WorldWideScience

Sample records for core promoter element

  1. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    Science.gov (United States)

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

  2. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    Science.gov (United States)

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  3. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  4. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  5. Restraint system for core elements of a reactor core

    International Nuclear Information System (INIS)

    Class, G.

    1975-01-01

    In a nuclear reactor, a core element bundle formed of a plurality of side-by-side arranged core elements is surrounded by restraining elements that exert a radially inwardly directly restraining force generating friction forces between the core elements in a restraining plane that is transverse to the core element axes. The adjoining core elements are in rolling contact with one another in the restraining plane by virtue of rolling-type bearing elements supported in the core elements. (Official Gazette)

  6. Core Promoter Structure in the Oomycete Phytophthora infestans

    Science.gov (United States)

    McLeod, Adele; Smart, Christine D.; Fry, William E.

    2004-01-01

    We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

  7. Linking Core Promoter Classes to Circadian Transcription.

    Directory of Open Access Journals (Sweden)

    Pål O Westermark

    2016-08-01

    Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.

  8. Loading method of core constituting elements

    International Nuclear Information System (INIS)

    Kasai, Shigeo

    1976-01-01

    Purpose: To provide a remote-controlled replacing method for core constituting elements in a liquid-metal cooling fast breeder, wherein particularly, the core constituting elements are prevented from being loaded on the core position other than as designated. Constitution: The method comprises a first step which determines a position of a suitable neutron shielding body in order to measure a reference level of complete insertion of the core constituting elements, a second step which inserts a gripper for a fuel exchanger, a third step which decides stroke dimensions of the complete insertion, and a fourth step which discriminates the core constituting elements to begin handling of fuel rods. The method further comprises a fifth step which determines a loading position of fuel rod, and a sixth step which inserts and loads fuel rods into the core. The method still further comprises a seventh step which compares and judges the dimension of loading stroke and the dimension of complete inserting stroke so that when coincided, loading is completed, and when not coincided, loading is not completed and then the cycle of the fourth step is repeated. (Kawakami, Y.)

  9. Siderophile Volatile Element Partitioning during Core Formation.

    Science.gov (United States)

    Loroch, D. C.; Hackler, S.; Rohrbach, A.; Klemme, S.

    2017-12-01

    Since the nineteen sixties it is known, that the Earth's mantle is depleted relative to CI chondrite in numerous elements as a result of accretion and core-mantle differentiation. Additionally, if we take the chondritic composition as the initial solar nebular element abundances, the Earth lacks 85 % of K and up to 98 % of other volatiles. However one potentially very important group of elements has received considerably less attention in this context and these elements are the siderophile but volatile elements (SVEs). SVEs perhaps provide important information regarding the timing of volatile delivery to Earth. Especially for the SVEs the partitioning between metal melt and silicate melt (Dmetal/silicate) at core formation conditions is poorly constrained, never the less they are very important for most of the core formation models. This study is producing new metal-silicate partitioning data for a wide range of SVEs (S, Se, Te, Tl, Ag, As, Au, Cd, Bi, Pb, Sn, Cu, Ge, Zn, In and Ga) with a focus on the P, T and fO2dependencies. The initial hypothesis that we are aiming to test uses the accretion of major portions of volatile elements while the core formation was still active. The key points of this study are: - What are the effects of P, T and fO2 on SVE metal-silicate partioning? - What is the effect of compositional complexity on SVE metal-silicate partioning? - How can SVE's D-values fit into current models of core formation? The partitioning experiments will be performed using a Walker type multi anvil apparatus in a pressure range between 10 and 20 GPa and temperatures of 1700 up to 2100 °C. To determine the Dmetal/silicate values we are using a field emission high-resolution JEOL JXA-8530F EPMA for major elements and a Photon Machines Analyte G2 Excimer laser (193 nm) ablation system coupled to a Thermo Fisher Element 2 single-collector ICP-MS (LA-ICP-MS) for the trace elements. We recently finished the first sets of experiments and can provide the

  10. Explicit Instruction Elements in Core Reading Programs

    Science.gov (United States)

    Child, Angela R.

    2012-01-01

    Classroom teachers are provided instructional recommendations for teaching reading from their adopted core reading programs (CRPs). Explicit instruction elements or what is also called instructional moves, including direct explanation, modeling, guided practice, independent practice, discussion, feedback, and monitoring, were examined within CRP…

  11. Support structure for reactor core constituent element

    International Nuclear Information System (INIS)

    Aida, Yasuhiko.

    1993-01-01

    A connection pipe having an entrance nozzle inserted therein as a reactor core constituent element is protruded above the upper surface of a reactor core support plate. A through hole is disposed to the protruding portion of the connection pipe. The through hole and a through hole disposed to the reactor core support plate are connected by a communication pipe. A shear rod is disposed in a horizontal portion at the inside of the communication pipe and is supported by a spring horizontally movably. Further, a groove is disposed at a position of the entrance nozzle opposing to the shear rod. The shear rod is urged out of the communication pipe by the pressure of the high pressure plenum and the top end portion of the shear rod is inserted to the groove of the entrance nozzle during operation. Accordingly, the shear rod is positioned in a state where it is extended from the through hole of the communication pipe to the groove of the entrance nozzle. This can mechanically constrain the rising of the reactor core constituent elements by the shear rod upon occurrence of earthquakes. (I.N.)

  12. Nuclear reactor core and fuel element therefor

    International Nuclear Information System (INIS)

    Fortescue, P.

    1986-01-01

    This patent describes a nuclear reactor core. This core consists of vertical columns of disengageable fuel elements stacked one atop another. These columns are arranged in side-by-side relationship to form a substantially continuous horizontal array. Each of the fuel elements include a block of refractory material having relatively good thermal conductivity and neutron moderating characteristics. The block has a pair of parallel flat top and bottom end faces and sides which are substantially prependicular to the end faces. The sides of each block is aligned vertically within a vertical column, with the sides of vertically adjacent blocks. Each of the blocks contains fuel chambers, including outer rows containing only fuel chambers along the sides of the block have nuclear fuel material disposed in them. The blocks also contain vertical coolant holes which are located inside the fuel chambers in the outer rows and the fuel chambers which are not located in the outer rows with the fuel chambers and which extend axially completely through from end face to end face and form continuous vertical intracolumn coolant passageways in the reactor core. The blocks have vertical grooves extending along the sides of the blocks form interblock channels which align in groups to form continuous vertical intercolumn coolant passsageways in the reactor core. The blocks are in the form of a regular hexagonal prism with each side of the block having vertical gooves defining one half of one of the coolant interblock channels, six corner edges on the blocks have vertical groves defining one-third of an interblock channel, the vertical sides of the blocks defining planar vertical surfaces

  13. Making Mercury's Core with Light Elements

    Science.gov (United States)

    Vander Kaaden, Kathleen E.; McCubbin, Francis M.; Ross, D. Kent

    2016-01-01

    Recent results obtained from the MErcury Surface, Space ENvironment, GEochemistry, and Ranging spacecraft showed the surface of Mercury has low FeO abundances (less than 2 wt%) and high S abundances (approximately 4 wt%), suggesting the oxygen fugacity of Mercury's surface materials is somewhere between 3 to 7 log10 units below the IW buffer. The highly reducing nature of Mercury has resulted in a relatively thin mantle and a large core that has the potential to exhibit an exotic composition in comparison to the other terrestrial planets. This exotic composition may extend to include light elements (e.g., Si, C, S). Furthermore, has argued for a possible primary floatation crust on Mercury composed of graphite, which may require a core that is C-saturated. In order to investigate mercurian core compositions, we conducted piston cylinder experiments at 1 GPa, from 1300 C to 1700 C, using a range of starting compositions consisting of various Si-Fe metal mixtures (Si5Fe95, Si10Fe90, Si22Fe78, and Si35Fe65). All metals were loaded into graphite capsules used to ensure C-saturation during the duration of each experimental run. Our experiments show that Fe-Si metallic alloys exclude carbon relative to more Fe-rich metal. This exclusion of carbon commences within the range of 5 to 10 wt% Si. These results indicate that if Mercury has a Si-rich core (having more than approximately 5 wt% silicon), it would have saturated in carbon at low C abundances allowing for the possible formation of a graphite floatation crust as suggested by. These results have important implications for the thermal and magmatic evolution of Mercury.

  14. Mammalian RNA polymerase II core promoters: insights from genome-wide studies

    DEFF Research Database (Denmark)

    Sandelin, Albin; Carninci, Piero; Lenhard, Boris

    2007-01-01

    The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

  15. Experimental Study of Elements Promoting Mixing in Fuel Elements

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2003-01-01

    In the present work a thermal tracing technique is used to measure the increase of the mixing between subchannels in the presence of different mixing elements.As representative elements a spacer, a spacer with mixing vanes and turbulence promoter buttons were considered.The performance of these elements was evaluated by studying the behavior of a thermal trace in each case.Also the pressure drop for each case is presented.The results present a qualitative and quantitative guide for the application of each one of these appendages in future nuclear elements

  16. A comparison between elemental logs and core data

    International Nuclear Information System (INIS)

    Kerr, S.A.; Grau, J.A.; Schweitzer, J.S.

    1992-01-01

    Neutron-induced gamma-ray spectroscopy, of prompt capture and delayed activation, together with natural gamma-ray measurements, provides a borehole elemental analysis to characterize rock matrix composition. This study involved extensive core and log data in two wells. One well was drilled with a barite-weighted oil-based mud through a shallow marine sand. The other was drilled with fresh water-based mud through a channel sand, mudstone sequence overlying limestone. The results illustrate the importance of a suitable core sampling strategy and the problems associated with matching core to log data. Possible inaccuracies from the modelling of Ca-, Fe- and S-bearing minerals have been determined. A method for correcting the total measured aluminium concentration for that due to the borehole mud has been successfully tested against aluminium concentrations measured in the cleaned core samples. Estimates of the overall accuracy and precision of the elemental logging concentrations are obtained by comparing the log results with those obtained from the laboratory core analysis. A comprehensive core elemental analysis can also provide useful insight into the way other logs, such as the photoelectric factor or formation thermal neutron macroscopic absorption cross section, are influenced by minor and trace elements. Differences between calculated values from elemental logs and measured macroscopic parameters provide additional data for a more detailed understanding of the rock properties. (Author)

  17. Four-terminal circuit element with photonic core

    Science.gov (United States)

    Sampayan, Stephen

    2017-08-29

    A four-terminal circuit element is described that includes a photonic core inside of the circuit element that uses a wide bandgap semiconductor material that exhibits photoconductivity and allows current flow through the material in response to the light that is incident on the wide bandgap material. The four-terminal circuit element can be configured based on various hardware structures using a single piece or multiple pieces or layers of a wide bandgap semiconductor material to achieve various designed electrical properties such as high switching voltages by using the photoconductive feature beyond the breakdown voltages of semiconductor devices or circuits operated based on electrical bias or control designs. The photonic core aspect of the four-terminal circuit element provides unique features that enable versatile circuit applications to either replace the semiconductor transistor-based circuit elements or semiconductor diode-based circuit elements.

  18. Vibration tests on some models of PEC reactor core elements

    International Nuclear Information System (INIS)

    Bonacina, G.; Castoldi, A.; Zola, M.; Cecchini, F.; Martelli, A.; Vincenzi, D.

    1982-01-01

    This paper describes the aims of the experimental tests carried out at ISMES, within an agreement with the Department of Fast Reactors of ENEA, on some models of the elements of PEC Fast Nuclear Reactor Core in the frame of the activities for the seismic verification of the PEC core. The seismic verification is briefly described with particular attention to the problems arising from the shocks among the various elements during an earthquake, as well as the computer code used, the purpose and the techniques used to perform tests, some results and the first comparison between the theory and the experimental data

  19. Three-dimensional discrete element method simulation of core disking

    Science.gov (United States)

    Wu, Shunchuan; Wu, Haoyan; Kemeny, John

    2018-04-01

    The phenomenon of core disking is commonly seen in deep drilling of highly stressed regions in the Earth's crust. Given its close relationship with the in situ stress state, the presence and features of core disking can be used to interpret the stresses when traditional in situ stress measuring techniques are not available. The core disking process was simulated in this paper using the three-dimensional discrete element method software PFC3D (particle flow code). In particular, PFC3D is used to examine the evolution of fracture initiation, propagation and coalescence associated with core disking under various stress states. In this paper, four unresolved problems concerning core disking are investigated with a series of numerical simulations. These simulations also provide some verification of existing results by other researchers: (1) Core disking occurs when the maximum principal stress is about 6.5 times the tensile strength. (2) For most stress situations, core disking occurs from the outer surface, except for the thrust faulting stress regime, where the fractures were found to initiate from the inner part. (3) The anisotropy of the two horizontal principal stresses has an effect on the core disking morphology. (4) The thickness of core disk has a positive relationship with radial stress and a negative relationship with axial stresses.

  20. RA-3 core with uranium silicide fuel elements

    International Nuclear Information System (INIS)

    Abbate, Maximo J.; Sbaffoni, Maria M.

    2000-01-01

    Following on with studies on uranium silicide fuel elements, this paper reports some comparisons between the use of standard ECN [U 3 O 8 ] fuel elements and type P-06 [from U 3 Si 2 ] fuel elements in the RA-3 core.The first results showed that the calculated overall mean burn up is in agreement with that reported for the facility, which gives more confidence to the successive ones. Comparing the mentioned cores, the silicide one presents several advantages such as: -) a mean burn up increase of 18 %; -) an extraction burn up increase of 20 %; -) 37.4 % increase in full power days, for mean burn up. All this is meritorious for this fuel. Moreover, grouped and homogenized libraries were prepared for CITVAP code that will be used for planning experiments and other bidimensional studies. Preliminary calculations were also performed. (author)

  1. Dynamic usage of transcription start sites within core promoters

    DEFF Research Database (Denmark)

    Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro

    2006-01-01

    BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...

  2. Automating the generation of finite element dynamical cores with Firedrake

    Science.gov (United States)

    Ham, David; Mitchell, Lawrence; Homolya, Miklós; Luporini, Fabio; Gibson, Thomas; Kelly, Paul; Cotter, Colin; Lange, Michael; Kramer, Stephan; Shipton, Jemma; Yamazaki, Hiroe; Paganini, Alberto; Kärnä, Tuomas

    2017-04-01

    The development of a dynamical core is an increasingly complex software engineering undertaking. As the equations become more complete, the discretisations more sophisticated and the hardware acquires ever more fine-grained parallelism and deeper memory hierarchies, the problem of building, testing and modifying dynamical cores becomes increasingly complex. Here we present Firedrake, a code generation system for the finite element method with specialist features designed to support the creation of geoscientific models. Using Firedrake, the dynamical core developer writes the partial differential equations in weak form in a high level mathematical notation. Appropriate function spaces are chosen and time stepping loops written at the same high level. When the programme is run, Firedrake generates high performance C code for the resulting numerics which are executed in parallel. Models in Firedrake typically take a tiny fraction of the lines of code required by traditional hand-coding techniques. They support more sophisticated numerics than are easily achieved by hand, and the resulting code is frequently higher performance. Critically, debugging, modifying and extending a model written in Firedrake is vastly easier than by traditional methods due to the small, highly mathematical code base. Firedrake supports a wide range of key features for dynamical core creation: A vast range of discretisations, including both continuous and discontinuous spaces and mimetic (C-grid-like) elements which optimally represent force balances in geophysical flows. High aspect ratio layered meshes suitable for ocean and atmosphere domains. Curved elements for high accuracy representations of the sphere. Support for non-finite element operators, such as parametrisations. Access to PETSc, a world-leading library of programmable linear and nonlinear solvers. High performance adjoint models generated automatically by symbolically reasoning about the forward model. This poster will present

  3. CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs.

    Science.gov (United States)

    Gilbert, N; Labuda, D

    1999-03-16

    A 65-bp "core" sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3' ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome.

  4. Trace elements in a North Sea drill core

    DEFF Research Database (Denmark)

    Kunzendorf, Helmar; Gwozdz, R.; Svendsen, N.

    1986-01-01

    , V, Sr, Dy, Mg, Ti, Ba and Eu. The major elements Ca and Al could be related to petrophysical parameters, particularly Al which shows a correlation with the silicification/argillaceous content. Na (and Cl) has a low content in the hydrocarbon-bearing section of the drill core suggesting that the pore......Chalk samples, systematically taken along a drill core from one of the hydrocarbon producing fields of the North Sea (Tyra field), were analysed by a neutron activation technique involving measurement of radioisotopes with relatively short half-lives. Elements determined include Na, Al, Cl, Ca, Mn...... space is filled mainly by hydrocarbons. A significant decrease of Mn with depth probably suggests diagenesis of chalk prior to, or with, hydrocarbon emplacement. Investigations of drilling fluids and cuttings reveal a strong contamination of the latter, mainly by Ba. Chalk data from comparable onshore...

  5. Neutron radiography (NRAD) reactor 64-element core upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Bess, John D. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2014-03-01

    The neutron radiography (NRAD) reactor is a 250 kW TRIGA (registered) (Training, Research, Isotopes, General Atomics) Mark II , tank-type research reactor currently located in the basement, below the main hot cell, of the Hot Fuel Examination Facility (HFEF) at the Idaho National Laboratory (INL). It is equipped with two beam tubes with separate radiography stations for the performance of neutron radiography irradiation on small test components. The interim critical configuration developed during the core upgrade, which contains only 62 fuel elements, has been evaluated as an acceptable benchmark experiment. The final 64-fuel-element operational core configuration of the NRAD LEU TRIGA reactor has also been evaluated as an acceptable benchmark experiment. Calculated eigenvalues differ significantly (approximately ±1%) from the benchmark eigenvalue and have demonstrated sensitivity to the thermal scattering treatment of hydrogen in the U-Er-Zr-H fuel.

  6. Trace elements in a dated ice core from Antarctica

    International Nuclear Information System (INIS)

    Keshin, S.S.; Xudong Huang; Olmez, I.; Langway, C.C. Jr.

    1992-01-01

    Aerosol particles from both natural and anthropogenic sources are emitted into the atmosphere and transported by wind systems by various mechanisms. Once airborne, the particles, which contain various trace elements, accumulate on the earth's surface as either condensation nuclei or by dry fallout processes. In the polar regions, these particles are incorporated and deposited in snow layers in sequential time-unit increments. The trace analysis of elements contained in dated annual snow layers provides a measure of the elemental chemistry content of the atmosphere for the same time interval. A 164-m-deep, 10-cm-diam ice core was obtained at Byrd Station, Antarctica, in November 1989. Other physical and chemistry studies on this ice core have identified its detailed chronology in annual increments for the past 1360 yr. This study presents the results of the instrumental neutron activation analysis (INAA) measurements made on 26 individually dated samples of this core, selected between the 6.43- and 118.15-m depths

  7. The advanced neutron source three-element-core fuel grading

    International Nuclear Information System (INIS)

    Gehin, J.C.

    1995-01-01

    The proposed Advanced Neutron Source (ANS) pre-conceptual design consists of a two-element 330 MW f nuclear reactor fueled with highly-enriched uranium and is cooled, moderated, and reflected with heavy water. Recently, the ANS design has been changed to a three-element configuration in order to permit a reduction of the enrichment, if required, while maintaining or improving the thermal-hydraulic margins. The core consists of three annular fuel elements composed of involute-shaped fuel plates. Each fuel plate has a thickness of 1.27 mm and consists of a fuel meat region Of U 3 Si 2 -Al (50% enriched in one case that was proposed) and an aluminum filler region between aluminum cladding. The individual plates are separated by a 1.27 mm coolant channel. The three element core has a fuel loading of 31 kg of 235 U which is sufficient for a 17-day fuel cycle. The goal in obtaining a new fuel grading is to maximize important temperature margins. The limits imposed axe: (1) Limit the temperature drop over the cladding oxide layer to less than 119 degrees C to avoid oxide spallation. (2) Limit the fuel centerline temperature to less than 400 degrees C to avoid fuel damage. (3) Limit the cladding wall temperature to less than the coolant. incipient-boiling temperature to avoid coolant boiling. Other thermal hydraulic conditions, such as critical heat flux, are also considered

  8. Characterization and identification of microRNA core promoters in four model species.

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhou

    2007-03-01

    Full Text Available MicroRNAs are short, noncoding RNAs that play important roles in post-transcriptional gene regulation. Although many functions of microRNAs in plants and animals have been revealed in recent years, the transcriptional mechanism of microRNA genes is not well-understood. To elucidate the transcriptional regulation of microRNA genes, we study and characterize, in a genome scale, the promoters of intergenic microRNA genes in Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, and Oryza sativa. We show that most known microRNA genes in these four species have the same type of promoters as protein-coding genes have. To further characterize the promoters of microRNA genes, we developed a novel promoter prediction method, called common query voting (CoVote, which is more effective than available promoter prediction methods. Using this new method, we identify putative core promoters of most known microRNA genes in the four model species. Moreover, we characterize the promoters of microRNA genes in these four species. We discover many significant, characteristic sequence motifs in these core promoters, several of which match or resemble the known cis-acting elements for transcription initiation. Among these motifs, some are conserved across different species while some are specific to microRNA genes of individual species.

  9. Expressions Creating Confusion among Elements of Promotion Mix: Sales Promotion

    OpenAIRE

    Kelesbayev, Dinmukhamed; Kalykulov, Kuatbek; Yertayev, Yermek; Turlybekova, Altynay; Kamalov, Akhmet

    2017-01-01

    More than twenty years on marketing, research and publications have dealt with research problems based on marketing mix and have mostly examined marketing processes. However, the types or elements of the marketing mix that are important for both the enterprises and the consumers are not analyzed too deeply, and different expressions or concepts are used in the analyzed sources. For example, when we look at the literature on marketing, which is being used as a source in our universities, the c...

  10. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  11. Behaviour of Rare Earth Elements during the Earth's core formation

    Science.gov (United States)

    Faure, Pierre; Bouhifd, Mohamed Ali; Boyet, Maud; Hammouda, Tahar; Manthilake, Geeth

    2017-04-01

    Rare Earth Elements (REE) are classified in the refractory group, which means that they have a high temperature condensation and their volatility-controlled fractionation is limited to high-temperature processes. Anomalies have been measured for Eu, Yb and Sm, which are the REE with the lowest condensation temperatures in CAIs and chondrules (e.g. [1]). REE are particularly abundant in the sulfides of enstatite chondrites, 100 to 1000 times the CI value [e.g. 2,3], proving that these elements are not strictly lithophile under extremely reducing conditions. However by investigating experimentally the impact of Earth's core formation on the behavior of Sm and Nd, we have shown the absence of fractionation between Sm and Nd during the segregation of the metallic phase [4]. Recently, Wohlers and Wood [5] proposed that Nd and Sm could be fractionated in presence of a S-rich alloy phase. However, their results were obtained at pressure and temperature conditions below the plausible conditions of the Earth's core formation. Clearly, large pressure range needs to be covered before well-constrained model can be expected. Furthermore, our preliminary metal-silicate partitioning results show that Ce and Eu have higher metal/silicate partition coefficients than their neighboring elements, and that the presence of sulphur enhances the relative difference between partition coefficients. In this presentation, we will present and discuss new metal-silicate partition coefficients of all REE at a deep magma ocean at pressures ranging from those of the uppermost upper mantle ( 5 GPa) to a maximum pressure expected in the range of 20 GPa, temperatures ranging from 2500 to about 3000 K, and oxygen fugacities within IW-1 to IW-5 (1 to 5 orders of magnitude lower than the iron-wüstite buffer). We will discuss the effect of S, as well as the effect of H2O on the behaviour of REE during the Earth's core formation: recent models suggest that contrary to currently accepted beliefs, the

  12. Elemental composition of a deep sediment core from Lake Stocksjoen in the Forsmark area

    Energy Technology Data Exchange (ETDEWEB)

    Stroemgren, Maarten [Umeaa Univ. (Sweden). Dept. of Ecology and Environmental Sciences; Brunberg, Anna-Kristina [Uppsala Univ. (Sweden). Dept. of Ecology and Evolution/Limnology

    2006-10-15

    A deep sediment core was taken from Lake Stocksjoen, situated within the Forsmark site investigation area. The 55 cm long sediment core, representing the entire history of the lake (approx 430 years) was sliced in 5 cm portions and analysed for various chemical elements, using ICP-MS technique. In total, 54 different elements - classified as main elements, heavy metals and trace elements - were analysed. In general terms, three different patterns of stratigraphy were derived from all the analysed elements. Calcium, manganese, lead and mercury occurred in highest concentrations in the upper sediments (<30 cm depth). Phosphorus, zinc, cadmium, antimony, tin and strontium occurred in more even proportions throughout the sediment core. All the other elements were substantially reduced in the upper parts (<30 cm) compared to the deeper parts of the sediment core. Metals that are considered as airborne pollutants were found in low or moderate concentrations. This is in concert with other investigations of pollutants that have been performed in the Forsmark area. The sediment of Lake Stocksjoen is highly organic, and has been so during the entire history of the lake. Much of the organic Material seems to be refractory and less susceptible for mineralisation and respiration during the prevailing environmental conditions. This corresponds well with the characteristic gelatinous cyanophycee gyttja found in the lower parts of the sediment core. Although speculative, the pronounced changes in elemental composition of the sediment at 30 cm depth may correspond to the final isolation of the lake from the Baltic Sea, which occurred approximately 230 years ago. The deeper parts (below 30 cm depth) thus may represent the time period with regular intrusions of brackish water into the lake basin. One important factor governing the environmental conditions and the resulting elemental composition of the sediment is the unusually thick 'microbial mat', which is characteristic

  13. PROMOTION AS AN ELEMENT OF MARKETING IN SPORTING EVENT

    Directory of Open Access Journals (Sweden)

    Miodrag Koprivica

    2009-11-01

    Full Text Available The events are happening at the present time on million different tv and radio sta- tions. Every marketer should be aware of that, each and every marketer in situations like this is using different elements of marketing mix, such as: advertising, personal sales, promotional development, publicity and public relations, and of course direct marketing. Organizers of sporting events are using many different ways to bring in visitors. By using marketing mix good position and design of event is secured, and of course vi- sitors are guaranteed. Promotion is by definition one of the elements of marketing mix. This work is exploring promotion goals, rational usage of means, and usage of internet as an media in promotion of sporting event

  14. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  15. TAF4 nucleates a core subcomplex of TFIID and mediates activated transcription from a TATA-less promoter

    OpenAIRE

    Wright, Kevin J.; Marr, Michael T.; Tjian, Robert

    2006-01-01

    Activator-dependent recruitment of TFIID initiates formation of the transcriptional preinitiation complex. TFIID binds core promoter DNA elements and directs the assembly of other general transcription factors, leading to binding of RNA polymerase II and activation of RNA synthesis. How TATA box-binding protein (TBP) and the TBP-associated factors (TAFs) are assembled into a functional TFIID complex with promoter recognition and coactivator activities in vivo remains unknown. Here, we use RNA...

  16. Developing core elements and checklist items for global hospital antimicrobial stewardship programmes: a consensus approach.

    Science.gov (United States)

    Pulcini, C; Binda, F; Lamkang, A S; Trett, A; Charani, E; Goff, D A; Harbarth, S; Hinrichsen, S L; Levy-Hara, G; Mendelson, M; Nathwani, D; Gunturu, R; Singh, S; Srinivasan, A; Thamlikitkul, V; Thursky, K; Vlieghe, E; Wertheim, H; Zeng, M; Gandra, S; Laxminarayan, R

    2018-04-03

    With increasing global interest in hospital antimicrobial stewardship (AMS) programmes, there is a strong demand for core elements of AMS to be clearly defined on the basis of principles of effectiveness and affordability. To date, efforts to identify such core elements have been limited to Europe, Australia, and North America. The aim of this study was to develop a set of core elements and their related checklist items for AMS programmes that should be present in all hospitals worldwide, regardless of resource availability. A literature review was performed by searching Medline and relevant websites to retrieve a list of core elements and items that could have global relevance. These core elements and items were evaluated by an international group of AMS experts using a structured modified Delphi consensus procedure, using two-phased online in-depth questionnaires. The literature review identified seven core elements and their related 29 checklist items from 48 references. Fifteen experts from 13 countries in six continents participated in the consensus procedure. Ultimately, all seven core elements were retained, as well as 28 of the initial checklist items plus one that was newly suggested, all with ≥80% agreement; 20 elements and items were rephrased. This consensus on core elements for hospital AMS programmes is relevant to both high- and low-to-middle-income countries and could facilitate the development of national AMS stewardship guidelines and adoption by healthcare settings worldwide. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. All rights reserved.

  17. PROMOTION AS AN ELEMENT OF MARKETING IN SPORTING EVENT

    OpenAIRE

    Miodrag Koprivica; Vasilj Koprivica; Slobodan Živkucin

    2009-01-01

    The events are happening at the present time on million different tv and radio sta- tions. Every marketer should be aware of that, each and every marketer in situations like this is using different elements of marketing mix, such as: advertising, personal sales, promotional development, publicity and public relations, and of course direct marketing. Organizers of sporting events are using many different ways to bring in visitors. By using marketing mix good position and design of event is sec...

  18. Core-Mantle Partitioning of Volatile Elements and the Origin of Volatile Elements in Earth and Moon

    Science.gov (United States)

    Righter, K.; Pando, K.; Danielson, L.; Nickodem, K.

    2014-01-01

    Depletions of siderophile elements in mantles have placed constraints on the conditions on core segregation and differentiation in bodies such as Earth, Earth's Moon, Mars, and asteroid 4 Vesta. Among the siderophile elements there are a sub-set that are also volatile (volatile siderophile elements or VSE; Ga, Ge, In, As, Sb, Sn, Bi, Zn, Cu, Cd), and thus can help to constrain the origin of volatile elements in these bodies, and in particular the Earth and Moon. One of the fundamental observations of the geochemistry of the Moon is the overall depletion of volatile elements relative to the Earth, but a satisfactory explanation has remained elusive. Hypotheses for Earth include addition during accretion and core formation and mobilized into the metallic core, multiple stage origin, or addition after the core formed. Any explanation for volatile elements in the Earth's mantle must also be linked to an explanation of these elements in the lunar mantle. New metal-silicate partitioning data will be applied to the origin of volatile elements in both the Earth and Moon, and will evaluate theories for exogenous versus endogenous origin of volatile elements.

  19. Experimental constraints on light elements in the Earth’s outer core

    OpenAIRE

    Youjun Zhang; Toshimori Sekine; Hongliang He; Yin Yu; Fusheng Liu; Mingjian Zhang

    2016-01-01

    Earth?s outer core is liquid and dominantly composed of iron and nickel (~5?10?wt%). Its density, however, is ~8% lower than that of liquid iron, and requires the presence of a significant amount of light element(s). A good way to specify the light element(s) is a direct comparison of density and sound velocity measurements between seismological data and those of possible candidate compositions at the core conditions. We report the sound velocity measurements of a model core composition in th...

  20. Registry Assessment of Peripheral Interventional Devices (RAPID): Registry assessment of peripheral interventional devices core data elements.

    Science.gov (United States)

    Jones, W Schuyler; Krucoff, Mitchell W; Morales, Pablo; Wilgus, Rebecca W; Heath, Anne H; Williams, Mary F; Tcheng, James E; Marinac-Dabic, J Danica; Malone, Misti L; Reed, Terrie L; Fukaya, Rie; Lookstein, Robert A; Handa, Nobuhiro; Aronow, Herbert D; Bertges, Daniel J; Jaff, Michael R; Tsai, Thomas T; Smale, Joshua A; Zaugg, Margo J; Thatcher, Robert J; Cronenwett, Jack L

    2018-02-01

    The current state of evaluating patients with peripheral artery disease and more specifically of evaluating medical devices used for peripheral vascular intervention (PVI) remains challenging because of the heterogeneity of the disease process, the multiple physician specialties that perform PVI, the multitude of devices available to treat peripheral artery disease, and the lack of consensus about the best treatment approaches. Because PVI core data elements are not standardized across clinical care, clinical trials, and registries, aggregation of data across different data sources and physician specialties is currently not feasible. Under the auspices of the U.S. Food and Drug Administration's Medical Device Epidemiology Network initiative-and its PASSION (Predictable and Sustainable Implementation of the National Registries) program, in conjunction with other efforts to align clinical data standards-the Registry Assessment of Peripheral Interventional Devices (RAPID) workgroup was convened. RAPID is a collaborative, multidisciplinary effort to develop a consensus lexicon and to promote interoperability across clinical care, clinical trials, and national and international registries of PVI. The current manuscript presents the initial work from RAPID to standardize clinical data elements and definitions, to establish a framework within electronic health records and health information technology procedural reporting systems, and to implement an informatics-based approach to promote the conduct of pragmatic clinical trials and registry efforts in PVI. Ultimately, we hope this work will facilitate and improve device evaluation and surveillance for patients, clinicians, health outcomes researchers, industry, policymakers, and regulators. Copyright © 2017 Society for Vascular Surgery. All rights reserved.

  1. The CompHP Core Competencies Framework for Health Promotion in Europe

    Science.gov (United States)

    Barry, Margaret M.; Battel-Kirk, Barbara; Dempsey, Colette

    2012-01-01

    Background: The CompHP Project on Developing Competencies and Professional Standards for Health Promotion in Europe was developed in response to the need for new and changing health promotion competencies to address health challenges. This article presents the process of developing the CompHP Core Competencies Framework for Health Promotion across…

  2. Advanced neutron source reactor conceptual safety analysis report, three-element-core design: Chapter 15, accident analysis

    International Nuclear Information System (INIS)

    Chen, N.C.J.; Wendel, M.W.; Yoder, G.L.; Harrington, R.M.

    1996-02-01

    In order to utilize reduced enrichment fuel, the three-element-core design for the Advanced Neutron Source has been proposed. The proposed core configuration consists of inner, middle, and outer elements, with the middle element offset axially beneath the inner and outer elements, which are axially aligned. The three-element-core RELAP5 model assumes that the reactor hardware is changed only within the core region, so that the loop piping, heat exchangers, and pumps remain as assumed for the two-element-core configuration. To assess the impact of changes in the core region configuration and the thermal-hydraulic steady-state conditions, the safety analysis has been updated. This report gives the safety margins for the loss-of-off-site power and pressure-boundary fault accidents based on the RELAP5 results. AU margins are greater for the three-element-core simulations than those calculated for the two-element core

  3. Diagenetic remobilization of rare earth elements in a sediment core from the central Indian Basin

    Digital Repository Service at National Institute of Oceanography (India)

    Pattan, J.N.; Banakar, V.K.

    Rare earth elements (REE) distribution in a 36 cm long sediment box core from the Central Indian Basin is studied. REE concentration is generally higher in the upper oxic zone than in intermediate suboxic zone suggesting REE diffusion upwards...

  4. Research on the Core Competitive Power Elements Evaluation System of Green Hotel

    OpenAIRE

    Hui LIANG

    2013-01-01

    Green hotel is a new type of hospitality industry development model based on the concept of circular economy and sustainable development. This paper makes an analysis and evaluation of the elements of green hotel core competence, on this basis, constructs the Green Hotel core competitive evaluation index system. The construction of the system is conducive to understand the green hotel’s own competitive advantage objectively, and explore ways to enhance its core competitiveness, providing obje...

  5. Introduction of mixed oxide fuel elements in the belgian cores

    International Nuclear Information System (INIS)

    Charlier, A.F.; Hollasky, N.A.

    1994-01-01

    The important amount of plutonium recovered from the reprocessing of spent fuel on the one hand, the national and international experience of the use of mixed oxide UO 2 -PuO 2 fuel in power reactors on the other hand, have led Belgian utilities to decide the introduction of Mixed-Oxide fuel in Doel unit 3 and Tihange unit 2 cores. The 'MOX' project has shown that it was possible without reducing safety or requiring modifications of the plant equipment. It has been approved by the Belgian 'Nuclear Safety Commission'. (authors). 1 tab., 2 figs

  6. Nondestructive examination of 54 fuel and reflector elements from Fort St. Vrain core segment 2

    International Nuclear Information System (INIS)

    Saurwein, J.J.

    1982-10-01

    Fifty-four fuel and reflector elements irradiated in core segment 2 of the Fort St. Vrain high-temperature gas-cooled reactor (HTGR) were nondestructively examined. The time- and volume-averaged graphite irradiation temperatures for the elements ranged from approx. 350 0 to 750 0 C. The element-averaged fast neutron fluences ranged from approx. 0.2 to 1.6 x 10 25 n/m 2 (E > 29 fJ)/sub HTGR/. The elements, except for two fuel elements in which single localizeed cracks developed during irradiation, were in excellent condition. No evidence was observed of significant graphite oxidation or mechanical interaction beween elements. The cracks in the two elements did not affect their performance or handling. These elements were, otherwise, in excellent condition. Nearly all elements shrank in both the axial and radial directions, but the dimensional changes were relatively small

  7. RELAP5 model for advanced neutron source reactor thermal-hydraulic transients, three-element-core design

    Energy Technology Data Exchange (ETDEWEB)

    Chen, N.C.J.; Wendel, M.W.; Yoder, G.L.

    1996-02-01

    In order to utilize reduced enrichment fuel, the three-element-core design has been proposed. The proposed core configuration consists of inner, middle, and outer elements, with the middle element offset axially beneath the inner and outer elements, which are axially aligned. The three-element-core RELAP5 model assumes that the reactor hardware is changed only within the core region, so that the loop piping, heat exchangers, and pumps remain as assumed for the two-element-core configuration. However, the total flow rate through the core is greater and the pressure drop across the core is less so that the primary coolant pumps and heat exchangers are operating at a different point in their performance curves. This report describes the new RELAP5 input for the core components.

  8. Calculation analysis of TRIGA MARK II reactor core composed of two types of fuel elements

    International Nuclear Information System (INIS)

    Ravnik, M.

    1988-11-01

    The most important properties of mixed cores are treated for TRIGA MARK II reactor, composed of standard (20% enriched, 8.5w% U content) and FLIP (70% enriched, 8.5w% U content) fuel elements. Large difference in enrichment and presence of burnable poison in FLIP fuel have strong influence on the main core characteristics, such as: fuel temperature coefficient, power defect, Xe and Sm worth, power and flux distributions, etc. They are significantly different for both types of fuel. Optimal loading of mixed cores therefore strongly depends on the loading pattern of both types of fuel elements. Results of systematic calculational analysis of mixed cores are presented. Calculations on the level of fuel element are performed with WIMSD-4 computer code with extended cross-section library. Core calculations are performed with TRIGAP two-group 1-D diffusion code. Results are compared to measurements and physical explanation is provided. Special concern is devoted to realistic mixed cores, for which optimal in-core fuel management is derived. Refs, figs and tabs

  9. Optimizing a three-element core design for the Advanced Neutron Source Reactor

    International Nuclear Information System (INIS)

    West, C.D.

    1995-01-01

    Source of neutrons in the proposed Advanced Neutron Source facility is a multipurpose research reactor providing 5-10 times the flux, for neutron beams, of the best existing facilities. Baseline design for the reactor core, based on the ''no new inventions'' rule, was an assembly of two annular fuel elements similar to those used in the Oak Ridge and Grenoble high flux reactors, containing highly enriched U silicide particles. DOE commissioned a study of the use of medium- or low-enriched U; a three-element core design was studied as a means to provide extra volume to accommodate the additional U compound required when the fissionable 235 U has to be diluted with 238 U to reduce the enrichment. This paper describes the design and optimization of that three-element core

  10. Simulation on reactor TRIGA Puspati core kinetics fueled with thorium (Th) based fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Mohammed, Abdul Aziz, E-mail: azizM@uniten.edu.my; Rahman, Shaik Mohmmed Haikhal Abdul [Universiti Tenaga Nasional. Jalan Ikram-UNITEN, 43000 Kajang, Selangor (Malaysia); Pauzi, Anas Muhamad, E-mail: anas@uniten.edu.my; Zin, Muhamad Rawi Muhammad; Jamro, Rafhayudi; Idris, Faridah Mohamad [Malaysian Nuclear Agency, Bangi, 43000 Kajang, Selangor (Malaysia)

    2016-01-22

    In confronting global energy requirement and the search for better technologies, there is a real case for widening the range of potential variations in the design of nuclear power plants. Smaller and simpler reactors are attractive, provided they can meet safety and security standards and non-proliferation issues. On fuel cycle aspect, thorium fuel cycles produce much less plutonium and other radioactive transuranic elements than uranium fuel cycles. Although not fissile itself, Th-232 will absorb slow neutrons to produce uranium-233 ({sup 233}U), which is fissile. By introducing Thorium, the numbers of highly enriched uranium fuel element can be reduced while maintaining the core neutronic performance. This paper describes the core kinetic of a small research reactor core like TRIGA fueled with a Th filled fuel element matrix using a general purpose Monte Carlo N-Particle (MCNP) code.

  11. Research on the Core Competitive Power Elements Evaluation System of Green Hotel

    Directory of Open Access Journals (Sweden)

    Hui Liang

    2013-12-01

    Full Text Available Green hotel is a new type of hospitality industry development model based on the concept of circular economy and sustainable development. This paper makes an analysis and evaluation of the elements of green hotel core competence, on this basis, constructs the Green Hotel core competitive evaluation index system.The construction of the system is conducive to understand the green hotel’s own competitive advantage objectively, and explore ways to enhance its core competitiveness, providing objective basis for sustainable development of China's Hotel industry.

  12. Behaviour of contact layer material between cermet fuel element core and can

    International Nuclear Information System (INIS)

    Gavrilin, S.S.; Permyakov, L.N.; Simakov, G.A.; Chernikov, A.S.

    1996-01-01

    The structural state of the contact layer between the shell of the Zr1Nb alloy and cermet fuel element core containing up to 70% of uranium dioxides is experimental studied. The silumin alloy was used as contact material. The results of studies on interaction zones, formed on the Zr1Nb - silumin boundary after fuel elements manufacture and also under temperature conditions, modeling the maximum design and hypothetical accidents accompanied by the contact material melting, are presented [ru

  13. Study of Core Competency Elements and Factors Affecting Performance Efficiency of Government Teachers in Northeastern Thailand

    Science.gov (United States)

    Chansirisira, Pacharawit

    2012-01-01

    The research aimed to investigate the core competency elements and the factors affecting the performance efficiency of the civil service teachers in the northeastern region, Thailand. The research procedure consisted of two steps. In the first step, the data were collected using a questionnaire with the reliability (Cronbach's Alpha) of 0.90. The…

  14. Core Clinical Data Elements for Cancer Genomic Repositories: A Multi-stakeholder Consensus.

    Science.gov (United States)

    Conley, Robert B; Dickson, Dane; Zenklusen, Jean Claude; Al Naber, Jennifer; Messner, Donna A; Atasoy, Ajlan; Chaihorsky, Lena; Collyar, Deborah; Compton, Carolyn; Ferguson, Martin; Khozin, Sean; Klein, Roger D; Kotte, Sri; Kurzrock, Razelle; Lin, C Jimmy; Liu, Frank; Marino, Ingrid; McDonough, Robert; McNeal, Amy; Miller, Vincent; Schilsky, Richard L; Wang, Lisa I

    2017-11-16

    The Center for Medical Technology Policy and the Molecular Evidence Development Consortium gathered a diverse group of more than 50 stakeholders to develop consensus on a core set of data elements and values essential to understanding the clinical utility of molecularly targeted therapies in oncology. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

    Science.gov (United States)

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2012-01-01

    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

  16. Influence of precipitating light elements on stable stratification below the core/mantle boundary

    Science.gov (United States)

    O'Rourke, J. G.; Stevenson, D. J.

    2017-12-01

    Stable stratification below the core/mantle boundary is often invoked to explain anomalously low seismic velocities in this region. Diffusion of light elements like oxygen or, more slowly, silicon could create a stabilizing chemical gradient in the outermost core. Heat flow less than that conducted along the adiabatic gradient may also produce thermal stratification. However, reconciling either origin with the apparent longevity (>3.45 billion years) of Earth's magnetic field remains difficult. Sub-isentropic heat flow would not drive a dynamo by thermal convection before the nucleation of the inner core, which likely occurred less than one billion years ago and did not instantly change the heat flow. Moreover, an oxygen-enriched layer below the core/mantle boundary—the source of thermal buoyancy—could establish double-diffusive convection where motion in the bulk fluid is suppressed below a slowly advancing interface. Here we present new models that explain both stable stratification and a long-lived dynamo by considering ongoing precipitation of magnesium oxide and/or silicon dioxide from the core. Lithophile elements may partition into iron alloys under extreme pressure and temperature during Earth's formation, especially after giant impacts. Modest core/mantle heat flow then drives compositional convection—regardless of thermal conductivity—since their solubility is strongly temperature-dependent. Our models begin with bulk abundances for the mantle and core determined by the redox conditions during accretion. We then track equilibration between the core and a primordial basal magma ocean followed by downward diffusion of light elements. Precipitation begins at a depth that is most sensitive to temperature and oxygen abundance and then creates feedbacks with the radial thermal and chemical profiles. Successful models feature a stable layer with low seismic velocity (which mandates multi-component evolution since a single light element typically

  17. Simulation of hemp fibre bundle and cores using discrete element method

    Energy Technology Data Exchange (ETDEWEB)

    Al-Amin Sadek, M.; Chen, Y. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Biosystems Engineering; Lague, C. [Ottawa Univ., Ottawa, ON (Canada). Faculty of Engineering; Landry, H. [Prairie Agricultural Machinery Inst., Humboldt, SK (Canada); Peng, Q. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Mechanical and Manufacturing Engineering; Zhong, W. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Textile Sciences

    2010-07-01

    The mechanical behaviour of hemp fibre and core must be well understood in order to obtain high-grade hemp fibre that is currently in high demand for various industrial applications. Modelling by discrete element method can simulate the mechanical behaviour of such materials. A commercial discrete element software called Particle Flow Code was used in this study. In particular, the 3-dimension (PFC3D) was used to simulate hemp fibre and core. Since the basic PFC3D particles are spherical, the individual virtual hemp fibres were defined as strings of balls held together by PFC3D parallel bonds. The study showed that the virtual fibre is flexible and can bend and break by forces. This reflects the characteristics of hemp fibre. Using the clump logic of PFC3D, the virtual hemp core was defined as a rigid and unbreakable body, which reflect the characteristics of the core. The virtual fibre and core were defined with several microproperties, some of which were previously calibrated. The PFC3D bond properties were calibrated in this study. They included normal and shear stiffness; pb{sub k}n and pb{sub k}s; normal and shear strength; and bond disk radius, R of the virtual fibre. The calibration started with developing a PFC3D model to simulate fibre tensile test. The microproperties of virtual fibre and core were calibrated by running the PFC3D model. Literature data from fibre tensile tests was compared with simulation results.

  18. Core conversion from rod to plate type fuel elements in research reactors

    International Nuclear Information System (INIS)

    Khattab, M.S.; Mina, A.R.

