, and use of information about educational programs undertaken for the purpose of improving student learning and development. (Palomba and Banta 1999). It is widely recognized that sophisticated computing technologies are becoming a key element in today's classroom instructional techniques. Regardless, the Professor must be held responsible for creating an instructional environment in which the technology actually supplements learning outcomes of the students. Almost all academic disciplines have found a niche for computer-based instruction in their respective professional domain. In many cases, it is viewed as an essential and integral part of the educational process. Educational institutions are committing substantial resources to the establishment of dedicated technology-based laboratories, so that they will be able to accommodate and fulfill students' desire to master certain of these specific skills. This type of technology-based instruction may raise some fundamental questions about the core competencies of the student learner. Some of the most important questions are : 1. Is the utilization of these fast high-powered computers and user-friendly software programs creating a totally non-challenging instructional environment for the student learner ? 2. Can technology itself all too easily overshadow the learning outcomes intended ? 3. Are the educational institutions simply training students how to use technology rather than educating them in the appropriate field ? 4. Are we still teaching content-driven courses and analysis oriented subject matter ? 5. Are these sophisticated modern era technologies contributing to a decline in the Critical Thinking Capabilities of the 21st century technology-savvy students ? The author tries to focus on technology as a tool and not on the technology

  13. Reactor core control device

    International Nuclear Information System (INIS)

    Sano, Hiroki

    1998-01-01

    The present invention provides a reactor core control device, in which switching from a manual operation to an automatic operation, and the control for the parameter of an automatic operation device are facilitated. Namely, the hysteresis of the control for the operation parameter by an manual operation input means is stored. The hysteresis of the control for the operation parameter is collected. The state of the reactor core simulated by an operation control to which the collected operation parameters are manually inputted is determined as an input of the reactor core state to the automatic input means. The record of operation upon manual operation is stored as a hysteresis of control for the operation parameter, but the hysteresis information is not only the result of manual operation of the operation parameter. This is results of operation conducted by a skilled operator who judge the state of the reactor core to be optimum. Accordingly, it involves information relevant to the reactor core state. Then, it is considered that the optimum automatic operation is not deviated greatly from the manual operation. (I.S.)

  14. The PWR cores management

    International Nuclear Information System (INIS)

    Barral, J.C.; Rippert, D.; Johner, J.

    2000-01-01

    During the meeting of the 25 january 2000, organized by the SFEN, scientists and plant operators in the domain of the PWR debated on the PWR cores management. The five first papers propose general and economic information on the PWR and also the fast neutron reactors chains in the electric power market: statistics on the electric power industry, nuclear plant unit management, the ITER project and the future of the thermonuclear fusion, the treasurer's and chairman's reports. A second part offers more technical papers concerning the PWR cores management: performance and optimization, in service load planning, the cores management in the other countries, impacts on the research and development programs. (A.L.B.)

  15. Molten core retention assembly

    International Nuclear Information System (INIS)

    Lampe, R.F.

    1976-01-01

    Molten fuel produced in a core overheating accident is caught by a molten core retention assembly consisting of a horizontal baffle plate having a plurality of openings therein, heat exchange tubes having flow holes near the top thereof mounted in the openings, and a cylindrical imperforate baffle attached to the plate and surrounding the tubes. The baffle assembly is supported from the core support plate of the reactor by a plurality of hanger rods which are welded to radial beams passing under the baffle plate and intermittently welded thereto. Preferably the upper end of the cylindrical baffle terminates in an outwardly facing lip to which are welded a plurality of bearings having slots therein adapted to accept the hanger rods

  16. Core status computing system

    International Nuclear Information System (INIS)

    Yoshida, Hiroyuki.

    1982-01-01

    Purpose: To calculate power distribution, flow rate and the like in the reactor core with high accuracy in a BWR type reactor. Constitution: Total flow rate signals, traverse incore probe (TIP) signals as the neutron detector signals, thermal power signals and pressure signals are inputted into a process computer, where the power distribution and the flow rate distribution in the reactor core are calculated. A function generator connected to the process computer calculates the absolute flow rate passing through optional fuel assemblies using, as variables, flow rate signals from the introduction part for fuel assembly flow rate signals, data signals from the introduction part for the geometrical configuration data at the flow rate measuring site of fuel assemblies, total flow rate signals for the reactor core and the signals from the process computer. Numerical values thus obtained are given to the process computer as correction signals to perform correction for the experimental data. (Moriyama, K.)

  17. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  18. TMI-2 core examination

    International Nuclear Information System (INIS)

    Hobbins, R.R.; MacDonald, P.E.; Owen, D.E.

    1983-01-01

    The examination of the damaged core at the Three Mile Island Unit 2 (TMI-2) reactor is structured to address the following safety issues: fission product release, transport, and deposition; core coolability; containment integrity; and recriticality during severe accidents; as well as zircaloy cladding ballooning and oxidation during so-called design basis accidents. The numbers of TMI-2 components or samples to be examined, the priority of each examination, the safety issue addressed by each examination, the principal examination techniques to be employed, and the data to be obtained and the principal uses of the data are discussed in this paper

  19. Superconducting tin core fiber

    International Nuclear Information System (INIS)

    Homa, Daniel; Liang, Yongxuan; Hill, Cary; Kaur, Gurbinder; Pickrell, Gary

    2015-01-01

    In this study, we demonstrated superconductivity in a fiber with a tin core and fused silica cladding. The fibers were fabricated via a modified melt-draw technique and maintained core diameters ranging from 50-300 microns and overall diameters of 125-800 microns. Superconductivity of this fiber design was validated via the traditional four-probe test method in a bath of liquid helium at temperatures on the order of 3.8 K. The synthesis route and fiber design are perquisites to ongoing research dedicated all-fiber optoelectronics and the relationships between superconductivity and the material structures, as well as corresponding fabrication techniques. (orig.)

  20. LMFBR core design analysis

    International Nuclear Information System (INIS)

    Cho, M.; Yang, J.C.; Yoh, K.C.; Suk, S.D.; Soh, D.S.; Kim, Y.M.

    1980-01-01

    The design parameters of a commercial-scale fast breeder reactor which is currently under construction by regeneration of these data is preliminary analyzed. The analysis of nuclear and thermal characteristics as well as safety features of this reactor is emphasized. And the evaluation of the initial core mentioned in the system description is carried out in the areas of its kinetics and control system, and, at the same time, the flow distribution of sodium and temperature distribution of the initial FBR core system are calculated. (KAERI INIS Section)

  1. Nuclear core catchers

    International Nuclear Information System (INIS)

    Golden, M.P.; Tilbrook, R.W.; Heylmun, N.F.

    1976-01-01

    A receptacle is described for taking the molten fragments of a nuclear reactor during a reactor core fusion accident. The receptacle is placed under the reactor. It includes at least one receptacle for the reactor core fragments, with a dome shaped part to distribute the molten fragments and at least one outside layer of alumina bricks around the dome. The characteristic of this receptacle is that the outer layer of bricks contains neutron poison rods which pass through the bricks and protrude in relation to them [fr

  2. Organizing Core Tasks

    DEFF Research Database (Denmark)

    Boll, Karen

    has remained much the same within the last 10 years. However, how the core task has been organized has changed considerable under the influence of various “organizing devices”. The paper focusses on how organizing devices such as risk assessment, output-focus, effect orientation, and treatment...... projects influence the organization of core tasks within the tax administration. The paper shows that the organizational transformations based on the use of these devices have had consequences both for the overall collection of revenue and for the employees’ feeling of “making a difference”. All in all...

  3. GREEN CORE HOUSE

    Directory of Open Access Journals (Sweden)

    NECULAI Oana

    2017-05-01

    Full Text Available The Green Core House is a construction concept with low environmental impact, having as main central element a greenhouse. The greenhouse has the innovative role to use the biomass energy provided by plants to save energy. Although it is the central piece, the greenhouse is not the most innovative part of the Green Core House, but the whole building ensemble because it integrates many other sustainable systems as "waste purification systems", "transparent photovoltaic panels" or "double skin façades".

  4. PWR core design calculations

    Energy Technology Data Exchange (ETDEWEB)

    Trkov, A; Ravnik, M; Zeleznik, N [Inst. Jozef Stefan, Ljubljana (Slovenia)

    1992-07-01

    Functional description of the programme package Cord-2 for PWR core design calculations is presented. Programme package is briefly described. Use of the package and calculational procedures for typical core design problems are treated. Comparison of main results with experimental values is presented as part of the verification process. (author) [Slovenian] Opisali smo programski paket CORD-2, ki se uporablja pri projektnih izracunih sredice pri upravljanju tlacnovodnega reaktorja. Prikazana je uporaba paketa in racunskih postopkov za tipicne probleme, ki nastopajo pri projektiranju sredice. Primerjava glavnih rezultatov z eksperimentalnimi vrednostmi je predstavljena kot del preveritvenega procesa. (author)

  5. Maximum stellar iron core mass

    Indian Academy of Sciences (India)

    An analytical method of estimating the mass of a stellar iron core, just prior to core collapse, is described in this paper. The method employed depends, in part, upon an estimate of the true relativistic mass increase experienced by electrons within a highly compressed iron core, just prior to core collapse, and is significantly ...

  6. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

    Science.gov (United States)

    Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

    2015-01-01

    Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

  7. Nuclear core baffling apparatus

    International Nuclear Information System (INIS)

    Cooper, F.W. Jr.; Silverblatt, B.L.; Knight, C.B.; Berringer, R.T.

    1979-01-01

    An apparatus for baffling the flow of reactor coolant fluid into and about the core of a nuclear reactor is described. The apparatus includes a plurality of longitudinally aligned baffle plates with mating surfaces that allow longitudinal growth with temperature increases while alleviating both leakage through the aligned plates and stresses on the components supporting the plates

  8. The Uncommon Core

    Science.gov (United States)

    Ohler, Jason

    2013-01-01

    This author contends that the United States neglects creativity in its education system. To see this, he states, one may look at the Common Core State Standards. If one searches the English Language Arts and Literacy standards for the words "creative," "innovative," and "original"--and any associated terms, one will…

  9. Utah's New Mathematics Core

    Science.gov (United States)

    Utah State Office of Education, 2011

    2011-01-01

    Utah has adopted more rigorous mathematics standards known as the Utah Mathematics Core Standards. They are the foundation of the mathematics curriculum for the State of Utah. The standards include the skills and understanding students need to succeed in college and careers. They include rigorous content and application of knowledge and reflect…

  10. Some Core Contested Concepts

    Science.gov (United States)

    Chomsky, Noam

    2015-01-01

    Core concepts of language are highly contested. In some cases this is legitimate: real empirical and conceptual issues arise. In other cases, it seems that controversies are based on misunderstanding. A number of crucial cases are reviewed, and an approach to language is outlined that appears to have strong conceptual and empirical motivation, and…

  11. Reactor core structure

    International Nuclear Information System (INIS)

    Higashinakagawa, Emiko; Sato, Kanemitsu.

    1992-01-01

    Taking notice on the fact that Fe based alloys and Ni based alloys are corrosion resistant in a special atmosphere of a nuclear reactor, Fe or Ni based alloys are applied to reactor core structural components such as fuel cladding tubes, fuel channels, spacers, etc. On the other hand, the neutron absorption cross section of zirconium is 0.18 barn while that of iron is 2.52 barn and that of nickel is 4.6 barn, which amounts to 14 to 25 times compared with that of zirconium. Accordingly, if the reactor core structural components are constituted by the Fe or Ni based alloys, neutron economy is lowered. Since it is desirable that neutrons contribute to uranium fission with least absorption to the reactor core structural components, the reactor core structural components are constituted with the Fe or Ni based alloys of good corrosion resistance only at a portion in contact with reactor water, that is, at a surface portion, while the main body is constituted with zircalloy in the present invention. Accordingly, corrosion resistnace can be kept while keeping small neutron absorption cross section. (T.M.)

  12. Investigation of EAS cores

    Directory of Open Access Journals (Sweden)

    Shaulov S.B.

    2017-01-01

    Full Text Available The development of nuclear-electromagnetic cascade models in air in the late forties have shown informational content of the study of cores of extensive air showers (EAS. These investigations were the main goal in different experiments which were carried out over many years by a variety of methods. Outcomes of such investigations obtained in the HADRON experiment using an X-ray emulsion chamber (XREC as a core detector are considered. The Ne spectrum of EAS associated with γ-ray families, spectra of γ-rays (hadrons in EAS cores and the Ne dependence of the muon number, ⟨Nμ⟩, in EAS with γ-ray families are obtained for the first time at energies of 1015–1017 eV with this method. A number of new effects were observed, namely, an abnormal scaling violation in hadron spectra which are fundamentally different from model predictions, an excess of muon number in EAS associated with γ-ray families, and the penetrating component in EAS cores. It is supposed that the abnormal behavior of γ-ray spectra and Ne dependence of the muon number are explained by the emergence of a penetrating component in the 1st PCR spectrum ‘knee’ range. Nuclear and astrophysical explanations of the origin of the penetrating component are discussed. The necessity of considering the contribution of a single close cosmic-ray source to explain the PCR spectrum in the knee range is noted.