    1997-01-01

    Core thermalhydraulic analysis have been performed for rod and plate types fuel elements without altering the core bundles square grid spacer (68 mm, side) and coolant mass flow rate. The U O 2 -Mg, 10% enrichment rod type fuel elements are replaced by the MTR plate type, U-Al alloy of 20% enrichment. Coolant mass flux increased from 2000 kg/m 2 S to 5000 kg/m 2 S. Reactor power could be upgraded from 2 to 10 MW without significantly altering the steady state, thermal-hydraulic safety margins. Fuel, clad and coolant transient temperatures are determined inside the core hot channel during flow coast down using paret code. Residual heat removal system of 20% coolant capacity is necessary for upgrading reactor power to encounter the case of pumps off at 10 MW nominal operation. 6 figs., 2 tabs

  19. An upstream activation element exerting differential transcriptional activation on an archaeal promoter

    DEFF Research Database (Denmark)

    Peng, Nan; Xia, Qiu; Chen, Zhengjun

    2009-01-01

    S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

  20. Reorienting health services with capacity building: a case study of the Core Skills in Health Promotion Project.

    Science.gov (United States)

    Yeatman, H R; Nove, T

    2002-12-01

    This paper presents a case study of the application of a framework for capacity building [Hawe, P., King, L., Noort, M., Jordens, C. and Lloyd, B. (2000) Indicators to Help with Capacity Building in Health Promotion. NSW Health, Sydney] to describe actions aimed at building organizational support for health promotion within an area health service in New South Wales, Australia. The Core Skills in Health Promotion Project (CSHPP) arose from an investigation which reported that participants of a health promotion training course had increased health promotion skills but that they lacked the support to apply their skills in the workplace. The project was action-research based. It investigated and facilitated the implementation of a range of initiatives to support community health staff to apply a more preventive approach in their practice and it contributed to the establishment of new organizational structures for health promotion. An evaluation was undertaken 4 years after the CSHPP was established, and 2 years after it had submitted its final report. Interviews with senior managers, document analysis of written reports, and focus groups with middle managers and service delivery staff were undertaken. Change was achieved in the three dimensions of health infrastructure, program maintenance and problem solving capacity of the organization. It was identified that the critically important elements in achieving the aims of the project-partnership, leadership and commitment-were also key elements of the capacity building framework. This case study provides a practical example of the usefulness of the capacity building framework in orienting health services to be supportive of health promotion.

  1. Kin28 regulates the transient association of Mediator with core promoters.

    Science.gov (United States)

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  2. Training of adolescent multipliers from the perspective of health promotion core competencies

    Directory of Open Access Journals (Sweden)

    Kely Vanessa Leite Gomes da Silva

    Full Text Available ABSTRACT Objective: Recognize the domains of health promotion core competencies in the training process of adolescents carried out by nursing students. Method: Qualitative and descriptive study, which used the theoretical methodological contribution Developing Competencies and Professional Standards for Health Promotion Capacity Building in Europe (CompHP, carried out with 14 nursing students. Results: There were four domains: Enable Change; Mediate through Partnership; Communication; and Leadership. These domains came from the interest and commitment of adolescents in intersectoral partnership, the use of communication techniques, and the role of facilitator to catalyze learning and empowerment. Conclusion: There were some domains of core competency in the training of adolescents, suggesting that nursing students act as health promoters. Challenges for Nursing are the implementation of a theoretical contribution of CompHP in undergraduate and ongoing training to carry out health promotion action.

  3. RA-3 reactor core with uranium silicide fuel elements P-07 type

    International Nuclear Information System (INIS)

    Abbate, Maximo J.; Sbaffoni, Maria M.

    2003-01-01

    Following the studies on the utilization of fuel elements (FE) containing uranium silicide, core of the RA-3 was analyzed with several calculation models. At first, the present situation, i.e. the core charged with normal FE (U 3 O 8 ), has been analyzed to validate the simulation methodology comparing with experimental results and to establish reference data to 5 and 10 MW able to be compared with future new situations. Also, CITVAP's nuclear data libraries to be used in irradiation experiment planning were completed. The results were satisfactory and were applied to the study of the core containing P-07 FE [U 3 Si 2 ], in face of a future core change. Comparing with the performance of the U 3 O 8 FE, the silicides ones show the following advantages: - average burnup: 45 % greater; -extraction burnup increase 12 %; and, -the residence time [in full power days] could be a 117 % greater. (author)

  4. Whole-core damage analysis of EBR-II driver fuel elements following SHRT program

    International Nuclear Information System (INIS)

    Chang, L.K.; Koenig, J.F.; Porter, D.L.

    1987-01-01

    In the Shutdown Heat Removal Testing (SHRT) program in EBR-II, fuel element cladding temperatures of some driver subassemblies were predicted to exceed temperatures at which cladding breach may occur. A whole-core thermal analysis of driver subassemblies was performed to determine the cladding temperatures of fuel elemnts, and these temperatures were used for fuel element damage calculation. The accumulated cladding damage of fuel element was found to be very small and fuel element failure resulting from SHRT transients is unlikely. No element breach was noted during the SHRT transients. The reactor was immediately restarted after the most severe SHRT transient had been completed and no driver fuel breach has been noted to date. (orig.)

  5. Fuel element burnup determination in HEU-LEU mixed TRIGA research reactor core

    International Nuclear Information System (INIS)

    Zagar, Tomaz; Ravnik, Matjaz

    2000-01-01

    This paper presents the results of a burnup calculations and burnup measurements for TRIGA FLIP HEU fuel elements and standard TRIGA LEU fuel elements used simultaneously in small TRIGA Mark II research reactor in Ljubljana, Slovenija. The fuel element burnup for approximately 15 years of operation was calculated with two different in house computer codes TRIGAP and TRIGLAV (both codes are available at OECD NEA Data Bank). The calculation is performed in one-dimensional radial geometry in TRIGAP and in two-dimensional (r,φ) geometry in TRIGLAV. Inter-comparison of results shows important influence of in-core water gaps, irradiation channels and mixed rings on burnup calculation accuracy. Burnup of 5 HEU and 27 LEU fuel elements was also measured with reactivity method. Measured and calculated burnup values are inter-compared for these elements (author)

  6. Modelling of Equilibrium Between Mantle and Core: Refractory, Volatile, and Highly Siderophile Elements

    Science.gov (United States)

    Righter, K.; Danielson, L.; Pando, K.; Shofner, G.; Lee, C. -T.

    2013-01-01

    Siderophile elements have been used to constrain conditions of core formation and differentiation for the Earth, Mars and other differentiated bodies [1]. Recent models for the Earth have concluded that the mantle and core did not fully equilibrate and the siderophile element contents of the mantle can only be explained under conditions where the oxygen fugacity changes from low to high during accretion and the mantle and core do not fully equilibrate [2,3]. However these conclusions go against several physical and chemical constraints. First, calculations suggest that even with the composition of accreting material changing from reduced to oxidized over time, the fO2 defined by metal-silicate equilibrium does not change substantially, only by approximately 1 logfO2 unit [4]. An increase of more than 2 logfO2 units in mantle oxidation are required in models of [2,3]. Secondly, calculations also show that metallic impacting material will become deformed and sheared during accretion to a large body, such that it becomes emulsified to a fine scale that allows equilibrium at nearly all conditions except for possibly the length scale for giant impacts [5] (contrary to conclusions of [6]). Using new data for D(Mo) metal/silicate at high pressures, together with updated partitioning expressions for many other elements, we will show that metal-silicate equilibrium across a long span of Earth s accretion history may explain the concentrations of many siderophile elements in Earth's mantle. The modeling includes refractory elements Ni, Co, Mo, and W, as well as highly siderophile elements Au, Pd and Pt, and volatile elements Cd, In, Bi, Sb, Ge and As.

  7. HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com

    2015-10-23

    This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases

  8. HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1

    International Nuclear Information System (INIS)

    Tan, Yongsheng; Li, Yan

    2015-01-01

    This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1

  9. Partnership between CTSI and business schools can promote best practices for core facilities and resources.

    Science.gov (United States)

    Reeves, Lilith; Dunn-Jensen, Linda M; Baldwin, Timothy T; Tatikonda, Mohan V; Cornetta, Kenneth

    2013-08-01

    Biomedical research enterprises require a large number of core facilities and resources to supply the infrastructure necessary for translational research. Maintaining the financial viability and promoting efficiency in an academic environment can be particularly challenging for medical schools and universities. The Indiana Clinical and Translational Sciences Institute sought to improve core and service programs through a partnership with the Indiana University Kelley School of Business. The program paired teams of Masters of Business Administration students with cores and programs that self-identified the need for assistance in project management, financial management, marketing, or resource efficiency. The projects were developed by CTSI project managers and business school faculty using service-learning principles to ensure learning for students who also received course credit for their participation. With three years of experience, the program demonstrates a successful partnership that improves clinical research infrastructure by promoting business best practices and providing a valued learning experience for business students. © 2013 Wiley Periodicals, Inc.

  10. Nondestructive examination of 51 fuel and reflector elements from Fort St. Vrain Core Segment 1

    International Nuclear Information System (INIS)

    Miller, C.M.; Saurwein, J.J.

    1980-12-01

    Fifty-one fuel and reflector elements irradiated in core segment 1 of the Fort St. Vrain High-Temperature Gas-Cooled Reactor (HTGR) were inspected dimensionally and visually in the Hot Service Facility at Fort St. Vrain in July 1979. Time- and volume-averaged graphite temperatures for the examined fuel elements ranged from approx. 400 0 to 750 0 C. Fast neutron fluences varied from approx. 0.3 x 10 25 n/m 2 to 1.0 x 10 25 n/m 2 (E > 29 fJ)/sub HTGR/. Nearly all of the examined elements shrank in both axial and radial dimensions. The measured data were compared with strain and bow predictions obtained from SURVEY/STRESS, a computer code that employs viscoelastic beam theory to calculate stresses and deformations in HTGR fuel elements

  11. The lunar core can be a major reservoir for volatile elements S, Se, Te and Sb.

    Science.gov (United States)

    Steenstra, Edgar S; Lin, Yanhao; Dankers, Dian; Rai, Nachiketa; Berndt, Jasper; Matveev, Sergei; van Westrenen, Wim

    2017-11-06

    The Moon bears a striking compositional and isotopic resemblance to the bulk silicate Earth (BSE) for many elements, but is considered highly depleted in many volatile elements compared to BSE due to high-temperature volatile loss from Moon-forming materials in the Moon-forming giant impact and/or due to evaporative loss during subsequent magmatism on the Moon. Here, we use high-pressure metal-silicate partitioning experiments to show that the observed low concentrations of volatile elements sulfur (S), selenium (Se), tellurium (Te), and antimony (Sb) in the silicate Moon can instead reflect core-mantle equilibration in a largely to fully molten Moon. When incorporating the core as a reservoir for these elements, their bulk Moon concentrations are similar to those in the present-day bulk silicate Earth. This suggests that Moon formation was not accompanied by major loss of S, Se, Te, Sb from Moon-forming materials, consistent with recent indications from lunar carbon and S isotopic compositions of primitive lunar materials. This is in marked contrast with the losses of other volatile elements (e.g., K, Zn) during the Moon-forming event. This discrepancy may be related to distinctly different cosmochemical behavior of S, Se, Te and Sb within the proto-lunar disk, which is as of yet virtually unconstrained.

  12. In-core fuel element temperature and flow measurment of HFETR

    International Nuclear Information System (INIS)

    Chen Daolong; Jiang Pei

    1988-02-01

    The HFETR in-core fuel element temperature-flow measurement facility and its measurement system are expounded. The applications of the instrumented fuel element to stationary and transient states measurements during the lift of power, the operation test of all lifetime at first load, and the deepening burn-up test at second load are described. The method of determination of the hot point temperature under the fin is discussed. The error analysis is made. The fuel element out-of-pile water deprivation test is described. The development of this measurement facility and succesful application have made important contribution to high power and deep burn-up safe operation at two load, in-core fuel element irradiation, and varied investigation of HFETR. After operation at two loads, the integrated power of this instrumented fuel element arrives at 90.88 MWd, its maximum point burn-up is about 64.9%, so that the economy of fuel use of HFETR is raised very much

  13. Device for moving fuel elements and control bars from one place to another in reactor core

    International Nuclear Information System (INIS)

    Hoffmeister, B.

    1976-01-01

    A description is given of a device, including a gripper, for manipulation of fuel elements and control bars, or rods, in a reactor core in which a vertical mast is provided in which the gripper is nonrotatably reciprocable. The mast is rotatable on a work platform and latch elements are provided to halt the mast in selected rotated positions on the platform. Abutment means are also provided to limit the rotary movement of the mast on the platform to 360 0 . 11 Claims, 6 drawing figures

  14. Numerical Analysis of Heat Storage and Heat Conductivity in the Concrete Hollow Core Deck Element

    DEFF Research Database (Denmark)

    Pomianowski, Michal Zbigniew; Heiselberg, Per; Jensen, Rasmus Lund

    2011-01-01

    extent these simplified models estimate the heat storage potential of precast hollow-core concrete decks correctly. This study investigates various approaches on how to model the heat transfer within the air void in the deck. Furthermore, it is analysed how different heat transfer models influence...... the overall heat transfer and heat storage in the hollow-core decks. The presented results allow comparison between detailed results from 2D-COMSOL simulations and simple 1D calculations from the whole building simulation tool such as BSim program and moreover, it is possible to validate the calculation...... method in BSim for the concrete deck element with air voids. Finally, this paper presents a comparison of the calculated heat conductivity of the hollow-core concrete deck and the measured heat conductivity for the same deck by using hot box apparatus....

  15. Natural vibrations of a core banel of a PWR type reactor by elements of revolution shell

    International Nuclear Information System (INIS)

    Barcellos, C.S. de.

    1980-01-01

    Aim to estimate the behavior of the cove barrel of PWR type reactors, submitted to several load conditions, their dynamic characteristic, were determined. In order to obtain the natural modes and frequencies of the core barrel, the CYLDYFE comprete code based in the finite element method, was developed. The obtained results are compared with results obtained by other programs such as SAP, ASKA and STRUDL/DYNAL and by other analytical methods. (M.C.K.) [pt

  16. Demonstration tests for HTGR fuel elements and core components with test sections in HENDEL

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, Yoshiaki; Hino, Ryutaro; Inagaki, Yoshiyuki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] [and others

    1995-03-01

    In the fuel stack test section (T{sub 1}) of the Helium Engineering Demonstration Loop (HENDEL), thermal and hydraulic performances of helium gas flows through a fuel rod channel and a fuel stack have been investigated for the High-Temperature Engineering Test Reactor (HTTR) core thermal design. The test data showed that the turbulent characteristics appearing in the Reynolds number above 2000: no typical behavior in the transition zone, and friction factors and heat transfer coefficients in the fuel channel were found to be higher than those in a smooth annular channel. Heat transfer behavior of gas flow in a fuel element channel with blockage and cross-flow through a gap between upper and lower fuel elements stacked was revealed using the mock-up models. On the other hand, demonstration tests have been performed to verify thermal and hydraulic characteristics and structural integrity related to the core bottom structure using a full-scale test facility named as the in-core structure test section (T{sub 2}). The sealing performance test revealed that the leakage of low-temperature helium gas through gaps between the permanent reflector blocks to the core was very low level compared with the HTTR design value and no change of the leakage flow rate were observed after a long term operation. The heat transfer tests including thermal transient at shutdown of gas circulators verified good insulating performance of core insulation structures in the core bottom structure and the hot gas duct; the temperature of the metal portion of these structure was below the design value. Examination of the thermal mixing characteristics indicated that the mixing of the hot helium gas started at a hot plenum and finished completely at downstream of the outlet hot gas duct. The present results obtained from these demonstration tests have been practically applied to the detailed design works and licensing procedures of the HTTR. (J.P.N.) 92 refs.

  17. Modularization of genetic elements promotes synthetic metabolic engineering.

    Science.gov (United States)

    Qi, Hao; Li, Bing-Zhi; Zhang, Wen-Qian; Liu, Duo; Yuan, Ying-Jin

    2015-11-15

    In the context of emerging synthetic biology, metabolic engineering is moving to the next stage powered by new technologies. Systematical modularization of genetic elements makes it more convenient to engineer biological systems for chemical production or other desired purposes. In the past few years, progresses were made in engineering metabolic pathway using synthetic biology tools. Here, we spotlighted the topic of implementation of modularized genetic elements in metabolic engineering. First, we overviewed the principle developed for modularizing genetic elements and then discussed how the genetic modules advanced metabolic engineering studies. Next, we picked up some milestones of engineered metabolic pathway achieved in the past few years. Last, we discussed the rapid raised synthetic biology field of "building a genome" and the potential in metabolic engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Defining core elements and outstanding practice in Nutritional Science through collaborative benchmarking.

    Science.gov (United States)

    Samman, Samir; McCarthur, Jennifer O; Peat, Mary

    2006-01-01

    Benchmarking has been adopted by educational institutions as a potentially sensitive tool for improving learning and teaching. To date there has been limited application of benchmarking methodology in the Discipline of Nutritional Science. The aim of this survey was to define core elements and outstanding practice in Nutritional Science through collaborative benchmarking. Questionnaires that aimed to establish proposed core elements for Nutritional Science, and inquired about definitions of " good" and " outstanding" practice were posted to named representatives at eight Australian universities. Seven respondents identified core elements that included knowledge of nutrient metabolism and requirement, food production and processing, modern biomedical techniques that could be applied to understanding nutrition, and social and environmental issues as related to Nutritional Science. Four of the eight institutions who agreed to participate in the present survey identified the integration of teaching with research as an indicator of outstanding practice. Nutritional Science is a rapidly evolving discipline. Further and more comprehensive surveys are required to consolidate and update the definition of the discipline, and to identify the optimal way of teaching it. Global ideas and specific regional requirements also need to be considered.

  19. Identification and functional analysis of a CDE/CHR element in the POLDI promoter

    Institute of Scientific and Technical Information of China (English)

    SONG NanMeng; ZHU XiaoYu; SHI Lei; AN Jing; WU YanWei; SANG JianLi

    2009-01-01

    Chinese Center for Disease Control and Prevention, Beijing 102206, China DNA polymerase delta is encoded by the POLD1 gene, the transcription of which is strictly cell cy-cle-dependent. However, the means by which POLD1 transcription is regulated by the cell cycle mechanism is currently unknown. We discovered a novel element in the POLD1 promoter known as a CDE(cell cycle-dependent element)lCHR(cell cycle gene homology region) element. A series of luci-ferase reporter constructs containing various POLD1 promoter mutations were used to investigate the role of the CDF_JCHR element in POLD1 transcription. When the CDE/CHR element was mutated, the promoter activity was up-regulated, and the cell-cycle related factors E2F1 and p21 stopped regulating the promoter. Furthermore, cell cycle-dependent changes in the promoter activity required the integra-tive CDE/CHR element. Electrophoretic mobility shift assay (EMSA) revealed the presence of at least three types of DNA/protein complexes binding to the CDE/CHR element. Our findings provide strong evidence that the CDE/CHR-like sequence is an active functional element in the POLD1 promoter, which is important for the cell cycle regulation of the POLD1 gene.

  20. The influence of sales promotion elements on consumers (jsc „rimi lietuva“ sample)

    OpenAIRE

    Markovskaja, Ivona

    2016-01-01

    The influence of sales promotion elements on consumer is analyzed in the Bachelor‘s Thesis. The thesis examines the information published by various foreign and Lithuanian authors. The main aim of this paper is to analyze different theories of sales promotion effectiveness, sales promotion relevance and factors influencing consumer‘s behavior. This paper analyses the theoretical aspects of sales promotion. It has become more popular in the beginning of the sixth decade. The definition of conc...

  1. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  2. Registry Assessment of Peripheral Interventional Devices (RAPID) - Registry Assessment of Peripheral Interventional Devices Core Data Elements.

    Science.gov (United States)

    Jones, W Schuyler; Krucoff, Mitchell W; Morales, Pablo; Wilgus, Rebecca W; Heath, Anne H; Williams, Mary F; Tcheng, James E; Marinac-Dabic, J Danica; Malone, Misti L; Reed, Terrie L; Fukaya, Rie; Lookstein, Robert; Handa, Nobuhiro; Aronow, Herbert D; Bertges, Daniel J; Jaff, Michael R; Tsai, Thomas T; Smale, Joshua A; Zaugg, Margo J; Thatcher, Robert J; Cronenwett, Jack L; Nc, Durham; Md, Silver Spring; Japan, Tokyo; Ny, New York; Ri, Providence; Vt, Burlington; Mass, Newton; Colo, Denver; Ariz, Tempe; Calif, Santa Clara; Minn, Minneapolis; Nh, Lebanon

    2018-01-25

    The current state of evaluating patients with peripheral artery disease and more specifically of evaluating medical devices used for peripheral vascular intervention (PVI) remains challenging because of the heterogeneity of the disease process, the multiple physician specialties that perform PVI, the multitude of devices available to treat peripheral artery disease, and the lack of consensus about the best treatment approaches. Because PVI core data elements are not standardized across clinical care, clinical trials, and registries, aggregation of data across different data sources and physician specialties is currently not feasible.Methods and Results:Under the auspices of the U.S. Food and Drug Administration's Medical Device Epidemiology Network initiative-and its PASSION (Predictable and Sustainable Implementation of the National Registries) program, in conjunction with other efforts to align clinical data standards-the Registry Assessment of Peripheral Interventional Devices (RAPID) workgroup was convened. RAPID is a collaborative, multidisciplinary effort to develop a consensus lexicon and to promote interoperability across clinical care, clinical trials, and national and international registries of PVI. The current manuscript presents the initial work from RAPID to standardize clinical data elements and definitions, to establish a framework within electronic health records and health information technology procedural reporting systems, and to implement an informatics-based approach to promote the conduct of pragmatic clinical trials and registry efforts in PVI. Ultimately, we hope this work will facilitate and improve device evaluation and surveillance for patients, clinicians, health outcomes researchers, industry, policymakers, and regulators.

  3. Possibility evaluation of eliminating the saturated control fuel element from Tehran research reactor core

    International Nuclear Information System (INIS)

    Mirvakili, S.M.; Keyvani, M.; Arshi, S. Safaei; Khalafi, H.

    2012-01-01

    Highlights: ► We show safe operation of Tehran research reactor without one of its control rods. ► We propose an optimum new core configuration by fuel management calculations. ► We calculate neutronic and thermal hydraulic parameters of the new core. ► Parameters are consistent with the safety criteria. - Abstract: In this study the possibility of safe operation of Tehran research reactor (TRR) providing the elimination of one control rod is evaluated. One of the control fuel elements (CFEs) of TRR has been reached the maximum permissible burn-up and due to the impossibility of fresh fuel assembly provision under current situation, providing an optimum core configuration which satisfies safe operation conditions by applying fuel management calculations is essential. In order to ensure the safe and stable operation of recently proposed configuration for TRR core, neutronic and thermal hydraulic parameters of the new core are calculated and compared with the safety criteria. The results show good compatibility with reactor safety criteria, and provide desired shutdown margin and safety reactivity factor.

  4. Comparison of different enrichment factors to assess the natural accumulation of trace elements in sediment cores from Nhecolandia Pantanal, Brazil

    International Nuclear Information System (INIS)

    Santos, Levi F.; Damatto, Sandra R.; Barbiero, Laurent; Furian, Sonia M.; Rezende Filho, Ary T.

    2015-01-01

    Four sediment cores were collected at different lakes of salty water, commonly known as 'Salinas', in the Nhecolandia Wetland. In the collected cores, Salina A, Salina 6, Salina M and Salina V, the elements As, Ba, Co, Cr, Cs, Fe, Hf, K, Na, Rb, Sb, Se, U, Zn and rare earth elements Ce, Eu, La, Lu, Nd, Sc, Sm, Tb and Yb concentrations were determined by instrumental neutron activation analysis (INAA) technique. Aiming to verify the best criterion to evaluate the enrichment factor of minor and major elements in the sediment cores, three different calculations of the enrichment factor was employed. The first one, EF (Enrichment Factor), compares the normalized element concentrations with Upper Continental Crust normalized values, the second one, GNF (Geochemical Normalization Factor) compares the ratio between the element concentration and the normalizer with the depth in the sediment core; for these both factors the element Sc was used as a normalizer element. The third one factor, BEF (Base Enrichment Factor), compares the concentrations determined throughout the core with the results obtained in the base of it. With the results, it was possible to conclude that the best enrichment factor to evaluate the enhancement of elements in natural environments is the one that takes into account the core element concentration obtained in the base of it, BEF. (author)

  5. Comparison of different enrichment factors to assess the natural accumulation of trace elements in sediment cores from Nhecolandia Pantanal, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Levi F.; Damatto, Sandra R., E-mail: leyi@usp.br, E-mail: damatto@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Barbiero, Laurent, E-mail: barbiero@ltmg.obs.mip.fr [Centro de Energia Nuclear na Agricultura (CENA/USP), Sao Paulo, SP (Brazil); Furian, Sonia M., E-mail: furian@usp.br [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Departamento de Geografia; Rezende Filho, Ary T., E-mail: ary.rezende@ufms.br [Universidade Federal do Mato Grosso do Sul (UFMS), MS (Brazil). Faculdade de Engenharias, Arquitetura e Urbanismo e Geografia

    2015-07-01

    Four sediment cores were collected at different lakes of salty water, commonly known as 'Salinas', in the Nhecolandia Wetland. In the collected cores, Salina A, Salina 6, Salina M and Salina V, the elements As, Ba, Co, Cr, Cs, Fe, Hf, K, Na, Rb, Sb, Se, U, Zn and rare earth elements Ce, Eu, La, Lu, Nd, Sc, Sm, Tb and Yb concentrations were determined by instrumental neutron activation analysis (INAA) technique. Aiming to verify the best criterion to evaluate the enrichment factor of minor and major elements in the sediment cores, three different calculations of the enrichment factor was employed. The first one, EF (Enrichment Factor), compares the normalized element concentrations with Upper Continental Crust normalized values, the second one, GNF (Geochemical Normalization Factor) compares the ratio between the element concentration and the normalizer with the depth in the sediment core; for these both factors the element Sc was used as a normalizer element. The third one factor, BEF (Base Enrichment Factor), compares the concentrations determined throughout the core with the results obtained in the base of it. With the results, it was possible to conclude that the best enrichment factor to evaluate the enhancement of elements in natural environments is the one that takes into account the core element concentration obtained in the base of it, BEF. (author)

  6. Distribution of 35 Elements in Peat Cores from Ombrotrophic Bogs Studied by Epithermal Neutron Activation Analysis

    CERN Document Server

    Frontasyeva, M V

    2004-01-01

    In ombrotrophic bogs the surface peat layer is supplied with chemical substances only from the atmosphere. Peat cores from these bogs therefore can be used to study temporal trends in atmospheric deposition of pollutants. In this work epithermal neutron activation analysis was applied for the first time to study the distribution of 35 elements in peat profiles from ombrotrophic bogs. The selected examples were from Finnmark county in northern Norway: one pristine site far from any local pollution source, and another strongly affected by long-term operation of Russian copper-nickel smelters located close to the border. The elements are classified with respect to their behavior in the uppermost 40 cm of the peat, and similarities and differences between the two profiles are discussed. As compared with other more commonly used analytical techniques based on acid decomposition of the sample ENAA has the advantage of providing the total concentrations of the elements.

  7. Examining the Possibility of Carbon as a Light Element in the Core of Mercury

    Science.gov (United States)

    Vander Kaaden, Kathleen; McCubbin, Francis M.; Turner, Amber; Ross, D. Kent

    2017-01-01

    Results from the MErcury Surface, Space ENvironment, GEochemistry and Ranging (MESSENGER) spacecraft have shown elevated abundances of C on the surface of Mercury. Peplowski et al. used GRS data from MESSENGER to show an average northern hemisphere abundance of C on the planet of 0 to 4.1 wt% C at the three-sigma detection limit. Confirmation of C on the planet prompts many questions regarding the role of C during the differentiation and evolution of Mercury. The elevated abundances of both S and C on Mercury's surface, coupled with the low abundances of iron, suggest that the oxygen fugacity of the planet is several log10 units below the Iron-Wustite buffer. These observations spark questions about the bulk composition of Mercury's core. This experimental study seeks to understand the impact of C as a light element on potential mercurian core compositions. In order to address this question, experiments were conducted at 1 GPa and a variety of temperatures (700 - 1500 C) on metal compositions ranging from Si5Fe95 to Si22Fe78, possibly representative of the mercurian core. All starting metals were completely enclosed in a graphite capsule to ensure C saturation at a given set of run conditions. All elements, including C, were analyzed using electron probe microanalysis. Precautions were taken to ensure accurate measurements of C with this technique including using the LDE2 crystal, the cold finger on the microprobe to minimize contamination and increase the vacuum, and an instrument with no oil based pumps. Based on the superliquidus experimental results in the present study, as Fe-rich cores become more Si-rich, the C content of that core composition will decrease. Furthermore, although C concentration at graphite saturation (CCGS) varies from a liquid to a solid, temperature does not seem to play a substantial role in CCGS, at least at 1 GPa.

  8. The Interplay of Opacities and Rotation in Promoting the Explosion of Core-Collapse Supernovae

    Science.gov (United States)

    Vartanyan, David; Burrows, Adam; Radice, David

    2018-01-01

    For over five decades, the mechanism of explosion in core-collapse supernovae has been a central unsolved problem in astrophysics, challenging both our computational capabilities and our understanding of relevant physics. Current simulations often produce explosions, but they are at times underenergetic. The neutrino mechanism, wherein a fraction of emitted neutrinos is absorbed in the mantle of the star to reignite the stalled shock, remains the dominant model for reviving explosions in massive stars undergoing core collapse. We present here a diverse suite of 2D axisymmetric simulations produced by FORNAX, a highly parallelizable multidimensional supernova simulation code. We explore the effects of various corrections, including the many-body correction, to neutrino-matter opacities and the possible role of rotation in promoting explosion amongst various core-collapse progenitors.

  9. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  10. Four regulatory elements in the human c-fos promoter mediate transactivation by HTLV-1 Tax protein.

    Science.gov (United States)

    Alexandre, C; Verrier, B

    1991-04-01

    Expression of the human c-fos proto-oncogene is activated in trans by the Tax protein encoded by human T-cell leukemia virus type-1 (HTLV-1). Indeed, we show here that a HeLa clone stably transfected by Tax expresses Fos at a high level. We also show that multiple elements of the human c-fos promoter, i.e. the v-sis conditioned medium inducible element (SIE), the dyad symmetry element (DSE) necessary for growth factor induction, the octanucleotide direct repeat element (DR), and the cyclic AMP response element (CRE) centred at -60, can all mediate Tax transactivation. In the DSE, the 10bp central core that binds the serum response factor (SRF) is, by itself, sufficient to mediate Tax transactivation. Moreover, a CRE-binding protein is involved in Tax activation through the CRE-60 element. Since Fos is a transregulator of cellular genes, our results suggest that the oncoprotein plays a crucial role in T-cell transformation by HTLV-1 in conjunction with other Tax-inducible genes.

  11. Provenance of whitefish in the Gulf of Bothnia determined by elemental analysis of otolith cores

    Science.gov (United States)

    Lill, J.-O.; Finnäs, V.; Slotte, J. M. K.; Jokikokko, E.; Heimbrand, Y.; Hägerstrand, H.

    2018-02-01

    The strontium concentration in the core of otoliths was used to determine the provenance of whitefish found in the Gulf of Bothnia, Baltic Sea. To that end, a database of strontium concentration in fish otoliths representing different habitats (sea, river and fresh water) had to be built. Otoliths from juvenile whitefish were therefore collected from freshwater ponds at 5 hatcheries, from adult whitefish from 6 spawning sites at sea along the Finnish west coast, and from adult whitefish ascending to spawn in the Torne River, in total 67 otoliths. PIXE was applied to determine the elemental concentrations in these otoliths. While otoliths from the juveniles raised in the freshwater ponds showed low but varying strontium concentrations (194-1664 μg/g,), otoliths from sea-spawning fish showed high uniform strontium levels (3720-4333 μg/g). The otolith core analysis of whitefish from Torne River showed large variations in the strontium concentrations (1525-3650 μg/g). These otolith data form a database to be used for provenance studies of wild adult whitefish caught at sea. The applicability of the database was evaluated by analyzing the core of polished otoliths from 11 whitefish from a test site at sea in the Larsmo archipelago. Our results show that by analyzing strontium in the otolith core, we can differentiate between hatchery-origin and wild-origin whitefish, but not always between river and sea spawning whitefish.

  12. Vibration Finite Element Analysis of SC10 Dry-type Transformer Core

    Directory of Open Access Journals (Sweden)

    Gao Sheng Wei

    2014-06-01

    Full Text Available As the popularization and application of dry-type power transformer, its work when the vibration noise problem widely concerned, on the basis of time-varying electromagnetic field and structural mechanics equation, this paper established a finite element analysis model of dry-type transformer, through the electromagnetic field – Structural mechanics field – sound field more than physical field coupling calculation analysis, obtained in no load and the vibration modes of the core under different load and frequency. According to the transformer vibration mechanism, compared with the experimental data, verified the accuracy of the calculation results, as the core of how to provide the theory foundation and to reduce the noise of the experiment.

  13. Monte Carlo neutronics analysis of the ANS reactor three-element core design

    International Nuclear Information System (INIS)

    Wemple, C.A.

    1995-01-01

    The advanced neutron source (ANS) is a world-class research reactor and experimental center for neutron research, currently being designed at the Oak Ridge National Laboratory (ORNL). The reactor consists of a 330-MW(fission) highly enriched uranium core, which is cooled, moderated, and reflected with heavy water. It was designed to be the preeminent ultrahigh neutron flux reactor in the world, with facilities for research programs in biology, materials science, chemistry, fundamental and nuclear physics, and analytical chemistry. Irradiation facilities are provided for a variety of isotope production capabilities, as well as materials irradiation. This paper summarizes the neutronics efforts at the Idaho National Engineering Laboratory in support of the development and analysis of the three-element core for the advanced conceptual design phase

  14. Investigation of equilibrium core by recycling MA and LLFP in fast reactor cycle. 2. Investigation of LLFP confined in Equilibrium Core with element separation

    International Nuclear Information System (INIS)

    Mizutani, Akihiko; Shono, Akira; Ishikawa, Makoto

    2000-02-01

    A feasibility study has been performed on a self-consistent fuel cycle system in the nuclear fuel recycle system with fast reactors. In this system, the self-generated MAs (Minor Actinides) and LLFPs (Long-Lived Fission Products) are confined and incinerated in the fast reactor, which is called the 'Equilibrium Core' concept. However, as the isotope separations for selected LLFPs have been assumed in this cycle system, it seems that this assumption is far from realistic one from the viewpoint of economy with respect to the fuel cycle system. In this study, the possibility for realization of the 'Equilibrium Core' concept is evaluated for three fuel types such as oxide, nitride and metallic fuels, provided that the isotopic separation of LLFPs is changed to the element one. This study provides, that is to say, how many LLFP elements can be confined in the 'Equilibrium Core' with element separation. This report examines the nuclear properties of the Equilibrium Core' for various combinations of LLFP incineration schemes from the viewpoints of the risk of geological disposal and the limit in confinable quantity of LLFPs. From the viewpoint of the risk of geological disposal estimated by the retardation factor, it is possible to confine with element separation for Tc, I and Se even in the oxide fueled core. From the standpoint of the limit of confinable amounts of LLFPs, on the other hand, Tc, I, Se, Sn and Cs can be confined with element separate only in case that the nitride fuel is chosen. (author)

  15. Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element.

    Science.gov (United States)

    Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin

    2015-03-01

    The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

  16. Core Promoter Plasticity Between Maize Tissues and Genotypes Contrasts with Predominance of Sharp Transcription Initiation Sites.

    Science.gov (United States)

    Mejía-Guerra, María Katherine; Li, Wei; Galeano, Narmer F; Vidal, Mabel; Gray, John; Doseff, Andrea I; Grotewold, Erich

    2015-12-01

    Core promoters are crucial for gene regulation, providing blueprints for the assembly of transcriptional machinery at transcription start sites (TSSs). Empirically, TSSs define the coordinates of core promoters and other regulatory sequences. Thus, experimental TSS identification provides an essential step in the characterization of promoters and their features. Here, we describe the application of CAGE (cap analysis of gene expression) to identify genome-wide TSSs used in root and shoot tissues of two maize (Zea mays) inbred lines (B73 and Mo17). Our studies indicate that most TSS clusters are sharp in maize, similar to mice, but distinct from Arabidopsis thaliana, Drosophila melanogaster, or zebra fish, in which a majority of genes have broad-shaped TSS clusters. We established that ∼38% of maize promoters are characterized by a broader TATA-motif consensus, and this motif is significantly enriched in genes with sharp TSSs. A noteworthy plasticity in TSS usage between tissues and inbreds was uncovered, with ∼1500 genes showing significantly different dominant TSSs, sometimes affecting protein sequence by providing alternate translation initiation codons. We experimentally characterized instances in which this differential TSS utilization results in protein isoforms with additional domains or targeted to distinct subcellular compartments. These results provide important insights into TSS selection and gene expression in an agronomically important crop. © 2015 American Society of Plant Biologists. All rights reserved.

  17. Core elements of hospital antibiotic stewardship programs from the Centers for Disease Control and Prevention.

    Science.gov (United States)

    Pollack, Loria A; Srinivasan, Arjun

    2014-10-15

    The proven benefits of antibiotic stewardship programs (ASPs) for optimizing antibiotic use and minimizing adverse events, such as Clostridium difficile and antibiotic resistance, have prompted the Centers for Disease Control and Prevention (CDC) to recommend that all hospitals have an ASP. This article summarizes Core Elements of Hospital Antibiotic Stewardship Programs, a recently released CDC document focused on defining the infrastructure and practices of coordinated multidisciplinary programs to improve antibiotic use and patient care in US hospitals. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  18. Global shielding analysis of the 2-element ANS core and reflector with photoneutrons

    International Nuclear Information System (INIS)

    Bucholz, J.A.

    1996-01-01

    This paper describes the initial global 2-D shielding analyses for the 2-element, heavy-water cooled and reflected Advanced Neutron Source reactor which was to have been built in Oak Ridge, Tennessee. The portion of the system analyzed encompassed the highly enriched core, the 1.5-m-thick heavy-water reflector, the aluminum reflector vessel, and the first 0.2 m of light water beyond the reflector vessel. While some results are presented, this paper focuses primarily on the lessons learned during the analysis of this rather unique system

  19. Reactivity And Neutron Flux At Silicide Fuel Element In The Core Of RSG-GAS

    International Nuclear Information System (INIS)

    Hamzah, Amir

    2000-01-01

    In order to 4.8 and 5.2 gr U/cm exp 3 loading of U 3 Si 2 --Al fuel plates characterization, he core reactivity change and neutron flux depression had been done. Control rod calibration method was used to reactivity change measurement and neutron flux distribution was measured using foil activation method. Measurement of insertion of A-type of testing fuel element with U-loading above cannot be done due to technical reason, so the measurement using full type silicide fuel element of 2.96 gr U/cm exp 3 loading. The reactivity change measurement result of insertion in A-9 and C-3 is + 2.67 cent. The flux depression at silicide fuel in A-9 is 1.69 times bigger than oxide and in C-3 is 0.68 times lower than oxide

  20. Fuel elements in the core of the reactor Pegase. Description, successive improvements, actual possibilities

    International Nuclear Information System (INIS)

    Desandre-Navarre, Ch.; Lerouge, B.; Schwartz, J.P.

    1967-01-01

    The core of the research reactor Pegase, in operation at the Cadarache Nuclear Research Centre since 1983, contains fuel elements made from rolled plates of an aluminium-enriched uranium alloy whose characteristics have been changed several times. This report describes the modifications which have been made to these fuel elements with a view both to improving the technical qualities of the reactor and to decreasing its operational costs. Special attention is paid to the neutron aspects of the topic and in particular to the problem of the long-term modification of the reactivity. The 1966 results (30 per cent burn-up associated with only slight movement of the control rods) are particularly satisfying and can probably still be improved in the future. (authors) [fr

  1. Ultrafast vortex core dynamics investigated by finite-element micromagnetic simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gliga, Sebastian

    2010-07-01

    The investigations carried out in this thesis concern the ultrafast dynamics of a fundamental micromagnetic configuration: the vortex. Over the past decade, a detailed understanding of the dynamic and static properties of such magnetic nanostructures has been achieved as a result of close interplay between experiments, theory and numeric simulations. Here, micromagnetic simulations were performed based on the finite-element method. The vortex structure arises in laterally-confined ferromagnets, in particular in thin-film elements, and is characterized by an in-plane curling of the magnetic moments around a very stable and narrow core. In the present study, a novel process in micromagnetism was found: the ultrafast reversal of the vortex core. The possibility of easily switching the core orientation by means of short in-plane field pulses is surprising in view of the very high stability of the core. Moreover, the simulations presented here showed that this reversal process unfolds on a time scale of only a few tens of picoseconds, which leads to the prediction of the fastest and most complex micromagnetic reversal process known to date. Indeed, the vortex core is not merely switched: it is destroyed and recreated in the immediate vicinity with an opposite direction. This is mediated by a rapid sequence of vortex-antivortex pair creation and annihilation subprocesses and results in a sudden burst-like emission of spin waves. Equally fascinating is the ultrafast dynamics of an isolated magnetic antivortex, the topological counterpart of the vortex. The simulations performed here showed that the static complementarity between vortices and antivortices is equally reflected in their ultrafast dynamics, which leads to the reversal of the antivortex core. A promising means for the control of the magnetization on the nanoscale consists in exploiting the spin-transfer torque effect. The study of the current-induced dynamics of vortices showed that the core reversal can be

  2. Core elements of physiotherapy in cerebral palsy children: proposal for a trial checklist.

    Science.gov (United States)

    Meghi, P; Rossetti, L; Corrado, C; Maran, E; Arosio, N; Ferrari, A

    2012-03-01

    Currently international literature describes physiotherapy in cerebral palsy (CP) children only in generic terms (traditional / standard / background / routine). The aim of this study is to create a checklist capable of describing the different modalities employed in physiotherapeutic treatment by means of a non-bias, common, universal, standardised language. A preliminary checklist was outlined by a group of physiotherapists specialised in child rehabilitation. For its experimentation, several physiotherapists from various paediatric units from all over Italy with different methodological approaches and backgrounds, were involved. Using the interpretative model, proposed by Ferrari et al., and through collective analysis and discussion of clinical videos, the core elements were progressively selected and codified. A reliability study was then carried out by eight expert physiotherapists using an inter-rate agreement model. The checklist analyses therapeutic proposals of CP rehabilitation through the description of settings, exercises and facilitations and consists of items and variables which codify all possible physiotherapeutic interventions. It is accompanied by written explanations, demonstrative videos, caregiver interviews and descriptions of applied environmental adaptations. All checklist items obtained a high level of agreement (according to Cohen's kappa coefficient), revealing that the checklist is clearly and easily interpretable. The checklist should facilitate interaction and communication between specialists and families, and lead to comparable research studies and scientific advances. The main value is to be able to correlate therapeutic results with core elements of adopted physiotherapy.

  3. Regulatory inspection practices on fuel elements and core lay-out at NPPs

    International Nuclear Information System (INIS)

    Van Binnebeek, J.J.; Liuhto, Pekka; Badel, D.; Klonk, H.; Seidel, F.; Fichtinger, G.; Manzella, P.; Koizumi, Hiroyoshi; Delgado, Jose Luis; Gutierrez Ruiz, Luis Miguel; Bouvrie, E. des; Gil, J.; Forsberg, Staffan; Wand, H.; Warren, Tom; Gallo, R.

    1998-01-01

    The basic description of the reactor core of a nuclear power plant (NPP) is an important part of the Safety Analysis Report in all countries. Due to increased interest by regulatory authorities in the Member countries, in 1996 WGIP proposed looking at inspection aspects on fuel elements and core lay-out at nuclear power plants. The CNRA subsequently approved proceeding with this report. The report deals primarily with inspection practices and inspection requirements during nuclear power plant (NPP) operation with special emphasis on refuelling procedures. All license related topics, such as fuel and core design (mechanical, neutronic, thermal-hydraulic), as well as inspection philosophy and practices on fuel fabrication are included as appropriate serving as background information and may not be completely described. WGIP members describe their country's inspection programme according to the structure of a questionnaire (appendix 1). The individual contributions are contained in the appendix 2 and are compiled within the main chapters (1 through 3). Report Structure: 1. Licensing and Quality Assurance (QA) requirements for nuclear fuel; 2. Regulatory inspection programme during NPP operation and refuelling outages; 3. Procedures for inspection practices and inspection programme. Appendix: Questionnaire and Country specific contributions. Contributions are presented by Belgium, Finland, France, Germany, Hungary, Italy, Japan, Mexico, The Netherlands, Spain, Sweden, Switzerland, United Kingdom, USA

  4. Features and validation of discrete element method for simulating pebble flow in reactor core

    International Nuclear Information System (INIS)

    Xu Yong; Li Yanjie

    2005-01-01

    The core of a High-Temperature Gas-cooled Reactor (HTGR) is composed of big number of fuel pebbles, their kinetic behaviors are of great importance in estimating the path and residence time of individual pebble, the evolution of the mixing zone for the assessment of the efficiency of a reactor. Numerical method is highlighted in modern reactor design. In view of granular flow, the Discrete Element Model based on contact mechanics of spheres was briefly described. Two typical examples were presented to show the capability of the DEM method. The former is piling with glass/steel spheres, which provides validated evidences that the simulated angles of repose are in good coincidence with the experimental results. The later is particle discharge in a flat- bottomed silo, which shows the effects of material modulus and demonstrates several features. The two examples show the DEM method enables to predict the behaviors, such as the evolution of pebble profiles, streamlines etc., and provides sufficient information for pebble flow analysis and core design. In order to predict the cyclic pebble flow in a HTGR core precisely and efficiently, both model and code improvement are needed, together with rational specification of physical properties with proper measuring techniques. Strategic and methodological considerations were also discussed. (authors)

  5. LIGHT-WEIGHT LOAD-BEARING STRUCTURES REINFORCED BY CORE ELEMENTS MADE OF SEGMENTS AND A METHOD OF CASTING SUCH STRUCTURES

    DEFF Research Database (Denmark)

    2009-01-01

    The invention relates to a light-weight load-bearing structure, reinforced by core elements (2) of a strong material constituting one or more compression or tension zones in the structure to be cast, which core (2) is surrounded by or adjacent to a material of less strength compared to the core (2......), where the core (2) is constructed from segments (1) of core elements (2) assembled by means of one or more prestressing elements (4). The invention further relates to a method of casting of light-weight load-bearing structures, reinforced by core elements (2) of a strong material constituting one...... or more compression or tension zones in the structure to be cast, which core (2) is surrounded by or adjacent to a material of less strength compared to the core (2), where the core (2) is constructed from segments (1) of core elements (2) assembled and hold together by means of one or more prestressing...