  13. Plutonium cores of zenith

    Energy Technology Data Exchange (ETDEWEB)

    Barclay, F R; Cameron, I R; Drageset, A; Freemantle, R G; Wilson, D J

    1965-03-15

    The report describes a series of experiments carried out with plutonium fuel in the heated zero power reactor ZENITH, with the aim of testing current theoretical methods, with particular reference to excess reactivity, temperature coefficients, differential spectrum and reaction rate distributions. Two cores of widely different fissile/moderator atom ratios were loaded in order to test the theory under significantly varied spectrum conditions.

  14. Core damage risk indicators

    International Nuclear Information System (INIS)

    Szikszai, T.

    1994-01-01

    The purpose of this document is to show a method for the fast recalculation of the PSA. To avoid the information loose, it is necessary to simplify the PSA models, or at least reorganize them. The method, introduced in this document, require that preparation, so we try to show, how to do that. This document is an introduction. This is the starting point of the work related to the development of the risk indicators. In the future, with the application of this method, we are going to show an everyday use of the PSA results to produce the indicators of the core damage risk. There are two different indicators of the plant safety performance, related to the core damage risk. The first is the core damage frequency indicator (CDFI), and the second is the core damage probability indicator (CDPI). Of course, we cannot describe all of the possible ways to use these indicators, rather we will try to introduce the requirements to establish such an indicator system and the calculation process

  15. Core calculations of JMTR

    Energy Technology Data Exchange (ETDEWEB)

    Nagao, Yoshiharu [Japan Atomic Energy Research Inst., Oarai, Ibaraki (Japan). Oarai Research Establishment

    1998-03-01

    In material testing reactors like the JMTR (Japan Material Testing Reactor) of 50 MW in Japan Atomic Energy Research Institute, the neutron flux and neutron energy spectra of irradiated samples show complex distributions. It is necessary to assess the neutron flux and neutron energy spectra of an irradiation field by carrying out the nuclear calculation of the core for every operation cycle. In order to advance core calculation, in the JMTR, the application of MCNP to the assessment of core reactivity and neutron flux and spectra has been investigated. In this study, in order to reduce the time for calculation and variance, the comparison of the results of the calculations by the use of K code and fixed source and the use of Weight Window were investigated. As to the calculation method, the modeling of the total JMTR core, the conditions for calculation and the adopted variance reduction technique are explained. The results of calculation are shown. Significant difference was not observed in the results of neutron flux calculations according to the difference of the modeling of fuel region in the calculations by K code and fixed source. The method of assessing the results of neutron flux calculation is described. (K.I.)

  16. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  17. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  18. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  19. In-core fuel management via perturbation theory

    International Nuclear Information System (INIS)

    Mingle, J.O.

    1975-01-01

    A two-step procedure is developed for the optimization of in-core nuclear fuel management using perturbation theory to predict the effects of various core configurations. The first procedure is a cycle cost minimization using linear programming with a zoned core and discrete burnup groups. The second program utilizes an individual fuel assembly shuffling sequence to minimize the maldistribution of power generation. This latter quantity is represented by a figure of merit or by an assembly power peaking factor. A pressurized water reactor example calculation is utilized. 24 references

  20. Present status and needs of research on severe core damage

    International Nuclear Information System (INIS)

    1982-05-01

    The needs for research on severe core damage accident have been emphasized recently, in particular, since TMI-2 accident. The Severe Core Damage Research Task Force was established by the Divisions of Reactor Safety and Reactor Safety Evaluation to evaluate individual phenomenon, to survey the present status of research and to provide the recommended research subjects on severe accidents. This report describes the accident phenomena involving some analytical results, status of research and recommended research subjects on severe core damage accidents, divided into accident sequence, fuel damage, and molten material behavior, fission product behavior, hydrogen generation and combustion, steam explosion and containment integrity. (author)

  1. Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

    Science.gov (United States)

    Gerasymenko, I M; Sheludko, Y V

    2017-07-01

    To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

  2. CORE annual report 2006; CORE Jahresbericht 2006

    Energy Technology Data Exchange (ETDEWEB)

    Gut, A

    2007-04-15

    This annual report for the Swiss Federal Office of Energy (SFOE) summarises the activities of the Swiss Federal Commission on Energy Research CORE in 2006. The six main areas of work during the period 2004 - 2007 are examined, including a review of the SFOE's energy research programme, a road-map for the way towards the realisation of a 2000-watt society, the formulation of an energy research concept for 2008 - 2011, international co-operation, the dissemination of information and the assessment of existing and new instruments. International activities and Switzerland's involvement in energy research within the framework of the International Energy Agency IEA are discussed. New and existing projects are listed and the work done at the Competence Centre for Energy and Mobility noted. The Swiss Technology Award 2007 is presented. Information supplied to interested bodies to help improve knowledge on research work being done and to help make discussions on future energy supply more objective is discussed.

  3. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).

  4. Core principles of evolutionary medicine: A Delphi study.

    Science.gov (United States)

    Grunspan, Daniel Z; Nesse, Randolph M; Barnes, M Elizabeth; Brownell, Sara E

    2018-01-01

    Evolutionary medicine is a rapidly growing field that uses the principles of evolutionary biology to better understand, prevent and treat disease, and that uses studies of disease to advance basic knowledge in evolutionary biology. Over-arching principles of evolutionary medicine have been described in publications, but our study is the first to systematically elicit core principles from a diverse panel of experts in evolutionary medicine. These principles should be useful to advance recent recommendations made by The Association of American Medical Colleges and the Howard Hughes Medical Institute to make evolutionary thinking a core competency for pre-medical education. The Delphi method was used to elicit and validate a list of core principles for evolutionary medicine. The study included four surveys administered in sequence to 56 expert panelists. The initial open-ended survey created a list of possible core principles; the three subsequent surveys winnowed the list and assessed the accuracy and importance of each principle. Fourteen core principles elicited at least 80% of the panelists to agree or strongly agree that they were important core principles for evolutionary medicine. These principles over-lapped with concepts discussed in other articles discussing key concepts in evolutionary medicine. This set of core principles will be helpful for researchers and instructors in evolutionary medicine. We recommend that evolutionary medicine instructors use the list of core principles to construct learning goals. Evolutionary medicine is a young field, so this list of core principles will likely change as the field develops further.

  5. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  6. Children's science learning: A core skills approach.

    Science.gov (United States)

    Tolmie, Andrew K; Ghazali, Zayba; Morris, Suzanne

    2016-09-01

    Research has identified the core skills that predict success during primary school in reading and arithmetic, and this knowledge increasingly informs teaching. However, there has been no comparable work that pinpoints the core skills that underlie success in science. The present paper attempts to redress this by examining candidate skills and considering what is known about the way in which they emerge, how they relate to each other and to other abilities, how they change with age, and how their growth may vary between topic areas. There is growing evidence that early-emerging tacit awareness of causal associations is initially separated from language-based causal knowledge, which is acquired in part from everyday conversation and shows inaccuracies not evident in tacit knowledge. Mapping of descriptive and explanatory language onto causal awareness appears therefore to be a key development, which promotes unified conceptual and procedural understanding. This account suggests that the core components of initial science learning are (1) accurate observation, (2) the ability to extract and reason explicitly about causal connections, and (3) knowledge of mechanisms that explain these connections. Observational ability is educationally inaccessible until integrated with verbal description and explanation, for instance, via collaborative group work tasks that require explicit reasoning with respect to joint observations. Descriptive ability and explanatory ability are further promoted by managed exposure to scientific vocabulary and use of scientific language. Scientific reasoning and hypothesis testing are later acquisitions that depend on this integration of systems and improved executive control. © 2016 The British Psychological Society.

  7. Hydrogen-Poor Core-Collapse Supernovae

    Science.gov (United States)

    Pian, Elena; Mazzali, Paolo A.

    Hydrogen-poor core-collapse supernovae (SNe) signal the explosive death of stars more massive than the progenitors of hydrogen-rich core-collapse supernovae, i.e., approximately in the range 15-50 M⊙ in main sequence. Since hydrogen-poor core-collapse supernovae include those that accompany gamma-ray bursts (GRBs), which were all rigorously identified with type Ic supernovae, their explosion energies cover almost two decades. The light curves and spectra are consequently very heterogeneous and often bear the signature of an asymmetric, i.e., aspherical, explosion. Asphericity is best traced by early-time (within days of the explosion) optical spectropolarimetry and by late-epoch (more than ˜ 100 days after explosion) low-resolution spectroscopy. While the relationship between hydrogen-poor core-collapse supernovae to hydrogen-poor super-luminous supernovae is not understood, a known case of association between an ultra-long gamma-ray burst and a very luminous hydrogen-poor supernova may help unraveling the connection. This is tantalizingly pointing to a magnetar powering source for both phenomena, although this scenario is still highly speculative. Host galaxies of hydrogen-poor supernovae are always star forming; in those of completely stripped supernovae and gamma-ray burst supernovae, the spatial distribution of the explosions follows the blue/ultraviolet light, with a correlation that is more than linear.

  8. Refined repetitive sequence searches utilizing a fast hash function and cross species information retrievals

    Directory of Open Access Journals (Sweden)

    Reneker Jeff

    2005-05-01

    Full Text Available Abstract Background Searching for small tandem/disperse repetitive DNA sequences streamlines many biomedical research processes. For instance, whole genomic array analysis in yeast has revealed 22 PHO-regulated genes. The promoter regions of all but one of them contain at least one of the two core Pho4p binding sites, CACGTG and CACGTT. In humans, microsatellites play a role in a number of rare neurodegenerative diseases such as spinocerebellar ataxia type 1 (SCA1. SCA1 is a hereditary neurodegenerative disease caused by an expanded CAG repeat in the coding sequence of the gene. In bacterial pathogens, microsatellites are proposed to regulate expression of some virulence factors. For example, bacteria commonly generate intra-strain diversity through phase variation which is strongly associated with virulence determinants. A recent analysis of the complete sequences of the Helicobacter pylori strains 26695 and J99 has identified 46 putative phase-variable genes among the two genomes through their association with homopolymeric tracts and dinucleotide repeats. Life scientists are increasingly interested in studying the function of small sequences of DNA. However, current search algorithms often generate thousands of matches – most of which are irrelevant to the researcher. Results We present our hash function as well as our search algorithm to locate small sequences of DNA within multiple genomes. Our system applies information retrieval algorithms to discover knowledge of cross-species conservation of repeat sequences. We discuss our incorporation of the Gene Ontology (GO database into these algorithms. We conduct an exhaustive time analysis of our system for various repetitive sequence lengths. For instance, a search for eight bases of sequence within 3.224 GBases on 49 different chromosomes takes 1.147 seconds on average. To illustrate the relevance of the search results, we conduct a search with and without added annotation terms for the

  9. Evaluation of tight-pitch PWR cores

    International Nuclear Information System (INIS)

    Correa, F.; Driscoll, M.J.; Lanning, D.D.

    1979-08-01

    The impact of tight pinch cores on the consumption of natural uranium ore has been evaluated for two systems of coupled PWR's namely one particular type of thorium system - 235 U/UO 2 : Pu/ThO 2 : 233 U/ThO 2 - and the conventional recycle-mode uranium system - 235 U/UO 2 : Pu/UO 2 . The basic parameter varied was the fuel-to-moderator volume ratio (F/M) of the (uniform) lattice for the last core in each sequence. Although methods and data verification in the range of present interest, 0.5 (current lattices) 1.0, the EPRI-LEOPARD and LASER programs used for the thorium and uranium calculations, respectively, were successfully benchmarked against several of the more pertinent experiments

  10. Particle-core multiplets in 89Y

    International Nuclear Information System (INIS)

    Batsch, T.; Kownacki, J.; Zelazny, Z.; Guttormsen, M.; Ramsoey, T.; Rekstad, J.

    1987-10-01

    The 89 Y nucleus has been formed in its excited states via the 87 Rb(α,2n) reaction at incident energies 24-34 MeV. The γ-ray decay of the states has been studied by measuring γ-γ-t coincidences, angular distributions and relative excitation functions. The experimental results from the present investigation are in general agreement with the former studies. However, some corrections in the level scheme have been introduced. Eight new levels with spins up to around 31/2 ℎ have been observed. The uppermost levels have been arranged into a rotational-like sequence, suggesting a nuclear shape change. Using our and previously known data we have tried to locate and calculate the members of the 1g 9/2 x core multiplet. The present results are compared with the semi-empirical shell model and the particle-core weak coupling description

  11. Study on core design for reduced-moderation water reactors

    International Nuclear Information System (INIS)

    Okubo, Tsutomu

    2002-01-01

    The Reduced-Moderation Water Reactor (RMWR) is a water-cooled reactor with the harder neutron spectrum comparing with the LWR, resulting from low neutron moderation due to reduced water volume fraction. Based on the difference from the spectrum from the LWR, the conversion from U-238 to Pu-239 is promoted and the new cores preferable to effective utilization of uranium resource can be possible Design study of the RMWR core started in 1997 and new four core concepts (three BWR cores and one PWR core) are recently evaluated in terms of control rod worths, plutonium multiple recycle, high burnup and void coefficient. Comparative evaluations show needed incorporation of control rod programming and simplified PUREX process as well as development of new fuel cans for high burnup of 100 GW-d/t. Final choice of design specifications will be made at the next step aiming at realization of the RMWR. (T. Tanaka)

  12. Study on core design for reduced-moderation water reactors

    Energy Technology Data Exchange (ETDEWEB)

    Okubo, Tsutomu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2002-12-01

    The Reduced-Moderation Water Reactor (RMWR) is a water-cooled reactor with the harder neutron spectrum comparing with the LWR, resulting from low neutron moderation due to reduced water volume fraction. Based on the difference from the spectrum from the LWR, the conversion from U-238 to Pu-239 is promoted and the new cores preferable to effective utilization of uranium resource can be possible Design study of the RMWR core started in 1997 and new four core concepts (three BWR cores and one PWR core) are recently evaluated in terms of control rod worths, plutonium multiple recycle, high burnup and void coefficient. Comparative evaluations show needed incorporation of control rod programming and simplified PUREX process as well as development of new fuel cans for high burnup of 100 GW-d/t. Final choice of design specifications will be made at the next step aiming at realization of the RMWR. (T. Tanaka)

  13. Long sequence correlation coprocessor

    Science.gov (United States)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  14. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  15. Anomaly Detection in Sequences

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a set of novel algorithms which we call sequenceMiner, that detect and characterize anomalies in large sets of high-dimensional symbol sequences that...

  16. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  17. sequenceMiner algorithm

    Data.gov (United States)

    National Aeronautics and Space Administration — Detecting and describing anomalies in large repositories of discrete symbol sequences. sequenceMiner has been open-sourced! Download the file below to try it out....

  18. Emergency core cooling device

    International Nuclear Information System (INIS)

    Suzaki, Kiyoshi; Inoue, Akihiro.

    1979-01-01

    Purpose: To improve core cooling effect by making the operation region for a plurality of water injection pumps more broader. Constitution: An emergency reactor core cooling device actuated upon failure of recycling pipe ways is adapted to be fed with cooling water through a thermal sleeve by way of a plurality of water injection pump from pool water in a condensate storage tank and a pressure suppression chamber as water feed source. Exhaust pipes and suction pipes of each of the pumps are connected by way of switching valves and the valves are switched so that the pumps are set to a series operation if the pressure in the pressure vessel is high and the pumps are set to a parallel operation if the pressure in the pressure vessel is low. (Furukawa, Y.)

  19. Birefringent hollow core fibers

    DEFF Research Database (Denmark)

    Roberts, John

    2007-01-01

    Hollow core photonic crystal fiber (HC-PCF), fabricated according to a nominally non-birefringent design, shows a degree of un-controlled birefringence or polarization mode dispersion far in excess of conventional non polarization maintaining fibers. This can degrade the output pulse in many...... applications, and places emphasis on the development of polarization maintaining (PM) HC-PCF. The polarization cross-coupling characteristics of PM HC-PCF are very different from those of conventional PM fibers. The former fibers have the advantage of suffering far less from stress-field fluctuations...... and an increased overlap between the polarization modes at the glass interfaces. The interplay between these effects leads to a wavelength for optimum polarization maintenance, lambda(PM), which is detuned from the wavelength of highest birefringence. By a suitable fiber design involving antiresonance of the core...

  20. Plasma core reactor applications

    International Nuclear Information System (INIS)

    Latham, T.S.; Rodgers, R.J.

    1976-01-01

    Analytical and experimental investigations are being conducted to demonstrate the feasibility of fissioning uranium plasma core reactors and to characterize space and terrestrial applications for such reactors. Uranium hexafluoride (UF 6 ) fuel is injected into core cavities and confined away from the surface by argon buffer gas injected tangentially from the peripheral walls. Power, in the form of thermal radiation emitted from the high-temperature nuclear fuel, is transmitted through fused-silica transparent walls to working fluids which flow in axial channels embedded in segments of the cavity walls. Radiant heat transfer calculations were performed for a six-cavity reactor configuration; each cavity is approximately 1 m in diameter by 4.35 m in length. Axial working fluid channels are located along a fraction of each cavity peripheral wall

  1. Reactor core cooling device

    International Nuclear Information System (INIS)

    Kobayashi, Masahiro.

    1986-01-01

    Purpose: To safely and effectively cool down the reactor core after it has been shut down but is still hot due to after-heat. Constitution: Since the coolant extraction nozzle is situated at a location higher than the coolant injection nozzle, the coolant sprayed from the nozzle, is free from sucking immediately from the extraction nozzle and is therefore used effectively to cool the reactor core. As all the portions from the top to the bottom of the reactor are cooled simultaneously, the efficiency of the reactor cooling process is increased. Since the coolant extraction nozzle can be installed at a point considerably higher than the coolant injection nozzle, the distance from the coolant surface to the point of the coolant extraction nozzle can be made large, preventing cavitation near the coolant extraction nozzle. Therefore, without increasing the capacity of the heat exchanger, the reactor can be cooled down after a shutdown safely and efficiently. (Kawakami, Y.)

  2. Some core contested concepts.

    Science.gov (United States)

    Chomsky, Noam

    2015-02-01

    Core concepts of language are highly contested. In some cases this is legitimate: real empirical and conceptual issues arise. In other cases, it seems that controversies are based on misunderstanding. A number of crucial cases are reviewed, and an approach to language is outlined that appears to have strong conceptual and empirical motivation, and to lead to conclusions about a number of significant issues that differ from some conventional beliefs.

  3. Schumpeter's core works revisited

    DEFF Research Database (Denmark)

    Andersen, Esben Sloth

    2012-01-01

    This paper organises Schumpeter’s core books in three groups: the programmatic duology,the evolutionaryeconomic duology,and the socioeconomic synthesis. By analysing these groups and their interconnections from the viewpoint of modern evolutionaryeconomics,the paper summarises resolved problems a...... and points at remaining challenges. Its analyses are based on distinctions between microevolution and macroevolution, between economic evolution and socioeconomic coevolution, and between Schumpeter’s three major evolutionary models (called Mark I, Mark II and Mark III)....

  4. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  5. BWR type reactor core

    International Nuclear Information System (INIS)

    Tatemichi, Shin-ichiro.

    1981-01-01

    Purpose: To eliminate the variation in the power distribution of a BWR type reactor core in the axial direction even if the flow rate is increased or decreased by providing a difference in the void coefficient between the upper part and the lower parts of the reactor core, and increasing the void coefficient at the lower part of the reactor core. Constitution: The void coefficient of the lower region from the center to the lower part along the axial direction of a nuclear fuel assembly is increased to decrease the dependence on the flow rate of the axial power distribution of the nuclear fuel assembly. That is, a water/fuel ratio is varied, the water in non-boiled region is increased or the neutron spectrum is varied so as to vary the void coefficient. In order to exemplify it, the rate of the internal pellets of the fuel rod of the nuclear fuel assembly or the shape of the channel box is varied. Accordingly, the power does not considerably vary even if the flow rate is altered since the power is varied in the power operation. (Yoshihara, H.)

  6. Emergency core cooling system

    International Nuclear Information System (INIS)

    Ando, Masaki.

    1987-01-01

    Purpose: To actuate an automatic pressure down system (ADS) and a low pressure emergency core cooling system (ECCS) upon water level reduction of a nuclear reactor other than loss of coolant accidents (LOCA). Constitution: ADS in a BWR type reactor is disposed for reducing the pressure in a reactor container thereby enabling coolant injection from a low pressure ECCS upon LOCA. That is, ADS has been actuated by AND signal for a reactor water level low signal and a dry well pressure high signal. In the present invention, ADS can be actuated further also by AND signal of the reactor water level low signal, the high pressure ECCS and not-operation signal of reactor isolation cooling system. In such an emergency core cooling system thus constituted, ADS operates in the same manner as usual upon LOCA and, further, ADS is operated also upon loss of feedwater accident in the reactor pressure vessel in the case where there is a necessity for actuating the low pressure ECCS, although other high pressure ECCS and reactor isolation cooling system are not operated. Accordingly, it is possible to improve the reliability upon reactor core accident and mitigate the operator burden. (Horiuchi, T.)

  7. Hunton Group core workshop and field trip

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, K.S. [ed.

    1993-12-31

    The Late Ordovician-Silurian-Devonian Hunton Group is a moderately thick sequence of shallow-marine carbonates deposited on the south edge of the North American craton. This rock unit is a major target for petroleum exploration and reservoir development in the southern Midcontinent. The workshop described here was held to display cores, outcrop samples, and other reservoir-characterization studies of the Hunton Group and equivalent strata throughout the region. A field trip was organized to complement the workshop by allowing examination of excellent outcrops of the Hunton Group of the Arbuckle Mountains.

  8. Cross-species mapping of bidirectional promoters enables prediction of unannotated 5' UTRs and identification of species-specific transcripts

    Directory of Open Access Journals (Sweden)

    Lewin Harris A

    2009-04-01

    Full Text Available Abstract Background Bidirectional promoters are shared regulatory regions that influence the expression of two oppositely oriented genes. This type of regulatory architecture is found more frequently than expected by chance in the human genome, yet many specifics underlying the regulatory design are unknown. Given that the function of most orthologous genes is similar across species, we hypothesized that the architecture and regulation of bidirectional promoters might also be similar across species, representing a core regulatory structure and enabling annotation of these regions in additional mammalian genomes. Results By mapping the intergenic distances of genes in human, chimpanzee, bovine, murine, and rat, we show an enrichment for pairs of genes equal to or less than 1,000 bp between their adjacent 5' ends ("head-to-head" compared to pairs of genes that fall in the same orientation ("head-to-tail" or whose 3' ends are side-by-side ("tail-to-tail". A representative set of 1,369 human bidirectional promoters was mapped to orthologous sequences in other mammals. We confirmed predictions for 5' UTRs in nine of ten manual picks in bovine based on comparison to the orthologous human promoter set and in six of seven predictions in human based on comparison to the bovine dataset. The two predictions that did not have orthology as bidirectional promoters in the other species resulted from unique events that initiated transcription in the opposite direction in only those species. We found evidence supporting the independent emergence of bidirectional promoters from the family of five RecQ helicase genes, which gained their bidirectional promoters and partner genes independently rather than through a duplication process. Furthermore, by expanding our comparisons from pairwise to multispecies analyses we developed a map representing a core set of bidirectional promoters in mammals. Conclusion We show that the orthologous positions of bidirectional

  9. The Chemistry of Curcumin, the Health Promoting Ingredient in Turmeric

    Science.gov (United States)

    Dewprashad, Brahmadeo

    2010-01-01

    Case studies pertaining to the health benefits of foods can be particularly effective in engaging students and in teaching core concepts in science (Heidemann and Urquart 2005). This case study focuses on the chemistry of curcumin, the health-promoting ingredient in turmeric. The case was developed to review core concepts in organic chemistry and…

  10. Hard Core Pharmacology: How Much Is Taught in Pharmacy Schools?

    Science.gov (United States)

    Bachmann, Kenneth A.; And Others

    1990-01-01

    A survey was sent to eighty-five American Association of Colleges of Pharmacy-member schools and affiliates to learn how many lectures are accorded to core sequences in pharmacology. The data were intended to provide a frame of reference for the University of Toledo College of Pharmacy. (Author/MLW)

  11. Design of a PWR emergency core cooling simulator loop

    International Nuclear Information System (INIS)

    Melo, C.A. de.