  6. Analysis of 2D reactor core using linear perturbation theory and nodal finite element methods

    International Nuclear Information System (INIS)

    Adrian Mugica; Edmundo del Valle

    2005-01-01

    In this work the multigroup steady state neutron diffusion equations are solved using the nodal finite element method (NFEM) and the Linear Perturbation Theory (LPT) for XY geometry. The NFEM used corresponds to the Raviart-Thomas schemes RT0 and RT1, interpolating 5 and 12 parameters respectively in each node of the space discretization. The accuracy of these methods is related with the dimension of the space approximation and the mesh size. Therefore, using fine meshes and the RT0 or RT1 nodal methods leads to a large an interesting eigenvalue problem. The finite element method used to discretize the weak formulation of the diffusion equations is the Galerkin one. The algebraic structure of the discrete eigenvalue problem is obtained and solved using the Wielandt technique and the BGSTAB iterative method using the SPARSKIT package developed by Yousef Saad. The results obtained with LPT show good agreement with the results obtained directly for the perturbed problem. In fact, the cpu time to solve a single problem, the unperturbed and the perturbed one, is practically the same but when one is focused in shuffling many times two different assemblies in the core then the LPT technique becomes quite useful to get good approximations in a short time. This particular problem was solved for one quarter-core with NFEM. Thus, the computer program based on LPT can be used to perform like an analysis tool in the fuel reload optimization or combinatory analysis to get reload patterns in nuclear power plants once that it had been incorporated with the thermohydraulic aspects needed to simulate accurately a real problem. The maximum differences between the NFEM and LPT for the three LWR reactor cores are about 250 pcm. This quantity is considered an acceptable value for this kind of analysis. (authors)

  7. Historical accumulation of Trace elements in sediment cores from Tiete river, Sao Paulo, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Damatto, S.; Rocha, F.; Baumgardt, D.; Martins, L.; Silva, P.; Favaro, D. [IPEN-CNEN (Brazil)

    2014-07-01

    Tiete River, with 1100 km of extension, is one of the most economically important river of the state of Sao Paulo, Brazil and throughout its length can be found reservoirs formed by damming its waters. This river is considered one of the most polluted rivers in the world, especially when it passes through the city of Sao Paulo. As a result of pollution observed since the 1950's, a project was established with the aim of evaluating the historic concentration of the trace elements As, Ba, Br, Ca, Ce, Co, Cr, Cs, Eu, Fe, Hf, La, Lu, Na, Nd, Rb, Sb, Sc, Sm, Ta, Tb, Th, U, Yb and Zn (mg.kg{sup -1}), in sediment cores dated by {sup 210}Pb method, sampled is several points of the river, since its source in Salesopolis up the mouth, on the Parana River. This work presents the results obtained by the trace elements above determined in two sediment cores collected in reservoirs in the city of Salesopolis and Pirapora do Bom Jesus. The analytical techniques used for the analysis were instrumental neutron activation analysis and gross beta measurement, respectively. The results obtained for the elements Br, Ce, Cr, Cs, Eu, Nd, Sb, Sm, Th and U are higher than the values of Upper Continental Crust and the sedimentation rate obtained for the reservoir in Salesopolis, 1.53 cm.y{sup -1}, suggest silting processes. The enrichment factor and the geo-accumulation index were used to assess the presence of anthropogenic sources of pollution. Document available in abstract form only. (authors)

  8. Recognition of Core Elements of Medical Professionalism among Medical Students and Faculty Members

    Directory of Open Access Journals (Sweden)

    irdous Jahan

    2016-05-01

    Full Text Available Objectives: Medical students and future physicians have chosen to pursue a profession that requires personal integrity, compassion and a constant awareness of the commitment made by them. Professionalism includes personal behaviors, knowledge, and competency. It includes the attitudes and values one holds and that run through the profession as a whole. Medical students learn professionalism during the course by either direct teaching or experiential learning. We conducted this study to estimate the self-reported level of practice of the core elements of professionalism by medical students and medical faculty and compared the two groups. Methods: One-hundred and nine students and 83 faculty members of Oman Medical College completed a professionalism questionnaire. The survey questions related to core elements of professionalism and were grouped under professional knowledge, professional skills, professional attitude, and qualities essential for professionalism. Results: The response rate was 65.6% (109 of 166 among students and 75.5% (83 of 110 from faculty members. Response to the questions on professional skills between the student and faculty group was significantly different (p < 0.001. Similarly, there was a significant difference in the responses related to professional attitude between the student and faculty group (p < 0.001. Students and faculty members have a significant difference in opinion regarding up to date knowledge of basic and clinical sciences and clinical competency (p = 0.024. Similarly, significant differences in opinion regarding up to date knowledge of basic and clinical sciences and clinical competency in clinical and basic sciences faculty members (p = 0.001. Students identified good communication skills (82.6%, and faculty staff identified up to date professional knowledge (62.7% as the most important aspect of professionalism. Conclusions: Both students and teaching faculty agreed that the top most professional

  9. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  10. Fuel element burnup measurements for the equilibrium LEU silicide RSG GAS (MPR-30) core under a new fuel management strategy

    International Nuclear Information System (INIS)

    Pinem, Surian; Liem, Peng Hong; Sembiring, Tagor Malem; Surbakti, Tukiran

    2016-01-01

    Highlights: • Burnup measurement of fuel elements comprising the new equilibrium LEU silicide core of RSG GAS. • The burnup measurement method is based on a linear relationship between reactivity and burnup. • Burnup verification was conducted using an in-house, in-core fuel management code BATAN-FUEL. • A good agreement between the measured and calculated burnup was confirmed. • The new fuel management strategy was confirmed and validated. - Abstract: After the equilibrium LEU silicide core of RSG GAS was achieved, there was a strong need to validate the new fuel management strategy by measuring burnup of fuel elements comprising the core. Since the regulatory body had a great concern on the safety limit of the silicide fuel element burnup, amongst the 35 burnt fuel elements we selected 22 fuel elements with high burnup classes i.e. from 20 to 53% loss of U-235 (declared values) for the present measurements. The burnup measurement method was based on a linear relationship between reactivity and burnup where the measurements were conducted under subcritical conditions using two fission counters of the reactor startup channel. The measurement results were compared with the declared burnup evaluated by an in-house in-core fuel management code, BATAN-FUEL. A good agreement between the measured burnup values and the calculated ones was found within 8% uncertainties. Possible major sources of differences were identified, i.e. large statistical errors (i.e. low fission counters’ count rates), variation of initial U-235 loading per fuel element and accuracy of control rod indicators. The measured burnup of the 22 fuel elements provided the confirmation of the core burnup distribution planned for the equilibrium LEU silicide core under the new fuel management strategy.

  11. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  12. Ab initio effective core potentials for molecular calculations. Potentials for main group elements Na to Bi

    International Nuclear Information System (INIS)

    Wadt, W.R.; Hay, P.J.

    1985-01-01

    A consistent set of ab initio effective core potentials (ECP) has been generated for the main group elements from Na to Bi using the procedure originally developed by Kahn. The ECP's are derived from all-electron numerical Hartree--Fock atomic wave functions and fit to analytical representations for use in molecular calculations. For Rb to Bi the ECP's are generated from the relativistic Hartree--Fock atomic wave functions of Cowan which incorporate the Darwin and mass--velocity terms. Energy-optimized valence basis sets of (3s3p) primitive Gaussians are presented for use with the ECP's. Comparisons between all-electron and valence-electron ECP calculations are presented for NaF, NaCl, Cl 2 , Cl 2 - , Br 2 , Br 2 - , and Xe 2 + . The results show that the average errors introduced by the ECP's are generally only a few percent

  13. Conceptual Elements: A Detailed Framework to Support and Assess Student Learning of Biology Core Concepts

    Science.gov (United States)

    Cary, Tawnya; Branchaw, Janet

    2017-01-01

    The Vision and Change in Undergraduate Biology Education: Call to Action report has inspired and supported a nationwide movement to restructure undergraduate biology curricula to address overarching disciplinary concepts and competencies. The report outlines the concepts and competencies generally but does not provide a detailed framework to guide the development of the learning outcomes, instructional materials, and assessment instruments needed to create a reformed biology curriculum. In this essay, we present a detailed Vision and Change core concept framework that articulates key components that transcend subdisciplines and scales for each overarching biological concept, the Conceptual Elements (CE) Framework. The CE Framework was developed using a grassroots approach of iterative revision and incorporates feedback from more than 60 biologists and undergraduate biology educators from across the United States. The final validation step resulted in strong national consensus, with greater than 92% of responders agreeing that each core concept list was ready for use by the biological sciences community, as determined by scientific accuracy and completeness. In addition, we describe in detail how educators and departments can use the CE Framework to guide and document reformation of individual courses as well as entire curricula. PMID:28450444

  14. A finite element thermal analysis of various dowel and core materials

    Directory of Open Access Journals (Sweden)

    Shanti Varghese

    2012-01-01

    Conclusion: Non-metallic dowel and core materials such as fibre reinforced composite dowels (FRC generate greater stress than metallic dowel and core materials. This emphasized the preferable use of the metallic dowel and core materials in the oral environment.

  15. Mitochondrial Respiration Is Reduced in Atherosclerosis, Promoting Necrotic Core Formation and Reducing Relative Fibrous Cap Thickness.

    Science.gov (United States)

    Yu, Emma P K; Reinhold, Johannes; Yu, Haixiang; Starks, Lakshi; Uryga, Anna K; Foote, Kirsty; Finigan, Alison; Figg, Nichola; Pung, Yuh-Fen; Logan, Angela; Murphy, Michael P; Bennett, Martin

    2017-12-01

    Mitochondrial DNA (mtDNA) damage is present in murine and human atherosclerotic plaques. However, whether endogenous levels of mtDNA damage are sufficient to cause mitochondrial dysfunction and whether decreasing mtDNA damage and improving mitochondrial respiration affects plaque burden or composition are unclear. We examined mitochondrial respiration in human atherosclerotic plaques and whether augmenting mitochondrial respiration affects atherogenesis. Human atherosclerotic plaques showed marked mitochondrial dysfunction, manifested as reduced mtDNA copy number and oxygen consumption rate in fibrous cap and core regions. Vascular smooth muscle cells derived from plaques showed impaired mitochondrial respiration, reduced complex I expression, and increased mitophagy, which was induced by oxidized low-density lipoprotein. Apolipoprotein E-deficient (ApoE -/- ) mice showed decreased mtDNA integrity and mitochondrial respiration, associated with increased mitochondrial reactive oxygen species. To determine whether alleviating mtDNA damage and increasing mitochondrial respiration affects atherogenesis, we studied ApoE -/- mice overexpressing the mitochondrial helicase Twinkle (Tw + /ApoE -/- ). Tw + /ApoE -/- mice showed increased mtDNA integrity, copy number, respiratory complex abundance, and respiration. Tw + /ApoE -/- mice had decreased necrotic core and increased fibrous cap areas, and Tw + /ApoE -/- bone marrow transplantation also reduced core areas. Twinkle increased vascular smooth muscle cell mtDNA integrity and respiration. Twinkle also promoted vascular smooth muscle cell proliferation and protected both vascular smooth muscle cells and macrophages from oxidative stress-induced apoptosis. Endogenous mtDNA damage in mouse and human atherosclerosis is associated with significantly reduced mitochondrial respiration. Reducing mtDNA damage and increasing mitochondrial respiration decrease necrotic core and increase fibrous cap areas independently of changes in

  16. Device for relocating fuel elements and control rods in a core reactor

    International Nuclear Information System (INIS)

    Hoffmeister, B.; Schwarz, W.

    1976-01-01

    A device is described for changing the location of fuel elements and control rods in a core reactor with a guiding mast which is mounted on a movable working platform for rotation about a vertical axis and which is provided with a gripping body for grasping the fuel elements and control rods, said gripping body being suspended on a lifting mechanism and being displaceable in vertical direction within the guiding mast while being prevented from rotating relative to the guiding mast. The device furthermore comprises winding means for storing supply lines which are introduced at the top into the guiding mast and the gripper body. The device also includes power operated means for actuating the lifting mechanism. The winding means and lifting mechanism rotate with the mast and are so arranged in the mast that any water dripping therefrom runs down the inside of the mast. Supply conduits leading to the mast are connected thereby by slack loops which permit 360 0 of rotation of the mast. 11 claims, 6 drawing figures

  17. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  18. Finite element program ARKAS: verification for IAEA benchmark problem analysis on core-wide mechanical analysis of LMFBR cores

    International Nuclear Information System (INIS)

    Nakagawa, M.; Tsuboi, Y.

    1990-01-01

    ''ARKAS'' code verification, with the problems set in the International Working Group on Fast Reactors (IWGFR) Coordinated Research Programme (CRP) on the inter-comparison between liquid metal cooled fast breeder reactor (LMFBR) Core Mechanics Codes, is discussed. The CRP was co-ordinated by the IWGFR around problems set by Dr. R.G. Anderson (UKAEA) and arose from the IWGFR specialists' meeting on The Predictions and Experience of Core Distortion Behaviour (ref. 2). The problems for the verification (''code against code'') and validation (''code against experiment'') were set and calculated by eleven core mechanics codes from nine countries. All the problems have been completed and were solved with the core structural mechanics code ARKAS. Predictions by ARKAS agreed very well with other solutions for the well-defined verification problems. For the validation problems based on Japanese ex-reactor 2-D thermo-elastic experiments, the agreements between measured and calculated values were fairly good. This paper briefly describes the numerical model of the ARKAS code, and discusses some typical results. (author)

  19. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  20. Study The Effect Extension Of Fuel Element Life Time In The Core Small Power Reactor

    International Nuclear Information System (INIS)

    Dewita, E.; Rusli, A.; Tuka, V.

    1998-01-01

    Mini power reactor is a low power nuclear reactor which mostly are designed especially to supply energy demand in the remote areas, such as for electricity generation, industries, desalination and district heating.The goal of the operation cycle extension to 3 - 5 years is to maximize the use of the fuel in order to achieve much cheaper energy generated. From the stand point of fuel element, in order to maximize the fuel life time there is a need to see all possible effects of extended life time to the fuel behavior in the core. This study has been carried out in order to obtain the understanding on all influencing factors to the fuel element behaviors at extended operation cycle whose results are expected to be useful as the input to fuel design and fabrication. The study has show that the material selection for fuel and cladding materials are the essential factor in maximizing the fuel life time. Development of cladding and fuel materials has been done, and shown that the new zirconium alloy, zircaloy, having composition of Zr-1,0 Sn-0,27 Fe-0,16 Cr-0,1 Nb-0,01 Ni has higher corrosion resistance and mechanical characteristics better than that of the standard zircaloy-4. Adding the Nb content (0,005-0,2 wt %), decreasing the Sn content until 0,5 wt %, and decreasing the ratio of Fe/Cr from 0,6 to 0,5 can increase resistance to corrosion, while decreasing the ratio of Fe and Cr from 0,3 to 0,7 wt % can increase the mechanical characteristics. To enhance the resistance to nodular corrosion in the BWR system, adding the Nb-Mo, Nb-W and Nb-V at low Sn zircaloy-2 can be done. In improving the fuel element it has been shown that adding niobium (Nb 2 O 5 -0,3 wt %) can enlarge the particle size of fuel hence improving the fuel performance

  1. Heat Storage Performance of the Prefabricated Hollow Core Concrete Deck Element with Integrated Microencapsulated Phase Change Material

    DEFF Research Database (Denmark)

    Pomianowski, Michal Zbigniew; Heiselberg, Per; Jensen, Rasmus Lund

    2012-01-01

    The paper presents the numerically calculated dynamic heat storage capacity of the prefabricated hollow core concrete deck element with and without microencapsulated phase change material (PCM). The reference deck is the ordinary deck made of standard concrete material and that is broadly used...

  2. Assessment of core characteristics during transition from 37-element fuel to CANFLEX-NU fuel in CANDU 6

    International Nuclear Information System (INIS)

    Jeong, Chang Joon; Suk, Ho Chun

    2002-01-01

    A transition from 37-element natural uranium fuel to CANFLEX-NU fuel has been modeled in a 1200-day time-dependent fuel management simulation for a CANDU 6 reactor. The simulation was divided into three parts. The pre-transition period extended from 0 to 300 FPD, in which the reactor was fuelled only with standard 37-element fuel bundles. In the transition period, refueling took place only with the CANFLEX-NU fuel bundle. The transition stage lasted from 300 to 920 FPD, at which point all of the 37-element fuel in the core had been replaced by CANFLEX-NU fuel bundle. In the post-transition phase, refueling continued with CANFLEX-NU fuel until 1200 FPD, to arrive at estimate of the equilibrium core characteristics with CANFLEX-NU fuel. Simulation results show that the CANFLEX-NU fuel bundle has a operational compatibility with the CANDU 6 reactor during the transition core, and also show that the transition core from 37-element natural uranium fuel to CANFLEX-NU can be operated without violating any license limit of the CANDU 6 reactor

  3. Anisotropic anti-resonant elements gives broadband single-mode low-loss hollow-core fibers

    DEFF Research Database (Denmark)

    Habib, Selim; Bang, Ole; Bache, Morten

    2016-01-01

    Hollow-core fibers with node-free anisotropic anti-resonant elements give broadband low-loss fibers that are also single-moded. At 1.06 μm silica-based fiber designs show higher-order-mode extinction-ratio >1000 and losses below 10 dB/km over a broad wavelength range....

  4. Major and trace elements in Mahogany zone oil shale in two cores from the Green River Formation, piceance basin, Colorado

    Science.gov (United States)

    Tuttle, M.L.; Dean, W.E.; Parduhn, N.L.

    1983-01-01

    The Parachute Creek Member of the lacustrine Green River Formation contains thick sequences of rich oil-shale. The richest sequence and the richest oil-shale bed occurring in the member are called the Mahogany zone and the Mahogany bed, respectively, and were deposited in ancient Lake Uinta. The name "Mahogany" is derived from the red-brown color imparted to the rock by its rich-kerogen content. Geochemical abundance and distribution of eight major and 18 trace elements were determined in the Mahogany zone sampled from two cores, U. S. Geological Survey core hole CR-2 and U. S. Bureau of Mines core hole O1-A (Figure 1). The oil shale from core hole CR-2 was deposited nearer the margin of Lake Uinta than oil shale from core hole O1-A. The major- and trace-element chemistry of the Mahogany zone from each of these two cores is compared using elemental abundances and Q-mode factor modeling. The results of chemical analyses of 44 CR-2 Mahogany samples and 76 O1-A Mahogany samples are summarized in Figure 2. The average geochemical abundances for shale (1) and black shale (2) are also plotted on Figure 2 for comparison. The elemental abundances in the samples from the two cores are similar for the majority of elements. Differences at the 95% probability level are higher concentrations of Ca, Cu, La, Ni, Sc and Zr in the samples from core hole CR-2 compared to samples from core hole O1-A and higher concentrations of As and Sr in samples from core hole O1-A compared to samples from core hole CR-2. These differences presumably reflect slight differences in depositional conditions or source material at the two sites. The Mahogany oil shale from the two cores has lower concentrations of most trace metals and higher concentrations of carbonate-related elements (Ca, Mg, Sr and Na) compared to the average shale and black shale. During deposition of the Mahogany oil shale, large quantities of carbonates were precipitated resulting in the enrichment of carbonate-related elements

  5. Integrator element as a promoter of active learning in engineering teaching

    Science.gov (United States)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  6. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  7. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  8. Effective elements of school health promotion across behavioral domains: a systematic review of reviews

    Directory of Open Access Journals (Sweden)

    Peters Louk WH

    2009-06-01

    Full Text Available Abstract Background Most school health education programs focus on a single behavioral domain. Integrative programs that address multiple behaviors may be more efficient, but only if the elements of change are similar for these behaviors. The objective of this study was to examine which effective elements of school health education are similar across three particular behavioral domains. Methods A systematic review of reviews of the effectiveness of school-based health promotion programs was conducted for the domains of substance abuse, sexual behavior, and nutrition. The literature search spanned the time period between 1995 and October 2006 and included three databases, websites of review centers and backward search. Fifty-five reviews and meta-analyses met predetermined relevance and publication criteria and were included. Data was extracted by one reviewer and checked by a second reviewer. A standardized data extraction form was used, with detailed attention to effective elements pertaining to program goals, development, content, methods, facilitator, components and intensity. Two assessors rated the quality of reviews as strong, moderate or weak. We included only strong and moderate reviews in two types of analysis: one based on interpretation of conflicting results, the other on a specific vote-counting rule. Results Thirty six reviews were rated strong, 6 moderate, and 13 weak. A multitude of effective elements was identified in the included reviews and many elements were similar for two or more domains. In both types of analysis, five elements with evidence from strong reviews were found to be similar for all three domains: use of theory; addressing social influences, especially social norms; addressing cognitive-behavioral skills; training of facilitators; and multiple components. Two additional elements had positive results in all domains with the rule-based method of analysis, but had inconclusive results in at least one domain with

  9. Nucleoporins as components of the nuclear pore complex core structure and Tpr as the architectural element of the nuclear basket.

    Science.gov (United States)

    Krull, Sandra; Thyberg, Johan; Björkroth, Birgitta; Rackwitz, Hans-Richard; Cordes, Volker C

    2004-09-01

    The vertebrate nuclear pore complex (NPC) is a macromolecular assembly of protein subcomplexes forming a structure of eightfold radial symmetry. The NPC core consists of globular subunits sandwiched between two coaxial ring-like structures of which the ring facing the nuclear interior is capped by a fibrous structure called the nuclear basket. By postembedding immunoelectron microscopy, we have mapped the positions of several human NPC proteins relative to the NPC core and its associated basket, including Nup93, Nup96, Nup98, Nup107, Nup153, Nup205, and the coiled coil-dominated 267-kDa protein Tpr. To further assess their contributions to NPC and basket architecture, the genes encoding Nup93, Nup96, Nup107, and Nup205 were posttranscriptionally silenced by RNA interference (RNAi) in HeLa cells, complementing recent RNAi experiments on Nup153 and Tpr. We show that Nup96 and Nup107 are core elements of the NPC proper that are essential for NPC assembly and docking of Nup153 and Tpr to the NPC. Nup93 and Nup205 are other NPC core elements that are important for long-term maintenance of NPCs but initially dispensable for the anchoring of Nup153 and Tpr. Immunogold-labeling for Nup98 also results in preferential labeling of NPC core regions, whereas Nup153 is shown to bind via its amino-terminal domain to the nuclear coaxial ring linking the NPC core structures and Tpr. The position of Tpr in turn is shown to coincide with that of the nuclear basket, with different Tpr protein domains corresponding to distinct basket segments. We propose a model in which Tpr constitutes the central architectural element that forms the scaffold of the nuclear basket.

  10. Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

    Science.gov (United States)

    Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

    2018-05-01

    Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that

  11. Lunar core formation: New constraints from metal-silicate partitioning of siderophile elements

    NARCIS (Netherlands)

    Rai, N.; van Westrenen, W.

    2014-01-01

    Analyses of Apollo era seismograms, lunar laser ranging data and the lunar moment of inertia suggest the presence of a small, at least partially molten Fe-rich metallic core in the Moon, but the chemical composition and formation conditions of this core are not well constrained. Here, we assess

  12. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  13. Hyper Text Mark-up Language and Dublin Core metadata element set usage in websites of Iranian State Universities’ libraries

    Science.gov (United States)

    Zare-Farashbandi, Firoozeh; Ramezan-Shirazi, Mahtab; Ashrafi-Rizi, Hasan; Nouri, Rasool

    2014-01-01

    Introduction: Recent progress in providing innovative solutions in the organization of electronic resources and research in this area shows a global trend in the use of new strategies such as metadata to facilitate description, place for, organization and retrieval of resources in the web environment. In this context, library metadata standards have a special place; therefore, the purpose of the present study has been a comparative study on the Central Libraries’ Websites of Iran State Universities for Hyper Text Mark-up Language (HTML) and Dublin Core metadata elements usage in 2011. Materials and Methods: The method of this study is applied-descriptive and data collection tool is the check lists created by the researchers. Statistical community includes 98 websites of the Iranian State Universities of the Ministry of Health and Medical Education and Ministry of Science, Research and Technology and method of sampling is the census. Information was collected through observation and direct visits to websites and data analysis was prepared by Microsoft Excel software, 2011. Results: The results of this study indicate that none of the websites use Dublin Core (DC) metadata and that only a few of them have used overlaps elements between HTML meta tags and Dublin Core (DC) elements. The percentage of overlaps of DC elements centralization in the Ministry of Health were 56% for both description and keywords and, in the Ministry of Science, were 45% for the keywords and 39% for the description. But, HTML meta tags have moderate presence in both Ministries, as the most-used elements were keywords and description (56%) and the least-used elements were date and formatter (0%). Conclusion: It was observed that the Ministry of Health and Ministry of Science follows the same path for using Dublin Core standard on their websites in the future. Because Central Library Websites are an example of scientific web pages, special attention in designing them can help the researchers

  14. Hyper Text Mark-up Language and Dublin Core metadata element set usage in websites of Iranian State Universities' libraries.

    Science.gov (United States)

    Zare-Farashbandi, Firoozeh; Ramezan-Shirazi, Mahtab; Ashrafi-Rizi, Hasan; Nouri, Rasool

    2014-01-01

    Recent progress in providing innovative solutions in the organization of electronic resources and research in this area shows a global trend in the use of new strategies such as metadata to facilitate description, place for, organization and retrieval of resources in the web environment. In this context, library metadata standards have a special place; therefore, the purpose of the present study has been a comparative study on the Central Libraries' Websites of Iran State Universities for Hyper Text Mark-up Language (HTML) and Dublin Core metadata elements usage in 2011. The method of this study is applied-descriptive and data collection tool is the check lists created by the researchers. Statistical community includes 98 websites of the Iranian State Universities of the Ministry of Health and Medical Education and Ministry of Science, Research and Technology and method of sampling is the census. Information was collected through observation and direct visits to websites and data analysis was prepared by Microsoft Excel software, 2011. The results of this study indicate that none of the websites use Dublin Core (DC) metadata and that only a few of them have used overlaps elements between HTML meta tags and Dublin Core (DC) elements. The percentage of overlaps of DC elements centralization in the Ministry of Health were 56% for both description and keywords and, in the Ministry of Science, were 45% for the keywords and 39% for the description. But, HTML meta tags have moderate presence in both Ministries, as the most-used elements were keywords and description (56%) and the least-used elements were date and formatter (0%). It was observed that the Ministry of Health and Ministry of Science follows the same path for using Dublin Core standard on their websites in the future. Because Central Library Websites are an example of scientific web pages, special attention in designing them can help the researchers to achieve faster and more accurate information resources

  15. New finite element-based modeling of reactor core support plate failure

    Energy Technology Data Exchange (ETDEWEB)

    Pandazis, Peter; Lovasz, Liviusz [Gesellschaft fuer Anlagen- und Reaktorsicherheit gGmbH, Garching (Germany). Forschungszentrum; Babcsany, Boglarka [Budapest Univ. of Technology and Economics, Budapest (Hungary). Inst. of Nuclear Techniques; Hajas, Tamas

    2017-12-15

    ATHLET-CD is the severe accident module of the code system AC{sup 2} that is designed to simulate the core degradation phenomena including fission product release and transport in the reactor circuit, as well as the late phase processes in the lower plenum. In case of a severe accident degradation of the reactor core occurs, the fuel assemblies start to melt. The evolution of such processes is usually accompanied with the failure of the core support plate and relocation of the molten core to the lower plenum. Currently, the criterion for the failure of the support plate applied by ATHLET-CD is a user-defined signal which can be a specific time or process variable like mass, temperature, etc. A new method, based on FEM approach, was developed that could lead in the future to a more realistic criterion for the failure of the core support plate. This paper presents the basic idea and theory of this new method as well as preliminary verification calculations and an outlook on the planned future development.

  16. Nigeria's Core Values and the Use of Social Media to Promote Cultural Values

    Science.gov (United States)

    Asemah, Ezekiel S.; Ekhareafo, Daniel O.; Olaniran, Samuel

    2013-01-01

    This article examines how Nigeria's core values are being redefined in the face of the new media and cultural globalisation era; it identifies Nigeria's core values to include age, greeting, dressing, among others. The questionnaire was used as an instrument to elicit data from the sampled population (Jos South Local Government Area of Plateau…

  17. Acquiring Sediment and Element Compositional Changes Based on a Diffuse Reflectance Spectrophotometry Technology from Cores Offshore Southwestern Taiwan

    Science.gov (United States)

    Pan, H. J.; Chen, M. T.

    2014-12-01

    Heavy summer monsoon rainfall along with typhoon-induced extreme precipitation cause frequent geological hazards that often threaten the human's safety and property in Taiwan. These geological hazards can be triggered by both natural factors, and/or have become deteriorated by perturbations from more and more human activities ever since few thousand years ago. However, due to the limit of instrumental records for observing long-term environmental changes in Taiwan, few evidence exist for distinguishing the human-induced impacts from natural climate change. Here we report a study on a high quality marine sediment core (MD103264) which were retrieved from the high sedimentation rate area from offshore southwestern Taiwan and present evidence for the long-term climate and possibly human-induced environmental changes since the last glacial. We are using the VIS-NIR Diffuse Reflectance Spectrophotometry (DRS) methods to study the cores. Interpreting the VIS-NIR reflectance spectra through the VARIMAX-rotation, principle component analysis (VPCA) helps conducting rapid and inexpensive measurements for acquiring high-resolution biogenic component, clay, and iron oxide mineral compositional data from the cores. We are also using X-Ray Fluorescence (XRF) analysis, which is also useful in determining the element compositional changes in the core. Our studies aim toward understanding the sediment and element compositional changes that reflect the patterns of changes in precipitation and soil erosion on land since the last glacial to the Holocene, during which the human activities (deforestation, agriculture, and land uses change) may have increased drastically. We will report and interpret the preliminary results of the optical analyses of the core.

  18. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  19. Determination of heavy metals and other elements by Neutron Activation Analysis in sediment cores of laguna Mar Chiquita (Cordoba, Argentina)

    International Nuclear Information System (INIS)

    Larizzatti, Flavio Eduardo

    2001-01-01

    Laguna Mar Chiquita is one of the largest water bodies of South America. It is a big lake of saline waters, and its geographic localization is SOMS' S, 62 deg 30' W, about 150 km Northwest of Cordoba, Argentina. Due to its large variability of hydrological budget, surface and water levels produced periods of low stands (LLP) and high stands (HLP). This fluctuation of water level also produces substantial changes in the water salinity. The principal tributary of the Laguna Mar Chiquita is Dulce River and also receives water from two other rivers: Suquia and Xanaes. The Suquia River drains in a small satellite lake, the Laguna del Plata. The purpose of the present work was to investigate the sediment composition of the Laguna Mar Chiquita (2 sediment cores) and del Plata (one sediment core) by using Neutron Activation Analysis (NAA) technique. The three 60 cm long sediment cores, sliced each 2 cm, were analyzed and 26 elements were determined (As, Ba, Br, Ce, Co, Cr, Cs, Eu, Fe, Hf, La, Lu, Na, Nd, Rb, Sb, Sc, Se, Sm, Ta, Tb, Th, U, Yb, Zn e Zr). Other complementary techniques were utilized: macro elements (Al, Ca, Fe, K, Mg, Mn, Na, P, Si, Ti) were determined by X-ray fluorescence, and the mineralogical composition of the sediments was determined by X-ray diffraction. The results obtained did not show any indication of anthropic contribution in the sediment composition, and concentration of the majority of the elements analyzed is uniform along the entire profile of the analyzed core. Statistical analysis of elemental concentrations (Cluster Analysis) reflects that in Laguna del Plata the fine fractions of the sediments is dominated by detrital minerals, while in the Laguna Mar Chiquita, the neo formed minerals are the principal components. In both lakes, it was possible to identify compositional variations in the sediment segments, which may correspond to temporal fluctuations in the sedimentation conditions. The statistical analysis associated to sedimentation

  20. A mass and energy conserving spectral element atmospheric dynamical core on the cubed-sphere grid

    International Nuclear Information System (INIS)

    Taylor, M A; Edwards, J; Thomas, S; Nair, R

    2007-01-01

    We present results from a conservative formulation of the spectral element method applied to global atmospheric circulation modeling. Exact local conservation of both mass and energy is obtained via a new compatible formulation of the spectral element method. Compatibility insures that the key integral property of the divergence and gradient operators required to show conservation also hold in discrete form. The spectral element method is used on a cubed-sphere grid to discretize the horizontal directions on the sphere. It can be coupled to any conservative vertical/radial discretization. The accuracy and conservation properties of the method are illustrated using a baroclinic instability test case

  1. Identification of Columbia River basalt flows from deep cores in the Pasco Basin based on trace element abundances

    International Nuclear Information System (INIS)

    Fruchter, J.S.; Rancitelli, L.A.

    1976-01-01

    Samples of basalt from three deep core holes drilled in the Pasco Basin, Washington (DDH-3, DH-4, DH-5) were analyzed by instrumental neutron activation (INAA) for up to fifteen trace and major elements. These analyses were used to assign each basalt flow to one of a series of previously defined chemical types of the Columbia River Basalt Group. All of the flows except the two flows at the bottom of well DDH-3 were clearly assignable to one of the defined chemical types. These two flows apparently represent new, as yet undefined chemical types. Average values and standard deviations for compositions of each of the chemical types found in the three wells are presented along with two-element variation diagrams for the geochemically important pair La-Cr, La-Fe, La-Th and La-Sc. The assignment of the flows to known chemical types accomplished in this study was very helpful in relating the basalts in the core holes to stratigraphically defined basalt flows in surface sections. A correlation diagram relating the flows in the core holes to one another on the basis of chemical type is presented

  2. Test of Tree Core Sampling for Screening of Toxic Elements in Soils from a Norwegian Site

    DEFF Research Database (Denmark)

    Nielsen, Mette Algreen; Rein, Arno; Legind, Charlotte Nielsen

    2011-01-01

    Tree core samples have been used to delineate organic subsurface plumes. In 2009 and 2010, samples were taken at trees growing on a former dump site in Norway and analyzed for arsenic (As), cadmium (Cd), chromium (Cr), copper (Cu), nickel (Ni), and zinc (Zn). Concentrations in wood were in averag...

  3. Low-loss single-mode hollow-core fiber with anisotropic anti-resonant elements

    DEFF Research Database (Denmark)

    Habib, Selim; Bang, Ole; Bache, Morten

    2016-01-01

    A hollow-core fiber using anisotropic anti-resonant tubes in thecladding is proposed for low loss and effectively single-mode guidance. We show that the loss performance and higher-order mode suppression is significantly improved by using symmetrically distributed anisotropic antiresonant tubes i...

  4. A finite element model for independent wire rope core with double ...

    Indian Academy of Sciences (India)

    1Istanbul Technical University, Institute of Informatics, Computational Science and ... a little work has been done using the double helical geometry and real ... Finite element approach has been embedded in wire rope analysis since 1999.

  5. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    Science.gov (United States)

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  6. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    Science.gov (United States)

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  7. Detailed history of atmospheric trace elements from the Quelccaya ice core (Southern Peru) during the last 1200 years

    Science.gov (United States)

    Uglietti, C.; Gabrielli, P.; Thompson, L. G.

    2013-12-01

    The recent increase in trace element concentrations, for example Cr, Cu, Zn, Ag, Pb, Bi, and U, in polar snow and ice has provided compelling evidence of a hemispheric change in atmospheric composition since the nineteenth century. This change has been concomitant with the expansion of the Industrial Revolution and points towards an anthropogenic source of trace elements in the atmosphere. There are very few low latitude trace element ice core records and these are believed to be sensitive to perturbations of regional significance. To date, these records have not been used to document a preindustrial anthropogenic impact on atmospheric composition at low latitudes. Ice cores retrieved from the tropical Andes are particularly interesting because they have the potential to reveal detailed information about the evolution and environmental consequences of mineral exploitation related to the Pre Inca Civilizations, the Inca Empire (1438-1533 AD) and the subsequent Spanish invasion and dominance (1532-1833 AD). The chemical record preserved in the ice of the Quelccaya ice cap (southern Peruvian Andes) offers the exceptional opportunity to geochemically constrain the composition of the tropical atmosphere at high resolution over the last ~1200 years. Quantification of twenty trace elements (Ag, Al, As, Bi, Cd, Co, Cr, Cu, Fe, Mn, Mo, Pb, Rb, Sb, Sn, Ti, Tl, U, V, and Zn) was performed by ICP-SFMS over 105 m of the Quelccaya North Dome core (5600 m asl, 128.57 m) by analyzing 2450 samples. This provides the first atmospheric trace element record in South America spanning continuously and at high resolution for the time period between 1990 and 790 AD. Ag, As, Bi, Cd, Cr, Co, Cu, Mn, Mo, Sb, Sn, Pb and Zn show increases in concentration and crustal enrichment factor starting at different times between 1450 and 1550 AD, in concomitance with the expansions of the Inca Empire and, subsequently, the Spanish Empire well before the inception of the Industrial Revolution. This

  8. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  9. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  10. Fuel element and full core thermal–hydraulic analysis of the AHTR for the evaluation of the LOFC transient

    International Nuclear Information System (INIS)

    Avigni, P.; Petrovic, B.

    2014-01-01

    Highlights: • We developed MATLAB and RELAP5 models of the single channel of the AHTR. • Single channel analysis indicates design envelope for effective heat removal. • The reactivity feedback evaluated by SCALE supports safe operation of the reactor. • We developed RELAP5 models of the fuel assembly and full core. • The fully passive DRACS protects the reactor during a LOFC accident. - Abstract: The Advanced High Temperature Reactor (AHTR) is a fluoride-cooled and graphite-moderated reactor concept designed by Oak Ridge National Laboratory (Holcomb et al., 2011). The modeling and optimization of the heat removal system and the core structure is required, in order to obtain an adequate heavy metal loading and to provide effective cooling capability. The single channel MATLAB model provides a simple tool to evaluate the steady state conditions for the coolant and the fuel plate and the effects of the power distribution; sensitivity studies on the main design parameters of the fuel element are performed. A RELAP5-3D single channel model is developed for the validation and comparison with the MATLAB model; this model is the starting point for the development of a full core model, enabling the study of transients. A one-third fuel assembly model is then analyzed, consisting of six fuel plates and modeling the heat conduction of graphite through RELAP5-3D conduction enclosures. Since the assembly model is not suitable for the implementation in a full core model with the same level of detail, several simplifications have been evaluated, involving the modeling of the plate through a single heat structure and the modeling of different plates through a single plate. A SCALE model of the fuel assembly was developed for the evaluation of the reactivity feedback and the power distribution in the core. The results from the neutronic evaluations and the assembly model were implemented in a full core model, involving the core, the main reactor structures, the cooling

  11. Use of heterogeneous finite elements generated by collision probability solutions to calculate a pool reactor core

    International Nuclear Information System (INIS)

    Calabrese, C.R.; Grant, C.R.

    1990-01-01

    This work presents comparisons between measured fluxes obtained by activation of Manganese foils in the light water, enriched uranium research pool reactor RA-2 MTR (Materials Testing Reactors) fuel element) and fluxes calculated by the finite element method FEM using DELFIN code, and describes the heterogeneus finite elements by a set of solutions of the transport equations for several different configurations obtained using the collision probability code HUEMUL. The agreement between calculated and measured fluxes is good, and the advantage of using FEM is showed because to obtain the flux distribution with same detail using an usual diffusion calculation it would be necessary 12000 mesh points against the 2000 points that FEM uses, hence the processing time is reduced in a factor ten. An interesting alternative to use in MTR fuel management is presented. (Author) [es

  12. Optimization and Openmp Parallelization of a Discrete Element Code for Convex Polyhedra on Multi-Core Machines

    Science.gov (United States)

    Chen, Jian; Matuttis, Hans-Georg

    2013-02-01

    We report our experiences with the optimization and parallelization of a discrete element code for convex polyhedra on multi-core machines and introduce a novel variant of the sort-and-sweep neighborhood algorithm. While in theory the whole code in itself parallelizes ideally, in practice the results on different architectures with different compilers and performance measurement tools depend very much on the particle number and optimization of the code. After difficulties with the interpretation of the data for speedup and efficiency are overcome, respectable parallelization speedups could be obtained.

  13. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  14. Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

    DEFF Research Database (Denmark)

    Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

    2003-01-01

    To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

  15. Sediment textural characteristics and elemental distribution in the core sediments, Pullivasal and Kurusadai Island, Gulf of Mannar, Southeast coast of India

    Directory of Open Access Journals (Sweden)

    P. Saravanan

    2017-12-01

    Full Text Available Two core samples were collected in order to assess the textual characteristics and elemental distribution of the sediments, from the lagoonal environment of Pullivasal and Kurusadai island, Gulf of Mannar, Southeast coast of India. The distribution of the organic matter and calcium carbonate is chiefly controlled by the coral debris, shell fragments and mangrove litters. The elemental distribution is controlled by natural process and other trace elements are controlled by anthropogenic land based activities. Keywords: Sediment texture, Coral islands, Gulf of Mannar, Core sediments, Elemental distribution

  16. Thermo-mechanical interaction effects in foam cored sandwich panels-correlation between High-order models and Finite element analysis results

    DEFF Research Database (Denmark)

    Palleti, Hara Naga Krishna Teja; Santiuste, Carlos; Thomsen, Ole Thybo

    2010-01-01

    Thermo-mechanical interaction effects including thermal material degradation in polymer foam cored sandwich structures is investigated using the commercial Finite Element Analysis (FEA) package ABAQUS/Standard. Sandwich panels with different boundary conditions in the form of simply supported...

  17. Market basket survey of essential elements in some core vegetables in Accra, Ghana

    International Nuclear Information System (INIS)

    Adotey, D.K.; Serfor-Armah, Y.; Yeboah, P.O.; Fianko, J.R.

    2005-01-01

    The concentrations of essential trace elements of nutritional and toxicological significance in 5 vegetables that constitute an essential part of Ghanaian diet have been studied, using Instrumental Neutron Activation Analysis (INAA). The results of the study revealed that the elements As, Ca, Co, K, Mg, Mn and Na were present in all 5 vegetables analyzed. Elements of nutritional importance detected in very high concentrations are K, Ca and Mg whilst only trace levels of Mn, Na and Co were detected. Onions were found to have adequate amounts of As, Br, Ca, Cl, Mg and Mn and therefore a good source of these trace elements. Garden eggs have high concentration of K whiles Carrot is a good source of Co, Na and V. The precision and accuracy of the methods were tested with standard reference material, IAEA-359 (cabbage). The results obtained were within 5% of the certified values in all cases. The precision of the methods were calculated as percentage relative standard deviation. (au)

  18. Safety-related investigations on power distribution in MOX fuel elements in LWR cores

    International Nuclear Information System (INIS)

    Kramer, E.; Langenbuch, S.

    1991-01-01

    For the concept of thermal recycling various fuel assembly designs have been developped during the last years. An overview is given describing the present status of MOX-fuel assembly design for PWR and BWR. The local power distribution within the MOX-fuel assembly and influences between neighbouring MOX- and Uranium fuel assemblies have been analyzed by own calculations. These investigations are limited to specific aspects of the spatial power distribution, which are related to the use of MOX-fuel assemblies within the reactor core of LWR. (orig.) [de

  19. Dynamic structural analysis for assemblies of fuel elements in the core of a PWR

    International Nuclear Information System (INIS)

    Silva Macedo, L.V. da.

    1991-01-01

    It is presented a procedure for the dynamic structural analysis of a PWR core. Impacts between fuel assemblies may occur because of the existence of gaps between them. Thus, the problem is non-linear and an spectral analysis is avoided. It is necessary a time-history response analysis. The Modal Superposition Method with the Duhamel integral was used in order to solve the problem. It is presented an algorithm of solution and also results obtained with the STYCA computer program, developed in the basis of what was proposed here. (author)

  20. Combining X-Ray Fluorescence and Magnetic Techniques to Quantify Elemental Concentrations in Coral Cores from Belize

    Science.gov (United States)

    Goldfarb, L. A.; Kingsley, C.; Urbalejo, A. A.; Hangsterfer, A.; Gee, J. S.; Carilli, J.; Feinberg, J. M.; Mitra, R.; Bhattacharya, A.; Field, D.

    2017-12-01

    Caribbean coral reefs are some of the most threatened marine ecosystems in the world. Research suggest that environmental stressors of local origin, such as sediment run off, can reduce the resilience of these reefs to global threats such as ocean warming. Material trapped in coral skeletons can provide information on the sources of particulate matter in the ocean ecosystem. Despite the importance of quantifying sources and types of materials trapped in corals, the research community is yet to fully develop techniques that allow accurate representation of trapped matter, which is potentially a major source of metal content in reef building coral skeletons. The dataset presented here is a progress and combination of two works presented at American Geophysical Union 2016 Fall Meeting; In this research, we explore the efficacy of X-Ray Fluorescence (XRF), a widely used tool in environmental studies (but generally not in corals), to estimate detrital metal content in coral cores collected from four locations near Belize, with varying degrees of impact from coastal processes. Four coral cores together cover a period of 1862-2006. Trace, major and minor metal content from these cores have been well-studied using solution-based ICP-MS, providing us with the unique opportunity to test the efficacy of XRF technique in characterizing metal content in these coral cores. We have measured more than 50 metals using XRF every two millimeters along slabs removed from the middle of a coral core spanning to characterize materials present in coral skeletons. We compare the results from XRF to elemental concentrations reported from solution-based ICP-MS. Furthermore, we also compare our XRF data to magnetic measurements we have made in these same coral cores. Overall, it appears that the non-destructive XRF technique is a viable supplement to the ICP-MS in determining sediment and metal content in coral cores, and may be particularly helpful for assessing resistant phases such as

  1. Using lead isotopes and trace element records from two contrasting Lake Tanganyika sediment cores to assess watershed – Lake exchange

    Science.gov (United States)

    Odigie, Kingsley; Cohen, A.D.; Swarzenski, Peter W.; Flegal, R

    2014-01-01

    Lead isotopic and trace element records of two contrasting sediment cores were examined to reconstruct historic, industrial contaminant inputs to Lake Tanganyika, Africa. Observed fluxes of Co, Cu, Mn, Ni, Pb, and Zn in age-dated sediments collected from the lake varied both spatially and temporally over the past two to four centuries. The fluxes of trace elements were lower (up to 10-fold) at a mid-lake site (MC1) than at a nearshore site (LT-98-58), which is directly downstream from the Kahama and Nyasanga River watersheds and adjacent to the relatively pristine Gombe Stream National Park. Trace element fluxes at that nearshore site did not measurably change over the last two centuries (1815–1998), while the distal, mid-lake site exhibited substantial changes in the fluxes of trace elements – likely caused by changes in land use – over that period. For example, the flux of Pb increased by ∼300% from 1871 to 1991. That apparent accelerated weathering and detrital mobilization of lithogenic trace elements was further evidenced by (i) positive correlations (r = 0.77–0.99, p factors (EF operations within the lake’s watershed over the past century. The data also indicate that the mid-lake site is a much more sensitive and useful recorder of environmental changes than the nearshore site. Furthermore, the lead isotopic compositions of sediment at the sites differed spatially, indicating that the Pb (and other trace elements by association) originated from different natural sources at the two locations.

  2. Effects of Alloying Elements on the Formation of Core-Shell-Structured Reinforcing Particles during Heating of Al–Ti Powder Compacts

    Science.gov (United States)

    Chen, Tijun; Gao, Min; Tong, Yunqi

    2018-01-01

    To prepare core-shell-structured Ti@compound particle (Ti@compoundp) reinforced Al matrix composite via powder thixoforming, the effects of alloying elements, such as Si, Cu, Mg, and Zn, on the reaction between Ti powders and Al melt, and the microstructure of the resulting reinforcements were investigated during heating of powder compacts at 993 K (720 °C). Simultaneously, the situations of the reinforcing particles in the corresponding semisolid compacts were also studied. Both thermodynamic analysis and experiment results all indicate that Si participated in the reaction and promoted the formation of Al–Ti–Si ternary compounds, while Cu, Mg, and Zn did not take part in the reaction and facilitated Al3Ti phase to form to different degrees. The first-formed Al–Ti–Si ternary compound was τ1 phase, and then it gradually transformed into (Al,Si)3Ti phase. The proportion and existing time of τ1 phase all increased as the Si content increased. In contrast, Mg had the largest, Cu had the least, and Si and Zn had an equivalent middle effect on accelerating the reaction. The thicker the reaction shell was, the larger the stress generated in the shell was, and thus the looser the shell microstructure was. The stress generated in (Al,Si)3Ti phase was larger than that in τ1 phase, but smaller than that in Al3Ti phase. So, the shells in the Al–Ti–Si system were more compact than those in the other systems, and Si element was beneficial to obtain thick and compact compound shells. Most of the above results were consistent to those in the semisolid state ones except the product phase constituents in the Al–Ti–Mg system and the reaction rate in the Al–Ti–Zn system. More importantly, the desirable core-shell structured Ti@compoundp was only achieved in the semisolid Al–Ti–Si system. PMID:29342946

  3. Effects of Alloying Elements on the Formation of Core-Shell-Structured Reinforcing Particles during Heating of Al-Ti Powder Compacts.

    Science.gov (United States)

    Chen, Tijun; Gao, Min; Tong, Yunqi

    2018-01-15

    To prepare core-shell-structured Ti@compound particle (Ti@compound p ) reinforced Al matrix composite via powder thixoforming, the effects of alloying elements, such as Si, Cu, Mg, and Zn, on the reaction between Ti powders and Al melt, and the microstructure of the resulting reinforcements were investigated during heating of powder compacts at 993 K (720 °C). Simultaneously, the situations of the reinforcing particles in the corresponding semisolid compacts were also studied. Both thermodynamic analysis and experiment results all indicate that Si participated in the reaction and promoted the formation of Al-Ti-Si ternary compounds, while Cu, Mg, and Zn did not take part in the reaction and facilitated Al₃Ti phase to form to different degrees. The first-formed Al-Ti-Si ternary compound was τ1 phase, and then it gradually transformed into (Al,Si)₃Ti phase. The proportion and existing time of τ1 phase all increased as the Si content increased. In contrast, Mg had the largest, Cu had the least, and Si and Zn had an equivalent middle effect on accelerating the reaction. The thicker the reaction shell was, the larger the stress generated in the shell was, and thus the looser the shell microstructure was. The stress generated in (Al,Si)₃Ti phase was larger than that in τ1 phase, but smaller than that in Al₃Ti phase. So, the shells in the Al-Ti-Si system were more compact than those in the other systems, and Si element was beneficial to obtain thick and compact compound shells. Most of the above results were consistent to those in the semisolid state ones except the product phase constituents in the Al-Ti-Mg system and the reaction rate in the Al-Ti-Zn system. More importantly, the desirable core-shell structured Ti@compound p was only achieved in the semisolid Al-Ti-Si system.

  4. Effect of Silicon on Activity Coefficients of Siderophile Elements (P, Au, Pd, As, Ge, Sb, and In) in Liquid Fe, with Application to Core Formation

    Science.gov (United States)

    Righter, K.; Pando, K.; Danielson, L. R.; Humayun, M.; Righter, M.; Lapen, T.; Boujibar, A.

    2016-01-01

    Earth's core contains approximately 10 percent light elements that are likely a combination of S, C, Si, and O, with Si possibly being the most abundant. Si dissolved into Fe liquids can have a large effect on the magnitude of the activity coefficient of siderophile elements (SE) in Fe liquids, and thus the partitioning behavior of those elements between core and mantle. The effect of Si can be small such as for Ni and Co, or large such as for Mo, Ge, Sb, As. The effect of Si on many siderophile elements is unknown yet could be an important, and as yet unquantified, influence on the core-mantle partitioning of SE. Here we report new experiments designed to quantify the effect of Si on the partitioning of P, Au, Pd, and many other SE between metal and silicate melt. The results will be applied to Earth, for which we have excellent constraints on the mantle siderophile element concentrations.

  5. Constitutive modeling and finite element procedure development for stress analysis of prismatic high temperature gas cooled reactor graphite core components

    International Nuclear Information System (INIS)

    Mohanty, Subhasish; Majumdar, Saurindranath; Srinivasan, Makuteswara

    2013-01-01

    Highlights: • Finite element procedure developed for stress analysis of HTGR graphite component. • Realistic fluence profile and reflector brick shape considered for the simulation. • Also realistic H-451 grade material properties considered for simulation. • Typical outer reflector of a GT-MHR type reactor considered for numerical study. • Based on the simulation results replacement of graphite bricks can be scheduled. -- Abstract: High temperature gas cooled reactors, such as prismatic and pebble bed reactors, are increasingly becoming popular because of their inherent safety, high temperature process heat output, and high efficiency in nuclear power generation. In prismatic reactors, hexagonal graphite bricks are used as reflectors and fuel bricks. In the reactor environment, graphite bricks experience high temperature and neutron dose. This leads to dimensional changes (swelling and or shrinkage) of these bricks. Irradiation dimensional changes may affect the structural integrity of the individual bricks as well as of the overall core. The present paper presents a generic procedure for stress analysis of prismatic core graphite components using graphite reflector as an example. The procedure is demonstrated through commercially available ABAQUS finite element software using the option of user material subroutine (UMAT). This paper considers General Atomics Gas Turbine-Modular Helium Reactor (GT-MHR) as a bench mark design to perform the time integrated stress analysis of a typical reflector brick considering realistic geometry, flux distribution and realistic irradiation material properties of transversely isotropic H-451 grade graphite

  6. Constitutive modeling and finite element procedure development for stress analysis of prismatic high temperature gas cooled reactor graphite core components

    Energy Technology Data Exchange (ETDEWEB)

    Mohanty, Subhasish, E-mail: smohanty@anl.gov [Argonne National Laboratory, South Cass Avenue, Argonne, IL 60439 (United States); Majumdar, Saurindranath [Argonne National Laboratory, South Cass Avenue, Argonne, IL 60439 (United States); Srinivasan, Makuteswara [U.S. Nuclear Regulatory Commission, Washington, DC 20555 (United States)

    2013-07-15

    Highlights: • Finite element procedure developed for stress analysis of HTGR graphite component. • Realistic fluence profile and reflector brick shape considered for the simulation. • Also realistic H-451 grade material properties considered for simulation. • Typical outer reflector of a GT-MHR type reactor considered for numerical study. • Based on the simulation results replacement of graphite bricks can be scheduled. -- Abstract: High temperature gas cooled reactors, such as prismatic and pebble bed reactors, are increasingly becoming popular because of their inherent safety, high temperature process heat output, and high efficiency in nuclear power generation. In prismatic reactors, hexagonal graphite bricks are used as reflectors and fuel bricks. In the reactor environment, graphite bricks experience high temperature and neutron dose. This leads to dimensional changes (swelling and or shrinkage) of these bricks. Irradiation dimensional changes may affect the structural integrity of the individual bricks as well as of the overall core. The present paper presents a generic procedure for stress analysis of prismatic core graphite components using graphite reflector as an example. The procedure is demonstrated through commercially available ABAQUS finite element software using the option of user material subroutine (UMAT). This paper considers General Atomics Gas Turbine-Modular Helium Reactor (GT-MHR) as a bench mark design to perform the time integrated stress analysis of a typical reflector brick considering realistic geometry, flux distribution and realistic irradiation material properties of transversely isotropic H-451 grade graphite.

  7. FB elements can promote exon shuffling: a promoter-less white allele can be reactivated by FB mediated transposition in Drosophila melanogaster.

    Science.gov (United States)

    Moschetti, R; Marsano, R M; Barsanti, P; Caggese, C; Caizzi, R

    2004-05-01

    Foldback ( FB) elements are transposable elements found in many eukaryotic genomes; they are thought to contribute significantly to genome plasticity. In Drosophila melanogaster, FBs have been shown to be involved in the transposition of large chromosomal regions and in the genetic instability of some alleles of the white gene. In this report we show that FB mediated transposition of w(67C23), a mutation that deletes the promoter of the white gene and its first exon, containing the start codon, can restore expression of the white gene. We have characterized three independent events in which a 14-kb fragment from the w(67C23) locus was transposed into an intron region in three different genes. In each case a local promoter drives the expression of white, producing a chimeric mRNA. These findings suggest that, on an evolutionary timescale, FB elements may contribute to the creation of new genes via exon shuffling.

  8. Characterization of atmospheric trace elements in the Puruogangri ice core: a preliminary account of Tibetan Plateau environmental and contamination histories

    Science.gov (United States)

    Beaudon, E.; Gabrielli, P.; Sierra Hernandez, R.; Wegner, A.; Thompson, L. G.

    2014-12-01

    Asia is facing enormous challenges including large-scale environmental changes, rapid population growth and industrialization. The inherent generated pollution contributes to half of all Earth's anthropogenic trace metals emissions that, when deposited to glaciers of the surrounding mountains of the Third Pole region, leave a characteristic chemical fingerprint. Records of past atmospheric deposition preserved in snow and ice from Third Pole glaciers provide unique insights into changes of the chemical composition of the atmosphere and into the nature and intensity of the regional atmospheric circulation systems. The determination of the elemental composition of aeolian dust stored in Himalayan and Tibetan Plateau glaciers can help to qualify the potential contamination of glacial meltwater as a part of the greater fresh Asian water source. The 215 m long Puruogangri ice core retrieved in 2000 at 6500 m a.s.l. in central Tibetan Plateau (Western Tanggula Shan, China) provides one of the first multi-millennium-long environmental archives (spanning the last 7000 years and annually resolved for the last 400 years) obtained from the Tibetan Plateau region. The Puruogangri's area is climatologically of particular interest because of its location at the boundary between the monsoon (wet) and the westerly (dry) dominated atmospheric circulation. The major objective of this study is to determine the concentration of trace and ultra-trace elements in the Puruogangri ice core between 1600 and 2000 AD in order to characterize the atmospheric aerosols entrapped in the ice. Particular attention is given to assess the amount of trace elements originating from anthropogenic sources during both the pre-industrial and industrial periods. The distinction between the anthropogenic contribution and the crustal background may rely on the precise decoupling of the dry and wet seasons signals, the former being largely influenced by dust contribution.

  9. Promoção da saúde: elemento instituinte? Health promotion: an instituing element?

    Directory of Open Access Journals (Sweden)

    Juan Carlos Aneiros Fernandez

    2008-03-01

    Full Text Available O artigo inclui na discussão sobre os resultados da promoção da saúde um argumento de natureza epistemológica, levando em consideração o contexto contemporâneo de mudanças econômicas, políticas e culturais do qual ela é parte e expressão. Destacam-se, por um lado, as suspeitas que recaem sobre o projeto da Modernidade, sejam elas decorrentes do crescimento das incertezas ou da irrealização de promessas e, por outro lado, as tentativas de equacionamento do binômio determinação/autonomia, como questões sensíveis a uma ruptura dos modos de conhecer na contemporaneidade. Propõe-se considerar a dinâmica social e abordá-la como a união e a tensão da história feita e da história se fazendo, para melhor compreender o alcance e os resultados da promoção da saúde. A conclusão é que a promoção da saúde deve continuar buscando o desenvolvimento de ações cada vez mais efetivas, mas deve fazê-lo sem abdicar da possibilidade de manter-se próxima da energia social livre e em ebulição, que caracteriza o elemento instituinte de uma produção histórica.The article includes, in the discussion about health promotion results, an epistemological argument, considering the contemporary context of changes of which it is part and expression. The suspicion concerning the project of Modernity is emphasized, as a result of growing uncertainties or unfulfilled promises. In addition, the attempts to solve the conflict between determination and autonomy are also highlighted. Both aspects are considered as sensible questions regarding a rupture of the ways of knowing in contemporariness. The article proposes to consider social dynamics, approaching it as the union and tension of concluded history and ongoing history, so as to better understand the reach and results of health promotion. The conclusion is that health promotion must continue the search for the development of increasingly effective actions, but it must do it without

  10. Fabrication, fabrication control and in-core follow up of 4 LEU leader fuel elements based on U3Si2 in RECH-1

    International Nuclear Information System (INIS)

    Chavez, J.C.; Barrera, M.; Olivares, L.; Lisboa, J.

    1999-01-01

    The RECH-1 MTR reactor has been converted from HEU to MEU (45% enrichment) and the decision to a LEU (20% enrichment) conversion was taken some years ago. This LEU conversion decision involved a local fuel development and fabrication based on U 3 Si 2 -Al dispersion fuel, and a fabrication qualification stage that resulted in four fuel elements fully complying with established fabrication standards for this type of fuel. This report-presents relevant points of these four leaders fuel elements fabrication, in particular a fuel plate core homogeneity control development. A summary of the intended in core follow-up studies for the leaders fuel elements is also presented here. (author)

  11. Core analysis during transition from 37-element fuel to CANFLEX-NU fuel in CANDU 6

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Chang Joon; Suk, Ho Chun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1999-12-31

    An 1200-day time-dependent fuel-management for the transition from 37-element fuel to CANFLEX-NU fuel in a CANDU 6 reactor has been simulated to show the compatibility of the CANFLEX-NU fuel with the reactor operation. The simulation calculations were carried out with the RFSP code, provided by cell averaged fuel properties obtained from the POWDERPUFS-V code. The refueling scheme for both fuels was an eight bundle shift at a time. The simulation results show that the maximum channel and bundle powers were maintained below the license limit of the CANDU 6. This indicates that the CANFLEX-NU fuel bundle is compatible with the CANDU 6 reactor operation during the transition period. 3 refs., 2 figs., 1 tab. (Author)

  12. LMFBR operational and experimental in-core local-fault experience, primarily with oxide fuel elements

    International Nuclear Information System (INIS)

    Warinner, D.K.

    Case-by-case reviews of selective world experience with severe local faults, particularly fuel failure and fuel degradation, are reviewed for two sodium-cooled thermal reactors, several LMFBRs, and LMFBR-fuels experiments. The review summarizes fuel-failure frequency and illustrates the results of the most damaging LMFBR local-fault experiences of the last 20 years beginning with BR-5 and including DFR, BOR-60, BR2's MFBS-and Mol-loops experiments, Fermi, KNK, Rapsodie, EBR-II, and TREAT-D2. Local-fault accommodation is demonstrated and a need to more thoroughly investigate delayed-neutron and gaseous-fission-product signals is highlighted in view of uranate formation, observed blockages, and slow fuel-element failure-propagation

  13. Core analysis during transition from 37-element fuel to CANFLEX-NU fuel in CANDU 6

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Chang Joon; Suk, Ho Chun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1998-12-31

    An 1200-day time-dependent fuel-management for the transition from 37-element fuel to CANFLEX-NU fuel in a CANDU 6 reactor has been simulated to show the compatibility of the CANFLEX-NU fuel with the reactor operation. The simulation calculations were carried out with the RFSP code, provided by cell averaged fuel properties obtained from the POWDERPUFS-V code. The refueling scheme for both fuels was an eight bundle shift at a time. The simulation results show that the maximum channel and bundle powers were maintained below the license limit of the CANDU 6. This indicates that the CANFLEX-NU fuel bundle is compatible with the CANDU 6 reactor operation during the transition period. 3 refs., 2 figs., 1 tab. (Author)

  14. A new method based on low background instrumental neutron activation analysis for major, trace and ultra-trace element determination in atmospheric mineral dust from polar ice cores

    Energy Technology Data Exchange (ETDEWEB)

    Baccolo, Giovanni, E-mail: giovanni.baccolo@mib.infn.it [Graduate School in Polar Sciences, University of Siena, Via Laterina 8, 53100, Siena (Italy); Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Clemenza, Massimiliano [INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Department of Physics, University of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Delmonte, Barbara [Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); Maffezzoli, Niccolò [Centre for Ice and Climate, Niels Bohr Institute, Juliane Maries Vej, 30, 2100, Copenhagen (Denmark); Nastasi, Massimiliano; Previtali, Ezio [INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Department of Physics, University of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Prata, Michele; Salvini, Andrea [LENA, University of Pavia, Pavia (Italy); Maggi, Valter [Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy)

    2016-05-30

    Dust found in polar ice core samples present extremely low concentrations, in addition the availability of such samples is usually strictly limited. For these reasons the chemical and physical analysis of polar ice cores is an analytical challenge. In this work a new method based on low background instrumental neutron activation analysis (LB-INAA) for the multi-elemental characterization of the insoluble fraction of dust from polar ice cores is presented. Thanks to an accurate selection of the most proper materials and procedures it was possible to reach unprecedented analytical performances, suitable for ice core analyses. The method was applied to Antarctic ice core samples. Five samples of atmospheric dust (μg size) from ice sections of the Antarctic Talos Dome ice core were prepared and analyzed. A set of 37 elements was quantified, spanning from all the major elements (Na, Mg, Al, Si, K, Ca, Ti, Mn and Fe) to trace ones, including 10 (La, Ce, Nd, Sm, Eu, Tb, Ho, Tm, Yb and Lu) of the 14 natural occurring lanthanides. The detection limits are in the range of 10{sup −13}–10{sup −6} g, improving previous results of 1–3 orders of magnitude depending on the element; uncertainties lies between 4% and 60%. - Highlights: • A new method based on neutron activation for the multi-elemental characterization of atmospheric dust entrapped in polar ice cores is proposed. • 37 elements were quantified in μg size dust samples with detection limits ranging from 10{sup −13} to 10{sup −6} g. • A low background approach and a clean analytical protocol improved INAA performances to unprecedented levels for multi-elemental analyses.

  15. Social Justice at the Core of Breastfeeding Protection, Promotion and Support: A Conceptualization.

    Science.gov (United States)

    Smith, Paige Hall

    2018-05-01

    Despite widespread awareness of the health benefits for both mothers and babies we are far from achieving universal breastfeeding. Breastfeeding rates globally are lower than recommended levels and there are concerns that some global breastfeeding efforts have stalled (1, 2). In addition, we see persistent disparities in breastfeeding rates by race, ethnicity, class and status (3). A growing literature documents how a range of injustices, including gender inequality (7), racism (8), poverty (9), and violence (10, 11) shape whether, how exclusive, and for how long mothers and others will be able to breastfeed or feed their infants human milk. These social injustices and inequities work to privilege breastfeeding even as the health message becomes more mainstreamed and human milk more desirable. A social justice approach could help us address the gender, race, and sexuality-based inequities and injustices in opportunities, resources, status, and power that are influencing the patterns of breastfeeding we see today. The 12th Breastfeeding and Feminism International Conference held in 2017 took as its theme Breastfeeding as Social Justice: From Crucial Conversation to Inspired Action. The planning team for that conference identified seven core domains that could help us conceptualize a framework for placing social justice at the core of our work. This paper presents this framework and suggestions for policy and practice that follow.

  16. THE IMPLICATIONS OF MARKETING ACTIVITY IN RISK ANALYSIS, CORE ELEMENT OF LENDING POLICY TO COMMERCIAL BANKS

    Directory of Open Access Journals (Sweden)

    Magda Florin-Mihai

    2013-04-01

    Full Text Available In the present financial context first affected by the lack of trust generated by the important bankruptcies in the USA and secondly by the global economic crisis, financial institutions are more than ever focused on applying market research, customer segmentation procedures and based upon them adapted credit strategies. The process is based on the fundaments of the marketing mix, much more carefully than before in order to maximize efficiency and market position or to consolidate, increase market share by taking advantage of opportunities or diminishing the effects of the present unfavorable economic climate. Analysis procedures based on differential risk models can be identified, the starting point being precisely the involvement of marketing by the market segmentation process and the concepts of “customer centricity” and “client relationship management”, specific credit policies being based upon them. The present paper intends to bring forth the client segmentation criteria practiced by top Romanian commercial banks, as the right segmentation process will reflect on the typology of financing over time. Furthermore, client segmentation tends to influence banking management in order to administer the risks arising from the credit activities, as it is in strict connection to the elements and processes involved in determining a correct rating of the applicants for funding.

  17. Dynamic Analysis of Three-Layer Sandwich Beams with Thick Viscoelastic Damping Core for Finite Element Applications

    Directory of Open Access Journals (Sweden)

    Fernando Cortés

    2015-01-01

    Full Text Available This paper presents an analysis of the dynamic behaviour of constrained layer damping (CLD beams with thick viscoelastic layer. A homogenised model for the flexural stiffness is formulated using Reddy-Bickford’s quadratic shear in each layer, and it is compared with Ross-Kerwin-Ungar (RKU classical model, which considers a uniform shear deformation for the viscoelastic core. In order to analyse the efficiency of both models, a numerical application is accomplished and the provided results are compared with those of a 2D model using finite elements, which considers extensional and shear stress and longitudinal, transverse, and rotational inertias. The intermediate viscoelastic material is characterised by a fractional derivative model, with a frequency dependent complex modulus. Eigenvalues and eigenvectors are obtained from an iterative method avoiding the computational problems derived from the frequency dependence of the stiffness matrices. Also, frequency response functions are calculated. The results show that the new model provides better accuracy than the RKU one as the thickness of the core layer increases. In conclusion, a new model has been developed, being able to reproduce the mechanical behaviour of thick CLD beams, reducing storage needs and computational time compared with a 2D model, and improving the results from the RKU model.

  18. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  19. The effect of melt composition on metal-silicate partitioning of siderophile elements and constraints on core formation in the angrite parent body

    Science.gov (United States)

    Steenstra, E. S.; Sitabi, A. B.; Lin, Y. H.; Rai, N.; Knibbe, J. S.; Berndt, J.; Matveev, S.; van Westrenen, W.

    2017-09-01

    We present 275 new metal-silicate partition coefficients for P, S, V, Cr, Mn, Co, Ni, Ge, Mo, and W obtained at moderate P (1.5 GPa) and high T (1683-1883 K). We investigate the effect of silicate melt composition using four end member silicate melt compositions. We identify possible silicate melt dependencies of the metal-silicate partitioning of lower valence elements Ni, Ge and V, elements that are usually assumed to remain unaffected by changes in silicate melt composition. Results for the other elements are consistent with the dependence of their metal-silicate partition coefficients on the individual major oxide components of the silicate melt composition suggested by recently reported parameterizations and theoretical considerations. Using multiple linear regression, we parameterize compiled metal-silicate partitioning results including our new data and report revised expressions that predict their metal-silicate partitioning behavior as a function of P-T-X-fO2. We apply these results to constrain the conditions that prevailed during core formation in the angrite parent body (APB). Our results suggest the siderophile element depletions in angrite meteorites are consistent with a CV bulk composition and constrain APB core formation to have occurred at mildly reducing conditions of 1.4 ± 0.5 log units below the iron-wüstite buffer (ΔIW), corresponding to a APB core mass of 18 ± 11%. The core mass range is constrained to 21 ± 8 mass% if light elements (S and/or C) are assumed to reside in the APB core. Incorporation of light elements in the APB core does not yield significantly different redox states for APB core-mantle differentiation. The inferred redox state is in excellent agreement with independent fO2 estimates recorded by pyroxene and olivine in angrites.

  20. Genome-scale portrait and evolutionary significance of human-specific core promoter tri- and tetranucleotide short tandem repeats.

    Science.gov (United States)

    Nazaripanah, N; Adelirad, F; Delbari, A; Sahaf, R; Abbasi-Asl, T; Ohadi, M

    2018-04-05

    While there is an ongoing trend to identify single nucleotide substitutions (SNSs) that are linked to inter/intra-species differences and disease phenotypes, short tandem repeats (STRs)/microsatellites may be of equal (if not more) importance in the above processes. Genes that contain STRs in their promoters have higher expression divergence compared to genes with fixed or no STRs in the gene promoters. In line with the above, recent reports indicate a role of repetitive sequences in the rise of young transcription start sites (TSSs) in human evolution. Following a comparative genomics study of all human protein-coding genes annotated in the GeneCards database, here we provide a genome-scale portrait of human-specific short- and medium-size (≥ 3-repeats) tri- and tetranucleotide STRs and STR motifs in the critical core promoter region between - 120 and + 1 to the TSS and evidence of skewing of this compartment in reference to the STRs that are not human-specific (Levene's test p human-specific transcripts was detected in the tri and tetra human-specific compartments (mid-p genome-scale skewing of STRs at a specific region of the human genome and a link between a number of these STRs and TSS selection/transcript specificity. The STRs and genes listed here may have a role in the evolution and development of characteristics and phenotypes that are unique to the human species.

  1. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    Science.gov (United States)

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  2. Long-term Records of Trace Metal Elements in Core Sediments: Anthropogenic Impacts in The Eure River Watershed

    Science.gov (United States)

    Gardes, T.; Debret, M.; Copard, Y.; Patault, E.; Deloffre, J.; Marcotte, S.; Develle, A. L.; Sabatier, P.; Chaumillon, E.; Coulombier, T.; Revillon, S.; Nizou, J.; Laberdesque, Y.; Koltalo, F.

    2017-12-01

    The Martot Dam is located in the Eure River Watershed (Normandy, France), few hundred meters upstream the Eure-Seine Rivers confluence. In the context of the European Water Framework Directive (2000/60/EC), the French Authorities planned to remove this dam in 2017. Nevertheless, impacts of the removal remain poorly studied. Classically, dam blocked sedimentary transfers downstream, but here, sediments are not blocked behind the dam but stored three hundred meters upstream in a hydraulic annex, called the Martot Pond. Furthermore, this pond is submitted to the tidal flow from the Seine Estuary despite the Martot Dam. The aim of the study is to evaluate the dam removal impacts on sedimentary transfers and re-suspension of contaminated sediments stored in the Martot Pond and the Eure River's channel. Concerning past transfers and sediments accumulation in the Eure River Watershed, sedimentary archives have been cored, before dam removal, at the Martot Pond and the Les Damps Pond (located 10km upstream the latter). Dating of sedimentary cores for both ponds indicates a sedimentation rate around 1 cm y-1. Trace metal elements quantification showed a wide metallic contamination with highest concentrations evidenced during the 1950-1960's (As: 13-22 mg kg-1; Cd: 40-55 mg kg-1; Cr: 170-210 mg kg-1; Cu: 400-490 mg kg-1; Hg: 2.3 mg kg-1; Mn: 1,280-2,200 mg kg-1; Ni: 64-75 mg kg-1; Zn: 905-990 mg kg-1) and the 1990-2000's (Cr: 95-215 mg kg-1; Ni: 100 mg kg-1; Pb: 670-855 mg kg-1). These variations of concentrations along cores can be associated with industrial past of the Eure River Watershed and sources of contamination can be identified. Thereby, Zn, Ni or Hg contamination could be associated with wastes of battery factory released in the Eure River during the economic recovery, while Pb contamination is linked to the activities of a cathode-ray tubes factory. Metals quantification in core materials highlighted anthropogenic impacts in the Eure River Watershed. These

  3. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  4. Experimental evaluation of different mixing promoter for nuclear fuel element by means of a new thermal tracing technique

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2004-01-01

    In this work a new experimental method is used to experimentally evaluate the performance of different appendages promoting the turbulent mixing between the coupled subchannels of nuclear fuel elements.The method used will be introduced in another presentation and consists in the generation and measurement of small thermal traces in the refrigerating water flow between the fuel rods.Because it is suitable for heterogeneous and compact subchannels (as Argentinean fuels) with high water flows in simple and affordable tests at atmospheric pressure, this new method is specially well suited for the design of fuel elements, while it offers advantages over other methods of mixing measurement.The experiments carried out on a small test section proved that the buttons brazed to the fuel rods (similar to the 'turbulence promoters' of the Canflex fuel) had an excellent thermohydraulic performance as compared to different mixing vane designs studied.The thermal traces method developed has shown its potential as a thermohydraulic design tool for the development of advanced nuclear fuels, that eventually incorporate mixing promoter elements. In the case of CARA, and as it includes spacer grids, it could be possible to use them to incorporate these elements without the need of brazing them to the rods (as is the case in Canflex), and therefore without penalizing its integrity [es

  5. Analysis Influence of Mixing Gd2O3 in the Silicide Fuel Element to Core Excess Reactivity of RSG-GAS

    International Nuclear Information System (INIS)

    Susilo, Jati

    2004-01-01

    Gadolinium (Gd 2 O 3 ) is a burnable poison material mixed in the pin fuel element of the LWR core used to decrease core excess reactivity. In this research, analysis influence of mixing Gd 2 O 3 in the silicide fuel element to excess reactivity of the RSG-GAS core had been done. Equivalent cell of the equilibrium core developed by L.E.Strawbridge from Westing House Co. burn-up calculation has been done using SRAC-PIJ computer code achieve infinite multiplication factor (k x ). Value of Gd 2 O 3 concentration in the fuel element (pcm) showed by mass ratio of Gd 2 O 3 (gram) to that U 3 Si 2 (gram) times 10 5 , that is 0 pcm ∼ 100 pcm. From the calculation results analysis showed that Gd 2 O 3 concentration added should be considered. because a large number of Gd 2 O 3 will result in not achieving criticality at the Beginning Of Cycle. The maximum concentration of Gd 2 O 3 for RSG-GAS equilibrium fueled silicide 2.96 grU/cc is 80 pcm or 52.02 mgram/fuel plate. Maximum reduction of core excess reactivity due to mixing of Gd 2 O 3 in the RSG-GAS silicide fuels was around 1.502 %Δk/k, and hence not achieving the standard nominal excess reactivity for RSG-GAS core using high density of U 3 Si 2 -Al fuel. (author)

  6. Apparatus for connecting an element attached to a metallic wire to an interior tube in a core drill

    Energy Technology Data Exchange (ETDEWEB)

    1970-04-17

    A locking device consists of at least one lever pivotable around an axis transversal to the axis of the core drill and mounted on the upper end of the core tube. A first arm oriented upward is intended to pivot during lowering of the wire line and to engage on the core tube, so that the core tube can be lifted by the wire line. A second arm prevents lifting of the core tube during drilling. The second arm also releases the core tube, after the wire line has been firmly attached and locked onto the core tube.

  7. The MTP1 promoters from Arabidopsis halleri reveal cis-regulating elements for the evolution of metal tolerance.

    Science.gov (United States)

    Fasani, Elisa; DalCorso, Giovanni; Varotto, Claudio; Li, Mingai; Visioli, Giovanna; Mattarozzi, Monica; Furini, Antonella

    2017-06-01

    In the hyperaccumulator Arabidopsis halleri, the zinc (Zn) vacuolar transporter MTP1 is a key component of hypertolerance. Because protein sequences and functions are highly conserved between A. halleri and Arabidopsis thaliana, Zn tolerance in A. halleri may reflect the constitutively higher MTP1 expression compared with A. thaliana, based on copy number expansion and different cis regulation. Three MTP1 promoters were characterized in A. halleri ecotype I16. The comparison with the A. thaliana MTP1 promoter revealed different expression profiles correlated with specific cis-acting regulatory elements. The MTP1 5' untranslated region, highly conserved among A. thaliana, Arabidopsis lyrata and A. halleri, contains a dimer of MYB-binding motifs in the A. halleri promoters absent in the A. thaliana and A. lyrata sequences. Site-directed mutagenesis of these motifs revealed their role for expression in trichomes. A. thaliana mtp1 transgenic lines expressing AtMTP1 controlled by the native A. halleri promoter were more Zn-tolerant than lines carrying mutations on MYB-binding motifs. Differences in Zn tolerance were associated with different distribution of Zn among plant organs and in trichomes. The different cis-acting elements in the MTP1 promoters of A. halleri, particularly the MYB-binding sites, are probably involved in the evolution of Zn tolerance. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  8. Incorporating the Six Core Elements of Health Care Transition Into a Medicaid Managed Care Plan: Lessons Learned From a Pilot Project.

    Science.gov (United States)

    McManus, Margaret; White, Patience; Pirtle, Robin; Hancock, Catina; Ablan, Michael; Corona-Parra, Raquel

    2015-01-01

    This pediatric-to-adult health care transition pilot project describes the process and results of incorporating the "Six Core Elements of Health Care Transition (2.0)" into a Medicaid managed care plan with a group of 35 18-23 year olds who have chronic mental health, developmental, and complex medical conditions. The pilot project demonstrated an effective approach for customizing and delivering recommended transition services. At the start of the 18-month project, the Medicaid plan was at the basic level (1) of transition implementation of the Six Core Elements with no transition policy, member transition readiness assessment results, health care transition plans of care, updated medical summaries, transfer package for the adult-focused provider, and assurance of transfer completion and consumer feedback. At the conclusion of the pilot project, the plan scored at level 3 on each core element. The primary reason for not scoring at the highest level (4) was because the transition elements have not been incorporated into services for all enrollees within the plan. Future efforts in managed care will benefit from starting the transition process much earlier (ages 12-14), expanding the role of nurse care managers and participating pediatric and adult-focused clinicians in transition, and offering payment incentives to clinicians to implement the Six Core Elements of Health Care Transition. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Platinum-group elements in the cores of potassium feldspar spherules from the Cretaceous-Tertiary boundary at Caravaca (Spain

    Directory of Open Access Journals (Sweden)

    Palomo, I.

    1994-04-01

    Full Text Available The abundant spherules present in the Cretaceous-Tertiary boundary layer at Caravaca are diagenetically transformed to potassium feldspar. Before our study no possible relicts of the precursor material had been reported. but in this paper we describe the presence of cores in these spherules that could represent a relict of the «unknown precursor». These cores are made up of C mixed with Si. Mg. AL Cr. Ca among other elements. Laser Ablation System analysis also reveals an enrichment in pe;E could suggest an extraterrestrial origin for this material. PI. Pd and Ir do not show a chondritic ratio: however. asevere modification of their concentration could be expected during the early diagenetic processes.Las esférulas existentes en la lámina de sedimento del tránsito Cretácico-Terciario de la sección de Caravaca han sido transformadas diagenéticamente a feldespato potásico. En este trabajo se describe la existencia de núcleos encontrados en el interior de las esférulas. los cuales' pueden representar relictos del material precursor. Dichos núcleos están constituidos por C. Si. Mg, AL Cr y Ca entre otros elementos. Se pone de relieve, por vez primera, su notable enriquecimiento en elementos del grupo del platino, cuyas relaciones no condríticas pueden ser debidas a la existencia de importantes modificaciones en su concentración inicial causadas por los procesos diagenéticos y por la existencia de materia orgánica.

  10. Green Infrastructure Research Promotes Students' Deeper Interest in Core Courses of a Water Resources Program

    Science.gov (United States)

    Yerk, W.; Montalto, F. A.; Foti, R.

    2015-12-01

    As one of most innovative among low impact development technologies, Green Infrastructure (GI) is a new technology that presents a range of potential research opportunities. Inherently linked to sustainability, urban quality of life, resilience, and other such topics, GI also represents a unique opportunity to highlight the social relevance of practical STEM research to undergraduate students. The nature of research on urban GI, in fact, as well as the accessibility of the GI sites, allows students to combine hands-on experience with theoretical work. Furthermore, the range of scales of the projects is such that they can be managed within a single term, but does not preclude longer engagement. The Sustainable Water Resource Engineering lab at Drexel University is engaged in two types of GI research outside the classroom. One type is a research co-op research internship. The second is a selective university-wide faculty-mentored summer scholarship STAR (Students Tackling Advanced Research) specifically designed for freshmen. The research projects we developed for those curricula can be accomplished by undergraduate students, but also address a larger research need in this emerging field. The research tasks have included identifying and calibrating affordable instruments, designing and building experimental setups, and monitoring and evaluating performance of GI sites. The work also promoted deeper understanding of the hydrological processes and initiated learning beyond the students' current curricula. The practice of the Lab's research being embedded into the educational process receives positive feedback from the students and achieves meaningful and long-lasting learning objectives. The experience helps students to students acquire hands-on experience, improves their metacognition and evidence-based inquiring into real-world problems, and further advances decision-making and communication skills.

  11. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    Science.gov (United States)

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  12. Determination of natural radionuclides from 238U and 232Th series, trace and major elements in sediment cores from baixada Santista and evaluation of impacted areas

    International Nuclear Information System (INIS)

    Damatto, Sandra Regina

    2010-01-01

    Baixada Santista is the region of higher population of the coast of Sao Paulo State, where it is located the largest port in Latin America, in the city of Santos, and the most important industrial complex of Latin America, in the city of Cubatao. This region has received in recent years a considerable load of industrial and domestic effluents in its water bodies, as a direct result of the industrial and port activities and the large population growth in recent decades, and is considered nowadays highly impacted. In the present study sediment cores were collected in the estuary of Santos-Cubatao, in the estuary of Sao Vicente, in the channel of Bertioga and Santos Bay, in order to determine the concentration of trace and major elements and natural radionuclides from the 238 U and 232 Th series. The techniques used were neutron activation analysis, X-ray fluorescence and gamma spectrometry, respectively. The obtained values for the elements Cr, Sb, Ta and Zn in some cores, are higher than data from literature, and can indicate a possible anthropic contribution. Comparing the obtained values of Cr and Zn elements determined in the sediment cores with the values of TEL and PEL index for sediment quality, it was verified that the studied region presents Cr levels higher than TEL in Santos-Cubatao estuary and Bertioga channel and Zn element presented values higher than TEL for some core slices of Santos-Cubatao estuary, for one core of Sao Vicente estuary, one core in Bertioga channel and Santos Bay. For the other elements, the values obtained in this study can be considered as reference values for the region. Although the element As presented higher values than the TEL in all the studied environments, the concentrations obtained are of the same order of magnitude as literature data and, therefore, can be considered also as reference values for the region. No enrichment was found for the major elements in all the ecosystems studied, with the exception for the element P

  13. Characterization of organic matter in sediment cores of the Todos os Santos Bay, Bahia, Brazil, by elemental analysis and 13C NMR

    International Nuclear Information System (INIS)

    Costa, A.B.; Novotny, E.H.; Bloise, A.C.; Azevedo, E.R. de; Bonagamba, T.J.; Zucchi, M.R.; Santos, V.L.C.S.; Azevedo, A.E.G.

    2011-01-01

    Highlights: → The impact of human activity on the sediments of Todos os Santos Bay in Brazil was evaluated by EA and 13 C NMR. → This article reports a study of six sediment cores collected at different depths and regions. → The elemental profiles of cores suggest an abrupt change in the sedimentation regime, corresponds to about 50 years ago, coinciding with the implantation of major onshore industrial projects. → The results presented illustrate several important aspects of environmental impact of human activity on this bay. - Abstract: The impact of human activity on the sediments of Todos os Santos Bay in Brazil was evaluated by elemental analysis and 13 C Nuclear Magnetic Resonance ( 13 C NMR). This article reports a study of six sediment cores collected at different depths and regions of Todos os Santos Bay. The elemental profiles of cores collected on the eastern side of Frades Island suggest an abrupt change in the sedimentation regime. Autoregressive Integrated Moving Average (ARIMA) analysis corroborates this result. The range of depths of the cores corresponds to about 50 years ago, coinciding with the implantation of major onshore industrial projects in the region. Principal Component Analysis of the 13 C NMR spectra clearly differentiates sediment samples closer to the Subae estuary, which have high contents of terrestrial organic matter, from those closer to a local oil refinery. The results presented in this article illustrate several important aspects of environmental impact of human activity on this bay.

  14. Analysing the interactions between renewable energy promotion and energy efficiency support schemes: The impact of different instruments and design elements

    International Nuclear Information System (INIS)

    Rio, Pablo del

    2010-01-01

    CO 2 emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the 'certificate' debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions.

  15. Analysing the interactions between renewable energy promotion and energy efficiency support schemes: The impact of different instruments and design elements

    Energy Technology Data Exchange (ETDEWEB)

    Rio, Pablo del, E-mail: pablo.delrio@cchs.csic.e [Instituto de Politicas y Bienes Publicos, Consejo Superior de Investigaciones Cientificas (CSIC), C/Albasanz 26-28, 28037 Madrid (Spain)

    2010-09-15

    CO{sub 2} emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the 'certificate' debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions.

  16. Analysing the interactions between renewable energy promotion and energy efficiency support schemes. The impact of different instruments and design elements

    Energy Technology Data Exchange (ETDEWEB)

    Del Rio, Pablo [Instituto de Politicas y Bienes Publicos, Consejo Superior de Investigaciones Cientificas (CSIC), C/Albasanz 26-28, 28037 Madrid (Spain)

    2010-09-15

    CO{sub 2} emissions reduction, renewable energy deployment and energy efficiency are three main energy/environmental goals, particularly in Europe. Their relevance has led to the implementation of support schemes in these realms. Their coexistence may lead to overlaps, synergies and conflicts between them. The aim of this paper is to analyse the interactions between energy efficiency measures and renewable energy promotion, whereas previous analyses have focused on the interactions between emissions trading schemes (ETS) and energy efficiency measures and ETS and renewable energy promotion schemes. Furthermore, the analysis in this paper transcends the certificate debate (i.e., tradable green and white certificates) and considers other instruments, particularly feed-in tariffs for renewable electricity. The goal is to identify positive and negative interactions between energy efficiency and renewable electricity promotion and to assess whether the choice of specific instruments and design elements within those instruments affects the results of the interactions. (author)

  17. Generic structure and promotional elements in best-selling online book blurbs: a cross-cultural study

    Directory of Open Access Journals (Sweden)

    Neslihan Önder

    2013-04-01

    Full Text Available This study investigates the generic structure and promotional elements of the online fiction blurbs accompanying the 95 best-selling books from Amazon United Kingdom and Okuoku Turkey (1999-2011, a company that sells books online that are written in Turkish or translated into Turkish, and adds to the growing number of investigations into this genre (Kathpalia, 1997; Bhatia, 2004; Cacchiani, 2007; Gea-Valor, 2007; Gesuato, 2007; Basturkmen, 2009. Based on the findings, a two-level schematic structure (moves and steps is proposed for the blurbs following Swales (1990. The findings suggest that Amazon UK book blurbs have a six-move schematic structure: complimenting the author, book description, justifying the book by establishing a niche, book promotion, author’s background and author’s website/blog being the second, fourth and fifth obligatory moves. However, Okuoku book blurbs feature a five-move schematic structure with complimenting the author, book description, involving the reader in the text, book promotion and author’s background, the second and fourth being obligatory. Analysis of promotional elements in the corpora reveals that online fiction book blurbs employ the art of advertising through the use of favorable expressions (Bhatia, 2005 and innovative uses of rhetorical strategies to persuade the reader to read the book.

  18. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  19. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  20. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  1. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus.

    Science.gov (United States)

    Smith, Emily M; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2016-01-07

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  2. ONLINE SOCIAL ADVERTISING: PROMOTIONAL ELEMENTS POSTED BY TRAVEL AGENCIES FROM SUCEAVA CITY ON FACEBOOK FRIENDS’ COMMUNITY

    Directory of Open Access Journals (Sweden)

    Pavel STANCIU

    2016-08-01

    Full Text Available Like any other business in the travel and hospitality industry, it is essential for travel agencies to establish a good promotion policy, to be most noticeable among buyers of travel packages. The promotion – WOM (Word of Mouth, and especially Social Advertising via social networks offer a new perspective of economic development, based on participatory marketing policies that would break the barriers of classical marketing, perceived by tourists as unattractive and completely outdated socio-morally. The new policy promoting travel agencies must be built in cyberspace, on account of social networks, which tend to overshadow the traditional ways of tourist feedback. In this relatively new conjuncture, travel agencies in Suceava are forced to adapt, offering potential customers in the online environment, tourism products and presenting highly attractive destinations in informal circumstances, with a seemingly purely informative character. A research based on questionnaires, which benefited from dissemination on social networks, was carried out with the support of one affable group of 137 friends from Facebook community, and aimed to highlight the effectiveness of online promotion of travel agencies in Suceava and its driving force generated locally. We conclude that people from Suceava who are in the group of friends have constant activity on social networks (especially Facebook, have much knowledge about the travel agencies in Suceava that are active in the virtual environment, but are reluctant when they have the opportunity to sign in with the promotional offers of tour operators. It is therefore imperative that travel agencies in Suceava have a constant interaction with future tourists and respond as quickly as possible to the signals they receive from them, even if, at least for now, locally, there is no culture that fosters such promotion relations - offer for sale - purchase between travel agencies and potential customers, recruited on

  3. Characterization of a Neutron Beam Following Reconfiguration of the Neutron Radiography Reactor (NRAD Core and Addition of New Fuel Elements

    Directory of Open Access Journals (Sweden)

    Aaron E. Craft

    2016-02-01

    Full Text Available The neutron radiography reactor (NRAD is a 250 kW Mark-II Training, Research, Isotopes, General Atomics (TRIGA reactor at Idaho National Laboratory, Idaho Falls, ID, USA. The East Radiography Station (ERS is one of two neutron beams at the NRAD used for neutron radiography, which sits beneath a large hot cell and is primarily used for neutron radiography of highly radioactive objects. Additional fuel elements were added to the NRAD core in 2013 to increase the excess reactivity of the reactor, and may have changed some characteristics of the neutron beamline. This report discusses characterization of the neutron beamline following the addition of fuel to the NRAD. This work includes determination of the facility category according to the American Society for Testing and Materials (ASTM standards, and also uses an array of gold foils to determine the neutron beam flux and evaluate the neutron beam profile. The NRAD ERS neutron beam is a Category I neutron radiography facility, the highest possible quality level according to the ASTM. Gold foil activation experiments show that the average neutron flux with length-to-diameter ratio (L/D = 125 is 5.96 × 106 n/cm2/s with a 2σ standard error of 2.90 × 105 n/cm2/s. The neutron beam profile can be considered flat for qualitative neutron radiographic evaluation purposes. However, the neutron beam profile should be taken into account for quantitative evaluation.

  4. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  5. PePPER : a webserver for prediction of prokaryote promoter elements and regulons

    NARCIS (Netherlands)

    de Jong, Anne; Pietersma, Hilco; Cordes, Martijn; Kuipers, Oscar P.; Kok, Jan

    2012-01-01

    Background: Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison

  6. Core promoter mutations 3 years after anti-hepatitis B e seroconversion in patients with chronic hepatitis B or hepatitis B and C infection and cancer remission.