    1982-12-01

    The preliminary design of a PWR Emergency Core Cooling Simulator Loop for investigations of the phenomena involved in a postulated Loss-of-Coolant Accident, during the Reflooding Phase, is presented. The functions of each component of the loop, the design methods and calculations, the specification of the instrumentation, the system operation sequence, the materials list and a cost assessment are included. (Author) [pt

  12. Textual Demands of Passages in Three English/Language Arts Common Core Assessments and One Core Literacy Program for Intermediate Elementary Grades

    Science.gov (United States)

    Morrison, Timothy G.; Wilcox, Brad; Murdoch, Erica; Bird, Lauren

    2018-01-01

    The Common Core has emphasized reading for comprehension, including making inferences. However, little is known about the textual demands found within assessment and instructional passages that are promoted as being in line with Common Core expectations. The purpose of this content analysis was to identify the readability levels, passage length,…

  13. Prediction of Hydrophobic Cores of Proteins Using Wavelet Analysis.

    Science.gov (United States)

    Hirakawa; Kuhara

    1997-01-01

    Information concerning the secondary structures, flexibility, epitope and hydrophobic regions of amino acid sequences can be extracted by assigning physicochemical indices to each amino acid residue, and information on structure can be derived using the sliding window averaging technique, which is in wide use for smoothing out raw functions. Wavelet analysis has shown great potential and applicability in many fields, such as astronomy, radar, earthquake prediction, and signal or image processing. This approach is efficient for removing noise from various functions. Here we employed wavelet analysis to smooth out a plot assigned to a hydrophobicity index for amino acid sequences. We then used the resulting function to predict hydrophobic cores in globular proteins. We calculated the prediction accuracy for the hydrophobic cores of 88 representative set of proteins. Use of wavelet analysis made feasible the prediction of hydrophobic cores at 6.13% greater accuracy than the sliding window averaging technique.

  14. Molten salt reactors: reactor cores

    International Nuclear Information System (INIS)

    1983-01-01

    In this critical analysis of the MSBR I project are examined the problems concerning the reactor core. Advantages of breeding depend essentially upon solutions to technological problems like continuous reprocessing or graphite behavior under neutron irradiation. Graphite deformation, moderator unloading, control rods and core instrumentation require more studies. Neutronics of the core, influence of core geometry and salt composition, fuel evolution, and thermohydraulics are reviewed [fr

  15. WNP-2 core model upgrade

    International Nuclear Information System (INIS)

    Golightly, C.E.; Ravindranath, T.K.; Belblidia, L.A.; O'Farrell, D.; Andersen, P.S.

    2006-01-01

    The paper describes the core model upgrade of the WNP-2 training simulator and the reasons for the upgrade. The core model as well as the interface with the rest of the simulator are briefly described . The paper also describes the procedure that will be used by WNP-2 to update the simulator core data after future core reloads. Results from the fully integrated simulator are presented. (author)

  16. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin

    2009-07-01

    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  17. On-line core monitoring with CORE MASTER / PRESTO

    International Nuclear Information System (INIS)

    Lindahl, S.O.; Borresen, S.; Ovrum, S.

    1986-01-01

    Advanced calculational tools are instrumental in improving reactor plant capacity factors and fuel utilization. The computer code package CORE MASTER is an integrated system designed to achieve this objective. The system covers all main activities in the area of in-core fuel management for boiling water reactors; design, operation support, and on-line core monitoring. CORE MASTER operates on a common data base, which defines the reactor and documents the operating history of the core and of all fuel bundles ever used

  18. In vessel core melt progression phenomena

    International Nuclear Information System (INIS)

    Courtaud, M.

    1993-01-01

    For all light water reactor (LWR) accidents, including the so called severe accidents where core melt down can occur, it is necessary to determine the amount and characteristics of fission products released to the environment. For existing reactors this knowledge is used to evaluate the consequences and eventual emergency plans. But for future reactors safety authorities demand decrease risks and reactors designed in such a way that fission products are retained inside the containment, the last protective barrier. This requires improved understanding and knowledge of all accident sequences. In particular it is necessary to be able to describe the very complex phenomena occurring during in vessel core melt progression because they will determine the thermal and mechanical loads on the primary circuit and the timing of its rupture as well as the fission product source term. On the other hand, in case of vessel failure, knowledge of the physical and chemical state of the core melt will provide the initial conditions for analysis of ex-vessel core melt progression and phenomena threatening the containment. Finally a good understanding of in vessel phenomena will help to improve accident management procedures like Emergency Core Cooling System water injection, blowdown and flooding of the vessel well, with their possible adverse effects. Research and Development work on this subject was initiated a long time ago and is still in progress but now it must be intensified in order to meet the safety requirements of the next generation of reactors. Experiments, limited in scale, analysis of the TMI 2 accident which is a unique source of global information and engineering judgment are used to establish and assess physical models that can be implemented in computer codes for reactor accident analysis

  19. Characterizing leader sequences of CRISPR loci

    DEFF Research Database (Denmark)

    Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

    2016-01-01

    The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

  20. Hollow-Core Fiber Lamp

    Science.gov (United States)

    Yi, Lin (Inventor); Tjoelker, Robert L. (Inventor); Burt, Eric A. (Inventor); Huang, Shouhua (Inventor)

    2016-01-01

    Hollow-core capillary discharge lamps on the millimeter or sub-millimeter scale are provided. The hollow-core capillary discharge lamps achieve an increased light intensity ratio between 194 millimeters (useful) and 254 millimeters (useless) light than conventional lamps. The capillary discharge lamps may include a cone to increase light output. Hollow-core photonic crystal fiber (HCPCF) may also be used.

  1. Dual-core Itanium Processor

    CERN Multimedia

    2006-01-01

    Intel’s first dual-core Itanium processor, code-named "Montecito" is a major release of Intel's Itanium 2 Processor Family, which implements the Intel Itanium architecture on a dual-core processor with two cores per die (integrated circuit). Itanium 2 is much more powerful than its predecessor. It has lower power consumption and thermal dissipation.

  2. Maximum stellar iron core mass

    Indian Academy of Sciences (India)

    60, No. 3. — journal of. March 2003 physics pp. 415–422. Maximum stellar iron core mass. F W GIACOBBE. Chicago Research Center/American Air Liquide ... iron core compression due to the weight of non-ferrous matter overlying the iron cores within large .... thermal equilibrium velocities will tend to be non-relativistic.

  3. Core TuLiP

    NARCIS (Netherlands)

    Czenko, M.R.; Etalle, Sandro

    2007-01-01

    We propose CoreTuLiP - the core of a trust management language based on Logic Programming. CoreTuLiP is based on a subset of moded logic programming, but enjoys the features of TM languages such as RT; in particular clauses are issued by different authorities and stored in a distributed manner. We

  4. Automated Core Design

    International Nuclear Information System (INIS)

    Kobayashi, Yoko; Aiyoshi, Eitaro

    2005-01-01

    Multistate searching methods are a subfield of distributed artificial intelligence that aims to provide both principles for construction of complex systems involving multiple states and mechanisms for coordination of independent agents' actions. This paper proposes a multistate searching algorithm with reinforcement learning for the automatic core design of a boiling water reactor. The characteristics of this algorithm are that the coupling structure and the coupling operation suitable for the assigned problem are assumed and an optimal solution is obtained by mutual interference in multistate transitions using multiagents. Calculations in an actual plant confirmed that the proposed algorithm increased the convergence ability of the optimization process

  5. Ice Sheets & Ice Cores

    DEFF Research Database (Denmark)

    Mikkelsen, Troels Bøgeholm

    Since the discovery of the Ice Ages it has been evident that Earth’s climate is liable to undergo dramatic changes. The previous climatic period known as the Last Glacial saw large oscillations in the extent of ice sheets covering the Northern hemisphere. Understanding these oscillations known....... The first part concerns time series analysis of ice core data obtained from the Greenland Ice Sheet. We analyze parts of the time series where DO-events occur using the so-called transfer operator and compare the results with time series from a simple model capable of switching by either undergoing...

  6. Nuclear reactor core assembly

    International Nuclear Information System (INIS)

    Baxi, C.B.

    1978-01-01

    The object of the present invention is to provide a fast reactor core assembly design for use with a fluid coolant such as liquid sodium or carbon monoxide incorporating a method of increasing the percentage of coolant flow though the blanket elements relative to the total coolant flow through the blanket and fuel elements during shutdown conditions without using moving parts. It is claimed that deterioration due to reactor radiation or temperature conditions is avoided and ready modification or replacement is possible. (U.K.)

  7. Reload core safety verification

    International Nuclear Information System (INIS)

    Svetlik, M.; Minarcin, M.

    2003-01-01

    This paper presents a brief look at the process of reload core safety evaluation and verification in Slovak Republic. It gives an overview of experimental verification of selected nuclear parameters in the course of physics testing during reactor start-up. The comparison of IAEA recommendations and testing procedures at Slovak and European nuclear power plants of similar design is included. An introduction of two level criteria for evaluation of tests represents an effort to formulate the relation between safety evaluation and measured values (Authors)

  8. RB reactor benchmark cores

    International Nuclear Information System (INIS)

    Pesic, M.

    1998-01-01

    A selected set of the RB reactor benchmark cores is presented in this paper. The first results of validation of the well-known Monte Carlo MCNP TM code and adjoining neutron cross section libraries are given. They confirm the idea for the proposal of the new U-D 2 O criticality benchmark system and support the intention to include this system in the next edition of the recent OECD/NEA Project: International Handbook of Evaluated Criticality Safety Experiment, in near future. (author)

  9. Modelling guidelines for core exit temperature simulations with system codes

    Energy Technology Data Exchange (ETDEWEB)

    Freixa, J., E-mail: jordi.freixa-terradas@upc.edu [Department of Physics and Nuclear Engineering, Technical University of Catalonia (UPC) (Spain); Paul Scherrer Institut (PSI), 5232 Villigen (Switzerland); Martínez-Quiroga, V., E-mail: victor.martinez@nortuen.com [Department of Physics and Nuclear Engineering, Technical University of Catalonia (UPC) (Spain); Zerkak, O., E-mail: omar.zerkak@psi.ch [Paul Scherrer Institut (PSI), 5232 Villigen (Switzerland); Reventós, F., E-mail: francesc.reventos@upc.edu [Department of Physics and Nuclear Engineering, Technical University of Catalonia (UPC) (Spain)

    2015-05-15

    Highlights: • Core exit temperature is used in PWRs as an indication of core heat up. • Modelling guidelines of CET response with system codes. • Modelling of heat transfer processes in the core and UP regions. - Abstract: Core exit temperature (CET) measurements play an important role in the sequence of actions under accidental conditions in pressurized water reactors (PWR). Given the difficulties in placing measurements in the core region, CET readings are used as criterion for the initiation of accident management (AM) procedures because they can indicate a core heat up scenario. However, the CET responses have some limitation in detecting inadequate core cooling and core uncovery simply because the measurement is not placed inside the core. Therefore, it is of main importance in the field of nuclear safety for PWR power plants to assess the capabilities of system codes for simulating the relation between the CET and the peak cladding temperature (PCT). The work presented in this paper intends to address this open question by making use of experimental work at integral test facilities (ITF) where experiments related to the evolution of the CET and the PCT during transient conditions have been carried out. In particular, simulations of two experiments performed at the ROSA/LSTF and PKL facilities are presented. The two experiments are part of a counterpart exercise between the OECD/NEA ROSA-2 and OECD/NEA PKL-2 projects. The simulations are used to derive guidelines in how to correctly reproduce the CET response during a core heat up scenario. Three aspects have been identified to be of main importance: (1) the need for a 3-dimensional representation of the core and Upper Plenum (UP) regions in order to model the heterogeneity of the power zones and axial areas, (2) the detailed representation of the active and passive heat structures, and (3) the use of simulated thermocouples instead of steam temperatures to represent the CET readings.

  10. How cores grow by pebble accretion. I. Direct core growth

    Science.gov (United States)

    Brouwers, M. G.; Vazan, A.; Ormel, C. W.