    Science.gov (United States)

    Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe

    2002-09-01

    In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.

  7. Analysis of AVR4 promoter by sequential response-element deletion ...

    African Journals Online (AJOL)

    An Avr4 promoter region ligated to chloramphenicol acetyltransferase plasmid vector (pBLCAT2) to produce recombinant plasmid Avr4pBLCAT2 was sequentially deleted to produce five distinct mutants: Avr4pBLCAT2907-176, Avr4pBLCAT2809-176, Avr4pBLCAT2789-176, Avr4pBLCAT2429-176 and Avr4pBLCAT2 ...

  8. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  9. Optimization of neutronic characteristics of U3Si2 low enrichment fuel elements for a new design of IEA-R1 reactor core

    International Nuclear Information System (INIS)

    Mai, L.A.; Maiorino, J.R.; Gouvea, E.A.

    1989-01-01

    This work shows a study of neutronic optimization of U 3 Si 2 -Al low enrichment fuel element. This study has a goal to propose a optimized Core to be used in the research reactor IEA-R1. The external dimensions of the fuel element were maintained as constraints and the loss of reactivity along fuel life-time was defined as 'objective function', and it has been minimized by varying the fuel element dimensions. Cell calculations were made with HAMMER-TECH /3/ Code, for burnups up to 50% of U-235 initial mass. The Computer values of the objective function for several combinations of fuel element dimensions were fitted by a surface using the SAS system /9/, and it has been minimized by a Harwell subroutine /10/. (author) [pt

  10. [Finite element analysis of the maxillary central incisor with crown lengthening surgery and post-core restoration in management of crown-root fracture].

    Science.gov (United States)

    Zhen, Min; Hu, Wen-jie; Rong, Qi-guo

    2015-12-18

    To construct the finite element models of maxillary central incisor and the simulations with crown lengthening surgery and post-core restoration in management of different crown-root fracture types, to investigate the stress intensity and distributions of these models mentioned above, and to analyze the indications of crown lengthening from the point of view of mechanics. An extracted maxillary central incisor and alveolar bone plaster model were scanned by Micro-CT and dental impression scanner (3shape D700) respectively. Then the 3D finite element models of the maxillary central incisor and 9 simulations with crown lengthening surgery and post-core restoration were constructed by Mimics 10.0, Geomagic studio 9.0 and ANSYS 14.0 software. The oblique static force (100 N) was applied to the palatal surface (the junctional area of the incisal 1/3 and middle 1/3), at 45 degrees to the longitudinal axis, then the von Mises stress of dentin, periodontal ligament, alveolar bone, post and core, as well as the periodontal ligament area, were calculated. A total of 10 high-precision three-dimensional finite element models of maxillary central incisor were established. The von Mises stress of models: post>dentin>alveolar bone>core>periodontal ligament, and the von Mises stress increased linearly with the augmentation of fracture degree (besides the core). The periodontal ligament area of the crown lengthening was reduced by 12% to 33%. The von Mises stress of periodontal ligament of the B2L2c, B2L3c, B3L1c, B3L2c, B3L3c models exceeded their threshold limit value, respectively. The maxillary central incisors with the labial fracture greater than three-quarter crown length and the palatal fracture deeper than 1 mm below the alveolar crest are not the ideal indications of the crown lengthening surgery.

  11. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  12. Comparative Study of Metadata Elements Used in the Website of Central Library of Universities Subordinate to the Ministry of Science, Research and Technology with the Dublin Core Metadata Elements

    Directory of Open Access Journals (Sweden)

    Kobra Babaei

    2012-03-01

    Full Text Available This research has been carried out with the aim of studying the web sites of central libraries of universities subordinate to the Ministry of Science, Research and Technology usage of metadata elements and its comparison with Dublin Core standard elements. This study was a comparative survey, in which 40 websites of academic library by using Internet Explorer browser. Then the HTML pages of these websites were seen through the Source of View menu, and metadata elements of each websites were extracted and entered in the checklist. Then, with using descriptive statistics (frequency, percentage and mean analysis of data was discussed. Research findings showed that the reviewed websites did not use any Dublin Core metadata elements, general metadata Markup language used in design of all websites, the amount of metadata elements used in website, Central Library of Ferdowsi University of Mashhad and Iran Science and Industries with 57% in first ranked and Shahid Beheshti University with 49% in second ranked and the International University of Imam Khomeini with 40% was in third ranked. The approach to web designers was determined too that as follows: the content of source in first ranked and attention to physical appearance source in second ranked and also ownership of source in third position.

  13. Structured model Consumer-based Brand Equity based on Promotional-mix elements(Case Study: Food Active Industries of Tehran)

    OpenAIRE

    Mehran Rezvani; Siran Mehrnia

    2014-01-01

    Abstract This paper aims to examine the relationships among Promotional-mix elements and Customer-based Brand Equity. Then, a model is developed to examine the relationships Promotional-mix elements and Customer-based brand equity in Food Industries of Tehran. The sample size is 240. Data are collected by questionnaire designed. The collected data is estimated using Lizrel and SEM method. The test results show that four dimensions of brand equity (brand awareness, perceived quality, and br...

  14. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  15. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    International Nuclear Information System (INIS)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-01-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants

  16. Nonlinear Thermo-mechanical Finite Element Analysis of Polymer Foam Cored Sandwich Structures including Geometrical and Material Nonlinearity

    DEFF Research Database (Denmark)

    Palleti, Hara Naga Krishna Teja; Thomsen, Ole Thybo; Taher, Siavash Talebi

    In this paper, polymer foam cored sandwich structures with fibre reinforced composite face sheets subjected to combined mechanical and thermal loads will be analysed using the commercial FE code ABAQUS® incorporating both material and geometrical nonlinearity. Large displacements and rotations...

  17. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    Science.gov (United States)

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  18. Human hepatocytes apoptosis induced by replication of hepatitis B virus subgenotypes F1b and F4: Role of basal core promoter and preCore mutations.

    Science.gov (United States)

    Elizalde, María Mercedes; Sevic, Ina; González López Ledesma, María Mora; Campos, Rodolfo Héctor; Barbini, Luciana; Flichman, Diego Martin

    2018-01-01

    In the context of pathogenesis of HBV infection, HBV genotypes and mutants have been shown to affect the natural course of chronic infection and treatment outcomes. In this work, we studied the induction of apoptosis by the replication of HBV subgenotypes F1b and F4, and the naturally occurring mutants BCP and preCore. Both subgenotypes F1b and F4 HBV genome transfections induced cell death by apoptosis in human hepatocytes. The BCPdm (A1762T/G1764A) and preCore (G1896A) mutants induced higher levels of apoptosis than the wt virus. This increase in apoptosis was not associated with the enhanced viral replication of the variants. HBV-mediated apoptosis was independent of viral subgenotypes, and associated with the modulation of members of the regulatory Bcl-2 family proteins expression in the mitochondrial apoptotic pathway. Finally, the apoptosis induction increase observed for the preCore mutants suggests that HBeAg might have an anti-apoptotic effect in human hepatocytes. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  20. Finite element modeling of fluid/thermal/structural interaction for a gas-cooled fast reactor core

    International Nuclear Information System (INIS)

    Bennett, J.G.; Ju, F.D.

    1980-01-01

    Two nonlinear finite element formulations for application to a series of experiments in the Gas-Cooled Fast Reactor (GCFR) development program are described. An efficient beam column element for moderately large deformations is combined with a finite element developed for an engineering description of a convecting fluid. Typical results from both elements are illustrated. A combined application for a problem typical of the GCFR loss-of-coolant experiments is illustrated. These problems are not the usual fluid structural interaction problems in that the inertia coupling is negligible while the thermal coupling is very important

  1. Critical Role of a Single Position in the −35 Element for Promoter Recognition by Mycobacterium tuberculosis SigE and SigH▿

    OpenAIRE

    Song, Taeksun; Song, Seung-Eun; Raman, Sahadevan; Anaya, Mauricio; Husson, Robert N.

    2008-01-01

    Mycobacterial SigE and SigH both initiate transcription from the sigB promoter, suggesting that they recognize similar sequences. Through mutational and primer extension analyses, we determined that SigE and SigH recognize nearly identical promoters, with differences at the 3′ end of the −35 element distinguishing between SigE- and SigH-dependent promoters.

  2. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  3. HCV core protein-induced down-regulation of microRNA-152 promoted aberrant proliferation by regulating Wnt1 in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Shifeng Huang

    Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell

  4. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  5. Major- and trace elements in grain size fractions of the Apollo-17 core of the drilled sample 74001

    International Nuclear Information System (INIS)

    Kraehenbuehl, U.; Gunten, H.R. von; Jost, D.; Meyer, G.; Wegmueller, F.

    1980-01-01

    Two layers of a drill sample were examined, one from a depth of 38 cm and the other from 58 cm depth. Neutron activation analysis was used for one group of elements, and radiochemical analysis for another. Over a range of grain size from 36 to 450 μm, the trace elements U, Co, and La were found to uniformly distributed, as was iron. The top layer consistently showed a 5-8% higher content. The volatile trace elements Ge and Cd were found to be enriched in the smaller grain sizes. This contradicts previous assumptions of an enrichment of the more volatile elements in top layers owing to more rapid cooling of volcanic eruptions. (R.S.)

  6. Comparison of problems and experience of core operation with distorted fuel element assemblies in VVER-1000 and PWR reactors

    International Nuclear Information System (INIS)

    Afanas'ev, A.

    1999-01-01

    The main reactors leading to distortion of fuel element assemblies during reactor operation were studied. A series of actions which compensate this effect was proposed. Criteria of operation limitation in VVER-1000 and PWR reactors are described

  7. From field to database : a user-oriented approche to promote cyber-curating of scientific drilling cores

    Science.gov (United States)

    Pignol, C.; Arnaud, F.; Godinho, E.; Galabertier, B.; Caillo, A.; Billy, I.; Augustin, L.; Calzas, M.; Rousseau, D. D.; Crosta, X.

    2016-12-01

    Managing scientific data is probably one the most challenging issues in modern science. In plaeosciences the question is made even more sensitive with the need of preserving and managing high value fragile geological samples: cores. Large international scientific programs, such as IODP or ICDP led intense effort to solve this problem and proposed detailed high standard work- and dataflows thorough core handling and curating. However many paleoscience results derived from small-scale research programs in which data and sample management is too often managed only locally - when it is… In this paper we present a national effort leads in France to develop an integrated system to curate ice and sediment cores. Under the umbrella of the national excellence equipment program CLIMCOR, we launched a reflexion about core curating and the management of associated fieldwork data. Our aim was then to conserve all data from fieldwork in an integrated cyber-environment which will evolve toward laboratory-acquired data storage in a near future. To do so, our demarche was conducted through an intimate relationship with field operators as well laboratory core curators in order to propose user-oriented solutions. The national core curating initiative proposes a single web portal in which all teams can store their fieldwork data. This portal is used as a national hub to attribute IGSNs. For legacy samples, this requires the establishment of a dedicated core list with associated metadata. However, for forthcoming core data, we developed a mobile application to capture technical and scientific data directly on the field. This application is linked with a unique coring-tools library and is adapted to most coring devices (gravity, drilling, percussion etc.) including multiple sections and holes coring operations. Those field data can be uploaded automatically to the national portal, but also referenced through international standards (IGSN and INSPIRE) and displayed in international

  8. Spontaneous core-shell elemental distribution in In-rich InxGa1-xN nanowires grown by molecular beam epitaxy

    Science.gov (United States)

    Gómez-Gómez, M.; Garro, N.; Segura-Ruiz, J.; Martinez-Criado, G.; Cantarero, A.; Mengistu, H. T.; García-Cristóbal, A.; Murcia-Mascarós, S.; Denker, C.; Malindretos, J.; Rizzi, A.

    2014-02-01

    The elemental distribution of self-organized In-rich InxGa1-xN nanowires grown by plasma-assisted molecular beam epitaxy has been investigated using three different techniques with spatial resolution on the nanoscale. Two-dimensional images and elemental profiles of single nanowires obtained by x-ray fluorescence and energy-dispersive x-ray spectroscopy, respectively, have revealed a radial gradient in the alloy composition of each individual nanowire. The spectral selectivity of resonant Raman scattering has been used to enhance the signal from very small volumes with different elemental composition within single nanowires. The combination of the three techniques has provided sufficient sensitivity and spatial resolution to prove the spontaneous formation of a core-shell nanowire and to quantify the thicknesses and alloy compositions of the core and shell regions. A theoretical model based on continuum elastic theory has been used to estimate the strain fields present in such inhomogeneous nanowires. These results suggest new strategies for achieving high quality non-polar heterostructures.

  9. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  10. Trace Element Geochemistry of Basaltic Tephra in Maar Cores; Implications for Centre Correlation, Field Evolution, and Mantle Source Characteristics of the Auckland Volcanic Field, New Zealand

    Science.gov (United States)

    Hopkins, J. L.; Leonard, G.; Timm, C.; Wilson, C. J. N.; Neil, H.; Millet, M. A.

    2014-12-01

    Establishing volcanic hazard and risk management strategies hinges on a detailed understanding of the type, timing and tephra dispersal of past eruptions. In order to unravel the pyroclastic eruption history of a volcanic field, genetic links between the deposits and eruption source centre need to be established. The Auckland Volcanic Field (AVF; New Zealand) has been active for ca. 200 kyr and comprises ca. 53 individual centres covering an area of ca. 360km2. These centres show a range of sizes and eruptive styles from maar craters and tuff rings, to scoria cones and lava flows consistent with both phreatomagmatic and magmatic eruptions. Superimposition of the metropolitan area of Auckland (ca. 1.4 million inhabitants) on the volcanic field makes it critically important to assess the characteristics of the volcanic activity, on which to base assessment and management of the consequent hazards. Here we present a geochemical approach for correlating tephra deposits to their source centres. To acquire the most complete stratigraphic record of pyroclastic events, maar crater cores from different locations, covering various depths and thus ages across the field were selected. Magnetic susceptibility and x-ray density scanning of the cores was used to identify the basaltic tephra horizons, which were sampled and in-situ analysis of individual shards undertaken for major and trace elements using EPMA and LA-ICP-MS techniques, respectively. Our results show that tephra shard trace element ratios are comparable and complementary to the AVF whole rock database. The use of specific trace element ratios (e.g. Gd/Yb vs. Zr/Yb) allows us to fingerprint and cross correlate tephra horizons between cores and, when coupled with newly acquired 40Ar-39Ar age dating and eruption size estimates, correlate horizons to their source centres. This integrated style of study can provide valuable information to help volcanic hazard management and forecasting, and mitigation of related risks.

  11. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  12. ARKAS: A three-dimensional finite element code for the analysis of core distortions and mechanical behaviour

    International Nuclear Information System (INIS)

    Nakagawa, M.

    1984-01-01

    Computer program ARKAS has been developed for the purpose of predicting core distortions and mechanical behaviour in a cluster of subassemblies under steady state conditions in LMFBR cores. This report describes the analytical models and numerical procedures employed in the code together with some typical results of the analysis made on large LMFBR cores. ARKAS is programmed in the FORTRAN-IV language and is capable of treating up to 260 assemblies in a cluster with flexible boundary conditions including mirror and rotational symmetry. The nonlinearity of the problem due to contact and separation is solved by the step iterative procedure based on the Newton-Raphson method. In each step iterative procedure, the linear matrix equation must be reconstructed and then solved directly. To save computer time and memory, the substructure method is adopted in the step of reconstructing the linear matrix equation, and in the step of solving the linear matrix equation, the block successive over-relaxation method is adopted. The program ARKAS computes, at every time step, 3-dimensional displacements and rotations of the subassemblies in the core and the interduct forces including at the nozzle tips and nozzle bases with friction effects. The code also has an ability to deal with the refueling and shuffling of subassemblies and to calculate the values of withdrawal forces. For the qualitative validation of the code, sample calculations were performed on the several bundle arrays. In these calculations, contact and separation processes under the influences of friction forces, off-center loading, duct rotations and torsion, thermal expansion and irradiation induced swelling and creep were analyzed. These results are quite reasonable in the light of the expected behaviour. This work was performed under the sponsorship of Toshiba Corporation

  13. Component mode synthesis methods applied to 3D heterogeneous core calculations, using the mixed dual finite element solver MINOS

    Energy Technology Data Exchange (ETDEWEB)

    Guerin, P.; Baudron, A. M.; Lautard, J. J. [Commissariat a l' Energie Atomique, DEN/DANS/DM2S/SERMA/LENR, CEA Saclay, 91191 Gif sur Yvette (France)

    2006-07-01

    This paper describes a new technique for determining the pin power in heterogeneous core calculations. It is based on a domain decomposition with overlapping sub-domains and a component mode synthesis technique for the global flux determination. Local basis functions are used to span a discrete space that allows fundamental global mode approximation through a Galerkin technique. Two approaches are given to obtain these local basis functions: in the first one (Component Mode Synthesis method), the first few spatial eigenfunctions are computed on each sub-domain, using periodic boundary conditions. In the second one (Factorized Component Mode Synthesis method), only the fundamental mode is computed, and we use a factorization principle for the flux in order to replace the higher order Eigenmodes. These different local spatial functions are extended to the global domain by defining them as zero outside the sub-domain. These methods are well-fitted for heterogeneous core calculations because the spatial interface modes are taken into account in the domain decomposition. Although these methods could be applied to higher order angular approximations - particularly easily to a SPN approximation - the numerical results we provide are obtained using a diffusion model. We show the methods' accuracy for reactor cores loaded with UOX and MOX assemblies, for which standard reconstruction techniques are known to perform poorly. Furthermore, we show that our methods are highly and easily parallelizable. (authors)

  14. Component mode synthesis methods applied to 3D heterogeneous core calculations, using the mixed dual finite element solver MINOS

    International Nuclear Information System (INIS)

    Guerin, P.; Baudron, A. M.; Lautard, J. J.

    2006-01-01

    This paper describes a new technique for determining the pin power in heterogeneous core calculations. It is based on a domain decomposition with overlapping sub-domains and a component mode synthesis technique for the global flux determination. Local basis functions are used to span a discrete space that allows fundamental global mode approximation through a Galerkin technique. Two approaches are given to obtain these local basis functions: in the first one (Component Mode Synthesis method), the first few spatial eigenfunctions are computed on each sub-domain, using periodic boundary conditions. In the second one (Factorized Component Mode Synthesis method), only the fundamental mode is computed, and we use a factorization principle for the flux in order to replace the higher order Eigenmodes. These different local spatial functions are extended to the global domain by defining them as zero outside the sub-domain. These methods are well-fitted for heterogeneous core calculations because the spatial interface modes are taken into account in the domain decomposition. Although these methods could be applied to higher order angular approximations - particularly easily to a SPN approximation - the numerical results we provide are obtained using a diffusion model. We show the methods' accuracy for reactor cores loaded with UOX and MOX assemblies, for which standard reconstruction techniques are known to perform poorly. Furthermore, we show that our methods are highly and easily parallelizable. (authors)

  15. Neutronics methods, models, and applications at the Idaho National Engineering Laboratory for the advanced neutron source reactor three-element core design

    International Nuclear Information System (INIS)

    Wemple, C.A.; Schnitzler, B.G.; Ryskamp, J.M.

    1995-08-01

    A summary of the methods and models used to perform neutronics analyses on the Advanced Neutron Source reactor three-element core design is presented. The applications of the neutral particle Monte Carlo code MCNP are detailed, as well as the expansion of the static role of MCNP to analysis of fuel cycle depletion calculations. Results to date of these applications are presented also. A summary of the calculations not yet performed is also given to provide a open-quotes to-doclose quotes list if the project is resurrected

  16. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    Science.gov (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  17. Component mode synthesis methods for 3-D heterogeneous core calculations applied to the mixed-dual finite element solver MINOS

    International Nuclear Information System (INIS)

    Guerin, P.; Baudron, A.M.; Lautard, J.J.; Van Criekingen, S.

    2007-01-01

    This paper describes a new technique for determining the pin power in heterogeneous three-dimensional calculations. It is based on a domain decomposition with overlapping sub-domains and a component mode synthesis (CMS) technique for the global flux determination. Local basis functions are used to span a discrete space that allows fundamental global mode approximation through a Galerkin technique. Two approaches are given to obtain these local basis functions. In the first one (the CMS method), the first few spatial eigenfunctions are computed on each sub-domain, using periodic boundary conditions. In the second one (factorized CMS method), only the fundamental mode is computed, and we use a factorization principle for the flux in order to replace the higher-order Eigenmodes. These different local spatial functions are extended to the global domain by defining them as zero outside the sub-domain. These methods are well fitted for heterogeneous core calculations because the spatial interface modes are taken into account in the domain decomposition. Although these methods could be applied to higher-order angular approximations-particularly easily to an SPN approximation-the numerical results we provide are obtained using a diffusion model. We show the methods' accuracy for reactor cores loaded with uranium dioxide and mixed oxide assemblies, for which standard reconstruction techniques are known to perform poorly. Furthermore, we show that our methods are highly and easily parallelizable. (authors)

  18. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  19. Process and device for finding and alarming faults in cooling in a fuel element of a reactor core

    International Nuclear Information System (INIS)

    Holick, A.

    1985-01-01

    The coolant outlet temperature of each fuel element of a BWR is no longer monitored, but the mean fuel or coolant temperature, which cannot be measured directly, is derived from parameters which can easily be measured using a thermo-hydraulic model. This mean fuel or coolant temperature is a parameter, whose value is only affected by very little noise. The problems which arose from the noise of the coolant outlet temperature no longer occur when determining the mean fuel temperature. A deviation of the mean fuel or coolant temperature from the reference value can therefore be found with great accuracy, so that a fault alarm can be initiated for the fuel element concerned. (orig./HP) [de

  20. Program ELM: A tool for rapid thermal-hydraulic analysis of solid-core nuclear rocket fuel elements

    International Nuclear Information System (INIS)

    Walton, J.T.

    1992-11-01

    This report reviews the state of the art of thermal-hydraulic analysis codes and presents a new code, Program ELM, for analysis of fuel elements. ELM is a concise computational tool for modeling the steady-state thermal-hydraulics of propellant flow through fuel element coolant channels in a nuclear thermal rocket reactor with axial coolant passages. The program was developed as a tool to swiftly evaluate various heat transfer coefficient and friction factor correlations generated for turbulent pipe flow with heat addition which have been used in previous programs. Thus, a consistent comparison of these correlations was performed, as well as a comparison with data from the NRX reactor experiments from the Nuclear Engine for Rocket Vehicle Applications (NERVA) project. This report describes the ELM Program algorithm, input/output, and validation efforts and provides a listing of the code

  1. Characterization of a Suppressive Cis-acting Element in the Epstein–Barr Virus LMP1 Promoter

    Directory of Open Access Journals (Sweden)

    Masahiro Yoshida

    2017-11-01

    Full Text Available Latent membrane protein 1 (LMP1 is a major oncogene encoded by Epstein–Barr virus (EBV and is essential for immortalization of B cells by the virus. Previous studies suggested that several transcription factors, such as PU.1, RBP-Jκ, NFκB, EBF1, AP-2 and STAT, are involved in LMP1 induction; however, the means by which the oncogene is negatively regulated remains unclear. Here, we introduced short mutations into the proximal LMP1 promoter that includes recognition sites for the E-box and Ikaros transcription factors in the context of EBV-bacterial artificial chromosome. Upon infection, the mutant exhibited increased LMP1 expression and EBV-mediated immortalization of B cells. However, single mutations of either the E-box or Ikaros sites had limited effects on LMP1 expression and transformation. Our results suggest that this region contains a suppressive cis-regulatory element, but other transcriptional repressors (apart from the E-box and Ikaros transcription factors may remain to be discovered.

  2. Core lifter

    Energy Technology Data Exchange (ETDEWEB)

    Pavlov, N G; Edel' man, Ya A

    1981-02-15

    A core lifter is suggested which contains a housing, core-clamping elements installed in the housing depressions in the form of semirings with projections on the outer surface restricting the rotation of the semirings in the housing depressions. In order to improve the strength and reliability of the core lifter, the semirings have a variable transverse section formed from the outside by the surface of the rotation body of the inner arc of the semiring aroung the rotation axis and from the inner a cylindrical surface which is concentric to the outer arc of the semiring. The core-clamping elements made in this manner have the possibility of freely rotating in the housing depressions under their own weight and from contact with the core sample. These semirings do not have weakened sections, have sufficient strength, are inserted into the limited ring section of the housing of the core lifter without reduction in its through opening and this improve the reliability of the core lifter in operation.

  3. Trace elements in South America aerosol during 20th century inferred from a Nevado Illimani ice core, Eastern Bolivian Andes (6350 m asl

    Directory of Open Access Journals (Sweden)

    A. Correia

    2003-01-01

    Full Text Available A 137 m ice core drilled in 1999 from Eastern Bolivian Andes at the summit of Nevado Illimani (16º 37' S, 67º 46' W, 6350 m asl was analyzed at high temporal resolution, allowing a characterization of trace elements in Andean aerosol trapped in the ice during the 20th century. The upper 50 m of the ice core were dated by multi-proxy analysis of stable isotopes (d18O and d2H, 137Cs and Ca+2 content, electrical conductivity, and insoluble microparticle content, together with reference historical horizons from atmospheric nuclear tests and known volcanic eruptions. This 50 m section corresponds to a record of environmental variations spanning about 80 years from 1919 to 1999. It was cut in 744 sub-samples under laminar flow in a clean bench, which were analyzed by Ion Chromatography for major ionic concentration, by a particle counter for insoluble aerosol content, and by Inductively Coupled Plasma Mass Spectrometry (ICP-MS for the concentration of 45 chemical species from Li to U. This paper focuses on results of trace element concentrations measured by ICP-MS. The high temporal resolution used in the analyses allowed classifying samples as belonging to dry or wet seasons. During wet season elemental concentrations are low and samples show high crustal enrichment factors. During dry seasons the situation is opposite, with high elemental concentrations and low crustal enrichments. For example, with salt lakes as main sources in the region, average Li concentration during the 20th century is 0.035 and 0.90 ng g-1 for wet and dry seasons, respectively. Illimani average seasonal concentration ranges cover the spectrum of elemental concentration measurements at another Andean ice core site (Sajama for most soil-related elements. Regional crustal dust load in the deposits was found to be overwhelming during dry season, obfuscating the contribution of biomass burning material. Marked temporal trends from the onset of 20th century to more recent years

  4. Element-specific and site-specific ion desorption from adsorbed molecules by deep core-level photoexcitation at the K-edges

    CERN Document Server

    Baba, Y H

    2003-01-01

    This article reviews our recent works on the ion desorption from adsorbed and condensed molecules at low temperature following the core-level photoexcitations using synchrotron soft x-rays. The systems investigated here are adsorbed molecules with relatively heavy molecular weight containing third-row elements such as Si, P, S, and Cl. Compared with molecules composed of second-row elements, the highly element-specific and site-specific fragment-ion desorption were observed when we tune the photon energy at the dipole-allowed 1s -> sigma sup * (3p sup *) resonance. On the basis of the resonance Auger decay spectra around the 1s ionization thresholds, the observed highly specific ion desorption is interpreted by the localization of the excited electrons (here we call as 'spectator electrons') in the antibonding sigma sup * orbital. In order to separate the direct photo-induced process from the indirect processes triggered by the secondary electrons, the photon-stimulated ion desorption was also investigated in...

  5. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  6. Neither Reb1p nor poly(dA*T) elements are responsible for the highly specific chromatin organization at the ILV1 promoter

    DEFF Research Database (Denmark)

    Moreira, José Manuel Alfonso; Hörz, Wolfram; Holmberg, Steen

    2001-01-01

    Analysis of the chromatin structure at the yeast ILV1 locus revealed highly positioned nucleosomes covering the entire locus except for a hypersensitive site in the promoter region. All previously identified cis-acting elements required for GCN4-independent ILV1 basal level transcription, includi...

  7. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. [Finite element analysis of the maxillary central incisor with traditional and modified crown lengthening surgery and post-core restoration in management of crown-root fracture].

    Science.gov (United States)

    Zhen, M; Wei, Y P; Hu, W J; Rong, Q G; Zhang, H

    2016-06-01

    To construct three-dimensional finite element models with modified crown lengthening surgery and post-core restoration in management of various crown-root fracture types, to investigate the intensity and distribution of stressin models mentioned above, and to compare and analyze the indications of traditional and modified crown lengthening surgeries from the mechanic point of view. Nine three-dimensional finite element models with modified crown lengthening surgery and post-core restoration were established and analyzed by micro-CT scanning technique, dental impression scanner, Mimics 10.0, Geomagic studio 9.0 and ANSYS 14.0 software. The von Mises stress of dentin, periodontal ligament, alveolar bone, post and core, as well as the periodontal ligament area and threshold limit value were calculated and compared with the findings of traditional crown lengthening models which had been published earlierby our research group. The von Mises stress intensity of modified crown lengthening models were: dentin>post>core>alveolar bone>periodontal ligament. The maximum von Mises stress of dentin(44.37-80.58 MPa)distributed in lingual central shoulder. The periodontal ligament area of the modified crown lengthening surgery was reduced by 6% to 28%, under the same crown-root fracture conditions, the periodontal ligament area of modified crown lengthening models was larger than that of the traditional crown lengthening models. In modified crown lengthening surgery models, the von Mises stress of periodontal ligament of B3L1m, B3L2m, B3L3m models exceeded their limit values, however, the von Mises stress of periodontal ligament of the B2L2c, B2L3c, B3L1c, B3L2c, B3L3c models exceeded their limit values in traditional crown lengthening surgery models. The modified crown lengthening surgery conserves more periodontal supporting tissues, which facilitates the long-term survival of teeth. The indication of modified crown lengthening surgery is wider than traditional method. The

  9. ELM - A SIMPLE TOOL FOR THERMAL-HYDRAULIC ANALYSIS OF SOLID-CORE NUCLEAR ROCKET FUEL ELEMENTS

    Science.gov (United States)

    Walton, J. T.

    1994-01-01

    ELM is a simple computational tool for modeling the steady-state thermal-hydraulics of propellant flow through fuel element coolant channels in nuclear thermal rockets. Written for the nuclear propulsion project of the Space Exploration Initiative, ELM evaluates the various heat transfer coefficient and friction factor correlations available for turbulent pipe flow with heat addition. In the past, these correlations were found in different reactor analysis codes, but now comparisons are possible within one program. The logic of ELM is based on the one-dimensional conservation of energy in combination with Newton's Law of Cooling to determine the bulk flow temperature and the wall temperature across a control volume. Since the control volume is an incremental length of tube, the corresponding pressure drop is determined by application of the Law of Conservation of Momentum. The size, speed, and accuracy of ELM make it a simple tool for use in fuel element parametric studies. ELM is a machine independent program written in FORTRAN 77. It has been successfully compiled on an IBM PC compatible running MS-DOS using Lahey FORTRAN 77, a DEC VAX series computer running VMS, and a Sun4 series computer running SunOS UNIX. ELM requires 565K of RAM under SunOS 4.1, 360K of RAM under VMS 5.4, and 406K of RAM under MS-DOS. Because this program is machine independent, no executable is provided on the distribution media. The standard distribution medium for ELM is one 5.25 inch 360K MS-DOS format diskette. ELM was developed in 1991. DEC, VAX, and VMS are trademarks of Digital Equipment Corporation. Sun4 and SunOS are trademarks of Sun Microsystems, Inc. IBM PC is a registered trademark of International Business Machines. MS-DOS is a registered trademark of Microsoft Corporation.

  10. Binding of Pseudomonas aeruginosa Apo-Bacterioferritin Associated Ferredoxin to Bacterioferritin B Promotes Heme Mediation of Electron Delivery and Mobilization of Core Mineral Iron†

    Science.gov (United States)

    Weeratunga, Saroja K.; Gee, Casey E.; Lovell, Scott; Zeng, Yuhong; Woodin, Carrie L.; Rivera, Mario

    2009-01-01

    The bfrB gene from Pseudomonas aeruginosa was cloned and expressed in E. coli. The resultant protein (BfrB), which assembles into a 445.3 kDa complex0020from 24 identical subunits, binds 12 molecules of heme axially coordinated by two Met residues. BfrB, isolated with 5–10 iron atoms per protein molecule, was reconstituted with ferrous ions to prepare samples with a core mineral containing 600 ± 40 ferric ions per BfrB molecule and approximately one phosphate molecule per iron atom. In the presence of sodium dithionite or in the presence of P. aeruginosa ferredoxin NADP reductase (FPR) and NADPH the heme in BfrB remains oxidized and the core iron mineral is mobilized sluggishly. In stark contrast, addition of NADPH to a solution containing BfrB, FPR and the apo-form of P. aeruginosa bacterioferritin associated ferredoxin (apo-Bfd) results in rapid reduction of the heme in BfrB and in the efficient mobilization of the core iron mineral. Results from additional experimentation indicate that Bfd must bind to BfrB to promote heme mediation of electrons from the surface to the core to support the efficient mobilization of ferrous ions from BfrB. In this context, the thus far mysterious role of heme in bacterioferritins has been brought to the front by reconstituting BfrB with its physiological partner, apo-Bfd. These findings are discussed in the context of a model for the utilization of stored iron in which the significant upregulation of the bfd gene under low-iron conditions [Ochsner, U.A., Wilderman, P.J., Vasil, A.I., and Vasil, M.L. (2002) Mol. Microbiol. 45, 1277–1287] ensures sufficient concentrations of apo-Bfd to bind BfrB and unlock the iron stored in its core. Although these findings are in contrast to previous speculations suggesting redox mediation of electron transfer by holo-Bfd, the ability of apo-Bfd to promote iron mobilization is an economical strategy used by the cell because it obviates the need to further deplete cellular iron levels to

  11. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  12. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  13. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  14. A pilot study on genetic variation in purine-rich elements in the nephrin gene promoter in type 2 diabetic patients

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2007-01-01

    Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls

  15. The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancer-like element involved in chloroplast-dependent expression.

    Science.gov (United States)

    Vorst, O; Kock, P; Lever, A; Weterings, B; Weisbeek, P; Smeekens, S

    1993-12-01

    Plastocyanin is part of the photosynthetic electron transport chain in the chloroplast and is encoded in the nucleus. Expression of the Arabidopsis thaliana plastocyanin gene is organ specific: high mRNA levels are observed in young green parts of the plant. Furthermore, expression is dependent on the presence of light and functional chloroplasts. When grown in the presence of norflurazon under white light conditions, resulting in the photo-oxidative destruction of the chloroplast, plastocyanin mRNA levels are strongly reduced. A -1579 to -9 promoter fragment confers light-regulated and chloroplast-dependent expression to the beta-glucuronidase reporter gene in transgenic tobacco plants. This suggests that regulation takes place at the level of transcription. A plastocyanin promoter deletion series ranging from -1579 to -121 which was also tested in tobacco, revealed the presence of a strong positive regulating element (PRE) in the -1579 to -705 region. Deletion of this part of the promoter resulted in a approximately 100-fold reduction of GUS expression as measured in mature leaves. Surprisingly, this enhancer-like element was capable of stimulating transcription from a position downstream of its reporter. Moreover, it could also activate a truncated CaMV 35S promoter. Deletion of this element coincides with the loss of chloroplast-dependency of reporter gene expression, as judged by norflurazon treatment of transgenic seedlings. So, the activity of the PRE itself might depend on the presence of functional chloroplasts.

  16. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  17. Spatial variation in diesel-related elemental and organic PM2.5 components during workweek hours across a downtown core.

    Science.gov (United States)

    Tunno, Brett J; Shmool, Jessie L C; Michanowicz, Drew R; Tripathy, Sheila; Chubb, Lauren G; Kinnee, Ellen; Cambal, Leah; Roper, Courtney; Clougherty, Jane E

    2016-12-15

    Capturing intra-urban variation in diesel-related pollution exposures remains a challenge, given its complex chemical mix, and relatively few well-characterized ambient-air tracers for the multiple diesel sources in densely-populated urban areas. To capture fine-scale spatial resolution (50×50m grid cells) in diesel-related pollution, we used geographic information systems (GIS) to systematically allocate 36 sampling sites across downtown Pittsburgh, PA, USA (2.8km 2 ), cross-stratifying to disentangle source impacts (i.e., truck density, bus route frequency, total traffic density). For buses, outbound and inbound trips per week were summed by route and a kernel density was calculated across sites. Programmable monitors collected fine particulate matter (PM 2.5 ) samples specific to workweek hours (Monday-Friday, 7 am-7 pm), summer and winter 2013. Integrated filters were analyzed for black carbon (BC), elemental carbon (EC), organic carbon (OC), elemental constituents, and diesel-related organic compounds [i.e., polycyclic aromatic hydrocarbons (PAHs), hopanes, steranes]. To our knowledge, no studies have collected this suite of pollutants with such high sampling density, with the ability to capture spatial patterns during specific hours of interest. We hypothesized that we would find substantial spatial variation for each pollutant and significant associations with key sources (e.g. diesel and gasoline vehicles), with higher concentrations near the center of this small downtown core. Using a forward stepwise approach, we developed seasonal land use regression (LUR) models for PM 2.5 , BC, total EC, OC, PAHs, hopanes, steranes, aluminum (Al), calcium (Ca), and iron (Fe). Within this small domain, greater concentration differences were observed in most pollutants across sites, on average, than between seasons. Higher PM 2.5 and BC concentrations were found in the downtown core compared to the boundaries. PAHs, hopanes, and steranes displayed different spatial

  18. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    Science.gov (United States)

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  19. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  20. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  1. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Science.gov (United States)

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  2. Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

    OpenAIRE

    Babiss, L E; Friedman, J M; Darnell, J E

    1986-01-01

    In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

  3. The retinoid X receptor response element in the human aldehyde dehydrogenase 2 promoter is antagonized by the chicken ovalbumin upstream promoter family of orphan receptors

    NARCIS (Netherlands)

    Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D

    2000-01-01

    Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift

  4. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  5. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  6. Core BPEL

    DEFF Research Database (Denmark)

    Hallwyl, Tim; Højsgaard, Espen

    The Web Services Business Process Execution Language (WS-BPEL) is a language for expressing business process behaviour based on web services. The language is intentionally not minimal but provides a rich set of constructs, allows omission of constructs by relying on defaults, and supports language......, does not allow omissions, and does not contain ignorable elements. We do so by identifying syntactic sugar, including default values, and ignorable elements in WS-BPEL. The analysis results in a translation from the full language to the core subset. Thus, we reduce the effort needed for working...

  7. Investigation of water and CO2 (carbon dioxide) flooding using micro-CT (micro-computed tomography) images of Berea sandstone core using finite element simulations

    International Nuclear Information System (INIS)

    Gunde, Akshay C.; Bera, Bijoyendra; Mitra, Sushanta K.

    2010-01-01

    The present study reports a numerical investigation of water and CO 2 (carbon dioxide) flooding at the pore scale of a porous medium. We use high resolution micro-computed tomography (micro-CT) images of Berea sandstone core to obtain the pore geometry. The numerical solution used for the simulation was carried out by a finite element based software package. Level Set method is used to determine the position of the interface between two immiscible fluids when oil is displaced by water and CO 2 , respectively. The present formulation is validated against single-phase flow through the porous structure. It is found that, fluid flow inside the pore space takes place through preferential inlet and outlet pores. For two-phase flow, it is observed that continuous displacement of oil occurs during water flooding but CO 2 is able to displace oil at certain locations in the pores. Also, the separation of flow front is observed in the case of CO 2 flooding. A quantitative comparison of the results obtained in two types of flooding simulations suggests that water displaces a higher volume of oil than CO 2 in the time period for which the simulations are performed.

  8. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  9. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.

    2015-01-01

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  10. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  11. Prevalence of hepatitis B virus subgenotypes and basal core promoter, precore variants in patients with acute hepatitis B in central Vietnam.

    Science.gov (United States)

    Hayashi, Kazuhiko; Katano, Yoshiaki; Chuong, Tran Xuan; Takeda, Yasushi; Ishigami, Masatoshi; Itoh, Akihiro; Hirooka, Yoshiki; Nakano, Isao; Huy, Tran Van; Minh, Nguyen Ngoc; Diem, Tran thi Minh; An, Dong thi Hoai; Phiet, Pham Hoang; Goto, Hidemi

    2009-01-01

    Hepatitis B virus (HBV) has been classified into 8 genotypes that have different geographic distributions. The clinical outcomes of acute hepatitis are dependent on genotype. The aim of this study was to investigate the distribution of HBV subgenotypes and basal core promoter (BCP)/precore (PC) regions in acute hepatitis patients in Central Vietnam to clarify the distributions and the clinical and virological differences. 27 patients with acute hepatitis B were studied. HBV subgenotypes and BCP/PC variants were determined by direct sequencing of the preS, BCP/PC regions, respectively. HBV subgenotypes B4/Ba (n = 22) and C1/Cs (n = 5) were detected. Of the 27 patients, 3 developed fulminant hepatic failure, and all were infected with B4/Ba. Three patients had a BCP mutation, and 10 patients had a PC mutation in subgenotype B4/Ba. Three patients with C1/Cs had a BCP mutation. Two of 3 patients who progressed to fulminant hepatic failure had T1762, A1764, and A1896 simultaneously. None of the patients with acute, self-limited hepatitis carried these triple mutations. The prevalent HBV subgenotypes in patients with acute hepatitis B in Central Vietnam were B4/Ba and C1/Cs. BCP/PC variants have an association with the development of fulminant hepatic failure in subgenotype B4/Ba. Copyright 2009 S. Karger AG, Basel.

  12. Autokinase activity of alpha-crystallin inhibits its specific interaction with the DOTIS element in the murine gamma D/E/F-crystallin promoter in vitro.

    Science.gov (United States)

    Pietrowski, D; Graw, J

    1997-10-01

    In a previous report we demonstrated the in vitro interaction of alpha-crystallin with an element downstream of the transcriptional initiation site (DOTIS) of the murine gamma E-crystallin promoter (Pietrowski et al., 1994, Gene 144, 171-178). The aim of the present study was to investigate the influence of phosphorylation on this particular interaction. We could demonstrate that the autophosphorylation of alpha-crystallin leads to a complete loss of interaction with the DOTIS element, however, PKA-dependent phosphorylation of alpha-crystallin is without effect on the interaction. It is hypothesized that the autophosphorylation of alpha-crystallin might be involved in regulatory mechanisms of the murine gamma D/E/F-crystallin gene expression.

  13. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  14. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  15. Wave propagation simulation in the upper core of sodium-cooled fast reactors using a spectral-element method for heterogeneous media

    Science.gov (United States)

    Nagaso, Masaru; Komatitsch, Dimitri; Moysan, Joseph; Lhuillier, Christian

    2018-01-01

    ASTRID project, French sodium cooled nuclear reactor of 4th generation, is under development at the moment by Alternative Energies and Atomic Energy Commission (CEA). In this project, development of monitoring techniques for a nuclear reactor during operation are identified as a measure issue for enlarging the plant safety. Use of ultrasonic measurement techniques (e.g. thermometry, visualization of internal objects) are regarded as powerful inspection tools of sodium cooled fast reactors (SFR) including ASTRID due to opacity of liquid sodium. In side of a sodium cooling circuit, heterogeneity of medium occurs because of complex flow state especially in its operation and then the effects of this heterogeneity on an acoustic propagation is not negligible. Thus, it is necessary to carry out verification experiments for developments of component technologies, while such kind of experiments using liquid sodium may be relatively large-scale experiments. This is why numerical simulation methods are essential for preceding real experiments or filling up the limited number of experimental results. Though various numerical methods have been applied for a wave propagation in liquid sodium, we still do not have a method for verifying on three-dimensional heterogeneity. Moreover, in side of a reactor core being a complex acousto-elastic coupled region, it has also been difficult to simulate such problems with conventional methods. The objective of this study is to solve these 2 points by applying three-dimensional spectral element method. In this paper, our initial results on three-dimensional simulation study on heterogeneous medium (the first point) are shown. For heterogeneity of liquid sodium to be considered, four-dimensional temperature field (three spatial and one temporal dimension) calculated by computational fluid dynamics (CFD) with Large-Eddy Simulation was applied instead of using conventional method (i.e. Gaussian Random field). This three-dimensional numerical

  16. [Immunoprecipitation mapping of the TRX-associated chromosome elements in the fork head gene promoter in the Drosophila melanogaster salivary gland cells].

    Science.gov (United States)

    Riakhovskiĭ, A A; Tillib, S V

    2007-09-01

    Using the method of immunoprecipitation of the in vivo crosslinked and sheared by sonication chromatin, mapping of potential trithorax-associated regulatory elements within the extended (9 kb) promoter region of the fork head gene (fkh) in the Drosophila melanogaster salivary gland cells was performed. Relative homogeneity of the salivary gland cells, along with the parallel use of the antibodies to different domains of the same trithorax protein (TRX), and the introduction of cross-hybridization steps for additional specific enrichment of initial DNA libraries, provided improvement of the method effectiveness and identification of one major and two less expressed potential TRX-binding sites.

  17. Equipment for the conditioning of core components in the fuel element storage pool with particular respect to the design required by the conditions for nuclear facilities in operation and the surveillance in accordance with atomic rules and regulations

    International Nuclear Information System (INIS)

    Dumpe, J.; Schwiertz, V.; Geiser, C.; Prucker, E.

    2001-01-01

    In nuclear power plants worn out and activated parts from the reactor core (core components) which are placed into the fuel element storage pool arise on a regular basis during the technical maintenance and the review. The disposal of these core components due to radiation protection aspects is only feasible within the fuel element storage pool during the operation of the NPP using techniques of the under water conditioning. Therefore, special GNS equipment is used for the conditioning, using under water conditioning equipment, such as UWS, BZ, and ZVA, a number of lifting and auxiliary equipment for mounting and dismantling purposes and the handling of the core components and the waste casks within the fuel element storage pool. These components must meet particular safety requirements with regard to their integrity and reliability. They are designed according to the requirements on nuclear components (KTA). The manipulating equipment must be partly redundant and the protection goals for nuclear accidents must be met. The Bavarian Ministry for Development and Environment tasked the TUeV Sueddeutschland with the surveillance and control. The conditioning equipment of GNS is therefore designed in co-ordination with the examiner of the Governmental Regulating Agency, in particular respect to all safety aspects. Furthermore the examiners perform reviews of the construction and the documentation during the design and construction phase. (orig.)

  18. Effect of copy number and spacing of the ACGT and GT cis elements ...

    Indian Academy of Sciences (India)

    Unknown

    cognized by transcription factors of the bZIP family. The core ACGT element occurs at different relative positions in one or more copies upstream of the minimal promoter region. Protein-DNA interaction studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. The bZIP transcription ...

  19. Further promotion of the use of mosses and lichens for studies of atmospheric deposition of trace elements

    International Nuclear Information System (INIS)

    Steinnes, E.