    2018-03-01

    Context. Planet formation by pebble accretion is an alternative to planetesimal-driven core accretion. In this scenario, planets grow by the accretion of cm- to m-sized pebbles instead of km-sized planetesimals. One of the main differences with planetesimal-driven core accretion is the increased thermal ablation experienced by pebbles. This can provide early enrichment to the planet's envelope, which influences its subsequent evolution and changes the process of core growth. Aims: We aim to predict core masses and envelope compositions of planets that form by pebble accretion and compare mass deposition of pebbles to planetesimals. Specifically, we calculate the core mass where pebbles completely evaporate and are absorbed before reaching the core, which signifies the end of direct core growth. Methods: We model the early growth of a protoplanet by calculating the structure of its envelope, taking into account the fate of impacting pebbles or planetesimals. The region where high-Z material can exist in vapor form is determined by the temperature-dependent vapor pressure. We include enrichment effects by locally modifying the mean molecular weight of the envelope. Results: In the pebble case, three phases of core growth can be identified. In the first phase (Mcore mixes outwards, slowing core growth. In the third phase (Mcore > 0.5M⊕), the high-Z inner region expands outwards, absorbing an increasing fraction of the ablated material as vapor. Rainout ends before the core mass reaches 0.6 M⊕, terminating direct core growth. In the case of icy H2O pebbles, this happens before 0.1 M⊕. Conclusions: Our results indicate that pebble accretion can directly form rocky cores up to only 0.6 M⊕, and is unable to form similarly sized icy cores. Subsequent core growth can proceed indirectly when the planet cools, provided it is able to retain its high-Z material.

  11. Composing a Tumor Specific Bacterial Promoter.

    Directory of Open Access Journals (Sweden)

    Igor V Deyneko

    Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

  12. Shakespeare and the Common Core: An Opportunity to Reboot

    Science.gov (United States)

    Turchi, Laura; Thompson, Ayanna

    2013-01-01

    The Common Core generally eschews mandating texts in favor of promoting critical analysis and rigor. So it's significant that Shakespeare is the only author invoked in imperatives. His explicit inclusion offers a significant opportunity for educators to rethink how we approach Shakespearean instruction. Rather than the traditional learning of…

  13. Monitoring an electric cable core

    International Nuclear Information System (INIS)

    Bhattacharya, S.; Marris, A.

    1984-01-01

    A method of, and apparatus for, continuously monitoring an advancing core having a continuous covering comprises directing X-ray radiation laterally towards the advancing covered core; continuously forming an X-ray image pattern of the advancing covered core and translating the image pattern into a visible image pattern; continuously transforming the visible pattern into a digital bit pattern; and processing the digital bit pattern using a microprocessor with interfacing electronics to provide an image profile of the advancing covered core and/or to provide analogue and/or digital signals indicative of the overall diameter and eccentricity of the covered core and of the thickness of the covering. (author)

  14. Winning Cores in Parity Games

    DEFF Research Database (Denmark)

    Vester, Steen

    2016-01-01

    We introduce the novel notion of winning cores in parity games and develop a deterministic polynomial-time under-approximation algorithm for solving parity games based on winning core approximation. Underlying this algorithm are a number properties about winning cores which are interesting...... in their own right. In particular, we show that the winning core and the winning region for a player in a parity game are equivalently empty. Moreover, the winning core contains all fatal attractors but is not necessarily a dominion itself. Experimental results are very positive both with respect to quality...

  15. Initial charge reactor core

    International Nuclear Information System (INIS)

    Kiyono, Takeshi

    1984-01-01

    Purpose: To effectivity burn fuels and improve the economical performance in an inital charge reactor core of BWR type reactors or the likes. Constitution: In a reactor core constituted with a plurality of fuel assemblies which are to be partially replaced upon fuel replacement, the density of the fissionable materials and the moderator - fuel ratio of a fuel assembly is set corresponding to the period till that fuel assembly is replaced, in which the density of the nuclear fissionable materials is lowered and the moderator - fuel ratio is increased for the fuel assembly with a shorter period from the fueling to the fuel exchange and, while on the other hand, the density of the fissionable materials is increased and the moderator - fuel ratio is decreased for the fuel assembly with a longer period from the fueling to the replacement. Accordingly, since the moderator - fuel ratio is increased for the fuel assembly to be replaced in a shorter period, the neutrons moderating effect is increased to increase the reactivity. (Horiuchi, T.)

  16. Statistical core design

    International Nuclear Information System (INIS)

    Oelkers, E.; Heller, A.S.; Farnsworth, D.A.; Kearfott, K.J.

    1978-01-01

    The report describes the statistical analysis of DNBR thermal-hydraulic margin of a 3800 MWt, 205-FA core under design overpower conditions. The analysis used LYNX-generated data at predetermined values of the input variables whose uncertainties were to be statistically combined. LYNX data were used to construct an efficient response surface model in the region of interest; the statistical analysis was accomplished through the evaluation of core reliability; utilizing propagation of the uncertainty distributions of the inputs. The response surface model was implemented in both the analytical error propagation and Monte Carlo Techniques. The basic structural units relating to the acceptance criteria are fuel pins. Therefore, the statistical population of pins with minimum DNBR values smaller than specified values is determined. The specified values are designated relative to the most probable and maximum design DNBR values on the power limiting pin used in present design analysis, so that gains over the present design criteria could be assessed for specified probabilistic acceptance criteria. The results are equivalent to gains ranging from 1.2 to 4.8 percent of rated power dependent on the acceptance criterion. The corresponding acceptance criteria range from 95 percent confidence that no pin will be in DNB to 99.9 percent of the pins, which are expected to avoid DNB

  17. Nuclear reactor core

    International Nuclear Information System (INIS)

    Koyama, Jun-ichi; Aoyama, Motoo; Ishibashi, Yoko; Mochida, Takaaki; Haikawa, Katsumasa; Yamanaka, Akihiro.

    1995-01-01

    A reactor core is radially divided into an inner region, an outer region and an outermost region. As a fuel, three kinds of fuels, namely, a high enrichment degree fuel at 3.4%, a middle enrichment degree fuel at 2.3% and a low enrichment degree at 1.1% of a fuel average enrichment degree of fission product are used. Each of the fuels is bisected to upper and lower portions at an axial center thereof. The difference of average enrichment degrees between upper and lower portions is 0.1% for the high enrichment degree fuel, 0.3% for the middle enrichment degree fuel and 0.2% for the low enrichment degree fuel. In addition, the composition of fuels in each of radial regions comprises 100% of the low enrichment degree fuels in the outermost region, 91% of the higher enrichment degree fuels and 9% of the middle enrichment degree fuels in the outer region, and 34% of the high enrichment degree fuels and 30% of the middle enrichment degree fuels in the inner region. With such a constitution, fuel economy can be improved while maintaining the thermal margin in an initially loaded reactor core of a BWR type reactor. (I.N.)

  18. Models of the earth's core

    Science.gov (United States)

    Stevenson, D. J.

    1981-01-01

    Combined inferences from seismology, high-pressure experiment and theory, geomagnetism, fluid dynamics, and current views of terrestrial planetary evolution lead to models of the earth's core with five basic properties. These are that core formation was contemporaneous with earth accretion; the core is not in chemical equilibrium with the mantle; the outer core is a fluid iron alloy containing significant quantities of lighter elements and is probably almost adiabatic and compositionally uniform; the more iron-rich inner solid core is a consequence of partial freezing of the outer core, and the energy release from this process sustains the earth's magnetic field; and the thermodynamic properties of the core are well constrained by the application of liquid-state theory to seismic and labroatory data.

  19. Status of the TMI-2 core: a review of damage assessments

    International Nuclear Information System (INIS)

    Croucher, D.W.

    1981-01-01

    Assessments of the damage within the core of the Three Mile Island Unit 2 reactor, performed by reconstructing the transient thermal-hydraulic sequence of events, estimating the amount of hydrogen generation, and evaluating the amount of fission products released, are reviewed and summarized. Minimum and maximum bounds of damage to the core are identified

  20. Core Knowledge and Standards: A Conversation with E.D. Hirsch, Jr.

    Science.gov (United States)

    O'Neil, John

    1999-01-01

    Hirsch believes it is vitally important to specify the "core knowledge" that all students must learn. Here, Hirsch explains elements of his K-8 core-knowledge sequence. Teachers should avoid canned lessons but should know where they are going. New English standards are unacceptable, since they omit Shakespeare's works. (MLH)

  1. Core design methodology and software for Temelin NPP

    International Nuclear Information System (INIS)

    Havluj, F; Hejzlar, J.; Klouzal, J.; Stary, V.; Vocka, R.

    2011-01-01

    In the frame of the process of fuel vendor change at Temelin NPP in the Czech Republic, where, starting since 2010, TVEL TVSA-T fuel is loaded instead of Westinghouse VVANTAGE-6 fuel, new methodologies for core design and core reload safety evaluation have been developed. These documents are based on the methodologies delivered by TVEL within the fuel contract, and they were further adapted according to Temelin NPP operational needs and according to the current practice at NPP. Along with the methodology development the 3D core analysis code ANDREA, licensed for core reload safety evaluation in 2010, have been upgraded in order to optimize the safety evaluation process. New sequences of calculations were implemented in order to simplify the evaluation of different limiting parameters and output visualization tools were developed to make the verification process user friendly. Interfaces to the fuel performance code TRANSURANUS and sub-channel analysis code SUBCAL were developed as well. (authors)

  2. COMSORS: A light water reactor chemical core catcher

    International Nuclear Information System (INIS)

    Forsberg, C.W.; Parker, G.W.; Rudolph, J.C.; Osborne-Lee, I.W.

    1997-01-01

    The Core-Melt Source Reduction System (COMSORS) is a new approach to terminate lightwater reactor (LWR) core-melt accidents and ensure containment integrity. A special dissolution glass made of lead oxide (PbO) and boron oxide (B 2 O 3 ) is placed under the reactor vessel. If molten core debris is released onto the glass, the following sequence happens: (1) the glass absorbs decay heat as its temperature increases and the glass softens; (2) the core debris dissolves into the molten glass; (3) molten glass convective currents create a homogeneous high-level waste (HLW) glass; (4) the molten glass spreads into a wider pool, distributing the heat for removal by radiation to the reactor cavity above or transfer to water on top of the molten glass; and (5) the glass solidifies as increased surface cooling area and decreasing radioactive decay heat generation allows heat removal to exceed heat generation

  3. Amyloid cores in prion domains: Key regulators for prion conformational conversion.

    Science.gov (United States)

    Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador

    2017-01-02

    Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.

  4. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  5. Waves in the core and mechanical core-mantle interactions

    DEFF Research Database (Denmark)

    Jault, D.; Finlay, Chris

    2015-01-01

    This Chapter focuses on time-dependent uid motions in the core interior, which can beconstrained by observations of the Earth's magnetic eld, on timescales which are shortcompared to the magnetic diusion time. This dynamics is strongly inuenced by the Earth's rapid rotation, which rigidies...... the motions in the direction parallel to the Earth'srotation axis. This property accounts for the signicance of the core-mantle topography.In addition, the stiening of the uid in the direction parallel to the rotation axis gives riseto a magnetic diusion layer attached to the core-mantle boundary, which would...... otherwisebe dispersed by Alfven waves. This Chapter complements the descriptions of large-scaleow in the core (8.04), of turbulence in the core (8.06) and of core-mantle interactions(8.12), which can all be found in this volume. We rely on basic magnetohydrodynamictheory, including the derivation...

  6. Core cooling systems

    International Nuclear Information System (INIS)

    Hoeppner, G.

    1980-01-01

    The reactor cooling system transports the heat liberated in the reactor core to the component - heat exchanger, steam generator or turbine - where the energy is removed. This basic task can be performed with a variety of coolants circulating in appropriately designed cooling systems. The choice of any one system is governed by principles of economics and natural policies, the design is determined by the laws of nuclear physics, thermal-hydraulics and by the requirement of reliability and public safety. PWR- and BWR- reactors today generate the bulk of nuclear energy. Their primary cooling systems are discussed under the following aspects: 1. General design, nuclear physics constraints, energy transfer, hydraulics, thermodynamics. 2. Design and performance under conditions of steady state and mild transients; control systems. 3. Design and performance under conditions of severe transients and loss of coolant accidents; safety systems. (orig./RW)

  7. The true 'core' splitting

    International Nuclear Information System (INIS)

    Hallerbach, J.

    1978-01-01

    Massive unemployment and the fear of a barred future put at present the unions and civil initiative to the apparent alternatives; securing work places or securing life and future. How the 'atomic fight' is fought and its result can have considerable consequences for our society. This volume presents a dialogue: Firstly the situation and environment must be understood giving rise to the controversial arguments. Reports, analyses and interviews are presented on this as basic structure for the future discussion. The quality and direction of the technical progress are dealt with in the core of the discussion. Is atomic technology acceptable. Who should decide and whom does it serve. What is progress going to look like anyway. (orig.) [de

  8. Emergency core cooling systems

    International Nuclear Information System (INIS)

    Kubokoya, Takashi; Okataku, Yasukuni.