    1999-01-01

    This paper presents a brief survey of biomonitoring work carried out in the author's laboratory during more than 20 years using nuclear and non-nuclear techniques for the determination of over 50 elements. A major part of this work concerns large-scale deposition surveys in Norway and elsewhere using the moss Hylocomium splendens. However, considerable efforts have also been spent on intercalibration of different species of mosses and lichens and transformation of concentrations in moss to absolute deposition rates. Experience from this intercalibration work as well as from the calibration of moss reference samples may be of particular importance to the present co-ordinated research project. (author)

  20. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  1. Policies and instruments for the promotion of the export sector in Japan: Key elements for the economic growth

    Directory of Open Access Journals (Sweden)

    Alberto Francisco Torres García

    2011-08-01

    Full Text Available Ravaged by war and submitted during the first years by the Supreme Commander Allied Powers, led by General McArthur of the U.S., Japan in 1950 implemented a policy of economic recovery. Over the years, this economy has been considered a peculiar case of economic growth and development. The diversification of international relations under the pillar of economic restructuring has enabled a more favorable insertion in international markets to an economy that even in a deep recession, remains high competitiveness. Thus, the promotion of Japanese exports was made possible by the combination of state intervention and private sector efficiency, which showed a great ability to tune their industrial development.

  2. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  3. Two ABREs, two redundant root-specific and one W-box cis-acting elements are functional in the sunflower HAHB4 promoter.

    Science.gov (United States)

    Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L

    2008-10-01

    HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.

  4. Theoretical analysis and numerical modelling of heat transfer and fuel migration in underlying soils and constructive elements of nuclear plants during an accident release from the core

    International Nuclear Information System (INIS)

    Arutunjan, R.V.; Bolshov, L.A.; Vitukov, V.V.; Goloviznin, V.M.; Dykhne, A.M.; Kiselev, V.P.; Klementova, S.V.; Krayushkin, I.E.; Moskovchenko, A.V.; Pismennii, V.D.; Popkov, A.G.; Chernov, S.Y.; Chudanov, V.V.; Khoruzhii, O.V.; Yudin, A.I.

    1990-01-01

    Migration of fuel fragments and core fission products during severe accidents on nuclear plants is studied analytically and numerically. The problems of heat transfer and migration of volume heat sources in construction materials and underlying soils are considered

  5. DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Thanh Theresa Dinh

    2014-07-01

    Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

  6. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  7. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  8. Perilipin-mediated lipid droplet formation in adipocytes promotes sterol regulatory element-binding protein-1 processing and triacylglyceride accumulation.

    Directory of Open Access Journals (Sweden)

    Yu Takahashi

    Full Text Available Sterol regulatory element-binding protein-1 (SREBP-1 has been thought to be a critical factor that assists adipogenesis. During adipogenesis SREBP-1 stimulates lipogenic gene expression, and peroxisome proliferator-activated receptor γ (PPARγ enhances perilipin (plin gene expression, resulting in generating lipid droplets (LDs to store triacylglycerol (TAG in adipocytes. Plin coats adipocyte LDs and protects them from lipolysis. Here we show in white adipose tissue (WAT of plin-/- mice that nuclear active SREBP-1 and its target gene expression, but not nuclear SREBP-2, significantly decreased on attenuated LD formation. When plin-/- mouse embryonic fibroblasts (MEFs differentiated into adipocytes, attenuated LDs were formed and nuclear SREBP-1 decreased, but enforced plin expression restored them to their original state. Since LDs are largely derived from the endoplasmic reticulum (ER, alterations in the ER cholesterol content were investigated during adipogenesis of 3T3-L1 cells. The ER cholesterol greatly reduced in differentiated adipocytes. The ER cholesterol level in plin-/- WAT was significantly higher than that of wild-type mice, suggesting that increased LD formation caused a change in ER environment along with a decrease in cholesterol. When GFP-SREBP-1 fusion proteins were exogenously expressed in 3T3-L1 cells, a mutant protein lacking the S1P cleavage site was poorly processed during adipogenesis, providing evidence of the increased canonical pathway for SREBP processing in which SREBP-1 is activated by two cleavage enzymes in the Golgi. Therefore, LD biogenesis may create the ER microenvironment favorable for SREBP-1 activation. We describe the novel interplay between LD formation and SREBP-1 activation through a positive feedback loop.

  9. Genome-Wide Mapping Targets of the Metazoan Chromatin Remodeling Factor NURF Reveals Nucleosome Remodeling at Enhancers, Core Promoters and Gene Insulators.

    Directory of Open Access Journals (Sweden)

    So Yeon Kwon

    2016-04-01

    Full Text Available NURF is a conserved higher eukaryotic ISWI-containing chromatin remodeling complex that catalyzes ATP-dependent nucleosome sliding. By sliding nucleosomes, NURF is able to alter chromatin dynamics to control transcription and genome organization. Previous biochemical and genetic analysis of the specificity-subunit of Drosophila NURF (Nurf301/Enhancer of Bithorax (E(bx has defined NURF as a critical regulator of homeotic, heat-shock and steroid-responsive gene transcription. It has been speculated that NURF controls pathway specific transcription by co-operating with sequence-specific transcription factors to remodel chromatin at dedicated enhancers. However, conclusive in vivo demonstration of this is lacking and precise regulatory elements targeted by NURF are poorly defined. To address this, we have generated a comprehensive map of in vivo NURF activity, using MNase-sequencing to determine at base pair resolution NURF target nucleosomes, and ChIP-sequencing to define sites of NURF recruitment. Our data show that, besides anticipated roles at enhancers, NURF interacts physically and functionally with the TRF2/DREF basal transcription factor to organize nucleosomes downstream of active promoters. Moreover, we detect NURF remodeling and recruitment at distal insulator sites, where NURF functionally interacts with and co-localizes with DREF and insulator proteins including CP190 to establish nucleosome-depleted domains. This insulator function of NURF is most apparent at subclasses of insulators that mark the boundaries of chromatin domains, where multiple insulator proteins co-associate. By visualizing the complete repertoire of in vivo NURF chromatin targets, our data provide new insights into how chromatin remodeling can control genome organization and regulatory interactions.

  10. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  11. A preliminary study on the behavior of trace elements in sediment cores from Ilha Grande (Rio de Janeiro State) by neutron activation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Wasserman, Julio Cesar [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Geoquimica; Figueiredo, Ana Maria G. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Figueira, Andre Luiz [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Dept. de Oceanografia; Kelecom, Alphonse [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Biologia Geral

    2002-07-01

    The present work aims to identify atmospheric and marine inputs of 9 metals (Ba, Co, Cr, Cs, Fe, Hf, Rb, Sc, Zn), 8 rare earths (La, Ce, Nd, Sm, Eu, Tb, Yb e Lu), 2 actinides (U, Th) and 3 non-metals (As, Sb, Se) in sediment cores from a remote area, the Biological Reserve of Praia do Sul, Ilha Grande, Rio de Janeiro, Brazil. The sediment cores were sampled in a peat bog (out of the tidal reach) and in a mangrove, downstream of the peat bog. The analytical technique employed was Instrumental Neutron Activation Analysis. The samples were irradiated for 16 hours at a thermal neutron flux of 10{sup 12} n cm{sup -2} s{sup -1} at the IEA-R1 reactor of IPEN. The measurements of the induced gamma-ray activity were carried out by high resolution gamma spectrometry, with an hyperpure Ge detector. A preliminary sediment dating with Po-210 was also carried out by applying radiochemical procedures and measurements were done in an Alfa spectrometer The results indicate that the peat bog core present a slight surface enrichment that can be attributed to atmospheric inputs. Increasing concentrations of metals with age is probably due to history of soil occupation. In the mangrove core, no significant increase in concentration could be detected in the surface sediments (except for Zn) confirming the suitability of the peat bog core as a tracer for atmospheric inputs. (author)

  12. A preliminary study on the behavior of trace elements in sediment cores from Ilha Grande (Rio de Janeiro State) by neutron activation analysis

    International Nuclear Information System (INIS)

    Wasserman, Julio Cesar; Figueira, Andre Luiz; Kelecom, Alphonse

    2002-01-01

    The present work aims to identify atmospheric and marine inputs of 9 metals (Ba, Co, Cr, Cs, Fe, Hf, Rb, Sc, Zn), 8 rare earths (La, Ce, Nd, Sm, Eu, Tb, Yb e Lu), 2 actinides (U, Th) and 3 non-metals (As, Sb, Se) in sediment cores from a remote area, the Biological Reserve of Praia do Sul, Ilha Grande, Rio de Janeiro, Brazil. The sediment cores were sampled in a peat bog (out of the tidal reach) and in a mangrove, downstream of the peat bog. The analytical technique employed was Instrumental Neutron Activation Analysis. The samples were irradiated for 16 hours at a thermal neutron flux of 10 12 n cm -2 s -1 at the IEA-R1 reactor of IPEN. The measurements of the induced gamma-ray activity were carried out by high resolution gamma spectrometry, with an hyperpure Ge detector. A preliminary sediment dating with Po-210 was also carried out by applying radiochemical procedures and measurements were done in an Alfa spectrometer The results indicate that the peat bog core present a slight surface enrichment that can be attributed to atmospheric inputs. Increasing concentrations of metals with age is probably due to history of soil occupation. In the mangrove core, no significant increase in concentration could be detected in the surface sediments (except for Zn) confirming the suitability of the peat bog core as a tracer for atmospheric inputs. (author)

  13. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    Science.gov (United States)

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  14. Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2014-09-01

    Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  15. Distribution of equilibrium burnup for an homogeneous core with fuel elements of slightly enriched uranium (0.85% U-235) at Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Sidelnik, J.I.; Perez, R.A.; Salom, G.F.

    1987-01-01

    At Atucha I, the present fuel management with natural uranium comprises three burnup areas and one irradiation path, sometimes performing four steps in the reactor core, according to the requirements. The discharge burnup is 6.0 Mw d/kg U for a waste reactivity of 6.5 m k and a heavy water purity of 99.75%. This is a preliminary study to obtain the distribution of equilibrium burnup of an homogeneous core with slightly enriched uranium (0.85% by weight U-235), using the time-averaged method implemented in the code PUMA and a representative model of one third of core and fixed rod position. It was found a strategy of three areas and two paths that agrees with the present limits of channel power and specific power in fuel rod. The discharge burnup obtained is 11.6 Mw d/kg U. This strategy is calculated with the same method and a full core representation model is used to verify the obtained results. (Author)

  16. Conceptualizations of professional competencies in school health promotion

    DEFF Research Database (Denmark)

    Carlsson, Monica Susanne

    2016-01-01

    Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...... by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...... domains: 1) policy-development, 2) organizational development, 3) professional development, 4) development of students’ learning, and 5) development of health promotion activities. Three critical gaps in the conceptualizations of competency domains and elements are identified and discussed: 1...

  17. Assessing and Promoting Cultural Relativism in Students of Counseling

    Science.gov (United States)

    Mcauliffe, Garrett John; Grothaus, Tim; Jensen, Margaret; Michel, Rebecca

    2012-01-01

    Multicultural counseling is often promoted as a core element in counselor development. As such, educational efforts aim to increase counselors' cultural relativism, or their ability to recognize their own enculturation and to appreciate the value of other cultural norms. This mixed qualitative-quantitative study explored the relationship between…

  18. Estudo de correspondência de elementos metadados: DUBLIN CORE e MARC 21 Study of the correspondence of metadata elements: DUBLIN CORE and MARC 21 p. 20-38

    Directory of Open Access Journals (Sweden)

    Maria das Dores Rosa Alves

    2007-01-01

    Full Text Available A tecnologia da informação tem possibilitado o desenvolvimento de aplicações e metodologias de tratamento descritivo, como é o caso dos padrões de metadados, permitindo novas abordagens práticas para a organização da informação, principalmente em meio eletrônico. A adoção de padrão de metadados propicia a interoperabilidade entre aplicações e o compartilhamento de dados entre sistemas. Baseado nesse pressuposto, foi realizado um estudo da correspondência entre o padrão Dublin Core e o Formato MARC 21, visando fornecer subsídios para o desenvolvimento de ferramentas de conversão de dados oriundos da catalogação. A maximização de esforços na integração e intercâmbio de dados, bem como a sistematização das relações entre esses padrões, propiciam o reuso de conjuntos de metadados na mesma organização. Palavras-chave Dublin Core; Formato MARC 21; Metadados; Interoperabilidade; Catalogação de recursos eletrônicos; Agência de informação Embrapa Abstract The information technology has been making possible the development of applications and methodologies of material descriptive treatment, as it is the case of the metadata standards, allowing new practical approaches for the organization of the information, mainly in electronic means. The adoption of metadata standard propitiates the interoperability between applications and sharing of data among systems. Based on that presupposition, a study of the correspondence was accomplished between the Dublin Core standard and the MARC 21 format, seeking to supply subsidies for the development of data conversion tools originating from of the cataloguing. The maximization of efforts in the integration and exchange of data, as well as the systemization of the relationships among those standards propitiate the reuse of metadata sets in the same organization. Key words Dublin Core; MARC 21 format; Metadata; Interoperability; Cataloguing of electronic resources; Embrapa

  19. Analysis of HBV basal core promoter/precore gene variability in patients with HBV drug resistance and HIV co-infection in Northwest Ethiopia.

    Directory of Open Access Journals (Sweden)

    Yeshambel Belyhun

    Full Text Available We recently reported complex hepatitis B virus (HBV drug resistant and concomitant vaccine escape hepatitis B surface antigen (HBsAg variants during human immunodeficiency virus (HIV co-infection and antiretroviral therapy (ART exposure in Ethiopia. As a continuation of this report using the HBV positive sera from the same study participants, the current study further analyzed the HBV basal core promoter (BCP/precore (PC genes variability in patients with HBV drug resistance (at tyrosine-methionine-aspartate-aspartate (YMDD reverse transcriptase (RT motifs and HIV co-infection in comparison with HBV mono-infected counterparts with no HBV drug resistant gene variants.A total of 143 participants of HBV-HIV co-infected (n = 48, HBV mono-infected blood donors (n = 43 and chronic liver disease (CLD patients (n = 52 were included in the study. The BCP/PC genome regions responsible for HBeAg expression from the EcoRI site (nucleotides 1653-1959 were sequenced and analyzed for the BCP/PC mutant variants.Among the major mutant variants detected, double BCP mutations (A1762T/G1764A (25.9%, Kozak sequences mutations (nt1809-1812 (51.7% and the classical PC mutations such as A1814C/C1816T (15.4%, G1896A (25.2% and G1862T (44.8% were predominant mutant variants. The prevalence of the double BCP mutations was significantly lower in HIV co-infected patients (8.3% compared with HBV mono-infected blood donors (32.6% and CLD patients (36.5%. However, the Kozak sequences BCP mutations and the majority of PC mutations showed no significant differences among the study groups. Moreover, except for the overall BCP/PC mutant variants, co-prevalence rates of each major BCP/PC mutations and YMDDRT motif associated lamivudine (3TC/entecavir (ETV resistance mutations showed no significant differences when compared with the rates of BCP/PC mutations without YMDD RT motif drug resistance gene mutations. Unlike HIV co-infected group, no similar comparison made among HBV mono

  20. Burn-up determinations and dimensional measurements of TRIGA-HEU fuel elements from the 14 MW steady-state core

    International Nuclear Information System (INIS)

    Toma, C.; Alexa, Al.; Craciunescu, T.; Pirvan, M.; Dobrin, R.

    2008-01-01

    In this paper there are presented the results of nondestructive examination in Post Irradiation Examination Laboratory for twenty five fuel rods selected from 14 MW steady state core. Gamma scanning and dimensional measurements were carried out in order to determine burn-up and diametric deflection of the fuel rods. Also, some comparisons with SSR Safety Report estimations for the maximum burn-up pin were made. (authors)

  1. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

  2. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Science.gov (United States)

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  3. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Directory of Open Access Journals (Sweden)

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  4. Proteomics Core

    Data.gov (United States)

    Federal Laboratory Consortium — Proteomics Core is the central resource for mass spectrometry based proteomics within the NHLBI. The Core staff help collaborators design proteomics experiments in a...

  5. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Directory of Open Access Journals (Sweden)

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  6. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Directory of Open Access Journals (Sweden)

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  7. Moving beyond Compliance: Promoting Research-Based Professional Discretion in the Implementation of the Common Core State Standards in English Language Arts

    Science.gov (United States)

    Woodard, Rebecca; Kline, Sonia

    2015-01-01

    State- and local-level mandates are currently being implemented to ensure strict compliance to the new national Common Core State Standards for English Language Arts (CCSS for ELA) and related assessments. These standards provide many potential opportunities to improve literacy education nationally and locally. However, the CCSS for ELA will…

  8. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  9. Heat shock factor 1 upregulates transcription of Epstein–Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    International Nuclear Information System (INIS)

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-01-01

    Epstein–Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the − 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  10. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng-Wei [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Wu, Xian-Rui [Department of Surgery, Sixth Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Liu, Wen-Ju; Liao, Yi-Ji [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Lin, Sheng [Laboratory of Integrated Biosciences, School of Life Science, Sun Yat-sen University, Guangzhou (China); Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Mai, Shi-Juan, E-mail: maishj@sysucc.org.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Xie, Dan, E-mail: xied@mail.sysu.edu.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China)

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  11. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  12. Critical evaluation of the experiments and mathematical models for the determination of fission product release from the spherical fuel elements in cases of core heating accidents in modular HTR's

    International Nuclear Information System (INIS)

    Bailly, H.W.

    1987-01-01

    In this work, the thermal behaviour of modular reactors in cases of core heating accidents and the physical phenomena relevant for a release of radioactive materials from HTR fuel elements are explained as far as is necessary for understanding the work. The present mathematical models by which the release of radioactive materials from HTR fuel elements due to diffusion or breaking particles in cases of core heating accidents are also described, examined and evaluated with regard to their applicability to module reactors. The experiments used to verify the mathematical models are also evaluated. The mathematical models are in nearly all cases computer programs, which describe the complicated process of releasing radioactive materials quantitative mathematically. One should point out that these models are constantly being developed further, in line with the increasing amount of knowledge. To conclude the work, proposals are made for improving the certainty of information from experiments and mathematical models to determine the release behaviour of modular reactors. (orig./GL) [de

  13. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

    Science.gov (United States)

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

    1998-01-01

    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  14. Cre/loxP-mediated adenovirus type 5 packaging signal excision demonstrates that core element VI is sufficient for virus packaging

    International Nuclear Information System (INIS)

    Maeda, Yasushi; Kimura, En; Uchida, Yuji; Nishida, Yasuto; Yamashita, Satoshi; Arima, Toshiyuki; Uchino, Makoto

    2003-01-01

    Previous analyses have demonstrated that packaging of the adenovirus type 5 (Ad5) genome is dependent on at least seven cis-acting elements, called AI to AVII, which are located in the left-end region of the genome. These elements have different packaging efficiencies, and without AI through AV, viral DNA cannot be packaged. Here we report the identification of the cis-acting Ad5 packaging domain in vivo by using the Cre/loxP system. We found that an adenoviral DNA fragment (nt 192 to nt 358), which includes elements AI to AV, is excised by Cre recombinase and packaged into capsids. Furthermore, this mutant adenovirus replicated so efficiently by repetitive propagation that its purification by CsCI equilibrium gradient was possible. This study clarified that the region from nt 358 to nt 454 on the viral genome is sufficient for packaging. Recently, the helper-dependent adenoviral vector (HDAd) construction system has been developed for the purpose of gene therapy. This system uses a helper virus with two parallel loxP sites flanking the packaging signal. This region is eliminated by Cre-mediated excision, which prevents helper virus packaging. Our data provide useful information regarding factors affecting efficient elimination

  15. Enrichment Of Volcanogenic Trace Elements, Co, Cr, Cu, Ni, Mo And Zr In A Continuous Subsurface Eagle Ford Core In South Texas And Origin Of The Oceanic Anoxic Event II At The Cenomanian-Turonian (C/T) Boundary

    Science.gov (United States)

    Valencia, D.; Basu, A. R.; Loocke, M. P.

    2017-12-01

    The Eagle Ford Formation containing the Cenomanian-Turonian (C/T) boundary continues to be studied globally not only for its economic potential and analog for `frack-able' unconventional organic-rich formations, but it is of particular interest to researchers because it was deposited across the C/T boundary recording an Oceanic Anoxic Event (OAE2). OAEs are short lived episodes (matter into the sedimentary record remains enigmatic. Geochemical and geochronological analysis of a subsurface 300ft long continuous core of the Eagle Ford Formation of South Texas shows evidence for volcanism throughout. This is confirmed by multiple thin intermittent bentonite beds. The whole rock black shale (marl) shows elevated concentrations of volcanogenic trace elements (Co, Cr, Cu, Ni, Mo and Zn) throughout the core. By sampling bentonite bed zircons near the inferred C/T boundary, U-Pb age of 93.2 ±1.7 Ma for the Eagle Ford is established. Using this horizon, the onset of OAE2 is constrained and well-correlated with the positive δ13C excursion. For the trace element analysis, the core was sampled at 10ft intervals for ICP-MS. The analytical results show significantly increased volcanogenic trace metal input correlating with increased Total Organic Carbon and positive δ13C values at the C/T dated zircon horizon. OAE2, defined by the positive δ13C excursion, was found to span over an interval of 85ft. With a definitive constraint for OAE2 established, this well-defined interval was analyzed at a much higher resolution using ED-XRF. The core was then sampled at 6' intervals throughout the C/T boundary at OAE2. The high-resolution sampling of the core shows 80-99% increase in abundance of Co, Cr, Cu, Ni, Mo, Zn over the average Post Australian Archean Shale(PAAS), representative of average continental crust. These volcanogenic-rich intervals reach peak values before the onset of OAE2 and at the maximum values for the positive δ13C isotope excursion directly after the 93.2 ±1

  16. Based on the core competitiveness of enterprise innovation culture research

    Institute of Scientific and Technical Information of China (English)

    韩 军

    2017-01-01

    In the spring tide of market economy at present, the enterprise is a must to survive in order to achieve innovation, promote enterprise's core competitiveness. Enterprise innovation culture, the promotion enterprise's core competitiveness plays an important role in promoting, therefore must complete enterprise innovation culture. Therefore, put forward by enterprise innovation culture, promote enterprise's core competitiveness.

  17. Conceptualizations of professional competencies in school health promotion

    DEFF Research Database (Denmark)

    Carlsson, Monica Susanne

    2016-01-01

    by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...... delineates an overall professional competency model for SHP, discusses the specific demands on professional competencies within this field in relation to this model, and addresses three critical gaps in the conceptualizations of competency. Keywords: Professionals, competence, school health promotion Paper......Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...

  18. Conceptualizations of professional competencies in school health promotion

    DEFF Research Database (Denmark)

    Carlsson, Monica Susanne

    2016-01-01

    Purpose: The purpose of the paper is to contribute to the conceptualization and discussion of professional competencies needed for supporting the development of the whole-school approach in school health promotion (SHP). Design: The paper is based a conceptual synthesis of literature, guided...... delineates an overall professional competency model for SHP, discusses the specific demands on professional competencies within this field in relation to this model, and addresses three critical gaps in the conceptualizations of competency. Keywords: Professionals, competence, school health promotion Paper...... by a theoretical perspective on health promotion agency and professional competencies to identify core competency domains and elements. This is followed by a discussion of focus, gaps, and links in conceptualizations of competency domains and elements. Findings: The synthesis identifies five core competency...

  19. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

    2010-10-20

    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  20. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Science.gov (United States)

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  1. Study of the mechanism of clamping and detachment of a core sample by core lever lifters

    Energy Technology Data Exchange (ETDEWEB)

    Barabashkin, I I; Mizyakin, V M; Nikitin, S V

    1981-01-01

    Geometric dimensions of the basic elements of a core lifter should be determined depending on the clamping conditions. The changes should be determined depending on the conditions of the core sample diameter, critical angle between the lever and the core samples in the necessary depth of submersion of the contact edge of the lever into its surface. The core lifter KTsRZ-80 with eccentric core reception makes it possible to arrange more efficiently the core removing elements on the edge of the band. The use of the core lifters with eccentric plan of arrangement of the levers and their optimal length increases the removal of the core sample.

  2. Calibrated cryo-cell UV-LA-ICPMS elemental concentrations from the NGRIP ice core reveal abrupt, sub-annual variability in dust across the GI-21.2 interstadial period

    Directory of Open Access Journals (Sweden)

    D. Della Lunga

    2017-05-01

    Full Text Available Several abrupt shifts from periods of extreme cold (Greenland stadials, GS to relatively warmer conditions (Greenland interstadials, GI called Dansgaard–Oeschger events are recorded in the Greenland ice cores. Using cryo-cell UV-laser-ablation inductively coupled-plasma mass spectrometry (UV-LA-ICPMS, we analysed a 2.85 m NGRIP ice core section (2691.50–2688.65 m depth, age interval 84.86–85.09 ka b2k, thus covering  ∼  230 years across the transitions of GI-21.2, a short-lived interstadial prior to interstadial GI-21.1. GI-21.2 is a  ∼  100-year long period with δ18O values 3–4 ‰ higher than the following  ∼  200 years of stadial conditions (GS-21.2, which precede the major GI-21.1 warming. We report concentrations of major elements indicative of dust and/or sea salt (Na, Fe, Al, Ca, Mg at a spatial resolution of  ∼  200 µm, while maintaining detection limits in the low-ppb range, thereby achieving sub-annual time resolution even in deep NGRIP ice. We present an improved external calibration and quantification procedure using a set of five ice standards made from aqueous (international standard solutions. Our results show that element concentrations decrease drastically (more than 10-fold at the warming onset of GI-21.2 at the scale of a single year, followed by relatively low concentrations characterizing the interstadial part before gradually reaching again typical stadial values.

  3. The earths innermost core

    International Nuclear Information System (INIS)

    Nanda, J.N.

    1989-01-01

    A new earth model is advanced with a solid innermost core at the centre of the Earth where elements heavier than iron, over and above what can be retained in solution in the iron core, are collected. The innermost core is separated from the solid iron-nickel core by a shell of liquid copper. The innermost core has a natural vibration measured on the earth's surface as the long period 26 seconds microseisms. The earth was formed initially as a liquid sphere with a relatively thin solid crust above the Byerly discontinuity. The trace elements that entered the innermost core amounted to only 0.925 ppm of the molten mass. Gravitational differentiation must have led to the separation of an explosive thickness of pure 235 U causing a fission explosion that could expel beyond the Roche limit a crustal scab which would form the centre piece of the moon. A reservoir of helium floats on the liquid copper. A small proportion of helium-3, a relic of the ancient fission explosion present there will spell the exciting magnetic field. The field is stable for thousands of years because of the presence of large quantity of helium-4 which accounts for most of the gaseous collisions that will not disturb the atomic spin of helium-3 atoms. This field is prone to sudden reversals after long periods of stability. (author). 14 refs

  4. Progress on the development of a new fuel management code to simulate the movement of pebble and block type fuel elements in a very high temperature reactor core

    Energy Technology Data Exchange (ETDEWEB)

    Xhonneux, Andre, E-mail: a.xhonneux@fz-juelich.de [Forschungszentrum Jülich, 52425 Jülich (Germany); Institute for Reactor Safety and Reactor Technology, RWTH-Aachen, 52064 Aachen (Germany); Kasselmann, Stefan; Rütten, Hans-Jochem [Forschungszentrum Jülich, 52425 Jülich (Germany); Becker, Kai [Institute for Reactor Safety and Reactor Technology, RWTH-Aachen, 52064 Aachen (Germany); Allelein, Hans-Josef [Forschungszentrum Jülich, 52425 Jülich (Germany); Institute for Reactor Safety and Reactor Technology, RWTH-Aachen, 52064 Aachen (Germany)

    2014-05-01

    The history of gas-cooled high-temperature reactor prototypes in Germany is closely related to Forschungszentrum Jülich and its “Institute of Nuclear Waste Disposal and Reactor Safety (IEK-6)”. A variety of computer codes have been developed, validated and optimized to simulate the different safety and operational aspects of V/HTR. In order to overcome the present limitations of these codes and to exploit the advantages of modern computer clusters, a project has been initiated to integrate these individual programs into a consistent V/HTR code package (VHCP) applying state-of-the-art programming techniques and standards. One important aspect in the simulation of a V/HTR is the modeling of a continuous moving pebble bed or the periodic rearrangement of prismatic block type fuel. Present models are either too coarse to take special issues (e.g. pebble piles) into account or are too detailed and therefore too time consuming to be applicable in the HCP. The new Software for Handling Universal Fuel Elements (SHUFLE) recently being developed is well suited to close this gap. Although at first the code has been designed for pebble bed reactors, it can in principal be applied to all other types of nuclear fuel. The granularity of the mesh grid meets the requirements to consider these special issues while keeping the used computing power within reasonable limits. New features are for example the possibility to consider azimuthally differing flow velocities in the case of a pebble bed reactor or individual void factors to simulate effects to seismic events. The general idea behind this new approach to the simulation of pebble bed reactors is the following: In the preprocessing step, experimental flow lines or flow lines simulated by more detailed codes serve as an input. For each radial mesh column a representative flow line is then determined by interpolation. These representative flow lines are finally mapped to a user defined rectangular grid forming chains of meshes

  5. Progress on the development of a new fuel management code to simulate the movement of pebble and block type fuel elements in a very high temperature reactor core

    International Nuclear Information System (INIS)

    Xhonneux, Andre; Kasselmann, Stefan; Rütten, Hans-Jochem; Becker, Kai; Allelein, Hans-Josef

    2014-01-01

    The history of gas-cooled high-temperature reactor prototypes in Germany is closely related to Forschungszentrum Jülich and its “Institute of Nuclear Waste Disposal and Reactor Safety (IEK-6)”. A variety of computer codes have been developed, validated and optimized to simulate the different safety and operational aspects of V/HTR. In order to overcome the present limitations of these codes and to exploit the advantages of modern computer clusters, a project has been initiated to integrate these individual programs into a consistent V/HTR code package (VHCP) applying state-of-the-art programming techniques and standards. One important aspect in the simulation of a V/HTR is the modeling of a continuous moving pebble bed or the periodic rearrangement of prismatic block type fuel. Present models are either too coarse to take special issues (e.g. pebble piles) into account or are too detailed and therefore too time consuming to be applicable in the HCP. The new Software for Handling Universal Fuel Elements (SHUFLE) recently being developed is well suited to close this gap. Although at first the code has been designed for pebble bed reactors, it can in principal be applied to all other types of nuclear fuel. The granularity of the mesh grid meets the requirements to consider these special issues while keeping the used computing power within reasonable limits. New features are for example the possibility to consider azimuthally differing flow velocities in the case of a pebble bed reactor or individual void factors to simulate effects to seismic events. The general idea behind this new approach to the simulation of pebble bed reactors is the following: In the preprocessing step, experimental flow lines or flow lines simulated by more detailed codes serve as an input. For each radial mesh column a representative flow line is then determined by interpolation. These representative flow lines are finally mapped to a user defined rectangular grid forming chains of meshes

  6. 5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

    Science.gov (United States)

    Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

    2014-01-01

    X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

  7. 5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

    Directory of Open Access Journals (Sweden)

    Filipe Brum Machado

    Full Text Available X-chromosome inactivation (XCI is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX and males (XY. DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa from inactive (Xi X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8 and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2 and Xq (AR chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

  8. The INTEGRAL Core Observing Programme

    DEFF Research Database (Denmark)

    Winkler, C.; Gehrels, N.; Lund, Niels

    1999-01-01

    The Core Programme of the INTEGRAL mission is defined as the portion of the scientific programme covering the guaranteed time observations for the INTEGRAL Science Working Team. This paper describes the current status of the Core Programme preparations and summarizes the key elements...... of the observing programme....

  9. Transformer core

    NARCIS (Netherlands)

    Mehendale, A.; Hagedoorn, Wouter; Lötters, Joost Conrad

    2008-01-01

    A transformer core includes a stack of a plurality of planar core plates of a magnetically permeable material, which plates each consist of a first and a second sub-part that together enclose at least one opening. The sub-parts can be fitted together via contact faces that are located on either side

  10. Transformer core

    NARCIS (Netherlands)

    Mehendale, A.; Hagedoorn, Wouter; Lötters, Joost Conrad

    2010-01-01

    A transformer core includes a stack of a plurality of planar core plates of a magnetically permeable material, which plates each consist of a first and a second sub-part that together enclose at least one opening. The sub-parts can be fitted together via contact faces that are located on either side

  11. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Science.gov (United States)

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  12. Models of the earth's core

    Science.gov (United States)

    Stevenson, D. J.

    1981-01-01

    Combined inferences from seismology, high-pressure experiment and theory, geomagnetism, fluid dynamics, and current views of terrestrial planetary evolution lead to models of the earth's core with five basic properties. These are that core formation was contemporaneous with earth accretion; the core is not in chemical equilibrium with the mantle; the outer core is a fluid iron alloy containing significant quantities of lighter elements and is probably almost adiabatic and compositionally uniform; the more iron-rich inner solid core is a consequence of partial freezing of the outer core, and the energy release from this process sustains the earth's magnetic field; and the thermodynamic properties of the core are well constrained by the application of liquid-state theory to seismic and labroatory data.

  13. GREEN CORE HOUSE

    Directory of Open Access Journals (Sweden)

    NECULAI Oana

    2017-05-01

    Full Text Available The Green Core House is a construction concept with low environmental impact, having as main central element a greenhouse. The greenhouse has the innovative role to use the biomass energy provided by plants to save energy. Although it is the central piece, the greenhouse is not the most innovative part of the Green Core House, but the whole building ensemble because it integrates many other sustainable systems as "waste purification systems", "transparent photovoltaic panels" or "double skin façades".

  14. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    International Nuclear Information System (INIS)

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori

    2005-01-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism

  15. Forming Core Elements for Strategic Design Management

    DEFF Research Database (Denmark)

    Beim, Anne; Vibæk, Kasper Sánchez

    2007-01-01

    . This evolution also leads to a demand for precise definitions of the values and qualities that can be used as managing tools in common building practice and it puts the traditional architectural design process under pressure. This paper outlines an approach to architectural quality as dealt with in the design...... and how the architectural potentials are realized when dealing with modern industrial processes are examined. To analyse and structure the empirical data, a model was developed consisting of four approaches for action. The approaches are categorized along different dichotomies in order to point out...... the model was tested in the architectural education at the Royal Danish Academy of Fine Arts - School of Architecture. The overall research project has two aims - to help offices identify the characteristics and specific methods of working with architectural quality in an industrialized context...

  16. Wire core reactor for NTP

    International Nuclear Information System (INIS)

    Harty, R.B.

    1991-01-01

    The development of the wire core system for Nuclear Thermal Propulsion (NTP) that took place from 1963 to 1965 is discussed. A wire core consists of a fuel wire with spacer wires. It's an annular flow core having a central control rod. There are actually four of these, with beryllium solid reflectors on both ends and all the way around. Much of the information on the concept is given in viewgraph form. Viewgraphs are presented on design details of the wire core, the engine design, engine weight vs. thrust, a technique used to fabricate the wire fuel element, and axial temperature distribution

  17. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  18. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L)

    Czech Academy of Sciences Publication Activity Database

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocábek, Tomáš; Matoušek, Jaroslav

    2016-01-01

    Roč. 84, October (2016), s. 346-352 ISSN 1476-9271 R&D Projects: GA ČR GA13-03037S Institutional support: RVO:60077344 Keywords : Cis-acting elements * Gene regulation * Humulus lupulus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.331, year: 2016

  19. Reactor core

    International Nuclear Information System (INIS)

    Azekura, Kazuo; Kurihara, Kunitoshi.

    1992-01-01

    In a BWR type reactor, a great number of pipes (spectral shift pipes) are disposed in the reactor core. Moderators having a small moderating cross section (heavy water) are circulated in the spectral shift pipes to suppress the excess reactivity while increasing the conversion ratio at an initial stage of the operation cycle. After the intermediate stage of the operation cycle in which the reactor core reactivity is lowered, reactivity is increased by circulating moderators having a great moderating cross section (light water) to extend the taken up burnup degree. Further, neutron absorbers such as boron are mixed to the moderator in the spectral shift pipe to control the concentration thereof. With such a constitution, control rods and driving mechanisms are no more necessary, to simplify the structure of the reactor core. This can increase the fuel conversion ratio and control great excess reactivity. Accordingly, a nuclear reactor core of high conversion and high burnup degree can be attained. (I.N.)

  20. Ice Cores

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Records of past temperature, precipitation, atmospheric trace gases, and other aspects of climate and environment derived from ice cores drilled on glaciers and ice...

  1. Nuclear reactor core assembly

    International Nuclear Information System (INIS)

    Baxi, C.B.

    1978-01-01

    The object of the present invention is to provide a fast reactor core assembly design for use with a fluid coolant such as liquid sodium or carbon monoxide incorporating a method of increasing the percentage of coolant flow though the blanket elements relative to the total coolant flow through the blanket and fuel elements during shutdown conditions without using moving parts. It is claimed that deterioration due to reactor radiation or temperature conditions is avoided and ready modification or replacement is possible. (U.K.)

  2. 推进网络空间核心支援能力建设%Considerations on promoting the building-up of PLA's core supporting capabilities in cyberspace

    Institute of Scientific and Technical Information of China (English)

    柯宏发; 祝冀鲁; 赵荣

    2017-01-01

    从网络空间侦察能力、指挥控制能力、精确攻击能力、防御能力和评估能力等五个方面,对网络空间支援力量的核心支援能力进行了系统论述,提出建设军队网络支援力量、应对网络空间安全威胁的新思考和新观点.研究认为,当前我军在网络空间的安全意识、核心技术、均衡发展等方面面临严峻困难.为实现网络强国的奋斗目标,需要加强国家网络安全的顶层设计,增强网络技术自主创新能力,强化军民融合式建设和系统常态的攻防训练等.%Core supporting capabilities of cyberspace military forces, such as cyberspace reconnaissance, command and control, precise attack, defense and evaluation, are systematically discussed.New considerations and ideas about promoting the building up of PLA's cyberspace supporting forces and encountering security threats in cyberspace are proposed.It is concluded that a lot of difficulties exist in aspects such as security awareness of cyberspace, core technologies and balanced developing.In order to realize the goal of building up a powerful country in cyberspace, emphasis should be laid on enhancing top-level design of national cyber security, independent innovation of cyber technologies, civil-military integration, and systematical and regular attack-and-defense training, etc.

  3. Emergency core cooling system

    International Nuclear Information System (INIS)

    Kato, Ken.

    1989-01-01

    In PWR type reactors, a cooling water spray portion of emergency core cooling pipelines incorporated into pipelines on high temperature side is protruded to the inside of an upper plenum. Upon rupture of primary pipelines, pressure in a pressure vessel is abruptly reduced to generate a great amount of steams in the reactor core, which are discharged at a high flow rate into the primary pipelines on high temperature side. However, since the inside of the upper plenum has a larger area and the steam flow is slow, as compared with that of the pipelines on the high temperature side, ECCS water can surely be supplied into the reactor core to promote the re-flooding of the reactor core and effectively cool the reactor. Since the nuclear reactor can effectively be cooled to enable the promotion of pressure reduction and effective supply of coolants during the period of pressure reduction upon LOCA, the capacity of the pressure accumulation vessel can be decreased. Further, the re-flooding time for the reactor is shortened to provide an effect contributing to the improvement of the safety and the reduction of the cost. (N.H.)

  4. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

    Science.gov (United States)

    Hattori, T; Terada, T; Hamasuna, S

    1995-06-01

    Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

  5. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    OpenAIRE

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the...

  6. 赛博作战力量的核心能力及其建设要素初探%Discussion on Core Competencies and Construction Elements of Cyberwarfare Forces

    Institute of Scientific and Technical Information of China (English)

    张军奇; 柯宏发; 祝冀鲁

    2016-01-01

    赛博作战力量的能力建设是赛博弱国应对赛博空间安全威胁的基本方法和根本途径;从生产力和生产关系的角度分析赛博作战力量的构成与建设规律,基于赛博作战需求提出赛博作战力量必须具备侦察、指挥控制、攻击、精确摧毁、防御等5种核心能力,根据其构成提出赛博作战力量必须具备赛博装备、体制编制、赛博人才、演练训练、综合保障等五种建设要素,为合理划分赛博作战力量建设的内容和类别提供理论依据。%The fundamental way for disadvantaged countries to deal with security threats of cyberspace is to strengthen competence construction of cyberwarfare forces.Firstly,from the view of productive forces and productive relations,the composition and constructive principles of cyberwarfare forces were analyzed. Then,based on the analysis of cyberwarfare requirements,five core competencies,i.e.reconnaissance, command and control,attack,accurate destruction,defense,were considered to be necessary for cyber-warfare forces.Finally,based on the analysis of cyberwarfare composition,five construction elements,i. e.cyber equipment,system and organization,cyber personnel,maneuvers and training,comprehensive insurances were considered to be necessary for cyberwarfare forces.It’s theoretically helpful for dividing and classifying construction contents of cyberwarfare forces.

  7. Preliminary Nuclear Analysis for the HANARO Fuel Element with Burnable Absorber

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Chul Gyo; Kim, So Young; In, Won Ho [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-10-15

    Burnable absorber is used for reducing reactivity swing and power peaking in high performance research reactors. Development of the HANARO fuel element with burnable absorber was started in the U-Mo fuel development program at HANARO, but detailed full core analysis was not performed because the current HANARO fuel management system is uncertain to analysis the HANARO core with burnable absorber. A sophisticated reactor physics system is required to analysis the core. The McCARD code was selected and the detailed McCARD core models, in which the basic HANARO core model was developed by one of the McCARD developers, are used in this study. The development of nuclear fuel requires a long time and correct developing direction especially by the nuclear analysis. This paper presents a preliminary nuclear analysis to promote the fuel development. Based on the developed fuel, the further nuclear analysis will improve reactor performance and safety. Basic nuclear analysis for the HANARO and the AHR were performed for getting the proper fuel elements with burnable absorber. Addition of 0.3 - 0.4% Cd to the fuel meat is promising for the current HANARO fuel element. Small addition of burnable absorber may not change any fuel characteristics of the HANARO fuel element, but various basic tests and irradiation tests at the HANARO core are required.

  8. Micromagnetic simulation on the dynamic permeability spectrum of micrometer sized magnetic elements

    International Nuclear Information System (INIS)

    Liu, Huanhuan; Wang, Qi; Zhang, Huaiwu; Zhong, Zhiyong

    2014-01-01

    The inductance of a thin film inductor with magnetic core is much less than μ'(magnetic core's permeability) times that of inductor without magnetic core due to the complicated magnetic structure in the scaled-down magnetic elements. Therefore, it is very important to optimize the micro-scale magnetic structure for improving the inductance value of the thin film inductor with magnetic core. In this paper, the magnetization dynamics and magnetic structure have been investigated using micromagnetic simulation method, in which the additional internal boundaries are considered. The simulated results show that the permeability of structured micromagnetic core is promoted 32.5% than that of magnetic element without slits. It opens a new way to improve the dynamic high frequency characteristics of micro-scale magnetic element, which can be used in a thin film inductor. - Highlights: • Simulate the magnetic element with dimensions of 2 μm×1 μm×100 nm with slits using micromagnetic simulation method. • The dynamic characteristics of micro-scale magnetic element can be improved when adding appropriate slits. • Give the corresponding area for different resonance frequency

  9. The Drosophila Translational Control Element (TCE) is required for high-level transcription of many genes that are specifically expressed in testes.

    Science.gov (United States)

    Katzenberger, Rebeccah J; Rach, Elizabeth A; Anderson, Ashley K; Ohler, Uwe; Wassarman, David A

    2012-01-01

    To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5' untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the

  10. Reactor core

    International Nuclear Information System (INIS)

    Matsuura, Tetsuaki; Nomura, Teiji; Tokunaga, Kensuke; Okuda, Shin-ichi

    1990-01-01

    Fuel assemblies in the portions where the gradient of fast neutron fluxes between two opposing faces of a channel box is great are kept loaded at the outermost peripheral position of the reactor core also in the second operation cycle in the order to prevent interference between a control rod and the channel box due to bending deformation of the channel box. Further, the fuel assemblies in the second row from the outer most periphery in the first operation cycle are also kept loaded at the second row in the second operation cycle. Since the gradient of the fast neutrons in the reactor core is especially great at the outer circumference of the reactor core, the channel box at the outer circumference is bent such that the surface facing to the center of the reactor core is convexed and the channel box in the second row is also bent to the identical direction, the insertion of the control rod is not interfered. Further, if the positions for the fuels at the outermost periphery and the fuels in the second row are not altered in the second operation cycle, the gaps are not reduced to prevent the interference between the control rod and the channel box. (N.H.)

  11. Conceptual core model for the reactor core test

    International Nuclear Information System (INIS)

    Swenson, L.D.

    1970-01-01

    Several design options for the ZrH Flight System Reactor were investigated which involved tradeoffs of core excess reactivity, reactor control, coolant mixing and cladding thickness. A design point was selected which is to be the basis for more detailed evaluation in the preliminary design phase. The selected design utilizes 295 elements with 0.670 inch element-to-element pitch, 32 mil thick Incoloy cladding, 18.00 inches long fuel meat, hydrogen content of 6.3 x 10 22 atoms/cc fuel, 10.5 w/o uranium, and a spiraled fin configuration with alternate elements having fins with spiral to the right, spiral to the left, and no fin at all (R-L-N fin configuration). Fin height is 30 mils for the center region of the core and 15 mils for the outer region. (U.S.)

  12. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  13. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona

    2014-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  14. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    Science.gov (United States)

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Elemental composition of strawberry plants inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, assessed with scanning electron microscopy and energy dispersive X-ray analysis.

    Science.gov (United States)

    Guerrero-Molina, M F; Lovaisa, N C; Salazar, S M; Díaz-Ricci, J C; Pedraza, R O

    2014-07-01

    The elemental composition of strawberry plants (Fragaria ananassa cv. Macarena) inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, and non-inoculated controls, was studied using scanning electron microscopy (SEM) and energy dispersive X-ray (EDS) analysis. This allowed simultaneous semi-quantification of different elements in a small, solid sample. Plants were inoculated and grown hydroponically in 50% or 100% Hoagland solution, corresponding to limited or optimum nutrient medium, respectively. Bacteria-inoculated plants increased the growth index 45% and 80% compared to controls when grown in 100% and 50% Hoagland solution, respectively. Thus, inoculation with A. brasilense REC3 in a nutrient-limited medium had the strongest effect in terms of increasing both shoot and root biomass and growth index, as already described for Azospirillum inoculated into nutrient-poor soils. SEM-EDS spectra and maps showed the elemental composition and relative distribution of nutrients in strawberry tissues. Leaves contained C, O, N, Na, P, K, Ca and Cu, while roots also had Si and Cl. The organic fraction (C, O and N) accounted for over 96.3% of the total chemical composition; of the mineral fraction, Na had higher accumulation in both leaves and roots. Azospirillum-inoculated and control plants had similar elemental quantities; however, in bacteria-inoculated roots, P was significantly increased (34.33%), which constitutes a major benefit for plant nutrition, while Cu content decreased (35.16%). © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. Cyclic AMP-Responsive Element-Binding Protein (CREB is Critical in Autoimmunity by Promoting Th17 but Inhibiting Treg Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Xiaohu Wang

    2017-11-01

    Full Text Available The molecular mechanisms that govern differential T cell development into pro-inflammatory Th17 vs. regulatory T (Treg cells remain unclear. Here, we show that selective deletion of CREB in T cells or Th17 cells impaired Th17 cell differentiation in vitro and in vivo, and led to resistance to autoimmune diseases. Mechanistically, CREB, activated by CD3-PKC-ϴ signaling, plays a key role in regulating Th17 cell differentiation, at least in part through directly binding to the Il17-Il17f gene locus. Unexpectedly, although dispensable for FOXP3 expression and for the homeostasis and suppressive function of thymus-derived Treg cells, CREB negatively regulates the survival of TGF-β-induced Treg cells, and deletion of CREB resulted in increased FOXP3+ Treg cells in the intestine and protection in a colitis model. Thus, CREB is critical in autoimmune diseases by promoting Th17 cell and inhibiting de novo Treg cell generation.