    1984-01-01

    Purpose: To maintain the fuel soundness upon loss of primary coolant accidents in a pressure tube type nuclear reactor by injecting cooling heavy water at an early stage, to suppress the temperature of fuel cans at a lower level. Constitution: When a thermometer detects the temperature rise and a pressure gauge detects that the pressure for the primary coolants is reduced slightly from that in the normal operation upon loss of coolant accidents in the vicinity of the primary coolant circuit, heavy water is caused to flow in the heavy water feed pipeway by a controller. This enables to inject the heavy water into the reactor core in a short time upon loss of the primary coolant accidents to suppress the temperature rise in the fuel can thereby maintain the fuel soundness. (Moriyama, K.)

  9. The core and cosmopolitans

    DEFF Research Database (Denmark)

    Dahlander, Linus; Frederiksen, Lars

    2012-01-01

    Users often interact and help each other solve problems in communities, but few scholars have explored how these relationships provide opportunities to innovate. We analyze the extent to which people positioned within the core of a community as well as people that are cosmopolitans positioned...... across multiple external communities affect innovation. Using a multimethod approach, including a survey, a complete database of interactions in an online community, content coding of interactions and contributions, and 36 interviews, we specify the types of positions that have the strongest effect...... on innovation. Our study shows that dispositional explanations for user innovation should be complemented by a relational view that emphasizes how these communities differ from other organizations, the types of behaviors this enables, and the effects on innovation....

  10. Adult educators' core competences

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2016-01-01

    ” requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students’ prior learning into account; (3) supporting a learning environment; and (4) the adult educator’s reflection on his or her own performance. At the end of his analysis of different competence......Abstract Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators’ required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural...... environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or “core...

  11. CORE annual report 2006

    International Nuclear Information System (INIS)

    Gut, A.

    2007-04-01

    This annual report for the Swiss Federal Office of Energy (SFOE) summarises the activities of the Swiss Federal Commission on Energy Research CORE in 2006. The six main areas of work during the period 2004 - 2007 are examined, including a review of the SFOE's energy research programme, a road-map for the way towards the realisation of a 2000-watt society, the formulation of an energy research concept for 2008 - 2011, international co-operation, the dissemination of information and the assessment of existing and new instruments. International activities and Switzerland's involvement in energy research within the framework of the International Energy Agency IEA are discussed. New and existing projects are listed and the work done at the Competence Centre for Energy and Mobility noted. The Swiss Technology Award 2007 is presented. Information supplied to interested bodies to help improve knowledge on research work being done and to help make discussions on future energy supply more objective is discussed

  12. Nuclear reactor core

    Energy Technology Data Exchange (ETDEWEB)

    Prescott, R F

    1974-07-11

    The core of the fast neutron reactor consisting, among other components, of fuel elements enriched in plutonium is divided into modules. Each module contains a bundle of four or six elongated components (fuel elements and control rods). In the arrangement with four components, one is kept rigid while the other three are elastically yielding inclined towards the center and lean against the rigid component. In the modules with six pieces, each component is elastically yielding inclined towards a central cavity. In this way, they form a circular arc. A control rod may be placed in the cavity. In order to counteract a relative lateral movement, the outer surfaces of the components which have hexagonal cross-sections have interlocking bearing cushions. The bearing cushions consist of keyway-type ribs or grooves with the wedges or ribs gripping in the grooves of the neighbouring components. In addition, the ribs have oblique entering surfaces.

  13. Understanding core conductor fabrics

    International Nuclear Information System (INIS)

    Swenson, D E

    2011-01-01

    ESD Association standard test method ANSI/ESD STM2.1 - Garments (STM2.1), provides electrical resistance test procedures that are applicable for materials and garments that have surface conductive or surface dissipative properties. As has been reported in other papers over the past several years 1 fabrics are now used in many industries for electrostatic control purposes that do not have surface conductive properties and therefore cannot be evaluated using the procedures in STM2.1 2 . A study was conducted to compare surface conductive fabrics with samples of core conductor fibre based fabrics in order to determine differences and similarities with regards to various electrostatic properties. This work will be used to establish a new work item proposal within WG-2, Garments, in the ESD Association Standards Committee in the USA.

  14. Um mundo de cores

    Directory of Open Access Journals (Sweden)

    Elis Artz

    2016-08-01

    Full Text Available A pintura de Elis Artz é feita com muita alma e transborda alegria. A vitalidade de seu trabalho transparece nas cores fortes e nos traços simples e harmoniosos. Confira o trabalho da artista nesta edição da Revista Jangada. ELIS by ELIS Descobri meu talento artístisco e criativo há uns 25 anos. Nasci no Brasil e me mudei para os EUA 10 anos atrás por puro amor. Embora seja psicóloga de formação, o meu apreço pela pintura só cresceu e, com o passar dos anos, a paixão pelas tintas me direcionou a fazer cursos com artistas brasileiros renomados. Já morando nos EUA e com essa grande paixão adormecida, durante anos, decidi me entregar para as cores que sempre me trouxeram alegria e cor para os meus dias. Embora muitas de minhas pinturas tenham ido para minha família e amigos no Brasil, vendi inúmeras outras pelo país através de exposições em galerias de arte. Em 2014, fui uma das artistas em destaque no MTD ART nos Estados Unidos. Minha obra estava dentro de cada ônibus das cidades de Champaign e Urbana e exposta em destaque na Estação de Trem. Em maio de 2015, tive o prazer de ter outro trabalho meu nos outdoors da cidade, destacando a minha tela 'Frida' o ano inteiro e de expor em conjunto com alguns artistas locais no final de outubro. Desde então, tenho pintado cada vez mais e me interessado em divulgar o meu trabalho. E, como diria um amigo meu "Elis, você me mostrou que a vida não é só preto no branco". Ele estava certo.

  15. Growth outside the core.

    Science.gov (United States)

    Zook, Chris; Allen, James

    2003-12-01

    Growth in an adjacent market is tougher than it looks; three-quarters of the time, the effort fails. But companies can change those odds dramatically. Results from a five-year study of corporate growth conducted by Bain & Company reveal that adjacency expansion succeeds only when built around strong core businesses that have the potential to become market leaders. And the best place to look for adjacency opportunities is inside a company's strongest customers. The study also found that the most successful companies were able to consistently, profitably outgrow their rivals by developing a formula for pushing out the boundaries of their core businesses in predictable, repeatable ways. Companies use their repeatability formulas to expand into any number of adjacencies. Some companies make repeated geographic moves, as Vodafone has done in expanding from one geographic market to another over the past 13 years, building revenues from $1 billion in 1990 to $48 billion in 2003. Others apply a superior business model to new segments. Dell, for example, has repeatedly adapted its direct-to-customer model to new customer segments and new product categories. In other cases, companies develop hybrid approaches. Nike executed a series of different types of adjacency moves: it expanded into adjacent customer segments, introduced new products, developed new distribution channels, and then moved into adjacent geographic markets. The successful repeaters in the study had two common characteristics. First, they were extraordinarily disciplined, applying rigorous screens before they made an adjacency move. This discipline paid off in the form of learning curve benefits, increased speed, and lower complexity. And second, in almost all cases, they developed their repeatable formulas by studying their customers and their customers' economics very, very carefully.

  16. Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

    Directory of Open Access Journals (Sweden)

    van Straalen Nico M

    2007-06-01

    Full Text Available Abstract Background Metallothionein (mt transcription is elevated in heavy metal tolerant field populations of Orchesella cincta (Collembola. This suggests that natural selection acts on transcriptional regulation of mt in springtails at sites where cadmium (Cd levels in soil reach toxic values This study investigates the nature and the evolutionary origin of polymorphisms in the metallothionein promoter (pmt and their functional significance for mt expression. Results We sequenced approximately 1600 bp upstream the mt coding region by genome walking. Nine pmt alleles were discovered in NW-European populations. They differ in the number of some indels, consensus transcription factor binding sites and core promoter elements. Extensive recombination events between some of the alleles can be inferred from the alignment. A deviation from neutral expectations was detected in a cadmium tolerant population, pointing towards balancing selection on some promoter stretches. Luciferase constructs were made from the most abundant alleles, and responses to Cd, paraquat (oxidative stress inducer and moulting hormone were studied in cell lines. By using paraquat we were able to dissect the effect of oxidative stress from the Cd specific effect, and extensive differences in mt induction levels between these two stressors were observed. Conclusion The pmt alleles evolved by a number of recombination events, and exhibited differential inducibilities by Cd, paraquat and molting hormone. In a tolerant population from a metal contaminated site, promoter allele frequencies differed significantly from a reference site and nucleotide polymorphisms in some promoter stretches deviated from neutral expectations, revealing a signature of balancing selection. Our results suggest that the structural differences in the Orchesella cincta metallothionein promoter alleles contribute to the metallothionein -over-expresser phenotype in cadmium tolerant populations.

  17. Core catcher for nuclear reactor core meltdown containment

    International Nuclear Information System (INIS)

    Driscoll, M.J.; Bowman, F.L.

    1978-01-01

    A bed of graphite particles is placed beneath a nuclear reactor core outside the pressure vessel but within the containment building to catch the core debris in the event of failure of the emergency core cooling system. Spray cooling of the debris and graphite particles together with draining and flooding of coolant fluid of the graphite bed is provided to prevent debris slump-through to the bottom of the bed

  18. YOUNG STARLESS CORES EMBEDDED IN THE MAGNETICALLY DOMINATED PIPE NEBULA

    International Nuclear Information System (INIS)

    Frau, P.; Girart, J. M.; Alves, F. O.; Beltran, M. T.; Morata, O.; Masque, J. M.; Busquet, G.; Sanchez-Monge, A.; Estalella, R.; Franco, G. A. P.

    2010-01-01

    The Pipe Nebula is a massive, nearby dark molecular cloud with a low star formation efficiency which makes it a good laboratory in which to study the very early stages of the star formation process. The Pipe Nebula is largely filamentary and appears to be threaded by a uniform magnetic field at scales of a few parsecs, perpendicular to its main axis. The field is only locally perturbed in a few regions, such as the only active cluster-forming core B59. The aim of this study is to investigate primordial conditions in low-mass pre-stellar cores and how they relate to the local magnetic field in the cloud. We used the IRAM 30 m telescope to carry out a continuum and molecular survey at 3 and 1 mm of early- and late-time molecules toward four selected starless cores inside the Pipe Nebula. We found that the dust continuum emission maps trace the densest regions better than previous Two Micron All Sky Survey (2MASS) extinction maps, while 2MASS extinction maps trace the diffuse gas better. The properties of the cores derived from dust emission show average radii of ∼0.09 pc, densities of ∼1.3x10 5 cm -3 , and core masses of ∼2.5 M sun . Our results confirm that the Pipe Nebula starless cores studied are in a very early evolutionary stage and present a very young chemistry with different properties that allow us to propose an evolutionary sequence. All of the cores present early-time molecular emission with CS detections in the whole sample. Two of them, cores 40 and 109, present strong late-time molecular emission. There seems to be a correlation between the chemical evolutionary stage of the cores and the local magnetic properties that suggests that the evolution of the cores is ruled by a local competition between the magnetic energy and other mechanisms, such as turbulence.

  19. Migration: a core public health ethics issue.

    Science.gov (United States)

    Wild, V; Dawson, A

    2018-05-01

    In this article, we outline the link between migration, public health and ethics. Discussing relevant arguments about migration from the perspective of public health and public health ethics. Critical review of theories and frameworks, case-based analysis and systematic identification and discussion of challenges. Migration is a core issue of public health ethics and must take a case-based approach: seeking to identify the specific ethical dimensions and vulnerabilities in each particular context. Public health as a practice, built upon the core value of justice, requires the protection and promotion of migrants' well-being (even if this produces tension with immigration services). Ethical analysis should take all phases of migration into account: before, during and after transit. We argue that migration policies, at least as they relate to migrants' well-being, should be founded upon a shared humanity, respect for human rights and on the idea that effective public health cannot and should not be confined within the borders and to the citizens of any host country. We make the case for migration to be seen as a core issue of public health ethics. Copyright © 2018 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  20. Reactor core for FBR type reactor

    International Nuclear Information System (INIS)

    Fujita, Tomoko; Watanabe, Hisao; Kasai, Shigeo; Yokoyama, Tsugio; Matsumoto, Hiroshi.

    1996-01-01

    In a gas-sealed assembly for a FBR type reactor, two or more kinds of assemblies having different eigen frequency and a structure for suppressing oscillation of liquid surface are disposed in a reactor core. Coolant introduction channels for introducing coolants from inside and outside are disposed in the inside of structural members of an upper shielding member to form a shielding member-cooling structure in the reactor core. A structure for promoting heat conduction between a sealed gas in the assembly and coolants at the inner side or the outside of the assembly is disposed in the reactor core. A material which generates heat by neutron irradiation is disposed in the assembly to heat the sealed gases positively by radiation heat from the heat generation member also upon occurrence of power elevation-type event to cause temperature expansion. Namely, the coolants flown out from or into the gas sealed-assemblies cause differential fluctuation on the liquid surface, and the change of the capacity of a gas region is also different on every gas-sealed assemblies thereby enabling to suppress fluctuation of the reactor power. Pressure loss is increased by a baffle plate or the like to lower the liquid surface of the sodium coolants or decrease the elevating speed thereof thereby suppressing fluctuation of the reactor power. (N.H.)

  1. Estimation and Control for Autonomous Coring from a Rover Manipulator

    Science.gov (United States)

    Hudson, Nicolas; Backes, Paul; DiCicco, Matt; Bajracharya, Max

    2010-01-01

    A system consisting of a set of estimators and autonomous behaviors has been developed which allows robust coring from a low-mass rover platform, while accommodating for moderate rover slip. A redundant set of sensors, including a force-torque sensor, visual odometry, and accelerometers are used to monitor discrete critical and operational modes, as well as to estimate continuous drill parameters during the coring process. A set of critical failure modes pertinent to shallow coring from a mobile platform is defined, and autonomous behaviors associated with each critical mode are used to maintain nominal coring conditions. Autonomous shallow coring is demonstrated from a low-mass rover using a rotary-percussive coring tool mounted on a 5 degree-of-freedom (DOF) arm. A new architecture of using an arm-stabilized, rotary percussive tool with the robotic arm used to provide the drill z-axis linear feed is validated. Particular attention to hole start using this architecture is addressed. An end-to-end coring sequence is demonstrated, where the rover autonomously detects and then recovers from a series of slip events that exceeded 9 cm total displacement.

  2. Sequences for Student Investigation

    Science.gov (United States)

    Barton, Jeffrey; Feil, David; Lartigue, David; Mullins, Bernadette

    2004-01-01

    We describe two classes of sequences that give rise to accessible problems for undergraduate research. These problems may be understood with virtually no prerequisites and are well suited for computer-aided investigation. The first sequence is a variation of one introduced by Stephen Wolfram in connection with his study of cellular automata. The…

  3. Analysis of core damage frequency: Surry, Unit 1 internal events

    International Nuclear Information System (INIS)

    Bertucio, R.C.; Julius, J.A.; Cramond, W.R.

    1990-04-01

    This document contains the accident sequence analysis of internally initiated events for the Surry Nuclear Station, Unit 1. This is one of the five plant analyses conducted as part of the NUREG-1150 effort by the Nuclear Regulatory Commission. NUREG-1150 documents the risk of a selected group of nuclear power plants. The work performed and described here is an extensive of that published in November 1986 as NUREG/CR-4450, Volume 3. It addresses comments form numerous reviewers and significant changes to the plant systems and procedures made since the first report. The uncertainty analysis and presentation of results are also much improved. The context and detail of this report are directed toward PRA practitioners who need to know how the work was performed and the details for use in further studies. The mean core damage frequency at Surry was calculated to be 4.05-E-5 per year, with a 95% upper bound of 1.34E-4 and 5% lower bound of 6.8E-6 per year. Station blackout type accidents (loss of all AC power) were the largest contributors to the core damage frequency, accounting for approximately 68% of the total. The next type of dominant contributors were Loss of Coolant Accidents (LOCAs). These sequences account for 15% of core damage frequency. No other type of sequence accounts for more than 10% of core damage frequency. 49 refs., 52 figs., 70 tabs

  4. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  5. Experiment on heat transfer in simulated molten core/concrete interaction

    International Nuclear Information System (INIS)

    Katsumura, Yukihiro; Hashizume, Hidetoshi; Toda, Saburo; Kawaguchi, Takahiro.

    1993-01-01

    In order to investigate heat transfer between molten core and concrete in LWR severe accidents, experiments were performed using water as the molten core, paraffin as the concrete, and air as gases from the decomposition of concrete. It was found that the heat transfer on the interface between paraffin and water were promoted strongly by the air gas. (author)

  6. Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

    Science.gov (United States)

    Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

    2016-11-15

    Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

  7. Association between Interleukin-18 promoter polymorphisms and ...

    African Journals Online (AJOL)

    Noha M. Bakr

    the study. Genotypic analysis of IL-18 promoter polymorphisms were performed using sequence- .... diabetes mellitus, heart disease, previous stroke, cigarette smok- ing. Included .... of the mutated AA genotype and A allele was observed in IS ..... factor for ischemic stroke in the Chinese population: a meta-analysis. Meta.

  8. AGR core safety assessment methodologies

    International Nuclear Information System (INIS)

    McLachlan, N.; Reed, J.; Metcalfe, M.P.

    1996-01-01

    To demonstrate the safety of its gas-cooled graphite-moderated AGR reactors, nuclear safety assessments of the cores are based upon a methodology which demonstrates no component failures, geometrical stability of the structure and material properties bounded by a database. All AGRs continue to meet these three criteria. However, predictions of future core behaviour indicate that the safety case methodology will eventually need to be modified to deal with new phenomena. A new approach to the safety assessment of the cores is currently under development, which can take account of these factors while at the same time providing the same level of protection for the cores. This approach will be based on the functionality of the core: unhindered movement of control rods, continued adequate cooling of the fuel and the core, continued ability to charge and discharge fuel. (author). 5 figs

  9. Overview of JSPS Core-to-Core Program: Forming Research and Educational Hubs of Medical Physics.

    Science.gov (United States)

    Koizumi, Masahiko; Takashina, Masaaki

    To foster medical physicists, we introduce the achievement we made since 2011 under the national research project of the Japan Society for the Promotion of Science (JSPS) Core-to-Core program; 'Forming Research and Educational Hubs of Medical Physics.' On this basis and under the JSPS program, we promoted research and educational exchange with Indiana University (IU) in USA, University of Groningen (The UG) in the Netherland and other cooperating institutions such as University of Minnesota (UM).A total of 23 students and researchers were sent. UG accepted the most among three institutions. In turn, 12 foreign researchers including post-doctor fellows came to Japan for academic seminars or educational lectures.Fifteen international seminars were held; 8 in Japan, 4 in USA, and 3 in the Netherland.Lots of achievement were made through these activities in 5 years. Total of 23 research topics at the international conferences were presented. Total of 12 articles were published in international journals.This program clearly promoted the establishment of international collaboration, and many young researchers and graduate students were exchanged and collaborated with foreign researchers.

  10. The seismic assessment of fast reactor cores in the UK

    International Nuclear Information System (INIS)

    Duthie, J.C.; Dostal, M.

    1988-01-01

    The design of the UK Commercial Demonstration Fast Reactor (CDFR) has evolved over a number of years. The design has to meet two seismic requirements: (i) the reactor must cause no hazard to the public during or after the Safe Shutdown Earthquake (SSE); (ii) there must be no sudden reduction in safety for an earthquake exceeding the SSE. The core is a complicated component in the whole reactor. It is usually represented in a very simplified manner in the seismic assessment of the whole reactor station. From this calculation, a time history or response spectrum can be generated for the diagrid, which supports the core, and for the above core structure, which supports the main absorber rods. These data may then be used to perform a detailed assessment of the reactor core. A new simplified model of the core response may then be made and used in a further calculation of the whole reactor. The calculation of the core response only, is considered in the remainder of this paper. One important feature of the fast reactor core, compared with other reactors, is that the components are relatively thin and flexible to promote neutron economy and heat transfer. A further important feature is that there are very small gaps between the wrapper tubes. This leads to very strong fluid-coupling effects. These effects are likely to be beneficial, but adequate techniques to calculate them are only just being developed. 9 refs, figs

  11. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

    2003-01-01

    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  12. Overview of core disruptive accidents

    International Nuclear Information System (INIS)

    Marchaterre, J.F.

    1977-01-01

    An overview of the analysis of core-disruptive accidents is given. These analyses are for the purpose of understanding and predicting fast reactor behavior in severe low probability accident conditions, to establish the consequences of such conditions and to provide a basis for evaluating consequence limiting design features. The methods are used to analyze core-disruptive accidents from initiating event to complete core disruption, the effects of the accident on reactor structures and the resulting radiological consequences are described

  13. Coupling between core and cladding modes in a helical core fiber with large core offset

    International Nuclear Information System (INIS)

    Napiorkowski, Maciej; Urbanczyk, Waclaw

    2016-01-01

    We analyzed the effect of resonant coupling between core and cladding modes in a helical core fiber with large core offset using the fully vectorial method based on the transformation optics formalism. Our study revealed that the resonant couplings to lower order cladding modes predicted by perturbative methods and observed experimentally in fibers with small core offsets are in fact prohibited for larger core offsets. This effect is related to the lack of phase matching caused by elongation of the optical path of the fundamental modes in the helical core. Moreover, strong couplings to the cladding modes of the azimuthal modal number much higher than predicted by perturbative methods may be observed for large core offsets, as the core offset introduces higher order angular harmonics in the field distribution of the fundamental modes. Finally, in contrast to previous studies, we demonstrate the existence of spectrally broad polarization sensitive couplings to the cladding modes suggesting that helical core fibers with large core offsets may be used as broadband circular polarizers. (paper)

  14. Models of the earth's core

    International Nuclear Information System (INIS)

    Stevenson, D.J.

    1981-01-01

    The combination of seismology, high pressure experiment and theory, geomagnetism, fluid dynamics, and current views of terrestrial planetary evolution lead to strong constraints on core models. The synthesis presented here is devoted to the defense of the following properties: (1) core formation was contemporaneous with earth accretion; (2) the outer, liquid core is predominately iron but cannot be purely iron; (3) the inner core-outer core boundary represents a thermodynamic equilibrium between a liquid alloys and a predominanately iron solid; (4) thermodynamic and transport properties of outer core can be estimated from liquid-state theories; and (5) the outer core is probably adiabatic and uniform in composition. None of these propositions are universally accepted by geophysicists. But, the intent of this paper is to present a coherent picture which explains most of the data with the fewest ad hoc assumptions. Areas in which future progress is both essential and likely are geo- and cosmochronology, seismological determinations of core structure, fluid dynamics of the core and mantle, and condensed matter physics

  15. Wire core reactor for NTP

    International Nuclear Information System (INIS)

    Harty, R.B.

    1991-01-01

    The development of the wire core system for Nuclear Thermal Propulsion (NTP) that took place from 1963 to 1965 is discussed. A wire core consists of a fuel wire with spacer wires. It's an annular flow core having a central control rod. There are actually four of these, with beryllium solid reflectors on both ends and all the way around. Much of the information on the concept is given in viewgraph form. Viewgraphs are presented on design details of the wire core, the engine design, engine weight vs. thrust, a technique used to fabricate the wire fuel element, and axial temperature distribution

  16. Nuclear reactor with several cores

    International Nuclear Information System (INIS)

    Swars, H.

    1977-01-01

    Several sodium-cooled cores in separate vessels with removable closures are placed in a common reactor tank. Each individual vessel is protected against the consequences of an accident in the relevant core. Maintenance devices and inlet and outlet pipes for the coolant are also arranged within the reactor tank. The individual vessels are all enclosed by coolant in a way that in case of emergency cooling or refuelling each core can be continued to be cooled by means of the coolant loops of the other cores. (HP) [de

  17. Biochemistry Instrumentation Core Technology Center

    Data.gov (United States)

    Federal Laboratory Consortium — The UCLA-DOE Biochemistry Instrumentation Core Facility provides the UCLA biochemistry community with easy access to sophisticated instrumentation for a wide variety...

  18. Core barrel inner tube lifter

    Energy Technology Data Exchange (ETDEWEB)

    Jeffers, J P

    1968-07-16

    A core drill with means for selectively lifting a core barrel inner tube consists of a lifting means connected to the core barrel inner tube assembly. It has a closable passage to permit drilling fluid normally to pass through it. The lifting means has a normally downward facing surface and a means to direct drilling fluid pressure against that surface so that on closure of the passage to fluid flow, the pressure of the drilling fluid is caused to act selectively on it. This causes the lifting means to rise and lift the core barrel. (7 claims)

  19. TMI-2 core debris analysis

    International Nuclear Information System (INIS)

    Cook, B.A.; Carlson, E.R.