  17. Nuclear fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Armijo, J S; Coffing, L F

    1979-04-05

    The fuel element with circular cross-section for BWR and PWR consists of a core surrounded by a compound jacket container where there is a gap between the core and jacket during operation in the reactor. The core consists of U, Pu, Th compounds and mixtures of these. The compound jacket consists of zircaloy 2 or 4. In order to for example prevent the corrosion of the compound jacket, its inner surface has a metal barrier with smaller neutron absorbers than the jacket material in the form of a zirconium sponge. The zirconium of this metal barrier has impurities of various elements in the order of magnitude of 1000 to 5000 ppm. The oxygen content is in the range of 200 to 1200 ppm and the thickness of the metal barrier is 1-30% of the thickness of the jacket.

  18. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  19. 20 Years Health Promotion Research in and on settings

    Directory of Open Access Journals (Sweden)

    Heiko Waller

    2007-12-01

    Full Text Available In 2006 we celebrated the 20th anniversary of the Ottawa Charta for Health Promotion. During these 20 years health promotion became a very influential public health strategy. Let us - with reference to the WHO Health Promotion Glossary - recall some of the core elements of health promotion: “Health promotion represents a comprehensive social and political process, it not only embraces actions directed at strengthening skills and capabilities of individuals, but also actions directed towards changing social, environmental and economic conditions so as to alleviate their impact on public and individual health.Health promotion is the process of enabling people to increase control over the determinants of health and thereby improve their health. Participation is essential to sustain health promotion action.” The Ottawa Charter identifies three basic strategies for health promotion. These are (1 advocacy for health to create the essential conditions for health indicated above; (2 enabling all people to achieve their full health potential; and (3 mediating between different interests in society in the pursuit of health. The Ottawa Charter identifies three basic strategies for health promotion. These are (1 advocacy for health to create the essential conditions for health indicated above; (2 enabling all people to achieve their full health potential; and (3 mediating between different interests in society in the pursuit of health.

  20. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However...... and enhancers are considered a single class of functional element, with a unified architecture for transcription initiation. The context of interacting regulatory elements and the surrounding sequences determine local transcriptional output as well as the enhancer and promoter activities of individual elements....

  1. Nuclear reactor core

    Energy Technology Data Exchange (ETDEWEB)

    Prescott, R F

    1974-07-11

    The core of the fast neutron reactor consisting, among other components, of fuel elements enriched in plutonium is divided into modules. Each module contains a bundle of four or six elongated components (fuel elements and control rods). In the arrangement with four components, one is kept rigid while the other three are elastically yielding inclined towards the center and lean against the rigid component. In the modules with six pieces, each component is elastically yielding inclined towards a central cavity. In this way, they form a circular arc. A control rod may be placed in the cavity. In order to counteract a relative lateral movement, the outer surfaces of the components which have hexagonal cross-sections have interlocking bearing cushions. The bearing cushions consist of keyway-type ribs or grooves with the wedges or ribs gripping in the grooves of the neighbouring components. In addition, the ribs have oblique entering surfaces.

  2. Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia.

    Science.gov (United States)

    Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar

    2013-12-15

    In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

  3. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  4. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  5. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  6. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Science.gov (United States)

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  7. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  8. Mice and men: their promoter properties.

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Using the two largest collections of Mus musculus and Homo sapiens transcription start sites (TSSs determined based on CAGE tags, ditags, full-length cDNAs, and other transcript data, we describe the compositional landscape surrounding TSSs with the aim of gaining better insight into the properties of mammalian promoters. We classified TSSs into four types based on compositional properties of regions immediately surrounding them. These properties highlighted distinctive features in the extended core promoters that helped us delineate boundaries of the transcription initiation domain space for both species. The TSS types were analyzed for associations with initiating dinucleotides, CpG islands, TATA boxes, and an extensive collection of statistically significant cis-elements in mouse and human. We found that different TSS types show preferences for different sets of initiating dinucleotides and cis-elements. Through Gene Ontology and eVOC categories and tissue expression libraries we linked TSS characteristics to expression. Moreover, we show a link of TSS characteristics to very specific genomic organization in an example of immune-response-related genes (GO:0006955. Our results shed light on the global properties of the two transcriptomes not revealed before and therefore provide the framework for better understanding of the transcriptional mechanisms in the two species, as well as a framework for development of new and more efficient promoter- and gene-finding tools.

  9. Annular Core Pulse Reactor upgrade quarterly report, April--June 1976

    International Nuclear Information System (INIS)

    1976-09-01

    Information is presented concerning safety, compliance, and documentation requirements; core design; console development; containment systems; fuel element design; UO 2 -BeO fuel development; secondary fuel material studies; and driver core fuel element

  10. Assessing Core Competencies

    Science.gov (United States)

    Narayanan, M.

    2004-12-01

    Catherine Palomba and Trudy Banta offer the following definition of assessment, adapted from one provided by Marches in 1987. Assessment in the systematic collection, review, and use of information about educational programs undertaken for the purpose of improving student learning and development. (Palomba and Banta 1999). It is widely recognized that sophisticated computing technologies are becoming a key element in today's classroom instructional techniques. Regardless, the Professor must be held responsible for creating an instructional environment in which the technology actually supplements learning outcomes of the students. Almost all academic disciplines have found a niche for computer-based instruction in their respective professional domain. In many cases, it is viewed as an essential and integral part of the educational process. Educational institutions are committing substantial resources to the establishment of dedicated technology-based laboratories, so that they will be able to accommodate and fulfill students' desire to master certain of these specific skills. This type of technology-based instruction may raise some fundamental questions about the core competencies of the student learner. Some of the most important questions are : 1. Is the utilization of these fast high-powered computers and user-friendly software programs creating a totally non-challenging instructional environment for the student learner ? 2. Can technology itself all too easily overshadow the learning outcomes intended ? 3. Are the educational institutions simply training students how to use technology rather than educating them in the appropriate field ? 4. Are we still teaching content-driven courses and analysis oriented subject matter ? 5. Are these sophisticated modern era technologies contributing to a decline in the Critical Thinking Capabilities of the 21st century technology-savvy students ? The author tries to focus on technology as a tool and not on the technology

  11. Development of a Collaborative Practice Agreement Template to Promote the Role of the Pharmacist in Managing Urinary Tract Infections in Long-term Care Residents

    OpenAIRE

    Fehrenbacher, Lynne; McDevitt, Kimberly; Palmer, Matthew; Traynor, Laura; Boero, Joe; Crnich, Christopher

    2017-01-01

    Abstract Background One of the CDC core elements of antimicrobial stewardship in nursing homes emphasizes the promotion of clinical practice change and integration of the dispensing and consultant pharmacist to improve antibiotic use. An opportunity to support this element is via collaborative practice agreements (CPA). A CPA is a voluntary agreement between one or more prescribers and pharmacists which delegates physician authority under defined conditions and/or limitations toward a common ...

  12. Unprecedented reduction of the uranyl ion [UO2]2+ into a polyoxo uranium(IV) cluster: synthesis and crystal structure of the first f-element oxide with a M6(micro3-O)8 core.

    Science.gov (United States)

    Berthet, Jean-Claude; Thuéry, Pierre; Ephritikhine, Michel

    2005-07-21

    The smooth comproportionation reaction of the U(VI) and U(III) complexes UO2(OTf)2 and U(OTf)3, afforded the hexanuclear U(IV) oxide cluster [U6(micro3-O)8(micro2-OTf)8(py)8], a rare example of a metal oxide with a M6(micro3-O)8 core.

  13. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    International Nuclear Information System (INIS)

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S.

    2007-01-01

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-κB. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K

  14. SOLUBILITY OF IRON IN METALLIC HYDROGEN AND STABILITY OF DENSE CORES IN GIANT PLANETS

    International Nuclear Information System (INIS)

    Wahl, Sean M.; Wilson, Hugh F.; Militzer, Burkhard

    2013-01-01

    The formation of the giant planets in our solar system, and likely a majority of giant exoplanets, is most commonly explained by the accretion of nebular hydrogen and helium onto a large core of terrestrial-like composition. The fate of this core has important consequences for the evolution of the interior structure of the planet. It has recently been shown that H 2 O, MgO, and SiO 2 dissolve in liquid metallic hydrogen at high temperature and pressure. In this study, we perform ab initio calculations to study the solubility of an innermost metallic core. We find dissolution of iron to be strongly favored above 2000 K over the entire pressure range (0.4-4 TPa) considered. We compare with and summarize the results for solubilities on other probable core constituents. The calculations imply that giant planet cores are in thermodynamic disequilibrium with surrounding layers, promoting erosion and redistribution of heavy elements. Differences in solubility behavior between iron and rock may influence evolution of interiors, particularly for Saturn-mass planets. Understanding the distribution of iron and other heavy elements in gas giants may be relevant in understanding mass-radius relationships, as well as deviations in transport properties from pure hydrogen-helium mixtures

  15. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  16. Side core lifter

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Ya A

    1982-01-01

    A side core lifter is proposed which contains a housing with guide slits and a removable core lifter with side projections on the support section connected to the core receiver. In order to preserve the structure of the rock in the core sample by means of guaranteeing rectilinear movement of the core lifter in the rock, the support and core receiver sections are hinged. The device is equipped with a spring for angular shift in the core-reception part.

  17. The Fuzziness of Giant Planets’ Cores

    International Nuclear Information System (INIS)

    Helled, Ravit; Stevenson, David

    2017-01-01

    Giant planets are thought to have cores in their deep interiors, and the division into a heavy-element core and hydrogen–helium envelope is applied in both formation and structure models. We show that the primordial internal structure depends on the planetary growth rate, in particular, the ratio of heavy elements accretion to gas accretion. For a wide range of likely conditions, this ratio is in one-to-one correspondence with the resulting post-accretion profile of heavy elements within the planet. This flux ratio depends sensitively on the assumed solid-surface density in the surrounding nebula. We suggest that giant planets’ cores might not be distinct from the envelope and includes some hydrogen and helium, and the deep interior can have a gradual heavy-element structure. Accordingly, Jupiter’s core may not be well defined. Accurate measurements of Jupiter’s gravitational field by Juno could put constraints on Jupiter’s core mass. However, as we suggest here, the definition of Jupiter’s core is complex, and the core’s physical properties (mass, density) depend on the actual definition of the core and on the planet’s growth history.

  18. The Fuzziness of Giant Planets’ Cores

    Energy Technology Data Exchange (ETDEWEB)

    Helled, Ravit [Institute for Computational Science, University of Zurich, Zurich (Switzerland); Stevenson, David [Division of Geological and Planetary Sciences, Caltech, Pasadena, CA (United States)

    2017-05-01

    Giant planets are thought to have cores in their deep interiors, and the division into a heavy-element core and hydrogen–helium envelope is applied in both formation and structure models. We show that the primordial internal structure depends on the planetary growth rate, in particular, the ratio of heavy elements accretion to gas accretion. For a wide range of likely conditions, this ratio is in one-to-one correspondence with the resulting post-accretion profile of heavy elements within the planet. This flux ratio depends sensitively on the assumed solid-surface density in the surrounding nebula. We suggest that giant planets’ cores might not be distinct from the envelope and includes some hydrogen and helium, and the deep interior can have a gradual heavy-element structure. Accordingly, Jupiter’s core may not be well defined. Accurate measurements of Jupiter’s gravitational field by Juno could put constraints on Jupiter’s core mass. However, as we suggest here, the definition of Jupiter’s core is complex, and the core’s physical properties (mass, density) depend on the actual definition of the core and on the planet’s growth history.

  19. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  20. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo; Kronbichler, Martin; Bangerth, Wolfgang

    2010-01-01

    Today's large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  1. Subharmonic excitation in an HTGR core

    International Nuclear Information System (INIS)

    Bezler, P.; Curreri, J.R.

    1977-01-01

    The occurrence of subharmonic resonance in a series of blocks with clearance between blocks and with springs on the outer most ends is the subject of this paper. This represents an HTGR core response to an earthquake input. An analytical model of the cross section of this type of core is a series of blocks arranged horizontally between outer walls. Each block represents many graphite hexagonal core elements acting in unison as a single mass. The blocks are of unequal size to model the true mass distribution through the core. Core element elasticity and damping characteristics are modeled with linear spring and viscous damping units affixed to each block. The walls and base represent the core barell or core element containment structure. For forced response calculations, these boundaries are given prescribed motions. The clearance between each block could be the same or different with the total clearance duplicating that of the entire core. Spring packs installed between the first and last block and the boundaries model the boundary elasticity. The system non-linearity is due to the severe discontinuity in the interblock elastic forces when adjacent blocks collide. A computer program using a numerical integration scheme was developed to solve for the response of the system to arbitrary inputs

  2. Inclusion of orbital relaxation and correlation through the unitary group adapted open shell coupled cluster theory using non-relativistic and scalar relativistic Hamiltonians to study the core ionization potential of molecules containing light to medium-heavy elements

    Science.gov (United States)

    Sen, Sangita; Shee, Avijit; Mukherjee, Debashis

    2018-02-01

    The orbital relaxation attendant on ionization is particularly important for the core electron ionization potential (core IP) of molecules. The Unitary Group Adapted State Universal Coupled Cluster (UGA-SUMRCC) theory, recently formulated and implemented by Sen et al. [J. Chem. Phys. 137, 074104 (2012)], is very effective in capturing orbital relaxation accompanying ionization or excitation of both the core and the valence electrons [S. Sen et al., Mol. Phys. 111, 2625 (2013); A. Shee et al., J. Chem. Theory Comput. 9, 2573 (2013)] while preserving the spin-symmetry of the target states and using the neutral closed-shell spatial orbitals of the ground state. Our Ansatz invokes a normal-ordered exponential representation of spin-free cluster-operators. The orbital relaxation induced by a specific set of cluster operators in our Ansatz is good enough to eliminate the need for different sets of orbitals for the ground and the core-ionized states. We call the single configuration state function (CSF) limit of this theory the Unitary Group Adapted Open-Shell Coupled Cluster (UGA-OSCC) theory. The aim of this paper is to comprehensively explore the efficacy of our Ansatz to describe orbital relaxation, using both theoretical analysis and numerical performance. Whenever warranted, we also make appropriate comparisons with other coupled-cluster theories. A physically motivated truncation of the chains of spin-free T-operators is also made possible by the normal-ordering, and the operational resemblance to single reference coupled-cluster theory allows easy implementation. Our test case is the prediction of the 1s core IP of molecules containing a single light- to medium-heavy nucleus and thus, in addition to demonstrating the orbital relaxation, we have addressed the scalar relativistic effects on the accuracy of the IPs by using a hierarchy of spin-free Hamiltonians in conjunction with our theory. Additionally, the contribution of the spin-free component of the two

  3. Inclusion of orbital relaxation and correlation through the unitary group adapted open shell coupled cluster theory using non-relativistic and scalar relativistic Hamiltonians to study the core ionization potential of molecules containing light to medium-heavy elements.

    Science.gov (United States)

    Sen, Sangita; Shee, Avijit; Mukherjee, Debashis

    2018-02-07

    The orbital relaxation attendant on ionization is particularly important for the core electron ionization potential (core IP) of molecules. The Unitary Group Adapted State Universal Coupled Cluster (UGA-SUMRCC) theory, recently formulated and implemented by Sen et al. [J. Chem. Phys. 137, 074104 (2012)], is very effective in capturing orbital relaxation accompanying ionization or excitation of both the core and the valence electrons [S. Sen et al., Mol. Phys. 111, 2625 (2013); A. Shee et al., J. Chem. Theory Comput. 9, 2573 (2013)] while preserving the spin-symmetry of the target states and using the neutral closed-shell spatial orbitals of the ground state. Our Ansatz invokes a normal-ordered exponential representation of spin-free cluster-operators. The orbital relaxation induced by a specific set of cluster operators in our Ansatz is good enough to eliminate the need for different sets of orbitals for the ground and the core-ionized states. We call the single configuration state function (CSF) limit of this theory the Unitary Group Adapted Open-Shell Coupled Cluster (UGA-OSCC) theory. The aim of this paper is to comprehensively explore the efficacy of our Ansatz to describe orbital relaxation, using both theoretical analysis and numerical performance. Whenever warranted, we also make appropriate comparisons with other coupled-cluster theories. A physically motivated truncation of the chains of spin-free T-operators is also made possible by the normal-ordering, and the operational resemblance to single reference coupled-cluster theory allows easy implementation. Our test case is the prediction of the 1s core IP of molecules containing a single light- to medium-heavy nucleus and thus, in addition to demonstrating the orbital relaxation, we have addressed the scalar relativistic effects on the accuracy of the IPs by using a hierarchy of spin-free Hamiltonians in conjunction with our theory. Additionally, the contribution of the spin-free component of the two

  4. Core clamping device for a nuclear reactor

    International Nuclear Information System (INIS)

    Guenther, R.W.

    1974-01-01

    The core clamping device for a fast neutron reactor includes clamps to support the fuel zone against the pressure vessel. The clamps are arranged around the circumference of the core. They consist of torsion bars arranged parallel at some distance around the core with lever arms attached to the ends whose force is directed in the opposite direction, pressing against the wall of the pressure vessel. The lever arms and pressure plates also actuated by the ends of the torsion bars transfer the stress, the pressure plates acting upon the fuel elements or fuel assemblies. Coupling between the ends of the torsion bars and the pressure plates is achieved by end carrier plates directly attached to the torsion bars and radially movable. This clamping device follows the thermal expansions of the core, allows specific elements to be disengaged in sections and saves space between the core and the neutron reflectors. (DG) [de

  5. SMART core protection system design

    International Nuclear Information System (INIS)

    Lee, J. K.; Park, H. Y.; Koo, I. S.; Park, H. S.; Kim, J. S.; Son, C. H.

    2003-01-01

    SMART COre Protection System(SCOPS) is designed with real-tims Digital Signal Processor(DSP) board and Network Interface Card(NIC) board. SCOPS has a Control Rod POSition (CRPOS) software module while Core Protection Calculator System(CPCS) consists of Core Protection Calculators(CPCs) and Control Element Assembly(CEA) Calculators(CEACs) in the commercial nuclear plant. It's not necessary to have a independent cabinets for SCOPS because SCOPS is physically very small. Then SCOPS is designed to share the cabinets with Plant Protection System(PPS) of SMART. Therefor it's very easy to maintain the system because CRPOS module is used instead of the computer with operating system

  6. Comparisons of significant parameters for a standard 20% enriched and FLIP 70% enriched TRIGA core

    International Nuclear Information System (INIS)

    Ringle, John C.; Anderson, Terrance V.; Johnson, Arthur G.

    1978-01-01

    A comparison is made between the 20% and 70% enriched cores. The initial start-up data for both cores show the FLIP needs ∼3.8 times the 235 U mass as the 20% core just to go critical. Operational configurations for both cores indicate a need for ∼33% additional fuel above initial critical for adequate maneuvering excess. The fuel element worths are higher in the central core locations for the 20% elements while the peripheral element worths are about the same (with some thermal flux peaking in the FLIP perheral elements). Pulsing comparisons of the two cores show significant differences in reactivity insertions and power peaks. (author)

  7. Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors.

    Science.gov (United States)

    Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha

    2018-01-01

    The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

  8. In-core Instrument Subcritical Verification (INCISV) - Core Design Verification Method - 358

    International Nuclear Information System (INIS)

    Prible, M.C.; Heibel, M.D.; Conner, S.L.; Sebastiani, P.J.; Kistler, D.P.

    2010-01-01

    According to the standard on reload startup physics testing, ANSI/ANS 19.6.1, a plant must verify that the constructed core behaves sufficiently close to the designed core to confirm that the various safety analyses bound the actual behavior of the plant. A large portion of this verification must occur before the reactor operates at power. The INCISV Core Design Verification Method uses the unique characteristics of a Westinghouse Electric Company fixed in-core self powered detector design to perform core design verification after a core reload before power operation. A Vanadium self powered detector that spans the length of the active fuel region is capable of confirming the required core characteristics prior to power ascension; reactivity balance, shutdown margin, temperature coefficient and power distribution. Using a detector element that spans the length of the active fuel region inside the core provides a signal of total integrated flux. Measuring the integrated flux distributions and changes at various rodded conditions and plant temperatures, and comparing them to predicted flux levels, validates all core necessary core design characteristics. INCISV eliminates the dependence on various corrections and assumptions between the ex-core detectors and the core for traditional physics testing programs. This program also eliminates the need for special rod maneuvers which are infrequently performed by plant operators during typical core design verification testing and allows for safer startup activities. (authors)

  9. Animal MRI Core

    Data.gov (United States)

    Federal Laboratory Consortium — The Animal Magnetic Resonance Imaging (MRI) Core develops and optimizes MRI methods for cardiovascular imaging of mice and rats. The Core provides imaging expertise,...

  10. Nuclear fuel element

    International Nuclear Information System (INIS)

    Penrose, R.T.; Thompson, J.R.

    1976-01-01

    A method of protecting the cladding of a nuclear fuel element from internal attack and a nuclear fuel element for use in the core of a nuclear reactor are disclosed. The nuclear fuel element has disposed therein an additive of a barium-containing material and the barium-containing material collects reactive gases through chemical reaction or adsorption at temperatures ranging from room temperature up to fuel element plenum temperatures. The additive is located in the plenum of the fuel element and preferably in the form of particles in a hollow container having a multiplicity of gas permeable openings in one portion of the container with the openings being of a size smaller than the size of the particles. The openings permit gases and liquids entering the plenum to contact the particles. The additive is comprised of elemental barium or a barium alloy containing one or more metals in addition to barium such as aluminum, zirconium, nickel, titanium and combinations thereof. 6 claims, 3 drawing figures

  11. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo

    2012-10-01

    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  12. Transplutonium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  13. Characteristics of core sampling from crumbing Paleozoic rock

    Energy Technology Data Exchange (ETDEWEB)

    Barabashkin, I I; Edelman, Y A; Filippov, V N; Lychev, V N

    1981-01-01

    The results of analysis of core sampling using standard core sampling tools with small and medium inside diameter are cited. It is demonstrated that when using these tools loss of core in Paleozoic deposits promising with regard to oil and gas content does not exceed 25 - 30%. The use of a new core sampling tool with a large inside diameter which includes drill bits of different types and a core lifter ''Krembriy'' SKU-172/100 made it possible to increase core removal approximately 52%. A representative core from a highly crumbling and vesicular rock belinging to groups III - IV in terms of difficulty of core sampling was obtained first. A description of a new core sampling tool is given. The characteristics of the technology of its use which promote preservation of the core are cited. Means of continued improvement of this tool are noted.

  14. Reactor core performance estimating device

    International Nuclear Information System (INIS)

    Tanabe, Akira; Yamamoto, Toru; Shinpuku, Kimihiro; Chuzen, Takuji; Nishide, Fusayo.

    1995-01-01

    The present invention can autonomously simplify a neural net model thereby enabling to conveniently estimate various amounts which represents reactor core performances by a simple calculation in a short period of time. Namely, a reactor core performance estimation device comprises a nerve circuit net which divides the reactor core into a large number of spacial regions, and receives various physical amounts for each region as input signals for input nerve cells and outputs estimation values of each amount representing the reactor core performances as output signals of output nerve cells. In this case, the nerve circuit net (1) has a structure of extended multi-layered model having direct coupling from an upper stream layer to each of downstream layers, (2) has a forgetting constant q in a corrected equation for a joined load value ω using an inverse error propagation method, (3) learns various amounts representing reactor core performances determined using the physical models as teacher signals, (4) determines the joined load value ω decreased as '0' when it is to less than a predetermined value upon learning described above, and (5) eliminates elements of the nerve circuit net having all of the joined load value decreased to 0. As a result, the neural net model comprises an autonomously simplifying means. (I.S.)

  15. Improved nuclear fuel element

    International Nuclear Information System (INIS)

    1980-01-01

    The invention is of a nuclear fuel element which comprises a central core of a body of nuclear fuel material selected from the group consisting of compounds of uranium, plutonium, thorium and mixtures thereof, and an elongated composite cladding container comprising a zirconium alloy tube containing constituents other than zirconium in an amount greater than about 5000 parts per million by weight and an undeformed metal barrier of moderate purity zirconium bonded to the inside surface of the alloy tube. The container encloses the core so as to leave a gap between the container and the core during use in a nuclear reactor. The metal barrier is of moderate purity zirconium with an impurity level on a weight basis of at least 1000ppm and less than 5000ppm. Impurity levels of specific elements are given. Variations of the invention are also specified. The composite cladding reduces chemical interaction, minimizes localized stress and strain corrosion and reduces the likelihood of a splitting failure in the zirconium alloy tube. Other benefits are claimed. (U.K.)

  16. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  17. Back up core designs for the experimental multi-purpose VHTR

    International Nuclear Information System (INIS)

    Aochi, Tetsuo; Yasuno, Takehiko; Miyamoto, Yoshiaki; Shindo, Ryuichi; Ikushima, Takeshi

    1979-02-01

    For the Experimental Multi-Purpose Very High Temperature Reactor (thermal power 50 MW and reactor outlet helium temperature 1000 0 C), design studies have been made of two backup cores loaded with new-type fuel elements. The purpose is to improve core operational characteristics, especially in thermohydraulics, of the reference design core consisting of pin-in-block type fuel elements having externally cooled hollow fuel rods. In this report are described the design principles and the analyses made of nuclear, thermal and hydraulic, fuel, and safety performances to determine the backup fuel and core design parameters. The first backup core (SP fuel core) is composed of fuel elements with internally cooled fuel rods (semi-pin), 36 rods in each standard element and 18 rods in each control element. The second backup core (MH fuel core) is composed of multihole fuel elements. 102 fuel and 54 coolant holes in each standard element and 30 fuel and 18 coolant holes in each control element. Either of the cores has 73 fuel columns 4 m high; the arrangement of active core and reactor internal structures is the same as that in the reference design. The backup cores meet nearly all design requirements of the VHTR, permitting the rated power operation with coolant Reynolds number of over 10,000 in the SP core and over 6,000 in the MH core. (author)

  18. Critical experiments of JMTRC MEU cores

    International Nuclear Information System (INIS)

    Nagaoka, Y.; Takeda, K.; Shimakawa, S.; Koike, S.; Oyamada, R.

    1984-01-01

    The JMTRC, the critical facility of the Japan Materials Testing Reactor (JMTR), went critical on August 29, 1983, with 14 medium enriched uranium (MEU, 45%) fuel elements. Experiments are now being carried out to measure the change in various reactor characteristics between the previous HEU core and the new MEU fueled core. This paper describes the results obtained thus far on critical mass, excess reactivity, control rod worths and flux distribution, including preliminary neutronics calculations for the experiments using the SRAC code. (author)

  19. Dehydration of core/shell fruits

    OpenAIRE

    Liu, Y.; Yang, Xiaosong; Cao, Y.; Wang, Z.; Chen, B.; Zhang, Jian J.; Zhang, H.

    2015-01-01

    Dehydrated core/shell fruits, such as jujubes, raisins and plums, show very complex buckles and wrinkles on their exocarp. It is a challenging task to model such complicated patterns and their evolution in a virtual environment even for professional animators. This paper presents a unified physically-based approach to simulate the morphological transformation for the core/shell fruits in the dehydration process. A finite element method (FEM), which is based on the multiplicative decomposition...

  20. Core Hunter 3: flexible core subset selection.

    Science.gov (United States)

    De Beukelaer, Herman; Davenport, Guy F; Fack, Veerle

    2018-05-31

    Core collections provide genebank curators and plant breeders a way to reduce size of their collections and populations, while minimizing impact on genetic diversity and allele frequency. Many methods have been proposed to generate core collections, often using distance metrics to quantify the similarity of two accessions, based on genetic marker data or phenotypic traits. Core Hunter is a multi-purpose core subset selection tool that uses local search algorithms to generate subsets relying on one or more metrics, including several distance metrics and allelic richness. In version 3 of Core Hunter (CH3) we have incorporated two new, improved methods for summarizing distances to quantify diversity or representativeness of the core collection. A comparison of CH3 and Core Hunter 2 (CH2) showed that these new metrics can be effectively optimized with less complex algorithms, as compared to those used in CH2. CH3 is more effective at maximizing the improved diversity metric than CH2, still ensures a high average and minimum distance, and is faster for large datasets. Using CH3, a simple stochastic hill-climber is able to find highly diverse core collections, and the more advanced parallel tempering algorithm further increases the quality of the core and further reduces variability across independent samples. We also evaluate the ability of CH3 to simultaneously maximize diversity, and either representativeness or allelic richness, and compare the results with those of the GDOpt and SimEli methods. CH3 can sample equally representative cores as GDOpt, which was specifically designed for this purpose, and is able to construct cores that are simultaneously more diverse, and either are more representative or have higher allelic richness, than those obtained by SimEli. In version 3, Core Hunter has been updated to include two new core subset selection metrics that construct cores for representativeness or diversity, with improved performance. It combines and outperforms the

  1. Componente educativo-recreativo-asociativo en estrategias promotoras de salud bucal en preescolares Educational-recreational-associative element of promotion strategies for oral health in children of preschool education.

    Directory of Open Access Journals (Sweden)

    Carmen Julia Álvarez Montero

    2006-08-01

    Full Text Available Se analiza la integración del componente educativo-recreativo-asociativo en las estrategias mediadoras de promoción de salud bucal implementadas en el Preescolar Fuerzas Armadas de Cooperación, Maracaibo, Venezuela. El estado de salud-enfermedad bucal se determinó en una muestra de 32 niños evaluando la caries inicial y manifiesta e índices de placa y gingival. Se conocieron las concepciones de salud bucal de los padres, posteriormente se diseñaron y aplicaron actividades para lograr la resignificación de los conceptos y obtener la adopción de conductas observables en padres y niños, empleando actividades lúdicas, recursos visuales y prácticas guiadas de higiene bucal. Se concluye que el estado de salud bucal de los niños mejoró significativamente luego del aprendizaje obtenido, lo cual se relacionó directamente con las acciones mediadoras implementadas y el compromiso asumido por los padres y docentes. Se recomienda la metodología empleada para planificar nuevas experiencias de enseñanza-aprendizaje.This paper analyzed the integration of the educational-recreational-associative element into the oral health-promoting strategies implemented in the preschool education center named “Fuerzas Armadas de Cooperación”, Maracaibo, Venezuela. The condition of oral health-disease was determined in a sample of 32 children by evaluating initial and manifest caries along with plaque and gingival indexes. The oral health conceptions of the parents were learned, afterwards, some activities were designed and carried out to come to a re-definition of concepts and to achieve adoption of observable behaviours in parents and their children alike by holding games and usisng visual resources and guided practices in oral hygiene. It was concluded that the oral health condition of children improved significantly after the required learning, which directly related with the implemented actions and the commitment by parents and professors. This

  2. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  3. Fuel element

    International Nuclear Information System (INIS)

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  4. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  5. Seismic Wave Velocity in Earth's Shallow Core

    Science.gov (United States)

    Alexandrakis, C.; Eaton, D. W.

    2008-12-01

    Studies of the outer core indicate that it is composed of liquid Fe and Ni alloyed with a ~10% fraction of light elements such as O, S or Si. Recently, unusual features, such as sediment accumulation, immiscible fluid layers or stagnant convection, have been predicted in the shallow core region. Secular cooling and compositional buoyancy drive vigorous convection that sustains the geodynamo, although critical details of light-element composition and thermal regime remain uncertain. Seismic velocity models can provide important constraints on the light element composition, however global reference models, such as Preliminary Reference Earth Model (PREM), IASP91 and AK135 vary significantly in the 200 km below the core-mantle boundary. Past studies of the outermost core velocity structure have been hampered by traveltime uncertainties due to lowermost mantle heterogeneities. The recently published Empirical Transfer Function (ETF) method has been shown to reduce the uncertainty using a waveform stacking approach to improve global observations of SmKS teleseismic waves. Here, we apply the ETF method to achieve a precise top-of-core velocity measurement of 8.05 ± 0.03 km/s. This new model accords well with PREM. Since PREM is based on the adiabatic form of the Adams-Williamson equation, it assumes a well mixed (i.e. homogeneous) composition. This result suggests a lack of heterogeneity in the outermost core due to layering or stagnant convection.

  6. k-core covers and the core

    NARCIS (Netherlands)

    Sanchez-Rodriguez, E.; Borm, Peter; Estevez-Fernandez, A.; Fiestras-Janeiro, G.; Mosquera, M.A.

    This paper extends the notion of individual minimal rights for a transferable utility game (TU-game) to coalitional minimal rights using minimal balanced families of a specific type, thus defining a corresponding minimal rights game. It is shown that the core of a TU-game coincides with the core of

  7. Under sodium reliability tests on core components and in-core instrumentation

    International Nuclear Information System (INIS)

    Ruppert, E.; Stehle, H.; Vinzens, K.

    1977-01-01

    A sodium test facility for fast breeder core components (AKB), built by INTERATOM at Bensberg, has been operating since 1971 to test fuel dummies and blanket elements as well as absorber elements under simulated normal and extreme reactor conditions. Individual full-scale fuel or blanket elements and arrays of seven elements, modelling a section of the SNR-300 reactor core, have been tested under a wide range of sodium mass flow and isothermal test conditions up to 925K as well as under cyclic changed temperature transients. Besides endurance testing of the core components a special sodium and high-temperature instrumentation is provided to investigate thermohydraulic and vibrational behaviour of the test objects. During all test periods the main subassembly characteristics could be reproduced and the reliability of the instrumentation could be proven. (orig.) [de

  8. Improved nuclear fuel element

    International Nuclear Information System (INIS)

    Klepfer, H.H.

    1974-01-01

    A nuclear fuel element is described which comprises: 1) an elongated clad container, 2) a layer of high lubricity material being disposed in and adjacent to the clad container, 3) a low neutron capture cross section metal liner being disposed in the clad container and adjacent to the layer, 4) a central core of a body of nuclear fuel material disposed in and partially filling the container and forming an internal cavity in the container, 5) an enclosure integrally secured and sealed at each end of the container, and a nuclear fuel material retaining means positioned in the cavity. (author)

  9. Monitoring arrangement for vented nuclear fuel elements

    International Nuclear Information System (INIS)

    Campana, R.J.

    1981-01-01

    In a nuclear fuel reactor core, fuel elements are arranged in a closely packed hexagonal configuration, each fuel element having diametrically opposed vents permitting 180 0 rotation of the fuel elements to counteract bowing. A grid plate engages the fuel elements and forms passages for communicating sets of three, four or six individual vents with respective monitor lines in order to communicate vented radioactive gases from the fuel elements to suitable monitor means in a manner readily permitting detection of leakage in individual fuel elements

  10. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    Science.gov (United States)

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  11. Static analysis of material testing reactor cores:critical core calculations

    International Nuclear Information System (INIS)

    Nawaz, A. A.; Khan, R. F. H.; Ahmad, N.

    1999-01-01

    A methodology has been described to study the effect of number of fuel plates per fuel element on critical cores of Material Testing Reactors (MTR). When the number of fuel plates are varied in a fuel element by keeping the fuel loading per fuel element constant, the fuel density in the fuel plates varies. Due to this variation, the water channel width needs to be recalculated. For a given number of fuel plates, water channel width was determined by optimizing k i nfinity using a transport theory lattice code WIMS-D/4. The dimensions of fuel element and control fuel element were determined using this optimized water channel width. For the calculated dimensions, the critical cores were determined for the given number of fuel plates per fuel element by using three dimensional diffusion theory code CITATION. The optimization of water channel width gives rise to a channel width of 2.1 mm when the number of fuel plates is 23 with 290 g ''2''3''5U fuel loading which is the same as in the case of Pakistan Reactor-1 (PARR-1). Although the decrease in number of fuel element results in an increase in optimal water channel width but the thickness of standard fuel element (SFE) and control fuel element (CFE) decreases and it gives rise to compact critical and equilibrium cores. The criticality studies of PARR-1 are in good agreement with the predictions

  12. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  13. Nuclear fuel element

    International Nuclear Information System (INIS)

    1974-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed. A heat conducting fission product retaining metal liner of a refractory metal is incorporated in the fuel element between the cladding and the nuclear fuel to inhibit mechanical interaction between the nuclear fuel and the cladding, to isolate fission products and nuclear fuel impurities from contacting the cladding, and to improve the axial thermal peaking gradient along the length of the fuel rod. The metal liner can be in the form of a tube or hollow cylindrical column, a foil of single or multiple layers in the shape of a hollow cylindrical column, or a coating on the internal surface of the cladding. Preferred refractory metal materials are molybdenum, tungsten, rhenium, niobium and alloys of the foregoing metals

  14. Nuclear fuel element

    International Nuclear Information System (INIS)

    Thompson, J.R.; Rowland, T.C.

    1976-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed. A heat conducting, fission product retaining metal liner of a refractory metal is incorporated in the fuel element between the cladding and the nuclear fuel to inhibit mechanical interaction between the nuclear fuel and the cladding, to isolate fission products and nuclear fuel impurities from contacting the cladding and to improve the axial thermal peaking gradient along the length of the fuel rod. The metal liner can be in the form of a tube or hollow cylindrical column, a foil of single or multiple layers in the shape of a hollow cylindrical column, or a coating on the internal surface of the cladding. Preferred refractory metal materials are molybdenum, tungsten, rhenium, niobium and alloys of the foregoing metals

  15. Viral DNA Replication Orientation and hnRNPs Regulate Transcription of the Human Papillomavirus 18 Late Promoter.

    Science.gov (United States)

    Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming

    2017-05-30

    The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P 811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis -acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. IMPORTANCE It has been known for decades that the activity of viral late promoters is associated with viral DNA replication among almost all DNA viruses. However, the mechanism of how DNA replication activates the viral late promoter and what components of the replication machinery are involved remain largely unknown. In this study, we characterized the P 811 promoter region of HPV18 and demonstrated that its activation depends on the orientation of DNA replication. Using single

  16. Evaluating Community Health Advisor (CHA) Core Competencies: The CHA Core Competency Retrospective Pretest/Posttest (CCCRP).

    Science.gov (United States)

    Story, Lachel; To, Yen M

    2016-05-01

    Health care and academic systems are increasingly collaborating with community health advisors (CHAs) to provide culturally relevant health interventions that promote sustained community transformation. Little attention has been placed on CHA training evaluation, including core competency attainment. This study identified common CHA core competencies, generated a theoretically based measure of those competencies, and explored psychometric properties of that measure. A concept synthesis revealed five CHA core competencies (leadership, translation, guidance, advocacy, and caring). The CHA Core Competency Retrospective Pretest/Posttest (CCCRP) resulted from that synthesis, which was administered using multiple approaches to individuals who previously received CHA training (N= 142). Exploratory factor analyses revealed a two-factor structure underlying the posttraining data, and Cronbach's alpha indicated high internal consistency. This study suggested some CHA core competencies might be more interrelated than previously thought, and two major competencies exist rather than five and supported the CCCRP's use to evaluate core competency attainment resulting from training. © The Author(s) 2014.

  17. GCRA review and appraisal of HTGR reactor-core-design program

    International Nuclear Information System (INIS)

    1980-09-01

    The reactor-core-design program has as its principal objective and responsibility the design and resolution of major technical issues for the reactor core and core components on a schedule consistent with the plant licensing and construction program. The task covered in this review includes three major design areas: core physics, core thermal and hydraulic performance fuel element design, and in-core fuel performance evaluation

  18. The Drosophila Translational Control Element (TCE is required for high-level transcription of many genes that are specifically expressed in testes.

    Directory of Open Access Journals (Sweden)

    Rebeccah J Katzenberger

    Full Text Available To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE. The TCE functions in the 5' untranslated region of Mst(3CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and

  19. Design studies of back up cores for the experimental multi-purpose VHTR, (1)

    International Nuclear Information System (INIS)

    Yasuno, Takehiko; Miyamoto, Yoshiaki; Mitake, Susumu

    1982-09-01

    For the Experimental Multi-Purpose Very High Temperature Reactor, design studies have been made of two backup cores loaded with new type fuel elements. The purpose is to improve core operational characteristics of the standard design core (Mark-III core) consisting of pin-in-block type fuel element having externally cooled hollow fuel rods. The first backup core (semi-pin fuel core) is composed of fuel elements with internally cooled fuel pins, and the second core (multihole fuel core) is composed of multihole fuel elements, which can be adopted for the experimental VHTR as the substitution of the standard Mark-III fuel element. Either of the cores has 73 fuel columns and 4 m height. The arrangement of active core and reactor internal structure is same as that in the standard design core. These backup cores meet almost all design requirements of the VHTR and increase the margins for some important design items in comparison with the standard core (Mark-III core). This report describes the overall characteristics of nuclear, thermal-hydraulic, fuel and safety, and structural consideration for these cores. (author)

  20. Reactor core fuel management

    International Nuclear Information System (INIS)

    Silvennoinen, P.

    1976-01-01

    The subject is covered in chapters, entitled: concepts of reactor physics; neutron diffusion; core heat transfer; reactivity; reactor operation; variables of core management; computer code modules; alternative reactor concepts; methods of optimization; general system aspects. (U.K.)

  1. Nuclear reactor core catcher

    International Nuclear Information System (INIS)

    1977-01-01

    A nuclear reactor core catcher is described for containing debris resulting from an accident causing core meltdown and which incorporates a method of cooling the debris by the circulation of a liquid coolant. (U.K.)

  2. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  3. Seismic core shroud

    International Nuclear Information System (INIS)

    Puri, A.; Mullooly, J.F.

    1981-01-01

    A core shroud is provided, comprising: a coolant boundary, following the shape of the core boundary, for channeling the coolant through the fuel assemblies; a cylindrical band positioned inside the core barrel and surrounding the coolant boundary; and support members extending from the coolant boundary to the band, for transferring load from the coolant boundary to the band. The shroud may be assembled in parts using automated welding techniques, and it may be adjusted to fit the reactor core easily

  4. Core Values | NREL

    Science.gov (United States)

    Core Values Core Values NREL's core values are rooted in a safe and supportive work environment guide our everyday actions and efforts: Safe and supportive work environment Respect for the rights physical and social environment Integrity Maintain the highest standard of ethics, honesty, and integrity

  5. Sidewall coring shell

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Ya A; Konstantinov, L P; Martyshin, A N

    1966-12-12

    A sidewall coring shell consists of a housing and a detachable core catcher. The core lifter is provided with projections, the ends of which are situated in another plane, along the longitudinal axis of the lifter. The chamber has corresponding projections.

  6. Dynamic response of a multielement HTGR core

    International Nuclear Information System (INIS)

    Reich, M.; Bezler, P.; Koplik, B.; Curreri, J.; Goradia, H.; Lasker, L.

    1977-01-01

    One of the primary factors in determining the structural integrity and consequently the safety of a High Temperature Gas-Cooled Reactor (HTGR) is the dynamic response of the core when subjected to a seismic excitation. The HTGR core under consideration consists of several thousands of hexagonal elements arranged in vertical stacks containing about eight elements per stack. There are clearance gaps between adjacent elements, which can change substantially due to radiation effects produced during their active lifetime. Surrounding the outer periphery of the core are reflector blocks and restraining spring-pack arrangements which bear against the reactor vessel structure (PCRV). Earthquake input motions to this type of core arrangement will result in multiple impacts between adjacent elements as well as between the reflector blocks and the restraining spring packs. The highly complex nonlinear response associated with the multiple collisions across the clearance gaps and with the spring packs is the subject matter of this paper. Of particular importance is the ability to analyze a complex nonlinear system with gaps by employing a model with a reduced number of masses. This is necessary in order to obtain solutions in a time-frame and at a cost which is not too expensive. In addition the effect of variations in total clearance as well as the initial distribution of clearances between adjacent elements is of primary concern. Both of these aspects of the problem are treated in the present analysis. Finally, by constraining the motion of the reflector blocks, a more realistic description of the dynamic response of the multi-element HTGR core is obtained

  7. Core labeling of adenovirus with EGFP

    International Nuclear Information System (INIS)

    Le, Long P.; Le, Helen N.; Nelson, Amy R.; Matthews, David A.; Yamamoto, Masato; Curiel, David T.

    2006-01-01

    The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expression vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology

  8. Fuel element

    International Nuclear Information System (INIS)

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  9. Transactinide elements

    International Nuclear Information System (INIS)

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)

  10. Sulfur in Earth's Mantle and Its Behavior During Core Formation

    Science.gov (United States)

    Chabot, Nancy L.; Righter,Kevin

    2006-01-01

    The density of Earth's outer core requires that about 5-10% of the outer core be composed of elements lighter than Fe-Ni; proposed choices for the "light element" component of Earth's core include H, C, O, Si, S, and combinations of these elements [e.g. 1]. Though samples of Earth's core are not available, mantle samples contain elemental signatures left behind from the formation of Earth's core. The abundances of siderophile (metal-loving) elements in Earth's mantle have been used to gain insight into the early accretion and differentiation history of Earth, the process by which the core and mantle formed, and the composition of the core [e.g. 2-4]. Similarly, the abundance of potential light elements in Earth's mantle could also provide constraints on Earth's evolution and core composition. The S abundance in Earth's mantle is 250 ( 50) ppm [5]. It has been suggested that 250 ppm S is too high to be due to equilibrium core formation in a high pressure, high temperature magma ocean on early Earth and that the addition of S to the mantle from the subsequent accretion of a late veneer is consequently required [6]. However, this earlier work of Li and Agee [6] did not parameterize the metalsilicate partitioning behavior of S as a function of thermodynamic variables, limiting the different pressure and temperature conditions during core formation that could be explored. Here, the question of explaining the mantle abundance of S is revisited, through parameterizing existing metal-silicate partitioning data for S and applying the parameterization to core formation in Earth.

  11. Chilean fuel elements fabrication progress report

    International Nuclear Information System (INIS)

    Baeza, J.; Contreras, H.; Chavez, J.; Klein, J.; Mansilla, R.; Marin, J.; Medina, R.

    1993-01-01

    Due to HEU-LEU core conversion necessity for the Chilean MTR reactors, the Fuel Elements Plant is being implemented to LEU nuclear fuel elements fabrication. A glove box line for powder-compact processing designed at CCHEN, which supposed to operate under an automatic control system, is at present under initial tests. Results of first natural uranium fuel plates manufacturing runs are shown

  12. Finite element analysis of tibial fractures

    DEFF Research Database (Denmark)

    Wong, Christian Nai En; Mikkelsen, Mikkel Peter W; Hansen, Leif Berner

    2010-01-01

    Project. The data consisted of 21,219 3D elements with a cortical shell and a trabecular core. Three types of load of torsion, a direct lateral load and axial compression were applied. RESULTS: The finite element linear static analysis resulted in relevant fracture localizations and indicated relevant...

  13. Rotary core drills

    Energy Technology Data Exchange (ETDEWEB)

    1967-11-30

    The design of a rotary core drill is described. Primary consideration is given to the following component parts of the drill: the inner and outer tube, the core bit, an adapter, and the core lifter. The adapter has the form of a downward-converging sleeve and is mounted to the lower end of the inner tube. The lifter, extending from the adapter, is split along each side so that it can be held open to permit movement of a core. It is possible to grip a core by allowing the lifter to assume a closed position.

  14. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  15. Improving Deterrence of Hard-Core Cartels

    OpenAIRE

    Mariana Tavares de Araujo

    2010-01-01

    Holding perpetrators accountable and tailoring the optimal mix of sanctions through a combination of administrative and criminal penalties are two core elements of Brazil’s anti-cartel enforcement. Mariana Tavares de Araujo (SDE, Brazil)

  16. Unification of fuel elements for research reactors

    International Nuclear Information System (INIS)

    Vatulyn, A.V.; Stetskyi, Y.A.; Dobrikova, I.V.

    1997-01-01

    To the purpose of fuel elements unification the possibility of rod fuel assembly (FA) using in the cores of research reactors have been considered in this paper. The calculation results of geometric, hydraulic and thermotechnical parameters of rod assembly are submitted. Several designs of finned square fuel element and fuel assembly are proposed on base of analysis of rod FA characteristics in compare of tube ones. The fuel elements specimens and the model assembly are manufactured. The developed designs are the basis for further optimization after neutron-physical calculations of cores. (author)

  17. HYDRATE CORE DRILLING TESTS

    Energy Technology Data Exchange (ETDEWEB)

    John H. Cohen; Thomas E. Williams; Ali G. Kadaster; Bill V. Liddell

    2002-11-01

    The ''Methane Hydrate Production from Alaskan Permafrost'' project is a three-year endeavor being conducted by Maurer Technology Inc. (MTI), Noble, and Anadarko Petroleum, in partnership with the U.S. DOE National Energy Technology Laboratory (NETL). The project's goal is to build on previous and ongoing R&D in the area of onshore hydrate deposition. The project team plans to design and implement a program to safely and economically drill, core and produce gas from arctic hydrates. The current work scope includes drilling and coring one well on Anadarko leases in FY 2003 during the winter drilling season. A specially built on-site core analysis laboratory will be used to determine some of the physical characteristics of the hydrates and surrounding rock. Prior to going to the field, the project team designed and conducted a controlled series of coring tests for simulating coring of hydrate formations. A variety of equipment and procedures were tested and modified to develop a practical solution for this special application. This Topical Report summarizes these coring tests. A special facility was designed and installed at MTI's Drilling Research Center (DRC) in Houston and used to conduct coring tests. Equipment and procedures were tested by cutting cores from frozen mixtures of sand and water supported by casing and designed to simulate hydrate formations. Tests were conducted with chilled drilling fluids. Tests showed that frozen core can be washed out and reduced in size by the action of the drilling fluid. Washing of the core by the drilling fluid caused a reduction in core diameter, making core recovery very difficult (if not impossible). One successful solution was to drill the last 6 inches of core dry (without fluid circulation). These tests demonstrated that it will be difficult to capture core when drilling in permafrost or hydrates without implementing certain safeguards. Among the coring tests was a simulated hydrate

  18. Core physics calculation and analysis for SNRE

    International Nuclear Information System (INIS)

    Xie Jiachun; Zhao Shouzhi; Jia Baoshan

    2010-01-01

    Five different precise calculation models have been set up for Small Nuclear Rocket Engine (SNRE) core based on MCNP code, and then the effective multiplication constant, drum control worth and power distribution were calculated. The results from different models indicate that the model in which elements are homogeneous could be used in the reactivity calculation, but a detailed description of elements have to be used in the element internal power distribution calculation. The results of physics parameters show that the basic characteristics of SNRE are reasonable. The drum control worth is sufficient. The power distribution is symmetrical and reasonable. All of the parameters can satisfy the design requirement. (authors)

  19. Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

    Science.gov (United States)

    Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

    2000-06-01

    The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

  20. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  1. New elements

    International Nuclear Information System (INIS)

    Flerov, G.

    1976-01-01

    The history is briefly described of the investigation of superheavy elements at the Joint Institute for Nuclear Research at Dubna. The significance of the investigation is assessed from the point of view of the nuclear structure study and major problems encountered in experimental efforts are indicated. Current experimental methods aiming at the discovery or the production of superheavy nuclei with Z approximately 114 are listed. (I.W.)

  2. Postirradiation examination of ORR demonstration elements

    International Nuclear Information System (INIS)

    Snelgrove, J.L.; Copeland, G.L.; Hofman, G.L.

    1991-01-01

    Postirradiation examinations of selected U 3 Si 2 fuel elements fabricated by B and W, CERCA, and NUKEM and irradiated during the whole core demonstration in the Oak Ridge Research Reactor are nearing completion. The results of all tests have shown the demonstration fuel elements, produced under production-line conditions, to have performed in the excellent manner expected from earlier tests of miniature fuel plates and full-sized elements. (orig.)

  3. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    Science.gov (United States)

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  4. FRG-1: new millenium - new compact core

    International Nuclear Information System (INIS)

    Schreiner, P.; Knop, W.

    2001-01-01

    The GKSS research center Geesthacht GmbH operates the MTR-type swimming pool research reactor FRG-1 (5 MW) for more than 40 years. The FRG-1 has been converted in February 1991 from HEU (93 %) to LEU (20 %) in one step and at that time the core size was reduced from 49 to 26 fuel elements. Consequently the thermal neutron flux in beam tube positions could be increased by more than a factor of two. It is the strong intention of GKSS to continue the operation of the FRG-1 research reactor for at least an additional 15 years with high availability and utilization. The reactor has been operated during the last years for approximately 250 full power days per year. To prepare the FRG-1 for an efficient future use, the core size has been reduced in a second step from 26 fuel elements to 12 fuel elements. (author)

  5. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

    Science.gov (United States)

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

    2000-10-01

    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  6. Developing a promotional strategy: important questions for social marketing.

    Science.gov (United States)

    Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L

    2007-10-01

    Health practitioners often use the terms marketing and promotion interchangeably. Yet, promotion is just one element of an overall marketing strategy. To realize the greatest impact there must be a combination of all the marketing components, including product, price, place, and promotion. The purpose of this article is to clarify the role of promotion and describe key elements of developing a promotional strategy within the broader context of a social marketing initiative.

  7. Seismic analysis methods for LMFBR core and verification with mock-up vibration tests

    International Nuclear Information System (INIS)

    Sasaki, Y.; Kobayashi, T.; Fujimoto, S.

    1988-01-01

    This paper deals with the vibration behaviors of a cluster of core elements with the hexagonal cross section in a barrel under the dynamic excitation due to seismic events. When a strong earthquake excitation is applied to the core support, the cluster of core elements displace to a geometrical limit determined by restraint rings in the barrel, and collisions could occur between adjacent elements as a result of their relative motion. For these reasons, seismic analysis on LMFBR core elements is a complicated non-linear vibration problem, which includes collisions and fluid interactions. In an actual core design, it is hard to include hundreds of elements in the numerical calculations. In order to study the seismic behaviors of core elements, experiments with single row 29 elements (17 core fuel assemblies, 4 radial blanket assemblies, and 8 neutron shield assemblies) simulated all elements in MONJU core central row, and experiments with 7 cluster rows of 37 core fuel assemblies in the core center were performed in a fluid filled tank, using a large-sized shaking table. Moreover, the numerical analyses of these experiments were performed for the validation of simplified and detailed analytical methods. 4 refs, 18 figs

  8. Ultrabroadband polarization splitter based on three-core photonic crystal fiber with a modulation core.

    Science.gov (United States)

    Zhao, Tongtong; Lou, Shuqin; Wang, Xin; Zhou, Min; Lian, Zhenggang

    2016-08-10

    We design an ultrabroadband polarization splitter based on three-core photonic crystal fiber (PCF). A modulation core and two fluorine-doped cores are introduced to achieve an ultrawide bandwidth. The properties of three-core PCF are modeled by using the full-vector finite element method along with the full-vector beam propagation method. Numerical results demonstrate that an ultrabroadband splitter with 320 nm bandwidth with an extinction ratio as low as -20  dB can be achieved by using 52.8 mm long three-core PCF. This splitter also has high compatibility with standard single-mode fibers as the input and output ports due to low splicing loss of 0.02 dB. All the air holes in the proposed structure are circular holes and arranged in a triangular lattice that makes it easy to fabricate.

  9. The core paradox.

    Science.gov (United States)

    Kennedy, G. C.; Higgins, G. H.

    1973-01-01

    Rebuttal of suggestions from various critics attempting to provide an escape from the seeming paradox originated by Higgins and Kennedy's (1971) proposed possibility that the liquid in the outer core was thermally stably stratified and that this stratification might prove a powerful inhibitor to circulation of the outer core fluid of the kind postulated for the generation of the earth's magnetic field. These suggestions are examined and shown to provide no reasonable escape from the core paradox.

  10. Core level shifts in group IV semiconductors and semimetals

    International Nuclear Information System (INIS)

    Yin, S.; Tosatti, E.

    1981-08-01

    We calculate the core level binding energy shift from the isolated atom to the crystalline solid, for group IV elemental semiconductors. This is done by simple extension of Johansson and Martensson's scheme for metals. We show that the core level energy in a nonmetal must be measured by the photo absorption (''core exciton'') threshold rather than by photo emission. As a byproduct, a simple scheme is also devised to evaluate impurity heats of solutions in semiconductors. (author)

  11. How Should the Graduate Economics Core Be Changed?

    Science.gov (United States)

    Abito, Jose Miguel; Borovickova, Katarina; Golden, Hays; Goldin, Jacob; Masten, Matthew A.; Morin, Miguel; Poirier, Alexandre; Pons, Vincent; Romem, Israel; Williams, Tyler; Yoon, Chamna

    2011-01-01

    The authors present suggestions by graduate students from a range of economics departments for improving the first-year core sequence in economics. The students identified a number of elements that should be added to the core: more training in building microeconomic models, a discussion of the methodological foundations of model-building, more…

  12. Nuclear reactor core flow baffling

    International Nuclear Information System (INIS)

    Berringer, R.T.

    1979-01-01

    A flow baffling arrangement is disclosed for the core of a nuclear reactor. A plurality of core formers are aligned with the grids of the core fuel assemblies such that the high pressure drop areas in the core are at the same elevations as the high pressure drop areas about the core periphery. The arrangement minimizes core bypass flow, maintains cooling of the structure surrounding the core, and allows the utilization of alternative beneficial components such as neutron reflectors positioned near the core

  13. Improved core protection calculator system algorithm

    International Nuclear Information System (INIS)

    Yoon, Tae Young; Park, Young Ho; In, Wang Kee; Bae, Jong Sik; Baeg, Seung Yeob

    2009-01-01

    Core Protection Calculator System (CPCS) is a digitized core protection system which provides core protection functions based on two reactor core operation parameters, Departure from Nucleate Boiling Ratio (DNBR) and Local Power Density (LPD). It generates a reactor trip signal when the core condition exceeds the DNBR or LPD design limit. It consists of four independent channels which adapted a two out of four trip logic. CPCS algorithm improvement for the newly designed core protection calculator system, RCOPS (Reactor COre Protection System), is described in this paper. New features include the improvement of DNBR algorithm for thermal margin, the addition of pre trip alarm generation for auxiliary trip function, VOPT (Variable Over Power Trip) prevention during RPCS (Reactor Power Cutback System) actuation and the improvement of CEA (Control Element Assembly) signal checking algorithm. To verify the improved CPCS algorithm, CPCS algorithm verification tests, 'Module Test' and 'Unit Test', would be performed on RCOPS single channel facility. It is expected that the improved CPCS algorithm will increase DNBR margin and enhance the plant availability by reducing unnecessary reactor trips

  14. Validation of reactor core protection system

    International Nuclear Information System (INIS)

    Lee, Sang-Hoon; Bae, Jong-Sik; Baeg, Seung-Yeob; Cho, Chang-Ho; Kim, Chang-Ho; Kim, Sung-Ho; Kim, Hang-Bae; In, Wang-Kee; Park, Young-Ho

    2008-01-01

    Reactor COre Protection System (RCOPS), an advanced core protection calculator system, is a digitized one which provides core protection function based on two reactor core operation parameters, Departure from Nucleate Boiling Ratio (DNBR) and Local Power Density (LPD). It generates a reactor trip signal when the core condition exceeds the DNBR or LPD design limit. It consists of four independent channels adapted a two-out-of-four trip logic. System configuration, hardware platform and an improved algorithm of the newly designed core protection calculator system are described in this paper. One channel of RCOPS was implemented as a single channel facility for this R and D project where we performed final integration software testing. To implement custom function blocks, pSET is used. Software test is performed by two methods. The first method is a 'Software Module Test' and the second method is a 'Software Unit Test'. New features include improvement of core thermal margin through a revised on-line DNBR algorithm, resolution of the latching problem of control element assembly signal and addition of the pre-trip alarm generation. The change of the on-line DNBR calculation algorithm is considered to improve the DNBR net margin by 2.5%-3.3%. (author)

  15. Sediment Core Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: Provides instrumentation and expertise for physical and geoacoustic characterization of marine sediments.DESCRIPTION: The multisensor core logger measures...

  16. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  17. Analytical results of Tank 38H core samples -- Fall 1999

    International Nuclear Information System (INIS)

    Swingle, R.F.

    2000-01-01

    Two samples were pulled from Tank 38H in the Fall of 1999: a variable depth sample (VDS) of the supernate was pulled in October and a core sample from the salt layer was pulled in December. Analysis of the rinse from the outside of the core sample indicated no sign of volatile or semivolatile organics. Both supernate and solids from the VDS and the dried core sample solids were analyzed for isotopes which could pose a criticality concern and also for elements which could serve as neutron poisons, as well as other elements. Results of the elemental analyses of these samples show significant elements present to mitigate the potential for nuclear criticality. However, it should be noted the results given for the VDS solids elemental analyses may be higher than the actual concentration in the solids, since the filter paper was dissolved along with the sample solids

  18. Can Psychiatric Rehabilitation Be Core to CORE?

    Science.gov (United States)

    Olney, Marjorie F.; Gill, Kenneth J.

    2016-01-01

    Purpose: In this article, we seek to determine whether psychiatric rehabilitation principles and practices have been more fully incorporated into the Council on Rehabilitation Education (CORE) standards, the extent to which they are covered in four rehabilitation counseling "foundations" textbooks, and how they are reflected in the…

  19. Genome-wide mapping of autonomous promoter activity in human cells.

    Science.gov (United States)

    van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

    2017-02-01

    Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

  20. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  1. A volatile-rich Earth's core inferred from melting temperature of core materials

    Science.gov (United States)

    Morard, G.; Andrault, D.; Antonangeli, D.; Nakajima, Y.; Auzende, A. L.; Boulard, E.; Clark, A. N.; Lord, O. T.; Cervera, S.; Siebert, J.; Garbarino, G.; Svitlyk, V.; Mezouar, M.

    2016-12-01

    Planetary cores are mainly constituted of iron and nickel, alloyed with lighter elements (Si, O, C, S or H). Understanding how these elements affect the physical and chemical properties of solid and liquid iron provides stringent constraints on the composition of the Earth's core. In particular, melting curves of iron alloys are key parameter to establish the temperature profile in the Earth's core, and to asses the potential occurrence of partial melting at the Core-Mantle Boundary. Core formation models based on metal-silicate equilibration suggest that Si and O are the major light element components1-4, while the abundance of other elements such as S, C and H is constrained by arguments based on their volatility during planetary accretion5,6. Each compositional model implies a specific thermal state for the core, due to the different effect that light elements have on the melting behaviour of Fe. We recently measured melting temperatures in Fe-C and Fe-O systems at high pressures, which complete the data sets available both for pure Fe7 and other binary alloys8. Compositional models with an O- and Si-rich outer core are suggested to be compatible with seismological constraints on density and sound velocity9. However, their crystallization temperatures of 3650-4050 K at the CMB pressure of 136 GPa are very close to, if not higher than the melting temperature of the silicate mantle and yet mantle melting above the CMB is not a ubiquitous feature. This observation requires significant amounts of volatile elements (S, C or H) in the outer core to further reduce the crystallisation temperature of the core alloy below that of the lower mantle. References 1. Wood, B. J., et al Nature 441, 825-833 (2006). 2. Siebert, J., et al Science 339, 1194-7 (2013). 3. Corgne, A., et al Earth Planet. Sc. Lett. 288, 108-114 (2009). 4. Fischer, R. a. et al. Geochim. Cosmochim. Acta 167, 177-194 (2015). 5. Dreibus, G. & Palme, H. Geochim. Cosmochim. Acta 60, 1125-1130 (1995). 6. Mc

  2. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. PV as a core element of utility business plans

    International Nuclear Information System (INIS)

    Osborn, Don

    2000-01-01

    The author expounds the advantages and rationale for utility PV (photovoltaics) business strategies and discusses various initiatives being taken by some companies in the US. It is claimed that in perhaps 5-12 years the photovoltaics price will be competing with retail electricity and customer-owned utilities should be in a position to offer photovoltaics as an option rather than concede that business to someone else. Five specific reasons for investing in PVs are given and the message is that if you are not involved then get involved. The author describes his own company's commitments to PV and suggests that regulators and legislators should appreciate the long term interests of the ratepayer in that investment now in higher cost PV technology will lead to greater cost reductions in the future

  4. Improved nuclear fuel element

    International Nuclear Information System (INIS)

    1974-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has a metal liner disposed between the cladding and the nuclear fuel material and a high lubricity material in the form of a coating disposed between the liner and the cladding. The liner preferably has a thickness greater than the longest fission product recoil distance and is composed of a low neutron capture cross-section material. The liner is preferably composed of zirconium, an alloy of zirconium, niobium or an alloy of niobium. The liner serves as a preferential reaction site for volatile impurities and fission products and protects the cladding from contact and reaction with such impurities and fission products. The high lubricity material acts as an interface between the liner and the cladding and reduces localized stresses on the cladding due to fuel expansion and cracking of the fuel

  5. PWR core design calculations

    International Nuclear Information System (INIS)

    Trkov, A.; Ravnik, M.; Zeleznik, N.

    1992-01-01

    Functional description of the programme package Cord-2 for PWR core design calculations is presented. Programme package is briefly described. Use of the package and calculational procedures for typical core design problems are treated. Comparison of main results with experimental values is presented as part of the verification process. (author) [sl

  6. EEA core set of indicators. Guide

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This guide provides information on the quality of the 37 indicators in the EEA core set. Its primary role is to support improved implementation of the core set in the EEA, European topic centres and the European environment information and observation network (Eionet). In parallel, it is aimed at helping users outside the EEA/Eionet system make best use of the indicators in their own work. It is hoped that the guide will promote cooperation on improving indicator methodologies and data quality as part of the wider process to streamline and improve environmental reporting in the European Union and beyond. (au)

  7. Fuel element

    International Nuclear Information System (INIS)

    Hirose, Yasuo.

    1982-01-01

    Purpose: To increase the plenum space in a fuel element used for a liquid metal cooled reactor. Constitution: A fuel pellet is secured at one end with an end plug and at the other with a coil spring in a tubular container. A mechanism for fixing the coil spring composed of a tubular unit is mounted by friction with the inner surface of the tubular container. Accordingly, the recoiling force of the coil spring can be retained by fixing mechanism with a small volume, and since a large amount of plenum space can be obtained, the internal pressure rise in the cladding tube can be suppressed even if large quantities of fission products are discharged. (Kamimura, M.)

  8. Replaceable LMFBR core components

    International Nuclear Information System (INIS)

    Evans, E.A.; Cunningham, G.W.

    1976-01-01

    Much progress has been made in understanding material and component performance in the high temperature, fast neutron environment of the LMFBR. Current data have provided strong assurance that the initial core component lifetime objectives of FFTF and CRBR can be met. At the same time, this knowledge translates directly into the need for improved core designs that utilize improved materials and advanced fuels required to meet objectives of low doubling times and extended core component lifetimes. An industrial base for the manufacture of quality core components has been developed in the US, and all procurements for the first two core equivalents for FFTF will be completed this year. However, the problem of fabricating recycled plutonium while dramatically reducing fabrication costs, minimizing personnel exposure, and protecting public health and safety must be addressed

  9. Lunar Core and Tides

    Science.gov (United States)

    Williams, J. G.; Boggs, D. H.; Ratcliff, J. T.

    2004-01-01

    Variations in rotation and orientation of the Moon are sensitive to solid-body tidal dissipation, dissipation due to relative motion at the fluid-core/solid-mantle boundary, and tidal Love number k2 [1,2]. There is weaker sensitivity to flattening of the core-mantle boundary (CMB) [2,3,4] and fluid core moment of inertia [1]. Accurate Lunar Laser Ranging (LLR) measurements of the distance from observatories on the Earth to four retroreflector arrays on the Moon are sensitive to lunar rotation and orientation variations and tidal displacements. Past solutions using the LLR data have given results for dissipation due to solid-body tides and fluid core [1] plus Love number [1-5]. Detection of CMB flattening, which in the past has been marginal but improving [3,4,5], now seems significant. Direct detection of the core moment has not yet been achieved.

  10. Internal core tightener

    International Nuclear Information System (INIS)

    Brynsvold, G.V.; Snyder, H.J. Jr.

    1976-01-01

    An internal core tightener is disclosed which is a linear actuated (vertical actuation motion) expanding device utilizing a minimum of moving parts to perform the lateral tightening function. The key features are: (1) large contact areas to transmit loads during reactor operation; (2) actuation cam surfaces loaded only during clamping and unclamping operation; (3) separation of the parts and internal operation involved in the holding function from those involved in the actuation function; and (4) preloaded pads with compliant travel at each face of the hexagonal assembly at the two clamping planes to accommodate thermal expansion and irradiation induced swelling. The latter feature enables use of a ''fixed'' outer core boundary, and thus eliminates the uncertainty in gross core dimensions, and potential for rapid core reactivity changes as a result of core dimensional change. 5 claims, 12 drawing figures

  11. Beacon: A three-dimensional structural analysis code for bowing history of fast breeder reactor cores

    International Nuclear Information System (INIS)

    Miki, K.

    1979-01-01

    The core elements of an LMFBR are bowed due to radial gradients of both temperature and neutron flux in the core. Since all hexagonal elements are multiply supported by adjacent elements or the restraint system, restraint forces and bending stresses are induced. In turn, these forces and stresses are relaxed by irradiation enhanced creep of the material. The analysis of the core bowing behavior requires a three-dimensional consideration of the mechanical interactions among the core elements, because the core consists of different kinds of elements and of fuel assemblies with various burnup histories. A new computational code BEACON has been developed for analyzing the bowing behavior of an LMFBR's core in three dimensions. To evaluate mechanical interactions among core elements, the code uses the analytical method of the earlier SHADOW code. BEACON analyzes the mechanical interactions in three directions, which form angles of 60 0 with one another. BEACON is applied to the 60 0 sector of a typical LMFBR's core for analyzing the bowing history during one equilibrium cycle. 120 core elements are treated, assuming the boundary condition of rotational symmetry. The application confirms that the code can be an effective tool for parametric studies as well as for detailed structural analysis of LMFBR's core. (orig.)

  12. Fuel assembly and nuclear reactor core

    International Nuclear Information System (INIS)

    Masumi, Ryoji; Aoyama, Motoo; Yamashita, Jun-ichi.

    1995-01-01

    The present invention concerns a fuel assembly and a nuclear reactor core capable of improving a transmutation rate of transuranium elements while improving a residual rate of fission products. In a reactor core of a BWR type reactor to which fuel rods with transuranium elements (TRU) enriched are loaded, the enrichment degree of transuranium elements occupying in fuel materials is determined not less than 2wt%, as well as a ratio of number of atoms between hydrogen and fuel heavy metals in an average reactor core under usual operation state (H/HM) is determined not more than 3 times. In addition, a ratio of the volumes between coolant regions and fuel material regions is determined not more than 2 times. A T ratio (TRU/Pu) is lowered as the TRU enrichment degree is higher and the H/HM ratio is lower. In order to reduce the T ratio not more than 1, the TRU enrichment degree is determined as not less than 2wt%, and the H/HM ratio is determined to not more than 3 times. Accordingly, since the H/HM ratio is reduced to not more than 1, and TRU is transmuted while recycling it with plutonium, the transmutation ratio of transuranium elements can be improved while improving the residual rate of fission products. (N.H.)

  13. Modular core component support for nuclear reactor

    International Nuclear Information System (INIS)

    Finch, L.M.; Anthony, A.J.

    1975-01-01

    The core of a nuclear reactor is made up of a plurality of support modules for containing components such as fuel elements, reflectors and control rods. Each module includes a component support portion located above a grid plate in a low-pressure coolant zone and a coolant inlet portion disposed within a module receptacle which depends from the grid plate into a zone of high-pressure coolant. Coolant enters the module through aligned openings within the receptacle and module inlet portion and flows upward into contact with the core components. The modules are hydraulically balanced within the receptacles to prevent expulsion by the upward coolant forces. (U.S.)

  14. Calcium ions affect the hepatitis B virus core assembly

    International Nuclear Information System (INIS)

    Choi, Yongwook; Gyoo Park, Sung; Yoo, Jun-hi; Jung, Guhung

    2005-01-01

    Previous report showed that cytosolic Ca 2+ induced by hepatitis B virus X protein (HBx) promotes HBV replication. In this study, in vitro experiments showed that (i) HBV core assembly in vitro was promoted by Ca 2+ through the sucrose density gradient and the analytical ultracentrifuge analysis. Also (ii) transmission electron microscope analysis demonstrated these assembled HBV core particles were the capsids. Ex vivo experiments showed that the treatment of BAPTA-AM and cyclosporine A (CsA) reduced HBV capsids in the transfected HepG2 cells. In addition to that, the treatment of Thapsigargin (TG) increased HBV capsids in the transfected HepG2 cells. Furthermore, we investigated the increased HBV core assembly by HBx. The results show that the increased cytosolic calcium ions by HBx promote the HBV core assembly

  15. Earth's inner core: Innermost inner core or hemispherical variations?

    NARCIS (Netherlands)

    Lythgoe, K. H.; Deuss, A.|info:eu-repo/dai/nl/412396610; Rudge, J. F.; Neufeld, J. A.

    2014-01-01

    The structure of Earth's deep inner core has important implications for core evolution, since it is thought to be related to the early stages of core formation. Previous studies have suggested that there exists an innermost inner core with distinct anisotropy relative to the rest of the inner core.

  16. Dependence of Core and Extended Flux on Core Dominance ...

    Indian Academy of Sciences (India)

    Abstract. Based on two extragalactic radio source samples, the core dominance parameter is calculated, and the correlations between the core/extended flux density and core dominance parameter are investi- gated. When the core dominance parameter is lower than unity, it is linearly correlated with the core flux density, ...

  17. Korrelasjon mellom core styrke, core stabilitet og utholdende styrke i core

    OpenAIRE

    Berg-Olsen, Andrea Marie; Fugelsøy, Eivor; Maurstad, Ann-Louise

    2010-01-01

    Formålet med studien var å se hvilke korrelasjon det er mellom core styrke, core stabilitet og utholdende styrke i core. Testingen bestod av tre hoveddeler hvor vi testet core styrke, core stabilitet og utholdende styrke i core. Innenfor core styrke og utholdende styrke i core ble tre ulike tester utført. Ved måling av core stabilitet ble det gjennomført kun en test. I core styrke ble isometrisk abdominal fleksjon, isometrisk rygg ekstensjon og isometrisk lateral fleksjon testet. Sit-ups p...

  18. Windscale pile core surveys

    International Nuclear Information System (INIS)

    Curtis, R.F.; Mathews, R.F.

    1996-01-01

    The two Windscale Piles were closed down, defueled as far as possible and mothballed for thirty years following a fire in the core of Pile 1 in 1957 resulting from the spontaneous release of stored Wigner energy in the graphite moderator. Decommissioning of the reactors commenced in 1987 and has reached the stage where the condition of both cores needs to be determined. To this end, non-intrusive and intrusive surveys and sampling of the cores have been planned and partly implemented. The objectives for each Pile differ slightly. The location and quantity of fuel remaining in the damaged core of Pile 1 needed to be established, whereas the removal of all fuel from Pile 2 needed to be confirmed. In Pile 1, the possible existence of a void in the core is to be explored and in Pile 2, the level of Wigner energy remaining required to be quantified. Levels of radioactivity in both cores needed to be measured. The planning of the surveys is described including strategy, design, safety case preparation and the remote handling and viewing equipment required to carry out the inspection, sampling and monitoring work. The results from the completed non-intrusive survey of Pile 2 are summarised. They confirm that the core is empty and the graphite is in good condition. The survey of Pile 1 has just started. (UK)

  19. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Science.gov (United States)

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  20. Precise seismic-wave velocity atop Earth's core: No evidence for outer-core stratification

    Science.gov (United States)

    Alexandrakis, Catherine; Eaton, David W.

    2010-05-01

    Earth's outer core is composed of liquid Fe and Ni alloyed with a ˜10% fraction of light elements such as O, S, or Si. Secular cooling and compositional buoyancy drive vigorous convection that sustains the geodynamo, but critical details of light-element composition and thermal regime remain uncertain. Seismic velocities can provide important observational constraints on these parameters, but global reference models such as Preliminary Reference Earth Model ( PREM), IASP91 and AK135 exhibit significant discrepancies in the outermost ˜200 km of the core. Here, we apply an Empirical Transfer Function method to obtain precise arrival times for SmKS waves, a whispering-gallery mode that propagates near the underside of the core-mantle boundary. Models that fit our data are all characterized by seismic velocities and depth gradients in the outermost 200 km of the core that correspond best with PREM. This similarity to PREM, which has a smooth velocity profile that satisfies the adiabatic Adams and Williamson equation, argues against the presence of an anomalous layer of light material near the top of the core as suggested in some previous studies. A new model, AE09, is proposed as a slight modification to PREM for use as a reference model of the outermost core.

  1. Core shroud corner joints

    Science.gov (United States)

    Gilmore, Charles B.; Forsyth, David R.

    2013-09-10

    A core shroud is provided, which includes a number of planar members, a number of unitary corners, and a number of subassemblies each comprising a combination of the planar members and the unitary corners. Each unitary corner comprises a unitary extrusion including a first planar portion and a second planar portion disposed perpendicularly with respect to the first planar portion. At least one of the subassemblies comprises a plurality of the unitary corners disposed side-by-side in an alternating opposing relationship. A plurality of the subassemblies can be combined to form a quarter perimeter segment of the core shroud. Four quarter perimeter segments join together to form the core shroud.

  2. IGCSE core mathematics

    CERN Document Server

    Wall, Terry

    2013-01-01

    Give your core level students the support and framework they require to get their best grades with this book dedicated to the core level content of the revised syllabus and written specifically to ensure a more appropriate pace. This title has been written for Core content of the revised Cambridge IGCSE Mathematics (0580) syllabus for first teaching from 2013. ? Gives students the practice they require to deepen their understanding through plenty of practice questions. ? Consolidates learning with unique digital resources on the CD, included free with every book. We are working with Cambridge

  3. Impact of a five-day short course on integration of health promotion into practice in north Queensland.

    Science.gov (United States)

    Devine, Susan G; Llewellyn-Jones, Lorraine; Lloyd, Jacqui

    2009-04-01

    Workforce development is one element of health promotion capacity building. This paper describes the extent to which participants in a five-day short course in health promotion, delivered three times in north Queensland during 2007, reported greater adoption of health promotion within their work roles, and the factors that affected the level of adoption. Out of 54 course attendees, 39 completed a post-course survey five to nine months after completing the course (72% response rate). Additionally, 11 course attendees participated in a focus group or phone interview to explore survey findings. The courses succeeded in providing knowledge, skills, confidence and enthusiasm to undertake health promotion work. Eighty per cent of participants stated they had incorporated health promotion into their work frequently or all of the time since undertaking the course. Lack of understanding of health promotion from co-workers and managers, lack of organisational support and commitment, lack of resources, competing clinical priorities, and lack of time were cited as the main barriers for undertaking health promotion. The course met participant training needs. However, similar training across all levels of staff including management may help to develop organisational capacity, thereby building a more knowledgeable workforce that is supported to undertake health promotion as a core part of an organisation's business.

  4. The 2nd reactor core of the NS Otto Hahn

    International Nuclear Information System (INIS)

    Manthey, H.J.; Kracht, H.

    1979-01-01

    Details of the design of the 2nd reactor core are given, followed by a brief report summarising the operating experience gained with this 2nd core, as well as by an evaluation of measured data and statements concerning the usefulness of the knowledge gained for the development of future reactor cores. Quite a number of these data have been used to improve the concept and thus the specifications for the fuel elements of the 3rd core of the reactor of the NS Otto Hahn. (orig./HP) [de

  5. Investigating the impact of uneven magnetic flux density distribution on core loss estimation

    DEFF Research Database (Denmark)

    Niroumand, Farideh Javidi; Nymand, Morten; Wang, Yiren

    2017-01-01

    is calculated according to an effective flux density value and the macroscopic dimensions of the cores. However, the flux distribution in the core can alter by core shapes and/or operating conditions due to nonlinear material properties. This paper studies the element-wise estimation of the loss in magnetic......There are several approaches for loss estimation in magnetic cores, and all these approaches highly rely on accurate information about flux density distribution in the cores. It is often assumed that the magnetic flux density evenly distributes throughout the core and the overall core loss...

  6. Toward quantitative core-loss EFTEM tomography

    International Nuclear Information System (INIS)

    Jin-Phillipp, N.Y.; Koch, C.T.; Aken, P.A. van

    2011-01-01

    Core-loss EFTEM tomography provides three-dimensional structural and chemical information. Multiple inelastic scattering occurring in thick specimens as well as orientation-dependent diffraction contrast due to multiple elastic scattering, however, often limit its applications. After demonstrating the capability of core-loss EFTEM tomography to reconstruct just a few monolayers thin carbon layer covering a Fe catalyst particle we discuss its application to thicker samples. We propose an approximate multiple-scattering correction method based on the use of zero-loss images and apply it successfully to copper whiskers, providing a significant improvement of the reconstructed 3D elemental distribution. We conclude this paper by a general discussion on experimental parameters affecting the accuracy of EFTEM 3D elemental mapping. -- Research highlights: → EFTEM 3D elemental mapping has been applied to a catalyst particle from which a CNT has grown and a copper whisker. → Correction of multiple inelastic scattering shows significant improvements in the reconstruction of 3D elemental maps. → Experimental parameters affecting the accuracy of EFTEM 3D elemental mapping are discussed.

  7. Heterogeneous gas core reactor

    International Nuclear Information System (INIS)

    Diaz, N.J.; Dugan, E.T.

    1983-01-01

    A heterogeneous gas core nuclear reactor is disclosed comprising a core barrel provided interiorly with an array of moderator-containing tubes and being otherwise filled with a fissile and/or fertile gaseous fuel medium. The fuel medium may be flowed through the chamber and through an external circuit in which heat is extracted. The moderator may be a fluid which is flowed through the tubes and through an external circuit in which heat is extracted. The moderator may be a solid which may be cooled by a fluid flowing within the tubes and through an external heat extraction circuit. The core barrel is surrounded by moderator/coolant material. Fissionable blanket material may be disposed inwardly or outwardly of the core barrel

  8. iPSC Core

    Data.gov (United States)

    Federal Laboratory Consortium — The induced Pluripotent Stem Cells (iPSC) Core was created in 2011 to accelerate stem cell research in the NHLBI by providing investigators consultation, technical...

  9. Core Flight Software

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Core Flight Software (CFS) project purpose is to analyze applicability, and evolve and extend the reusability of the CFS system originally developed by...

  10. PWR degraded core analysis

    International Nuclear Information System (INIS)

    Gittus, J.H.

    1982-04-01

    A review is presented of the various phenomena involved in degraded core accidents and the ensuing transport of fission products from the fuel to the primary circuit and the containment. The dominant accident sequences found in the PWR risk studies published to date are briefly described. Then chapters deal with the following topics: the condition and behaviour of water reactor fuel during normal operation and at the commencement of degraded core accidents; the generation of hydrogen from the Zircaloy-steam and the steel-steam reactions; the way in which the core deforms and finally melts following loss of coolant; debris relocation analysis; containment integrity; fission product behaviour during a degraded core accident. (U.K.)

  11. Research on plasma core reactors

    International Nuclear Information System (INIS)

    Jarvis, G.A.; Barton, D.M.; Helmick, H.H.; Bernard, W.; White, R.H.

    1977-01-01

    Experiments and theoretical studies are being conducted for NASA on critical assemblies with 1-m-diam by 1-m-long low-density cores surrounded by a thick beryllium reflector. These assemblies make extensive use of existing nuclear propulsion reactor components, facilities, and instrumentation. Due to excessive porosity in the reflector, the initial critical mass was 19 kg U(93.2). Addition of a 17-cm-thick by 89-cm-diam beryllium flux trap in the cavity reduced the critical mass to 7 kg when all the uranium was in the zone just outside the flux trap. A mockup aluminum UF 6 container was placed inside the flux trap and fueled with uranium-graphite elements. Fission distributions and reactivity worths of fuel and structural materials were measured. Finally, an 85,000-cm 3 aluminum canister in the central region was fueled with UF 6 gas and fission density distributions determined. These results will be used to guide the design of a prototype plasma core reactor which will test energy removal by optical radiation

  12. Heterogeneous gas core reactor

    International Nuclear Information System (INIS)

    Han, K.I.

    1977-01-01

    Preliminary investigations of a heterogeneous gas core reactor (HGCR) concept suggest that this potential power reactor offers distinct advantages over other existing or conceptual reactor power plants. One of the most favorable features of the HGCR is the flexibility of the power producing system which allows it to be efficiently designed to conform to a desired optimum condition without major conceptual changes. The arrangement of bundles of moderator/coolant channels in a fissionable gas or mixture of gases makes a truly heterogeneous nuclear reactor core. It is this full heterogeneity for a gas-fueled reactor core which accounts for the novelty of the heterogeneous gas core reactor concept and leads to noted significant advantages over previous gas core systems with respect to neutron and fuel economy, power density, and heat transfer characteristics. The purpose of this work is to provide an insight into the design, operating characteristics, and safety of a heterogeneous gas core reactor system. The studies consist mainly of neutronic, energetic and kinetic analyses of the power producing and conversion systems as a preliminary assessment of the heterogeneous gas core reactor concept and basic design. The results of the conducted research indicate a high potential for the heterogeneous gas core reactor system as an electrical power generating unit (either large or small), with an overall efficiency as high as 40 to 45%. The HGCR system is found to be stable and safe, under the conditions imposed upon the analyses conducted in this work, due to the inherent safety of ann expanding gaseous fuel and the intrinsic feedback effects of the gas and water coolant

  13. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  14. Engineered inorganic core/shell nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mélinon, Patrice, E-mail: patrice.melinon@univ-lyon1.fr [Institut Lumière matière Université Claude Bernard Lyon 1 et CNRS et OMNT, Domaine Scientifique de la Doua, Bâtiment Léon Brillouin, 43 Boulevard du 11 Novembre 1918, F 69622 Villeurbanne (France); Begin-Colin, Sylvie [IPCMS et OMNT, 23 rue du Loess BP 43, 67034 STRASBOURG Cedex 2 (France); Duvail, Jean Luc [IMN UMR 6502 et OMNT Campus Sciences : 2 rue de la Houssinire, BP32229, 44322 Nantes Cedex3 (France); Gauffre, Fabienne [SPM et OMNT : Institut des sciences chimiques de Rennes - UMR 6226, 263 Avenue du General Leclerc, CS 74205, 35042 RENNES Cedex (France); Boime, Nathalie Herlin [IRAMIS-NIMBE, Laboratoire Francis Perrin (CEA CNRS URA 2453) et OMNT, Bat 522, CEA Saclay, 91191 Gif sur Yvette Cedex (France); Ledoux, Gilles [Institut Lumière Matière Université Claude Bernard Lyon 1 et CNRS et OMNT, Domaine Scientifique de la Doua, Bâtiment Alfred Kastler 43 Boulevard du 11 Novembre 1918 F 69622 Villeurbanne (France); Plain, Jérôme [Universit de technologie de Troyes LNIO-ICD, CNRS et OMNT 12 rue Marie Curie - CS 42060 - 10004 Troyes cedex (France); Reiss, Peter [CEA Grenoble, INAC-SPrAM, UMR 5819 CEA-CNRS-UJF et OMNT, Grenoble cedex 9 (France); Silly, Fabien [CEA, IRAMIS, SPEC, TITANS, CNRS 2464 et OMNT, F-91191 Gif sur Yvette (France); Warot-Fonrose, Bénédicte [CEMES-CNRS, Université de Toulouse et OMNT, 29 rue Jeanne Marvig F 31055 Toulouse (France)

    2014-10-20

    It has been for a long time recognized that nanoparticles are of great scientific interest as they are effectively a bridge between bulk materials and atomic structures. At first, size effects occurring in single elements have been studied. More recently, progress in chemical and physical synthesis routes permitted the preparation of more complex structures. Such structures take advantages of new adjustable parameters including stoichiometry, chemical ordering, shape and segregation opening new fields with tailored materials for biology, mechanics, optics magnetism, chemistry catalysis, solar cells and microelectronics. Among them, core/shell structures are a particular class of nanoparticles made with an inorganic core and one or several inorganic shell layer(s). In earlier work, the shell was merely used as a protective coating for the core. More recently, it has been shown that it is possible to tune the physical properties in a larger range than that of each material taken separately. The goal of the present review is to discuss the basic properties of the different types of core/shell nanoparticles including a large variety of heterostructures. We restrict ourselves on all inorganic (on inorganic/inorganic) core/shell structures. In the light of recent developments, the applications of inorganic core/shell particles are found in many fields including biology, chemistry, physics and engineering. In addition to a representative overview of the properties, general concepts based on solid state physics are considered for material selection and for identifying criteria linking the core/shell structure and its resulting properties. Chemical and physical routes for the synthesis and specific methods for the study of core/shell nanoparticle are briefly discussed.

  15. FBR type reactor core

    International Nuclear Information System (INIS)

    Tamiya, Tadashi; Kawashima, Katsuyuki; Fujimura, Koji; Murakami, Tomoko.

    1995-01-01

    Neutron reflectors are disposed at the periphery of a reactor core fuel region and a blanket region, and a neutron shielding region is disposed at the periphery of them. The neutron reflector has a hollow duct structure having a sealed upper portion, a lower portion opened to cooling water, in which a gas and coolants separately sealed in the inside thereof. A driving pressure of a primary recycling pump is lowered upon reduction of coolant flow rate, then the liquid level of coolants in the neutron reflector is lowered due to imbalance between the driving pressure and a gas pressure, so that coolants having an effect as a reflector are eliminated from the outer circumference of the reactor core. Therefore, the amount of neutrons leaking from the reactor core is increased, and negative reactivity is charged to the reactor core. The negative reactivity of the neutron reflector is made greater than a power compensation reactivity. Since this enables reactor scram by using an inherent performance of the reactor core, the reactor core safety of an LMFBR-type reactor can be improved. (I.N.)

  16. The synergistic transactivation of the hepatitis B viral (HBV) pregenomic promoter by the E6 protein of human papillomavirus type 16 (HPV-16 E6) with HBV X protein was mediated through the AP1 site of E element in the enhancer I (EnI) in human liver cell.

    Science.gov (United States)

    Lee, D H; Choi, B H; Rho, H M

    1999-11-01

    Infection by HBV of a cell already infected with other viral species or vice versa has been suggested as being involved in hepatocellular carcinoma. Using the CAT assay method, we investigated the interactive roles of HBx and potentially oncogenic and transactivating viral early proteins such as Ad5 E1A, HPV-16 E6, and SV40 T ag. In the presence of HBx, only HPV-16 E6 showed significant synergistic transactivation of EnI. We further investigated the function of the HPV-16 E6 using deletion, heterologous promoter, and mutation analyses on the EnI promoter. The results showed that the synergistic effect was mediated through the AP1 site of the E element in EnI by the direct activation of AP1 and support the idea that the infection by HBV of the cell with other viral species such as HPV-16 could increase the transcription activity of the HBV and other oncogenes containing an AP1 site in the promoter. Copyright 1999 Academic Press.

  17. Neutronic Core Performance of CAREM-25 Reactor

    International Nuclear Information System (INIS)

    Villarino, Eduardo; Hergenreder, Daniel; Matzkin, S

    2000-01-01

    The actual design state of core of CAREM-25 reactor is presented.It is shown that the core design complains with the safety and operation established requirements.It is analyzed the behavior of the reactor safety and control systems (single failure of the fast shut down system, single failure of the shut down system, single failure of the second shut down system, reactivity worth of the adjust and control system in normal operation and hot shut down, reactivity worth of the adjust and control system and the scheme of movement of the control rod during the operation cycle).It is shown the burnup profile of fuel elements with the proposed scheme of refueling and the burnup and power density distribution at different moments of the operation cycle.The power peaking factor of the equilibrium core is 2.56, the minimum DNBR is 1.90 and its average is 2.09 during the operation cycle

  18. Getting to the Core of Transition: A Re-Assessment of Old Wine in New Bottles.

    Science.gov (United States)

    Stodden, Robert A.; Leake, David W.

    1994-01-01

    The core of the education system must be transformed to make it supportive of exceptional students in transition. Attempts to improve the system by adding on programs rather than instituting core changes have not been effective. A "teaming" process that promotes school-community and interagency collaboration and infuses transition into the core of…

  19. A Fermat's spiral multifilament-core fiber

    Science.gov (United States)

    Tartara, L.; Codemard, C.

    2013-02-01

    A multifilament-core optical fiber where the microstructure is arranged in a Fermat's spiral is presented. The properties of such a fiber to be exploited for laser light amplification are numerically investigated by means of a full-vectorial finite-element method. Thanks to this peculiar microstructure, the fiber is shown to have an increased Brillouin threshold power and very low bending losses, while preserving a very good beam spatial quality.

  20. Distribution, provenance and early diagenesis of major and trace metals in sediment cores from the Mandovi estuary, western India

    Digital Repository Service at National Institute of Oceanography (India)

    Prajith, A.; Rao, V.P.; Chakraborty, P.