    1985-01-01

    One of the ongoing examination tasks for the damaged TMI-2 reactor is analysis of samples of debris obtained from the debris bed presently at the top of the core. This paper summarizes the results reported in the TMI-2 Core Debris Grab Sample Examination and Analysis Report, which will be available early in 1986. The sampling and analysis procedures are presented, and information is provided on the key results as they relate to the present core condition, peak temperatures during the transient, temperature history, chemical interactions, and core relocation. The results are then summarized

  20. Meltdown reactor core cooling facility

    International Nuclear Information System (INIS)

    Matsuoka, Tsuyoshi.

    1992-01-01

    The meltdown reactor core cooling facility comprises a meltdown reactor core cooling tank, a cooling water storage tank situates at a position higher than the meltdown reactor core cooling tank, an upper pipeline connecting the upper portions of the both of the tanks and a lower pipeline connecting the lower portions of them. Upon occurrence of reactor core meltdown, a high temperature meltdown reactor core is dropped on the cooling tank to partially melt the tank and form a hole, from which cooling water is flown out. Since the water source of the cooling water is the cooling water storage tank, a great amount of cooling water is further dropped and supplied and the reactor core is submerged and cooled by natural convection for a long period of time. Further, when the lump of the meltdown reactor core is small and the perforated hole of the meltdown reactor cooling tank is small, cooling water is boiled by the high temperature lump intruding into the meltdown reactor core cooling tank and blown out from the upper pipeline to the cooling water storage tank to supply cooling water from the lower pipeline to the meltdown reactor core cooling tank. Since it is constituted only with simple static facilities, the facility can be simplified to attain improvement of reliability. (N.H.)

  1. Fort St. Vrain core performance

    International Nuclear Information System (INIS)

    McEachern, D.W.; Brown, J.R.; Heller, R.A.; Franek, W.J.

    1977-07-01

    The Fort St. Vrain High Temperature Gas Cooled Reactor core performance has been evaluated during the startup testing phase of the reactor operation. The reactor is graphite moderated, helium cooled, and uses coated particle fuel and on-line flow control to each of the 37 refueling regions. Principal objectives of startup testing were to determine: core and control system reactivity, radial power distribution, flow control capability, and initial fission product release. Information from the core demonstrates that Technical Specifications are being met, performance of the core and fuel is as expected, flow and reactivity control are predictable and simple for the operator to carry out

  2. Sequence Classification: 893428 [

    Lifescience Database Archive (English)

    Full Text Available e subunit, involved in recruitment of RNA polymerase II to the promoter, activation of TFIIH, and promoter opening; Tfa1p || http://www.ncbi.nlm.nih.gov/protein/6322824 ... ...Non-TMB Non-TMH Non-TMB Non-TMB TMB Non-TMB >gi|6322824|ref|NP_012897.1| TFIIE larg

  3. Promoter Motifs in NCLDVs: An Evolutionary Perspective

    Science.gov (United States)

    Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

    2017-01-01

    For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

  4. Promoter Motifs in NCLDVs: An Evolutionary Perspective

    Directory of Open Access Journals (Sweden)

    Graziele Pereira Oliveira

    2017-01-01

    Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

  5. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  6. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito

    2007-09-01

    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  7. Characterizing the Core via K-Core Covers

    NARCIS (Netherlands)

    Sanchez, S.M.; Borm, P.E.M.; Estevez, A.

    2013-01-01

    This paper extends the notion of individual minimal rights for a transferable utility game (TU-game) to coalitional minimal rights using minimal balanced families of a specific type, thus defining a corresponding minimal rights game. It is shown that the core of a TU-game coincides with the core of

  8. Using Multi-Core Systems for Rover Autonomy

    Science.gov (United States)

    Clement, Brad; Estlin, Tara; Bornstein, Benjamin; Springer, Paul; Anderson, Robert C.

    2010-01-01

    Task Objectives are: (1) Develop and demonstrate key capabilities for rover long-range science operations using multi-core computing, (a) Adapt three rover technologies to execute on SOA multi-core processor (b) Illustrate performance improvements achieved (c) Demonstrate adapted capabilities with rover hardware, (2) Targeting three high-level autonomy technologies (a) Two for onboard data analysis (b) One for onboard command sequencing/planning, (3) Technologies identified as enabling for future missions, (4)Benefits will be measured along several metrics: (a) Execution time / Power requirements (b) Number of data products processed per unit time (c) Solution quality

  9. Adult educators' core competences

    Science.gov (United States)

    Wahlgren, Bjarne

    2016-06-01

    Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators' required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or "core" requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students' prior learning into account; (3) supporting a learning environment; and (4) the adult educator's reflection on his or her own performance. At the end of his analysis of different competence profiles, the author notes that adult educators' ability to train adult learners in a way which then enables them to apply and use what they have learned in practice (thus performing knowledge transfer) still seems to be overlooked.

  10. Emergency core cooling system

    International Nuclear Information System (INIS)

    Arai, Kenji; Oikawa, Hirohide.

    1990-01-01

    The device according to this invention can ensure cooling water required for emerency core cooling upon emergence such as abnormally, for example, loss of coolant accident, without using dynamic equipments such as a centrifugal pump or large-scaled tank. The device comprises a pressure accumulation tank containing a high pressure nitrogen gas and cooling water inside, a condensate storage tank, a pressure suppression pool and a jet stream pump. In this device there are disposed a pipeline for guiding cooling water in the pressure accumulation tank as a jetting water to a jetting stream pump, a pipeline for guiding cooling water stored in the condensate storage tank and the pressure suppression pool as pumped water to the jetting pump and, further, a pipeline for guiding the discharged water from the jet stream pump which is a mixed stream of pumped water and jetting water into the reactor pressure vessel. In this constitution, a sufficient amount of water ranging from relatively high pressure to low pressure can be supplied into the reactor pressure vessel, without increasing the size of the pressure accumulation tank. (I.S.)

  11. Emergency core cooling system

    International Nuclear Information System (INIS)

    Sato, Akira; Kobayashi, Masahide.

    1983-01-01

    Purpose: To enable a stable operation of an emergency core cooling system by preventing the system from the automatic stopping at an abnormally high level of the reactor water during its operation. Constitution: A pump flow rate signal and a reactor water level signal are used and, when the reactor water level is increased to a predetermined level, the pump flow rate is controlled by the reactor water level signal instead of the flow rate signal. Specifically, when the reactor water level is gradually increased by the water injection from the pump and exceeds a setting signal for the water level, the water level deviation signal acts as a demand signal for the decrease in the flow rate of the pump and the output signal from the water level controller is also decreased depending on the control constant. At a certain point, the output signal from the water level controller becomes smaller than the output signal from the flow rate controller. Thus, the output signal from the water level controller is outputted as the output signal for the lower level preference device. In this way, the reactor water level and the pump flow rate can be controlled within a range not exceeding the predetermined pump flow rate. (Horiuchi, T.)

  12. Emergency core cooling system

    International Nuclear Information System (INIS)

    Abe, Nobuaki.

    1993-01-01

    A reactor comprises a static emergency reactor core cooling system having an automatic depressurization system and a gravitationally dropping type water injection system and a container cooling system by an isolation condenser. A depressurization pipeline of the automatic depressurization system connected to a reactor pressure vessel branches in the midway. The branched depressurizing pipelines are extended into an upper dry well and a lower dry well, in which depressurization valves are disposed at the top end portions of the pipelines respectively. If loss-of-coolant accidents should occur, the depressurization valve of the automatic depressurization system is actuated by lowering of water level in the pressure vessel. This causes nitrogen gases in the upper and the lower dry wells to transfer together with discharged steams effectively to a suppression pool passing through a bent tube. Accordingly, the gravitationally dropping type water injection system can be actuated faster. Further, subsequent cooling for the reactor vessel can be ensured sufficiently by the isolation condenser. (I.N.)

  13. Necrosome core machinery: MLKL.

    Science.gov (United States)

    Zhang, Jing; Yang, Yu; He, Wenyan; Sun, Liming

    2016-06-01

    In the study of regulated cell death, the rapidly expanding field of regulated necrosis, in particular necroptosis, has been drawing much attention. The signaling of necroptosis represents a sophisticated form of a death pathway. Anti-caspase mechanisms (e.g., using inhibitors of caspases, or genetic ablation of caspase-8) switch cell fate from apoptosis to necroptosis. The initial extracellular death signals regulate RIP1 and RIP3 kinase activation. The RIP3-associated death complex assembly is necessary and sufficient to initiate necroptosis. MLKL was initially identified as an essential mediator of RIP1/RIP3 kinase-initiated necroptosis. Recent studies on the signal transduction using chemical tools and biomarkers support the idea that MLKL is able to make more functional sense for the core machinery of the necroptosis death complex, called the necrosome, to connect to the necroptosis execution. The experimental data available now have pointed that the activated MLKL forms membrane-disrupting pores causing membrane leakage, which extends the prototypical concept of morphological and biochemical events following necroptosis happening in vivo. The key role of MLKL in necroptosis signaling thus sheds light on the logic underlying this unique "membrane-explosive" cell death pathway. In this review, we provide the general concepts and strategies that underlie signal transduction of this form of cell death, and then focus specifically on the role of MLKL in necroptosis.

  14. Processes and outcomes in school health promotion

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    This is the second special issue of Health Education which features research, theory and practice based perspectives on what counts as desirable outcomes of health promotion in schools in terms of health as well as education, and the effective processes in schools which lead to these outcomes....... The focus in the first special issue was on highlighting the argument that the question about the outcomes of the health-promoting schools should not be limited to narrowly defined health outcomes but needs to be closely linked with the core tasks and values of the school. Building further on this argument......, the papers in this issue feature a number of research issues of relevance for the effectiveness of the health-promoting schools approach, as well as a variety of research and evaluation methodologies contributing to the debate about what counts as reliable evidence within the health-promoting schools...

  15. The Colliding Beams Sequencer

    International Nuclear Information System (INIS)

    Johnson, D.E.; Johnson, R.P.

    1989-01-01

    The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

  16. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  17. What Is a Promotion?

    Science.gov (United States)

    Pergamit, Michael R.; Veum, Jonathan R.

    1999-01-01

    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  18. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    Science.gov (United States)

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  19. HOXB4 Promotes Hemogenic Endothelium Formation without Perturbing Endothelial Cell Development

    Directory of Open Access Journals (Sweden)

    Nadine Teichweyde

    2018-03-01

    Full Text Available Summary: Generation of hematopoietic stem cells (HSCs from pluripotent stem cells, in vitro, holds great promise for regenerative therapies. Primarily, this has been achieved in mouse cells by overexpression of the homeotic selector protein HOXB4. The exact cellular stage at which HOXB4 promotes hematopoietic development, in vitro, is not yet known. However, its identification is a prerequisite to unambiguously identify the molecular circuits controlling hematopoiesis, since the activity of HOX proteins is highly cell and context dependent. To identify that stage, we retrovirally expressed HOXB4 in differentiating mouse embryonic stem cells (ESCs. Through the use of Runx1(−/− ESCs containing a doxycycline-inducible Runx1 coding sequence, we uncovered that HOXB4 promoted the formation of hemogenic endothelium cells without altering endothelial cell development. Whole-transcriptome analysis revealed that its expression mediated the upregulation of transcription of core transcription factors necessary for hematopoiesis, culminating in the formation of blood progenitors upon initiation of Runx1 expression. : In this article, Klump and colleagues demonstrate that the human homeotic selector protein HOXB4 promotes ESC-derived hematopoiesis by inducing hemogenic endothelium formation, in vitro. It propels hematopoietic specification by upregulating the transcription of genes essential for hematopoietic development, such as those encoding members of the so-called heptad transcription factors. Keywords: HOXB4, hematopoietic stem cells, hemangioblast, hemogenic endothelium, hematopoietic specification, EHT, RUNX1, pluripotent stem cells

  20. Core-to-core uniformity improvement in multi-core fiber Bragg gratings

    Science.gov (United States)

    Lindley, Emma; Min, Seong-Sik; Leon-Saval, Sergio; Cvetojevic, Nick; Jovanovic, Nemanja; Bland-Hawthorn, Joss; Lawrence, Jon; Gris-Sanchez, Itandehui; Birks, Tim; Haynes, Roger; Haynes, Dionne

    2014-07-01

    Multi-core fiber Bragg gratings (MCFBGs) will be a valuable tool not only in communications but also various astronomical, sensing and industry applications. In this paper we address some of the technical challenges of fabricating effective multi-core gratings by simulating improvements to the writing method. These methods allow a system designed for inscribing single-core fibers to cope with MCFBG fabrication with only minor, passive changes to the writing process. Using a capillary tube that was polished on one side, the field entering the fiber was flattened which improved the coverage and uniformity of all cores.